Science.gov

Sample records for actual field samples

  1. FIELD SAMPLING PROTOCOLS AND ANALYSIS

    EPA Science Inventory

    I have been asked to speak again to the environmental science class regarding actual research scenarios related to my work at Kerr Lab. I plan to discuss sampling protocols along with various field analyses performed during sampling activities. Many of the students have never see...

  2. CHARACTERIZATION AND ACTUAL WASTE TEST WITH TANK 5F SAMPLES

    SciTech Connect

    Hay, M. S.; Crapse, K. P.; Fink, S. D.; Pareizs, J. M.

    2007-08-30

    The initial phase of bulk waste removal operations was recently completed in Tank 5F. Video inspection of the tank indicates several mounds of sludge still remain in the tank. Additionally, a mound of white solids was observed under Riser 5. In support of chemical cleaning and heel removal programs, samples of the sludge and the mound of white solids were obtained from the tank for characterization and testing. A core sample of the sludge and Super Snapper sample of the white solids were characterized. A supernate dip sample from Tank 7F was also characterized. A portion of the sludge was used in two tank cleaning tests using oxalic acid at 50 C and 75 C. The filtered oxalic acid from the tank cleaning tests was subsequently neutralized by addition to a simulated Tank 7F supernate. Solids and liquid samples from the tank cleaning test and neutralization test were characterized. A separate report documents the results of the gas generation from the tank cleaning test using oxalic acid and Tank 5F sludge. The characterization results for the Tank 5F sludge sample (FTF-05-06-55) appear quite good with respect to the tight precision of the sample replicates, good results for the glass standards, and minimal contamination found in the blanks and glass standards. The aqua regia and sodium peroxide fusion data also show good agreement between the two dissolution methods. Iron dominates the sludge composition with other major contributors being uranium, manganese, nickel, sodium, aluminum, and silicon. The low sodium value for the sludge reflects the absence of supernate present in the sample due to the core sampler employed for obtaining the sample. The XRD and CSEM results for the Super Snapper salt sample (i.e., white solids) from Tank 5F (FTF-05-07-1) indicate the material contains hydrated sodium carbonate and bicarbonate salts along with some aluminum hydroxide. These compounds likely precipitated from the supernate in the tank. A solubility test showed the material

  3. Pulsed field sample neutralization

    DOEpatents

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  4. Characterization, Leaching, and Filtration Testing for Tributyl Phosphate (TBP, Group 7) Actual Waste Sample Composites

    SciTech Connect

    Edwards, Matthew K.; Billing, Justin M.; Blanchard, David L.; Buck, Edgar C.; Casella, Amanda J.; Casella, Andrew M.; Crum, J. V.; Daniel, Richard C.; Draper, Kathryn E.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Snow, Lanee A.; Swoboda, Robert G.

    2009-03-09

    .A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. The tributyl phosphate sludge (TBP, Group 7) is the subject of this report. The Group 7 waste was anticipated to be high in phosphorus as well as aluminum in the form of gibbsite. Both are believed to exist in sufficient quantities in the Group 7 waste to address leaching behavior. Thus, the focus of the Group 7 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  5. TESTING OF THE SPINTEK ROTARY MICROFILTER USING ACTUAL HANFORD WASTE SAMPLES

    SciTech Connect

    HUBER HJ

    2010-04-13

    The SpinTek rotary microfilter was tested on actual Hanford tank waste. The samples were a composite of archived Tank 241-AN-105 material and a sample representing single-shell tanks (SST). Simulants of the two samples have been used in non-rad test runs at the 222-S laboratory and at Savannah River National Laboratory (SRNL). The results of these studies are compared in this report. Two different nominal pore sizes for the sintered steel rotating disk filter were chosen: 0.5 and 0.1 {micro}m. The results suggest that the 0.5-{micro}m disk is preferable for Hanford tank waste for the following reasons: (1) The filtrate clarity is within the same range (<<4 ntu for both disks); (2) The filtrate flux is in general higher for the 0.5-{micro}m disk; and (3) The 0.1-{micro}m disk showed a higher likelihood of fouling. The filtrate flux of the actual tank samples is generally in the range of 20-30% compared to the equivalent non-rad tests. The AN-105 slurries performed at about twice the filtrate flux of the SST slurries. The reason for this difference has not been identified. Particle size distributions in both cases are very similar; comparison of the chemical composition is not conclusive. The sole hint towards what material was stuck in the filter pore holes came from the analysis of the dried flakes from the surface of the fouled 0.1-{micro}m disk. A cleaning approach developed by SRNL personnel to deal with fouled disks has been found adaptable when using actual Hanford samples. The use of 1 M nitric acid improved the filtrate flux by approximately two times; using the same simulants as in the non-rad test runs showed that the filtrate flux was restored to 1/2 of its original amount.

  6. Filtration and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Geeting, John GH; Hallen, Richard T.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Snow, Lanee A.; Swoboda, Robert G.

    2009-02-20

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.( ) The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP-RPP-WTP-467, eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste-testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan • Characterizing the homogenized sample groups • Performing parametric leaching testing on each group for compounds of interest • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on filtration/leaching tests performed on two of the eight waste composite samples and follow-on parametric tests to support aluminum leaching results from those tests.

  7. Filtration and Leach Testing for PUREX Cladding Sludge and REDOX Cladding Sludge Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hallen, Richard T.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-03-02

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan (Barnes and Voke 2006). The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Hanford Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP RPP WTP 467 (Fiskum et al. 2007), eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan. • Characterizing the homogenized sample groups. • Performing parametric leaching testing on each group for compounds of interest. • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on a filtration/leaching test performed using two of the eight waste composite samples. The sample groups examined in this report were the plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR). Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, thus requiring caustic leaching. WTP RPT 167 (Snow et al. 2008) describes the homogenization, characterization, and parametric leaching activities before benchtop filtration/leaching testing of these two waste groups. Characterization and initial parametric data in that report were used to plan a single filtration/leaching test using a blend of both wastes. The test focused on filtration testing of the waste and caustic leaching for aluminum, in the form

  8. Modeling of Boehmite Leaching from Actual Hanford High-Level Waste Samples

    SciTech Connect

    Snow, L.A.; Rapko, B.M.; Poloski, A.P.; Peterson, R.A.

    2007-07-01

    The U.S. Department of Energy plans to vitrify approximately 60,000 metric tons of high-level waste (HLW) sludge from underground storage tanks at the Hanford Site in Southwest Washington State. To reduce the volume of HLW requiring treatment, a goal has been set to remove a significant quantity of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum is found in the form of gibbsite and sodium aluminate, which can be easily dissolved by washing the waste stream with caustic, and boehmite, which comprises nearly half of the total aluminum, but is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. Chromium, which makes up a much smaller amount ({approx}3%) of the sludge, must also be removed because there is a low tolerance for chromium in the HLW immobilization process. In this work, the coupled dissolution kinetics of aluminum and chromium species during caustic leaching of actual Hanford HLW samples is examined. The experimental results are used to develop a model that provides a basis for predicting dissolution dynamics from known process temperature and hydroxide concentration. (authors)

  9. Modeling of Boehmite Leaching from Actual Hanford High-Level Waste Samples

    SciTech Connect

    Peterson, Reid A.; Lumetta, Gregg J.; Rapko, Brian M.; Poloski, Adam P.

    2007-06-27

    The Department of Energy plans to vitrify approximately 60,000 metric tons of high level waste sludge from underground storage tanks at the Hanford Nuclear Reservation. To reduce the volume of high level waste requiring treatment, a goal has been set to remove about 90 percent of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum in the form of gibbsite and sodium aluminate can be easily dissolved by washing the waste stream with caustic, but boehmite, which comprises nearly half of the total aluminum, is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. In this work, the dissolution kinetics of aluminum species during caustic leaching of actual Hanford high level waste samples is examined. The experimental results are used to develop a shrinking core model that provides a basis for prediction of dissolution dynamics from known process temperature and hydroxide concentration. This model is further developed to include the effects of particle size polydispersity, which is found to strongly influence the rate of dissolution.

  10. Characterization of personal RF electromagnetic field exposure and actual absorption for the general public.

    PubMed

    Joseph, W; Vermeeren, G; Verloock, L; Heredia, Mauricio Masache; Martens, Luc

    2008-09-01

    In this paper, personal electromagnetic field exposure of the general public due to 12 different radiofrequency sources is characterized. Twenty-eight different realistic exposure scenarios based upon time, environment, activity, and location have been defined and a relevant number of measurements were performed with a personal exposure meter. Indoor exposure in office environments can be higher than outdoor exposure: 95th percentiles of field values due to WiFi ranged from 0.36 to 0.58 V m(-1), and for DECT values of 0.33 V m(-1) were measured. The downlink signals of GSM and DCS caused the highest outdoor exposures up to 0.52 V m(-1). The highest total field exposure occurred for mobile scenarios (inside a train or bus) from uplink signals of GSM and DCS (e.g., mobile phones) due to changing environmental conditions, handovers, and higher required transmitted signals from mobile phones due to penetration through windows while moving. A method to relate the exposure to the actual whole-body absorption in the human body is proposed. An application is shown where the actual absorption in a human body model due to a GSM downlink signal is determined. Fiftieth, 95th, and 99 th percentiles of the whole-body specific absorption rate (SAR) due to this GSM signal of 0.58 microW kg(-1), 2.08 microW kg(-1), and 5.01 microW kg(-1) are obtained for a 95th percentile of 0.26 V m(-1). A practical usable function is proposed for the relation between the whole-body SAR and the electric fields. The methodology of this paper enables epidemiological studies to make an analysis in combination with both electric field and actual whole-body SAR values and to compare exposure with basic restrictions. PMID:18695413

  11. Field techniques for sampling ants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ants occur in most environments and ecologists ask a diverse array of questions involving ants. Thus, a key consideration in ant studies is to match the environment and question (and associated environmental variables) to the ant sampling technique. Since each technique has distinct limitations, usi...

  12. Field sampling and travel report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dr. Sigua was involved with two field visits of watersheds with different livestock production systems (poultry, swine, and beef/dairy cattle); one in the sub-basins of Pinhal River Watershed (October 23, 2008) and at the micro-basins of the Rio Pine Forest (October 29, 2008) where studies of assess...

  13. Strontium and Actinides Removal from Savannah River Site Actual Waste Samples by Freshly Precipitated Manganese Oxide

    SciTech Connect

    Barnes, M.J.

    2003-10-30

    The authors investigated the performance of freshly precipitated manganese oxide and monosodium titanate (MST) for the removal of strontium (Sr) and actinides from actual high-level waste. Manganese oxide precipitation occurs upon addition of a reductant such as formate (HCO2-) or peroxide (H2O2) to a waste solution containing permanganate (MnO4-). Tests described in this document address the capability of manganese oxide treatment to remove Rs, Pu, and Np from actual high-level waste containing elevated concentrations of Pu. Additionally, tests investigate MST (using two unique batches) performance with the same waste for direct comparison to the manganese oxide performance.

  14. 12 CFR Appendix M3 to Part 226 - Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures M3 Appendix M3 to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z)...

  15. Comprehensive Evaluation of Attitude and Orbit Estimation Using Actual Earth Magnetic Field Data

    NASA Technical Reports Server (NTRS)

    Deutschmann, Julie K.; Bar-Itzhack, Itzhack Y.

    2000-01-01

    A single, augmented Extended Kalman Filter (EKF), which simultaneously and autonomously estimates spacecraft attitude and orbit has been developed and successfully tested with real magnetometer and gyro data only. Because the earth magnetic field is a function of time and position, and because time is known quite precisely, the differences between the computed and measured magnetic field components, as measured by the magnetometers throughout the entire spacecraft orbit, are a function of both orbit and attitude errors. Thus, conceivably these differences could be used to estimate both orbit and attitude; an observability study validated this assumption. The results of testing the EKF with actual magnetometer and gyro data, from four satellites supported by the NASA Goddard Space Flight Center (GSFC) Guidance, Navigation, and Control Center, are presented and evaluated. They confirm the assumption that a single EKF can estimate both attitude and orbit when using gyros and magnetometers only.

  16. Thermal Performance of Cryogenic Piping Multilayer Insulation in Actual Field Installations

    NASA Technical Reports Server (NTRS)

    Fesmire, J.; Augustnynowicz, S.; Thompson, K. (Technical Monitor)

    2002-01-01

    A standardized way of comparing the thermal performance of different pipelines in different sizes is needed. Vendor data for vacuum-insulated piping are typically given in heat leak rate per unit length (W/m) for a specific diameter pipeline. An overall k-value for actual field installations (k(sub oafi)) is therefore proposed as a more generalized measure for thermal performance comparison and design calculation. The k(sub oafi) provides a direct correspondence to the k-values reported for insulation materials and illustrates the large difference between ideal multilayer insulation (MLI) and actual MLI performance. In this experimental research study, a section of insulated piping was tested under cryogenic vacuum conditions, including simulated spacers and bending. Several different insulation systems were tested using a 1-meter-long cylindrical cryostat test apparatus. The simulated spacers tests showed significant degradation in the thermal performance of a given insulation system. An 18-meter-long pipeline test apparatus is now in operation at the Cryogenics Test Laboratory, NASA Kennedy Space Center, for conducting liquid nitrogen thermal performance tests.

  17. Field test of the Cognitive Interview: enhancing the recollection of actual victims and witnesses of crime.

    PubMed

    Fisher, R P; Geiselman, R E; Amador, M

    1989-10-01

    The Cognitive Interview was tested in the field to enhance the recollection of actual victims and witnesses of crime. The technique is based on laboratory-tested principles of memory retrieval, knowledge representation, and communication. Seven experienced detectives from the Metro-Dade Police Department were trained to use the technique and were compared with 9 untrained detectives. Before and after training, all detectives tape-recorded interviews with victims and witnesses of crime. The trained detectives elicited 47% more information after than before training, and 63% more information than did the untrained detectives. Overall collaboration rates (94%) were extremely high and were equivalent for pre- and posttrained interviews. Because the Cognitive Interview reliably enhances memory and is easily learned and administered, it should be useful for a variety of investigative interviews. PMID:2793772

  18. Bioaerosol sampling: sampling mechanisms, bioefficiency and field studies.

    PubMed

    Haig, C W; Mackay, W G; Walker, J T; Williams, C

    2016-07-01

    Investigations into the suspected airborne transmission of pathogens in healthcare environments have posed a challenge to researchers for more than a century. With each pathogen demonstrating a unique response to environmental conditions and the mechanical stresses it experiences, the choice of sampling device is not obvious. Our aim was to review bioaerosol sampling, sampling equipment, and methodology. A comprehensive literature search was performed, using electronic databases to retrieve English language papers on bioaerosol sampling. The review describes the mechanisms of popular bioaerosol sampling devices such as impingers, cyclones, impactors, and filters, explaining both their strengths and weaknesses, and the consequences for microbial bioefficiency. Numerous successful studies are described that point to best practice in bioaerosol sampling, from the use of small personal samplers to monitor workers' pathogen exposure through to large static samplers collecting airborne microbes in various healthcare settings. Of primary importance is the requirement that studies should commence by determining the bioefficiency of the chosen sampler and the pathogen under investigation within laboratory conditions. From such foundations, sampling for bioaerosol material in the complexity of the field holds greater certainty of successful capture of low-concentration airborne pathogens. From the laboratory to use in the field, this review enables the investigator to make informed decisions about the choice of bioaerosol sampler and its application. PMID:27112048

  19. Characterization and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Fiskum, Sandra K.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hubler, Timothy L.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; Lumetta, Gregg J.; MacFarlan, Paul J.; McNamara, Bruce K.; Peterson, Reid A.; Sinkov, Sergey I.; Snow, Lanee A.; Swoboda, Robert G.

    2008-07-10

    This report describes processing and analysis results of boehmite waste type (Group 5) and insoluble high Cr waste type (Group 6). The sample selection, compositing, subdivision, physical and chemical characterization are described. Extensive batch leach testing was conducted to define kinetics and leach factors of selected analytes as functions of NaOH concentration and temperature. Testing supports issue M-12 resolution for the Waste Treatment Plant.

  20. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck

    2003-04-19

    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  1. A Validation Study of Bullet and Cartridge Case Comparisons Using Samples Representative of Actual Casework.

    PubMed

    Smith, Tasha P; Andrew Smith, G; Snipes, Jeffrey B

    2016-07-01

    The foundation of firearm and tool mark identification is that no two tools should produce the same microscopic marks on two separate objects that they would be inaccurately or wrongly identified. Studies addressing the validity of identification infrequently employ tests that mirror realistic casework scenarios. This study attempted to do so using a double-blind process, reducing test-taking bias. Test kits including bullets and cartridge cases but not the associated firearms were completed by 31 analysts from 22 agencies. Analysis of the results demonstrated an overall error rate of 0.303%, sensitivity of 85.2%, and specificity of 86.8%. Variability in performance across examiners is addressed, and the effect of examiners' years of experience on identification accuracy is explored. Finally, the article discusses the importance of studies using realistic case work scenarios when validating the field's performance and in providing courts with usable indicators of the accuracy of firearm and tool mark identification. PMID:27135174

  2. Evaluation of a total dissolved solids model in comparison to actual field data measurements in the Cheyenne River, South Dakota, U.S.A.

    PubMed

    Berdanier, Bruce W; Ziadat, Anf H

    2006-06-01

    During the summers of 2002 and 2004, in-stream integrated flow and concentration measurements for the total dissolved solids in the Cheyenne River, South Dakota, USA was conducted in order to compare the obtained actual field measurements with the predictions values made by the Bureau of Reclamation in the Environmental Impact Statement. In comparison to the actual field measurements conducted in this study, The Bureau of Reclamation extension of a small database used in the analysis for the impact of operations at the Angostura Unit over the past 50 years and into the future to predict the annual total dissolved solid loadings doesn't represent the actual loading values and various conditions in the study area. Additional integrated flow and concentration sampling is required to characterize the impact of the current Angostura Dam operations and Angostura Irrigation District return flows on the Cheyenne River in different seasons of the year. PMID:16917716

  3. Soil Sampling Techniques For Alabama Grain Fields

    NASA Technical Reports Server (NTRS)

    Thompson, A. N.; Shaw, J. N.; Mask, P. L.; Touchton, J. T.; Rickman, D.

    2003-01-01

    Characterizing the spatial variability of nutrients facilitates precision soil sampling. Questions exist regarding the best technique for directed soil sampling based on a priori knowledge of soil and crop patterns. The objective of this study was to evaluate zone delineation techniques for Alabama grain fields to determine which method best minimized the soil test variability. Site one (25.8 ha) and site three (20.0 ha) were located in the Tennessee Valley region, and site two (24.2 ha) was located in the Coastal Plain region of Alabama. Tennessee Valley soils ranged from well drained Rhodic and Typic Paleudults to somewhat poorly drained Aquic Paleudults and Fluventic Dystrudepts. Coastal Plain s o i l s ranged from coarse-loamy Rhodic Kandiudults to loamy Arenic Kandiudults. Soils were sampled by grid soil sampling methods (grid sizes of 0.40 ha and 1 ha) consisting of: 1) twenty composited cores collected randomly throughout each grid (grid-cell sampling) and, 2) six composited cores collected randomly from a -3x3 m area at the center of each grid (grid-point sampling). Zones were established from 1) an Order 1 Soil Survey, 2) corn (Zea mays L.) yield maps, and 3) airborne remote sensing images. All soil properties were moderately to strongly spatially dependent as per semivariogram analyses. Differences in grid-point and grid-cell soil test values suggested grid-point sampling does not accurately represent grid values. Zones created by soil survey, yield data, and remote sensing images displayed lower coefficient of variations (8CV) for soil test values than overall field values, suggesting these techniques group soil test variability. However, few differences were observed between the three zone delineation techniques. Results suggest directed sampling using zone delineation techniques outlined in this paper would result in more efficient soil sampling for these Alabama grain fields.

  4. Mars Analogue Field Research and Sample Analysis

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.

    2016-07-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009 to 2016) in the Utah desert and in other extreme environments (Iceland, Eifel, La Reunion) relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution affected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with significant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare campaign results from 2009-2013 campaigns in Utah and other sites to new measurements concerning: the comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.

  5. Mars Analogue Field Research and Sample Analysis

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.

    2016-07-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009 to 2016) in the Utah desert and in other extreme environments (Iceland, Eifel, La Reunion) relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution a ffected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with significant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare campaign results from 2009-2013 campaigns in Utah and other sites to new measurements concerning: the comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.

  6. Assessment of actual transpiration rate in olive tree field combining sap-flow, leaf area index and scintillometer measurements

    NASA Astrophysics Data System (ADS)

    Agnese, C.; Cammalleri, C.; Ciraolo, G.; Minacapilli, M.; Provenzano, G.; Rallo, G.; de Bruin, H. A. R.

    2009-09-01

    Models to estimate the actual evapotranspiration (ET) in sparse vegetation area can be fundamental for agricultural water managements, especially when water availability is a limiting factor. Models validation must be carried out by considering in situ measurements referred to the field scale, which is the relevant scale of the modelled variables. Moreover, a particular relevance assumes to consider separately the components of plant transpiration (T) and soil evaporation (E), because only the first is actually related to the crop stress conditions. Objective of the paper was to assess a procedure aimed to estimate olive trees actual transpiration by combining sap flow measurements with the scintillometer technique at field scale. The study area, located in Western Sicily (Italy), is mainly cultivated with olive crop and is characterized by typical Mediterranean semi-arid climate. Measurements of sap flow and crop actual evapotranspiration rate were carried out during 2008 irrigation season. Crop transpiration fluxes, measured on some plants by means of sap flow sensors, were upscaled considering the leaf area index (LAI). The comparison between evapotranspiration values, derived by displaced-beam small-aperture scintillometer (DBSAS-SLS20, Scintec AG), with the transpiration fluxes obtained by the sap flow sensors, also allowed to evaluate the contribute of soil evaporation in an area characterized by low vegetation coverage.

  7. Field evaluation of a VOST sampling method

    SciTech Connect

    Jackson, M.D.; Johnson, L.D.; Fuerst, R.G.; McGaughey, J.F.; Bursey, J.T.; Merrill, R.G.

    1994-12-31

    The VOST (SW-846 Method 0030) specifies the use of Tenax{reg_sign} and a particular petroleum-based charcoal (SKC Lot 104, or its equivalent), that is no longer commercially available. In field evaluation studies of VOST methodology, a replacement petroleum-based charcoal has been used: candidate replacement sorbents for charcoal were studied, and Anasorb{reg_sign} 747, a carbon-based sorbent, was selected for field testing. The sampling train was modified to use only Anasorb{reg_sign} in the back tube and Tenax{reg_sign} in the two front tubes to avoid analytical difficulties associated with the analysis of the sequential bed back tube used in the standard VOST train. The standard (SW-846 Method 0030) and the modified VOST methods were evaluated at a chemical manufacturing facility using a quadruple probe system with quadruple trains. In this field test, known concentrations of the halogenated volatile organic compounds, that are listed in the Clean Air Act Amendments of 1990, Title 3, were introduced into the VOST train and the modified VOST train, using the same certified gas cylinder as a source of test compounds. Statistical tests of the comparability of methods were performed on a compound-by-compound basis. For most compounds, the VOST and modified VOST methods were found to be statistically equivalent.

  8. Comparison of dechlorination rates for field DNAPL vs synthetic samples: effect of sample matrix

    NASA Astrophysics Data System (ADS)

    O'Carroll, D. M.; Sakulchaicharoen, N.; Herrera, J. E.

    2015-12-01

    Nanometals have received significant attention in recent years due to their ability to rapidly destroy numerous priority source zone contaminants in controlled laboratory studies. This has led to great optimism surrounding nanometal particle injection for insitu remediation. Reported dechlorination rates vary widely among different investigators. These differences have been ascribed to differences in the iron types (granular, micro, or nano-sized iron), matrix solution chemistry and the morphology of the nZVI surface. Among these, the effects of solution chemistry on rates of reductive dechlorination of various chlorinated compounds have been investigated in several short-term laboratory studies. Variables investigated include the effect of anions or groundwater solutes such as SO4-2, Cl-, NO3-, pH, natural organic matters (NOM), surfactant, and humic acid on dechlorination reaction of various chlorinated compounds such as TCE, carbon tetrachloride (CT), and chloroform (CF). These studies have normally centered on the assessment of nZVI reactivity toward dechlorination of an isolated individual contaminant spiked into a ground water sample under ideal conditions, with limited work conducted using real field samples. In this work, the DNAPL used for the dechlorination study was obtained from a contaminatied site. This approach was selected to adequately simulate a condition where the nZVI suspension was in direct contact with DNAPL and to isolate the dechlorination activity shown by the nZVI from the groundwater matrix effects. An ideal system "synthetic DNAPL" composed of a mixture of chlorinated compounds mimicking the composition of the actual DNAPL was also dechlorinated to evaluate the DNAPL "matrix effect" on NZVI dechlorination activity. This approach allowed us to evaluate the effect of the presence of different types of organic compounds (volatile fatty acids and humic acids) found in the actual DNAPL on nZVI dechlorination activity. This presentation will

  9. Strategies for Field Sampling When Large Sample Sizes are Required

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Estimates of prevalence or incidence of infection with a pathogen endemic in a fish population can be valuable information for development and evaluation of aquatic animal health management strategies. However, hundreds of unbiased samples may be required in order to accurately estimate these parame...

  10. Attosecond nanoscale near-field sampling

    NASA Astrophysics Data System (ADS)

    Förg, B.; Schötz, J.; Süßmann, F.; Förster, M.; Krüger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; Pervak, V.; Kessel, A.; Trushin, S. A.; Azzeer, A. M.; Stockman, M. I.; Kim, D.; Krausz, F.; Hommelhoff, P.; Kling, M. F.

    2016-05-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  11. Attosecond nanoscale near-field sampling.

    PubMed

    Förg, B; Schötz, J; Süßmann, F; Förster, M; Krüger, M; Ahn, B; Okell, W A; Wintersperger, K; Zherebtsov, S; Guggenmos, A; Pervak, V; Kessel, A; Trushin, S A; Azzeer, A M; Stockman, M I; Kim, D; Krausz, F; Hommelhoff, P; Kling, M F

    2016-01-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted. PMID:27241851

  12. Attosecond nanoscale near-field sampling

    PubMed Central

    Förg, B.; Schötz, J.; Süßmann, F.; Förster, M.; Krüger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; Pervak, V.; Kessel, A.; Trushin, S. A.; Azzeer, A. M.; Stockman, M. I.; Kim, D.; Krausz, F.; Hommelhoff, P.; Kling, M. F.

    2016-01-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted. PMID:27241851

  13. Attosecond nanoscale near-field sampling

    DOE PAGESBeta

    Forg, B.; Schotz, J.; SuBmann, F.; Forster, M.; Kruger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; et al

    2016-05-31

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. Furthermore, by comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  14. Focused feasibility study final field sampling plan

    SciTech Connect

    Not Available

    1993-10-01

    At the direction of APG-DSHE, the project has been separated into three work phases to allow for data evaluation and risk determination before a full focused feasibility study is conducted. Phase I of the project consists of an aerial photography investigation, surface/marine geophysical surveys, a flowmeter logging program, sampling surface and subsurface soils, an ecological risk assessment of the Beach Point Test Site, and analysis of chemical groundwater data generated through the separate Canal Creek Groundwater Monitoring Program. Tasks described for Phase II of the FFS will be performed upon evaluation of data needs identified subsequent to completion of the Phase I tasks. Phase II investigations include installation fo additional groundwater monitoring wells, sampling of the new and previously existing monitoring wells, a flowmeter logging program, downhole geophysical logging of new monitoring wells (and one previously existing well), and possible soil gas surveys.

  15. Characterization and Leach Testing for PUREX Cladding Waste Sludge (Group 3) and REDOX Cladding Waste Sludge (Group 4) Actual Waste Sample Composites

    SciTech Connect

    Snow, Lanee A.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-02-13

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.(a) The testing program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual wastetesting program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR)—are the subjects of this report. Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, requiring caustic leaching. Characterization of the composite Group 3 and Group 4 waste samples confirmed them to be high in gibbsite. The focus of the Group 3 and 4 testing was on determining the behavior of gibbsite during caustic leaching. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  16. Intended release and actual retention of alfalfa leafcutting bees (Hymenoptera: Megachilidae) for pollination in commercial alfalfa seed fields.

    PubMed

    Pitts-Singer, Theresa L

    2013-04-01

    Low, medium, and high stocking densities (15,000; 30,000; and 45,000-50,000 bees per acre, respectively) of Megachile rotundata (F.) (Hymenoptera: Megachilidae), the alfalfa leafcutting bee, were released over 4 yr in three research plots of Utah alfalfa, Medicago sativa L. (Fabaceae), planted at seed-production rates. A low percentage of bees (46-79% of released) survived the incubation and field-emergence processes; of those bees, the number of females that established at the nesting sites was 25-100%. Of the three field sites, one site consistently retained more females and produced more completed nests than the other sites, all of which usually had poor female establishment and progeny production. In addition, floral resources were depleted over time, but many flowers remained unvisited over the season. Nest production decreased over time, as numbers of flowers and female bees declined. Significant positive relationships were found between the intended stocking densities and 1) the number of females that actually survived incubation and field emergence and 2) the number of females that established nests. The number of females that established nests was positively affected by the number of females that survived to emerge in the field. The percentage of females that established was not significantly affected by the intended number of released bees, countering a prediction that the release of fewer bees would allow more females to establish nests and achieve high reproductive success. For growers, it may be more frugal to use modest numbers of M. rotundata for pollination, because many of the bees at medium and high stocking densities do not nest in grower-provided bee boards. PMID:23786042

  17. Characterization, Leaching, and Filtration Testing for Bismuth Phosphate Sludge (Group 1) and Bismuth Phosphate Saltcake (Group 2) Actual Waste Sample Composites

    SciTech Connect

    Lumetta, Gregg J.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn; Edwards, Matthew K.; Fiskum, Sandra K.; Hallen, Richard T.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Sinkov, Sergey I.; Snow, Lanee A.

    2009-02-19

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.() The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—bismuth phosphate sludge (Group 1) and bismuth phosphate saltcake (Group 2)—are the subjects of this report. The Group 1 waste was anticipated to be high in phosphorus and was implicitly assumed to be present as BiPO4 (however, results presented here indicate that the phosphate in Group 1 is actually present as amorphous iron(III) phosphate). The Group 2 waste was also anticipated to be high in phosphorus, but because of the relatively low bismuth content and higher aluminum content, it was anticipated that the Group 2 waste would contain a mixture of gibbsite, sodium phosphate, and aluminum phosphate. Thus, the focus of the Group 1 testing was on determining the behavior of P removal during caustic leaching, and the focus of the Group 2 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  18. A Coupled Remote Sensing and Simplified Surface Energy Balance Approach to Estimate Actual Evapotranspiration from Irrigated Fields

    PubMed Central

    Senay, Gabriel B.; Budde, Michael; Verdin, James P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250-m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  19. A coupled remote sensing and simplified surface energy balance approach to estimate actual evapotranspiration from irrigated fields

    USGS Publications Warehouse

    Senay, G.B.; Budde, M.; Verdin, J.P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  20. Hybrid quantitative simulation on the in-line phase-contrast x-ray imaging of three dimensional samples under actual clinic imaging parameters

    SciTech Connect

    Yu Hong; Han Shensheng; Ding Jianhui; Jiang Zhaoxia; Peng Weijun

    2009-07-06

    A hybrid model combining Monte Carlo method with diffraction theory of wave optics has been developed and applied to quantitatively simulate the in-line diffractive phase-contrast x-ray imaging of three dimensional tissue samples under actual clinic imaging parameters. The primary microcosmic interactions of medical-energy x-ray within matter including photoabsorption, Compton scattering, and coherent scattering, have been taken into account in the Monte Carlo simulation. A diffraction processing based on Fresnel diffraction theory is carried out to simulate the macroscopic diffraction effect. A comparison with experiment results has also been performed.

  1. Astronaut Neil Armstrong studies rock samples during geological field trip

    NASA Technical Reports Server (NTRS)

    1969-01-01

    Astronaut Neil Armstrong, commander of the Apollo 11 lunar landing mission, studies rock samples during a geological field trip to the Quitman Mountains area near the Fort Quitman ruins in far west Texas.

  2. Modelling nanofluidic field amplified sample stacking with inhomogeneous surface charge

    NASA Astrophysics Data System (ADS)

    McCallum, Christopher; Pennathur, Sumita

    2015-11-01

    Nanofluidic technology has exceptional applications as a platform for biological sample preconcentration, which will allow for an effective electronic detection method of low concentration analytes. One such preconcentration method is field amplified sample stacking, a capillary electrophoresis technique that utilizes large concentration differences to generate high electric field gradients, causing the sample of interest to form a narrow, concentrated band. Field amplified sample stacking has been shown to work well at the microscale, with models and experiments confirming expected behavior. However, nanofluidics allows for further concentration enhancement due to focusing of the sample ions toward the channel center by the electric double layer. We have developed a two-dimensional model that can be used for both micro- and nanofluidics, fully accounting for the electric double layer. This model has been used to investigate even more complex physics such as the role of inhomogeneous surface charge.

  3. Development of field portable sampling and analysis systems

    SciTech Connect

    Beals, D.

    2000-06-08

    A rapid field portable sample and analysis system has been demonstrated at the Savannah River Site and the Hanford Site. The portable system can be used when rapid decisions are needed in the field during scoping or remediation activities, or when it is impractical to bring large volumes of water to the lab for analysis.

  4. Comparison of leach results from field and laboratory prepared samples

    SciTech Connect

    Oblath, S.B.; Langton, C.A.

    1985-03-25

    The leach behavior of saltstone prepared in the laboratory agrees well with that from samples mixed in the field using the Littleford mixer. Leach rates of nitrates and cesium from the current reference formulation saltstone were compared. The laboratory samples were prepared using simulated salt solution; those in the field used Tank 50 decontaminated supernate. For both nitrate and cesium, the field and laboratory samples showed nearly identical leach rates for the first 30 to 50 days. For the remaining period of the test, the field samples showed higher leach rates with the maximum difference being less than a factor of three. Ruthenium and antimony were present in the Tank 50 supernate in known amounts. Antimony-125 was observed in the leachate and a fractional leach rate was calculated to be at least a factor of ten less than that of /sup 137/Cs. No /sup 106/Ru was observed in the leachate, and the release rate was not calculated. However, based on the detection limits for the analysis, the ruthenium leach rate must also be at least a factor of ten less than cesium. These data are the first measurements of the leach rates of Ru and Sb from saltstone. The nitrate leach rates for these samples were 5 x 10/sup -5/ grams of nitrate per square cm per day after 100 days for the laboratory samples and after 200 days for the field samples. These values are consistent with the previously measured leach rates for reference formulation saltstone. The relative standard deviation in the leach rate is about 15% for the field samples, which all were produced from one batch of saltstone, and about 35% for the laboratory samples, which came from different batches. These are the first recorded estimates of the error in leach rates for saltstone.

  5. Magnetostatic modes in ferromagnetic samples with inhomogeneous internal fields

    NASA Astrophysics Data System (ADS)

    Arias, Rodrigo

    2015-03-01

    Magnetostatic modes in ferromagnetic samples are very well characterized and understood in samples with uniform internal magnetic fields. More recently interest has shifted to the study of magnetization modes in ferromagnetic samples with inhomogeneous internal fields. The present work shows that under the magnetostatic approximation and for samples of arbitrary shape and/or arbitrary inhomogeneous internal magnetic fields the modes can be classified as elliptic or hyperbolic, and their associated frequency spectrum can be delimited. This results from the analysis of the character of the second order partial differential equation for the magnetostatic potential under these general conditions. In general, a sample with an inhomogeneous internal field and at a given frequency, may have regions of elliptic and hyperbolic character separated by a boundary. In the elliptic regions the magnetostatic modes have a smooth monotonic character (generally decaying form the surfaces (a ``tunneling'' behavior)) and in hyperbolic regions an oscillatory wave-like character. A simple local criterion distinguishes hyperbolic from elliptic regions: the sign of a susceptibility parameter. This study shows that one may control to some extent magnetostatic modes via external fields or geometry. R.E.A. acknowledges Financiamiento Basal para Centros Cientificos y Tecnologicos de Excelencia under Project No. FB 0807 (Chile), Grant No. ICM P10-061-F by Fondo de Innovacion para la Competitividad-MINECON, and Proyecto Fondecyt 1130192.

  6. Digital Curation of Earth Science Samples Starts in the Field

    NASA Astrophysics Data System (ADS)

    Lehnert, K. A.; Hsu, L.; Song, L.; Carter, M. R.

    2014-12-01

    Collection of physical samples in the field is an essential part of research in the Earth Sciences. Samples provide a basis for progress across many disciplines, from the study of global climate change now and over the Earth's history, to present and past biogeochemical cycles, to magmatic processes and mantle dynamics. The types of samples, methods of collection, and scope and scale of sampling campaigns are highly diverse, ranging from large-scale programs to drill rock and sediment cores on land, in lakes, and in the ocean, to environmental observation networks with continuous sampling, to single investigator or small team expeditions to remote areas around the globe or trips to local outcrops. Cyberinfrastructure for sample-related fieldwork needs to cater to the different needs of these diverse sampling activities, aligning with specific workflows, regional constraints such as connectivity or climate, and processing of samples. In general, digital tools should assist with capture and management of metadata about the sampling process (location, time, method) and the sample itself (type, dimension, context, images, etc.), management of the physical objects (e.g., sample labels with QR codes), and the seamless transfer of sample metadata to data systems and software relevant to the post-sampling data acquisition, data processing, and sample curation. In order to optimize CI capabilities for samples, tools and workflows need to adopt community-based standards and best practices for sample metadata, classification, identification and registration. This presentation will provide an overview and updates of several ongoing efforts that are relevant to the development of standards for digital sample management: the ODM2 project that has generated an information model for spatially-discrete, feature-based earth observations resulting from in-situ sensors and environmental samples, aligned with OGC's Observation & Measurements model (Horsburgh et al, AGU FM 2014

  7. Sample taking problems in measuring actual histamine levels of human gastroduodenal mucosa: specific and general relevance in clinical trials on peptic ulcer pathogenesis and selective proximal vagotomy.

    PubMed Central

    Thon, K P; Lorenz, W; Ohmann, C; Weber, D; Rohde, H; Röher, H D

    1985-01-01

    Changes in histamine storage in the oxyntic mucosa of duodenal ulcer patients and their reversal by vagotomy and the histamine H2-antagonist cimetidine supported the hypothesis that histamine could be a causal factor in peptic ulcer pathogenesis. The specificity of these findings was impaired by problems in biopsy taking, however, and in the preparative steps before measuring the actual histamine contents in all parts of the gastric mucosa and in the duodenum. A prospective trial was carried out in 190 patients to identify these sources of bias and to overcome them by appropriate study designs. Usually a direct correlation was found between weight of biopsy and mucosal histamine content. This problem was solved by selecting a biopsy forceps producing smaller variations in sample size, by limiting the time of cold ischaemia to four to five minutes only and by taking three biopsy specimens for each single histamine value. The actual histamine content of mucosal biopsies remained constant for about four to five minutes only. The 'disappearance' rate was faster in control subjects than in duodenal ulcer patients. Hence by variation of the cold ischaemia time any artefacts of differences between mucosal histamine levels in controls and duodenal ulcer patients could be produced. Using the optimised sample taking procedure mucosal histamine contents of several gastric regions and the duodenal bulb were measured in 24 patients with duodenal ulcer, after selective proximal vagotomy without drainage and in control subjects without any stomach disease (randomised controlled trial). The histamine content was lower in all parts of the upper gastrointestinal tract in duodenal ulcer patients than in controls and was raised again in all regions after selective proximal vagotomy. As the most likely hypothesis it is suggested that vagal reflexes with afferent fibres coming from the oxyntic mucosa stimulate histamine release in duodenal ulcer patients by efferent peptidergic neurones

  8. Long-Term Ecological Monitoring Field Sampling Plan for 2007

    SciTech Connect

    T. Haney R. VanHorn

    2007-07-31

    This field sampling plan describes the field investigations planned for the Long-Term Ecological Monitoring Project at the Idaho National Laboratory Site in 2007. This plan and the Quality Assurance Project Plan for Waste Area Groups 1, 2, 3, 4, 5, 6, 7, 10, and Removal Actions constitute the sampling and analysis plan supporting long-term ecological monitoring sampling in 2007. The data collected under this plan will become part of the long-term ecological monitoring data set that is being collected annually. The data will be used t determine the requirements for the subsequent long-term ecological monitoring. This plan guides the 2007 investigations, including sampling, quality assurance, quality control, analytical procedures, and data management. As such, this plan will help to ensure that the resulting monitoring data will be scientifically valid, defensible, and of known and acceptable quality.

  9. Rotating sample magnetometer for cryogenic temperatures and high magnetic fields

    NASA Astrophysics Data System (ADS)

    Eisterer, M.; Hengstberger, F.; Voutsinas, C. S.; Hörhager, N.; Sorta, S.; Hecher, J.; Weber, H. W.

    2011-06-01

    We report on the design and implementation of a rotating sample magnetometer (RSM) operating in the variable temperature insert (VTI) of a cryostat equipped with a high-field magnet. The limited space and the cryogenic temperatures impose the most critical design parameters: the small bore size of the magnet requires a very compact pick-up coil system and the low temperatures demand a very careful design of the bearings. Despite these difficulties the RSM achieves excellent resolution at high magnetic field sweep rates, exceeding that of a typical vibrating sample magnetometer by about a factor of ten. In addition the gas-flow cryostat and the high-field superconducting magnet provide a temperature and magnetic field range unprecedented for this type of magnetometer.

  10. FIELD SAMPLING OF RESIDUAL AVIATION GASOLINE IN SANDY SOIL

    EPA Science Inventory

    Two complimentary field sampling methods for the determination of residual aviation gasoline content in the contaminated capillary fringe of a fine, uniform, sandy soil were investigated. The first method featured filed extrusion of core barrels into pint size Mason jars, while ...

  11. Capacity degradation of field-tested silica gel samples

    NASA Astrophysics Data System (ADS)

    Penney, T. R.; Pesaran, A. A.; Thomas, T. M.

    1985-06-01

    Researchers at the Solar Energy Research Institute (SERI) have begun preliminary studies to quantify the effect of contamination of silica gel used in dehumidification processes of desiccant cooling systems. Sorption capacity degradation of field tested samples was measured, and the source of degradation was quantified using surface analysis experimental methods.

  12. Astronauts Armstrong and Aldrin study rock samples during field trip

    NASA Technical Reports Server (NTRS)

    1969-01-01

    Astronaut Neil Armstrong, commander of the Apollo 11 lunar landing mission, and Astronaut Edwin Aldrin, Lunar module pilot for Apollo 11, study rock samples during a geological field trip to the Quitman Mountains area near the Fort Quitman ruins in far west Texas.

  13. Comparison of simulants to actual neutralized current acid waste: Process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.

    1996-04-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs have been established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste is being performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  14. Association between subjective actual sleep duration, subjective sleep need, age, body mass index, and gender in a large sample of young adults

    PubMed Central

    Kalak, Nadeem; Brand, Serge; Beck, Johannes; Holsboer-Trachsler, Edith; Wollmer, M Axel

    2015-01-01

    Background Poor sleep is a major health concern, and there is evidence that young adults are at increased risk of suffering from poor sleep. There is also evidence that sleep duration can vary as a function of gender and body mass index (BMI). We sought to replicate these findings in a large sample of young adults, and also tested the hypothesis that a smaller gap between subjective sleep duration and subjective sleep need is associated with a greater feeling of being restored. Methods A total of 2,929 university students (mean age 23.24±3.13 years, 69.1% female) took part in an Internet-based survey. They answered questions related to demographics and subjective sleep patterns. Results We found no gender differences in subjective sleep duration, subjective sleep need, BMI, age, or feeling of being restored. Nonlinear associations were observed between subjective sleep duration, BMI, and feeling of being restored. Moreover, a larger discrepancy between subjective actual sleep duration and subjective sleep need was associated with a lower feeling of being restored. Conclusion The present pattern of results from a large sample of young adults suggests that males and females do not differ with respect to subjective sleep duration, BMI, or feeling of being restored. Moreover, nonlinear correlations seemed to provide a more accurate reflection of the relationship between subjective sleep and demographic variables. PMID:25657583

  15. Comparison of simulants to actual neutralized current acid waste: process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.; Elliott, M.L.

    1996-10-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs were established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste was performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property ,models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  16. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  17. Field sampling method for quantifying odorants in humid environments.

    PubMed

    Trabue, Steven L; Scoggin, Kenwood D; Li, Hong; Burns, Robert; Xin, Hongwei

    2008-05-15

    Most air quality studies in agricultural environments use thermal desorption analysis for quantifying semivolatile organic compounds (SVOCs) associated with odor. The objective of this study was to develop a robust sampling technique for measuring SVOCs in humid environments. Test atmospheres were generated at ambient temperatures (23 +/- 1.5 degrees C) and 25, 50, and 80% relative humidity (RH). Sorbent material used included Tenax, graphitized carbon, and carbon molecular sieve (CMS). Sorbent tubes were challenged with 2, 4, 8, 12, and 24 L of air at various RHs. Sorbent tubes with CMS material performed poorly at both 50 and 80% RH dueto excessive sorption of water. Heating of CMS tubes during sampling or dry-purging of CMS tubes post sampling effectively reduced water sorption with heating of tubes being preferred due to the higher recovery and reproducibility. Tenaxtubes had breakthrough of the more volatile compounds and tended to form artifacts with increasing volumes of air sampled. Graphitized carbon sorbent tubes containing Carbopack X and Carbopack C performed best with quantitative recovery of all compounds at all RHs and sampling volumes tested. The graphitized carbon tubes were taken to the field for further testing. Field samples taken from inside swine feeding operations showed that butanoic acid, 4-methylphenol, 4-ethylphenol, indole, and 3-methylindole were the compounds detected most often above their odor threshold values. Field samples taken from a poultry facility demonstrated that butanoic acid, 3-methylbutanoic acid, and 4-methylphenol were the compounds above their odor threshold values detected most often, relative humidity, CAFO, VOC, SVOC, thermal desorption, swine, poultry, air quality, odor. PMID:18546717

  18. Optimal sampling and sample preparation for NIR-based prediction of field scale soil properties

    NASA Astrophysics Data System (ADS)

    Knadel, Maria; Peng, Yi; Schelde, Kirsten; Thomsen, Anton; Deng, Fan; Humlekrog Greve, Mogens

    2013-04-01

    The representation of local soil variability with acceptable accuracy and precision is dependent on the spatial sampling strategy and can vary with a soil property. Therefore, soil mapping can be expensive when conventional soil analyses are involved. Visible near infrared spectroscopy (vis-NIR) is considered a cost-effective method due to labour savings and relative accuracy. However, savings may be offset by the costs associated with number of samples and sample preparation. The objective of this study was to find the most optimal way to predict field scale total organic carbon (TOC) and texture. To optimize the vis-NIR calibrations the effects of sample preparation and number of samples on the predictive ability of models with regard to the spatial distribution of TOC and texture were investigated. Conditioned Latin hypercube sampling (cLHs) method was used to select 125 sampling locations from an agricultural field in Denmark, using electromagnetic induction (EMI) and digital elevation model (DEM) data. The soil samples were scanned in three states (field moist, air dried and sieved to 2 mm) with a vis-NIR spectrophotometer (LabSpec 5100, ASD Inc., USA). The Kennard-Stone algorithm was applied to select 50 representative soil spectra for the laboratory analysis of TOC and texture. In order to investigate how to minimize the costs of reference analysis, additional smaller subsets (15, 30 and 40) of samples were selected for calibration. The performance of field calibrations using spectra of soils at the three states as well as using different numbers of calibration samples was compared. Final models were then used to predict the remaining 75 samples. Maps of predicted soil properties where generated with Empirical Bayesian Kriging. The results demonstrated that regardless the state of the scanned soil, the regression models and the final prediction maps were similar for most of the soil properties. Nevertheless, as expected, models based on spectra from field

  19. Spatial sampling of head electrical fields: the geodesic sensor net.

    PubMed

    Tucker, D M

    1993-09-01

    In studying brain electrical activity from scalp sensors (electrodes), the optimal measurement would sample the potential field over the entire surface of the braincase, with a sufficient density to avoid spatial aliasing of the surface electrical fields. The geodesic sensor net organizes an array of sensors, each enclosed in a saline sponge, in a geodesic tension structure comprised of elastic threads. By fixing a sensor pedestal at each geodesic vertex, the geometry of the tension structure insures insures that the sensor array is distributed evenly across the accessible head surface. Furthermore, the tension of the network is translated into compression that is divided equally among the sensor pedestals and directed along head-radial vectors. Various geodesic partitioning frequencies may be selected to provide an even surface distribution of the dense sensor arrays (e.g., 64, 128, or 256) that appear to be necessary to provide adequate spatial sampling of brain electrical events. PMID:7691542

  20. DESIGN, DEVELOPMENT AND FIELD DEPLOYMENT OF A TELEOPERATED SAMPLING SYSTEM

    SciTech Connect

    Dalmaso, M; Robert Fogle, R; Tony Hicks, T; Larry Harpring, L; Daniel Odell, D

    2007-11-09

    A teleoperated sampling system for the identification, collection and retrieval of samples following the detonation of an Improvised Nuclear Device (IND) or Radiological Dispersion Devise (RDD) has been developed and tested in numerous field exercises. The system has been developed as part of the Defense Threat Reduction Agency's (DTRA) National Technical Nuclear Forensic (NTNF) Program. The system is based on a Remotec ANDROS Mark V-A1 platform. Extensive modifications and additions have been incorporated into the platform to enable it to meet the mission requirements. The Defense Science Board Task Force on Unconventional Nuclear Warfare Defense, 2000 Summer Study Volume III report recommended the Department of Defense (DOD) improve nuclear forensics capabilities to achieve accurate and fast identification and attribution. One of the strongest elements of protection is deterrence through the threat of reprisal, but to accomplish this objective a more rapid and authoritative attribution system is needed. The NTNF program provides the capability for attribution. Early on in the NTNF program, it was recognized that there would be a desire to collect debris samples for analysis as soon as possible after a nuclear event. Based on nuclear test experience, it was recognized that mean radiation fields associated with even low yield events could be several thousand R/Hr near the detonation point for some time after the detonation. In anticipation of pressures to rapidly sample debris near the crater, considerable effort is being devoted to developing a remotely controlled vehicle that could enter the high radiation field area and collect one or more samples for subsequent analysis.

  1. Wide field of view multifocal scanning microscopy with sparse sampling

    NASA Astrophysics Data System (ADS)

    Wang, Jie; Wu, Jigang

    2016-02-01

    We propose to use sparsely sampled line scans with a sparsity-based reconstruction method to obtain images in a wide field of view (WFOV) multifocal scanning microscope. In the WFOV microscope, we used a holographically generated irregular focus grid to scan the sample in one dimension and then reconstructed the sample image from line scans by measuring the transmission of the foci through the sample during scanning. The line scans were randomly spaced with average spacing larger than the Nyquist sampling requirement, and the image was recovered with sparsity-based reconstruction techniques. With this scheme, the acquisition data can be significantly reduced and the restriction for equally spaced foci positions can be removed, indicating simpler experimental requirement. We built a prototype system and demonstrated the effectiveness of the reconstruction by recovering microscopic images of a U.S. Air Force target and an onion skin cell microscope slide with 40, 60, and 80% missing data with respect to the Nyquist sampling requirement.

  2. "I Actually Learned a Lot from This": A Field Assignment to Prepare Future Preservice Math Teachers for Culturally Diverse Classrooms

    ERIC Educational Resources Information Center

    Downey, Jayne A.; Cobbs, Georgia A.

    2007-01-01

    Teacher education programs are cognizant of the need to prepare preservice teachers (PTs) to work effectively with children from diverse cultural backgrounds. Well-constructed field experiences can help PTs develop awareness and gain understanding of important cultural considerations related to effective teaching and learning (Sleeter, 2001). This…

  3. Intended release and actual retention of alfalfa leafcutting bees (hymenoptera: megachilidae) for pollination in commercial alfalfa seed fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Low, medium, and high stocking densities of Megachile rotundata, the alfalfa leafcutting bee, were released over four years in three research plots of Utah alfalfa planted at seed-production rates. A low number of bees (46-79% of released) survived the incubation and field emergence processes, and ...

  4. Testing an Energy Balance Model for Estimating Actual Evapotranspiration Using Remotely Sensed Data. [Hannover, West Germany barley and wheat fields

    NASA Technical Reports Server (NTRS)

    Gurney, R. J.; Camillo, P. J.

    1985-01-01

    An energy-balance model is used to estimate daily evapotranspiration for 3 days for a barley field and a wheat field near Hannover, Federal Republic of Germany. The model was calibrated using once-daily estimates of surface temperatures, which may be remotely sensed. The evaporation estimates were within the 95% error bounds of independent eddy correlation estimates for the daytime periods for all three days for both sites, but the energy-balance estimates are generally higher; it is unclear which estimate is biassed. Soil moisture in the top 2 cm of soil, which may be remotely sensed, may be used to improve these evaporation estimates under partial ground cover. Sensitivity studies indicate the amount of ground data required is not excessive.

  5. Comparison of aquatic macroinvertebrate samples collected using different field methods

    USGS Publications Warehouse

    Lenz, Bernard N.; Miller, Michael A.

    1996-01-01

    Government agencies, academic institutions, and volunteer monitoring groups in the State of Wisconsin collect aquatic macroinvertebrate data to assess water quality. Sampling methods differ among agencies, reflecting the differences in the sampling objectives of each agency. Lack of infor- mation about data comparability impedes data shar- ing among agencies, which can result in duplicated sampling efforts or the underutilization of avail- able information. To address these concerns, com- parisons were made of macroinvertebrate samples collected from wadeable streams in Wisconsin by personnel from the U.S. Geological Survey- National Water Quality Assessment Program (USGS-NAWQA), the Wisconsin Department of Natural Resources (WDNR), the U.S. Department of Agriculture-Forest Service (USDA-FS), and volunteers from the Water Action Volunteer-Water Quality Monitoring Program (WAV). This project was part of the Intergovernmental Task Force on Monitoring Water Quality (ITFM) Wisconsin Water Resources Coordination Project. The numbers, types, and environmental tolerances of the organ- isms collected were analyzed to determine if the four different field methods that were used by the different agencies and volunteer groups provide comparable results. Additionally, this study com- pared the results of samples taken from different locations and habitats within the same streams.

  6. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field

    PubMed Central

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L.; Miloushev, Vesselin; Poot, Alex J.; Truong, Steven; Alvarez, Julio A.; Aldeborgh, Hannah N.; Keshari, Kayvan R.

    2016-01-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting 13C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength. PMID:27597137

  7. Evaluation of membrane filter field monitors for microbiological air sampling

    NASA Technical Reports Server (NTRS)

    Fields, N. D.; Oxborrow, G. S.; Puleo, J. R.; Herring, C. M.

    1974-01-01

    Due to area constraints encountered in assembly and testing areas of spacecraft, the membrane filter field monitor (MF) and the National Aeronautics and Space Administration-accepted Reyniers slit air sampler were compared for recovery of airborne microbial contamination. The intramural air in a microbiological laboratory area and a clean room environment used for the assembly and testing of the Apollo spacecraft was studied. A significantly higher number of microorganisms was recovered by the Reyniers sampler. A high degree of consistency between the two sampling methods was shown by a regression analysis, with a correlation coefficient of 0.93. The MF samplers detected 79% of the concentration measured by the Reyniers slit samplers. The types of microorganisms identified from both sampling methods were similar.

  8. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field.

    PubMed

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L; Miloushev, Vesselin; Poot, Alex J; Truong, Steven; Alvarez, Julio A; Aldeborgh, Hannah N; Keshari, Kayvan R

    2016-01-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting (13)C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength. PMID:27597137

  9. Actual Condition of Paddy Field Levee Maintenance by Various Farm Households including Large-scale Farming in the Developed Land Renting Area

    NASA Astrophysics Data System (ADS)

    Sakata, Yasuyo

    The survey of interview, resource acquisition, photographic operation, and questionnaire were carried out in the “n” Community in the “y” District in Hakusan City in Ishikawa Prefecture to investigate the actual condition of paddy field levee maintenance in the area where land-renting market was proceeding, large-scale farming was dominant, and the problems of geographically scattered farm-land existed. In the study zone, 1) an agricultural production legal person rent-cultivated some of the paddy fields and maintained the levees, 2) another agricultural production legal person rent-cultivated some of the soy bean fields for crop changeover and land owners maintained the levees. The results indicated that sufficient maintenance was executed on the levees of the paddy fields cultivated by the agricultural production legal person, the soy bean fields for crop changeover, and the paddy fields cultivated by the land owners. Each reason is considered to be the managerial strategy, the economic incentive, the mutual monitoring and cross-regulatory mechanism, etc.

  10. Sample heating in near-field scanning optical microscopy

    NASA Astrophysics Data System (ADS)

    Erickson, Elizabeth S.; Dunn, Robert C.

    2005-11-01

    Heating near the aperture of aluminum coated, fiber optic near-field scanning optical microscopy probes was studied as a function of input and output powers. Using the shear-force feedback method, near-field probes were positioned nanometers above a thermochromic polymer and spectra were recorded as the input power was varied. Excitation at 405 nm of a thin polymer film incorporating perylene and N-allyl-N-methylaniline leads to dual emission peaks in the spectra. The relative peak intensity is temperature sensitive leading to a ratiometric measurement, which avoids complications based solely on intensity. Using this method, we find that the proximal end of typical near-field probes modestly increase in temperature to 40-45 °C at output powers of a few nanowatts (input power of ˜0.15mW). This increases to 55-65 °C at higher output powers of 50 nW or greater (input power of ˜2-4mW). Thermal heating of the probe at higher powers leads to probe elongation, which limits the heating experienced by the sample.

  11. Virtual MEG Helmet: Computer Simulation of an Approach to Neuromagnetic Field Sampling.

    PubMed

    Medvedovsky, Mordekhay; Nenonen, Jukka; Koptelova, Alexandra; Butorina, Anna; Paetau, Ritva; Makela, Jyrki P; Ahonen, Antti; Simola, Juha; Gazit, Tomer; Taulu, Samu

    2016-03-01

    Head movements during an MEG recording are commonly considered an obstacle. In this computer simulation study, we introduce an approach, the virtual MEG helmet (VMH), which employs the head movements for data quality improvement. With a VMH, a denser MEG helmet is constructed by adding new sensors corresponding to different head positions. Based on the Shannon's theory of communication, we calculated the total information as a figure of merit for comparing the actual 306-sensor Elekta Neuromag helmet to several types of the VMH. As source models, we used simulated randomly distributed source current (RDSC), simulated auditory and somatosensory evoked fields. Using the RDSC model with the simulation of 360 recorded events, the total information (bits/sample) was 989 for the most informative single head position and up to 1272 for the VMH (addition of 28.6%). Using simulated AEFs, the additional contribution of a VMH was 12.6% and using simulated SEF only 1.1%. For the distributed and bilateral sources, a VMH can provide a more informative sampling of the neuromagnetic field during the same recording time than measuring the MEG from one head position. VMH can, in some situations, improve source localization of the neuromagnetic fields related to the normal and pathological brain activity. This should be investigated further employing real MEG recordings. PMID:25616085

  12. Direct sampling of electric-field vacuum fluctuations

    NASA Astrophysics Data System (ADS)

    Riek, C.; Seletskiy, D. V.; Moskalenko, A. S.; Schmidt, J. F.; Krauspe, P.; Eckart, S.; Eggert, S.; Burkard, G.; Leitenstorfer, A.

    2015-10-01

    The ground state of quantum systems is characterized by zero-point motion. This motion, in the form of vacuum fluctuations, is generally considered to be an elusive phenomenon that manifests itself only indirectly. Here, we report direct detection of the vacuum fluctuations of electromagnetic radiation in free space. The ground-state electric-field variance is inversely proportional to the four-dimensional space-time volume, which we sampled electro-optically with tightly focused laser pulses lasting a few femtoseconds. Subcycle temporal readout and nonlinear coupling far from resonance provide signals from purely virtual photons without amplification. Our findings enable an extreme time-domain approach to quantum physics, with nondestructive access to the quantum state of light. Operating at multiterahertz frequencies, such techniques might also allow time-resolved studies of intrinsic fluctuations of elementary excitations in condensed matter.

  13. EVALUATION OF SAMPLING AND FIELD FILTRATION METHODS FOR THE ANALYSIS OF TRACE METALS IN GROUND WATER

    EPA Science Inventory

    Selected groundwater sampling and filtering methods were evaluated to determine their effects on field parameters and trace metal concentrations in samples collected under several types of field conditions. he study focused on sampling in conventional standpipe monitoring wells u...

  14. An Autosampler and Field Sample Carrier for Maximizing Throughput Using an Open-Air, Surface Sampling Ion Source for MS

    EPA Science Inventory

    A recently developed, commercially available, open-air, surface sampling ion source for mass spectrometers provides individual analyses in several seconds. To realize its full throughput potential, an autosampler and field sample carrier were designed and built. The autosampler ...

  15. Terahertz imaging using full-field electrooptic sampling

    NASA Astrophysics Data System (ADS)

    Ayesheshim, Ayesheshim Kebie

    Real time terahertz imaging is emerging as an important non-destructive imaging tool for medical, quality control, security and other industrial applications. In this thesis, we demonstrate real-time full-field terahertz (THz) imaging of still, moving, and concealed objects, and real-time THz images of the field distribution on the imaging plane. A femtosecond laser pulse from an amplified Ti:sapphire laser system with a pulse duration of 100 fs, repetition rate of 1 kHz, and 800 nm center wavelength is used to generate THz pulses via optical rectification in a 15x15 mm2 by 2 mm thick [110] ZnTe crystal. The THz pulses are collimated to a 1" diameter beam using off-axis parabolic reflectors. An object is placed in the collimated THz beam, and a plastic lens is used to form an image of the object on a second ZnTe crystal (detector). The THz image is detected by free-space electro-optic sampling using a large diameter gating beam derived from the laser source. Video or still images are captured by an 8-bit (30 fps) grayscale CCD camera, and objects hidden behind paper or inside Styrofoam can be clearly seen in real-time. We also study the ring-like spatial intensity distribution of the various frequency components of the THz pulse focused in the image plane by varying the time-delay between the THz and probe beams. Methods for improving signal-to-noise such as frame averaging and dynamic subtraction are also studied.

  16. Effect of soil type patterns on the variability of bare soil evaporation within a field: comparison of eddy covariance measurements with potential and actual evaporation calculations

    NASA Astrophysics Data System (ADS)

    Vanderborght, J.; Graf, A.; Steenpass, C.; Scharnagl, B.; Prolingheuer, N.; Herbst, M.; Vereecken, H.

    2009-12-01

    Bare soil evaporation was measured with the eddy-covariance method at the Selhausen field site. The site has a distinct gradient in soil texture with a considerably higher stone content at the upper part of the field. Because of this gradient, a spatial variation in evaporation fluxes in the field is expected. Because of the higher stone content at the upper part of the field, it is expected that the water that is stored in the soil surface layer and can be evaporated at a maximal evaporation rate, which is determined by the energy that is available for evaporation, is considerable smaller in the upper than in the lower part of the field. We investigated whether this hypothesis is supported by eddy covariance (EC) measurements of the evaporation fluxes at the field site. The EC measurements were combined with a footprint model that predicts the location of the soil surface that contributes to the measured evaporation flux. In this way, evaporation measurements of the two parts of the field site could be distinguished. However, since only one EC station was available, simultaneous evaporation measurements for the two field parts were not available. As a consequence, the datasets of measurements had to be interpreted and put into context of the meteorological and soil hydrological conditions. The potential evapotranspiration was calculated using the FAO method (Allen et al., 1998) to represent the meteorological conditions whereas a simple soil evaporation model (Boesten and Stroosnijder, 1986) was used to represent the influence of the precipitation and soil hydrological conditions on the actual evaporation rate. Since different soil parameters were required to describe the evaporation measurements for the upper and lower part of the plot, our starting hypothesis that more water is evaporated in the lower part of the field could be confirmed. Allen, R. G., L. S. Pereira, D. Raes, and M. Smith (1998), Crop evapotranspiration: Guidelines for computing crop water

  17. COLLECTION EFFICIENCY OF FIELD SAMPLING CASSETTES: INTERAGENCY ENERGY/ENVIRONMENT R AND D PROGRAM REPORT

    EPA Science Inventory

    Industrial hygiene particulate samples are often collected under anisokinetic sampling conditions and in crosswinds. Experiments were conducted to quantitate errors associated with sampling under these non-ideal conditions. Three types of field sampling cassetts were tested to de...

  18. Preliminary Study on the Radar Vegetation Index (RVI) Application to Actual Paddy Fields by ALOS/PALSAR Full-polarimetry SAR Data

    NASA Astrophysics Data System (ADS)

    Yamada, Y.

    2015-04-01

    Kim and van Zyl (2001) proposed a kind of radar vegetation index (RVI). RVI = 4*min(λ1, λ2, λ3) / (λ1 + λ2 + λ3) They modified the equation as follows. (2009) RVI = 8 * σ0hv / (σ0hh + σ0vv +σ0hv ) by L-band full-polarimetric SAR data. They applied it into rice crop and soybean. (Y.Kim, T.Jackson et al., 2012) They compared RVI for L-, C- and X-bands to crop growth data, LAI and NDVI. They found L-band RVI was well correlated with Vegetation Water Content, LAI and NDVI. But the field data were collected by the multifrequency polarimetric scatterometer. The platform height was 4.16 meters from the ground. The author tried to apply the method to actual paddy fields near Tsukuba science city in Japan using ALOS/PALSAR, full-polarimetry L-band SAR data. The staple crop in Eastern Asia is rice and paddy fields are dominant land use. A rice-planting machine comes into wide use in this areas. The young rice plants were bedded regularly ridged line in the paddy fields by the machine. The space between two ridges of rice plants is about 30 cm and the wave length of PALSAR sensor is about 23 cm. Hence the Bragg scattering will appear depending upon the direction of the ridges of paddy fields. Once the Bragg scattering occurs, the backscattering values from the pixels should be very high comparing the surrounding region. Therefore the radar vegetation index (RVI) would be saturated. The RVI did not follow the increasing of vegetation anymore. Japan has launched ALOS-2 satellite and it has PALSAR-2, L-band SAR. Therefore RVI application product by PALSAR-2 will be watched with deep interest.

  19. A Sample of OB Stars that Formed in the Field

    NASA Astrophysics Data System (ADS)

    Oey, M. S.; Lamb, J. B.; Kushner, C. T.; Pellegrini, E. W.; Graus, A. S.

    2013-05-01

    We present a sample of 14 OB stars in the Small Magellanic Cloud that meet strong criteria for having formed under extremely sparse star-forming conditions in the field. These stars are a minimum of 28 pc in projection from other OB stars, and they are centered within symmetric, round H II regions. They show no evidence of bow shocks, implying that the targets are not transverse runaway stars. Their radial velocities relative to local H I also indicate that they are not line-of-sight runaway stars. A friends-of-friends analysis shows that nine of the objects present a few low-mass companion stars, with typical mass ratios for the two highest-mass stars of around 0.1. This further substantiates that these OB stars formed in place, and that they can and do form in extremely sparse conditions. This poses strong constraints on theories of star formation and challenges proposed relations between cluster mass and maximum stellar mass.

  20. A SAMPLE OF OB STARS THAT FORMED IN THE FIELD

    SciTech Connect

    Oey, M. S.; Lamb, J. B.; Kushner, C. T.; Pellegrini, E. W.; Graus, A. S.

    2013-05-01

    We present a sample of 14 OB stars in the Small Magellanic Cloud that meet strong criteria for having formed under extremely sparse star-forming conditions in the field. These stars are a minimum of 28 pc in projection from other OB stars, and they are centered within symmetric, round H II regions. They show no evidence of bow shocks, implying that the targets are not transverse runaway stars. Their radial velocities relative to local H I also indicate that they are not line-of-sight runaway stars. A friends-of-friends analysis shows that nine of the objects present a few low-mass companion stars, with typical mass ratios for the two highest-mass stars of around 0.1. This further substantiates that these OB stars formed in place, and that they can and do form in extremely sparse conditions. This poses strong constraints on theories of star formation and challenges proposed relations between cluster mass and maximum stellar mass.

  1. COMPARISON OF USEPA FIELD SAMPLING METHODS FOR BENTHIC MACROINVERTEBRATE STUDIES

    EPA Science Inventory

    Two U.S. Environmental Protection Agency (USEPA) macroinvertebrate sampling protocols were compared in the Mid-Atlantic Highlands region. The Environmental Monitoring and Assessment Program (EMAP) wadeable streams protocol results in a single composite sample from nine transects...

  2. Field evaluation of personal sampling methods for multiple bioaerosols.

    PubMed

    Wang, Chi-Hsun; Chen, Bean T; Han, Bor-Cheng; Liu, Andrew Chi-Yeu; Hung, Po-Chen; Chen, Chih-Yong; Chao, Hsing Jasmine

    2015-01-01

    Ambient bioaerosols are ubiquitous in the daily environment and can affect health in various ways. However, few studies have been conducted to comprehensively evaluate personal bioaerosol exposure in occupational and indoor environments because of the complex composition of bioaerosols and the lack of standardized sampling/analysis methods. We conducted a study to determine the most efficient collection/analysis method for the personal exposure assessment of multiple bioaerosols. The sampling efficiencies of three filters and four samplers were compared. According to our results, polycarbonate (PC) filters had the highest relative efficiency, particularly for bacteria. Side-by-side sampling was conducted to evaluate the three filter samplers (with PC filters) and the NIOSH Personal Bioaerosol Cyclone Sampler. According to the results, the Button Aerosol Sampler and the IOM Inhalable Dust Sampler had the highest relative efficiencies for fungi and bacteria, followed by the NIOSH sampler. Personal sampling was performed in a pig farm to assess occupational bioaerosol exposure and to evaluate the sampling/analysis methods. The Button and IOM samplers yielded a similar performance for personal bioaerosol sampling at the pig farm. However, the Button sampler is more likely to be clogged at high airborne dust concentrations because of its higher flow rate (4 L/min). Therefore, the IOM sampler is a more appropriate choice for performing personal sampling in environments with high dust levels. In summary, the Button and IOM samplers with PC filters are efficient sampling/analysis methods for the personal exposure assessment of multiple bioaerosols. PMID:25799419

  3. ESTIMATING SAMPLE REQUIREMENTS FOR FIELD EVALUATIONS OF PESTICIDE LEACHING

    EPA Science Inventory

    A method is presented for estimating the number of samples needed to evaluate pesticide leaching threats to ground water at a desired level of precision. Sample size projections are based on desired precision (exhibited as relative tolerable error), level of confidence (90 or 95%...

  4. Field Evaluation of Personal Sampling Methods for Multiple Bioaerosols

    PubMed Central

    Wang, Chi-Hsun; Chen, Bean T.; Han, Bor-Cheng; Liu, Andrew Chi-Yeu; Hung, Po-Chen; Chen, Chih-Yong; Chao, Hsing Jasmine

    2015-01-01

    Ambient bioaerosols are ubiquitous in the daily environment and can affect health in various ways. However, few studies have been conducted to comprehensively evaluate personal bioaerosol exposure in occupational and indoor environments because of the complex composition of bioaerosols and the lack of standardized sampling/analysis methods. We conducted a study to determine the most efficient collection/analysis method for the personal exposure assessment of multiple bioaerosols. The sampling efficiencies of three filters and four samplers were compared. According to our results, polycarbonate (PC) filters had the highest relative efficiency, particularly for bacteria. Side-by-side sampling was conducted to evaluate the three filter samplers (with PC filters) and the NIOSH Personal Bioaerosol Cyclone Sampler. According to the results, the Button Aerosol Sampler and the IOM Inhalable Dust Sampler had the highest relative efficiencies for fungi and bacteria, followed by the NIOSH sampler. Personal sampling was performed in a pig farm to assess occupational bioaerosol exposure and to evaluate the sampling/analysis methods. The Button and IOM samplers yielded a similar performance for personal bioaerosol sampling at the pig farm. However, the Button sampler is more likely to be clogged at high airborne dust concentrations because of its higher flow rate (4 L/min). Therefore, the IOM sampler is a more appropriate choice for performing personal sampling in environments with high dust levels. In summary, the Button and IOM samplers with PC filters are efficient sampling/analysis methods for the personal exposure assessment of multiple bioaerosols. PMID:25799419

  5. CTEPP NC DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Other Persistent...

  6. Estimation of Actual Crop ET of Paddy Using the Energy Balance Model SMARET and Validation with Field Water Balance Measurements and a Crop Growth Model (ORYZA)

    NASA Astrophysics Data System (ADS)

    Nallasamy, N. D.; Muraleedharan, B. V.; Kathirvel, K.; Narasimhan, B.

    2014-12-01

    Sustainable management of water resources requires reliable estimates of actual evapotranspiration (ET) at fine spatial and temporal resolution. This is significant in the case of rice based irrigation systems, one of the major consumers of surface water resources and where ET forms a major component of water consumption. However huge tradeoff in the spatial and temporal resolution of satellite images coupled with lack of adequate number of cloud free images within a growing season act as major constraints in deriving ET at fine spatial and temporal resolution using remote sensing based energy balance models. The scale at which ET is determined is decided by the spatial and temporal scale of Land Surface Temperature (LST) and Normalized Difference Vegetation Index (NDVI), which form inputs to energy balance models. In this context, the current study employed disaggregation algorithms (NL-DisTrad and DisNDVI) to generate time series of LST and NDVI images at fine resolution. The disaggregation algorithms aimed at generating LST and NDVI at finer scale by integrating temporal information from concurrent coarse resolution data and spatial information from a single fine resolution image. The temporal frequency of the disaggregated images is further improved by employing composite images of NDVI and LST in the spatio-temporal disaggregation method. The study further employed half-hourly incoming surface insolation and outgoing long wave radiation obtained from the Indian geostationary satellite (Kalpana-1) to convert the instantaneous ET into daily ET and subsequently to the seasonal ET, thereby improving the accuracy of ET estimates. The estimates of ET were validated with field based water balance measurements carried out in Gadana, a subbasin predominated by rice paddy fields, located in Tamil Nadu, India.

  7. Multi-field Pattern Matching based on Sparse Feature Sampling.

    PubMed

    Wang, Zhongjie; Seidel, Hans-Peter; Weinkauf, Tino

    2016-01-01

    We present an approach to pattern matching in 3D multi-field scalar data. Existing pattern matching algorithms work on single scalar or vector fields only, yet many numerical simulations output multi-field data where only a joint analysis of multiple fields describes the underlying phenomenon fully. Our method takes this into account by bundling information from multiple fields into the description of a pattern. First, we extract a sparse set of features for each 3D scalar field using the 3D SIFT algorithm (Scale-Invariant Feature Transform). This allows for a memory-saving description of prominent features in the data with invariance to translation, rotation, and scaling. Second, the user defines a pattern as a set of SIFT features in multiple fields by e.g. brushing a region of interest. Third, we locate and rank matching patterns in the entire data set. Experiments show that our algorithm is efficient in terms of required memory and computational efforts. PMID:26390479

  8. A contemporary decennial global sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, E.; Roy, D. P.

    2011-12-01

    In the last several hundred years agriculture has caused significant human induced Land Cover Land Use Change (LCLUC) with dramatic cropland expansion and a marked increase in agricultural productivity. The size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLUC. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, diffusion of disease pathogens and pests, and loss or degradation in buffers to nutrient, herbicide and pesticide flows. In this study, globally distributed locations with significant contemporary field size change were selected guided by a global map of agricultural yield and literature review and were selected to be representative of different driving forces of field size change (associated with technological innovation, socio-economic conditions, government policy, historic patterns of land cover land use, and environmental setting). Seasonal Landsat data acquired on a decadal basis (for 1980, 1990, 2000 and 2010) were used to extract field boundaries and the temporal changes in field size quantified and their causes discussed.

  9. FIELD APPLICATIONS OF CHEMICAL TIME-SERIES SAMPLING

    EPA Science Inventory

    Two municipal supply wells in Lakewood, Washington, were found to be contaminated with trichloroethylene, transdichloroethylene, and tetrachloroethylene. Sequential samples were taken for chemical analyses, in conjunction with drawdown measurement during aquifer (pump) tests desi...

  10. DICK''S CREEK & VICINITY FIELD SAMPLING & ANALYSIS

    EPA Science Inventory

    Sediment and floodplain samples were collected by USEPA and analyzed for PCB Aroclors, PCB congeners, semi-volatile compounds and metals to fill data gaps, complete human health and ecological risk assessments, and identify areas which need remediation

  11. Magnetic Field Sampling using a Pulsed Hysteretic SQUID

    NASA Astrophysics Data System (ADS)

    Kwon, S. P.; Vlahacos, C. P.; Berkley, A. J.; Gubrud, M. A.; Wellstood, F. C.; Cawthorne, A.

    2004-03-01

    Weak magnetic field detection using a non-hysteretic DC SQUID with Flux-Locked-Loop electronics is typically limited to 1MHz bandwidth or less. However, there is demand for larger bandwidth magnetic field detection for use in the semiconductor industry. We have studied the possibility of using a 4.2K hysteretic trilayer Nb DC SQUID, fabricated by Hypres Inc., with pulsed bias current to increase the bandwidth by an order of magnitude or more. The technique is based on the fast switching of a hysteretic SQUID from the superconducting state to the normal conducting state. By observing the switching of the SQUID, the applied magnetic field at the time of a pulse can be followed. Experimental results show that the technique can be used to follow magnetic fields of up to 60MHz with 5ns pulses. With shorter pulses and better electronics, the technique could further increase the bandwidth by another order of magnitude.

  12. CTEPP: RECRUITING AND FIELD SAMPLING IN NORTH CAROLINA AND OHIO

    EPA Science Inventory

    The research field study (CTEPP) of approximately 260 preschool children's exposures to persistent organic pollutants in their everyday environments began in early 2000. CTEPP is a multimedia study of the children's aggregate (total) exposures over a 48-hr period, both at thei...

  13. "Digital Sampling": Mapping Weed Presence in Fallow Fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Growers need maps of the distribution of weeds in their fields to reduce herbicide use with site-specific weed management (SSWM). Remote sensing is key to successful weed mapping and sophisticated hyper- and multi-spectral image-based systems appear promising for detecting weed patches and identifyi...

  14. Field test of the IMEEDS radionuclide sampling system

    SciTech Connect

    Bandong, B; Bianchini, G; Esser, B; Volpe, A M.

    1998-09-15

    This report describes the function and performance of a seawater sampling system. The purpose of the sampling system is to process water and isolate, or concentrate man-made radionuclides present in the marine environment. Many of these isotopes are present in natural waters at extremely low levels, if at all. Also, biogeochemical processes in the environment sequester elements so that any given analyte may be in a compound, molecular, or ionic state, and associated with solid, colloidal and dissolved phases. The distribution of radioisotopes in natural waters is controlled by chemical speciation, pH, temperature, redox conditions, complex formation, adsorption and desorption, salinity, conductivity, and hydrolytic colloid formation (Harvey et al., 1990; von Gunten and Benes, 1995). Therefore, the goal of this work is to develop a sampler that is capable of isolating suites of radionuclides as they are found in the environment.

  15. Development and field testing of a miniaturized sampling system for simultaneous sampling of vapours and droplets.

    PubMed

    Breuer, Dietmar; Dragan, George C; Friedrich, Claudia; Möhlmann, Carsten; Zimmermann, Ralf

    2015-02-01

    The sampling of semi volatiles (SV) in workplaces may lead to different results as measurements may be affected by sampling bias. The new European Standard EN 13936 defines "semi-volatiles" as substances with vapour pressures in the range between 0.001 and 100 Pa at room temperature. EN 13936 regulates the basic requirements for SV compounds that can occur as vapour and particle at the same time. Vapour and particles shall not be sampled separately and particles have to be sampled as inhalable fraction. Following EN 13936, the Institute for Occupational Safety and Health (Institut für Arbeitsschutz - IFA) has developed a miniaturized droplet-vapour sampler (GGP-Mini) which is designed to sample the inhalable aerosol fraction at low flow rates. The GGP-Mini uses 13 mm filters for particle sampling combined with adsorption tubes for vapour sampling. Laboratory tests were performed on 11 polar and non-polar compounds in a boiling point range from 188 °C to 318 °C. The substances were spiked directly on the filter followed by aspiration of 40 litres of air. Substances with boiling points below 230 °C were almost completely evaporated. Substances with boiling points above 230 °C up to 300 °C were found on both filter and charcoal tube. Lower-volatile compounds remained almost completely on the filter. For polar substances, the atmospheric humidity had a considerable influence upon the distribution of the liquid and vaporous components. A strong influence of the sampling temperature was found in the range from 0 °C to 50 °C. Droplet-vapour mixtures of n-hexadecane and diethylene glycol with droplet sizes between 1 μm and 4 μm were generated in a flow tube to verify the laboratory results. The aerosol concentrations were analysed on-line with a particle sizer and a flame ionisation detector, while parallel off-line samples were taken with the GGP-Mini. Evaporation losses from filters could be studied by comparing the on-line with off-line measurements. All

  16. Tackling field-portable Raman spectroscopy of real world samples

    NASA Astrophysics Data System (ADS)

    Shand, Neil C.

    2008-10-01

    A major challenge confronting first responders, customs authorities and other security-related organisations is the accurate, rapid, and safe identification of potentially hazardous chemicals outside a laboratory environment. Currently, a range of hand portable Raman equipment is commercially available that is low cost and increasingly more sophisticated. These systems are generally based on the 785nm Stokes shifted Raman technique with many using dispersive grating spectrometers. This technique offers a broad range of capabilities including the ability to analyse illicit drugs, explosives, chemical weapons and pre-cursors but still has some fundamental constraints. 'Real world' samples, such as those found at a crime scene, will often not be presented in the most accessible manner. Simple issues such as glass fluorescence can make an otherwise tractable sample impossible to analyse in-situ. A new generation of portable Raman equipment is currently being developed to address these issues. Consideration is given to the use of longer wavelength for fluorescence reduction. Alternative optical designs are being tested to compensate for the signal reduction incurred by moving to longer wavelengths. Furthermore, the use of anti-Stokes spectroscopy is being considered as well as investigating the robustness and portability of traditional Fourier Transform interferometer designs along with future advances in detector technology and ultra small spectrometers.

  17. Using geostatistical methods to inform field sampling of heterogeneous fractured media

    NASA Astrophysics Data System (ADS)

    Pollyea, R.; Fairley, J.

    2008-12-01

    Acquiring data at appropriately fine scales to capture heterogeneous features for use in stochastic simulation can be costly when relying on borehole data, lidar, or other geophysical methods. Additionally, relying on available borehole data typically yields lateral resolution inadequate for assessing horizontal correlation structure. Here we present methodology for developing a field sampling plan in fractured basalt using a published fracture map of a basalt surface exposure. Using a sub-meter sample grid the correlation range of the fractures on the published fracture map was determined. Field sampling was then emulated by removing samples and reassessing the correlation range. Sample spacing for field sampling was identified as the largest that would maintain the original correlation structure. This sample spacing was then implemented for obtaining field samples at surface exposures of two basalt flows near the fracture map exposure. The correlation range of the field samples suggests that using the model semivariogram to test a field sampling plan in preparation for a field sampling event may provide useful information for defining a sampling scheme in heterogeneous fractured media.

  18. Guidance for establishment and implementation of field sample management programs in support of EM environmental sampling and analysis activities

    SciTech Connect

    Not Available

    1994-02-18

    The role of the National Sample Management Program (NSMP) proposed by the Department of Energy`s Office of Environmental Management (EM) is to be a resource for EM programs and for local Field Sample Management Programs (FSMPs). It will be a source of information on sample analysis and data collection within the DOE complex. The purpose of this document is to establish the suggested scope of the FSMP activities to be performed under each Operations Office, list the drivers under which the program will operate, define terms and list references. This guidance will apply only to EM sampling and analysis activities associated with project planning, contracting, laboratory selection, sample collection, sample transportation, laboratory analysis and data management.

  19. Assessment of sampling and analytical uncertainty of trace element contents in arable field soils.

    PubMed

    Buczko, Uwe; Kuchenbuch, Rolf O; Ubelhör, Walter; Nätscher, Ludwig

    2012-07-01

    Assessment of trace element contents in soils is required in Germany (and other countries) before sewage sludge application on arable soils. The reliability of measured element contents is affected by measurement uncertainty, which consists of components due to (1) sampling, (2) laboratory repeatability (intra-lab) and (3) reproducibility (between-lab). A complete characterization of average trace element contents in field soils should encompass the uncertainty of all these components. The objectives of this study were to elucidate the magnitude and relative proportions of uncertainty components for the metals As, B, Cd, Co, Cr, Mo, Ni, Pb, Tl and Zn in three arable fields of different field-scale heterogeneity, based on a collaborative trial (CT) (standardized procedure) and two sampling proficiency tests (PT) (individual sampling procedure). To obtain reference values and estimates of field-scale heterogeneity, a detailed reference sampling was conducted. Components of uncertainty (sampling person, sampling repetition, laboratory) were estimated by variance component analysis, whereas reproducibility uncertainty was estimated using results from numerous laboratory proficiency tests. Sampling uncertainty in general increased with field-scale heterogeneity; however, total uncertainty was mostly dominated by (total) laboratory uncertainty. Reproducibility analytical uncertainty was on average by a factor of about 3 higher than repeatability uncertainty. Therefore, analysis within one single laboratory and, for heterogeneous fields, a reduction of sampling uncertainty (for instance by larger numbers of sample increments and/or a denser coverage of the field area) would be most effective to reduce total uncertainty. On the other hand, when only intra-laboratory analytical uncertainty was considered, total sampling uncertainty on average prevailed over analytical uncertainty by a factor of 2. Both sampling and laboratory repeatability uncertainty were highly variable

  20. Progress in field-assisted extraction and its application to solid sample analysis.

    PubMed

    He, Yuanyuan; Xiao, Xiaohua; Cheng, Yingyi; Li, Gongke

    2016-01-01

    Sample preparation is the most time-consuming and laborious procedure during analysis. The rapid and effective extraction of solid and semi-solid samples is much more difficult than that of gas and liquid samples. In the present review, various extraction methods for solid and semi-solid samples such as supercritical fluid extraction, ultrasound-assisted extraction, microwave-assisted extraction, etc. are summarized based on the principles of field and field synergy effects. The expected trends of field-assisted extraction methods are discussed and proposed to encourage further development on the rapid and effective extraction for solid and semi-solid samples. PMID:26390199

  1. Effect of sample size in the evaluation of "in-field" sampling plans for aflatoxin B(1) determination in corn.

    PubMed

    Brera, Carlo; De Santis, Barbara; Prantera, Elisabetta; Debegnach, Francesca; Pannunzi, Elena; Fasano, Floriana; Berdini, Clara; Slate, Andrew B; Miraglia, Marina; Whitaker, Thomas B

    2010-08-11

    Use of proper sampling methods throughout the agri-food chain is crucial when it comes to effectively detecting contaminants in foods and feeds. The objective of the study was to estimate the performance of sampling plan designs to determine aflatoxin B(1) (AFB(1)) contamination in corn fields. A total of 840 ears were selected from a corn field suspected of being contaminated with aflatoxin. The mean and variance among the aflatoxin values for each ear were 10.6 mug/kg and 2233.3, respectively. The variability and confidence intervals associated with sample means of a given size could be predicted using an equation associated with the normal distribution. Sample sizes of 248 and 674 ears would be required to estimate the true field concentration of 10.6 mug/kg within +/-50 and +/-30%, respectively. Using the distribution information from the study, operating characteristic curves were developed to show the performance of various sampling plan designs. PMID:20608734

  2. Fast and accurate near-field - far-field transformation by sampling interpolation of plane-polar measurements

    NASA Astrophysics Data System (ADS)

    Bucci, Ovidio M.; Gennarelli, Claudio; Savarese, Catello

    1991-01-01

    An optimal sampling interpolation algorithm which allows the accurate recovery of plane-rectangular near-field samples from the knowledge of the plane-polar ones is developed. This enables the standard near field-far field (NF-FF) transformation, which takes full advantage of the FFT algorithm, to be applied to plane-polar scanning. The maximum allowable sample spacing is also rigorously derived, and it is shown that it can be significantly greater than lambda/2 as the measurement place moves away from the source. This allows a remarkable reduction of both measurement time and memory storage requirements. The sampling approach is compared with that based on the bivariate Lagrange interpolation (BLI) method. The sampling reconstruction agrees with the exact results significantly better than the BLI, in spite of the significantly lower number of required measurements.

  3. Optimization of field-amplified sample injection for analysis of peptides by capillary electrophoresis-mass spectrometry.

    PubMed

    Yang, Yuanzhong; Boysen, Reinhard I; Hearn, Milton T W

    2006-07-15

    A versatile experimental approach is described to achieve very high sensitivity analysis of peptides by capillary electrophoresis-mass spectrometry with sheath flow configuration based on optimization of field-amplified sample injection. Compared to traditional hydrodynamic injection methods, signal enhancement in terms of detection sensitivity of the bioanalytes by more than 3000-fold can be achieved. The effects of injection conditions, composition of the acid and organic solvent in the sample solution, length of the water plug, sample injection time, and voltage on the efficiency of the sample stacking have been systematically investigated, with peptides in the low-nanomolar (10(-9) M) range readily detected under the optimized conditions. Linearity of the established stacking method was found to be excellent over 2 orders of magnitude of concentration. The method was further evaluated for the analysis of low concentration bioactive peptide mixtures and tryptic digests of proteins. A distinguishing feature of the described approach is that it can be employed directly for the analysis of low-abundance protein fragments generated by enzymatic digestion and a reversed-phase-based sample-desalting procedure. Thus, rapid identification of protein fragments as low-abundance analytes can be achieved with this new approach by comparison of the actual tandem mass spectra of selected peptides with the predicted fragmentation patterns using online database searching algorithms. PMID:16841892

  4. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    SciTech Connect

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  5. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS ? (ABSTRACT)

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  6. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS?

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  7. A laboratory and field evaluation of a portable immunoassay test for triazine herbicides in environmental water samples

    USGS Publications Warehouse

    Schulze, P.A.; Capel, P.D.; Squillace, P.J.; Helsel, D.R.

    1993-01-01

    The usefulness and sensitivity, of a portable immunoassay test for the semiquantitative field screening of water samples was evaluated by means of laboratory and field studies. Laboratory results indicated that the tests were useful for the determination of atrazine concentrations of 0.1 to 1.5 μg/L. At a concentration of 1 μg/L, the relative standard deviation in the difference between the regression line and the actual result was about 40 percent. The immunoassay was less sensitive and produced similar errors for other triazine herbicides. After standardization, the test results were relatively insensitive to ionic content and variations in pH (range, 4 to 10), mildly sensitive to temperature changes, and quite sensitive to the timing of the final incubation step, variances in timing can be a significant source of error. Almost all of the immunoassays predicted a higher atrazine concentration in water samples when compared to results of gas chromatography. If these tests are used as a semiquantitative screening tool, this tendency for overprediction does not diminish the tests' usefulness. Generally, the tests seem to be a valuable method for screening water samples for triazine herbicides.

  8. Communication: Multiple atomistic force fields in a single enhanced sampling simulation

    NASA Astrophysics Data System (ADS)

    Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H.

    2015-07-01

    The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.

  9. Communication: Multiple atomistic force fields in a single enhanced sampling simulation

    SciTech Connect

    Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H.

    2015-07-14

    The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.

  10. Field guidelines for collection, treatment, and analysis of water samples, Montana district

    USGS Publications Warehouse

    Knapton, J.R.

    1985-01-01

    This manual provides a set of standardized guidelines and quality-control procedures for the collection and preservation of water samples and defines procedures for field analyses of unstable constituents or properties. Seldom is the water being samples of such uniformity that a single grab sample is representative of the whole. For this reason a variety of sampler types and sampling methods have been devised. Descriptions and procedures for field use are given for a number of sampler types. Several methods of sampling are described for which these samplers can be used. Sample-processing devices such as sample splitters and filtration apparatus are discussed along with methods of cleaning. Depending on the type of analysis to be performed in the laboratory, samples may need to be preserved shortly after collection. Various types of preservation are described in detail. Analyses for unstable constituents or properties are of necessity accomplished in the field. This manual addresses analytical techniques and quality assurance for: (1) Water temperature, (2) specific conductance, (3) pH, (4) alkalinity, (5) dissolved oxygen, and (6) bacteria. Examples of field report forms are given as attachments. Information pertinent to certain field calculations is also presented. (USGS)

  11. COMPARISON OF TWO FIELD SAMPLING PROCEDURES (EN CORE AND FIELD METHANOL EXTRACTION) FOR VOLATILE ORGANIC COMPOUNDS

    EPA Science Inventory

    In-situ Lasagna technology was recently evaluated at a contaminated site at Offutt Air Force Base. The site was contaminated with low levels (< 30 mg/kg) of volatile organic compounds (VOCs). Originally, researchers planned to use field methanol extraction for both pre- and pos...

  12. Near-field study of magneto-optical samples: theoretical comparison of transversal and polar effects

    NASA Astrophysics Data System (ADS)

    Van Labeke, Daniel; Vial, A.; Barchiesi, Dominique

    1996-09-01

    The density of integration of magneto-optical devices is limited by diffraction of light. Recently some groups have proposed to use Near-Field Microscopy to overcome this limitation and some experiments have been performed both in transmission and reflection. In this paper we study theoretically magneto-optical effect in near-field. We consider a magneto-optical sample with details smaller than the wavelength. This sample is modelled as a multilayer rough structure. At least one layer has magneto-optical properties. The corrugation at the interfaces are very small compared to the optical wavelength. We do not consider the writing problem and the experiment is only modelled in the reading mode. Moreover, the magnetic properties are considered in the saturation regime. For this study we use an extension of the method that we used to describe near- field microscope with isotropic sample. The diffracted fields are determined in each layer by using a perturbative version of the Rayleigh method which leads to the resolution of a linear equation for each diffracted wave. The near- field above the sample is thus obtained by summing all the diffracted waves. We consider two geometries for the magnetization: polar effect where the magnetization is perpendicular to the sample and transversal effect where it is in the plane. We compare near-field images obtained in transmission and reflection by changing magnetization orientation. Comparisons with far-field results are also proposed.

  13. Sampling of high amounts of bioaerosols using a high-volume electrostatic field sampler.

    PubMed

    Madsen, A M; Sharma, A K

    2008-04-01

    For studies of the biological effects of bioaerosols, large samples are necessary. To be able to sample enough material and to cover the variations in aerosol content during and between working days, a long sampling time is necessary. Recently, a high-volume transportable electrostatic field sampler for collection of fine particles has been described. The aim of this study was to investigate whether this sampler can be used for collection of high amounts of authentic bioaerosols that can subsequently be used for biological analysis. The investigation was carried out at a biofuel plant in a straw storage room and in a boiler room over two seasons. The sampled dust was quantified in terms of mass and characterized regarding microbial components and compared with dust sampled by Gravikon and GSP samplers. For the electrostatic field sampler, a prefilter was used to remove large objects. The prefilter was characterized for particle penetration and this testing indicated that the prefilter did not remove particles up to 10 mum, and therefore respirable dust was sampled by the electrostatic field sampler. Using the electrostatic field sampler in the straw storage and in the boiler room, 330 and 315 mg dust (net recovery of the lyophilized dust) was sampled during a period of 7 days, respectively. The sampling rates of the electrostatic field samplers were between 1.34 and 1.96 mg dust per hour, the value for the Gravikon was between 0.083 and 0.108 mg dust per hour and the values for the GSP samplers were between 0.0031 and 0.032 mg dust per hour. The standard deviations of replica samplings and the following microbial analysis using the electrostatic field sampler and GSP samplers were at the same levels. The exposure to dust in the straw storage was 7.7 mg m(-3) when measured by the electrostatic field sampler and 11.8 mg m(-3) when measured by the GSP inhalable dust sampler. The quantity (amount per mg dust) of total fungi, Aspergillus fumigatus, total bacteria

  14. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  15. Guidelines for collection and field analysis of ground-water samples for selected unstable constituents

    USGS Publications Warehouse

    Wood, Warren W.

    1976-01-01

    The unstable nature of many chemical and physical constituents in ground water requires special collection procedures and field analysis immediately after collection. This report describes the techniques and equipment commonly used m the collection and field analysis of samples for pH, temperature, carbonate, bicarbonate, specific conductance, Eh, and dissolved oxygen.

  16. The Self Actualized Reader.

    ERIC Educational Resources Information Center

    Marino, Michael; Moylan, Mary Elizabeth

    A study examined the commonalities that "voracious" readers share, and how their experiences can guide parents, teachers, and librarians in assisting children to become self-actualized readers. Subjects, 25 adults ranging in age from 20 to 67 years, completed a questionnaire concerning their reading histories and habits. Respondents varied in…

  17. A field sampling strategy for semivariogram inference of fractures in rock outcrops

    SciTech Connect

    Ryan M. Pollyea; Jerry P. Fairley; Robert K. Podgorney; Travis L. Mcling

    2013-10-01

    The stochastic continuum (SC) representation is one common approach for simulating the effects of fracture heterogeneity in groundwater flow and transport models. These SC reservoir models are generally developed using geostatistical methods (e.g., kriging or sequential simulation) that rely on the model semivariogram to describe the spatial variability of each continuum. Although a number of strategies for sampling spatial distributions have been published in the literature, little attention has been paid to the optimization of sampling in resource- or access-limited environments. Here we present a strategy for estimating the minimum sample spacing needed to define the spatial distribution of fractures on a vertical outcrop of basalt, located in the Box Canyon, east Snake River Plain, Idaho. We used fracture maps of similar basalts from the published literature to test experimentally the effects of different sample spacings on the resulting semivariogram model. Our final field sampling strategy was based on the lowest sample density that reproduced the semivariogram of the exhaustively sampled fracture map. Application of the derived sampling strategy to an outcrop in our field area gave excellent results, and illustrates the utility of this type of sample optimization. The method will work for developing a sampling plan for any intensive property, provided prior information for a similar domain is available; for example, fracture maps or ortho-rectified photographs from analogous rock types could be used to plan for sampling of a fractured rock outcrop.

  18. Identifying sampling locations for field-scale soil moisture estimation using K-means clustering

    NASA Astrophysics Data System (ADS)

    Van Arkel, Zach; Kaleita, Amy L.

    2014-08-01

    Identifying and understanding the impact of field-scale soil moisture patterns is currently limited by the time and resources required to do sufficient monitoring. This study uses K-means clustering to find critical sampling points to estimate field-scale near-surface soil moisture. Points within the field are clustered based upon topographic and soils data and the points representing the center of those clusters are identified as the critical sampling points. Soil moisture observations at 42 sites across the growing seasons of 4 years were collected several times per week. Using soil moisture observations at the critical sampling points and the number of points within each cluster, a weighted average is found and used as the estimated mean field-scale soil moisture. Field-scale soil moisture estimations from this method are compared to the rank stability approach (RSA) to find optimal sampling locations based upon temporal soil moisture data. The clustering approach on soil and topography data resulted in field-scale average moisture estimates that were as good or better than RSA, but without the need for exhaustive presampling of soil moisture. Using an electromagnetic inductance map as a proxy for soils data significantly improved the estimates over those obtained based on topography alone.

  19. A simple and novel method for retrieval of Pasteurellaceae from swab samples collected in the field.

    PubMed

    Hansen, Mie J; Bertelsen, Mads F; Dietz, Rune; Sonne, Christian; Bojesen, Anders M

    2013-10-01

    Traditionally it has been difficult or impossible to collect and preserve bacterial samples of especially fastidious bacteria in mixed primary cultures, unless the samples could be transported to a laboratory within approximately 24 h. Therefore, a simple novel method for preserving swab samples until bacterial isolation can be completed in the laboratory was developed and evaluated. Pasteurellaceae bacteria were used as a representative for fastidious bacteria. A 7.5% glucose serum medium was used as freeze medium. Swab samples were soaked in the medium a maximum of 2 h after collection and stored at -20°C. As a control study, 15 samples were collected from the oral cavity of a captive brown bear. One was immediately plated, while the remaining 12 swabs were stored at -20°C for 7 days and multiples of 30 days up to 330 days prior to plating. Two samples were stored without the medium for 7 and 30 days prior to plating. From a field setting in Greenland, eight polar bear samples were collected and subsequently stored for 240 to 259 days at -20°C before incubation. Pasteurellaceae bacteria were isolated and genotyped from all samples stored in the freeze medium, indicating that the medium enabled the bacteria to survive for at least 330 days at -20°C. The 100% recovery of target organisms in the polar bear samples even following lengthy storage and transport demonstrates that the method is very useful under remote field conditions. PMID:23897719

  20. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  1. Problems with sampling desert tortoises: A simulation analysis based on field data

    USGS Publications Warehouse

    Freilich, J.E.; Camp, R.J.; Duda, J.J.; Karl, A.E.

    2005-01-01

    The desert tortoise (Gopherus agassizii) was listed as a U.S. threatened species in 1990 based largely on population declines inferred from mark-recapture surveys of 2.59-km2 (1-mi2) plots. Since then, several census methods have been proposed and tested, but all methods still pose logistical or statistical difficulties. We conducted computer simulations using actual tortoise location data from 2 1-mi2 plot surveys in southern California, USA, to identify strengths and weaknesses of current sampling strategies. We considered tortoise population estimates based on these plots as "truth" and then tested various sampling methods based on sampling smaller plots or transect lines passing through the mile squares. Data were analyzed using Schnabel's mark-recapture estimate and program CAPTURE. Experimental subsampling with replacement of the 1-mi2 data using 1-km2 and 0.25-km2 plot boundaries produced data sets of smaller plot sizes, which we compared to estimates from the 1-mi 2 plots. We also tested distance sampling by saturating a 1-mi 2 site with computer simulated transect lines, once again evaluating bias in density estimates. Subsampling estimates from 1-km2 plots did not differ significantly from the estimates derived at 1-mi2. The 0.25-km2 subsamples significantly overestimated population sizes, chiefly because too few recaptures were made. Distance sampling simulations were biased 80% of the time and had high coefficient of variation to density ratios. Furthermore, a prospective power analysis suggested limited ability to detect population declines as high as 50%. We concluded that poor performance and bias of both sampling procedures was driven by insufficient sample size, suggesting that all efforts must be directed to increasing numbers found in order to produce reliable results. Our results suggest that present methods may not be capable of accurately estimating desert tortoise populations.

  2. NHEXAS PHASE I MARYLAND STUDY--STANDARD OPERATING PROCEDURE FOR FIELD SAMPLING--GENERAL INFORMATION (F01)

    EPA Science Inventory

    The purpose of this SOP is to provide an overview of field sampling procedures. This SOP details the samples taken, the responsibilities of the field staff, an approximate schedule for field operations, persons responsible for analyses, equipment used for sampling, and contents ...

  3. Backflushing Filters for Field Processing of Water Samples Prior to Trace-Element Analyses

    USGS Publications Warehouse

    Kennedy, V.C.; Jenne, E.A.; Burchard, J.M.

    1976-01-01

    A portable unit is described for filtering water samples at field sites in such a manner that the filtrate is suitable for analysis not only of major constituents but also of trace elments at the mocrogram-per-liter level. A battery-operated peristaltic pump forces the water sample through medical-grade silicone tubing into and through an all-plastic in-line filter which can be backflushed when sediment clogs the filter membrane. Initial filtration rate exceeds 500 milliliter/minute and, because of the backflushing feature, a total time for filtering high-sediment-bearing waster samples is greatly reduced. (Woodard-USGS)

  4. Modification and Application of a Leaf Blower-vac for Field Sampling of Arthropods.

    PubMed

    Zou, Yi; van Telgen, Mario D; Chen, Junhui; Xiao, Haijun; de Kraker, Joop; Bianchi, Felix J J A; van der Werf, Wopke

    2016-01-01

    Rice fields host a large diversity of arthropods, but investigating their population dynamics and interactions is challenging. Here we describe the modification and application of a leaf blower-vac for suction sampling of arthropod populations in rice. When used in combination with an enclosure, application of this sampling device provides absolute estimates of the populations of arthropods as numbers per standardized sampling area. The sampling efficiency depends critically on the sampling duration. In a mature rice crop, a two-minute sampling in an enclosure of 0.13 m(2) yields more than 90% of the arthropod population. The device also allows sampling of arthropods dwelling on the water surface or the soil in rice paddies, but it is not suitable for sampling fast flying insects, such as predatory Odonata or larger hymenopterous parasitoids. The modified blower-vac is simple to construct, and cheaper and easier to handle than traditional suction sampling devices, such as D-vac. The low cost makes the modified blower-vac also accessible to researchers in developing countries. PMID:27584040

  5. Laboratory spectra of field samples as a check on two atmospheric correction methods

    NASA Technical Reports Server (NTRS)

    Xu, Pung; Greeley, Ronald

    1993-01-01

    Atmospheric correction is the first step toward quantitative analysis of imaging spectroscopy data. Two methods, MODTRAN model and the empirical line, were used to convert AVIRIS radiance values to reflectance values. A set of laboratory spectra of field samples corresponding to AVIRIS coverage was used to assess these methods. This will also serve to select bands for future quantative analyses.

  6. Using object-based image analysis to guide the selection of field sample locations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the most challenging tasks for resource management and research is designing field sampling schemes to achieve unbiased estimates of ecosystem parameters as efficiently as possible. This study focused on the potential of fine-scale image objects from object-based image analysis (OBIA) to be u...

  7. LABORATORY AND FIELD EVALUATION OF THE SEMI-VOST (SEMI-VOLATILE ORGANIC SAMPLING TRAIN) METHOD

    EPA Science Inventory

    Laboratory studies and a second field evaluation have been completed to assess the performance of the Semi-Volatile Organic Sampling Train (Semi-VOST) method for measuring concentrations of principal organic hazardous constituents (POHCs) with boiling points greater than 100 deg ...

  8. Sampling and Reconstruction of the Pupil and Electric Field for Phase Retrieval

    NASA Technical Reports Server (NTRS)

    Dean, Bruce; Smith, Jeffrey; Aronstein, David

    2012-01-01

    This technology is based on sampling considerations for a band-limited function, which has application to optical estimation generally, and to phase retrieval specifically. The analysis begins with the observation that the Fourier transform of an optical aperture function (pupil) can be implemented with minimal aliasing for Q values down to Q = 1. The sampling ratio, Q, is defined as the ratio of the sampling frequency to the band-limited cut-off frequency. The analytical results are given using a 1-d aperture function, and with the electric field defined by the band-limited sinc(x) function. Perfect reconstruction of the Fourier transform (electric field) is derived using the Whittaker-Shannon sampling theorem for 1sampling ratio such that 1field with no aliasing, which has been extended to 2-d optical apertures.

  9. Field spectroscopy sampling strategies for improved measurement of Earth surface reflectance

    NASA Astrophysics Data System (ADS)

    Mac Arthur, A.; Alonso, L.; Malthus, T. J.; Moreno, J. F.

    2013-12-01

    Over the last two decades extensive networks of research sites have been established to measure the flux of carbon compounds and water vapour between the Earth's surface and the atmosphere using eddy covariance (EC) techniques. However, contributing Earth surface components cannot be determined and (as the ';footprints' are spatially constrained) these measurements cannot be extrapolated to regional cover using this technique. At many of these EC sites researchers have been integrating spectral measurements with EC and ancillary data to better understand light use efficiency and carbon dioxide flux. These spectroscopic measurements could also be used to assess contributing components and provide support for imaging spectroscopy, from airborne or satellite platforms, which can provide unconstrained spatial cover. Furthermore, there is an increasing interest in ';smart' database and information retrieval systems such as that proposed by EcoSIS and OPTIMISE to store, analyse, QA and merge spectral and biophysical measurements and provide information to end users. However, as Earth surfaces are spectrally heterogeneous and imaging and field spectrometers sample different spatial extents appropriate field sampling strategies require to be adopted. To sample Earth surfaces spectroscopists adopt either single; random; regular grid; transect; or 'swiping' point sampling strategies, although little comparative work has been carried out to determine the most appropriate approach; the work by Goetz (2012) is a limited exception. Mac Arthur et al (2012) demonstrated that, for two full wavelength (400 nm to 2,500 nm) field spectroradiometers, the measurement area sampled is defined by each spectroradiometer/fore optic system's directional response function (DRF) rather than the field-of-view (FOV) specified by instrument manufacturers. Mac Arthur et al (2012) also demonstrated that each reflecting element within the sampled area was not weighted equally in the integrated

  10. Information Content of the Near-Field I: Two-Dimensional Samples

    NASA Technical Reports Server (NTRS)

    Frazin, Richard A.; Fischer, David G.; Carney, P. Scott

    2004-01-01

    Limits on the effective resolution of many optical near-field experiments are investigated. The results are applicable to variants of total-internal-reflection microscopy (TIRM), photon-scanning-tunneling microscopy (PSTM), and near-field-scanning-optical microscopy (NSOM) in which the sample is weakly scattering and the direction of illumination may be controlled. Analytical expressions for the variance of the estimate of the complex susceptibility of an unknown two-dimensional object as a function of spatial frequency are obtained for Gaussian and Poisson noise models, and a model-independent measure is examined. The results are used to explore the transition from near-zone to far-zone detection. It is demonstrated that the information content of the measurements made at a distance of even one wavelength away from the sample is already not much different from the information content of the far field. Copyright 2004 Optical Society of America

  11. Proposal for field sampling of plants and processing in the lab for environmental metabolic fingerprinting

    PubMed Central

    2010-01-01

    Background Samples for plant metabolic fingerprinting are prepared generally by metabolism quenching, grinding of plant material and extraction of metabolites in solvents. Further concentration and derivatisation steps follow in dependence of the sample nature and the available analytical platform. For plant material sampled in the field, several methods are not applicable, such as, e.g., collection in liquid nitrogen. Therefore, a protocol was established for sample pre-treatment, grinding, extraction and storage, which can be used for analysis of field-collected plant material, which is further processed in the laboratory. Ribwort plantain (Plantago lanceolata L., Plantaginaceae) was used as model plant. The quality criteria for method suitability were high reproducibility, extraction efficiency and handling comfort of each subsequent processing step. Results Highest reproducibility of results was achieved by sampling fresh plant material in a solvent mixture of methanol:dichloromethane (2:1), crushing the tissue with a hand-held disperser and storing the material until further processing. In the laboratory the material was extracted threefold at different pH. The gained extracts were separated with water (2:1:1 methanol:dichloromethane:water) and the aqueous phases used for analysis by LC-MS, because the polar metabolites were in focus. Chromatograms were compared by calculating a value Ξ for similarities. Advantages and disadvantages of different sample pre-treatment methods, use of solvents and solvent mixtures, influence of pH, extraction frequency and duration, and storing temperature are discussed with regard to the quality criteria. Conclusions The proposed extraction protocol leads to highly reproducible metabolic fingerprints and allows optimal handling of field-collected plant material and further processing in the laboratory, which is demonstrated for an exemplary field data-set. Calculation of Ξ values is a useful tool to judge similarities between

  12. Oxidation efficiencies of nitrite to nitrate by freezing of field rain samples

    SciTech Connect

    Takenaka, Norimichi; Daimon, Tohru; Sato, Keiichi

    1996-12-31

    Nitrite is known to be oxidized to nitrate by freezing much more rapidly than in solution. Furthermore, the oxidation efficiency of nitrite to nitrate by freezing is varied by pH or kinds and concentration of coexistences. We report here the oxidation efficiencies of nitrite to nitrate by freezing of field rain samples. The field rain samples were collected at Mt. Ikoma, which is located at about 20 km east of Osaka city, and Osaka Prefecture University. Concentration of nitrite was usually sub to a few {mu}mol/L order in rain and {mu}mol/L order in fog and less than 1 {mu}mol/L in snow. The highest value of nitrite concentration was 43 {mu}mol/L in rain and 620 {mu}mol/L in fog. Nitrite was oxidized immediately to nitrate by freezing at pH lower than 5.2, even when the sample droplet (about 1 mm diameter) was frozen very quickly in liquid nitrogen (77K). The oxidation efficiency was higher at lower pH. However, the efficiency varied from sample to sample. This is probably due to that kinds and concentration of coexistences were difference between samples. The effect of solutes will be also reported. Freezing of rain droplets are observed in freezing of super cooled droplets, growing of graupel and hail, growing of cumulonimbus, and so on. Ratio of nitrate to nitrite was higher in snow than that in rain or fog.

  13. Field determination of trace iron in fresh water samples by visual and spectrophotometric methods.

    PubMed

    Kawakubo, Susumu; Naito, Ayako; Fujihara, Asuka; Iwatsuki, Masaki

    2004-08-01

    Sensitive visual and micro spectrophotometric methods have been developed for field determination of trace iron in fresh water samples. For the visual method, a water sample (0.45-microm filtrate acidified to 0.1 M HCl) was placed in a glass vial and mixed with a reagent solution containing 1,10-phenanthroline, sodium thiocyanate and 0.1 M HCl. Iron was extracted as pink ferroin thiocyanate with 1 ml of 4-methy-2-pentanone. The sample up to 20 ml was added step-by-step, until the color of the extract was detected visually. Without any special instrument or color standard, iron down to 0.001 mg 1(-1) (0.025 microg) in a sample can be determined with an error of 20% in the field. For the micro spectrophotometric method, the extract for 20 ml of sample was separated by capillary suction in a column (micro pipette chip) with acrylic fibers. A part of the extract was pushed out into a micro cell for the absorbance measurement at 525 nm. The column was re-usable after washing with ethanol. This method had a detection limit of 0.001 mg 1(-1) and allowed determinations within an error of 5%. The proposed methods were applied to deionized-, tap-, river-, lake- and reservoir-water samples. PMID:15352504

  14. Field portable low temperature porous layer open tubular cryoadsorption headspace sampling and analysis part I: Instrumentation.

    PubMed

    Bruno, Thomas J

    2016-01-15

    Building on the successful application in the laboratory of PLOT-cryoadsorption as a means of collecting vapor (or headspace) samples for chromatographic analysis, in this paper a field portable apparatus is introduced. This device fits inside of a briefcase (aluminum tool carrier), and can be easily transported by vehicle or by air. The portable apparatus functions entirely on compressed air, making it suitable for use in locations lacking electrical power, and for use in flammable and explosive environments. The apparatus consists of four aspects: a field capable PLOT-capillary platform, the supporting equipment platform, the service interface between the PLOT-capillary and the supporting equipment, and the necessary peripherals. Vapor sampling can be done with either a hand piece (containing the PLOT capillary) or with a custom fabricated standoff module. Both the hand piece and the standoff module can be heated and cooled to facilitate vapor collection and subsequent vapor sample removal. The service interface between the support platform and the sampling units makes use of a unique counter current approach that minimizes loss of cooling and heating due to heat transfer with the surroundings (recuperative thermostatting). Several types of PLOT-capillary elements and sampling probes are described in this report. Applications to a variety of samples relevant to forensic and environmental analysis are discussed in a companion paper. PMID:26687166

  15. Recent developments on field gas extraction and sample preparation methods for radiokrypton dating of groundwater

    NASA Astrophysics Data System (ADS)

    Yokochi, Reika

    2016-09-01

    Current and foreseen population growths will lead to an increased demand in freshwater, large quantities of which is stored as groundwater. The ventilation age is crucial to the assessment of groundwater resources, complementing the hydrological model approach based on hydrogeological parameters. Ultra-trace radioactive isotopes of Kr (81 Kr and 85 Kr) possess the ideal physical and chemical properties for groundwater dating. The recent advent of atom trap trace analyses (ATTA) has enabled determination of ultra-trace noble gas radioisotope abundances using 5-10 μ L of pure Kr. Anticipated developments will enable ATTA to analyze radiokrypton isotope abundances at high sample throughput, which necessitates simple and efficient sample preparation techniques that are adaptable to various sample chemistries. Recent developments of field gas extraction devices and simple and rapid Kr separation method at the University of Chicago are presented herein. Two field gas extraction devices optimized for different sampling conditions were recently designed and constructed, aiming at operational simplicity and portability. A newly developed Kr purification system enriches Kr by flowing a sample gas through a moderately cooled (138 K) activated charcoal column, followed by a gentle fractionating desorption. This simple process uses a single adsorbent and separates 99% of the bulk atmospheric gases from Kr without significant loss. The subsequent two stages of gas chromatographic separation and a hot Ti sponge getter further purify the Kr-enriched gas. Abundant CH4 necessitates multiple passages through one of the gas chromatographic separation columns. The presented Kr separation system has a demonstrated capability of extracting Kr with > 90% yield and 99% purity within 75 min from 1.2 to 26.8 L STP of atmospheric air with various concentrations of CH4. The apparatuses have successfully been deployed for sampling in the field and purification of groundwater samples.

  16. A field-based cleaning protocol for sampling devices used in life-detection studies.

    PubMed

    Eigenbrode, Jennifer; Benning, Liane G; Maule, Jake; Wainwright, Norm; Steele, Andrew; Amundsen, Hans E F

    2009-06-01

    Analytical approaches to extant and extinct life detection involve molecular detection often at trace levels. Thus, removal of biological materials and other organic molecules from the surfaces of devices used for sampling is essential for ascertaining meaningful results. Organic decontamination to levels consistent with null values on life-detection instruments is particularly challenging at remote field locations where Mars analog field investigations are carried out. Here, we present a seven-step, multi-reagent decontamination method that can be applied to sampling devices while in the field. In situ lipopolysaccharide detection via low-level endotoxin assays and molecular detection via gas chromatography-mass spectrometry were used to test the effectiveness of the decontamination protocol for sampling of glacial ice with a coring device and for sampling of sediments with a rover scoop during deployment at Arctic Mars-analog sites in Svalbard, Norway. Our results indicate that the protocols and detection technique sufficiently remove and detect low levels of molecular constituents necessary for life-detection tests. PMID:19496672

  17. An Evaluation of Plotless Sampling Using Vegetation Simulations and Field Data from a Mangrove Forest

    PubMed Central

    Hijbeek, Renske; Koedam, Nico; Khan, Md Nabiul Islam; Kairo, James Gitundu; Schoukens, Johan; Dahdouh-Guebas, Farid

    2013-01-01

    In vegetation science and forest management, tree density is often used as a variable. To determine the value of this variable, reliable field methods are necessary. When vegetation is sparse or not easily accessible, the use of sample plots is not feasible in the field. Therefore, plotless methods, like the Point Centred Quarter Method, are often used as an alternative. In this study we investigate the accuracy of different plotless sampling methods. To this end, tree densities of a mangrove forest were determined and compared with estimates provided by several plotless methods. None of these methods proved accurate across all field sites with mean underestimations up to 97% and mean overestimations up to 53% in the field. Applying the methods to different vegetation patterns shows that when random spatial distributions were used the true density was included within the 95% confidence limits of all the plotless methods tested. It was also found that, besides aggregation and regularity, density trends often found in mangroves contribute to the unreliability. This outcome raises questions about the use of plotless sampling in forest monitoring and management, as well as for estimates of density-based carbon sequestration. We give recommendations to minimize errors in vegetation surveys and recommendations for further in-depth research. PMID:23826233

  18. CALIFA: a diameter-selected sample for an integral field spectroscopy galaxy survey

    NASA Astrophysics Data System (ADS)

    Walcher, C. J.; Wisotzki, L.; Bekeraité, S.; Husemann, B.; Iglesias-Páramo, J.; Backsmann, N.; Barrera Ballesteros, J.; Catalán-Torrecilla, C.; Cortijo, C.; del Olmo, A.; Garcia Lorenzo, B.; Falcón-Barroso, J.; Jilkova, L.; Kalinova, V.; Mast, D.; Marino, R. A.; Méndez-Abreu, J.; Pasquali, A.; Sánchez, S. F.; Trager, S.; Zibetti, S.; Aguerri, J. A. L.; Alves, J.; Bland-Hawthorn, J.; Boselli, A.; Castillo Morales, A.; Cid Fernandes, R.; Flores, H.; Galbany, L.; Gallazzi, A.; García-Benito, R.; Gil de Paz, A.; González-Delgado, R. M.; Jahnke, K.; Jungwiert, B.; Kehrig, C.; Lyubenova, M.; Márquez Perez, I.; Masegosa, J.; Monreal Ibero, A.; Pérez, E.; Quirrenbach, A.; Rosales-Ortega, F. F.; Roth, M. M.; Sanchez-Blazquez, P.; Spekkens, K.; Tundo, E.; van de Ven, G.; Verheijen, M. A. W.; Vilchez, J. V.; Ziegler, B.

    2014-09-01

    We describe and discuss the selection procedure and statistical properties of the galaxy sample used by the Calar Alto Legacy Integral Field Area (CALIFA) survey, a public legacy survey of 600 galaxies using integral field spectroscopy. The CALIFA "mother sample" was selected from the Sloan Digital Sky Survey (SDSS) DR7 photometric catalogue to include all galaxies with an r-band isophotal major axis between 45'' and 79.2'' and with a redshift 0.005 < z < 0.03. The mother sample contains 939 objects, 600 of which will be observed in the course of the CALIFA survey. The selection of targets for observations is based solely on visibility and thus keeps the statistical properties of the mother sample. By comparison with a large set of SDSS galaxies, we find that the CALIFA sample is representative of galaxies over a luminosity range of -19 > Mr > -23.1 and over a stellar mass range between 109.7 and 1011.4 M⊙. In particular, within these ranges, the diameter selection does not lead to any significant bias against - or in favour of - intrinsically large or small galaxies. Only below luminosities of Mr = -19 (or stellar masses <109.7 M⊙) is there a prevalence of galaxies with larger isophotal sizes, especially of nearly edge-on late-type galaxies, but such galaxies form <10% of the full sample. We estimate volume-corrected distribution functions in luminosities and sizes and show that these are statistically fully compatible with estimates from the full SDSS when accounting for large-scale structure. For full characterization of the sample, we also present a number of value-added quantities determined for the galaxies in the CALIFA sample. These include consistent multi-band photometry based on growth curve analyses; stellar masses; distances and quantities derived from these; morphological classifications; and an overview of available multi-wavelength photometric measurements. We also explore different ways of characterizing the environments of CALIFA galaxies

  19. Field sampling method for quantifying volatile sulfur compounds from animal feeding operations

    NASA Astrophysics Data System (ADS)

    Trabue, Steven; Scoggin, Kenwood; Mitloehner, Frank; Li, Hong; Burns, Robert; Xin, Hongwei

    Volatile sulfur compounds (VSCs) are a major class of chemicals associated with odor from animal feeding operations (AFOs). Identifying and quantifying VSCs in air is challenging due to their volatility, reactivity, and low concentrations. In the present study, a canister-based method collected whole air in fused silica-lined (FSL) mini-canister (1.4 L) following passage through a calcium chloride drying tube. Sampled air from the canisters was removed (10-600 mL), dried, pre-concentrated, and cryofocused into a GC system with parallel detectors (mass spectrometer (MS) and pulsed flame photometric detector (PFPD)). The column effluent was split 20:1 between the MS and PFPD. The PFPD equimolar sulfur response enhanced quantitation and the location of sulfur peaks for mass spectral identity and quantitation. Limit of quantitation for the PFPD and MSD was set at the least sensitive VSC (hydrogen sulfide) and determined to be 177 and 28 pg S, respectively, or 0.300 and 0.048 μg m -3 air, respectively. Storage stability of hydrogen sulfide and methanethiol was problematic in warm humid air (25 °C, 96% relative humidity (RH)) without being dried first, however, stability in canisters dried was still only 65% after 24 h of storage. Storage stability of hydrogen sulfide sampled in the field at a swine facility was over 2 days. The greater stability of field samples compared to laboratory samples was due to the lower temperature and RH of field samples compared to laboratory generated samples. Hydrogen sulfide was the dominant odorous VSCs detected at all swine facilities with methanethiol and dimethyl sulfide detected notably above their odor threshold values. The main odorous VSC detected in aged poultry litter was dimethyl trisulfide. Other VSCs above odor threshold values for poultry facilities were methanethiol and dimethyl sulfide.

  20. Field portable mobile phone based fluorescence microscopy for detection of Giardia lamblia cysts in water samples

    NASA Astrophysics Data System (ADS)

    Ceylan Koydemir, Hatice; Gorocs, Zoltan; McLeod, Euan; Tseng, Derek; Ozcan, Aydogan

    2015-03-01

    Giardia lamblia is a waterborne parasite that causes an intestinal infection, known as giardiasis, and it is found not only in countries with inadequate sanitation and unsafe water but also streams and lakes of developed countries. Simple, sensitive, and rapid detection of this pathogen is important for monitoring of drinking water. Here we present a cost-effective and field portable mobile-phone based fluorescence microscopy platform designed for automated detection of Giardia lamblia cysts in large volume water samples (i.e., 10 ml) to be used in low-resource field settings. This fluorescence microscope is integrated with a disposable water-sampling cassette, which is based on a flow-through porous polycarbonate membrane and provides a wide surface area for fluorescence imaging and enumeration of the captured Giardia cysts on the membrane. Water sample of interest, containing fluorescently labeled Giardia cysts, is introduced into the absorbent pads that are in contact with the membrane in the cassette by capillary action, which eliminates the need for electrically driven flow for sample processing. Our fluorescence microscope weighs ~170 grams in total and has all the components of a regular microscope, capable of detecting individual fluorescently labeled cysts under light-emitting-diode (LED) based excitation. Including all the sample preparation, labeling and imaging steps, the entire measurement takes less than one hour for a sample volume of 10 ml. This mobile phone based compact and cost-effective fluorescent imaging platform together with its machine learning based cyst counting interface is easy to use and can even work in resource limited and field settings for spatio-temporal monitoring of water quality.

  1. Field Investigation Plan for 1301-N and 1325-N FacilitiesSampling to Support Remedial Design

    SciTech Connect

    S. G. Weiss.

    1998-12-04

    This field investigation plan (FIP) provides for the sampling and analysis activities supporting the remedial design planning for the planned removal action for the 1301-N and 1325-N Liquid Waste Disposal Facilities (LWDFs), which are treatment, storage,and disposal (TSD) units (cribs/trenches). The planned removalaction involves excavation, transportation, and disposal of contaminated material at the Environmental Restoration Disposal Facility (ERDF).An engineering study (BHI 1997) was performed to develop and evaluate various options that are predominately influenced by the volume of high- and low-activity contaminated soil requiring removal. The study recommended that additional sampling be performed to supplement historical data for use in the remedial design.

  2. A new method of geobiological sample storage by snap freezing under alternating magnetic field

    NASA Astrophysics Data System (ADS)

    Morono, Y.; Terada, T.; Yamamoto, Y.; Hirose, T.; Xiao, N.; Sugeno, M.; Ohwada, N.; Inagaki, F.

    2012-12-01

    Scientific ocean drilling provides unprecedented opportunities to study the deep subseafloor biosphere. Especially, subseafloor living life and its genomes are significant components, since the activity may play some roles in global biogeochemical cycling of carbon, nitrogen, sulfur, metals, and other elements over geologic times. Given the significance of deep biological components as well as the potential application of future analytical technologies to the core, the material (or portions thereof) should be preserved in the best appropriate manner for long-term storage. Here we report a novel technology to freeze the cored sample with the least damage on scientifically important multiple characteristics including microbial cells. In the conventional freezer, expanding volume of pore space by the formation of ice crystals may change the (micro-) structure in the core sample (e.g., cell, micro-fossils). The cell alive system (CAS) is the new super-quick freezing system that applies alternating magnetic field for vibrating water molecules in the samples: i.e., the vibration leads to the stable super-cooled condition of the liquid-phase water at around -7 to -10 degree-C, keeping the liquid at the low temperature uniformly. Following further decrease of temperature enables the snap and hence uniform freezing of the samples with minimal size of the ice crystal formation, resulting in the minimum damage on structurally fragile components such as microbial cells and its DNA. We tested the CAS freezing technique for sediment core samples obtained by the Chikyu training cruise 905 and others. The core samples from various depths were sub-sampled, and immediately frozen in the CAS system along with the standard freezing method under the temperature of -20, -80, and -196 (liquid nitrogen) degree-C. Microbial cell abundance showed that the normal freezing decreased the number of microbial cells, whereas the CAS freezing resulted in almost no loss of the cells. We also tested

  3. Validation of in Situ Networks Via Field Sampling: Case Study in the South Fork Experimental Watershed

    NASA Astrophysics Data System (ADS)

    Cosh, M. H.; McKee, L.; Bindlish, R.; Coopersmith, E. J.; Jackson, T. J.; Prueger, J. H.

    2014-12-01

    The calibration and validation of soil moisture remote sensing products is complicated by the logistics of installing a soil moisture network for a long term period in an active landscape. Therefore, these stations are located along field boundaries or in non-representative sites with regards to soil type or soil moisture. The representative character of this network can only be established by large scale field sampling to provide a calibration dataset. A team of samplers were deployed twice a week for the summer of 2014 to collect surface soil moisture data across a variety of land covers at 44 sites. These samples were compared and scaled to the domain to get a better understanding of the large scale soil moisture distributions and dynamics. In addition, comparisons are made to the Soil Moisture Ocean Salinity (SMOS) soil moisture product for the length of the network installation.

  4. Use of percolation theory and Latin hypercube sampling in field-scale solute transport investigations

    SciTech Connect

    Luxmoore, R.J.; Jardine, P.M.; Gardner, R.H. ); Wilson, G.V. . Dept. of Plant and Soil Science)

    1990-01-01

    Investigations of rain-fed solute transport have been conducted at a forested hillslope site by using an in situ soil pedon and a subsurface hydrologic monitoring facility. Complementary solute transport studies on undisturbed soil columns taken from the field site have not provided data that can be directly applied to the field situation. Scaling up from columns to pedons and from pedons to hillslopes is being evaluated with percolation theory and Latin hypercube sampling methods. Percolation theory provides a means of identifying mobile zones and stagnant zones for given soil structural attributes which can be compared with column dye tracing results. The generation of frequency distributions of backwater and backbone porosities for a range of total soil porosities and pore arrangements may provide a stochastic representation of soil systems suitable for scaling up from the column scale to the pedon using the Latin hypercube sampling method. 9 refs.

  5. Realistic sampling of amino acid geometries for a multipolar polarizable force field

    PubMed Central

    Hughes, Timothy J.; Cardamone, Salvatore

    2015-01-01

    The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X‐ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF. © 2015 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:26235784

  6. Aqueous dissolution of laboratory and field samples from the in-situ vitrification process

    SciTech Connect

    McGrail, B.P. ); Bates, S.O. )

    1991-08-01

    In-situ vitrification (ISV) is being evaluated in several countries as a remediation technology for immobilizing both hazardous and radioactive buried wastes. A combination of laboratory data and modeling results are presented that establishes the scientific basis for predicting the long-term stability of an ISV glass in the environment. Laboratory experiments included tests with ISV samples obtained from pilot- and intermediate-scale field tests, a nuclear waste glass, and a natural obsidian. 8 refs.

  7. Vertical sampling flights in support of the 1981 ASCOT cooling tower experiments: field effort and data

    SciTech Connect

    Gay, G.T.

    1982-03-01

    During the month of August 1981, three nights of experimental sampling of tracers released into the cooling tower plume of a geothermal power plant were conducted. In these experiments a tethered balloon was used to lift a payload so as to obtain vertical profiles of the cooling tower plume and the entrained tracers. A description of the equipment used, the field effort and the data acquired are presented here.

  8. Search for life on Mars in surface samples: Lessons from the 1999 Marsokhod rover field experiment

    USGS Publications Warehouse

    Newsom, Horton E.; Bishop, J.L.; Cockell, C.; Roush, T.L.; Johnson, J. R.

    2001-01-01

    The Marsokhod 1999 field experiment in the Mojave Desert included a simulation of a rover-based sample selection mission. As part of this mission, a test was made of strategies and analytical techniques for identifying past or present life in environments expected to be present on Mars. A combination of visual clues from high-resolution images and the detection of an important biomolecule (chlorophyll) with visible/near-infrared (NIR) spectroscopy led to the successful identification of a rock with evidence of cryptoendolithic organisms. The sample was identified in high-resolution images (3 times the resolution of the Imager for Mars Pathfinder camera) on the basis of a green tinge and textural information suggesting the presence of a thin, partially missing exfoliating layer revealing the organisms. The presence of chlorophyll bands in similar samples was observed in visible/NIR spectra of samples in the field and later confirmed in the laboratory using the same spectrometer. Raman spectroscopy in the laboratory, simulating a remote measurement technique, also detected evidence of carotenoids in samples from the same area. Laboratory analysis confirmed that the subsurface layer of the rock is inhabited by a community of coccoid Chroococcidioposis cyanobacteria. The identification of minerals in the field, including carbonates and serpentine, that are associated with aqueous processes was also demonstrated using the visible/NIR spectrometer. Other lessons learned that are applicable to future rover missions include the benefits of web-based programs for target selection and for daily mission planning and the need for involvement of the science team in optimizing image compression schemes based on the retention of visual signature characteristics. Copyright 2000 by the American Geophysical Union.

  9. Search for life on Mars in surface samples: Lessons from the 1999 Marsokhod rover field experiment

    NASA Astrophysics Data System (ADS)

    Newsom, H. E.; Bishop, Janice L.; Cockell, Charles; Roush, Ted L.; Johnson, Jeffrey R.

    2001-04-01

    The Marsokhod 1999 field experiment in the Mojave Desert included a simulation of a rover-based sample selection mission. As part of this mission, a test was made of strategies and analytical techniques for identifying past or present life in environments expected to be present on Mars. A combination of visual clues from high-resolution images and the detection of an important biomolecule (chlorophyll) with visible/near-infrared (NIR) spectroscopy led to the successful identification of a rock with evidence of cryptoendolithic organisms. The sample was identified in high-resolution images (3 times the resolution of the Imager for Mars Pathfinder camera) on the basis of a green tinge and textural information suggesting the presence of a thin, partially missing exfoliating layer revealing the organisms. The presence of chlorophyll bands in similar samples was observed in visible/NIR spectra of samples in the field and later confirmed in the laboratory using the same spectrometer. Raman spectroscopy in the laboratory, simulating a remote measurement technique, also detected evidence of carotenoids in samples from the same area. Laboratory analysis confirmed that the subsurface layer of the rock is inhabited by a community of coccoid Chroococcidioposis cyanobacteria. The identification of minerals in the field, including carbonates and serpentine, that are associated with aqueous processes was also demonstrated using the visible/NIR spectrometer. Other lessons learned that are applicable to future rover missions include the benefits of web-based programs for target selection and for daily mission planning and the need for involvement of the science team in optimizing image compression schemes based on the retention of visual signature characteristics.

  10. A simplified protocol for molecular identification of Eimeria species in field samples.

    PubMed

    Haug, Anita; Thebo, Per; Mattsson, Jens G

    2007-05-15

    This study aimed to find a fast, sensitive and efficient protocol for molecular identification of chicken Eimeria spp. in field samples. Various methods for each of the three steps of the protocol were evaluated: oocyst wall rupturing methods, DNA extraction methods, and identification of species-specific DNA sequences by PCR. We then compared and evaluated five complete protocols. Three series of oocyst suspensions of known number of oocysts from Eimeria mitis, Eimeria praecox, Eimeria maxima and Eimeria tenella were prepared and ground using glass beads or mini-pestle. DNA was extracted from ruptured oocysts using commercial systems (GeneReleaser, Qiagen Stoolkit and Prepman) or phenol-chloroform DNA extraction, followed by identification of species-specific ITS-1 sequences by optimised single species PCR assays. The Stoolkit and Prepman protocols showed insufficient repeatability, and the former was also expensive and relatively time-consuming. In contrast, both the GeneReleaser protocol and phenol-chloroform protocols were robust and sensitive, detecting less than 0.4 oocysts of each species per PCR. Finally, we evaluated our new protocol on 68 coccidia positive field samples. Our data suggests that rupturing the oocysts by mini-pestle grinding, preparing the DNA with GeneReleaser, followed by optimised single species PCR assays, makes a robust and sensitive procedure for identifying chicken Eimeria species in field samples. Importantly, it also provides minimal hands-on-time in the pre-PCR process, lower contamination risk and no handling of toxic chemicals. PMID:17386979

  11. Rapid analysis of non-uniformly sampled pulsed field gradient data for velocity estimation.

    PubMed

    Raghavan, K; Park, J C; Pavlovskaya, G E; Gibbs, S J

    2001-06-01

    Bretthorst's recent generalization of the Lomb-Scargle periodogram shows that a sufficient statistic for frequency estimation from non-uniformly, but simultaneously sampled quadrature data is equivalent to the FFT of those data with the missing samples replaced by zeros. We have applied this concept to the rapid analysis of pulsed field gradient MRI data which have been non-uniformly sampled in the velocity encoding wave vector q. For a small number of q samples, it is more computationally efficient to calculate the periodogram directly rather than using the FFT algorithm with a large number of zeros. The algorithm we have implemented for finding the peak of the generalized periodogram is simple and robust; it involves repeated apodization and grid searching of the periodogram until the desired velocity resolution is achieved. The final estimate is refined by quadratic interpolation. We have tested the method for fully developed Poiseuille flow of a Newtonian fluid and have demonstrated substantial improvement in the precision of velocity measurement achievable in a fixed acquisition time with non-uniform sampling. The method is readily extendible to multidimensional data. Analysis of a 256 by 256 pixel image with 8 q samples and an effective velocity resolution of better than 1/680 of the Nyquist range requires approximately 1 minute computation time on a 400 MHz SUN Ultrasparc II processor. PMID:11672628

  12. A contemporary decennial global Landsat sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, Emma; Roy, David

    2014-05-01

    Agriculture has caused significant human induced Land Cover Land Use (LCLU) change, with dramatic cropland expansion in the last century and significant increases in productivity over the past few decades. Satellite data have been used for agricultural applications including cropland distribution mapping, crop condition monitoring, crop production assessment and yield prediction. Satellite based agricultural applications are less reliable when the sensor spatial resolution is small relative to the field size. However, to date, studies of agricultural field size distributions and their change have been limited, even though this information is needed to inform the design of agricultural satellite monitoring systems. Moreover, the size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLU change. In many parts of the world field sizes may have increased. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, and impacts on the diffusion of herbicides, pesticides, disease pathogens, and pests. The Landsat series of satellites provide the longest record of global land observations, with 30m observations available since 1982. Landsat data are used to examine contemporary field size changes in a period (1980 to 2010) when significant global agricultural changes have occurred. A multi-scale sampling approach is used to locate global hotspots of field size change by examination of a recent global agricultural yield map and literature review. Nine hotspots are selected where significant field size change is apparent and where change has been driven by technological advancements (Argentina and U.S.), abrupt societal changes (Albania and Zimbabwe), government land use and agricultural policy changes (China, Malaysia, Brazil), and/or constrained by

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  14. The efficacy of field techniques for obtaining and storing blood samples from fishes.

    PubMed

    Clark, T D; Donaldson, M R; Drenner, S M; Hinch, S G; Patterson, D A; Hills, J; Ives, V; Carter, J J; Cooke, S J; Farrell, A P

    2011-11-01

    Prompted by the dramatic increase in the use of blood analyses in fisheries research and monitoring, this study investigated the efficacy of common field techniques for sampling and storing blood from fishes. Three questions were addressed: (1) Do blood samples taken via rapid caudal puncture (the 'grab-and-stab' technique) yield similar results for live v. sacrificed groups of fishes? (2) Do rapidly obtained caudal blood samples accurately represent blood properties of fishes prior to capture? (3) Does storage of whole blood in an ice slurry for a working day (8·5 h) modify the properties of the plasma? It was shown that haematocrit, plasma ions, metabolites, stress hormones and sex hormones of caudal blood samples were statistically similar when taken from live v. recently sacrificed groups of adult coho salmon Oncorhynchus kisutch. Moreover, this study confirmed by using paired blood samples from cannulated O. kisutch that blood acquired through the caudal puncture technique (mean ±s.e. 142 ± 26 s after capture) was representative of fish prior to capture. Long-term (8·5 h) cold storage of sockeye salmon Oncorhynchus nerka whole blood caused significant decreases in plasma potassium and chloride, and a significant increase in plasma glucose. Previous research has suggested that these changes largely result from net movements of ions and molecules between the plasma and erythrocytes, movements that can occur within minutes of storage. Thus, blood samples from fishes should be centrifuged as quickly as practicable in the field for separation of plasma and erythrocytes to prevent potentially misleading data. PMID:22026608

  15. How Does Sampling Methodology Influence Molecular Detection and Isolation Success in Influenza A Virus Field Studies?

    PubMed

    Latorre-Margalef, Neus; Avril, Alexis; Tolf, Conny; Olsen, Björn; Waldenström, Jonas

    2016-02-01

    Wild waterfowl are important reservoir hosts for influenza A virus (IAV) and a potential source of spillover infections in other hosts, including poultry and swine. The emergence of highly pathogenic avian influenza (HPAI) viruses, such as H5N1 and H5N8, and subsequent spread along migratory flyways prompted the initiation of several programs in Europe, North America, and Africa to monitor circulation of HPAI and low-pathogenicity precursor viruses (low-pathogenicity avian influenza [LPAI] viruses). Given the costs of maintaining such programs, it is essential to establish best practice for field methodologies to provide robust data for epidemiological interpretation. Here, we use long-term surveillance data from a single site to evaluate the influence of a number of parameters on virus detection and isolation of LPAI viruses. A total of 26,586 samples (oropharyngeal, fecal, and cloacal) collected from wild mallards were screened by real-time PCR, and positive samples were subjected to isolation in embryonated chicken eggs. The LPAI virus detection rate was influenced by the sample type: cloacal/fecal samples showed a consistently higher detection rate and lower cycle threshold (Ct) value than oropharyngeal samples. Molecular detection was more sensitive than isolation, and virus isolation success was proportional to the number of RNA copies in the sample. Interestingly, for a given Ct value, the isolation success was lower in samples from adult birds than in those from juveniles. Comparing the results of specific real-time reverse transcriptase (RRT)-PCRs and of isolation, it was clear that coinfections were common in the investigated birds. The effects of sample type and detection methods warrant some caution in interpretation of the surveillance data. PMID:26655759

  16. How Does Sampling Methodology Influence Molecular Detection and Isolation Success in Influenza A Virus Field Studies?

    PubMed Central

    Avril, Alexis; Tolf, Conny; Olsen, Björn

    2015-01-01

    Wild waterfowl are important reservoir hosts for influenza A virus (IAV) and a potential source of spillover infections in other hosts, including poultry and swine. The emergence of highly pathogenic avian influenza (HPAI) viruses, such as H5N1 and H5N8, and subsequent spread along migratory flyways prompted the initiation of several programs in Europe, North America, and Africa to monitor circulation of HPAI and low-pathogenicity precursor viruses (low-pathogenicity avian influenza [LPAI] viruses). Given the costs of maintaining such programs, it is essential to establish best practice for field methodologies to provide robust data for epidemiological interpretation. Here, we use long-term surveillance data from a single site to evaluate the influence of a number of parameters on virus detection and isolation of LPAI viruses. A total of 26,586 samples (oropharyngeal, fecal, and cloacal) collected from wild mallards were screened by real-time PCR, and positive samples were subjected to isolation in embryonated chicken eggs. The LPAI virus detection rate was influenced by the sample type: cloacal/fecal samples showed a consistently higher detection rate and lower cycle threshold (Ct) value than oropharyngeal samples. Molecular detection was more sensitive than isolation, and virus isolation success was proportional to the number of RNA copies in the sample. Interestingly, for a given Ct value, the isolation success was lower in samples from adult birds than in those from juveniles. Comparing the results of specific real-time reverse transcriptase (RRT)-PCRs and of isolation, it was clear that coinfections were common in the investigated birds. The effects of sample type and detection methods warrant some caution in interpretation of the surveillance data. PMID:26655759

  17. Detection of Campylobacter in human and animal field samples in Cambodia.

    PubMed

    Osbjer, Kristina; Tano, Eva; Chhayheng, Leang; Mac-Kwashie, Akofa Olivia; Fernström, Lise-Lotte; Ellström, Patrik; Sokerya, Seng; Sokheng, Choup; Mom, Veng; Chheng, Kannarath; San, Sorn; Davun, Holl; Boqvist, Sofia; Rautelin, Hilpi; Magnusson, Ulf

    2016-06-01

    Campylobacter are zoonotic bacteria and a leading cause of human gastroenteritis worldwide with Campylobacter jejuni and C. coli being the most commonly detected species. The aim of this study was to detect Campylobacter in humans and livestock (chickens, ducks, pigs, cattle, water buffalo, quail, pigeons and geese) in rural households by routine culturing and multiplex PCR in faecal samples frozen before analysis. Of 681 human samples, 82 (12%) tested positive by PCR (C. jejuni in 66 samples and C. coli in 16), but none by routine culture. Children were more commonly Campylobacter positive (19%) than adult males (8%) and females (7%). Of 853 livestock samples, 106 (12%) tested positive by routine culture and 352 (41%) by PCR. Campylobacter jejuni was more frequent in chickens and ducks and C. coli in pigs. In conclusion, Campylobacter proved to be highly prevalent by PCR in children (19%), ducks (24%), chickens (56%) and pigs (72%). Routine culturing was insufficiently sensitive in detecting Campylobacter in field samples frozen before analysis. These findings suggest that PCR should be the preferred diagnostic method for detection of Campylobacter in humans and livestock where timely culture is not feasible. PMID:26991032

  18. Deoxynivalenol, zearalenone, and Fusarium graminearum contamination of cereal straw; field distribution; and sampling of big bales.

    PubMed

    Häggblom, P; Nordkvist, E

    2015-05-01

    Sampling of straw bales from wheat, barley, and oats was carried out after harvest showing large variations in deoxynivalenol (DON) and zearalenone (ZEN) levels. In the wheat field, DON was detected in all straw samples with an average DON concentration of 976 μg/kg and a median of 525 μg/kg, while in four bales, the concentrations were above 3000 μg/kg. For ZEN, the concentrations were more uniform with an average concentration of 11 μg/kg. The barley straw bales were all positive for DON with an average concentration of 449 μg/kg and three bales above 800 μg/kg. In oat straw, the average DON concentration was 6719 μg/kg with the lowest concentration at 2614 μg/kg and eight samples above 8000 μg/kg. ZEN contamination was detected in all bales with an average concentration of 53 μg/kg with the highest concentration at 219 μg/kg. Oat bales from another field showed an average concentration of 16,382 μg/kg. ZEN concentrations in the oat bales were on average 153 μg/kg with a maximum at 284 μg/kg. Levels of Fusarium graminearum DNA were higher in oat straw (max 6444 pg DNA/mg straw) compared to straw from wheat or barley. The significance of mycotoxin exposure from straw should not be neglected particularly in years when high levels of DON and ZEN are also detected in the feed grain. With a limited number of samples preferably using a sampling probe, it is possible to distinguish lots of straw that should not be used as bedding material for pigs. PMID:25665688

  19. Confirmatory analysis of field-presumptive GSR test sample using SEM/EDS

    NASA Astrophysics Data System (ADS)

    Toal, Sarah J.; Niemeyer, Wayne D.; Conte, Sean; Montgomery, Daniel D.; Erikson, Gregory S.

    2014-09-01

    RedXDefense has developed an automated red-light/green-light field presumptive lead test using a sampling pad which can be subsequently processed in a Scanning Electron Microscope for GSR confirmation. The XCAT's sampling card is used to acquire a sample from a suspect's hands on the scene and give investigators an immediate presumptive as to the presence of lead possibly from primer residue. Positive results can be obtained after firing as little as one shot. The same sampling card can then be sent to a crime lab and processed on the SEM for GSR following ASTM E-1588-10 Standard Guide for Gunshot Residue Analysis by Scanning Electron Microscopy/Energy Dispersive X-Ray Spectrometry, in the same manner as the existing tape lifts currently used in the field. Detection of GSR-characteristic particles (fused lead, barium, and antimony) as small as 0.8 microns (0.5 micron resolution) has been achieved using a JEOL JSM-6480LV SEM equipped with an Oxford Instruments INCA EDS system with a 50mm2 SDD detector, 350X magnification, in low-vacuum mode and in high vacuum mode after coating with carbon in a sputter coater. GSR particles remain stable on the sampling pad for a minimum of two months after chemical exposure (long term stability tests are in progress). The presumptive result provided by the XCAT yields immediate actionable intelligence to law enforcement to facilitate their investigation, without compromising the confirmatory test necessary to further support the investigation and legal case.

  20. Field methods for sampling and storing nectar from flowers with low nectar volumes

    PubMed Central

    Morrant, D. S.; Schumann, R.; Petit, S.

    2009-01-01

    Background and Aims Although several methods of sampling and storing floral nectar are available, little information exists on sampling and storing nectar from flowers with low nectar volumes. Methods for sampling and storing nectar from the flowers of species with low floral nectar volumes (<1 µL) were investigated using the flowers of Eucalyptus species. Methods Sampling with microcapillary tubes, blotting up with filter paper, washing and rinsing were compared to determine masses of sugars recovered and differences in sugar ratios. Storage methods included room temperature, refrigeration and freezing treatments; the addition of antimicrobial agents benzyl alcohol or methanol to some of these treatments was also evaluated. Nectar samples were analysed using high-performance liquid chromatography and the masses of sucrose, glucose and fructose in each sample were determined. Key Results Masses of sugars varied significantly among sampling treatments, but the highest yielding methods, rinsing and washing, were not significantly different. A washing time of 1 min was as effective as one of 20 min. Storage trials showed that the sugar concentration measurements of nectar solutions changed rapidly, with the best results achieved for refrigeration with no additive (sucrose and fructose were stable for at least 2 weeks). Sugar ratios, however, remained relatively stable in most treatments and did not change significantly across 4 weeks for the methanol plus refrigerator and freezing treatments, and 2 weeks for the refrigeration treatment with no additive. Conclusions Washing is recommended for nectar collection from flowers with low nectar volumes in the field (with the understanding that one wash underestimates the amounts of sugars present in a flower), as is immediate analysis of sugar mass. In view of the great variation in results depending on nectar collection and storage methods, caution should be exercised in their choice, and their accuracy should be evaluated

  1. RESIDENTIAL SOIL SAMPLING PLAN: COMPARISON OF LABORATORY AND FIELD X-RAY FLUORESCENCE (XRF) ANALYSIS AND SAMPLE PREPARATION.

    EPA Science Inventory

    In the past, Region 10 has relied exclusively on fixed-site laboratory analyses of soil samples for Remedial Investigation/Feasibility Studies and Risk Assessments. The objectives of this sampling effort included soil analyses for removal and remedial actions as well as collecti...

  2. Geographical variation in inorganic arsenic in paddy field samples and commercial rice from the Iberian Peninsula.

    PubMed

    Signes-Pastor, Antonio J; Carey, Manus; Carbonell-Barrachina, Angel A; Moreno-Jiménez, Eduardo; Green, Andy J; Meharg, Andrew A

    2016-07-01

    This study investigated total arsenic and arsenic speciation in rice using ion chromatography with mass spectrometric detection (IC-ICP-MS), covering the main rice-growing regions of the Iberian Peninsula in Europe. The main arsenic species found were inorganic and dimethylarsinic acid. Samples surveyed were soil, shoots and field-collected rice grain. From this information soil to plant arsenic transfer was investigated plus the distribution of arsenic in rice across the geographical regions of Spain and Portugal. Commercial polished rice was also obtained from each region and tested for arsenic speciation, showing a positive correlation with field-obtained rice grain. Commercial polished rice had the lowest i-As content in Andalucia, Murcia and Valencia while Extremadura had the highest concentrations. About 26% of commercial rice samples exceeded the permissible concentration for infant food production as governed by the European Commission. Some cadmium data is also presented, available with ICP-MS analyses, and show low concentration in rice samples. PMID:26920305

  3. Field portable low temperature porous layer open tubular cryoadsorption headspace sampling and analysis part II: Applications.

    PubMed

    Harries, Megan; Bukovsky-Reyes, Santiago; Bruno, Thomas J

    2016-01-15

    This paper details the sampling methods used with the field portable porous layer open tubular cryoadsorption (PLOT-cryo) approach, described in Part I of this two-part series, applied to several analytes of interest. We conducted tests with coumarin and 2,4,6-trinitrotoluene (two solutes that were used in initial development of PLOT-cryo technology), naphthalene, aviation turbine kerosene, and diesel fuel, on a variety of matrices and test beds. We demonstrated that these analytes can be easily detected and reliably identified using the portable unit for analyte collection. By leveraging efficiency-boosting temperature control and the high flow rate multiple capillary wafer, very short collection times (as low as 3s) yielded accurate detection. For diesel fuel spiked on glass beads, we determined a method detection limit below 1 ppm. We observed greater variability among separate samples analyzed with the portable unit than previously documented in work using the laboratory-based PLOT-cryo technology. We identify three likely sources that may help explain the additional variation: the use of a compressed air source to generate suction, matrix geometry, and variability in the local vapor concentration around the sampling probe as solute depletion occurs both locally around the probe and in the test bed as a whole. This field-portable adaptation of the PLOT-cryo approach has numerous and diverse potential applications. PMID:26726934

  4. Design of Field Experiments for Adaptive Sampling of the Ocean with Autonomous Vehicles

    NASA Astrophysics Data System (ADS)

    Zheng, H.; Ooi, B. H.; Cho, W.; Dao, M. H.; Tkalich, P.; Patrikalakis, N. M.

    2010-05-01

    Due to the highly non-linear and dynamical nature of oceanic phenomena, the predictive capability of various ocean models depends on the availability of operational data. A practical method to improve the accuracy of the ocean forecast is to use a data assimilation methodology to combine in-situ measured and remotely acquired data with numerical forecast models of the physical environment. Autonomous surface and underwater vehicles with various sensors are economic and efficient tools for exploring and sampling the ocean for data assimilation; however there is an energy limitation to such vehicles, and thus effective resource allocation for adaptive sampling is required to optimize the efficiency of exploration. In this paper, we use physical oceanography forecasts of the coastal zone of Singapore for the design of a set of field experiments to acquire useful data for model calibration and data assimilation. The design process of our experiments relied on the oceanography forecast including the current speed, its gradient, and vorticity in a given region of interest for which permits for field experiments could be obtained and for time intervals that correspond to strong tidal currents. Based on these maps, resources available to our experimental team, including Autonomous Surface Craft (ASC) are allocated so as to capture the oceanic features that result from jets and vortices behind bluff bodies (e.g., islands) in the tidal current. Results are summarized from this resource allocation process and field experiments conducted in January 2009.

  5. Membrane solid-phase extraction: Field application for isolation of polycyclic aromatic hydrocarbons from water samples

    SciTech Connect

    Furlong, E.T.; Koleis, J.C.; Gates, P.M.

    1995-12-31

    Solid-phase extraction (SPE) membranes (M-SPE) were used to isolate microgram-per-liter to nanogram-per-liter quantities of polycyclic aromatic hydrocarbons (PAH) in 4- to 8-liter ground-water samples from a crude-oil-contaminated ground-water site near Bemidji, Minnesota. The M-SPE method was evaluated (1) under laboratory conditions using reagent water fortified with individual PAH at 1.23 micrograms per liter, and (2) at the Bemidji site. At the site, ground-water samples were processed and PAH isolated using a M-SPE system connected directly to the well pump. Following sample isolation, all M-SPE samples were extracted using dichloromethane and analyzed by gas chromatography-mass spectrometry with selected-ion monitoring. Operationally, the M-SPE method provided a simple means to isolate PAH on site at the wellhead, particularly for anoxic water samples. Acceptable recoveries, ranging from 56 to over 100 percent, were observed for lower molecular weight PAH (naphthalene to pyrene) using the M-SPE method. Recoveries using M-SPE were somewhat lower, but reproducible, for higher molecular weight PAH (chrysene to benzo[ghi]perylene), ranging from 18 to 56 percent. M-SPE provides the capability to collect and field isolate PAH from a sufficiently large number of samples to identify environmental chemical processes occurring at individual compound concentrations of 50 to 1,200 nanograms per liter. Using M-SPE, the potential for facilitated transport of PAH by in situ-derived dissolved organic carbon (DOC) was evaluated at the site. Plots comparing DOC and PAH concentrations indicate that PAH concentrations increase exponentially with linear increases in DOC concentrations.

  6. Investigation of Particle Sampling Bias in the Shear Flow Field Downstream of a Backward Facing Step

    NASA Technical Reports Server (NTRS)

    Meyers, James F.; Kjelgaard, Scott O.; Hepner, Timothy E.

    1990-01-01

    The flow field about a backward facing step was investigated to determine the characteristics of particle sampling bias in the various flow phenomena. The investigation used the calculation of the velocity:data rate correlation coefficient as a measure of statistical dependence and thus the degree of velocity bias. While the investigation found negligible dependence within the free stream region, increased dependence was found within the boundary and shear layers. Full classic correction techniques over-compensated the data since the dependence was weak, even in the boundary layer and shear regions. The paper emphasizes the necessity to determine the degree of particle sampling bias for each measurement ensemble and not use generalized assumptions to correct the data. Further, it recommends the calculation of the velocity:data rate correlation coefficient become a standard statistical calculation in the analysis of all laser velocimeter data.

  7. Review of concepts useful for maintaining quality of male reproductive field samples for laboratory study

    USGS Publications Warehouse

    Jenkins, Jill A.

    2011-01-01

    Investigations into cellular and molecular characteristics of male gametes obtained from fish in natural ecosystems require careful sample handling and shipping in order to minimize artifacts. Maintaining sample integrity engenders confident assessments of ecosystem health, whereby animal condition is often reflected by gamete biomarkers - indicators that respond in measurable ways to changes. A number of our investigations have addressed the hypothesis that biomarkers from fish along a pollution gradient are reflective of site location. Species biology and the selected biological endpoints direct choice of parameters such as: temperature, buffer osmolality, time in transit, fixation, cryoprotectants, protease inhibition, and antibiotic inclusion in extender. This paper will highlight case studies, and outline parameters and thoughts on approaches for use by field and laboratory researchers.

  8. Highly efficient sample stacking by enhanced field amplification on a simple paper device.

    PubMed

    Ma, Biao; Song, Yi-Zhen; Niu, Ji-Cheng; Wu, Zhi-Yong

    2016-09-21

    We present a novel electrokinetic stacking (ES) method based on field amplification on a simple paper device for sample preconcentration. With voltage application, charged probe ions in a solution of lower conductivity stack and form a narrow band at the boundary between the sample and the background electrolyte of higher conductivity. The stacking band appears quickly and stabilizes in a few minutes. With this ES method, three orders of magnitude signal improvement was successfully achieved for both a fluorescein probe and a double-stranded DNA within 300 s. This enhanced stacking efficiency is attributed to a focusing effect due to the balance between electromigration and counter electroosmotic flow. We also applied this ES method to other low-cost fiber substrates such as cloth and thread. Such a simple and highly efficient ES method will find wide applications in the development of sensitive paper-based analytical devices (PADs), especially for low-cost point-of-care testing (POCT). PMID:27528399

  9. Strategy to obtain axenic cultures from field-collected samples of the cyanobacterium Phormidium animalis.

    PubMed

    Vázquez-Martínez, Guadalupe; Rodriguez, Mario H; Hernández-Hernández, Fidel; Ibarra, Jorge E

    2004-04-01

    An efficient strategy, based on a combination of procedures, was developed to obtain axenic cultures from field-collected samples of the cyanobacterium Phormidium animalis. Samples were initially cultured in solid ASN-10 medium, and a crude separation of major contaminants from P. animalis filaments was achieved by washing in a series of centrifugations and resuspensions in liquid medium. Then, manageable filament fragments were obtained by probe sonication. Fragmentation was followed by forceful washing, using vacuum-driven filtration through an 8-microm pore size membrane and an excess of water. Washed fragments were cultured and treated with a sequential exposure to four different antibiotics. Finally, axenic cultures were obtained from serial dilutions of treated fragments. Monitoring under microscope examination and by inoculation in Luria-Bertani (LB) agar plates indicated either axenicity or the degree of contamination throughout the strategy. PMID:15003694

  10. Quantitative reverse sample genome probing of microbial communities and its application to oil field production waters

    SciTech Connect

    Voordouw, G.; Shen, Y.; Harrington, C.S.; Teland, A.J. ); Jack, T.R. ); Westlake, W.S. )

    1993-12-01

    This paper presents a protocol for quantitative analysis of microbial communities by reverse sample genome probing is presented in which (i) whole community DNA is isolated and labeled in the presence of a known amount of an added internal standard and (ii) the resulting spiked reverse genome probe is hybridized with a master filter on which denatured genomic DNAs from bacterial standards isolated from the target environment were spotted in large amounts (up to 1,500 ng) in order to improve detection sensitivity. This protocol allowed reproducible fingerprinting of the microbial community in oil field production waters at 19 sites from which water and biofilm samples were collected. It appeared that selected sulfate-reducing bacteria were significantly enhanced in biofilms covering the metal surfaces in contact with the production waters.

  11. GeoLab's First Field Trials, 2010 Desert RATS: Evaluating Tools for Early Sample Characterization

    NASA Technical Reports Server (NTRS)

    Evans, Cindy A.; Bell, M. S.; Calaway, M. J.; Graff, Trevor; Young, Kelsey

    2011-01-01

    As part of an accelerated prototyping project to support science operations tests for future exploration missions, we designed and built a geological laboratory, GeoLab, that was integrated into NASA's first generation Habitat Demonstration Unit-1/Pressurized Excursion Module (HDU1-PEM). GeoLab includes a pressurized glovebox for transferring and handling samples collected on geological traverses, and a suite of instruments for collecting preliminary data to help characterize those samples. The GeoLab and the HDU1-PEM were tested for the first time as part of the 2010 Desert Research and Technology Studies (DRATS), NASA's analog field exercise for testing mission technologies. The HDU1- PEM and GeoLab participated in two weeks of joint operations in northern Arizona with two crewed rovers and the DRATS science team.

  12. Field enhancement sample stacking for analysis of organic acids in traditional Chinese medicine by capillary electrophoresis.

    PubMed

    Zhu, Qianqian; Xu, Xueqin; Huang, Yuanyuan; Xu, Liangjun; Chen, Guonan

    2012-07-13

    A technique known as field enhancement sample stacking (FESS) and capillary electrophoresis (CE) separation has been developed to analyze and detect organic acids in the three traditional Chinese medicines (such as Portulaca oleracea L., Crataegus pinnatifida and Aloe vera L.). In FESS, a reverse electrode polarity-stacking mode (REPSM) was applied as on-line preconcentration strategy. Under the optimized condition, the baseline separation of eight organic acids (linolenic acid, lauric acid, p-coumaric acid, ascorbic acid, benzoic acid, caffeic acid, succinic acid and fumaric acid) could be achieved within 20 min. Validation parameters of this method (such as detection limits, linearity and precision) were also evaluated. The detection limits ranged from 0.4 to 60 ng/mL. The results indicated that the proposed method was effective for the separation of mixtures of organic acids. Satisfactory recoveries were also obtained in the analysis of these organic acids in the above traditional Chinese medicine samples. PMID:22381886

  13. Lensless coherent imaging by sampling of the optical field with digital micromirror device

    NASA Astrophysics Data System (ADS)

    Vdovin, G.; Gong, H.; Soloviev, O.; Pozzi, P.; Verhaegen, M.

    2015-12-01

    We have experimentally demonstrated a lensless coherent microscope based on direct registration of the complex optical field by sampling the pupil with a sequence of two-point interferometers formed by a digital micromirror device. Complete registration of the complex amplitude in the pupil of the imaging system, without any reference beam, provides a convenient link between the experimental and computational optics. Unlike other approaches to digital holography, our method does not require any external reference beam, resulting in a simple and robust registration setup. Computer analysis of the experimentally registered field allows for focusing the image in the whole range from zero to infinity, and for virtual correction of the aberrations present in the real optical system, by applying the adaptive wavefront corrections to its virtual model.

  14. A Fast-sampling, Planar Array for Measuring the AC Field of Fermilab Pulsed Extraction Magnets

    SciTech Connect

    DiMarco, E.Joseph; Johnstone, C.; Kiemschies, O.; Kotelnikov, S.K.; Lamm, M.J.; Makulski, A.; Nehring, R.; Orris, D.F.; Russell, A.D.; Tartaglia, Michael Albert; Velev, G.; /Fermilab

    2008-06-25

    A system employing a planar array of inductive pick-up coils has been developed for measurements of the rapidly changing dipole field in pulsed extraction magnets for the Fermilab MuCool project. The magnets are of C-type and deigned to support a peak field of 0.65 T during 8.33 millisecond half-sine pulse at a 15 Hz repetition rate. The coils of the measurement system are fabricated on a single, 97.5 mm wide, 2-layer circuit board. The array of coils is simultaneously sampled at data rates of up to 100 kHz with 10 kHz bandwidth using 24-bit ADC's. A detailed overview of the system and data analysis is presented, along with a characterization of results and system performance.

  15. Wood dust sampling: field evaluation of personal samplers when large particles are present.

    PubMed

    Lee, Taekhee; Harper, Martin; Slaven, James E; Lee, Kiyoung; Rando, Roy J; Maples, Elizabeth H

    2011-03-01

    Recent recommendations for wood dust sampling include sampling according to the inhalable convention of International Organization for Standardization (ISO) 7708 (1995) Air quality--particle size fraction definitions for health-related sampling. However, a specific sampling device is not mandated, and while several samplers have laboratory performance approaching theoretical for an 'inhalable' sampler, the best choice of sampler for wood dust is not clear. A side-by-side field study was considered the most practical test of samplers as laboratory performance tests consider overall performance based on a wider range of particle sizes than are commonly encountered in the wood products industry. Seven companies in the wood products industry of the Southeast USA (MS, KY, AL, and WV) participated in this study. The products included hardwood flooring, engineered hardwood flooring, door skins, shutter blinds, kitchen cabinets, plywood, and veneer. The samplers selected were 37-mm closed-face cassette with ACCU-CAP™, Button, CIP10-I, GSP, and Institute of Occupational Medicine. Approximately 30 of each possible pairwise combination of samplers were collected as personal sample sets. Paired samplers of the same type were used to calculate environmental variance that was then used to determine the number of pairs of samples necessary to detect any difference at a specified level of confidence. Total valid sample number was 888 (444 valid pairs). The mass concentration of wood dust ranged from 0.02 to 195 mg m(-3). Geometric mean (geometric standard deviation) and arithmetic mean (standard deviation) of wood dust were 0.98 mg m(-3) (3.06) and 2.12 mg m(-3) (7.74), respectively. One percent of the samples exceeded 15 mg m(-3), 6% exceeded 5 mg m(-3), and 48% exceeded 1 mg m(-3). The number of collected pairs is generally appropriate to detect a 35% difference when outliers (negative mass loadings) are removed. Statistical evaluation of the nonsimilar sampler pair results

  16. Wood Dust Sampling: Field Evaluation of Personal Samplers When Large Particles Are Present

    PubMed Central

    Lee, Taekhee; Harper, Martin; Slaven, James E.; Lee, Kiyoung; Rando, Roy J.; Maples, Elizabeth H.

    2011-01-01

    Recent recommendations for wood dust sampling include sampling according to the inhalable convention of International Organization for Standardization (ISO) 7708 (1995) Air quality—particle size fraction definitions for health-related sampling. However, a specific sampling device is not mandated, and while several samplers have laboratory performance approaching theoretical for an ‘inhalable’ sampler, the best choice of sampler for wood dust is not clear. A side-by-side field study was considered the most practical test of samplers as laboratory performance tests consider overall performance based on a wider range of particle sizes than are commonly encountered in the wood products industry. Seven companies in the wood products industry of the Southeast USA (MS, KY, AL, and WV) participated in this study. The products included hardwood flooring, engineered hardwood flooring, door skins, shutter blinds, kitchen cabinets, plywood, and veneer. The samplers selected were 37-mm closed-face cassette with ACCU-CAP™, Button, CIP10-I, GSP, and Institute of Occupational Medicine. Approximately 30 of each possible pairwise combination of samplers were collected as personal sample sets. Paired samplers of the same type were used to calculate environmental variance that was then used to determine the number of pairs of samples necessary to detect any difference at a specified level of confidence. Total valid sample number was 888 (444 valid pairs). The mass concentration of wood dust ranged from 0.02 to 195 mg m−3. Geometric mean (geometric standard deviation) and arithmetic mean (standard deviation) of wood dust were 0.98 mg m−3 (3.06) and 2.12 mg m−3 (7.74), respectively. One percent of the samples exceeded 15 mg m−3, 6% exceeded 5 mg m−3, and 48% exceeded 1 mg m−3. The number of collected pairs is generally appropriate to detect a 35% difference when outliers (negative mass loadings) are removed. Statistical evaluation of the nonsimilar sampler pair

  17. Sample fields of the Viking landers, physical properties, and aeolian processes

    NASA Technical Reports Server (NTRS)

    Moore, H. J.; Spitzer, C. R.; Bradford, K. Z.; Cates, P. M.; Shorthill, R. W.; Hutton, R. E.

    1979-01-01

    Surface sampler activities on Mars during the Viking extended mission are considered, including excavation of deep trenches, construction of conical piles of materials, backhoe touchdown experiments, and acquisition of contiguous pictures of the surface beneath number 2 terminal descent engines using mirrors. Results of the Physical Properties Investigation that are relevant to aeolian processes are also discussed. Both pictures and surface sampler data indicate that the surface materials in the sample fields of the Viking landers may be grouped, in order of increasing strength, into drift material, crusty to cloddy material, blocky material and rocks.

  18. Field analysis of electro-optic probes for minimally invasive microwave sampling.

    PubMed

    Lee, Dong-Joon; Kwon, Jae-Yong; Kang, No-Weon

    2014-02-10

    We numerically and experimentally investigate the field invasiveness of microwave signals using an electro-optic technique. The distortion of the standing wave voltage and pulse waveform probed by the electro-optic technique is explored through both minimally invasive external and non-invasive internal sensing configurations. First, we analyzed the continuous wave microwave field imaging on a millimeter- scale coaxial transmission line using a highly accurate and stable electro- optic scanning system. The electric field images from the microwave device are attained virtually non-invasively using a miniaturized fiber-coupled electro-optic probe. The accuracy of the field imaging associated with various probe styles is investigated by numerical analysis and experiment. Then, we analyzed the waveform of the coaxial transmission line up to 50 GHz using a pulsed electro-optic system with an external probe set. Finally, the invasive analysis was extended to the sub-millimeter-scale on-wafer coplanar waveguides, where the voltage waveforms are measured using a minimally invasive external probe as well as an internal wafer probe for non-invasive sampling. PMID:24663582

  19. Sample Characterization of FIDO-2000 and FIDO-2002 Blind Field Test Sites by an APXS Instrument

    NASA Astrophysics Data System (ADS)

    Economou, T. E.

    2002-12-01

    The Mars Rover Explorer (MER) Project conducted in the past few years two major blind field test that involved the Field Integrated Design and Operations (FIDO) rover, with a payload not quite, but close to the real MER mission flight payload. Since the APXS and the MB spectrometer cannot operate properly in the Earth's atmosphere, a representative variety of rocks and soil samples from designated "landing" sites were collected and sent to the respective laboratories for analyses with these two instruments. During the field tests, the data from FIDO instruments, together with the appropriate data from the APXS and MB spectrometers, which, according to the site operators opinion, most closely resembled the real analyzed samples, were transmitted to the control room at JPL for target evaluation. The APXS analyzed both, the natural side and the fresh cut side, of most of the rocks that were made available. By comparing the analytical results from both sides, it was possible to clearly detect and evaluate alteration rinds and coatings on the analyzed rocks. Desert varnish, thin iron and carbon coatings were found on natural side of some rocks, but not others. The elemental composition results by the APXS contributed synergistically with the other FIDO instruments to derive the mineralogical and geological characterization of the sites by imposing limits on the amounts and the variety of specific minerals. Most of the analyzed samples from both FIDO field test sites were very high in silica and alumina. In a few cases, the analyses were compatible with pure quartz. The alpha mode of the APXS is especially valuable for detecting even small amounts of carbonates. In many instances, it was possible to show that the carbon was only on the surface of some rocks. Examples of the APXS results from both blind field tests will be presented and discussed at the meeting The APXS results will be compared to the Pathfinder APXS rock analyses and conclusions will be made about rinds

  20. Field observations of particle impacts by debris flows and debris floods on instrumented rock samples

    NASA Astrophysics Data System (ADS)

    McArdell, B. W.; Hsu, L.; Fritschi, B.; Dietrich, W. E.

    2011-12-01

    Bedrock incision and sediment entrainment by debris flows are important processes in torrent channels. As part of our effort to gain a better understanding of these processes, we installed instrumented rock samples in the bed of the Illgraben channel. Three rock samples, 0.4 m long (in the flow direction), 0.3 m wide, and 0.2 m thick, were installed in steel frames which were mounted on the upslope side of a concrete check dam, with the surface of the stones flush with the channel bed. Accelerometer sensors were installed on the bottom of one rock sample, with a range of up to 500 g (vertical) and 200 g (horizontal, parallel to the channel axis), where g is the acceleration due to gravity. Elastomer elements, typically used in the field as overload protection for load sensors, were placed between the rock samples and the steel frames. Data were sampled at 2 kHz and stored on a computer outside of the channel. The sensors provided data for 4 debris floods and part of one debris flow. For all of the events, the vertical acceleration data indicate a large background noise in the range of ±10 g, punctuated by very short duration impulses of up to several hundred g. The large accelerations are interpreted to represent hard impacts of cobbles or boulders in the flow with the rock tablet. Using a value of >20 g to define the occurrence of a large particle impact, it is possible to differentiate between debris floods (which have on the order of 0.1 impact per second) and the debris flow (on the order of 1 impact per second). The frequency of the sampling is too small to resolve details about the impacts, so it is not possible to precisely determine the maximum accelerations. However the peak recorded values are larger for debris flows, with values up to the measurement limit of the sensors, whereas for floods the maximum accelerations are typically less than 100 g. The results for the accelerometer which measures accelerations in the downstream direction generally mirror

  1. Classification of underwater targets from autonomous underwater vehicle sampled bistatic acoustic scattered fields.

    PubMed

    Fischell, Erin M; Schmidt, Henrik

    2015-12-01

    One of the long term goals of autonomous underwater vehicle (AUV) minehunting is to have multiple inexpensive AUVs in a harbor autonomously classify hazards. Existing acoustic methods for target classification using AUV-based sensing, such as sidescan and synthetic aperture sonar, require an expensive payload on each outfitted vehicle and post-processing and/or image interpretation. A vehicle payload and machine learning classification methodology using bistatic angle dependence of target scattering amplitudes between a fixed acoustic source and target has been developed for onboard, fully autonomous classification with lower cost-per-vehicle. To achieve the high-quality, densely sampled three-dimensional (3D) bistatic scattering data required by this research, vehicle sampling behaviors and an acoustic payload for precision timed data acquisition with a 16 element nose array were demonstrated. 3D bistatic scattered field data were collected by an AUV around spherical and cylindrical targets insonified by a 7-9 kHz fixed source. The collected data were compared to simulated scattering models. Classification and confidence estimation were shown for the sphere versus cylinder case on the resulting real and simulated bistatic amplitude data. The final models were used for classification of simulated targets in real time in the LAMSS MOOS-IvP simulation package [M. Benjamin, H. Schmidt, P. Newman, and J. Leonard, J. Field Rob. 27, 834-875 (2010)]. PMID:26723332

  2. Modulation transfer function measurement of sampled imaging systems in field test

    NASA Astrophysics Data System (ADS)

    Yang, Le; Sun, Qiang; Wang, Jian; Zhang, Jianzhong

    2010-10-01

    A digital mirror device (DMD) based light projector was developed as the target generator in modulation transfer function (MTF) measurement. In order to overcome the sampling-scene phase effect in MTF measurement of sampled imaging systems, a method using random targets is introduced to yield a phase-averaged MTF. The main potential problem of implementing this method is the fact that the stationary assumption of the random targets may be vitiated in practical measurement, especially in field test due to the ill condition. We provide an efficient model-independent way of analyzing and isolating the spectral contents arising from these additional contributions to MTF measurement. Algorithms with adaptive parameter selection were also developed for spectral estimation of the test image in order to overcome the challenge brought by the size limit of the test matrices for one certain field of view derived from the isoplantic region. The MTF measurement of a CCD video imager is used to demonstrate the measurement technique and illustrate the benefits over other methods. In order to validate the results, comparisons have been made between MTF measurements of imager implemented using this method and bar target direct measurements.

  3. Integrated Field Lysimetry and Porewater Sampling for Evaluation of Chemical Mobility in Soils and Established Vegetation

    PubMed Central

    Gannon, Travis W.; Polizzotto, Matthew L.

    2014-01-01

    Potentially toxic chemicals are routinely applied to land to meet growing demands on waste management and food production, but the fate of these chemicals is often not well understood. Here we demonstrate an integrated field lysimetry and porewater sampling method for evaluating the mobility of chemicals applied to soils and established vegetation. Lysimeters, open columns made of metal or plastic, are driven into bareground or vegetated soils. Porewater samplers, which are commercially available and use vacuum to collect percolating soil water, are installed at predetermined depths within the lysimeters. At prearranged times following chemical application to experimental plots, porewater is collected, and lysimeters, containing soil and vegetation, are exhumed. By analyzing chemical concentrations in the lysimeter soil, vegetation, and porewater, downward leaching rates, soil retention capacities, and plant uptake for the chemical of interest may be quantified. Because field lysimetry and porewater sampling are conducted under natural environmental conditions and with minimal soil disturbance, derived results project real-case scenarios and provide valuable information for chemical management. As chemicals are increasingly applied to land worldwide, the described techniques may be utilized to determine whether applied chemicals pose adverse effects to human health or the environment. PMID:25045915

  4. Near-field acoustic holography using sparse regularization and compressive sampling principles.

    PubMed

    Chardon, Gilles; Daudet, Laurent; Peillot, Antoine; Ollivier, François; Bertin, Nancy; Gribonval, Rémi

    2012-09-01

    Regularization of the inverse problem is a complex issue when using near-field acoustic holography (NAH) techniques to identify the vibrating sources. This paper shows that, for convex homogeneous plates with arbitrary boundary conditions, alternative regularization schemes can be developed based on the sparsity of the normal velocity of the plate in a well-designed basis, i.e., the possibility to approximate it as a weighted sum of few elementary basis functions. In particular, these techniques can handle discontinuities of the velocity field at the boundaries, which can be problematic with standard techniques. This comes at the cost of a higher computational complexity to solve the associated optimization problem, though it remains easily tractable with out-of-the-box software. Furthermore, this sparsity framework allows us to take advantage of the concept of compressive sampling; under some conditions on the sampling process (here, the design of a random array, which can be numerically and experimentally validated), it is possible to reconstruct the sparse signals with significantly less measurements (i.e., microphones) than classically required. After introducing the different concepts, this paper presents numerical and experimental results of NAH with two plate geometries, and compares the advantages and limitations of these sparsity-based techniques over standard Tikhonov regularization. PMID:22978881

  5. Effect of temporal sampling and timing for soil moisture measurements at field scale

    NASA Astrophysics Data System (ADS)

    Snapir, B.; Hobbs, S.

    2012-04-01

    Estimating soil moisture at field scale is valuable for various applications such as irrigation scheduling in cultivated watersheds, flood and drought prediction, waterborne disease spread assessment, or even determination of mobility with lightweight vehicles. Synthetic aperture radar on satellites in low Earth orbit can provide fine resolution images with a repeat time of a few days. For an Earth observing satellite, the choice of the orbit is driven in particular by the frequency of measurements required to meet a certain accuracy in retrieving the parameters of interest. For a given target, having only one image every week may not enable to capture the full dynamic range of soil moisture - soil moisture can change significantly within a day when rainfall occurs. Hence this study focuses on the effect of temporal sampling and timing of measurements in terms of error on the retrieved signal. All the analyses are based on in situ measurements of soil moisture (acquired every 30 min) from the OzNet Hydrological Monitoring Network in Australia for different fields over several years. The first study concerns sampling frequency. Measurements at different frequencies were simulated by sub-sampling the original data. Linear interpolation was used to estimate the missing intermediate values, and then this time series was compared to the original. The difference between these two signals is computed for different levels of sub-sampling. Results show that the error increases linearly when the interval is less than 1 day. For intervals longer than a day, a sinusoidal component appears on top of the linear growth due to the diurnal variation of surface soil moisture. Thus, for example, the error with measurements every 4.5 days can be slightly less than the error with measurements every 2 days. Next, for a given sampling interval, this study evaluated the effect of the time during the day at which measurements are made. Of course when measurements are very frequent the time

  6. Size-dependent Turbidimatric Quantification of Mobile Colloids in Field Samples

    NASA Astrophysics Data System (ADS)

    Yan, J.; Meng, X.; Jin, Y.

    2015-12-01

    Natural colloids, often defined as entities with sizes < 1.0 μm, have attracted much research attention because of their ability to facilitate the transport of contaminants in the subsurface environment. However, due to their small size and generally low concentrations in field samples, quantification of mobile colloids, especially the smaller fractions (< 0.45 µm), which are operationally defined as dissolved, is largely impeded and hence the natural colloidal pool is greatly overlooked and underestimated. The main objectives of this study are to: (1) develop an experimentally and economically efficient methodology to quantify natural colloids in different size fractions (0.1-0.45 and 0.45-1 µm); (2) quantify mobile colloids including small colloids, < 0.45 µm particularly, in different natural aquatic samples. We measured and generated correlations between mass concentration and turbidity of colloid suspensions, made by extracting and fractionating water dispersible colloids in 37 soils from different areas in the U.S. and Denmark, for colloid size fractions 0.1-0.45 and 0.45-1 µm. Results show that the correlation between turbidity and colloid mass concentration is largely affected by colloid size and iron content, indicating the need to generate different correlations for colloids with constrained size range and iron content. This method enabled quick quantification of colloid concentrations in a large number of field samples collected from freshwater, wetland and estuaries in different size fractions. As a general trend, we observed high concentrations of colloids in the < 0.45 µm fraction, which constitutes a significant percentage of the total mobile colloidal pool (< 1 µm). This observation suggests that the operationally defined cut-off size for "dissolved" phase can greatly underestimate colloid concentration therefore the role that colloids play in the transport of associated contaminants or other elements.

  7. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  8. Using analog field and sample data to understand remote data of Mars

    NASA Astrophysics Data System (ADS)

    Wright, Shawn

    2015-04-01

    The primary geologic processes on Mars are basaltic volcanism, sedimentation, impact cratering, and alteration. All potentially create amorphous materials and complex mineralogies, and these must be measured by rovers sent to Mars to characterize the geology. This paper addresses the field measurements and sample analyses of a terrestrial analog impact crater to interpret rover and perhaps orbital data of Mars. Motivation: OMEGA and CRISM have shown alteration minerals in Martian ejecta blankets. These phyllosilicates may represent altered crust that was excavated, and only exposed, by the impact, or could represent ejecta that was altered in part during impact or fractured/fragmented material that was altered at higher rate than surrounding terrain after ejecta emplacement. Study Site and Geologic History: Lonar Crater, India is a young (~570 ka), ~1.8 km impact site emplaced in ~65 Ma Deccan basalt, which is an excellent analog material for Mars with ~45-50% labradorite and ~35% augite/pigeonite before lower flows were altered and then excavated and/or shocked. Pre-impact stratigraphy was not complex: 3 flows of fresh basalt overlying 3 flows of aqueously-altered basalt, and both are found as impact breccia clasts in a ~8 m thick lithic (unshocked, "throw out") and ~1 m suevite (all ranges of shock pressure, "fall out") breccia units in the ejecta. Two geologic histories for shocked clasts in the Lonar suevite breccia are compared: 1.) the alteration of impactites (impact glasses and melts) of a range of shock pressures ("post-impact alteration"), which likely increase the rate of alteration and affects the order of alteration where compared to pristine, igneous minerals, and 2.) the existence of altered basalt protoliths ("pre-impact alteration") now vitrified as in-situ breccia clasts or float. Both of these geologic histories and their alteration pathways are compared to those of unshocked fresh and unshocked altered basalts found in the lithic breccia and

  9. Comparison of aerosol backscatter and wind field estimates from the REAL and the SAMPLE

    NASA Astrophysics Data System (ADS)

    Mayor, Shane D.; Dérian, Pierre; Mauzey, Christopher F.; Spuler, Scott M.; Ponsardin, Patrick; Pruitt, Jeff; Ramsey, Darrell; Higdon, Noah S.

    2015-09-01

    Although operating at the same near-infrared 1.5- m wavelength, the Raman-shifted Eye-safe Aerosol Lidar (REAL) and the Scanning Aerosol Micro-Pulse Lidar-Eye-safe (SAMPLE) are very different in how they generate and detect laser radiation. We present results from an experiment where the REAL and the SAMPLE were operated side-by-side in Chico, California, in March of 2015. During the non-continuous, eleven day test period, the SAMPLE instrument was operated at maximum pulse repetition frequency (15 kHz) and integrated over the interpulse period of the REAL (0.1 s). Operation at the high pulse repetition frequency resulted in second trip echoes which contaminated portions of the data. The performance of the SAMPLE instrument varied with background brightness--as expected with a photon counting receiver|--yet showed equal or larger backscatter intensity signal to noise ratio throughout the intercomparison experiment. We show that a modest low-pass filter or smooth applied to the REAL raw waveforms (that have 5x higher range resolution) results in significant increases in raw signal-to-noise ratio and image signal-to-noise ratio--a measure of coherent aerosol feature content in the images resulting from the scans. Examples of wind fields and time series of wind estimates from both systems are presented. We conclude by reviewing the advantages and disadvantages of each system and sketch a plan for future research and development activities to optimize the design of future systems.

  10. Quality assurance guidance for field sampling and measurement assessment plates in support of EM environmental sampling and analysis activities

    SciTech Connect

    Not Available

    1994-05-01

    This document is one of several guidance documents developed by the US Department of Energy (DOE) Office of Environmental Restoration and Waste Management (EM). These documents support the EM Analytical Services Program (ASP) and are based on applicable regulatory requirements and DOE Orders. They address requirements in DOE Orders by providing guidance that pertains specifically to environmental restoration and waste management sampling and analysis activities. DOE 5700.6C Quality Assurance (QA) defines policy and requirements to establish QA programs ensuring that risks and environmental impacts are minimized and that safety, reliability, and performance are maximized. This is accomplished through the application of effective management systems commensurate with the risks imposed by the facility and the project. Every organization supporting EM`s environmental sampling and analysis activities must develop and document a QA program. Management of each organization is responsible for appropriate QA program implementation, assessment, and improvement. The collection of credible and cost-effective environmental data is critical to the long-term success of remedial and waste management actions performed at DOE facilities. Only well established and management supported assessment programs within each EM-support organization will enable DOE to demonstrate data quality. The purpose of this series of documents is to offer specific guidance for establishing an effective assessment program for EM`s environmental sampling and analysis (ESA) activities.

  11. Field Comparison of the Sampling Efficacy of Two Smear Media: Cotton Fiber and Kraft Paper

    SciTech Connect

    Hogue, M.G.

    2002-02-07

    Two materials were compared in field tests at the Defense Waste Processing Facility: kraft paper (a strong, brown paper made from wood pulp prepared with a sodium sulfate solution) and cotton fiber. Based on a sampling of forty-six pairs of smears, the cotton fiber smears provide a greater sensitivity. The cotton fiber smears collected an average of forty-four percent more beta activity than the kraft paper smears and twenty-nine percent more alpha activity. Results show a greater sensitivity with cotton fiber over kraft paper at the 95 percent confidence level. Regulatory requirements for smear materials are vague. The data demonstrate that the difference in sensitivity of smear materials could lead to a large difference in reported results that are subsequently used for meeting shipping regulations or evaluating workplace contamination levels.

  12. Field Sampling Plan for the Distler Brickyard Superfund Site, Hardin County, Kentucky

    SciTech Connect

    J. P. Martin; L. N. Peterson; C. J. Taylor

    1999-08-01

    This plan describes the field and analytical activities to be conducted at the Distler Brickyard Superfund Site, Hardin County, Kentucky, in order to evaluate natural attenuation processes within the aquifer system. Sampling will consist of a single round to take place in October 1999. Analytes will consist of the contaminants of concern (chlorinated aliphatic hydrocarbons), electron donors (non-chlorinated organic compounds), oxidation-reduction indicators, and water quality parameters. These activities are conducted in order to evaluate the water quality parameters. These activities are conducted in order to evaluate the extent to which natural attenuation processes, in the form of anaerobic reductive dechlorination, may be taking place in the aquifer system. These data will then be used to select the appropriate remediation technology for this site.

  13. Calculation of membrane bending rigidity using field-theoretic umbrella sampling.

    PubMed

    Smirnova, Y G; Müller, M

    2015-12-28

    The free-energy change of membrane shape transformations can be small, e.g., as in the case of membrane bending. Therefore, the calculation of the free-energy difference between different membrane morphologies is a challenge. Here, we discuss a computational method - field-theoretic umbrella sampling - to compute the local chemical potential of a non-equilibrium configuration and illustrate how one can apply it to study free-energy changes of membrane transformations using simulations. Specifically, the chemical potential profile of the bent membrane and the bending rigidity of membrane are calculated for a soft, coarse-grained amphiphile model and the MARTINI model of a dioleoylphosphatidylcholine (DOPC) membrane. PMID:26723640

  14. Sampling and analysis of airborne residues of paraquat in treated cotton field environments.

    PubMed

    Seiber, J N; Woodrow, J E

    1981-01-01

    A method was developed for the analysis of paraquat residues in airborne particulate matter collected by filtration or impaction. The method is based on extraction of paraquat with 6N hydrochloric acid, transfer of residue to saturated ammonium bicarbonate solution, and reduction of the resulting residue with alkaline sodium borohydride to a mixture of two tertiary amines with subsequent determination by nitrogen-selective gas chromatography (GLC). Recoveries ranged from 74 to 96% for filters spiked at 0.05 microgram and above; the limit of detection is approximately 0.5 ng/m3 for high volume air samples. Paraquat concentrations measured in the air downwind from two commercial applications to cotton during spraying fell regularly from extrapolated interval-average values of 4.31 and 10.7 microgram/m3 at the 1 m downwind edge of the two fields to less than 50 ng/m3 at approximately 400 m downwind. Downwind samples taken 2 to 4 hr after spraying contained 1 to 10% as much paraquat as those during spraying, and by 5 to 7 hr no paraquat was detectable in the downwind air. Paraquat was also found in the airborne particulate matter during mechanical harvesting of one of the fields, the maximum interval-average values being 1,245 and 516 ng/m3 just outside and inside an open cab, respectively. The analytical findings for paraquat are compared with those for S,S,S-tributylphosphorotrithioate (DEF), a component of the harvest aid mixture employed, and discussed in terms of occupational exposure, potential hazard, and recommended occupational practices. PMID:7224666

  15. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal field, California, was measured at 150, 200, and 250 C as a function of steam pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption and desorption runs were made in order to investigate the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were made on the same rock samples. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there was no direct correlation between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The hysteresis decreased significantly at 250 C. The results indicate that multilayer adsorption, rather than capillary condensation, is the dominant water storage mechanism at high temperatures.

  16. The optical-infrared colour distribution of a statistically complete sample of faint field spheroidal galaxies

    NASA Astrophysics Data System (ADS)

    Menanteau, F.; Ellis, R. S.; Abraham, R. G.; Barger, A. J.; Cowie, L. L.

    1999-10-01

    In hierarchical models, where spheroidal galaxies are primarily produced via a continuous merging of disc galaxies, the number of intrinsically red systems at faint limits will be substantially lower than in `traditional' models where the bulk of star formation was completed at high redshifts. In this paper we analyse the optical-near-infrared colour distribution of a large flux-limited sample of field spheroidal galaxies identified morphologically from archival Hubble Space Telescope data. The I_814-HK' colour distribution for a sample jointly limited at I_814<23mag and HK'<19.5mag is used to constrain their star formation history. We compare visual and automated methods for selecting spheroidals from our deep HST images and, in both cases, detect a significant deficit of intrinsically red spheroidals relative to the predictions of high-redshift monolithic-collapse models. However, the overall space density of spheroidals (irrespective of colour) is not substantially different from that seen locally. Spectral synthesis modelling of our results suggests that high-redshift spheroidals are dominated by evolved stellar populations polluted by some amount of subsidiary star formation. Despite its effect on the optical-infrared colour, this star formation probably makes only a modest contribution to the overall stellar mass. We briefly discuss the implications of our results in the context of earlier predictions based on models where spheroidals assemble hierarchically.

  17. Acquisition of a High Resolution Field Emission Scanning Electron Microscope for the Analysis of Returned Samples

    NASA Technical Reports Server (NTRS)

    Nittler, Larry R.

    2003-01-01

    This grant furnished funds to purchase a state-of-the-art scanning electron microscope (SEM) to support our analytical facilities for extraterrestrial samples. After evaluating several instruments, we purchased a JEOL 6500F thermal field emission SEM with the following analytical accessories: EDAX energy-dispersive x-ray analysis system with fully automated control of instrument and sample stage; EDAX LEXS wavelength-dispersive x-ray spectrometer for high sensitivity light-element analysis; EDAX/TSL electron backscatter diffraction (EBSD) system with software for phase identification and crystal orientation mapping; Robinson backscatter electron detector; and an in situ micro-manipulator (Kleindiek). The total price was $550,000 (with $150,000 of the purchase supported by Carnegie institution matching funds). The microscope was delivered in October 2002, and most of the analytical accessories were installed by January 2003. With the exception of the wavelength spectrometer (which has been undergoing design changes) everything is working well and the SEM is in routine use in our laboratory.

  18. Determination of ephedrine and pseudoephedrine by field-amplified sample injection capillary electrophoresis.

    PubMed

    Deng, Dongli; Deng, Hao; Zhang, Lichun; Su, Yingying

    2014-04-01

    A simple and rapid capillary electrophoresis method was developed for the separation and determination of ephedrine (E) and pseudoephedrine (PE) in a buffer solution containing 80 mM of NaH2PO4 (pH 3.0), 15 mM of β-cyclodextrin and 0.3% of hydroxypropyl methylcellulose. The field-amplified sample injection (FASI) technique was applied to the online concentration of the alkaloids. With FASI in the presence of a low conductivity solvent plug (water), an approximately 1,000-fold improvement in sensitivity was achieved without any loss of separation efficiency when compared to conventional sample injection. Under these optimized conditions, a baseline separation of the two analytes was achieved within 16 min and the detection limits for E and PE were 0.7 and 0.6 µg/L, respectively. Without expensive instruments or labeling of the compounds, the limits of detection for E and PE obtained by the proposed method are comparable with (or even lower than) those obtained by capillary electrophoresis laser-induced fluorescence, liquid chromatography-tandem mass spectrometry and gas chromatography-mass spectrometry. The method was validated in terms of precision, linearity and accuracy, and successfully applied for the determination of the two alkaloids in Ephedra herbs. PMID:23619557

  19. In-Field Diffuse Ultraviolet Spectroscopy and Imaging of the Stardust Sample Return Capsule

    NASA Technical Reports Server (NTRS)

    Pugel, D. Elizabeth; Stackpoole, Mairead; McNamara, Karen; Schwartz, C.; Warren, J.; Kontinos, Dean

    2008-01-01

    In-field diffuse Ultraviolet (UV) spectroscopy and imaging systems were developed for the purposes of evaluating the surface chemical composition of spacecraft thermal control coatings and materials. The investigation of these systems and the compilation of an associated UV reflectance and luminescence database were conducted using the Stardust Sample Return Capsule (SRC), located at the Johnson Space Center. Spectral responses of the surfaces of the Stardust forebody and aftbody in both reflectance and fluorescence modes were examined post-flight. In this paper, we report on two primary findings of in-field diffuse UV spectroscopy and imaging: (1) deduction of the thermal history of thermal control coatings of the forebody and (2) bond line variations in the aftbody. In the forebody, the thermal history of thermal control coatings may be deduced from the presence of particular semiconducting defect states associated with ZnO, a common emissivity constituent in thermal control coatings. A spatial dependence of this history was mapped for these regions. In the aftbody, luminescing defect states, associated with Si and SiO2 color centers were found along regions of bond variability.

  20. FIELD-DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-09-12

    Methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of aqueous spent fuel storage basins and determine the oxide thickness on the spent fuel basin materials were developed to assess the corrosion potential of a basin. this assessment can then be used to determine the amount of time fuel has spent in a storage basin to ascertain if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations and assist in evaluating general storage basin operations. The test kit was developed based on the identification of key physical, chemical and microbiological parameters identified using a review of the scientific and basin operations literature. The parameters were used to design bench scale test cells for additional corrosion analyses, and then tools were purchased to analyze the key parameters. The tools were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The sampling kit consisted of a total organic carbon analyzer, an YSI multiprobe, and a thickness probe. The tools were field tested to determine their ease of use, reliability, and determine the quality of data that each tool could provide. Characterization confirmed that the L Area basin is a well operated facility with low corrosion potential.

  1. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling.

    PubMed

    Aerts, Sam; Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-01

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information-inside hotspots or in search of them-based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km2. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96. PMID:23759207

  2. Moving your laboratories to the field – Advantages and limitations of the use of field portable instruments in environmental sample analysis

    SciTech Connect

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M.; Namieśnik, Jacek

    2015-07-15

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet–visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. - Highlights: • Field portable instruments are widely used in environmental sample analysis. • Field portable instruments are indispensable for analysis in emergency response. • Miniaturization of field portable instruments reduces resource consumption. • In situ analysis is in agreement with green analytical chemistry

  3. Development of sampling approaches for the determination of the presence of genetically modified organisms at the field level.

    PubMed

    Sustar-Vozlic, Jelka; Rostohar, Katja; Blejec, Andrej; Kozjak, Petra; Cergan, Zoran; Meglic, Vladimir

    2010-03-01

    In order to comply with the European Union regulatory threshold for the adventitious presence of genetically modified organisms (GMOs) in food and feed, it is important to trace GMOs from the field. Appropriate sampling methods are needed to accurately predict the presence of GMOs at the field level. A 2-year field experiment with two maize varieties differing in kernel colour was conducted in Slovenia. Based on the results of data mining analyses and modelling, it was concluded that spatial relations between the donor and receptor field were the most important factors influencing the distribution of outcrossing rate (OCR) in the field. The approach for estimation fitting function parameters in the receptor (non-GM) field at two distances from the donor (GM) field (10 and 25 m) for estimation of the OCR (GMO content) in the whole receptor field was developed. Different sampling schemes were tested; a systematic random scheme in rows was proposed to be applied for sampling at the two distances for the estimation of fitting function parameters for determination of OCR. The sampling approach had already been validated with some other OCR data and was practically applied in the 2009 harvest in Poland. The developed approach can be used for determination of the GMO presence at the field level and for making appropriate labelling decisions. The importance of this approach lies in its possibility to also address other threshold levels beside the currently prescribed labelling threshold of 0.9% for food and feed. PMID:20069281

  4. Use of field-applied quality control samples to monitor performance of a Goulden large-sample extractor/GC-MS method for pesticides in water

    USGS Publications Warehouse

    Foreman, W.T.; Gates, Paul M.; Foster, G.D.; Rinella, F.A.; McKenzie, S.W.

    2000-01-01

    Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4'-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50-ng/L each. Recoveries ranged from not detected to greater than 100%. Variability in pesticide recoveries from triplicate 10-L water samples collected at one site averaged 5.7% relative standard deviation and did not exceed 19%.Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4???-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50

  5. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  6. Characterisation of radiation field for irradiation of biological samples at nuclear reactor-comparison of twin detector and recombination methods.

    PubMed

    Golnik, N; Gryziński, M A; Kowalska, M; Meronka, K; Tulik, P

    2014-10-01

    Central Laboratory for Radiological Protection is involved in achieving scientific project on biological dosimetry. The project includes irradiation of blood samples in radiation fields of nuclear reactor. A simple facility for irradiation of biological samples has been prepared at horizontal channel of the nuclear reactor MARIA in NCBJ in Poland. The radiation field, composed mainly of gamma radiation and thermal neutrons, has been characterised in terms of tissue kerma using twin-detector technique and recombination chambers. PMID:24366246

  7. The actual goals of geoethics

    NASA Astrophysics Data System (ADS)

    Nemec, Vaclav

    2014-05-01

    The most actual goals of geoethics have been formulated as results of the International Conference on Geoethics (October 2013) held at the geoethics birth-place Pribram (Czech Republic): In the sphere of education and public enlightenment an appropriate needed minimum know how of Earth sciences should be intensively promoted together with cultivating ethical way of thinking and acting for the sustainable well-being of the society. The actual activities of the Intergovernmental Panel of Climate Changes are not sustainable with the existing knowledge of the Earth sciences (as presented in the results of the 33rd and 34th International Geological Congresses). This knowledge should be incorporated into any further work of the IPCC. In the sphere of legislation in a large international co-operation following steps are needed: - to re-formulate the term of a "false alarm" and its legal consequences, - to demand very consequently the needed evaluation of existing risks, - to solve problems of rights of individuals and minorities in cases of the optimum use of mineral resources and of the optimum protection of the local population against emergency dangers and disasters; common good (well-being) must be considered as the priority when solving ethical dilemmas. The precaution principle should be applied in any decision making process. Earth scientists presenting their expert opinions are not exempted from civil, administrative or even criminal liabilities. Details must be established by national law and jurisprudence. The well known case of the L'Aquila earthquake (2009) should serve as a serious warning because of the proven misuse of geoethics for protecting top Italian seismologists responsible and sentenced for their inadequate superficial behaviour causing lot of human victims. Another recent scandal with the Himalayan fossil fraud will be also documented. A support is needed for any effort to analyze and to disclose the problems of the deformation of the contemporary

  8. Spatially-Optimized Sequential Sampling Plan for Cabbage Aphids Brevicoryne brassicae L. (Hemiptera: Aphididae) in Canola Fields.

    PubMed

    Severtson, Dustin; Flower, Ken; Nansen, Christian

    2016-08-01

    The cabbage aphid is a significant pest worldwide in brassica crops, including canola. This pest has shown considerable ability to develop resistance to insecticides, so these should only be applied on a "when and where needed" basis. Thus, optimized sampling plans to accurately assess cabbage aphid densities are critically important to determine the potential need for pesticide applications. In this study, we developed a spatially optimized binomial sequential sampling plan for cabbage aphids in canola fields. Based on five sampled canola fields, sampling plans were developed using 0.1, 0.2, and 0.3 proportions of plants infested as action thresholds. Average sample numbers required to make a decision ranged from 10 to 25 plants. Decreasing acceptable error from 10 to 5% was not considered practically feasible, as it substantially increased the number of samples required to reach a decision. We determined the relationship between the proportions of canola plants infested and cabbage aphid densities per plant, and proposed a spatially optimized sequential sampling plan for cabbage aphids in canola fields, in which spatial features (i.e., edge effects) and optimization of sampling effort (i.e., sequential sampling) are combined. Two forms of stratification were performed to reduce spatial variability caused by edge effects and large field sizes. Spatially optimized sampling, starting at the edge of fields, reduced spatial variability and therefore increased the accuracy of infested plant density estimates. The proposed spatially optimized sampling plan may be used to spatially target insecticide applications, resulting in cost savings, insecticide resistance mitigation, conservation of natural enemies, and reduced environmental impact. PMID:27371709

  9. DETERMINATION OF FENTHION RESIDUES IN SAMPLES OF MARINE BIOTA AND SEAWATER FROM LABORATORY EXPOSURES AND FIELD APPLICATIONS

    EPA Science Inventory

    A method for measuring fenthion in samples from the estuarine environment is described. The method was applied to samples from field applications of fenthion to control saltmarsh mosquitos. The method, offers an improvement in the silica gel cleanup of Watts (11), and yields grea...

  10. Pre-Mission Input Requirements to Enable Successful Sample Collection by A Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Lim, D. S. S.; Young, K. E.; Brunner, A.; Elphic, R. E.; Horne, A.; Kerrigan, M. C.; Osinski, G. R.; Skok, J. R.; Squyres, S. W.; Saint-Jacques, D.; Heldmann, J. L.

    2016-01-01

    The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team, part of the Solar System Exploration Virtual Institute (SSERVI), is a field-based research program aimed at generating strategic knowledge in preparation for human and robotic exploration of the Moon, near-Earth asteroids, Phobos and Deimos, and beyond. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused and, moreover, is sampling-focused with the explicit intent to return the best samples for geochronology studies in the laboratory. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. We examined the in situ sample characterization and real-time decision-making process of the astronauts, with a guiding hypothesis that pre-mission training that included detailed background information on the analytical fate of a sample would better enable future astronauts to select samples that would best meet science requirements. We conducted three tests of this hypothesis over several days in the field. Our investigation was designed to document processes, tools and procedures for crew sampling of planetary targets. This was not meant to be a blind, controlled test of crew efficacy, but rather an effort to explicitly recognize the relevant variables that enter into sampling protocol and to be able to develop recommendations for crew and backroom training in future endeavors.

  11. Energy dissipation rate of a sample-induced thermal fluctuating field in the tip of a probe microscope

    NASA Astrophysics Data System (ADS)

    Dorofeyev, I. A.

    1998-03-01

    Fluctuation electrodynamics was used as a basis to obtain an expression for the dissipation power of a thermal electromagnetic field of a heated plane sample in the tip of a probe microscope, as a function of the value of a gap between them. We have shown that the energy dissipation rate is inversely proportional to the tip-sample distance cubed.

  12. High volume electrostatic field-sampler for collection of fine particle bulk samples

    NASA Astrophysics Data System (ADS)

    Kumar Sharma, Anoop; Wallin, Håkan; Alstrup Jensen, Keld

    A high volume electrostatic field-sampler was developed for collection of fine particles, which easily can be recovered for subsequent sample characterisation and bioassays. The sampler was based on a commercial office air cleaner and consisted of a prefilter followed by electrostatic collection plates operating at 2.7 kV. The sampler performance was characterised for 26 nm to 5.4 μm-size particles in urban street air. The collection efficiency reached a maximum (60-70%) between 0.2 and 0.8 μm and dropped to ˜25% at 30 nm and 2.5 μm, respectively. After extraction in water, the particle loss was<2%. The extraction efficiency for dry lyophilised particulate matter was above 80%, allowing retrievement of ˜12 mg day -1 in urban street air at PM 10 levels of ˜24 μg m -3. The ozone generating capacity of the corona discharge during operation was on the order of 10 ppb. A polycyclic aromatic hydrocarbons (PAH) degradation test using benzo[a]pyrene as a model showed that ˜85% was degraded after 24 h. However, similar results were observed when the corona discharge was switched off. Hence, the ozone and other corona discharge reactants do not appear to contribute considerably to PAH-degradation. The overall results show that the sampler type is a promising alternative to traditional sampling of fine particles for bulk analysis and bioassays. The main advantages are simple operation, high stability, high quantifiable particle recovery rates and low cost.

  13. Experiments with central-limit properties of spatial samples from locally covariant random fields

    USGS Publications Warehouse

    Barringer, T.H.; Smith, T.E.

    1992-01-01

    When spatial samples are statistically dependent, the classical estimator of sample-mean standard deviation is well known to be inconsistent. For locally dependent samples, however, consistent estimators of sample-mean standard deviation can be constructed. The present paper investigates the sampling properties of one such estimator, designated as the tau estimator of sample-mean standard deviation. In particular, the asymptotic normality properties of standardized sample means based on tau estimators are studied in terms of computer experiments with simulated sample-mean distributions. The effects of both sample size and dependency levels among samples are examined for various value of tau (denoting the size of the spatial kernel for the estimator). The results suggest that even for small degrees of spatial dependency, the tau estimator exhibits significantly stronger normality properties than does the classical estimator of standardized sample means. ?? 1992.

  14. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling

    SciTech Connect

    Aerts, Sam Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-15

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information—inside hotspots or in search of them—based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km{sup 2}. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2 dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96. -- Highlights: • We present an

  15. DEVELOPMENT OF METHODOLOGY AND FIELD DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-06-04

    This project developed methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of the fuel storage medium and determine the oxide thickness on the spent fuel basin materials. The overall objective of this project was to determine the amount of time fuel has spent in a storage basin to determine if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations. This project developed and validated forensic tools that can be used to predict the age and condition of spent nuclear fuels stored in liquid basins based on key physical, chemical and microbiological basin characteristics. Key parameters were identified based on a literature review, the parameters were used to design test cells for corrosion analyses, tools were purchased to analyze the key parameters, and these were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The key parameters identified in the literature review included chloride concentration, conductivity, and total organic carbon level. Focus was also placed on aluminum based cladding because of their application to weapons production. The literature review was helpful in identifying important parameters, but relationships between these parameters and corrosion rates were not available. Bench scale test systems were designed, operated, harvested, and analyzed to determine corrosion relationships between water parameters and water conditions, chemistry and microbiological conditions. The data from the bench scale system indicated that corrosion rates were dependent on total organic carbon levels and chloride concentrations. The highest corrosion rates were observed in test cells amended with sediment, a large microbial inoculum and an organic carbon source. A complete characterization test kit was field tested to characterize the SRS L-Area spent fuel basin. The sampling kit consisted of a TOC analyzer, a YSI

  16. Ca II Triplet Spectroscopy of Small Magellanic Cloud Red Giants. IV. Abundances for a Large Sample of Field Stars and Comparison with the Cluster Sample

    NASA Astrophysics Data System (ADS)

    Parisi, M. C.; Geisler, D.; Carraro, G.; Clariá, J. J.; Villanova, S.; Gramajo, L. V.; Sarajedini, A.; Grocholski, A. J.

    2016-09-01

    This paper represents a major step forward in the systematic and homogeneous study of Small Magellanic Cloud (SMC) star clusters and field stars carried out by applying the calcium triplet technique. We present in this work the radial velocity and metallicity of approximately 400 red giant stars in 15 SMC fields, with typical errors of about 7 km s‑1 and 0.16 dex, respectively. We added to this information our previously determined metallicity values for 29 clusters and approximately 350 field stars using the identical techniques. Using this enlarged sample, we analyze the metallicity distribution and gradient in this galaxy. We also compare the chemical properties of the clusters and of their surrounding fields. We find a number of surprising results. While the clusters, taken as a whole, show no strong evidence for a metallicity gradient (MG), the field stars exhibit a clear negative gradient in the inner region of the SMC, consistent with the recent results of Dobbie et al. For distances to the center of the galaxy less than 4°, field stars show a considerably smaller metallicity dispersion than that of the clusters. However, in the external SMC regions, clusters and field stars exhibit similar metallicity dispersions. Moreover, in the inner region of the SMC, clusters appear to be concentrated in two groups: one more metal-poor and another more metal-rich than field stars. Individually considered, neither cluster group presents an MG. Most surprisingly, the MG for both stellar populations (clusters and field stars) appears to reverse sign in the outer regions of the SMC. The difference between the cluster metallicity and the mean metallicity of the surrounding field stars turns out to be a strong function of the cluster metallicity. These results could be indicating different chemical evolution histories for these two SMC stellar populations. They could also indicate variations in the chemical behavior of the SMC in its internal and external regions.

  17. Field guide for collecting and processing stream-water samples for the National Water-Quality Assessment Program

    USGS Publications Warehouse

    Shelton, Larry R.

    1994-01-01

    The U.S. Geological Survey's National Water-Quality Assessment program includes extensive data- collection efforts to assess the quality of the Nations's streams. These studies require analyses of stream samples for major ions, nutrients, sediments, and organic contaminants. For the information to be comparable among studies in different parts of the Nation, consistent procedures specifically designed to produce uncontaminated samples for trace analysis in the laboratory are critical. This field guide describes the standard procedures for collecting and processing samples for major ions, nutrients, organic contaminants, sediment, and field analyses of conductivity, pH, alkalinity, and dissolved oxygen. Samples are collected and processed using modified and newly designed equipment made of Teflon to avoid contamination, including nonmetallic samplers (D-77 and DH-81) and a Teflon sample splitter. Field solid-phase extraction procedures developed to process samples for organic constituent analyses produce an extracted sample with stabilized compounds for more accurate results. Improvements to standard operational procedures include the use of processing chambers and capsule filtering systems. A modified collecting and processing procedure for organic carbon is designed to avoid contamination from equipment cleaned with methanol. Quality assurance is maintained by strict collecting and processing procedures, replicate sampling, equipment blank samples, and a rigid cleaning procedure using detergent, hydrochloric acid, and methanol.

  18. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields

    SciTech Connect

    Armas-Pérez, Julio C.; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P.; Pablo, Juan J. de

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  19. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    SciTech Connect

    Armas-Perez, Julio C.; Londono-Hurtado, Alejandro; Guzman, Orlando; Hernandez-Ortiz, Juan P.; de Pablo, Juan J.

    2015-07-27

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  20. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    PubMed

    Armas-Pérez, Julio C; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P; de Pablo, Juan J

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate. PMID:26233107

  1. Field evaluation of carbon dioxide baits for sampling Ornithodoros turicata (Acari: Argasidae) in gopher tortoise burrows.

    PubMed

    Adeyeye, O A; Butler, J F

    1991-01-01

    Field studies were conducted to assess the reliability of carbon dioxide baits in sampling Ornithodoros turicata Duges. Tick response to about 50 g of dry ice placed at various distances away from tick-infested burrows was monitored over a 2-h period. In addition, tick attraction to different flow rates of carbon dioxide was monitored. Tests were conducted over a 15-mo period, during which seasonal effects on O. turicata response to CO2 were assessed. The efficacy of the baits was evaluated at night and in daytime. Ticks responded to dry ice baits placed up to 8 m away from the burrows. There was no significant difference in the total number of ticks attracted in a 1-h period using 500 to 2,000 ml CO2/min. At night, ticks were attracted to CO2 bits throughout the year except in December and January. By contrast, ticks were attracted to CO2 baits during daytime only between May and mid-December. PMID:1903452

  2. Where do the Field Plots Belong? A Multiple-Constraint Sampling Design for the BigFoot Project

    NASA Astrophysics Data System (ADS)

    Kennedy, R. E.; Cohen, W. B.; Kirschbaum, A. A.; Gower, S. T.

    2002-12-01

    A key component of a MODIS validation project is effective characterization of biophysical measures on the ground. Fine-grain ecological field measurements must be placed strategically to capture variability at the scale of the MODIS imagery. Here we describe the BigFoot project's revised sampling scheme, designed to simultaneously meet three important goals: capture landscape variability, avoid spatial autocorrelation between field plots, and minimize time and expense of field sampling. A stochastic process places plots in clumped constellations to reduce field sampling costs, while minimizing spatial autocorrelation. This stochastic process is repeated, creating several hundred realizations of plot constellations. Each constellation is scored and ranked according to its ability to match landscape variability in several Landsat-based spectral indices, and its ability to minimize field sampling costs. We show how this approach has recently been used to place sample plots at the BigFoot project's two newest study areas, one in a desert system and one in a tundra system. We also contrast this sampling approach to that already used at the four prior BigFoot project sites.

  3. Moving your laboratories to the field--Advantages and limitations of the use of field portable instruments in environmental sample analysis.

    PubMed

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M; Namieśnik, Jacek

    2015-07-01

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet-visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. PMID:26051907

  4. Laboratory development and field evaluation of a generic method for sampling and analysis of isocyanates. Revised final report

    SciTech Connect

    McGaughey, J.F.; Foster, S.C.; Merrill, R.G.

    1995-09-01

    The U.S. Environmental Protection Agency (EPA), under the authority of Title III of the Clean Air Act Amendments (CAAA) of 1990, requires the identification and validation of sampling and analytical methods for the isocyanate compounds which are listed among the 189 hazardous air pollutants identified in Title III. In all, three field tests were performed to accomplish the isocyanate field evaluation. The objective of this work was to develop and evaluate the isocyanate sampling and analytical test method through field testing at operating stationary sources. The method was evaluated by collecting flue gas samples for the analysis of the individual isocyanate and evaluating the data for bias and precision. EPA Method 301, Field Validation of Pollutant Measurement Methods from Various Waste Media, was used as the model for the experimental design of this method evaluation project.

  5. The Use of Satellite Imagery to Guide Field Plot Sampling Scheme for Biomass Estimation in Ghanaian Forest

    NASA Astrophysics Data System (ADS)

    Sah, B. P.; Hämäläinen, J. M.; Sah, A. K.; Honji, K.; Foli, E. G.; Awudi, C.

    2012-07-01

    Accurate and reliable estimation of biomass in tropical forest has been a challenging task because a large proportion of forests are difficult to access or inaccessible. So, for effective implementation of REDD+ and fair benefit sharing, the proper designing of field plot sampling schemes plays a significant role in achieving robust biomass estimation. The existing forest inventory protocols using various field plot sampling schemes, including FAO's regular grid concept of sampling for land cover inventory at national level, are time and human resource intensive. Wall to wall LiDAR scanning is, however, a better approach to assess biomass with high precision and spatial resolution even though this approach suffers from high costs. Considering the above, in this study a sampling design based on a LiDAR strips sampling scheme has been devised for Ghanaian forests to support field plot sampling. Using Top-of-Atmosphere (TOA) reflectance value of satellite data, Land Use classification was carried out in accordance with IPCC definitions and the resulting classes were further stratified, incorporating existing GIS data of ecological zones in the study area. Employing this result, LiDAR sampling strips were allocated using systematic sampling techniques. The resulting LiDAR strips represented all forest categories, as well as other Land Use classes, with their distribution adequately representing the areal share of each category. In this way, out of at total area of 15,153km2 of the study area, LiDAR scanning was required for only 770 km2 (sampling intensity being 5.1%). We conclude that this systematic LiDAR sampling design is likely to adequately cover variation in above-ground biomass densities and serve as sufficient a-priori data, together with the Land Use classification produced, for designing efficient field plot sampling over the seven ecological zones.

  6. Field geologic observation and sample collection strategies for planetary surface exploration: Insights from the 2010 Desert RATS geologist crewmembers

    NASA Astrophysics Data System (ADS)

    Hurtado, José M.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W.

    2013-10-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic fieldwork, the Desert RATS (Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crewmembers who participated in the 2010 field test. We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies related to duplication of samples and observations; logistical constraints on the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to "flexibly execute" their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  7. Field Geologic Observation and Sample Collection Strategies for Planetary Surface Exploration: Insights from the 2010 Desert RATS Geologist Crewmembers

    NASA Technical Reports Server (NTRS)

    Hurtado, Jose M., Jr.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W., Jr.

    2012-01-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic field- work, the Desert RATS(Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crew members who participated in the 2010 field test.We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies relatedtoduplicationofsamplesandobservations;logisticalconstraintson the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to flexibly execute their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  8. THE IMPORTANCE OF THE MAGNETIC FIELD FROM AN SMA-CSO-COMBINED SAMPLE OF STAR-FORMING REGIONS

    SciTech Connect

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Chen, Huei-Ru Vivien; Liu, Hau-Yu Baobab; Yen, Hsi-Wei; Lai, Shih-Ping; Zhang, Qizhou; Chen, How-Huan; Ching, Tao-Chung; Girart, Josep M.; Frau, Pau; Li, Hua-Bai; Li, Zhi-Yun; Padovani, Marco; Qiu, Keping; Rao, Ramprasad

    2014-12-20

    Submillimeter dust polarization measurements of a sample of 50 star-forming regions, observed with the Submillimeter Array (SMA) and the Caltech Submillimeter Observatory (CSO) covering parsec-scale clouds to milliparsec-scale cores, are analyzed in order to quantify the magnetic field importance. The magnetic field misalignment δ—the local angle between magnetic field and dust emission gradient—is found to be a prime observable, revealing distinct distributions for sources where the magnetic field is preferentially aligned with or perpendicular to the source minor axis. Source-averaged misalignment angles (|δ|) fall into systematically different ranges, reflecting the different source-magnetic field configurations. Possible bimodal (|δ|) distributions are found for the separate SMA and CSO samples. Combining both samples broadens the distribution with a wide maximum peak at small (|δ|) values. Assuming the 50 sources to be representative, the prevailing source-magnetic field configuration is one that statistically prefers small magnetic field misalignments |δ|. When interpreting |δ| together with a magnetohydrodynamics force equation, as developed in the framework of the polarization-intensity gradient method, a sample-based log-linear scaling fits the magnetic field tension-to-gravity force ratio (Σ {sub B}) versus (|δ|) with (Σ {sub B}) = 0.116 · exp (0.047 · (|δ|)) ± 0.20 (mean error), providing a way to estimate the relative importance of the magnetic field, only based on measurable field misalignments |δ|. The force ratio Σ {sub B} discriminates systems that are collapsible on average ((Σ {sub B}) < 1) from other molecular clouds where the magnetic field still provides enough resistance against gravitational collapse ((Σ {sub B}) > 1). The sample-wide trend shows a transition around (|δ|) ≈ 45°. Defining an effective gravitational force ∼1 – (Σ {sub B}), the average magnetic-field-reduced star formation efficiency is at least a

  9. Optimized Field Sampling and Monitoring of Airborne Hazardous Transport Plumes; A Geostatistical Simulation Approach

    SciTech Connect

    Chen, DI-WEN

    2001-11-21

    Airborne hazardous plumes inadvertently released during nuclear/chemical/biological incidents are mostly of unknown composition and concentration until measurements are taken of post-accident ground concentrations from plume-ground deposition of constituents. Unfortunately, measurements often are days post-incident and rely on hazardous manned air-vehicle measurements. Before this happens, computational plume migration models are the only source of information on the plume characteristics, constituents, concentrations, directions of travel, ground deposition, etc. A mobile ''lighter than air'' (LTA) system is being developed at Oak Ridge National Laboratory that will be part of the first response in emergency conditions. These interactive and remote unmanned air vehicles will carry light-weight detectors and weather instrumentation to measure the conditions during and after plume release. This requires a cooperative computationally organized, GPS-controlled set of LTA's that self-coordinate around the objectives in an emergency situation in restricted time frames. A critical step before an optimum and cost-effective field sampling and monitoring program proceeds is the collection of data that provides statistically significant information, collected in a reliable and expeditious manner. Efficient aerial arrangements of the detectors taking the data (for active airborne release conditions) are necessary for plume identification, computational 3-dimensional reconstruction, and source distribution functions. This report describes the application of stochastic or geostatistical simulations to delineate the plume for guiding subsequent sampling and monitoring designs. A case study is presented of building digital plume images, based on existing ''hard'' experimental data and ''soft'' preliminary transport modeling results of Prairie Grass Trials Site. Markov Bayes Simulation, a coupled Bayesian/geostatistical methodology, quantitatively combines soft information

  10. Sampling and Analysis of Impact Crater Residues found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R. P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years on orbit, the Wide Field Planetary Camera-2 (WFPC-2) was recovered from the Hubble Space Telescope in May 2009 during the 12 day shuttle mission designated STS-125. During that exposure to the low Earth orbit environment, the WFPC-2 radiator was struck by approximately 700 impactors producing crater features 300 micrometers and larger in size. Following an optical inspection of these features in 2009, an agreement was reached for the joint NASA-ESA examination and characterization of crater residues, the remnants of the projectile, in 2011. Active examination began in 2012, with 486 of the impact features being cored at NASA Johnson Space Center fs (JSC) Space Exposed Hardware cleanroom and curation facility. The core samples were subsequently divided between NASA and ESA. NASA's analysis was conducted at JSC fs Astromaterials Research and Exploration Science (ARES) Division, using scanning electron microscopy (SEM)/ energy dispersive X-ray spectrometry (EDS) methods, and ESA's analysis was conducted at the Natural History Museum (NHM) again using SEM/EDS, and at the University of Surrey Ion Beam Centre (IBC) using ion beam analysis (IBA) with a scanned proton microbeam. As detailed discussion of the joint findings remains premature at this point, this paper reports on the coring technique developed; the practical taxonomy developed to classify residues as belonging either to anthropogenic "orbital debris" or micrometeoroids; and the protocols for examination of crater residues. Challenges addressed in coring were the relative thickness of the surface to be cut, protection of the impact feature from contamination while coring, and the need to preserve the cleanroom environment so as to preclude or minimize cross-contamination. Classification criteria are summarized, including the assessment of surface contamination and surface cleaning. Finally, we discuss the analytical techniques used to examine the crater residues. We employed EDS from

  11. Integrating field sampling, spatial statistics and remote sensing to map wetland vegetation in the Pantanal, Brazil

    NASA Astrophysics Data System (ADS)

    Arieira, J.; Karssenberg, D.; de Jong, S. M.; Addink, E. A.; Couto, E. G.; Nunes da Cunha, C.; Skøien, J. O.

    2010-09-01

    To improve the protection of wetlands, it is imperative to have a thorough understanding of their structuring elements and of the identification of efficient methods to describe and monitor them. This article uses sophisticated statistical classification, interpolation and error propagation techniques, in order to describe vegetation spatial patterns, map plant community distribution and evaluate the capability of statistical approaches to produce high-quality vegetation maps. The approach results in seven vegetation communities with a known floral composition that can be mapped over large areas using remotely sensed data. The relations between remotely sensing data and vegetation patterns, captured in four factorial axes, were formalized mathematically in multiple linear regression models and used in a universal kriging procedure to reduce the uncertainty in mapped communities. Universal kriging has shown to be a valuable interpolation technique because parts of vegetation variability not explained by the images could be modeled as spatially correlated residuals, increasing prediction accuracy. Differences in spatial dependence of the vegetation gradients evidenced the multi-scale nature of vegetation communities. Cross validation procedures and Monte Carlo simulations were used to quantify the uncertainty in the resulting map. Cross-validation showed that accuracy in classification varies according with the community type, as a result of sampling density and configuration. A map of uncertainty resulted from Monte Carlo simulations displayed the spatial variation in classification accuracy, showing that the quality of classification varies spatially, even though the proportion and arrangement of communities observed in the original map is preserved to a great extent. These results suggested that mapping improvement could be achieved by increasing the number of field observations of those communities with a scattered and small patch size distribution; or by

  12. Linguistic Theory and Actual Language.

    ERIC Educational Resources Information Center

    Segerdahl, Par

    1995-01-01

    Examines Noam Chomsky's (1957) discussion of "grammaticalness" and the role of linguistics in the "correct" way of speaking and writing. It is argued that the concern of linguistics with the tools of grammar has resulted in confusion, with the tools becoming mixed up with the actual language, thereby becoming the central element in a metaphysical…

  13. Whiteheadian Actual Entitities and String Theory

    NASA Astrophysics Data System (ADS)

    Bracken, Joseph A.

    2012-06-01

    In the philosophy of Alfred North Whitehead, the ultimate units of reality are actual entities, momentary self-constituting subjects of experience which are too small to be sensibly perceived. Their combination into "societies" with a "common element of form" produces the organisms and inanimate things of ordinary sense experience. According to the proponents of string theory, tiny vibrating strings are the ultimate constituents of physical reality which in harmonious combination yield perceptible entities at the macroscopic level of physical reality. Given that the number of Whiteheadian actual entities and of individual strings within string theory are beyond reckoning at any given moment, could they be two ways to describe the same non-verifiable foundational reality? For example, if one could establish that the "superject" or objective pattern of self- constitution of an actual entity vibrates at a specific frequency, its affinity with the individual strings of string theory would be striking. Likewise, if one were to claim that the size and complexity of Whiteheadian 'societies" require different space-time parameters for the dynamic interrelationship of constituent actual entities, would that at least partially account for the assumption of 10 or even 26 instead of just 3 dimensions within string theory? The overall conclusion of this article is that, if a suitably revised understanding of Whiteheadian metaphysics were seen as compatible with the philosophical implications of string theory, their combination into a single world view would strengthen the plausibility of both schemes taken separately. Key words: actual entities, subject/superjects, vibrating strings, structured fields of activity, multi-dimensional physical reality.

  14. Computational ligand-based rational design: Role of conformational sampling and force fields in model development

    PubMed Central

    Shim, Jihyun; MacKerell, Alexander D.

    2011-01-01

    A significant number of drug discovery efforts are based on natural products or high throughput screens from which compounds showing potential therapeutic effects are identified without knowledge of the target molecule or its 3D structure. In such cases computational ligand-based drug design (LBDD) can accelerate the drug discovery processes. LBDD is a general approach to elucidate the relationship of a compound's structure and physicochemical attributes to its biological activity. The resulting structure-activity relationship (SAR) may then act as the basis for the prediction of compounds with improved biological attributes. LBDD methods range from pharmacophore models identifying essential features of ligands responsible for their activity, quantitative structure-activity relationships (QSAR) yielding quantitative estimates of activities based on physiochemical properties, and to similarity searching, which explores compounds with similar properties as well as various combinations of the above. A number of recent LBDD approaches involve the use of multiple conformations of the ligands being studied. One of the basic components to generate multiple conformations in LBDD is molecular mechanics (MM), which apply an empirical energy function to relate conformation to energies and forces. The collection of conformations for ligands is then combined with functional data using methods ranging from regression analysis to neural networks, from which the SAR is determined. Accordingly, for effective application of LBDD for SAR determinations it is important that the compounds be accurately modelled such that the appropriate range of conformations accessible to the ligands is identified. Such accurate modelling is largely based on use of the appropriate empirical force field for the molecules being investigated and the approaches used to generate the conformations. The present chapter includes a brief overview of currently used SAR methods in LBDD followed by a more

  15. Larval sampling and instar determination in field populations of northern and western corn rootworm (Coleoptera: Chrysomelidae).

    PubMed

    Hammack, Leslie; Ellsbury, Michael M; Roehrdanz, Richard L; Pikul, Joseph L

    2003-08-01

    Abundance and head capsule width were measured for northern (Diabrotica barberi Smith & Lawrence) and western corn rootworm (D. virgifera virgifera LeConte) larvae recovered primarily from maize root systems but also from large soil cores each centered around a root system. Larvae for measurement derived from field populations under infestation and rotation regimes that allowed most specimens to be assigned to species. A frequency distribution of head capsule widths indicated three separate peaks for western corn rootworm, presumably representing frequency of the three larval instars, with no larvae measuring 280 or 420 microm in the valleys between peaks. Multiple normal curves fit to similar but partially overlapping peaks generated by northern corn rootworm suggested that division of first to second and second to third instar can best be made for this species at 267 and 406 microm, respectively (270 and 410 when measurements are made to the nearest 20 microm). These results implied that instar of individuals from mixed northern and western corn rootworm populations can be accurately judged from head capsule width without having to determine species. The relative abundance of western corn rootworm instars was similar in root systems removed from the center of 19-cm diameter x 19-cm deep soil cores and in soil cores from which the root systems were removed. Furthermore, the number of larvae from root systems correlated significantly with that from the surrounding soil. These results indicated that the former and much more convenient sampling unit can be used to estimate population developmental stage and possibly density, at least early in the season when these tests were done and young larvae predominated. PMID:14503586

  16. Computational ligand-based rational design: Role of conformational sampling and force fields in model development.

    PubMed

    Shim, Jihyun; Mackerell, Alexander D

    2011-05-01

    A significant number of drug discovery efforts are based on natural products or high throughput screens from which compounds showing potential therapeutic effects are identified without knowledge of the target molecule or its 3D structure. In such cases computational ligand-based drug design (LBDD) can accelerate the drug discovery processes. LBDD is a general approach to elucidate the relationship of a compound's structure and physicochemical attributes to its biological activity. The resulting structure-activity relationship (SAR) may then act as the basis for the prediction of compounds with improved biological attributes. LBDD methods range from pharmacophore models identifying essential features of ligands responsible for their activity, quantitative structure-activity relationships (QSAR) yielding quantitative estimates of activities based on physiochemical properties, and to similarity searching, which explores compounds with similar properties as well as various combinations of the above. A number of recent LBDD approaches involve the use of multiple conformations of the ligands being studied. One of the basic components to generate multiple conformations in LBDD is molecular mechanics (MM), which apply an empirical energy function to relate conformation to energies and forces. The collection of conformations for ligands is then combined with functional data using methods ranging from regression analysis to neural networks, from which the SAR is determined. Accordingly, for effective application of LBDD for SAR determinations it is important that the compounds be accurately modelled such that the appropriate range of conformations accessible to the ligands is identified. Such accurate modelling is largely based on use of the appropriate empirical force field for the molecules being investigated and the approaches used to generate the conformations. The present chapter includes a brief overview of currently used SAR methods in LBDD followed by a more

  17. 2003 Mars Exploration Rover Mission: Robotic Field Geologists for a Mars Sample Return Mission

    NASA Technical Reports Server (NTRS)

    Ming, Douglas W.

    2008-01-01

    The Mars Exploration Rover (MER) Spirit landed in Gusev crater on Jan. 4, 2004 and the rover Opportunity arrived on the plains of Meridiani Planum on Jan. 25, 2004. The rovers continue to return new discoveries after 4 continuous Earth years of operations on the surface of the red planet. Spirit has successfully traversed 7.5 km over the Gusev crater plains, ascended to the top of Husband Hill, and entered into the Inner Basin of the Columbia Hills. Opportunity has traveled nearly 12 km over flat plains of Meridiani and descended into several impact craters. Spirit and Opportunity carry an integrated suite of scientific instruments and tools called the Athena science payload. The Athena science payload consists of the 1) Panoramic Camera (Pancam) that provides high-resolution, color stereo imaging, 2) Miniature Thermal Emission Spectrometer (Mini-TES) that provides spectral cubes at mid-infrared wavelengths, 3) Microscopic Imager (MI) for close-up imaging, 4) Alpha Particle X-Ray Spectrometer (APXS) for elemental chemistry, 5) Moessbauer Spectrometer (MB) for the mineralogy of Fe-bearing materials, 6) Rock Abrasion Tool (RAT) for removing dusty and weathered surfaces and exposing fresh rock underneath, and 7) Magnetic Properties Experiment that allow the instruments to study the composition of magnetic martian materials [1]. The primary objective of the Athena science investigation is to explore two sites on the martian surface where water may once have been present, and to assess past environmental conditions at those sites and their suitability for life. The Athena science instruments have made numerous scientific discoveries over the 4 plus years of operations. The objectives of this paper are to 1) describe the major scientific discoveries of the MER robotic field geologists and 2) briefly summarize what major outstanding questions were not answered by MER that might be addressed by returning samples to our laboratories on Earth.

  18. Trapped field of YBCO single-domain samples using pulse magnetization from 77K to 20K

    NASA Astrophysics Data System (ADS)

    Chaud, X.; Haanappel, E.; Noudem, J. G.; Horvath, D.

    2008-02-01

    ReBCO single-domain bulk superconductors have been shown to trap significant magnetic field at 77K and below. They can advantageously replace permanent magnets in cryogenic motors; more power in a smaller volume can be achieved. But practically, their magnetization has to be performed in situ. Usually it implies the use of pulse magnetization which is severe for the samples. This technique generates heat and stress on the superconductors. The magnetic-flux-trapping capabilities of YBCO single-domain samples were explored using the pulse-field facilities at the LNCMP (National Pulsed Magnetic Field Laboratory) at Toulouse, France. The flux dynamic was monitored during magnetic pulses by measuring the surface induction with a Hall probe on top of the samples at different temperatures from 77K to 20K. The samples were 16 mm in diameter and about 10 mm in height. The best one trapped 400 mT at 77K and 2.5T at 20K. The trapped field increases almost linearly down to 40K. The magnetic pulse is seen to generate heat. The temperature rise increases with decreasing temperature dwell because of lower heat capacity. The achieved trapped field is a compromise between the temperature rise and the applied field, and depends greatly of the magnetization history.

  19. A Field Comparison of Sampling Protocols for Measuring Lead in Drinking Water

    EPA Science Inventory

    US EPA Region 5 conducted a sampling study that demonstrates existing sampling protocols used for the Lead and Copper Rule (LCR) underestimate peak and probable mass of lead released in a system with lead service lines (LSLs). This comparative stagnation sampling was conducted i...

  20. Stressing biological samples with pulsed magnetic fields: physical aspects and experimental results

    NASA Astrophysics Data System (ADS)

    Delle Side, D.; Specchia, V.; D'Attis, S.; Giuffreda, E.; Quarta, G.; Calcagnile, L.; Bozzetti, M. P.; Nassisi, V.

    2016-05-01

    Magnetic field effects are diffused among living organisms. They are mainly studied with static or extremely low frequency fields, while scarce information is available for pulsed fields. This work is devoted to the study of the interaction between Drosophila melanogaster, both adults and larvae, and pulsed magnetic fields. We exposed the organisms to a peak field of 0.4 T, lasting for about 2 μ s, within an ad hoc designed copper coil. Adult individuals didn't present any deregulation of repetitive sequences in the germ line of Drosophila. Instead, we noticed a marked magnetic field effect in larvae. Polytene chromosomes coming from treated individuals showed the presence of heat shock puffs; the same organisms revealed also an upregulation of the genes encoding for the Hsp70 protein. These observations suggest that the larvae underwent an oxidative stress caused by the modulation of free radicals' yield induced by the magnetic field through a radical pair mechanism.

  1. Reverse Sample Genome Probing, a New Technique for Identification of Bacteria in Environmental Samples by DNA Hybridization, and Its Application to the Identification of Sulfate-Reducing Bacteria in Oil Field Samples

    PubMed Central

    Voordouw, Gerrit; Voordouw, Johanna K.; Karkhoff-Schweizer, Roxann R.; Fedorak, Phillip M.; Westlake, Donald W. S.

    1991-01-01

    A novel method for the identification of bacteria in environmental samples by DNA hybridization is presented. It is based on the fact that, even within a genus, the genomes of different bacteria may have little overall sequence homology. This allows the use of the labeled genomic DNA of a given bacterium (referred to as a “standard”) to probe for its presence and that of bacteria with highly homologous genomes in total DNA obtained from an environmental sample. Alternatively, total DNA extracted from the sample can be labeled and used to probe filters on which denatured chromosomal DNA from relevant bacterial standards has been spotted. The latter technique is referred to as reverse sample genome probing, since it is the reverse of the usual practice of deriving probes from reference bacteria for analyzing a DNA sample. Reverse sample genome probing allows identification of bacteria in a sample in a single step once a master filter with suitable standards has been developed. Application of reverse sample genome probing to the identification of sulfate-reducing bacteria in 31 samples obtained primarily from oil fields in the province of Alberta has indicated that there are at least 20 genotypically different sulfate-reducing bacteria in these samples. Images PMID:16348574

  2. Underground storage tanks 200W-FS-34 and 200W-FS-35 excavated soil field sample plan

    SciTech Connect

    Lucas, J.G.

    1994-09-07

    This plan outlines the process that will be used to collect samples from soil excavated during removal of underground storage tanks 200W-FS-34 and 200W-FS-35. The samples will be analyzed to determine if gasoline and diesel fuel are present in the soil at levels above action levels specified by the Washington State Department of Ecology. On April 15, 1992, the underground storage tanks were removed and soil samples were collected at each former tank location and from around the associated piping. Soil was excavated from the site until field instrumentation indicated that the former tank sites were clean in the judgment of the field team leader. Field monitoring consisted of using an organic vapor monitor to survey soil shaken in a plastic bag. Monitoring indicated that petroleum contamination ranged from 40 to 800 ppm.

  3. Adsorptive Films in Support of In-field UF6 Destructive Assay Sample Collection and Analysis

    SciTech Connect

    Barrett, Christopher A.; Martinez, Alonzo; McNamara, Bruce K.; Cannon, Bret D.; Anheier, Norman C.

    2014-07-20

    International Atom Energy Agency (IAEA) safeguard verification measures in gaseous centrifuge enrichment plants (GCEPs) rely on environmental sampling, non-destructive assay (NDA), and destructive assay (DA) sampling and analysis to determine uranium enrichment. UF6 bias defect measurements are made by DA sampling and analysis to assure that enrichment is consistent with declarations. DA samples are collected from a limited number of cylinders for high precision, offsite mass spectrometer analysis. Samples are typically drawn from a sampling tap into a UF6 sample bottle, then packaged, sealed, and shipped under IAEA chain of custody to an offsite analytical laboratory. Future DA safeguard measures may require improvements in efficiency and effectiveness as GCEP capacities increase and UF6 shipping regulations become increasingly more restrictive. The Pacific Northwest National Laboratory (PNNL) DA sampler concept and Laser Ablation Absorption Ratio Spectrometry (LAARS) assay method are under development to potentially provide DA safeguard tools that increase inspection effectiveness and reduce sample shipping constraints. The PNNL DA sampler concept uses a handheld sampler to collect DA samples for either onsite LAARS assay or offsite laboratory analysis. The DA sampler design will use a small sampling planchet that is coated with an adsorptive film to collect controlled quantities of UF6 gas directly from a cylinder or process sampling tap. Development efforts are currently underway at PNNL to enhance LAARS assay performance to allow high-precision onsite bias defect measurements. In this paper, we report on the experimental investigation to develop adsorptive films for the PNNL DA sampler concept. These films are intended to efficiently capture UF6 and then stabilize the collected DA sample prior to onsite LAARS or offsite laboratory analysis. Several porous material composite films were investigated, including a film designed to maximize the chemical adsorption

  4. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  5. Estimating population size for Capercaillie (Tetrao urogallus L.) with spatial capture-recapture models based on genotypes from one field sample

    USGS Publications Warehouse

    Mollet, Pierre; Kery, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, Andy

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species.

  6. Estimating Population Size for Capercaillie (Tetrao urogallus L.) with Spatial Capture-Recapture Models Based on Genotypes from One Field Sample

    PubMed Central

    Mollet, Pierre; Kéry, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, J. Andrew

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species. PMID:26087321

  7. Single Nucleotide Polymorphism Genotyping and Distribution of Coxiella burnetii Strains from Field Samples in Belgium

    PubMed Central

    Dal Pozzo, Fabiana; Renaville, Bénédicte; Martinelle, Ludovic; Renaville, Robert; Thys, Christine; Smeets, François; Kirschvink, Nathalie; Grégoire, Fabien; Delooz, Laurent; Czaplicki, Guy

    2015-01-01

    The genotypic characterization of Coxiella burnetii provides useful information about the strains circulating at the farm, region, or country level and may be used to identify the source of infection for animals and humans. The aim of the present study was to investigate the strains of C. burnetii circulating in caprine and bovine Belgian farms using a single nucleotide polymorphism (SNP) technique. Direct genotyping was applied to different samples (bulk tank milk, individual milk, vaginal swab, fetal product, and air sample). Besides the well-known SNP genotypes, unreported ones were found in bovine and caprine samples, increasing the variability of the strains found in the two species in Belgium. Moreover, multiple genotypes were detected contemporarily in caprine farms at different years of sampling and by using different samples. Interestingly, certain SNP genotypes were detected in both bovine and caprine samples, raising the question of interspecies transmission of the pathogen. PMID:26475104

  8. A portable automated system for trace gas sampling in the field and stable isotope analysis in the laboratory.

    PubMed

    Theis, Daniel E; Saurer, Matthias; Blum, Herbert; Frossard, Emmanuel; Siegwolf, Rolf T W

    2004-01-01

    A computer-controllable mobile system is presented which enables the automatic collection of 33 air samples in the field and the subsequent analysis for delta13C and delta18O stable isotope ratios of a carbon-containing trace gas in the laboratory, e.g. CO2, CO or CH4. The system includes a manifold gas source input for profile sampling and an infrared gas analyzer for in situ CO2 concentration measurements. Measurements of delta13C and delta18O of all 33 samples can run unattended and take less than six hours for CO2. Laboratory tests with three gases (compressed air with different pCO2 and stable isotope compositions) showed a measurement precision of 0.03 per thousand for delta13C and 0.02 per thousand for delta18O of CO2 (standard error (SE), n = 11). A field test of our system, in which 66 air samples were collected within a 24-hour period above grassland, showed a correlation of 0.99 (r2) between the inverse of pCO2 and delta13C of CO2. Storage of samples until analysis is possible for about 1 week; this can be an important factor for sampling in remote areas. A wider range of applications in the field is open with our system, since sampling and analysis of CO and CH4 for stable isotope composition is also possible. Samples of compressed air had a measurement precision (SE, n = 33) of 0.03 per thousand for delta13C and of 0.04 per thousand for delta18O on CO and of 0.07 per thousand for delta13C on CH4. Our system should therefore further facilitate research of trace gases in the context of the carbon cycle in the field, and opens many other possible applications with carbon- and possibly non-carbon-containing trace gases. PMID:15317047

  9. High-frequency isotopic analysis of liquid water samples in the field - initial results from continuous water sampling and cavity ring-down spectroscopy

    NASA Astrophysics Data System (ADS)

    von Freyberg, Jana; Studer, Bjørn; Kirchner, James

    2016-04-01

    Studying rapidly changing hydrochemical signals in catchments can help to improve our mechanistic understanding of their water flow pathways and travel times. For these purposes, stable water isotopes (18O and 2H) are commonly used as natural tracers. However, high-frequency isotopic analyses of liquid water samples are challenging. One must capture highly dynamic behavior with high precision and accuracy, but the lab workload (and sample storage artifacts) involved in collecting and analyzing thousands of bottled samples should also be avoided. Therefore, we have tested Picarro, Inc.'s newly developed Continuous Water Sampler Module (CoWS), which is coupled to their L2130-i Cavity Ring-Down Spectrometer to enable real-time on-line measurements of 18O and 2H in liquid water samples. We coupled this isotope analysis system to a dual-channel ion chomatograph (Metrohm AG, Herisau, Switzerland) for analysis of major cations and anions, as well as a UV-Vis spectroscopy system (s::can Messtechnik GmbH, Vienna, Austria) and electrochemical probes for characterization of basic water quality parameters. The system was run unattended for up to a week at a time in the laboratory and at a small catchment. At the field site, stream-water and precipitation samples were analyzed, alternating at sub-hourly intervals. We observed that measured isotope ratios were highly sensitive to the liquid water flow rate in the CoWS, and thus to the hydraulic head difference between the CoWS and the samples from which water was drawn. We used a programmable high-precision dosing pump to control the injection flow rate and eliminate this flow-rate artifact. Our experiments showed that the precision of the CoWS-L2130-i-system for 2-minute average values was typically better than 0.06‰ for δ18O and 0.16‰ for δ2H. Carryover effects were 1% or less between isotopically contrasting water samples for 30-minute sampling intervals. Instrument drift could be minimized through periodic analysis of

  10. Sampling of Riverine or Marine Bacterial Communities in Remote Locations: From Field to Publication.

    PubMed

    Lehmann, Katja

    2016-01-01

    This protocol describes how to sample and preserve microbial water column samples from rivers that can be used for 16S or 18S metabarcoding studies or shotgun sequencing. It further describes how to extract the DNA for sequencing and how to prepare raw Illumina MiSeq amplicon data and analyze it in the R environment. PMID:27460367

  11. Field test and calibration of neutron coincidence counters for high-mass plutonium samples

    SciTech Connect

    Menlove, H.O.; Dickinson, R.J.; Douglas, I.; Orr, C.; Rogers, F.J.G.; Wells, G.; Schenkel, R.; Smith, G.; Fattgh, A.; Ramalho, A.

    1987-02-01

    Five different neutron coincidence systems were evaluated and calibrated for high-mass PuO/sub 2/ samples. The samples were from 2 to 7.2 kg of PuO/sub 2/ in mass, with a large range of burnup. This report compares the equipment and the results, with an evaluation of deadtime and multiplication corrections.

  12. CTEPP-OH DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table for CTEPP-OH. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Oth...

  13. The intensity of the ancient lunar field from magnetic studies on lunar samples

    NASA Technical Reports Server (NTRS)

    Stephenson, A.; Collinson, D. W.; Runcorn, S. K.

    1974-01-01

    Palaeointensity determinations on Apollo 11, 16 and 17 rocks have indicated that 3.9 - 4.0 AE ago the strength of the surface lunar magnetic field was about 1.3 Oe while there is evidence from younger rocks that a field of about one quarter of this value was present at a later time (3.6 AE).

  14. Integrating Field-Based Research into the Classroom: An Environmental Sampling Exercise

    ERIC Educational Resources Information Center

    DeSutter, T.; Viall, E.; Rijal, I.; Murdoff, M.; Guy, A.; Pang, X.; Koltes, S.; Luciano, R.; Bai, X.; Zitnick, K.; Wang, S.; Podrebarac, F.; Casey, F.; Hopkins, D.

    2010-01-01

    A field-based, soil methods, and instrumentation course was developed to expose graduate students to numerous strategies for measuring soil parameters. Given the northern latitude of North Dakota State University and the rapid onset of winter, this course met once per week for the first 8 weeks of the fall semester and centered on the field as a…

  15. Two-dimensional compressed sensing using the cross-sampling approach for low-field MRI systems.

    PubMed

    Tamada, Daiki; Kose, Katsumi

    2014-09-01

    A compressed sensing method using a cross sampling and self-calibrated off-resonance correction is proposed. Estimation of the magnetic field inhomogeneity based on image registration enables the off-resonance correction with no additional radio-frequency pulses or acquisitions. In addition to this advantage, a fast and straightforward calculation was achieved by using the first-order components of the magnetic field inhomogeneity. Imaging experiments using a phantom and a chemically fixed mouse demonstrated practical benefits in improving blurring and artifacts in magnetic resonance images in low field magnetic resonance imaging systems. PMID:24879645

  16. Pre-Mission Input Requirements to Enable Successful Sample Collection by a Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Young, K. E.; Lim, D. S.

    2015-01-01

    This paper is intended to evaluate the sample collection process with respect to sample characterization and decision making. In some cases, it may be sufficient to know whether a given outcrop or hand sample is the same as or different from previous sampling localities or samples. In other cases, it may be important to have more in-depth characterization of the sample, such as basic composition, mineralogy, and petrology, in order to effectively identify the best sample. Contextual field observations, in situ/handheld analysis, and backroom evaluation may all play a role in understanding field lithologies and their importance for return. For example, whether a rock is a breccia or a clast-laden impact melt may be difficult based on a single sample, but becomes clear as exploration of a field site puts it into context. The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team is a new activity focused on a science and exploration field based research program aimed at generating strategic knowledge in preparation for the human and robotic exploration of the Moon, near-Earth asteroids (NEAs) and Phobos and Deimos. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused, and moreover, is sampling-focused, with the explicit intent to return the best samples for geochronology studies in the laboratory. This specific objective effectively reduces the number of variables in the goals of the field test and enables a more controlled investigation of the role of the crewmember in selecting samples. We formulated one hypothesis to test: that providing details regarding the analytical fate of the samples (e.g. geochronology, XRF/XRD, etc.) to the crew prior to their traverse will result in samples that are more likely to meet specific analytical

  17. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies.

    PubMed

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A

    2014-12-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg(-1) pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern. PMID:25580031

  18. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies

    PubMed Central

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A.

    2014-01-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg-1 pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern. PMID:25580031

  19. Energy Spectra of Electrons Backscattered from Sample Surfaces with Heterostructures using Field-Emission Scanning Tunneling Microscopy

    NASA Astrophysics Data System (ADS)

    Hirade, Masato; Arai, Toyoko; Tomitori, Masahiko

    2006-03-01

    We have improved the combined instrument of field-emission scanning tunneling microscopy (STM) with surface electron spectroscopy to directly identify the atomic species on a sample; we supplement an electric shield near the tip, the position of which can be adjusted by three-dimensional coarse stages, and optimize the grazing angle of a sample surface with respect to the entrance of an energy analyzer by placing the STM head on a rotation stage. We observe STM images and take the energy spectra of backscattered electrons from clean Si(111) and Al-deposited Si(111) using the improved instrument. The Auger peaks of Si LVV are found at a tip-sample separation of approximately 1 μm for Si(111), and Al LVV and Si LVV peaks are found for Al-deposited Si samples, depending on the deposited amount. The present study implies that submicron surface analysis of samples with heterostructures can be performed with the combined instrument.

  20. Investigating temporal field sampling strategies for site-specific calibration of three soil moisture-neutron intensity parameterisation methods

    NASA Astrophysics Data System (ADS)

    Iwema, J.; Rosolem, R.; Baatz, R.; Wagener, T.; Bogena, H. R.

    2015-07-01

    The Cosmic-Ray Neutron Sensor (CRNS) can provide soil moisture information at scales relevant to hydrometeorological modelling applications. Site-specific calibration is needed to translate CRNS neutron intensities into sensor footprint average soil moisture contents. We investigated temporal sampling strategies for calibration of three CRNS parameterisations (modified N0, HMF, and COSMIC) by assessing the effects of the number of sampling days and soil wetness conditions on the performance of the calibration results while investigating actual neutron intensity measurements, for three sites with distinct climate and land use: a semi-arid site, a temperate grassland, and a temperate forest. When calibrated with 1 year of data, both COSMIC and the modified N0 method performed better than HMF. The performance of COSMIC was remarkably good at the semi-arid site in the USA, while the N0mod performed best at the two temperate sites in Germany. The successful performance of COSMIC at all three sites can be attributed to the benefits of explicitly resolving individual soil layers (which is not accounted for in the other two parameterisations). To better calibrate these parameterisations, we recommend in situ soil sampled to be collected on more than a single day. However, little improvement is observed for sampling on more than 6 days. At the semi-arid site, the N0mod method was calibrated better under site-specific average wetness conditions, whereas HMF and COSMIC were calibrated better under drier conditions. Average soil wetness condition gave better calibration results at the two humid sites. The calibration results for the HMF method were better when calibrated with combinations of days with similar soil wetness conditions, opposed to N0mod and COSMIC, which profited from using days with distinct wetness conditions. Errors in actual neutron intensities were translated to average errors specifically to each site. At the semi-arid site, these errors were below the

  1. Genetic variability of spined soldier bugs (Hemiptera: Pentatomidae) sampled from distinct field sites and laboratory colonies in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The spined soldier bug, Podisus maculiventris (Say), is an important biological control agent for agricultural and forest pests that preys on eggs and larvae of lepidopteran and coleopteran species. Genetic variability among field collected samples from Michigan, Mississippi, Missouri, and Florida, ...

  2. Small RNA deep sequencing revealed that mixed infection of known and unknown viruses were common in field collected vegetable samples

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In an effort to characterize the causal agents for plant diseases in field collected samples using the small RNA deep sequencing technology, numerous known or novel viruses and viroids were identified. In many cases, a mixed infection with multiple pathogen species was common. Such situation compl...

  3. Basic properties of transition remanent magnetizations of magnetite in relation to the ambient field using granite samples

    NASA Astrophysics Data System (ADS)

    Sato, Masahiko; Seita, Kazuhiro; Miyagawa, Takeshi; Mochizuki, Nobutatsu; Kogiso, Tetsu; Tsunakawa, Hideo

    2015-01-01

    We have investigated basic properties of transition remanent magnetization of natural magnetite in granite samples collected from the Minnesota River Valley, North America. Transition remanence was imparted during cooling and/or warming through the Verwey transition around 120 K. Depending on magnetic field conditions during cooling and warming, three types of transition remanences have been categorized: (1) TrRM, acquired during a cycle of field cooling and field warming; (2) TrWRM, acquired during zero-field cooling and field warming and (3) TrCRM, imparted during field cooling and zero-field warming. These remanences fulfil basic laws of remanent magnetization: (1) directions of the transition remanences are parallel to direction of the applied field (the law of parallelism), (2) intensities of the transition remanences are proportional to the applied field intensity (the law of proportionality) and (3) sum of the partial transition remanences is equal to the total transitional remanence, that is, TrRM = TrWRM + TrCRM. In addition, the ratio of TrRM to TRMLTD (the demagnetized component of thermoremanent magnetization by low-temperature demagnetization) shows a nearly constant value of ˜0.34. This relationship might reflect differences in equilibrium magnetic domain state at low and high temperature.

  4. A simplified electrospray ionization source based on electrostatic field induction for mass spectrometric analysis of droplet samples.

    PubMed

    Lu, Xiaohui; Chen, Hong; Li, Xiang; Chen, Jianmin; Yang, Xin

    2012-12-21

    A simplified electrospray ionization source based on electrostatic field induction is introduced in this paper. The electrostatic field induced spray ionization, termed EFISI, is easily performed using a needle electrode and a capillary, and it does not require heat, gas, a syringe pump or any other equipment. A high voltage is applied to a needle electrode which does not contact the sample. The capillary is used as a sample spray emitter without any electrical contact or tip modification. As only a 1 μL sample droplet is needed for analysis with no or little pretreatment, the EFISI source is particularly suitable for the mass spectrometric analysis of microlitre volume samples. The change of charge distribution in the droplet solution, by the induction of an external electrostatic field from the needle electrode, is proposed to be the main cause of ion formation. We demonstrate its feasibility for the characterization of a wide range of organic compounds and biomolecules in pure solutions or complex matrices. The influence of sample capillary length and droplet solvent composition on the ionization process are also discussed. PMID:23095821

  5. MICROBIOLOGICAL FIELD SAMPLING AND INSTRUMENTATION IN THE ASSESSMENT OF SOIL AND GROUND-WATER POLLUTION

    EPA Science Inventory

    This chapter emphasizes the importance of microbiological sampling of soil and ground water with respect to human heath risks, laws and regulations dealing with safe drinking water, and more prevalent subsurface monitoring activities associated with chlorinated organic compounds,...

  6. Construction of an electrical device for sampling earthworm populations in the field

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Well-known methods for estimating earthworm population densities range from laborious handsorting through chemical applications to electrical extraction. Of these methods, only the electrical extraction allows for sampling of earthworms without detrimental soil disturbance or contamination. However,...

  7. FIELD AND LABORATORY PERFORMANCE CHARACTERISTICS OF A NEW SAMPLING PROTOCOL FOR RIVERINE MACROINVERTEBRATE ASSEMBLAGES

    EPA Science Inventory

    Measurement and estimation of performance characteristics (i.e., precision, bias, performance range, interferences and sensitivity) are often neglected in the development and use of new biological sampling methods. However, knowledge of this information is critical in enabling p...

  8. Update on field evaluation of EPA Method CTM-039 (PM2.5 Stack Sampling Method)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Agricultural operations are encountering difficulties complying with current air pollution regulations for particulate matter (PM). These regulations are based on the National Ambient Air Quality Standards, which set maximum concentration limits for ambient air PM. Source sampling for compliance pur...

  9. Field evaluation of sampling methods for pressurized geothermal liquids, gases, and suspended solids

    SciTech Connect

    Shannon, D.W.; Cole, M.W.; DeMonia, D.D.; Divine, J.R.; Jensen, G.A.; Kindle, C.H.; Koski, O.H.; Smith, R.P.; Woodruff, E.M.

    1980-01-01

    Many different sampling methods were tested and compared for collecting samples for measurement of brine chemistry, gases, and suspended solids from pressurized geothermal systems. The tests were conducted on the 6-2 wellhead and a test loop at the Department of Energy's Geothermal Test Facility at East Mesa, California. The recommended methods for single-phase liquid or single-phase steam (with gases) are presented, together with detailed procedures. The results of testing methods for sampling two phase liquid-steam systems showed significant errors can result. It was recommended that two-phase flowing wells be directed to a full flow separator and the single-phase liquid and single-phase steam sampled separately using the recommended methods.

  10. Preliminary field evaluation of EPA Method CTM-039 (PM2.5 Stack Sampling Method)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Agricultural operations are encountering difficulties complying with current air pollution regulations for particulate matter (PM). These regulations are based on the National Ambient Air Quality Standards which set maximum concentration limits for ambient air PM. Source sampling for compliance purp...

  11. Guidelines for collection and field analysis of water-quality samples from streams in Texas

    USGS Publications Warehouse

    Wells, F.C.; Gibbons, W.J.; Dorsey, M.E.

    1990-01-01

    Analyses for unstable constituents or properties are by necessity performed in the field. This manual addresses analytical techniques and quality assurance for: (1) Water temperature; (2) specific conductance; (3) pH; (4) alkalinity; (5) dissolved oxygen; and (6) bacteria.

  12. Field Methods and Sample Collection Techniques for the Surveillance of West Nile Virus in Avian Hosts.

    PubMed

    Wheeler, Sarah S; Boyce, Walter M; Reisen, William K

    2016-01-01

    Avian hosts play an important role in the spread, maintenance, and amplification of West Nile virus (WNV). Avian susceptibility to WNV varies from species to species thus surveillance efforts can focus both on birds that survive infection and those that succumb. Here we describe methods for the collection and sampling of live birds for WNV antibodies or viremia, and methods for the sampling of dead birds. Target species and study design considerations are discussed. PMID:27188560

  13. Selectivity and limitations of carbon sorption tubes for capturing siloxanes in biogas during field sampling.

    PubMed

    Tansel, Berrin; Surita, Sharon C

    2016-06-01

    Siloxane levels in biogas can jeopardize the warranties of the engines used at the biogas to energy facilities. The chemical structure of siloxanes consists of silicon and oxygen atoms, alternating in position, with hydrocarbon groups attached to the silicon side chain. Siloxanes can be either in cyclic (D) or linear (L) configuration and referred with a letter corresponding to their structure followed by a number corresponding to the number of silicon atoms present. When siloxanes are burned, the hydrocarbon fraction is lost and silicon is converted to silicates. The purpose of this study was to evaluate the adequacy of activated carbon gas samplers for quantitative analysis of siloxanes in biogas samples. Biogas samples were collected from a landfill and an anaerobic digester using multiple carbon sorbent tubes assembled in series. One set of samples was collected for 30min (sampling 6-L gas), and the second set was collected for 60min (sampling 12-L gas). Carbon particles were thermally desorbed and analyzed by Gas Chromatography Mass Spectrometry (GC/MS). The results showed that biogas sampling using a single tube would not adequately capture octamethyltrisiloxane (L3), hexamethylcyclotrisiloxane (D3), octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5) and dodecamethylcyclohexasiloxane (D6). Even with 4 tubes were used in series, D5 was not captured effectively. The single sorbent tube sampling method was adequate only for capturing trimethylsilanol (TMS) and hexamethyldisiloxane (L2). Affinity of siloxanes for activated carbon decreased with increasing molecular weight. Using multiple carbon sorbent tubes in series can be an appropriate method for developing a standard procedure for determining siloxane levels for low molecular weight siloxanes (up to D3). Appropriate quality assurance and quality control procedures should be developed for adequately quantifying the levels of the higher molecular weight siloxanes in biogas with sorbent tubes

  14. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data.

    PubMed

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Kohn, Jordan; Yuan, Michael L; Gesquiere, Laurence; Grieneisen, Laura E; Tung, Jenny

    2016-01-01

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples-unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  15. Study of Low Temperature Baking Effect on Field Emission on Nb Samples Treated by BEP, EP, and BCP

    SciTech Connect

    Andy Wu, Song Jin, Robert Rimmer, Xiang Yang Lu, K. Zhao, Laura MacIntyre, Robert Ike

    2010-05-01

    Field emission is still one of the major obstacles facing Nb superconducting radio frequency (SRF) community for allowing Nb SRF cavities to reach routinely accelerating gradient of 35 MV/m that is required for the international linear collider. Nowadays, the well know low temperature backing at 120 oC for 48 hours is a common procedure used in the SRF community to improve the high field Q slope. However, some cavity production data have showed that the low temperature baking may induce field emission for cavities treated by EP. On the other hand, an earlier study of field emission on Nb flat samples treated by BCP showed an opposite conclusion. In this presentation, the preliminary measurements of Nb flat samples treated by BEP, EP, and BCP via our unique home-made scanning field emission microscope before and after the low temperature baking are reported. Some correlations between surface smoothness and the number of the observed field emitters were found. The observed experimental results can be understood, at least partially, by a simple model that involves the change of the thickness of the pent-oxide layer on Nb surfaces.

  16. How People Actually Use Thermostats

    SciTech Connect

    Meier, Alan; Aragon, Cecilia; Hurwitz, Becky; Mujumdar, Dhawal; Peffer, Therese; Perry, Daniel; Pritoni, Marco

    2010-08-15

    Residential thermostats have been a key element in controlling heating and cooling systems for over sixty years. However, today's modern programmable thermostats (PTs) are complicated and difficult for users to understand, leading to errors in operation and wasted energy. Four separate tests of usability were conducted in preparation for a larger study. These tests included personal interviews, an on-line survey, photographing actual thermostat settings, and measurements of ability to accomplish four tasks related to effective use of a PT. The interviews revealed that many occupants used the PT as an on-off switch and most demonstrated little knowledge of how to operate it. The on-line survey found that 89% of the respondents rarely or never used the PT to set a weekday or weekend program. The photographic survey (in low income homes) found that only 30% of the PTs were actually programmed. In the usability test, we found that we could quantify the difference in usability of two PTs as measured in time to accomplish tasks. Users accomplished the tasks in consistently shorter times with the touchscreen unit than with buttons. None of these studies are representative of the entire population of users but, together, they illustrate the importance of improving user interfaces in PTs.

  17. Comparison and Field Validation of Binomial Sampling Plans for Oligonychus perseae (Acari: Tetranychidae) on Hass Avocado in Southern California.

    PubMed

    Lara, Jesus R; Hoddle, Mark S

    2015-08-01

    Oligonychus perseae Tuttle, Baker, & Abatiello is a foliar pest of 'Hass' avocados [Persea americana Miller (Lauraceae)]. The recommended action threshold is 50-100 motile mites per leaf, but this count range and other ecological factors associated with O. perseae infestations limit the application of enumerative sampling plans in the field. Consequently, a comprehensive modeling approach was implemented to compare the practical application of various binomial sampling models for decision-making of O. perseae in California. An initial set of sequential binomial sampling models were developed using three mean-proportion modeling techniques (i.e., Taylor's power law, maximum likelihood, and an empirical model) in combination with two-leaf infestation tally thresholds of either one or two mites. Model performance was evaluated using a robust mite count database consisting of >20,000 Hass avocado leaves infested with varying densities of O. perseae and collected from multiple locations. Operating characteristic and average sample number results for sequential binomial models were used as the basis to develop and validate a standardized fixed-size binomial sampling model with guidelines on sample tree and leaf selection within blocks of avocado trees. This final validated model requires a leaf sampling cost of 30 leaves and takes into account the spatial dynamics of O. perseae to make reliable mite density classifications for a 50-mite action threshold. Recommendations for implementing this fixed-size binomial sampling plan to assess densities of O. perseae in commercial California avocado orchards are discussed. PMID:26470355

  18. Sediment and radionuclide transport in rivers. Summary report, field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-11-01

    A three-phase field sampling program was conducted on the Buttermilk-Cattaraugus Creek system to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Phase 1 of the sampling program was conducted during November and December 1977; Phase 2 during September 1978; and Phase 3 during April 1979. Bed sediment, suspended sediment, and water samples were collected over a 45-mile reach of the creek system. Bed sediment samples were also collected at the mouth of Cattaraugus Creek in Lake Erie. A fourth sampling trip was conducted during May 1980 to obtain supplementary channel geometry data and flood plain sediment samples. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239,240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, CS-134, Co-60, Pu-238, Pu-239,240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks.

  19. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-12-01

    This study is a contribution to development of a heterogeneity characterization facility for "next-generation" soil sampling aimed, for example, at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity in quantification of a set of exemplar parameters is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The theory of sampling (TOS) and variographic analysis has been applied to develop a more general fit-for-purpose soil heterogeneity characterization approach. All parameters were assessed in large-scale transect (1-100 m) vs. small-scale (0.1-0.5 m) replication sampling point variability. Variographic profiles of experimental analytical results from a specific well-mixed soil type show that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among other soils types. This study has a significant carrying-over potential for related research areas, e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  20. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-06-01

    This study is a contribution to development of a heterogeneity characterisation facility for "next generation" sampling aimed at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity on quantification of a set of exemplar parameters, organic matter, loss on ignition (LOI), biomass, soil microbiology, MCPA sorption and mineralization is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The Theory of Sampling (TOS) and variographic analysis has been applied to develop a fit-for-purpose heterogeneity characterization approach. All parameters were assessed in large-scale profile (1-100 m) vs. small-scale (0.1-1 m) replication sampling pattern. Variographic profiles of experimental analytical results concludes that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among soils types. This study has a significant carrying-over potential for related research areas e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  1. Test and Analysis of China's First Short Conductor Sample for ITER Toroidal Field Coils

    NASA Astrophysics Data System (ADS)

    Liu, Bo; Wu, Yu

    2011-02-01

    In the framework of the ITER qualification tests, the first China TF conductor sample (CNTF1) was tested at the SULTAN facility. The sample was made of two TF conductor sections manufactured from identical internal stannum strands provided by the Oxford Superconducting technology company (OST). In order to evaluate the conductor performance, the current sharing temperature (Tcs) was measured at specified electromagnetic load cycling steps. Both conductor sections of the CNTF1 sample showed identical performance. Tcs was 7.2 K before cycling loading, and 6.9 K even after 950 cycles, without significant degradation, which substantially exceeds the ITER requirement of 5.7 K. The tests of the CNTF1 conductor sample showed that the electromagnetic cyclic load exhibited a negligible effect on the conductor performance. The coupling time constant θ for AC loss was 214 ms and 71.52 ms before and after the cycling load, respectively. The test results of the sample are compared with the strand performance and parameter model analysis.

  2. Groundwater Monitoring and Field Sampling Plan for Operable Unit 10-08

    SciTech Connect

    M. S. Roddy

    2007-05-01

    This plan describes the groundwater sampling and water level monitoring that will be conducted to evaluate contaminations in the Snake River Plain Aquifer entering and leaving the Idaho National Laboratory. The sampling and monitoring locations were selected to meet the data quality objectives detailed in this plan. Data for the Snake River Plain Aquifer obtained under this plan will be evaluated in the Operable Unit 10-08 Remedial Investigation/Feasibility Study report and will be used to support the Operable Unit 10-08 Sitewide groundwater model.

  3. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample.

    PubMed

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-01-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases. PMID:27357449

  4. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    NASA Astrophysics Data System (ADS)

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-06-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases.

  5. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    PubMed Central

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-01-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases. PMID:27357449

  6. Field evaluation of sampling and analysis for organic pollutants in indoor air. Project summary

    SciTech Connect

    Chuang, J.C.; Mack, G.A.; Stockrahm, J.W.; Hannan, S.W.; Bridges, C.

    1988-09-01

    The objectives of the study were to determine the feasibility of the use of newly developed indoor air samplers in residential indoor air sampling and to evaluate methodology for characterization of the concentrations of polynuclear aromatic hydrocarbons (PAH), PAH derivatives, and nicotine in residential air.

  7. FIELD EVALUATION OF SAMPLING AND ANALYSIS FOR ORGANIC POLLUTANTS IN INDOOR AIR

    EPA Science Inventory

    The objectives of the study were to determine the feasibility of the use of newly developed indoor air samplers in residential indoor air sampling and to evaluate methodology for characterization of the concentrations of polynuclear aromatic hydrocarbons (PAH), PAH derivatives, a...

  8. Optimizing electrostatic field calculations with the adaptive Poisson-Boltzmann Solver to predict electric fields at protein-protein interfaces. I. Sampling and focusing.

    PubMed

    Ritchie, Andrew W; Webb, Lauren J

    2013-10-01

    Continuum electrostatics methods are commonly used to calculate electrostatic potentials in proteins and at protein-protein interfaces to aid many types of biophysical studies. Despite their ubiquity throughout the biophysical literature, these calculations are difficult to test against experimental data to determine their accuracy and validity. To address this, we have calculated the Boltzmann-weighted electrostatic field at the midpoint of a nitrile bond placed at a variety of locations on the surface of the protein RalGDS, both in its monomeric form as well as when docked to four different constructs of the protein Rap, and compared the computation results to vibrational absorption energy measurements of the nitrile oscillator. This was done by generating a statistical ensemble of protein structures using enhanced molecular dynamics sampling with the Amber03 force field, followed by solving the linear Poisson-Boltzmann equation for each structure using the Applied Poisson-Boltzmann Solver (APBS) software package. Using a two-stage focusing strategy, we examined numerous second stage box dimensions, grid point densities, box locations, and compared the numerical result to the result obtained from the sum of the numeric reaction field and the analytic Coulomb field. It was found that the reaction field method yielded higher correlation with experiment for the absolute calculation of fields, while the numeric solutions yielded higher correlation with experiment for the relative field calculations. Finer grid spacing typically improved the calculation, although this effect was less pronounced in the reaction field method. These sorts of calculations were also very sensitive to the box location, particularly for the numeric calculations of absolute fields using a 10(3) Å(3) box. PMID:24041016

  9. Field Reliability of Comprehensive System Scoring in an Adolescent Inpatient Sample

    ERIC Educational Resources Information Center

    McGrath, Robert E.; Pogge, David L.; Stokes, John M.; Cragnolino, Ana; Zaccario, Michele; Hayman, Judy; Piacentini, Teresa; Wayland-Smith, Douglas

    2005-01-01

    The extent to which the Comprehensive System for the Rorschach is reliably scored has been a topic of some controversy. Although several studies have concluded it can be scored reliably in research settings, little is known about its reliability in field settings. This study evaluated the reliability of both response-level codes and protocol-level…

  10. Effects of sample storage on spectral reflectance changes in corn leaves excised from the field

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Excising leaves from plants in field studies and transporting them to a laboratory for hyperspectral measurement is a common practice. It is assumed that the leaf spectra characterize the plant canopies when viewed from above with an airborne or spaceborne sensor. However, few studies have explored ...

  11. Validation of in situ networks via field sampling: case study in the South Fork Experimental Watershed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The calibration and validation of soil moisture remote sensing products is complicated by the logistics of installing a soil moisture network for a long term period in an active landscape. Therefore, these stations are located along field boundaries or in non-representative sites with regards to so...

  12. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data

    PubMed Central

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A.; Barreiro, Luis B.; Johnson, Zachary P.; Wilson, Mark E.; Kohn, Jordan; Yuan, Michael L.; Gesquiere, Laurence; Grieneisen, Laura E.; Tung, Jenny

    2016-01-01

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples—unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  13. Sediment and radionuclide transport in rivers. Phase 3. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Ecker, R.M.; Walters, W.H.; Onishi, Y.

    1982-08-01

    A field sampling program was conducted on Cattaraugus and Buttermilk Creeks, New York during April 1979 to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Bed sediment, suspended sediment and water samples were collected during unsteady flow conditions over a 45 mile reach of stream channel. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239, 240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, Cs-134, Co-60, Pu-238, Pu-239, 240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks. This field sampling effort was the last of a three phase program to collect hydrologic and radiologic data at different flow conditions.

  14. Ultrasonic extraction and field-portable anodic stripping voltammetry for the determination of lead in workplace air samples.

    PubMed

    Ashley, K; Mapp, K J; Millson, M

    1998-10-01

    An on-site, field-portable analytical method for the determination of lead in workplace air samples, based on the use of ultrasonic extraction and anodic stripping voltammetry (ASV), was evaluated. Workplace air samples were obtained using a standard method involving particulate collection onto mixed cellulose ester membrane filters. Samples were collected at work sites where airborne particulates were generated from the abrasive blasting of lead-containing paint on highway bridges. Ultrasonic extraction (UE) of air filter samples in diluted nitric acid, followed by portable ASV, was used for the determination of lead. Also, performance evaluation samples consisting of reference materials of known lead concentration were subjected to the UE-ASV procedure for lead determination. Confirmatory analyses of the air filters and performance evaluation samples subjected to the UE-ASV lead measurement method were conducted by hotplate digestion in concentrated nitric acid and 30% hydrogen peroxide, followed by inductively coupled plasma-atomic emission spectrometric (ICP-AES) determination of lead. Recoveries of lead from performance evaluation materials (when using the UE-ASV method) were found to be quantitative. The performance of the UE-ASV method for lead in air filters was found to be acceptable, as evaluated by comparison with results from hotplate strong acid digestion followed by ICP-AES analysis. Based on the results of this study, the ultrasonic extraction/portable ASV procedure demonstrates potential for the on-site determination of lead in personal breathing zone and area air samples. PMID:9794065

  15. Consideration of some sampling problems in the on-line analysis of batch processes by low-field NMR spectrometry.

    PubMed

    Nordon, Alison; Diez-Lazaro, Alvaro; Wong, Chris W L; McGill, Colin A; Littlejohn, David; Weerasinghe, Manori; Mamman, Danladi A; Hitchman, Michael L; Wilkie, Jacqueline

    2008-03-01

    A low-field medium-resolution NMR spectrometer, with an operating frequency of 29 MHz for 1H, has been assessed for on-line process analysis. A flow cell that incorporates a pre-magnetisation region has been developed to minimise the decrease in the signal owing to incomplete polarisation effects. The homogeneous esterification reaction of crotonic acid and 2-butanol was monitored using a simple sampling loop; it was possible to monitor the progression of the reaction through changes in CH signal areas of butanol and butyl crotonate. On-line analysis of heterogeneous water-toluene mixtures proved more challenging and a fast sampling loop system was devised for use with a 5 L reactor. The fast sampling loop operated at a flow rate of 8 L min(-1) and a secondary sampling loop was used to pass a sub-sample through the NMR analyser at a slower (mL min(-1)) rate. It was shown that even with super-isokinetic sampling conditions, unrepresentative sampling could occur owing to inadequate mixing in the reactor. However, it was still possible to relate the 1H NMR signal obtained at a flow rate of 60 mL min(-1) to the composition of the reactor contents. PMID:18299748

  16. A large depth of field LIBS measuring system for elemental analysis of moving samples of raw coal

    NASA Astrophysics Data System (ADS)

    Redoglio, D.; Golinelli, E.; Musazzi, S.; Perini, U.; Barberis, F.

    2016-02-01

    We present preliminary results of laboratory tests carried out on moving samples of coal by means of an innovative LIBS system with a large depth of field. The measuring system has been conceived to operate on line in a coal fired power plant. To duplicate at laboratory level the real situation, the coal samples are sequentially positioned under the measuring head by means of a translation/rotation unit that allows reproducing the behavior of the raw coal transported by a conveyor belt. Experimental results show that both carbon and hydrogen concentration as well as the content of some inorganic components (Al, Ca, Fe, Si) can be evaluated with good accuracy.

  17. Flat field correction for high-throughput imaging of fluorescent samples.

    PubMed

    Kask, Peet; Palo, Kaupo; Hinnah, Chris; Pommerencke, Thora

    2016-09-01

    Vignetting of microscopic images impacts both the visual impression of the images and any image analysis applied to it. Especially in high-throughput screening high demands are made on an automated image analysis. In our work we focused on fluorescent samples and found that two profiles (background and foreground) for each imaging channel need to be estimated to achieve a sufficiently flat image after correction. We have developed a method which runs completely unsupervised on a wide range of assays. By adding a reliable internal quality control we mitigate the risk of introducing artefacts into sample images through correction. The method requires hundreds of images for the foreground profile, thus limiting its application to high-throughput screening where this requirement is fulfilled in routine operation. PMID:27028041

  18. Origin and Correction of Magnetic Field Inhomogeneity at the Interface in Biphasic NMR Samples

    PubMed Central

    Martin, Bryan T.; Chingas, G. C.

    2012-01-01

    The use of susceptibility matching to minimize spectral distortion of biphasic samples layered in a standard 5 mm NMR tube is described. The approach uses magic angle spinning (MAS) to first extract chemical shift differences by suppressing bulk magnetization. Then, using biphasic coaxial samples, magnetic susceptibilities are matched by titration with a paramagnetic salt. The matched phases are then layered in a standard NMR tube where they can be shimmed and examined. Line widths of two distinct spectral lines, selected to characterize homogeneity in each phase, are simultaneously optimized. Two-dimensional distortion-free, slice-resolved spectra of an octanol/water system illustrate the method. These data are obtained using a 2D stepped-gradient pulse sequence devised for this application. Advantages of this sequence over slice-selective methods are that acquisition efficiency is increased and processing requires only conventional software. PMID:22459062

  19. Origin and correction of magnetic field inhomogeneity at the interface in biphasic NMR samples.

    PubMed

    Martin, Bryan T; Chingas, G C; McDougal, Owen M

    2012-05-01

    The use of susceptibility matching to minimize spectral distortion of biphasic samples layered in a standard 5 mm NMR tube is described. The approach uses magic angle spinning (MAS) to first extract chemical shift differences by suppressing bulk magnetization. Then, using biphasic coaxial samples, magnetic susceptibilities are matched by titration with a paramagnetic salt. The matched phases are then layered in a standard NMR tube where they can be shimmed and examined. Linewidths of two distinct spectral lines, selected to characterize homogeneity in each phase, are simultaneously optimized. Two-dimensional distortion-free, slice-resolved spectra of an octanol/water system illustrate the method. These data are obtained using a 2D stepped-gradient pulse sequence devised for this application. Advantages of this sequence over slice-selective methods are that acquisition efficiency is increased and processing requires only conventional software. PMID:22459062

  20. Field evaluation of sampling and analysis for organic pollutants in indoor air

    SciTech Connect

    Chuang, J.C.; Mack, G.A.; Stockrahm, J.W.; Hannan, S.W.; Bridges, C.

    1988-08-01

    The objectives of the study were to determine the feasibility of the use of newly developed indoor air samplers in residential indoor air sampling and to evaluate methodology for characterization of the concentrations of polynuclear aromatic hydrocarbons (PAH), PAH derivatives, and nicotine in residential air. Residential air sampling was conducted in Columbus, Ohio during the winter of 1986/87. The PAH derivatives were found at much lower levels than their parent PAH. Higher average indoor levels of all but three target compounds were found compared to outdoor levels. The higher outdoor levels of these three compounds (naphthalene dicarboxylic acid anhydride, pyrene dicarboxylic acid anhydride, and 2-nitrofluoranthene) are probably due to atmospheric transformation. Cigarette smoking was identified as the most-significant contributor to indoor levels of PAH and PAH derivatives. Homes with gas-heating systems appeared to have higher pollutant levels compared to homes with electric-heating systems.

  1. Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

    PubMed Central

    Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2011-01-01

    A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

  2. NHEXAS PHASE I REGION 5 STUDY--STANDARD OPERATING PROCEDURE--HANDLING QUALITY CONTROL SAMPLES IN THE FIELD (RTI/ACS-AP-209-090)

    EPA Science Inventory

    This protocol describes how quality control samples should be handled in the field, and was designed as a quick reference source for the field staff. The protocol describes quality control samples for air-VOCs, air-particles, water samples, house dust, soil, urine, blood, hair, a...

  3. Comparison and evaluation of Renibacterium salmoninarum quantitative PCR diagnostic assays using field samples of Chinook and coho salmon.

    PubMed

    Sandell, Todd A; Jacobson, Kym C

    2011-01-21

    Renibacterium salmoninarum is a Gram-positive bacterium causing bacterial kidney disease (BKD) in susceptible salmonid fishes. Several quantitative PCR (qPCR) assays to measure R. salmoninarum infection intensity have been reported, but comparison and evaluation of these assays has been limited. Here, we compared 3 qPCR primer/probe sets for detection of R. salmoninarum in field samples of naturally exposed Chinook and coho salmon first identified as positive by nested PCR (nPCR). Additional samples from a hatchery population of Chinook salmon with BKD were included to serve as strong positive controls. The 3 qPCR assays targeted either the multiple copy major soluble antigen (msa) genes or the single copy abc gene. The msa/non-fluorescent quencher (NFQ) assay amplified R. salmoninarum DNA in 53.2% of the nPCR positive samples, whereas the abc/NFQ assay amplified 21.8% of the samples and the abc/TAMRA assay 18.2%. The enzyme-linked immunosorbent assay (ELISA) successfully quantified only 16.4% of the nPCR positive samples. Although the msa/NFQ assay amplified a greater proportion of nPCR positive samples, the abc/NFQ assay better amplified those samples with medium and high ELISA values. A comparison of the geometric mean quantity ratios highlighted limitations of the assays, and the abc/NFQ assay strongly amplified some samples that were negative in other tests, in contrast to its performance among the sample group as a whole. These data demonstrate that both the msa/NFQ and abc/NFQ qPCR assays are specific and effective at higher infection levels and outperform the ELISA. However, most pathogen studies will continue to require multiple assays to both detect and quantify R. salmoninarum infection. PMID:21381519

  4. Detection of Dengue Virus in Mosquito Extracts and Human Clinical Samples Using a Field Expedient Molecular Platform.

    PubMed

    Pal, Subhamoy; Richardson, Jason H; Murphy, Jittawadee R; Krairojananan, Panadda; Kongtak, Patcharee; Jaichapor, Boonsong; Kankaew, Prasan; Ekanayake, Sajeewane; Davis, Timothy J; Maserang, David L; Teng, David H F; Crisp, Robert J; Wu, Shuenn-Jue L; Coleman, Russell E; McAvin, James C; Swaby, James A

    2015-09-01

    Dengue fever occurs in localized outbreaks and can significantly erode troop strength and mission readiness. Timely identification of dengue virus (DENV) provides for rapid and appropriate patient management decisions, such as medical evacuation and supportive therapies, as well as help to promote Force Health Protection through vector control and personal protective measures. The "Ruggedized" Advanced Pathogen Identification Device is a field-friendly PCR (Polymerase Chain Reaction) platform that can be used to facilitate early identification of DENV. We developed a dry-format PCR assay on this platform. The assay demonstrated 100% analytical specificity for detecting dengue using a cross-reactivity panel. We used a panel of 102 acute, DENV isolation positive serum samples and 25 DENV negative samples; the assay demonstrated a clinical sensitivity of 97.1% (95% C.I. 91.6-99.4%) and specificity of 96.0% (95% C.I. 79.7-99.9%) in identifying patients with dengue infection. We also used the assay to test mosquito homogenates from 28 adult female Aedes aegypti. A single DENV infected mosquito was identified using the PCR assay and confirmed using immunofluorescence as a reference method. Much of the testing was performed under austere field conditions. Together, our results demonstrate the utility of this assay for detecting DENV in vector and human samples in field environments. PMID:26327544

  5. Field and Lab Methods to Reduce Sampling Variation in Soil Carbon

    NASA Astrophysics Data System (ADS)

    Mattson, K. G.; Zhang, J.

    2015-12-01

    Natural variability in soil and detrital carbon sampling is typically large enough that it hinders accurate assessment of standing stock and changes that may occur following disturbances and experimental treatments. We are developing carbon budgets in forests of Northern California and wish to see how experimental canopy thinning may affect carbon cycling in these forests. In the pre-treatment phase, we have sought methods to quantify detrital carbon pools in an accurate and efficient manner. We have found that small soil excavations 15 cm diameter to a depth of 10 cm work very well to reduce variation an avoid introducing sampling biases. We excavate a pit carefully of uniform dimensions using cutting chisels and scoops. We fill the void created using small pebbles contained in a small net and then weigh the pebbles to obtain a volume estimate of the soil collected. The samples are sorted moist through a series of sieves of 6, 4, and 2 mm into rocks, live roots, dead roots, woody debris, and remaining soil and its organic matter. From a single sample, we estimate proportional rock volume, fine soil bulk density (soil bulk density of the 2 mm fraction), live roots, dead roots, woody debris, and proportion of organic matter in the 2 mm fraction. The standard deviations of soil measures (soil carbon, loss on ignition, bulk density, rock volume, live and dead root mass) were universally reduced over similar measures by soil corers, in some instances by up to 5-fold. Coefficient of variation using excavation pits are typically 5 to 10 %, whereas cores were 20 to 30 %. We have observed that variation in soil organic matter is more a function of variation in soil bulk density than with variation in percent soil organic matter content. As a result, we often see increased soil organic matter stores at depths below 10 cm. Soils beneath highly decayed logs show increases in soil carbon in the mineral soil suggesting woody debris is a source of soil carbon. Below

  6. X-ray spectral properties of the AGN sample in the northern XMM-XXL field

    NASA Astrophysics Data System (ADS)

    Liu, Zhu; Merloni, Andrea; Georgakakis, Antonis; Menzel, Marie-Luise; Buchner, Johannes; Nandra, Kirpal; Salvato, Mara; Shen, Yue; Brusa, Marcella; Streblyanska, Alina

    2016-06-01

    In this paper we describe and publicly release a catalogue consisting of 8445 point-like X-ray sources detected in the XMM-XXL north survey. For the 2512 AGN which have reliable spectroscopy from SDSS-III/BOSS, we present the X-ray spectral fitting which has been computed with a Bayesian approach. We have also applied an X-ray spectral stacking method to different sub-samples, selected on the basis of the AGN physical properties (L2-10 keV, z, MBH, λEdd and NH). We confirm the well-known Iwasawa-Taniguchi effect in our luminosity-redshift sub-samples, and argue that such an effect is due to a decrease in the covering factor of a distant obscuring `torus' with increasing X-ray luminosity. By comparing the distribution of the reflection fraction, the ratio of the normalization of the reflected component to the direct radiation, we find that the low-luminosity, low-redshift sub-sample had systematically higher reflection fraction values than the high-redshift, high-luminosity one. On the other hand, no significant difference is found between samples having similar luminosity but different redshift, suggesting that the structure of the torus does not evolve strongly with redshift. Contrary to previous works, we do not find evidence for an increasing photon index at high Eddington ratio. This may be an indication that the structure of the accretion disc changes as the Eddington ratio approaches unity. Comparing our X-ray spectral analysis results with the optical spectral classification, we find that ˜20 per cent of optical type-1 AGN show an X-ray absorbing column density higher than 1021.5 cm- 2, and about 50 per cent of type-2 AGN have an X-ray absorbing column density less than 1021.5 cm- 2. We suggest that the excess X-ray absorption shown in the high-luminosity optical type-1 AGN can be due to small-scale dust-free gas within (or close to) the broad-line region, while in the low-luminosity ones it can be due to a clumpy torus with a large covering factor.

  7. Drilling, Sampling, and Well-Installation Plan for the IFC Well Field, 300 Area

    SciTech Connect

    Bjornstad, Bruce N.; Horner, Jacob A.

    2008-05-05

    The 300 Area was selected as a location for an IFC because it offers excellent opportunities for field research on the influence of mass-transfer processes on uranium in the vadose zone and groundwater. The 300 Area was the location of nuclear fuel fabrication facilities and has more than 100 waste sites. Two of these waste sites, the North and South Process Ponds received large volumes of process waste from 1943 to 1975 and are thought to represent a significant source of the groundwater uranium plume in the 300 Area. Geophysical surveys and other characterization efforts have led to selection of the South Process Pond for the IFC.

  8. Rapid and sensitive determination of tellurium in soil and plant samples by sector-field inductively coupled plasma mass spectrometry.

    PubMed

    Yang, Guosheng; Zheng, Jian; Tagami, Keiko; Uchida, Shigeo

    2013-11-15

    In this work, we report a rapid and highly sensitive analytical method for the determination of tellurium in soil and plant samples using sector field inductively coupled plasma mass spectrometry (SF-ICP-MS). Soil and plant samples were digested using Aqua regia. After appropriate dilution, Te in soil and plant samples was directly analyzed without any separation and preconcentration. This simple sample preparation approach avoided to a maximum extent any contamination and loss of Te prior to the analysis. The developed analytical method was validated by the analysis of soil/sediment and plant reference materials. Satisfactory detection limits of 0.17 ng g(-1) for soil and 0.02 ng g(-1) for plant samples were achieved, which meant that the developed method was applicable to studying the soil-to-plant transfer factor of Te. Our work represents for the first time that data on the soil-to-plant transfer factor of Te were obtained for Japanese samples which can be used for the estimation of internal radiation dose of radioactive tellurium due to the Fukushima Daiichi Nuclear Power Plant accident. PMID:24148390

  9. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal reservoir, California, was measured at 150, 200, and 250 C as a function of pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption (increasing pressure) and desorption (decreasing pressure) runs were made in order to investigate the nature and the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were performed on the same rock samples. Nitrogen or krypton adsorption and desorption isotherms at 77 K were used to obtain BET specific surface areas, pore volumes and their distributions with respect to pore sizes. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there is in general no proportionality between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The results indicate that multilayer adsorption rather than capillary condensation is the dominant water storage mechanism at high temperatures.

  10. A non-destructive sampling protocol for field studies of seed dispersal by fishes.

    PubMed

    Correa, S B; Anderson, J T

    2016-05-01

    This paper presents a standardized protocol for the non-lethal capture of fishes, sampling of stomach contents and quantification of seed dispersal efficiency by frugivorous fishes. Neotropical pacu Piaractus mesopotamicus individuals were collected with fruit-baited hooks. The diets of 110 fish were sampled using a lavage method, which retrieved >90% of stomach contents of both juveniles and adults and allowed individuals to recover within 5 min of treatment. The proportional volume of six food categories was similar for stomachs and whole digestive tracts retrieved by dissection. Fruit pulp was proportionally lower in the stomach. The abundance and species richness of intact seeds increased with fish size independent of whether only stomachs or whole digestive tracts were analysed. The analysis of stomach contents accounted for 62·5% of the total species richness of seeds dispersed by P. mesopotamicus and 96% of common seeds (seed species retrieved from more than one fish). Germination trials revealed that seed viability was similar for seeds collected from the stomach via lavage and seeds that passed through the entire digestive tract. Therefore, stomach contents provide an unbiased representation of the dietary patterns and seed dispersal of frugivorous fishes. PMID:27097831

  11. Estimating wildfire risk on a Mojave Desert landscape using remote sensing and field sampling

    USGS Publications Warehouse

    Van Linn, Peter F., III; Nussear, Kenneth E.; Esque, Todd C.; DeFalco, Lesley A.; Inman, Richard D.; Abella, Scott R.

    2013-01-01

    Predicting wildfires that affect broad landscapes is important for allocating suppression resources and guiding land management. Wildfire prediction in the south-western United States is of specific concern because of the increasing prevalence and severe effects of fire on desert shrublands and the current lack of accurate fire prediction tools. We developed a fire risk model to predict fire occurrence in a north-eastern Mojave Desert landscape. First we developed a spatial model using remote sensing data to predict fuel loads based on field estimates of fuels. We then modelled fire risk (interactions of fuel characteristics and environmental conditions conducive to wildfire) using satellite imagery, our model of fuel loads, and spatial data on ignition potential (lightning strikes and distance to roads), topography (elevation and aspect) and climate (maximum and minimum temperatures). The risk model was developed during a fire year at our study landscape and validated at a nearby landscape; model performance was accurate and similar at both sites. This study demonstrates that remote sensing techniques used in combination with field surveys can accurately predict wildfire risk in the Mojave Desert and may be applicable to other arid and semiarid lands where wildfires are prevalent.

  12. Utilization of 100 mb midlatitude height fields as an indicator of sampling effects on total ozone variations

    NASA Technical Reports Server (NTRS)

    Miller, A. J.; Nagatani, R. M.; Laver, J. D.; Korty, B.

    1979-01-01

    Midlatitude 100-mb height fields are employed to determine the effects of ground based sampling locations on measurements of variations in the total ozone content of the atmosphere. The precision of the zonal average heights computed by the technique of Angell and Korshover (1978) from data over ozone sampling areas at 50 deg N is compared to the zonal average computed from the entire data set. Linear regressions of ozone contents determined by an analysis of backscatter UV satellite data with respect to 100 mb heights are utilized to transform zonal differences in height to ozone levels. The zonal average total ozone sampling error is found to be on the order of 2% for midlatitudes of the Northern hemisphere, indicating that the general shape of ozone trends determined by ground-based observations appears to be real and the increase of ozone from the mid-1960's to the early 1970's may be greater than previously suggested.

  13. Field Sampling Plan for the Operable Units 6-05 and 10-04 Remedial Action, Phase IV

    SciTech Connect

    R. Wells

    2006-11-14

    This Field Sampling Plan outlines the collection and analysis of samples in support of Phase IV of the Waste Area Group 10, Operable Units 6-05 and 10-04 remedial action. Phase IV addresses the remedial actions to areas with the potential for unexploded ordnance at the Idaho National Laboratory Site. These areas include portions of the Naval Proving Ground, the Arco High-Altitude Bombing Range, and the Twin Buttes Bombing Range. The remedial action consists of removal and disposal of ordnance by high-order detonation, followed by sampling to determine the extent, if any, of soil that might have been contaminated by the detonation activities associated with the disposal of ordnance during the Phase IV activities and explosives during the Phase II activities.

  14. The structure and transformation of the nanomineral schwertmannite: a synthetic analog representative of field samples

    NASA Astrophysics Data System (ADS)

    French, Rebecca A.; Monsegue, Niven; Murayama, Mitsuhiro; Hochella, Michael F.

    2014-04-01

    The phase transformation of schwertmannite, an iron oxyhydroxide sulfate nanomineral synthesized at room temperature and at 75 °C using H2O2 to drive the precipitation of schwertmannite from ferrous sulfate (Regenspurg et al. in Geochim Cosmochim Acta 68:1185-1197, 2004), was studied using high-resolution transmission electron microscopy. The results of this study suggest that schwertmannite synthesized using this method should not be described as a single phase with a repeating unit cell, but as a polyphasic nanomineral with crystalline areas spanning less than a few nanometers in diameter, within a characteristic `pin-cushion'-like amorphous matrix. The difference in synthesis temperature affected the density of the needles on the schwertmannite surface. The needles on the higher-temperature schwertmannite displayed a dendritic morphology, whereas the needles on the room-temperature schwertmannite were more closely packed. Visible lattice fringes in the schwertmannite samples are consistent with the powder X-ray diffraction (XRD) pattern taken on the bulk schwertmannite and also matched d-spacings for goethite, indicating a close structural relationship between schwertmannite and goethite. The incomplete transformation from schwertmannite to goethite over 24 h at 75 °C was tracked using XRD and TEM. TEM images suggest that the sample collected after 24 h consists of aggregates of goethite nanocrystals. Comparing the synthetic schwertmannite in this study to a study on schwertmannite produced at 85 °C, which used ferric sulfate, reveals that synthesis conditions can result in significant differences in needle crystal structure. The bulk powder XRD patterns for the schwertmannite produced using these two samples were indistinguishable from one another. Future studies using synthetic schwertmannite should account for these differences when determining schwertmannite's structure, reactivity, and capacity to take up elements like arsenic. The schwertmannite

  15. Field Evaluations of Sampling Methods for Long-Term Monitoring of Upland Ecosystems on the Colorado Plateau

    USGS Publications Warehouse

    Miller, Mark E.; Witwicki, Dana L.; Mann, Rebecca K.; Tancreto, Nicole J.

    2007-01-01

    . There also were no differences among methods with respect to mean and median measures of among-plot variability in total live understory canopy cover. But among-plot variability was least for the line-point technique at seven of 11 ecological sites. Sampling activities had greatest impacts on plot conditions at macroplots where there was a high degree of cover by biological and physical soil crusts. Of all sampling procedures, 10-m2 quadrat sampling, line-point sampling, and gap-intercept sampling had the most impacts on soil conditions due to trampling of soil crusts by the field team.

  16. Applying high resolution SyXRD analysis on sulfate attacked concrete field samples

    SciTech Connect

    Stroh, J.; Schlegel, M.-C.; Irassar, E.F.; Meng, B.; Emmerling, F.

    2014-12-15

    High resolution synchrotron X-ray diffraction (SyXRD) was applied for a microstructural profile analysis of concrete deterioration after sulfate attack. The cement matrices consist of ordinary Portland cement and different amounts of supplementary cementitious materials, such as fly ash, natural pozzolana and granulated blast furnace slag. The changes of the phase composition were determined along the direction of sulfate ingress. This approach allows the identification of reaction fronts and zones of different phase compositions and conclusions about the mechanisms of sulfate attack. Two reaction fronts were localized in the initial 4 mm from the sample surface. The mechanism of deterioration caused by the exposition in the sulfate-bearing soil is discussed. SyXRD is shown to be a reliable method for investigation of cementitious materials with aggregates embedded in natural environments.

  17. NGSI FY15 Final Report. Innovative Sample Preparation for in-Field Uranium Isotopic Determinations

    SciTech Connect

    Yoshida, Thomas M.; Meyers, Lisa

    2015-11-10

    Our FY14 Final Report included an introduction to the project, background, literature search of uranium dissolution methods, assessment of commercial off the shelf (COTS) automated sample preparation systems, as well as data and results for dissolution of bulk quantities of uranium oxides, and dissolution of uranium oxides from swipe filter materials using ammonium bifluoride (ABF). Also, discussed were reaction studies of solid ABF with uranium oxide that provided a basis for determining the ABF/uranium oxide dissolution mechanism. This report details the final experiments for optimizing dissolution of U3O8 and UO2 using ABF and steps leading to development of a Standard Operating Procedure (SOP) for dissolution of uranium oxides on swipe filters.

  18. Use of the sampling theorem to speed up near-field physical optics scattering calculations

    NASA Technical Reports Server (NTRS)

    Cramer, P. W.; Imbriale, W. A.

    1994-01-01

    Physical optics scattering calculations performed on the DSN 34-m beam-waveguide antennas at Ka-band (32 GHz) require approximately 12 hr of central processing unit time on a Cray Y-MP2 computer. This is excessive in terms of resource utilization and turnaround time. Typically, the calculations involve five surfaces, and the calculations are done two surfaces at a time. The sampling theorem is used to reduce the number of current values that must be calculated over the second surface by performing a physical optics integration over the first surface. The additional number of current values required on the second surface by subsequent physical optics integrations is obtained by interpolation over the original current values. Time improvements on the order of a factor of 2 to 4 were obtained for typical scattering pairs.

  19. Sampling and Analysis of Impact Crater Residues Found on the Wide Field Planetary Camera-2 Radiator

    NASA Astrophysics Data System (ADS)

    Anz-Meador, P. D.; Liou, J.-C.; Ross, D.; Robinson, G. A.; Opiela, J. N.; Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R. P.; Griffin, T. J.; Reed, B. B.; Gerlach, L.

    2013-08-01

    After nearly 16 years in low Earth orbit (LEO), the Wide Field Planetary Camera-2 (WFPC2) was recovered from the Hubble Space Telescope (HST) in May 2009, during the 12 day shuttle mission designated STS-125. The WFPC-2 radiator had been struck by approximately 700 impactors producing crater features 300 μ m and larger in size. Following optical inspection in 2009, agreement was reached for joint NASA-ESA study of crater residues, in 2011. Over 480 impact features were extracted at NASA Johnson Space Center's (JSC) Space Exposed Hardware clean-room and curation facility during 2012, and were shared between NASA and ESA. We describe analyses conducted using scanning electron microscopy (SEM) - energy dispersive X-ray spectrometry (EDX): by NASA at JSC's Astromaterials Research and Exploration Science (ARES) Division; and for ESA at the Natural History Museum (NHM), with Ion beam analysis (IBA) using a scanned proton microbeam at the University of Surrey Ion Beam Centre (IBC).

  20. Sampling and Analysis of Impact Crater Residues Found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R, P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years in low Earth orbit (LEO), the Wide Field Planetary Camera-2 (WFPC2) was recovered from the Hubble Space Telescope (HST) in May 2009, during the 12 day shuttle mission designated STS-125. The WFPC-2 radiator had been struck by approximately 700 impactors producing crater features 300 microns and larger in size. Following optical inspection in 2009, agreement was reached for joint NASA-ESA study of crater residues, in 2011. Over 480 impact features were extracted at NASA Johnson Space Center's (JSC) Space Exposed Hardware clean-room and curation facility during 2012, and were shared between NASA and ESA. We describe analyses conducted using scanning electron microscopy (SEM) - energy dispersive X-ray spectrometry (EDX): by NASA at JSC's Astromaterials Research and Exploration Science (ARES) Division; and for ESA at the Natural History Museum (NHM), with Ion beam analysis (IBA) using a scanned proton microbeam at the University of Surrey Ion Beam Centre (IBC).

  1. It's about time; Repeated field sampling and flexible UAV platforms for a changing globe

    NASA Astrophysics Data System (ADS)

    Crutsinger, G.

    2015-12-01

    Unmanned Aerial Vehicles (UAVs) are quickly being adopted across the field sciences and will revolutionizing the speed and spatial scale of data collection. As a result, UAVs will alleviate much of the burden placed on boots-on-the-ground researchers as they seek to address fundamental scientific questionsa ssociated with global change. Concurrently, UAVs will initiate a rapid rise in time-series data, whether from monitoring weather patterns, measuring shifts in phenology due to a warming temperatures, or tracking range expansion and contraction of species. The challenges within the scientific community will be in the standardization of data collection, protocol sharing, and data management. The emergence of flexible aerial platforms within the commercial UAV space with multiple sensor configurations, open software application development, and cloud-based services should do much to address these challenges, but only if there is close collaboration between the industry and academic research partners.

  2. Using adaptive sampling and triangular meshes for the processing and inversion of potential field data

    NASA Astrophysics Data System (ADS)

    Foks, Nathan Leon

    The interpretation of geophysical data plays an important role in the analysis of potential field data in resource exploration industries. Two categories of interpretation techniques are discussed in this thesis; boundary detection and geophysical inversion. Fault or boundary detection is a method to interpret the locations of subsurface boundaries from measured data, while inversion is a computationally intensive method that provides 3D information about subsurface structure. My research focuses on these two aspects of interpretation techniques. First, I develop a method to aid in the interpretation of faults and boundaries from magnetic data. These processes are traditionally carried out using raster grid and image processing techniques. Instead, I use unstructured meshes of triangular facets that can extract inferred boundaries using mesh edges. Next, to address the computational issues of geophysical inversion, I develop an approach to reduce the number of data in a data set. The approach selects the data points according to a user specified proxy for its signal content. The approach is performed in the data domain and requires no modification to existing inversion codes. This technique adds to the existing suite of compressive inversion algorithms. Finally, I develop an algorithm to invert gravity data for an interfacing surface using an unstructured mesh of triangular facets. A pertinent property of unstructured meshes is their flexibility at representing oblique, or arbitrarily oriented structures. This flexibility makes unstructured meshes an ideal candidate for geometry based interface inversions. The approaches I have developed provide a suite of algorithms geared towards large-scale interpretation of potential field data, by using an unstructured representation of both the data and model parameters.

  3. Statistical techniques for detecting the intergalactic magnetic field from large samples of extragalactic Faraday rotation data

    SciTech Connect

    Akahori, Takuya; Gaensler, B. M.; Ryu, Dongsu E-mail: bryan.gaensler@sydney.edu.au

    2014-08-01

    Rotation measure (RM) grids of extragalactic radio sources have been widely used for studying cosmic magnetism. However, their potential for exploring the intergalactic magnetic field (IGMF) in filaments of galaxies is unclear, since other Faraday-rotation media such as the radio source itself, intervening galaxies, and the interstellar medium of our Galaxy are all significant contributors. We study statistical techniques for discriminating the Faraday rotation of filaments from other sources of Faraday rotation in future large-scale surveys of radio polarization. We consider a 30° × 30° field of view toward the south Galactic pole, while varying the number of sources detected in both present and future observations. We select sources located at high redshifts and toward which depolarization and optical absorption systems are not observed so as to reduce the RM contributions from the sources and intervening galaxies. It is found that a high-pass filter can satisfactorily reduce the RM contribution from the Galaxy since the angular scale of this component toward high Galactic latitudes would be much larger than that expected for the IGMF. Present observations do not yet provide a sufficient source density to be able to estimate the RM of filaments. However, from the proposed approach with forthcoming surveys, we predict significant residuals of RM that should be ascribable to filaments. The predicted structure of the IGMF down to scales of 0.°1 should be observable with data from the Square Kilometre Array, if we achieve selections of sources toward which sightlines do not contain intervening galaxies and RM errors are less than a few rad m{sup –2}.

  4. Megacrystic Clinopyroxene Basalts Sample A Deep Crustal Underplate To The Mount Taylor Volcanic Field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, M. E.; Schrader, C. M.; Crumpler, L. S.; Wolff, J. A.

    2012-12-01

    The alkaline and compositionally diverse (basanite to high-Si rhyolite) Mount Taylor Volcanic Field (MTVF), New Mexico comprises 4 regions that cover ~75 x 40 km2: (1) Mount Taylor, a large composite volcano and a surrounding field of basaltic vents; (2) Grants Ridge, constructed of topaz rhyolitic ignimbrite and coulees; (3) Mesa Chivato, a plateau of alkali basalts and mugearitic to trachytic domes; and (4) the Rio Puero basaltic necks. Distributed throughout its history (~3.6 to 1.26 Ma; Crumpler and Goff, 2012) and area (excepting Rio Puerco Necks) is a texturally distinct family of differentiated basalts (Mg# 43.2-53.4). These basalts contain resorbed and moth-eaten megacrysts (up to 2 cm) of plagioclase, clinopyroxene, and olivine ±Ti-magnetite ±ilmenite ±rare orthopyroxene. Some megacrystic lava flows have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. For instance, gabbroic and megacrystic clinopyroxenes form linear positive arrays in TiO2 (0.2-2.3 wt%) with respect to Al2O3 (0.7-9.3 wt%). The lowest Al clinopyroxenes are found in a gabbroic inclusion and are associated with partially melted intercumulus orthopyroxene. Megacrystic and gabbroic plagioclase (An 41-80) in 4 representative thin sections were analyzed for 87Sr/86Sr by Laser Ablation ICP-MS. 87Sr/86Sr values for the suite range from 0.7036 to 0.7047. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, these megacrysts track the differentiation of an intrusive body (or related bodies) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. The intrusive body likely underplates portions of the MTVF that have generated silicic magmas (Mount Taylor, Grants Ridge, Mesa Chivato). Although disequilibrium is implied by resorbed

  5. Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

    USGS Publications Warehouse

    Cecil, L.D.; Knobel, L.L.; Wegner, S.J.; Moore, L.L.

    1989-01-01

    Water from four wells completed in the Snake River Plain aquifer was sampled as part of the U.S. Geological Survey 's quality assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in groundwater at the Idaho National Engineering Laboratory. Water from each well was filtered through either a 0.45-micrometer membrane or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered samples was preserved in the field with reagent-grade hydrochloric acid and the other set of samples was not acidified. For water from wells with strontium-90 concentrations at or above the reporting level, 94% or more of the strontium-90 is in true solution or in colloidal particles smaller than 0.1 micrometer. These results suggest that within-laboratory reproducibility for strontium-90 in groundwater at the INEL is not significantly affected by changes in filtration and preservation methods used for sample collections. (USGS)

  6. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland: Volume 2, Quality Assurance Project Plan

    SciTech Connect

    Prasad, S.; Martino, L.; Patton, T.

    1995-03-01

    J-Field encompasses about 460 acres at the southern end of the Gunpowder Neck Peninsula in the Edgewood Area of APG (Figure 2.1). Since World War II, the Edgewood Area of APG has been used to develop, manufacture, test, and destroy chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). For the purposes of this project, J-Field has been divided into eight geographic areas or facilities that are designated as areas of concern (AOCs): the Toxic Burning Pits (TBP), the White Phosphorus Burning Pits (WPP), the Riot Control Burning Pit (RCP), the Robins Point Demolition Ground (RPDG), the Robins Point Tower Site (RPTS), the South Beach Demolition Ground (SBDG), the South Beach Trench (SBT), and the Prototype Building (PB). The scope of this project is to conduct a remedial investigation/feasibility study (RI/FS) and ecological risk assessment to evaluate the impacts of past disposal activities at the J-Field site. Sampling for the RI will be carried out in three stages (I, II, and III) as detailed in the FSP. A phased approach will be used for the J-Field ecological risk assessment (ERA).

  7. A sample cell for in situ electric-field-dependent structural characterization and macroscopic strain measurements.

    PubMed

    Hossain, Mohammad J; Wang, Lijun; Wang, Zhiyang; Khansur, Neamul H; Hinterstein, Manuel; Kimpton, Justin A; Daniels, John E

    2016-05-01

    When studying electro-mechanical materials, observing the structural changes during the actuation process is necessary for gaining a complete picture of the structure-property relationship as certain mechanisms may be meta-stable during actuation. In situ diffraction methods offer a powerful and direct means of quantifying the structural contributions to the macroscopic strain of these materials. Here, a sample cell is demonstrated capable of measuring the structural variations of electro-mechanical materials under applied electric potentials up to 10 kV. The cell is designed for use with X-ray scattering techniques in reflection geometry, while simultaneously collecting macroscopic strain data using a linear displacement sensor. The results show that the macroscopic strain measured using the cell can be directly correlated with the microscopic response of the material obtained from diffraction data. The capabilities of the cell have been successfully demonstrated at the Powder Diffraction beamline of the Australian Synchrotron and the potential implementation of this cell with laboratory X-ray diffraction instrumentation is also discussed. PMID:27140148

  8. Real-Time THz Imaging Using Full-Field Electro-Optic Sampling

    NASA Astrophysics Data System (ADS)

    Ayesheshim, A.; Bushfield, I.; Hegmann, F. A.

    2010-03-01

    Real time terahertz imaging offers diverse opportunities and applications for non-destructive imaging applications [1,2]. In this paper, we demonstrate real-time THz imaging of still, moving, and concealed objects. Using a Ti: sapphire amplifier laser system, a THz beam is generated and detected via optical rectification and EO sampling respectively using [110] ZnTe wafers. Real time THz video rate imaging of metal objects and dripping water within a cardboard cylinder are clearly seen by an 8-bit grayscale CCD camera. The ring-like temporal and spatial intensity distribution of the various frequency components of the THz signal on the focal plane is also studied. To improve SNR, we use frame averaging and dynamic subtraction methods [3]. [4pt] [1] B .B. Hu and M. C. Nuss, Opt.Lett. 20, 1716(1995). [0pt] [2] K.Kawase, Y.Ogawa, Y.Watanabe, Opt. Express 11, 2546(2003). [0pt] [3] Z.Jiang, X.G.Xu, and X. -C. Zhang, Appl.Opt.39, 2982-2987(2000).

  9. You wouldn't go into the field with dirty sampling gear, would you?

    NASA Astrophysics Data System (ADS)

    Rummel, J. D.; Voytek, M. A.; Hipkin, V.

    2014-12-01

    Planetary protection is a precautionary principle that brought together Western and Soviet interests at the height of the Cold War. Scientists on both sides lobbied for a guiding principle in the design of planetary missions that included how to prevent biological contamination of target planetary bodies to preserve their pristine nature until they could be studied in detail. Planetary protection policies today remain as relevant because the pace of exploration has been far slower than their expectation, which was to have completed the search for life in our solar system within 50 years. Today Planetary Protection Policy rides on our definitions of terran life and what we know of its limits on Earth and our limited knowledge of extraterrestrial environments. A brief history of planetary protection is presented with a reminder that the harmful contamination it protects against for Mars is the inability to detect biosignatures should they exist. For illustration, an imaginary life detection mission without planetary protection requirements is discussed. Finally, a brief review is given of current planetary protection implementation methods and new areas of research in this field.

  10. Field Research and Laboratory Sample Analysis of Dust-Water-Organics-Life from Mars Analogue Extreme Environments

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.; Ehrenfreund, Pascale; ILEWG EuroMoonMars Team

    2015-08-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009* to 2013) in the extreme environment of the Utah desert relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution a ected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with signi cant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare 2009 campaign results to new measurements from 2010-2013 campaigns: comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.References * in Foing, Stoker Ehrenfreund (Editors, 2011) Astrobiology field Research in Moon/Mars Analogue Environments", Special Issue of International Journal of Astrobiology

  11. Compatible host/mycorrhizal fungus combinations for micropropagated sea oats. I. Field sampling and greenhouse evaluations.

    PubMed

    Sylvia, David M; Alagely, Abid K; Kane, Michael E; Philman, Nancy L

    2003-08-01

    Micropropagation technology promises to improve the supply of sea oats for restoring Florida's eroded beaches, but concerns about genetic diversity need to be addressed. These dune plants are colonized by a wide array of arbuscular mycorrhizal (AM) fungi, yet little is know of the diversity of these fungal communities. Our goal was to test the level of functional diversity that exists among communities of AM fungi that are present in divergent Florida dunes. Community pot cultures were established from samples collected from ten transects in two Gulf coast and two Atlantic coast locations in Florida, and these were used to conduct two greenhouse studies. The objective of the first study was to evaluate within-location variance in the mycorrhizal function of different AM fungal communities associated with endemic sea oats. The objective of the second study was to evaluate among-location responses of plant and fungal ecotypes using selected combinations obtained from the first experiment. Within locations, the AM fungal community had significant impacts on shoot mass and shoot-P contents, confirming a range of symbiotic effectiveness exists within the beach-dune system. Among locations, there was a tendency for greater root colonization between host clones and fungal communities from the same location, indicating a degree of specificity between host ecotypes and their symbiotic fungi. Relative to plant growth response, one fungal community was superior across plant genotypes from all locations, while one plant genotype tended to have the best response across all fungal communities. These data suggest that while it is possible to select effective AM fungal-host combinations for outplanting, origin of host and AM fungi have little predictive value in screening these combinations. PMID:12687447

  12. Megacrystic pyroxene basalts sample deep crustal gabbroic cumulates beneath the Mount Taylor volcanic field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, Mariek E.; Schrader, Christian M.; Crumpler, Larry S.; Rowe, Michael C.; Wolff, John A.; Boroughs, Scott P.

    2016-04-01

    Distributed over the ~ 2.3 m.y. history of the alkaline and compositionally diverse Mount Taylor Volcanic Field (MTVF), New Mexico is a widespread texturally distinct family of differentiated basalts that contain resorbed megacrysts (up to 3 cm) of plagioclase, clinopyroxene, and olivine ± Ti-magnetite ± ilmenite ± orthopyroxene. These lavas have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. Gabbroic and megacrystic clinopyroxenes form positive linear arrays in TiO2 (0.2-2.3 wt.%) with respect to Al2O3 (0.7-9.3 wt.%). Plagioclase (An41-80) from representative thin sections analyzed for 87Sr/86Sr by laser ablation ICP-MS range from 0.7036 to 0.7048. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, the pyroxene and plagioclase megacrysts appear to track the differentiation of a gabbroic pluton (or related plutons) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. Clinopyroxene-liquid geobarometry calculations suggest that crystallization occurred near the crust-mantle transition at an average of ~ 1200 °C and 12-13 kbar. The distribution of the megacrystic pyroxene basalts suggests that a gabbroic intrusive body underlies subregions of the MTVF that have generated silicic magmas. The gabbro is interpreted to be a significant heat and mass input into the lower crust that is capable of driving the petrogenesis of diverse silicic compositions (through fractionation and crustal assimilation), including mugearites, trachytes, trachy-andesites and dacites, high-Si rhyolites, and topaz rhyolites of the MTVF.

  13. Using self-consistent fields to bias Monte Carlo methods with applications to designing and sampling protein sequences

    NASA Astrophysics Data System (ADS)

    Zou, Jinming; Saven, Jeffery G.

    2003-02-01

    For complex multidimensional systems, Monte Carlo methods are useful for sampling probable regions of a configuration space and, in the context of annealing, for determining "low energy" or "high scoring" configurations. Such methods have been used in protein design as means to identify amino acid sequences that are energetically compatible with a particular backbone structure. As with many other applications of Monte Carlo methods, such searches can be inefficient if trial configurations (protein sequences) in the Markov chain are chosen randomly. Here a mean-field biased Monte Carlo method (MFBMC) is presented and applied to designing and sampling protein sequences. The MFBMC method uses predetermined sequence identity probabilities wi(α) to bias the sequence selection. The wi(α) are calculated using a self-consistent, mean-field theory that can estimate the number and composition of sequences having predetermined values of energetically related foldability criteria. The MFBMC method is applied to both a simple protein model, the 27-mer lattice model, and an all-atom protein model. Compared to conventional Monte Carlo (MC) and configurational bias Monte Carlo (BMC), the MFBMC method converges faster to low energy sequences and samples such sequences more efficiently. The MFBMC method also tolerates faster cooling rates than the MC and BMC methods. The MFBMC method can be applied not only to protein sequence search, but also to a wide variety of polymeric and condensed phase systems.

  14. Woodbridge Army Research Facility RI/FS; volume 1. Field sampling plan. Report for 1995-1996

    SciTech Connect

    Choynowski, J.; Ehlers, M.; Elias, M.; Garcia, M.; Henry, C.

    1996-02-01

    U.S. Army Woodbridge Research Facility (WRF) was used in the past as a major military communications center and a research and development laboratory where electromagnetic pulse energy was tested on military and other equipment. WRF is presently an inactive facility pursuant to the 1991 Base Realignment and Closure list. Past investigation activities indicate that polychlorinated biphenyl compounds (PCBs) are primary chemicals of concern. The WRF is presently in the process of being turned over to the United States Fish and Wildlife Service (USFWS) to be used as a wildlife refuge and training facility. This task calls for provision of the necessary staff and equipment to provide remedial investigation/feasibility support for the USAEC BRAC Program investigation at WRF. The scope of work includes Focused Feasibility Studies, Remedial Investigations, Feasibility Studies, ecological assessments, risk assessments, proposed plans, RODs, and community relations support. This Field Sampling Plan contains a description of the site, sample location rationale, technical approach to field operations, site safety procedures, and methods for ecological assessments, analyses of samples, data management, and disposal of investigation-derived wastes. Information contained in other plans which accompany this submittal is identified.

  15. Laboratory validation and field verification of a new passive air monitoring badge for sampling ethylene oxide in air.

    PubMed

    Kring, E V; Damrell, D J; Basilio, A N; McGibney, P D; Douglas, J J; Henry, T J; Ansul, G R

    1984-10-01

    A new diffusion colorimetric air monitoring badge for sampling ethylene oxide is described. The Du Pont Pro-Tek C-70 badge has been laboratory validated over the range of 4-375 ppm-hours (0.5-47 ppm on an 8-hour TWA) using standard spectrophotometer readout in 1 centimeter (10 mm) cells. The lower range can be extended to 2 ppm-hours (0.25 ppm) by using 4 cm (40 mm) cells. The badge has an overall sampling and analytical method accuracy of +/- 13.5%. It meets NIOSH accuracy criteria and has a mean coefficient of variation CVT = 0.059. The badge has no temperature, pressure, relative humidity or face velocity effects over practical ranges. The response time is adequate to sample peak concentrations over short time periods. The badge may be used to determine ambient formaldehyde levels if suspected to be present along with ethylene oxide. Badges are shown to agree very well with the industry accepted and proposed ASTM pump/charcoal tube method in three extensive plant field tests. Badges were more precise than the charcoal tube/pump method in all field tests conducted. PMID:6496316

  16. The connection between supernova remnants and the Galactic magnetic field: A global radio study of the axisymmetric sample

    NASA Astrophysics Data System (ADS)

    West, J. L.; Safi-Harb, S.; Jaffe, T.; Kothes, R.; Landecker, T. L.; Foster, T.

    2016-03-01

    The study of supernova remnants (SNRs) is fundamental to understanding the chemical enrichment and magnetism in galaxies, including our own Milky Way. In an effort to understand the connection between the morphology of SNRs and the Galactic magnetic field (GMF), we have examined the radio images of all known SNRs in our Galaxy and compiled a large sample that have an axisymmetric morphology, which we define to mean SNRs with a bilateral or barrel-shaped morphology, in addition to one-sided shells. We selected the cleanest examples and model each of these at their appropriate Galactic position using two GMF models, one of which includes a vertical halo component, and another that is oriented entirely parallel to the plane. Since the magnitude and relative orientation of the magnetic field changes with distance from the sun, we analyze a range of distances, from 0.5 to 10 kpc in each case. Using a physically motivated model of an SNR expanding into an ambient GMF that includes a vertical halo component, we find it is able to reproduce observed morphologies of many SNRs in our sample. These results strongly support the presence of an off-plane, vertical component to the GMF, and the importance of the Galactic field on SNR morphology. Our approach also provides a potentially new method for determining distances to SNRs, or conversely, distances to features in the large-scale GMF if SNR distances are known.

  17. Effect of Nitrate Injection on the Microbial Community in an Oil Field as Monitored by Reverse Sample Genome Probing

    PubMed Central

    Telang, A. J.; Ebert, S.; Foght, J. M.; Westlake, D.; Jenneman, G. E.; Gevertz, D.; Voordouw, G.

    1997-01-01

    The reverse sample genome probe (RSGP) method, developed for monitoring the microbial community in oil fields with a moderate subsurface temperature, has been improved by (i) isolation of a variety of heterotrophic bacteria and inclusion of their genomes on the oil field master filter and (ii) use of phosphorimaging technology for the rapid quantitation of hybridization signals. The new master filter contains the genomes of 30 sulfate-reducing, 1 sulfide-oxidizing, and 16 heterotrophic bacteria. Most have been identified by partial 16S rRNA sequencing. Use of improved RSGP in monitoring the effect of nitrate injection in an oil field indicated that the sulfide-oxidizing, nitrate-reducing isolate CVO (a Campylobacter sp.) becomes the dominant community component immediately after injection. No significant enhancement of other community members, including the sulfate-reducing bacteria, was observed. The elevated level of CVO decayed at most sampling sites within 30 days after nitrate injection was terminated. Chemical analyses indicated a corresponding decrease and subsequent increase in sulfide concentrations. Thus, transient injection of a higher potential electron acceptor into an anaerobic subsurface system can have desirable effects (i.e., reduction of sulfide levels) without a permanent adverse influence on the resident microbial community. PMID:16535595

  18. Boehmite Actual Waste Dissolutions Studies

    SciTech Connect

    Snow, Lanee A.; Lumetta, Gregg J.; Fiskum, Sandra K.; Peterson, Reid A.

    2008-07-15

    The U.S. Department of Energy plans to vitrify approximately 60,000 metric tons of high-level waste (HLW) sludge from underground storage tanks at the Hanford Nuclear Reservation. To reduce the volume of HLW requiring treatment, a goal has been set to remove a significant quantity of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum is found in the form of gibbsite, sodium aluminate and boehmite. Gibbsite and sodium aluminate can be easily dissolved by washing the waste stream with caustic. Boehmite, which comprises nearly half of the total aluminum, is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. Samples were taken from four Hanford tanks and homogenized in order to give a sample that is representative of REDOX (Reduction Oxidation process for Pu recovery) sludge solids. Bench scale testing was performed on the homogenized waste to study the dissolution of boehmite. Dissolution was studied at three different hydroxide concentrations, with each concentration being run at three different temperatures. Samples were taken periodically over the 170 hour runs in order to determine leaching kinetics. Results of the dissolution studies and implications for the proposed processing of these wastes will be discussed.

  19. Actualities and Perspectives in Neurosurgery

    PubMed Central

    Iencean, SM; Brehar, FM

    2008-01-01

    In the field of neurosurgery, like in other surgical specialties, the last decades have brought major achievements. The series of revolutionary discoveries has started during the last century in the fifties, with stereotactic radiosurgery, then continued with the implementation of operative microscope (during the seventies), the endovascular embolisation in the nineties and finally with the major improvement in robotic neurosurgery and molecular neurosurgery at the beginning of this century. The major innovation has been brought not only in the field of therapeutical measures but also in the field of neuro– imaging. Thus, the modern MRI with more than 3 Tesla, can reveal to the neurosurgeon the most intimate structures of the nervous system. Several important areas in neurosurgery like: vascular neurosurgery, functional neurosurgery and brain tumors pathology, benefit from the modern technology and from the latest discoveries from genetic and molecular biology. In conclusion, summarizing the discoveries of the last decade, we emphasize that the related areas like genetics, molecular biology, computer technology become more and more important in the future progress of the neurosurgery. PMID:20108475

  20. Quantifying Marine Emissions of Biogenic Volatile Organic Compounds Using Laboratory Measurements of Plankton Monocultures and Field Samples

    NASA Astrophysics Data System (ADS)

    Sabolis, A. W.; Meskhidze, N.; Kamykowski, D.; Reed, R. E.

    2010-12-01

    Marine biogenic volatile organic compounds (BVOCs) have been suggested to contribute significant portion of the organic carbon present in ocean atmosphere. In this study emission rates of 40 different hydrocarbons are quantified for lab-grown non-axenic phytoplankton monocultures and ambient samples from the Pamlico-Neuse Estuary, NC. The outcome of environmental conditions on production of BVOCs was examined for different light and temperature conditions. These different regimes are considered proxies for physiological stress-induced effects observed in natural ecosystems. The samples were incubated in a climate controlled room; they were then transferred to smaller volumes (200 ml) for analysis. BVOCs accumulated in the water and headspace above the water were measured by bubbling hydrocarbon-free gas mixture through the sample and passing the gas stream through a gas chromatography/mass spectrometry system equipped with a sample pre-concentrator. Inside the pre-concentrator, the compounds were trapped on a sorbent material, heated, and flushed into the GC-MS column. The pre-concentrator/GC-MS system gave at least 1000 times magnification of the sample concentrations, allowing detection of low ppt levels of hydrocarbons. Here we report results for lab-grown diatoms Thalassiosira weissflogii and Thalassiosira pseudonana, prymnesiophyte Pleurochrysis carterae, and dinoflagellates Karina brevis and Procentrum minimum, as well as field samples. To make results widely usable, all the emissions are normalized to Chlorophyll-a (Chl-a) concentration and cell counts. Our results show that diatoms had the highest isoprene production rate of 2.8 μmol (g Chl-a)-1 h-1 with ranges between 1.4 and 3.6 μmol (g Chl-a)-1 h-1 at light levels between 90 and 900 μE m-2 s-1, respectively. The prymnesiophyte and dinoflagellate species had isoprene production rates of 1.3±0.4 μmol (g Chl-a)-1 h-1 with a similar light dependency as diatoms. Field samples had comparable isoprene

  1. Gas and Isotope Geochemistry of 81 Steam Samples from Wells in The Geysers Geothermal Field, Sonoma and Lake Counties, California

    USGS Publications Warehouse

    Lowenstern, Jacob B.; Janik, Cathy J.; Fahlquist, Lynne; Johnson, Linda S.

    1999-01-01

    The Geysers geothermal field in northern California, with about 2000-MW electrical capacity, is the largest geothermal field in the world. Despite its importance as a resource and as an example of a vapor-dominated reservoir, very few complete geochemical analyses of the steam have been published (Allen and Day, 1927; Truesdell and others, 1987). This report presents data from 90 steam, gas, and condensate samples from wells in The Geysers geothermal field in northern California. Samples were collected between 1978 and 1991. Well attributes include sampling date, well name, location, total depth, and the wellhead temperature and pressure at which the sample was collected. Geochemical characteristics include the steam/gas ratio, composition of noncondensable gas (relative proportions of CO2, H2S, He, H2, O2, Ar, N2, CH4, and NH3), and isotopic values for deltaD and delta18O of H2O, delta13C of CO2, and delta34S of H2S. The compilation includes 81 analyses from 74 different production wells, 9 isotopic analyses of steam condensate pumped into injection wells, and 5 complete geochemical analyses on gases from surface fumaroles and bubbling pools. Most samples were collected as saturated steam and plot along the liquid-water/steam boiling curve. Steam-togas ratios are highest in the southeastern part of the geothermal field and lowest in the northwest, consistent with other studies. Wells in the Northwest Geysers are also enriched in N2/Ar, CO2 and CH4, deltaD, and delta18O. Well discharges from the Southeast Geysers are high in steam/gas and have isotopic compositions and N2/Ar ratios consistent with recharge by local meteoric waters. Samples from the Central Geysers show characteristics found in both the Southeast and Northwest Geysers. Gas and steam characteristics of well discharges from the Northwest Geysers are consistent with input of components from a high-temperature reservoir containing carbonrich gases derived from the host Franciscan rocks. Throughout the

  2. Field Air Sampling with SPME for Ranking and Prioritization of Downwind Livestock Odors with MDGC-MS-Olfactometry

    NASA Astrophysics Data System (ADS)

    Koziel, Jacek A.; Cai, Lingshuang; Wright, Donald W.; Hoff, Steven J.

    2009-05-01

    Air sampling and characterization of odorous livestock gases is one of the most challenging analytical tasks. This is due to low concentrations, physicochemical properties, and problems with sample recoveries for typical odorants. Livestock operations emit a very complex mixture of volatile organic compounds and other gases. Many of these gases are odorous. Relatively little is known about the link between specific VOCs/gases and specifically, about the impact of specific odorants downwind from sources. In this research, solid phase microextraction (SPME) was used for field air sampling of odors downwind from swine and beef cattle operations. Sampling time ranged from 20 min to 1 hr. Samples were analyzed using a commercial GC-MS-Olfactometry system. Odor profiling efforts were directed at odorant prioritization with respect to distance from the source. The results indicated the odor downwind was increasingly defined by a smaller number of high priority odorants. These `character defining' odorants appeared to be dominated by compounds of relatively low volatility, high molecular weight and high polarity. In particular, p-cresol alone appeared to carry much of the overall odor impact for swine and beef cattle operations. Of particular interest was the character-defining odor impact of p-cresol as far as 16 km downwind of the nearest beef cattle feedlot. The findings are very relevant to scientists and engineers working on improved air sampling and analysis protocols and on improved technologies for odor abatement. More research evaluating the use of p-cresol and a few other key odorants as a surrogate for the overall odor dispersion modeling is warranted.

  3. Multiscale modeling of polycrystalline graphene: A comparison of structure and defect energies of realistic samples from phase field crystal models

    NASA Astrophysics Data System (ADS)

    Hirvonen, Petri; Ervasti, Mikko M.; Fan, Zheyong; Jalalvand, Morteza; Seymour, Matthew; Vaez Allaei, S. Mehdi; Provatas, Nikolas; Harju, Ari; Elder, Ken R.; Ala-Nissila, Tapio

    2016-07-01

    We extend the phase field crystal (PFC) framework to quantitative modeling of polycrystalline graphene. PFC modeling is a powerful multiscale method for finding the ground state configurations of large realistic samples that can be further used to study their mechanical, thermal, or electronic properties. By fitting to quantum-mechanical density functional theory (DFT) calculations, we show that the PFC approach is able to predict realistic formation energies and defect structures of grain boundaries. We provide an in-depth comparison of the formation energies between PFC, DFT, and molecular dynamics (MD) calculations. The DFT and MD calculations are initialized using atomic configurations extracted from PFC ground states. Finally, we use the PFC approach to explicitly construct large realistic polycrystalline samples and characterize their properties using MD relaxation to demonstrate their quality.

  4. The Mass of the Galaxy from Large Samples of Field Horizontal-Branch Stars in the SDSS Early Data Release

    NASA Astrophysics Data System (ADS)

    Beers, T. C.; Chiba, M.; Sakamoto, T.; Wilhelm, R.; Allende Prieto, C.; Sommer-Larsen, J.; Newberg, H. J.; Yanny, B.; Marsteller, B.; Pier, J. R.

    2004-07-01

    We present a new estimate of the mass of the Milky Way, making use of a large sample of 955 field horizontal-branch (FHB) stars from the Early Data Release of the Sloan Digital Sky Survey. This sample of stars has been classified on the basis of an automated analysis approach, in combination with other methods, in order to obtain estimates of the physical parameters of the stars, i.e., T_eff, log g, [Fe/H], and should be relatively free of contamination from halo blue stragglers. The stars all have measured radial velocities and photometric distance estimates, and the sample includes objects as distant as ˜ 75 kpc from the Galactic center. Application of a Bayesian likelihood method, for a specific model of the Galaxy, indicates that the total mass of the Galaxy lies in the range 1.5-4.0 x 1012 M⊙. Our sample appears to reveal a clear signature of a dual halo population of FHB stars, with the boundary between the inner and outer halo around 20 kpc, and the possibility of rather striking differences in the rotational properties of the Galaxy at low metallicity.

  5. Analysis of hydrogen peroxide field samples by HPLC/FD and HPLC/ED in DC mode.

    PubMed

    Tarvin, Megan; McCord, Bruce; Mount, Kelly; Miller, Mark L

    2011-06-15

    The goal of this paper is to describe applications of two recently developed HPLC methods for the analysis and confirmation of the presence of hydrogen peroxide residues in field studies. The procedure utilizes two different HPLC systems, one with post-column derivatization followed by fluorescence detection (HPLC/FD), and the other with electrochemical detection (HPLC/ED). The two systems were utilized to detect hydrogen peroxide in a variety of typical forensic samples including pre- and post-blast samples, as well as a series of environmental control samples. Peroxide-based organic explosives were also examined due to their propensity to produce peroxide residues following detonation. Because samples collected from post-blast scenes are frequently shipped or stored prior to analysis, the effects of storage time, temperature and type of substrate material on the recovery of hydrogen peroxide residues were also investigated. The combined results of the study demonstrate the capability of two HPLC approaches with selective detection in the analysis and investigation of suspected incidents involving peroxide based explosives. PMID:21324615

  6. Electric field-enhanced transport across phase boundaries and membranes and its potential use in sample pretreatment for bioanalysis.

    PubMed

    Kubán, Pavel; Slampová, Andrea; Bocek, Petr

    2010-03-01

    Separation techniques, such as electrodialysis, electroextraction, electro-membrane extraction and extraction across phase interfaces, are reviewed and discussed as methods for sample cleanup and preconcentration. This survey clearly shows that electromigration of ionic species across phase interfaces, especially across supported liquid membranes, may be very selective and is strongly dependent on the chemical composition of these interfaces. Thus, electric field-enhanced transport across chemically tailored liquid membranes may open new perspectives in preparative analytical chemistry. This review offers comprehensive survey of related literature and discussion of the topic, which may stimulate interest of experts and practitioners in bioanalysis. PMID:20191542

  7. CIP10 optimization for 4,4-methylene diphenyl diisocyanate aerosol sampling and field comparison with impinger method.

    PubMed

    Puscasu, Silvia; Aubin, Simon; Cloutier, Yves; Sarazin, Philippe; Tra, Huu V; Gagné, Sébastien

    2015-04-01

    4,4-methylene diphenyl diisocyanate (MDI) aerosol exposure evaluation in spray foam insulation application is known as being a challenge because the spray foam application actually involves a fast-curing process. Available techniques are either not user-friendly or are inaccurate or not validated for this application. To address these issues, a new approach using a CIP10M was developed to appropriately collect MDI aerosol in spray foam insulation while being suitable for personal sampling. The CIP10M is a commercially available personal aerosol sampler that has been validated for the collection of microbial spores into a liquid medium. Tributylphosphate with 1-(2-methoxyphenyl)piperazine (MOPIP) was introduced into the CIP10M to collect and stabilize the MDI aerosols. The limit of detection and limit of quantification of the method were 0.007 and 0.024 μg ml(-1), respectively. The dynamic range was from 0.024 to 0.787 μg ml(-1) (with R (2) ≥ 0.990), which corresponds to concentrations in the air from 0.04 to 1.3 µg m(-3), assuming 60 min of sampling at 10 l min(-1). The intraday and interday analytical precisions were <2% for all of the concentration levels tested, and the accuracy was within an appropriate range of 98 ± 1%. No matrix effect was observed, and a total recovery of 99% was obtained. Parallel sampling was performed in a real MDI foam spraying environment with a CIP10M and impingers containing toluene/MOPIP (reference method). The results obtained show that the CIP10M provides levels of MDI monomer in the same range as the impingers, and higher levels of MDI oligomers. The negative bias observed for MDI monomer was between 2 and 26%, whereas the positive bias observed for MDI oligomers was between 76 and 113%, with both biases calculated with a confidence level of 95%. The CIP10M seems to be a promising approach for MDI aerosol exposure evaluation in spray foam applications. PMID:25452291

  8. Implications of the field sampling procedure of the LUCAS Topsoil Survey for uncertainty in soil organic carbon concentrations.

    NASA Astrophysics Data System (ADS)

    Lark, R. M.; Rawlins, B. G.; Lark, T. A.

    2014-05-01

    The LUCAS Topsoil survey is a pan-European Union initiative in which soil data were collected according to standard protocols from 19 967 sites. Any inference about soil variables is subject to uncertainty due to different sources of variability in the data. In this study we examine the likely magnitude of uncertainty due to the field-sampling protocol. The published sampling protocol (LUCAS, 2009) describes a procedure to form a composite soil sample from aliquots collected to a depth of between approximately 15-20. A v-shaped hole to the target depth is cut with a spade, then a slice is cut from one of the exposed surfaces. This methodology gives rather less control of the sampling depth than protocols used in other soil and geochemical surveys, this may be a substantial source of variation in uncultivated soils with strong contrasts between an organic-rich A-horizon and an underlying B-horizon. We extracted all representative profile descriptions from soil series recorded in the memoir of the 1:250 000-scale map of Northern England (Soil Survey of England and Wales, 1984) where the base of the A-horizon is less than 20 cm below the surface. The Soil Associations in which these 14 series are significant members cover approximately 17% of the area of Northern England, and are expected to be the mineral soils with the largest organic content. Soil Organic Carbon content and bulk density were extracted for the A- and B-horizons, along with the thickness of the horizons. Recorded bulk density, or prediction by a pedotransfer function, were also recorded. For any proposed angle of the v-shaped hole, the proportions of A- and B-horizon in the resulting sample may be computed by trigonometry. From the bulk density and SOC concentration of the horizons, the SOC concentration of the sample can be computed. For each Soil Series we drew 1000 random samples from a trapezoidal distribution of angles, with uniform density over the range corresponding to depths 15-20 cm and

  9. Sampling in the Snow: High School Winter Field Experiences Provide Relevant, Real World Connections Between Scientific Practices and Disciplinary Core Ideas

    NASA Astrophysics Data System (ADS)

    Hanson, E. W.; Burakowski, E. A.

    2014-12-01

    For much of the northern United States, the months surrounding the winter solstice are times of increased darkness, low temperatures, and frozen landscapes. It's a time when many high school science educators, who otherwise would venture outside with their classes, hunker down and are wary of the outdoors. However, a plethora of learning opportunities lies just beyond the classroom. Working collaboratively, a high school science teacher and a snow scientist have developed multiple activities to engage students in the scientific process of collecting, analyzing and interpreting the winter world using snow data to (1) learn about the insulative properties of snow, and (2) to learn about the role of snow cover on winter climate through its reflective properties while participating in a volunteer network that collects snow depth, albedo (reflectivity), and density data. These outdoor field-based snow investigations incorporate Next Generation Science Standards (NGSS) and disciplinary core ideas, including ESS2.C: The roles of water in Earth's surface processes and ESS2.D: Weather and Climate. Additionally, the lesson plans presented address Common Core State Standards (CCSS) in Mathematics, including the creation and analysis of bar graphs and time series plots (CCSS.Math.HSS-ID.A.1) and xy scatter plots (CCSS.Math.HSS-ID.B.6). High school students participating in the 2013/2014 snow sampling season described their outdoor learning experience as "authentic" and "hands-on" as compared to traditional class indoors. They emphasized that learning outdoors was essential to their understanding of underlying content and concepts because they "learn through actual experience."

  10. Evaluating the roles of biotransformation, spatial concentration differences, organism home range, and field sampling design on trophic magnification factors.

    PubMed

    Kim, Jaeshin; Gobas, Frank A P C; Arnot, Jon A; Powell, David E; Seston, Rita M; Woodburn, Kent B

    2016-05-01

    Trophic magnification factors (TMFs) are field-based measurements of the bioaccumulation behavior of chemicals in food-webs. TMFs can provide valuable insights into the bioaccumulation behavior of chemicals. However, bioaccumulation metrics such as TMF may be subject to considerable uncertainty as a consequence of systematic bias and the influence of confounding variables. This study seeks to investigate the role of systematic bias resulting from spatially-variable concentrations in water and sediments and biotransformation rates on the determination of TMF. For this purpose, a multibox food-web bioaccumulation model was developed to account for spatial concentration differences and movement of organisms on chemical concentrations in aquatic biota and TMFs. Model calculated and reported field TMFs showed good agreement for persistent polychlorinated biphenyl (PCB) congeners and biotransformable phthalate esters (PEs) in a marine aquatic food-web. Model testing showed no systematic bias and good precision in the estimation of the TMF for PCB congeners but an apparent underestimation of model calculated TMFs, relative to reported field TMFs, for PEs. A model sensitivity analysis showed that sampling designs that ignore the presence of concentration gradients may cause systematically biased and misleading TMF values. The model demonstrates that field TMFs are most sensitive to concentration gradients and species migration patterns for substances that are subject to a low degree of biomagnification or trophic dilution. The model is useful in anticipating the effect of spatial concentration gradients on the determination of the TMF; guiding species collection strategies in TMF studies; and interpretation of the results of field bioaccumulation studies in study locations where spatial differences in chemical concentration exist. PMID:26891010

  11. NHEXAS PHASE I REGION 5 STUDY--STANDARD OPERATING PROCEDURE--SAMPLE CODING, LABELING, AND FIELD TRACKING PROCEDURES (RTI/ACS-AP-209-070)

    EPA Science Inventory

    This protocol defines the coding scheme, labeling procedures, and field tracking for samples collected in the NHEXAS Region 5 study. Unique sample codes were assigned to all personal, environmental, biological, and quality control samples. A label bearing the code in both bar cod...

  12. A FLUX-LIMITED SAMPLE OF z {approx} 1 Ly{alpha} EMITTING GALAXIES IN THE CHANDRA DEEP FIELD SOUTH ,

    SciTech Connect

    Barger, A. J.; Wold, I. G. B.; Cowie, L. L.

    2012-04-20

    We describe a method for obtaining a flux-limited sample of Ly{alpha} emitters from Galaxy Evolution Explorer (GALEX) grism data. We show that the multiple GALEX grism images can be converted into a three-dimensional (two spatial axes and one wavelength axis) data cube. The wavelength slices may then be treated as narrowband images and searched for emission-line galaxies. For the GALEX NUV grism data, the method provides a Ly{alpha} flux-limited sample over the redshift range z = 0.67-1.16. We test the method on the Chandra Deep Field South field, where we find 28 Ly{alpha} emitters with faint continuum magnitudes (NUV > 22) that are not present in the GALEX pipeline sample. We measure the completeness by adding artificial emitters and measuring the fraction recovered. We find that we have an 80% completeness above a Ly{alpha} flux of 10{sup -15} erg cm{sup -2} s{sup -1}. We use the UV spectra and the available X-ray data and optical spectra to estimate the fraction of active galactic nuclei in the selection. We report the first detection of a giant Ly{alpha} blob at z < 1, though we find that these objects are much less common at z = 1 than at z = 3. Finally, we compute limits on the z {approx} 1 Ly{alpha} luminosity function and confirm that there is a dramatic evolution in the luminosity function over the redshift range z = 0-1.

  13. Sediment and radionuclide transport in rivers. Phase 2. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-04-01

    As part of a study on sediment and radionuclide transport in rivers, Pacific Northwest Laboratory (PNL) is investigating the effect of sediment on the transport of radionuclides in Cattaraugus and Buttermilk Creeks, New York. A source of radioactivity in these creeks is the Western New York Nuclear Service Center which consists of a low-level waste disposal site and a nuclear fuel reprocessing plant. Other sources of radioactivity include fallout from worldwide weapons testing and natural background radioactivity. The major objective of the PNL Field Sampling Program is to provide data on sediment and radionuclide characteristics in Cattaraugus and Buttermilk Creeks to verify the use of the Sediment and Radionuclide Transport model, SERATRA, for nontidal rivers. This report covers the results of field data collection conducted during September 1978. Radiological analysis of sand, silt, and clay size fractions of suspended and bed sediment, and water were performed. Results of these analyses indicate that the principal radionuclides occurring in these two water courses, with levels significantly higher than background levels, during the Phase 2 sampling program were Cesium-137 and Strontium-90. These radionuclides had significantly higher activity levels above background in the bed sediment, suspended sediment, and water samples. Other radionuclides that are possibly being released into the surface water environment by the Nuclear Fuel Services facilities are Plutonium-238, 239, and 240, Americium-241, Curium-244, and Tritium. More radionuclides were consistently found in the bed sediment as compared to suspended sediment. The fewest radionuclides were found in the water of Buttermilk and Cattaraugus Creeks. The higher levels were found in the bed sediments for the gamma-emitters and in the suspended sediment for the alpha and beta-emitters (not including Tritium).

  14. Detection of cocaine in cargo containers by high-volume vapor sampling: field test at Port of Miami

    NASA Astrophysics Data System (ADS)

    Neudorfl, Pavel; Hupe, Michael; Pilon, Pierre; Lawrence, Andre H.; Drolet, Gerry; Su, Chih-Wu; Rigdon, Stephen W.; Kunz, Terry D.; Ulwick, Syd; Hoglund, David E.; Wingo, Jeff J.; Demirgian, Jack C.; Shier, Patrick

    1997-02-01

    The use of marine containers is a well known smuggling method for large shipments of drugs. Such containers present an ideal method of smuggling as the examination method is time consuming, difficult and expensive for the importing community. At present, various methods are being studied for screening containers which would allow to rapidly distinguish between innocent and suspicious cargo. Air sampling is one such method. Air is withdrawn for the inside of containers and analyzed for telltale vapors uniquely associated with the drug. The attractive feature of the technique is that the containers could be sampled without destuffing and opening, since air could be conveniently withdrawn via ventilation ducts. In the present paper, the development of air sampling methodology for the detection of cocaine hydrochloride will be discussed, and the results from a recent field test will be presented. The results indicated that vapors of cocaine and its decomposition product, ecgonidine methyl ester, could serve as sensitive indicators of the presence of the drug in the containers.

  15. Preliminary Evaluation of the Field and Laboratory Emission Cell (FLEC) for Sampling Attribution Signatures from Building Materials

    SciTech Connect

    Harvey, Scott D.; He, Lijian; Wahl, Jon H.

    2012-08-30

    This study provides a preliminary evaluation of the Field and Laboratory Emission Cell (FLEC) for its suitability for sampling building materials for toxic compounds and their associated impurities and residues that might remain after a terrorist chemical attack. Chemical warfare (CW) agents and toxic industrial chemicals were represented by a range of test probes that included CW surrogates. The test probes encompassed the acid-base properties, volatilities, and polarities of the expected chemical agents and residual compounds. Results indicated that dissipation of the test probes depended heavily on the underlying material. Near complete dissipation of almost all test probes occurred from galvanized stainless steel within 3.0 hrs, whereas far stronger retention with concomitant slower release was observed for vinyl composition floor tiles. The test probes displayed immediated permanence on Teflon. FLEC sampling was further evaluated by profiling residues remaining after the evaporation of 2-chloroethyl ethyl sulfide, a sulfur mustard simulant. This study lays the groundwork for the eventual goal of applying this sampling approach for collection of forensic attribution signatures that remain after a terrorist chemical attack.

  16. Reduction of magnetic field fluctuations in powered magnets for NMR using inductive measurements and sampled-data feedback control.

    PubMed

    Li, Mingzhou; Schiano, Jeffrey L; Samra, Jenna E; Shetty, Kiran K; Brey, William W

    2011-10-01

    Resistive and hybrid (resistive/superconducting) magnets provide substantially higher magnetic fields than those available in low-temperature superconducting magnets, but their relatively low spatial homogeneity and temporal field fluctuations are unacceptable for high resolution NMR. While several techniques for reducing temporal fluctuations have demonstrated varying degrees of success, this paper restricts attention to methods that utilize inductive measurements and feedback control to actively cancel the temporal fluctuations. In comparison to earlier studies using analog proportional control, this paper shows that shaping the controller frequency response results in significantly higher reductions in temporal fluctuations. Measurements of temporal fluctuation spectra and the frequency response of the instrumentation that cancels the temporal fluctuations guide the controller design. In particular, we describe a sampled-data phase-lead-lag controller that utilizes the internal model principle to selectively attenuate magnetic field fluctuations caused by the power supply ripple. We present a quantitative comparison of the attenuation in temporal fluctuations afforded by the new design and a proportional control design. Metrics for comparison include measurements of the temporal fluctuations using Faraday induction and observations of the effect that the fluctuations have on nuclear resonance measurements. PMID:21885308

  17. Actual Leisure Participation of Norwegian Adolescents with Down Syndrome

    ERIC Educational Resources Information Center

    Dolva, Anne-Stine; Kleiven, Jo; Kollstad, Marit

    2014-01-01

    This article reports the actual participation in leisure activities by a sample of Norwegian adolescents with Down syndrome aged 14. Representing a first generation to grow up in a relatively inclusive context, they live with their families, attend mainstream schools, and are part of common community life. Leisure information was obtained in…

  18. Physical properties of two core samples from Well 34-9RD2 at the Coso geothermal field, California

    USGS Publications Warehouse

    Morrow, C.A.; Lockner, D.A.

    2006-01-01

    The Coso geothermal field, located along the Eastern California Shear Zone, is composed of fractured granitic rocks above a shallow heat source. Temperatures exceed 640 ?F (~338 ?C) at a depth of less than 10000 feet (3 km). Permeability varies throughout the geothermal field due to the competing processes of alteration and mineral precipitation, acting to reduce the interconnectivity of faults and fractures, and the generation of new fractures through faulting and brecciation. Currently, several hot regions display very low permeability, not conducive to the efficient extraction of heat. Because high rates of seismicity in the field indicate that the area is highly stressed, enhanced permeability can be stimulated by increasing the fluid pressure at depth to induce faulting along the existing network of fractures. Such an Enhanced Geothermal System (EGS), planned for well 46A-19RD, would greatly facilitate the extraction of geothermal fluids from depth by increasing the extent and depth of the fracture network. In order to prepare for and interpret data from such a stimulation experiment, the physical properties and failure behavior of the target rocks must be fully understood. Various diorites and granodiorites are the predominant rock types in the target area of the well, which will be pressurized from 10000 feet measured depth (MD) (3048m MD) to the bottom of the well at 13,000 feet MD (3962 m MD). Because there are no core rocks currently available from well 46A-19RD, we report here on the results of compressive strength, frictional sliding behavior, and elastic measurements of a granodiorite and diorite from another well, 34-9RD2, at the Coso site. Rocks cored from well 34-9RD2 are the deepest samples to date available for testing, and are representative of rocks from the field in general.

  19. A Sample of Very Young Field L Dwarfs and Implications for the Brown Dwarf "Lithium Test" at Early Ages

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, J. Davy; Cruz, Kelle L.; Barman, Travis S.; Burgasser, Adam J.; Looper, Dagny L.; Tinney, C. G.; Gelino, Christopher R.; Lowrance, Patrick J.; Liebert, James; Carpenter, John M.; Hillenbrand, Lynne A.; Stauffer, John R.

    2008-12-01

    Using a large sample of optical spectra of late-type dwarfs, we identify a subset of late-M through L field dwarfs that, because of the presence of low-gravity features in their spectra, are believed to be unusually young. From a combined sample of 303 field L dwarfs, we find observationally that 7.6% +/- 1.6% are younger than 100 Myr. This percentage is in agreement with theoretical predictions once observing biases are taken into account. We find that these young L dwarfs tend to fall in the southern hemisphere (decl . < 0°) and may be previously unrecognized, low-mass members of nearby, young associations like Tucana-Horologium, TW Hydrae, β Pictoris, and AB Doradus. We use a homogeneously observed sample of ~150 optical spectra to examine lithium strength as a function of L/T spectral type and further corroborate the trends noted by Kirkpatrick and coworkers. We use our low-gravity spectra to investigate lithium strength as a function of age. The data weakly suggest that for early- to mid-L dwarfs the line strength reaches a maximum for a few × 100 Myr, whereas for much older (few Gyr) and much younger (<100 Myr) L dwarfs the line is weaker or undetectable. We show that a weakening of lithium at lower gravities is predicted by model atmosphere calculations, an effect partially corroborated by existing observational data. Larger samples containing L dwarfs of well-determined ages are needed to further test this empirically. If verified, this result would reinforce the caveat first cited by Kirkpatrick and coworkers that the lithium test should be used with caution when attempting to confirm the substellar nature of the youngest brown dwarfs. Most of the spectroscopic data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous

  20. Persistent Organic Pollutant Determination in Killer Whale Scat Samples: Optimization of a Gas Chromatography/Mass Spectrometry Method and Application to Field Samples.

    PubMed

    Lundin, Jessica I; Dills, Russell L; Ylitalo, Gina M; Hanson, M Bradley; Emmons, Candice K; Schorr, Gregory S; Ahmad, Jacqui; Hempelmann, Jennifer A; Parsons, Kim M; Wasser, Samuel K

    2016-01-01

    Biologic sample collection in wild cetacean populations is challenging. Most information on toxicant levels is obtained from blubber biopsy samples; however, sample collection is invasive and strictly regulated under permit, thus limiting sample numbers. Methods are needed to monitor toxicant levels that increase temporal and repeat sampling of individuals for population health and recovery models. The objective of this study was to optimize measuring trace levels (parts per billion) of persistent organic pollutants (POPs), namely polychlorinated-biphenyls (PCBs), polybrominated-diphenyl-ethers (PBDEs), dichlorodiphenyltrichloroethanes (DDTs), and hexachlorocyclobenzene, in killer whale scat (fecal) samples. Archival scat samples, initially collected, lyophilized, and extracted with 70 % ethanol for hormone analyses, were used to analyze POP concentrations. The residual pellet was extracted and analyzed using gas chromatography coupled with mass spectrometry. Method detection limits ranged from 11 to 125 ng/g dry weight. The described method is suitable for p,p'-DDE, PCBs-138, 153, 180, and 187, and PBDEs-47 and 100; other POPs were below the limit of detection. We applied this method to 126 scat samples collected from Southern Resident killer whales. Scat samples from 22 adult whales also had known POP concentrations in blubber and demonstrated significant correlations (p < 0.01) between matrices across target analytes. Overall, the scat toxicant measures matched previously reported patterns from blubber samples of decreased levels in reproductive-age females and a decreased p,p'-DDE/∑PCB ratio in J-pod. Measuring toxicants in scat samples provides an unprecedented opportunity to noninvasively evaluate contaminant levels in wild cetacean populations; these data have the prospect to provide meaningful information for vital management decisions. PMID:26298464

  1. Advantages of a Synchrotron Bending Magnet as the Sample Illuminator for a Wide-field X-ray Microscope

    SciTech Connect

    Feser, M.; Howells, M. R.; Kirz, J.; Rudati, J.; Yun, W.

    2012-09-01

    In our paper the choice between bending magnets and insertion devices as sample illuminators for a hard X-ray full-field microscope is investigated. An optimized bending-magnet beamline design is presented. Its imaging speed is very competitive with the performance of similar microscopes installed currently at insertion-device beamlines. The fact that imaging X-ray microscopes can accept a large phase space makes them very well suited to the output characteristics of bending magnets which are often a plentiful and paid-for resource. There exist opportunities at all synchrotron light sources to take advantage of this finding to build bending-magnet beamlines that are dedicated to transmission X-ray microscope facilities. We expect that demand for such facilities will increase as three-dimensional tomography becomes routine and advanced techniques such as mosaic tomography and XANES tomography (taking three-dimensional tomograms at different energies to highlight elemental and chemical differences) become more widespread.

  2. Precise Strong Lensing Mass Modeling of Four Hubble Frontier Field Clusters and a Sample of Magnified High-redshift Galaxies

    NASA Astrophysics Data System (ADS)

    Kawamata, Ryota; Oguri, Masamune; Ishigaki, Masafumi; Shimasaku, Kazuhiro; Ouchi, Masami

    2016-03-01

    We conduct precise strong lensing mass modeling of four Hubble Frontier Field (HFF) clusters, Abell 2744, MACS J0416.1-2403, MACS J0717.5+3745, and MACS J1149.6+2223, for which HFF imaging observations are completed. We construct a refined sample of more than 100 multiple images for each cluster by taking advantage of the full-depth HFF images, and conduct mass modeling using the glafic software, which assumes simply parametrized mass distributions. Our mass modeling also exploits a magnification constraint from the lensed SN Ia HFF14Tom for Abell 2744 and positional constraints from the multiple images S1-S4 of the lensed supernova SN Refsdal for MACS J1149.6+2223. We find that our best-fitting mass models reproduce the observed image positions with rms errors of ˜0.″4, which are smaller than rms errors in previous mass modeling that adopted similar numbers of multiple images. Our model predicts a new image of SN Refsdal with a relative time delay and magnification that are fully consistent with a recent detection of reappearance. We then construct catalogs of z ˜ 6-9 dropout galaxies behind the four clusters and estimate magnification factors for these dropout galaxies with our best-fitting mass models. The dropout sample from the four cluster fields contains ˜120 galaxies at z ≳ 6, about 20 of which are predicted to be magnified by a factor of more than 10. Some of the high-redshift galaxies detected in the HFF have lensing-corrected magnitudes of MUV ˜ -15 to -14. Our analysis demonstrates that the HFF data indeed offer an ideal opportunity to study faint high-redshift galaxies. All lensing maps produced from our mass modeling will be made available on the Space Telescope Science Institute website (https://archive.stsci.edu/prepds/frontier/lensmodels/).

  3. Application of a multiplex PCR for the detection of protozoan pathogens of the eastern oyster Crassostrea virginica in field samples.

    PubMed

    Russell, Spencer; Frasca, Salvatore; Sunila, Inke; French, Richard A

    2004-04-21

    Populations of eastern oysters Crassostrea virginica along the east coast of North America have repeatedly experienced epizootic mass mortality due to infections by protozoan parasites, and molecular diagnostic methodologies are fast becoming more widely available for the diagnosis of protozoan diseases of oysters. In this study we applied a modified version of an existing multiplex polymerase chain reaction (PCR) for detection of the eastern oyster parasites Haplosporidium nelsoni, H. costale and Perkinsus marinus from field-collected samples. We incorporated primers for DNA quality control based on the large subunit ribosomal RNA (LSU rRNA) gene of C. virginica. The multiplex PCR (MPCR) simultaneously amplified genomic DNA of C. virginica, and cloned DNA of H. nelsoni, P. marinus and H. costale. In field trial applications, we compared the performance of the MPCR to that of the conventional diagnostic techniques of histopathological tissue examination and the Ray/Mackin fluid thioglycollate medium (RMFT) assay. A total of 530 oysters were sampled from 18 sites at 12 locations along the east coast of the United States from the Gulf of Mexico to southern New England. The modified MPCR detected 21% oysters with H. nelsoni, 2% oysters with H. costale, and 40% oysters with P. marinus infections. In comparison, histopathological examination detected H. nelsoni and H. costale infections in 6 and 0.8% oysters, respectively, and the RMFT assay detected P. marinus infection in 31% oysters. The MPCR is a more sensitive diagnostic assay for detection of H. nelsoni, H. costale, and P. marinus, and incorporation of an oyster quality control product limits false negative results. PMID:15212297

  4. Simultaneous Separation of Eight Benzodiazepines in Human Urine Using Field-Amplified Sample Stacking Micellar Electrokinetic Chromatography.

    PubMed

    Oledzka, Ilona; Kulińska, Zofia; Prahl, Adam; Baczek, Tomasz

    2015-01-01

    A novel approach for the simultaneous quantification of eight benzodiazepines (BZDs) using dispersive liquid-liquid microextraction (DLLME) and field-amplified sample stacking (FASS) combined with micellar electrokinetic chromatography (MEKC) was investigated and evaluated in the context of precision, accuracy, sensitivity, linearity, detection and limits of quantification (LOQ). The absolute recovery rates of BZDs were above 90.65%. The limits of detection (LOD) were 20 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 30 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam, while the LOQ was set at 50 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 100 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam. Linearity was confirmed in the range of 50-2,000 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 100-2,000 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam, with a correlation coefficient greater than 0.9987 for all analytes. The elaborated procedure meets all the requirements of analytical methods. During the extraction procedure, a mixture of 1 mL of ethanol and 500 µL of dichloromethane, used as the disperser and extraction solvent, respectively, was rapidly injected into 3 mL of a urine sample. A significant improvement in sensitivity was achieved when DLLME was used to extract BZDs from the urine sample and FASS as an on-line preconcentration technique was developed. For the best separation of analytes, the running buffer was composed of 30 mM SDS, 10 mM sodium tetraborate and 15% methanol (pH 8.8), whereas a sample buffer was composed of 10 mM SDS and 2 mM sodium tetraborate. Moreover, a fused-silica capillary [inner diameter (i.d.) of 75 µm and length of 50 cm], photodiode array detection, pneumatic injection for 15 s and a voltage of 23 kV were applied. The applicability of the method has been confirmed for the analysis of BZD in urine samples collected from patients who

  5. H I CONTENT AND OPTICAL PROPERTIES OF FIELD GALAXIES FROM THE ALFALFA SURVEY. I. SELECTION OF A CONTROL SAMPLE

    SciTech Connect

    Toribio, M. Carmen; Solanes, Jose M.; Giovanelli, Riccardo; Haynes, Martha P.; Masters, Karen L. E-mail: jm.solanes@ub.edu E-mail: haynes@astro.cornell.edu

    2011-05-10

    We report results from a study of the H I content and stellar properties of nearby galaxies detected by the Arecibo Legacy Fast ALFA blind 21 cm line survey and the Sloan Digital Sky Survey. We consider two declination strips covering a total area of 9 hr x 16 deg in the general direction of the Virgo Cluster. The present analysis focuses on gas-rich galaxies expected to show little or no evidence of interaction with their surroundings. We seek to assemble a control sample suitable for providing absolute measures of the H I content of gaseous objects, as well as to study the relationship between H I emission and widely used optical measures of morphology. From a database which includes more than 15,000 H I detections, we have assembled three samples that could provide adequate H I standards. The most reliable results are obtained with a sample of 5647 sources found in low-density environments, as defined by a nearest neighbor approach. The other two samples contain several hundred relatively isolated galaxies each, as determined from standard isolation algorithms based either on a combination of spectroscopic and photometric information or solely on photometric data. We find that isolated objects are not particularly gas-rich compared to their low-density-environment counterparts, while they suffer from selection bias and span a smaller dynamic range. All this makes them less suitable for defining a reference for H I content. We have explored the optical morphology of gaseous galaxies in quiet environments, finding that, within the volume surveyed, the vast majority of them display unequivocal late-type galaxy features. In contrast, bona fide gas-rich early-type systems account only for a negligible fraction of the 21 cm detections. We argue that H I emission provides the most reliable way to determine the morphological population to which a galaxy belongs. We have also observed that the color distribution of flux-limited samples of optically selected field H I

  6. The effects of composition, temperature and sample size on the sintering of chem-prep high field varistors.

    SciTech Connect

    Garino, Terry J.

    2007-09-01

    The sintering behavior of Sandia chem-prep high field varistor materials was studied using techniques including in situ shrinkage measurements, optical and scanning electron microscopy and x-ray diffraction. A thorough literature review of phase behavior, sintering and microstructure in Bi{sub 2}O{sub 3}-ZnO varistor systems is included. The effects of Bi{sub 2}O{sub 3} content (from 0.25 to 0.56 mol%) and of sodium doping level (0 to 600 ppm) on the isothermal densification kinetics was determined between 650 and 825 C. At {ge} 750 C samples with {ge}0.41 mol% Bi{sub 2}O{sub 3} have very similar densification kinetics, whereas samples with {le}0.33 mol% begin to densify only after a period of hours at low temperatures. The effect of the sodium content was greatest at {approx}700 C for standard 0.56 mol% Bi{sub 2}O{sub 3} and was greater in samples with 0.30 mol% Bi{sub 2}O{sub 3} than for those with 0.56 mol%. Sintering experiments on samples of differing size and shape found that densification decreases and mass loss increases with increasing surface area to volume ratio. However, these two effects have different causes: the enhancement in densification as samples increase in size appears to be caused by a low oxygen internal atmosphere that develops whereas the mass loss is due to the evaporation of bismuth oxide. In situ XRD experiments showed that the bismuth is initially present as an oxycarbonate that transforms to metastable {beta}-Bi{sub 2}O{sub 3} by 400 C. At {approx}650 C, coincident with the onset of densification, the cubic binary phase, Bi{sub 38}ZnO{sub 58} forms and remains stable to >800 C, indicating that a eutectic liquid does not form during normal varistor sintering ({approx}730 C). Finally, the formation and morphology of bismuth oxide phase regions that form on the varistors surfaces during slow cooling were studied.

  7. Versatile pulsed laser setup for depth profiling analysis of multilayered samples in the field of cultural heritage

    NASA Astrophysics Data System (ADS)

    Mendes, N. F. C.; Osticioli, I.; Striova, J.; Sansonetti, A.; Becucci, M.; Castellucci, E.

    2009-04-01

    The present study considers the use of a nanosecond pulsed laser setup capable of performing laser induced breakdown spectroscopy (LIBS) and pulsed Raman spectroscopy for the study of multilayered objects in the field of cultural heritage. Controlled etching using the 4th harmonic 266 nm emission of a Nd:YAG laser source with a 8 ns pulse duration was performed on organic films and mineral strata meant to simulate different sequence of layers usually found in art objects such as in easel and mural paintings. The process of micro ablation coupled with powerful spectroscopic techniques operating with the same laser source, constitutes an interesting alternative to mechanical sampling especially when dealing with artworks such as ceramics and metal works which are problematic due to their hardness and brittleness. Another case is that of valuable pieces where sampling is not an option and the materials to analyse lie behind the surface. The capabilities and limitations of such instrumentation were assessed through several tests in order to characterize the trend of the laser ablation on different materials. Monitored ablation was performed on commercial sheets of polyethylene terephthalate (PET), a standard material of known thickness and mechanical stability, and rabbit glue, an adhesive often used in works of art. Measurements were finally carried out on a specimen with a stratigraphy similar to those found in real mural paintings.

  8. Thermal Solid Sample Introduction-Fast Gas Chromatography-Low Flow Ion Mobility Spectrometry as a field screening detection system.

    PubMed

    Hajialigol, Saeed; Ghorashi, Seyed Alireza; Alinoori, Amir Hossein; Torabpour, Amir; Azimi, Mehdi

    2012-12-14

    The potential of Thermal Solid Sample Introduction (TSSI)-Fast Gas Chromatography (GC)-Low Flow Ion Mobility Spectrometry (LF-IMS) having been designed and constructed in Engineering Research Center of Esfahan, detector group was investigated for chemical detection capabilities. Customizing the configuration of fast GC-IMS as a high technology, provides unique solutions for rapid detection of a broad range of chemical mixtures in many operational environments. TSSI configuration provides fast and easily applied method for direct detection with no additional sample preparation or extraction. The time required for total analysis, less than 265 s, was determined by the wide range of solid matrixes, including nitrate esters, nitroaromatics, and a nitramine. The fast extraction together with the short separation time limits degradation of the thermally labile compounds and decreases the peak widths, which results in larger peak intensities and a simultaneous improvement in detection limits. For signal-to-noise ratio equals to 5, the detection limits for instrument for TNT, DNT and RDX were attained 15, 10 and 50 ng/μl respectively. The combination of short analysis time and low detection limits make this instrument a potential candidate for field screening techniques. PMID:23141709

  9. Field Air Sampling and Simultaneous Chemical and Sensory Analysis of Livestock Odorants with Sorbent Tube GC-MS/Olfactometry

    NASA Astrophysics Data System (ADS)

    Zhang, Shicheng; Cai, Lingshuang; Koziel, Jacek A.; Hoff, Steven; Clanton, Charles; Schmidt, David; Jacobson, Larry; Parker, David; Heber, Albert

    2009-05-01

    Characterization and quantification of livestock odorants is one of the most challenging analytical tasks because odor-causing gases are very reactive, polar and often present at very low concentrations in a complex matrix of less important or irrelevant gases. The objective of this research was to develop a novel analytical method for characterization of the livestock odorants including their odor character, odor intensity, and hedonic tone and to apply this method for quantitative analysis of the key odorants responsible for livestock odor. Sorbent tubes packed with Tenax TA were used for field sampling. The automated one-step thermal desorption module coupled with multidimensional gas chromatography-mass spectrometry/olfactometry system was used for simultaneous chemical and odor analysis. Fifteen odorous VOCs and semi-VOCs identified from different livestock species operations were quantified. Method detection limits ranges from 40 pg for skatole to 3590 pg for acetic acid. In addition, odor character, odor intensity and hedonic tone associated with each of the target odorants are also analyzed simultaneously. We found that the mass of each VOCs in the sample correlates well with the log stimulus intensity. All of the correlation coefficients (R2) are greater than 0.74, and the top 10 correlation coefficients were greater than 0.90.

  10. Field-amplified sample injection in capillary electrophoresis with amperometric detection for the ultratrace analysis of diastereomeric ephedrine alkaloids.

    PubMed

    Chen, Xiaoyan; Tang, Yanxia; Wang, Shaoyun; Song, Yunping; Tang, Fengxiang; Wu, Xiaoping

    2015-08-01

    A coupling method of field-amplified sample injection (FASI) CE with amperometric detection is developed for ultratrace analysis of ephedrine alkaloids stereoisomers. FASI was introduced by injecting electrokinetically the sample solution for 10 s into the capillary filled with highly conductive background electrolyte (BGE). The diastereomeric selectivity and the detection sensitivity were improved by using borate buffer of high ionic strength as BGE. Parameters affecting FASI and CE separation were investigated to achieve the optimal conditions. Four analytes were separated within 15 min using 200 mmol/L borate buffer (pH 9.5) and separation voltage of +18 kV, with detection potential at +1.0 V (vs. Ag/AgCl) and carbon disc electrode as working electrode. Excellent linearity was observed between peak current and concentration of analytes in the range of 0.1-100 ng/mL. The LODs (S/N = 3) for (-)-ephedrine, (+)-pseudoephedrine, (-)-N-methylephedrine and (+)-N-methylpseudoephedrine were 39.3, 54.9, 30.8, and 44.1 pg/mL, respectively. The proposed method was successfully applied to the determination of alkaloids in Ephedra sinica, with results agreed well with HPLC method. Mean recoveries of 102.1-109.7% and RSDs less than 6% were found. And the merits of high sensitivity and selectivity, as well as a simple and stable operation, have been demonstrated. PMID:25873262

  11. Subcritical water extraction of alkaloids in Sophora flavescens Ait. and determination by capillary electrophoresis with field-amplified sample stacking.

    PubMed

    Wang, Haiyan; Lu, Yuchao; Chen, Jie; Li, Junchao; Liu, Shuhui

    2012-01-25

    The extraction and determination of cytisine, sophocarpine, matrine, sophoridine and oxymatrine in Sophora flavescens Ait. were performed using subcritical water extraction and capillary electrophoresis with field-amplified sample stacking. The effects of extraction temperature, pressure, time and cycle number on the extraction yields were investigated systematically for accelerated solvent extraction with ethanol (ASE) and accelerated solvent extraction with water (subcritical water extraction, SWE). The extraction yields obtained using SWE, ASE, water ultrasonic extraction and chloroform soaking extraction methods were compared. The electrophoresis separation buffer was monosodium phosphate (pH 3.0; 110 mM)-isopropanol (85:15, v/v). The effect of phosphoric acid added to the sample matrix on the reproducibility of the peak heights of the analytes was also examined. Cytisine, sophoridine and oxymatrine showed good linearity (R(2)>0.999) within 0.125-4.0 μg/mL, and sophocarpine and matrine exhibited good linearity (R(2)>0.998) within 0.0625-2.0 μg/mL, with the detection limits in the range of 0.004-0.0013 μg/mL. The five alkaloid contents in medicinal plants from different sources and Sophora instant granule were determined and compared. PMID:21996061

  12. Effect of an absorbent overlay on the residual stress field induced by laser shock processing on aluminum samples

    NASA Astrophysics Data System (ADS)

    Rubio-González, C.; Gomez-Rosas, G.; Ocaña, J. L.; Molpeceres, C.; Banderas, A.; Porro, J.; Morales, M.

    2006-07-01

    Laser shock processing (LSP) or laser shock peening is a new technique for strengthening metals. This process induces a compressive residual stress field, which increases fatigue crack initiation life and reduces fatigue crack growth rate. Specimens of 6061-T6 aluminum alloy are used in this investigation. A convergent lens is used to deliver 2.5 J, 8 ns laser pulses by a Q-switch Nd:YAG laser, operating at 10 Hz. The pulses are focused to a diameter of 1.5 mm onto aluminum samples. Density of 2500 pulses/cm 2 with infrared (1064 nm) radiation was used. The effect of an absorbent overlay on the residual stress field using this LSP setup and this energy level is evaluated. Residual stress distribution as a function of depth is assessed by the hole drilling method. It is observed that the overlay makes the compressive residual stress profile move to the surface. This effect is explained on the basis of the vaporization of the coat layer suppressing thermal effects on the metallic substrate. The effect of coating the specimen surface before LSP treatment may have advantages on improving wear and contact fatigue properties of this aluminum alloy.

  13. Moral Reasoning in Hypothetical and Actual Situations.

    ERIC Educational Resources Information Center

    Sumprer, Gerard F.; Butter, Eliot J.

    1978-01-01

    Results of this investigation suggest that moral reasoning of college students, when assessed using the DIT format, is the same whether the dilemmas involve hypothetical or actual situations. Subjects, when presented with hypothetical situations, become deeply immersed in them and respond as if they were actual participants. (Author/BEF)

  14. Factors Related to Self-Actualization.

    ERIC Educational Resources Information Center

    Hogan, H. Wayne; McWilliams, Jettie M.

    1978-01-01

    Provides data to further support the notions that females score higher in self-actualization measures and that self-actualization scores correlate inversely to the degree of undesirability individuals assign to their heights and weights. Finds that, contrary to predictions, greater androgyny was related to lower, not higher, self-actualization…

  15. A Quantitative Approach for Collocating NEON's Sensor-Based Ecological Measurements and in-situ Field Sampling and Observations

    NASA Astrophysics Data System (ADS)

    Zulueta, R. C.; Metzger, S.; Ayres, E.; Luo, H.; Meier, C. L.; Barnett, D.; Sanclements, M.; Elmendorf, S.

    2013-12-01

    The National Ecological Observatory Network (NEON) is a continental-scale research platform currently in development to assess the causes of ecological change and biological responses to change across a projected 30-year timeframe. A suite of standardized sensor-based measurements (i.e., Terrestrial Instrument System (TIS) measurements) and in-situ field sampling and observations (i.e., Terrestrial Observation System (TOS) activities) will be conducted across 20 ecoclimatic domains in the U.S. where NEON is establishing 60 terrestrial research sites. NEON's TIS measurements and TOS activities are designed to observe the temporal and spatial dynamics of key drivers and ecological processes and responses to change within each of the 60 terrestrial research sites. The TIS measurements are non-destructive and designed to provide in-situ, continuous, and areally integrated observations of the surrounding ecosystem and environment, while TOS sampling and observation activities are designed to encompass a hierarchy of measurable biological states and processes including diversity, abundance, phenology, demography, infectious disease prevalence, ecohydrology, and biogeochemistry. To establish valid relationships between these drivers and site-specific responses, two contradicting requirements must be fulfilled: (i) both types of observations shall be representative of the same ecosystem, and (ii) they shall not significantly influence one another. Here we outline the theoretical background and algorithmic process for determining areas of mutual representativeness and exclusion around NEON's TIS measurements and develop a procedure which quantitatively optimizes this trade-off through: (i) quantifying the source area distributions of TIS measurements, (ii) determining the ratio of user-defined impact threshold to effective impact area for different TOS activities, and (iii) determining the range of feasible distances between TIS locations and TOS activities. This approach

  16. Elevating sampling

    PubMed Central

    Labuz, Joseph M.; Takayama, Shuichi

    2014-01-01

    Sampling – the process of collecting, preparing, and introducing an appropriate volume element (voxel) into a system – is often under appreciated and pushed behind the scenes in lab-on-a-chip research. What often stands in the way between proof-of-principle demonstrations of potentially exciting technology and its broader dissemination and actual use, however, is the effectiveness of sample collection and preparation. The power of micro- and nanofluidics to improve reactions, sensing, separation, and cell culture cannot be accessed if sampling is not equally efficient and reliable. This perspective will highlight recent successes as well as assess current challenges and opportunities in this area. PMID:24781100

  17. Vent 7504 of the San Francisco Volcanic Field (SFVF), Arizona: Sample Geochemistry and Implications for Cone Formation

    NASA Astrophysics Data System (ADS)

    Needham, D. H.; Eppler, D. B.; Bleacher, J. E.; Skinner, J. A.; Evans, C. A.; Feng, W.; Gruener, J. E.; Whitson, P. A.; Janoiko, B. A.; Mertzman, S. A.

    2015-12-01

    Vent 7504 is a complex structure in the SFVF that has 3 unit classes: a central cone with exposed dikes and cinder-covered rheomorphic facies; a SE/NW-trending ridge north of the cone with cinder-covered rheomorphic facies; and three discrete lava flows that emanate to the N from the ridge and to the SW and NW from the cone. Field observations suggest the ridge was the northern crest of an initial, larger cone. The NW portion of this cone was most likely disrupted during a catastrophic breach of lava that had accumulated within the cone; this third of three lava flows carried rafted packages of the rheomorphic cone facies to the NW, forming the linear N ridge. The final phase of pyroclastic activity was concentrated in the SW portion of the original cone, covering the top of the cone with cinders and forming the more traditional conic-shaped construct observed today. This study describes the geochemistry of 9 samples collected from the mapped units (2 from the cone, 1 from the N ridge, 1 from the N lava flow, 2 from the SW lava flow, and 3 from the NW lava flow) to further constrain the formation of Vent 7504. Geochemical analyses including back-scatter electron scanning electron microscopy and laboratory X-ray fluorescence spectroscopy were conducted on the 9 collected samples to measure bulk rock and olivine phenocryst compositions. Major element concentrations in the bulk rock and olivine compositions are strongly clustered in all samples, indicating they likely originated from a single magmatic source. Bulk rock SiO2 (~47.5 wt%) and alkali (Na2O + K2O, ~2.7 wt% + 0.71 wt%) concentrations are consistent with a basaltic classification for these samples. Trends in major elements relative to MgO are observed for the olivine phenocrysts: SiO2, Al2O3, Na2O, and TiO2 remain constant relative to MgO, but strong linear trends are observed in MnO, FeO, and NiO relative to MgO. These linear trends are expected given the potential for bivalent cation exchanges in the

  18. Isolating the actual signal of paleointensity?

    NASA Astrophysics Data System (ADS)

    Valet, J. M.; Moreno, E.; Bassinot, F.; Herrero-Bervera, E.

    2011-12-01

    of the field determinations. It can be argued that studies of long-term field behaviour do not require the same accuracy as for knowledge of the field variations that prevailed during the past millenia. We have followed another track after noticing that samples containing exclusively monodomain magnetite provide almost systematically the right field determination. Thus, we prefer to select appropriate samples for standard Thellier experiments from thermal demagnetization diagrams of twin specimens. This preliminary thermal treatment also has the advantage of providing suitable directions so that there is no time waste and no loss of information.

  19. Investigation of differences between field and laboratory pH measurements of national atmospheric deposition program/national trends network precipitation samples

    USGS Publications Warehouse

    Latysh, N.; Gordon, J.

    2004-01-01

    A study was undertaken to investigate differences between laboratory and field pH measurements for precipitation samples collected from 135 weekly precipitation-monitoring sites in the National Trends Network from 12/30/1986 to 12/28/1999. Differences in pH between field and laboratory measurements occurred for 96% of samples collected during this time period. Differences between the two measurements were evaluated for precipitation samples collected before and after January 1994, when modifications to sample-handling protocol and elimination of the contaminating bucket o-ring used in sample shipment occurred. Median hydrogen-ion and pH differences between field and laboratory measurements declined from 3.9 ??eq L-1 or 0.10 pH units before the 1994 protocol change to 1.4 ??eq L-1 or 0.04 pH units after the 1994 protocol change. Hydrogen-ion differences between field and laboratory measurements had a high correlation with the sample pH determined in the field. The largest pH differences between the two measurements occurred for high-pH samples (>5.6), typical of precipitation collected in Western United States; however low- pH samples (<5.0) displayed the highest variability in hydrogen-ion differences between field and laboratory analyses. Properly screened field pH measurements are a useful alternative to laboratory pH values for trend analysis, particularly before 1994 when laboratory pH values were influenced by sample-collection equipment.

  20. Nanoparticles in natural systems I: The effective reactive surface area of the natural oxide fraction in field samples

    NASA Astrophysics Data System (ADS)

    Hiemstra, Tjisse; Antelo, Juan; Rahnemaie, Rasoul; Riemsdijk, Willem H. van

    2010-01-01

    fraction of ˜80%. The average mass density of such a NOM-mineral association is ˜1700 ± 100 kg/m 3 (i.e. high-density NOM). The amount of reversibly bound phosphate is rather close to the amount of phosphate that is extractable with oxalate. The phosphate loading varies remarkably ( Γ ≈ 1-3 μmol/m 2 oxide) in the samples. As discussed in part II of this paper series ( Hiemstra et al., 2010), the phosphate loading ( Γ) of field samples is suppressed by surface complexation of NOM, where hydrophilic, fulvic, and humic acids act as a competitor for (an)ions via site competition and electrostatic interaction.

  1. NHEXAS PHASE I REGION 5 STUDY--STANDARD OPERATING PROCEDURE--FIELD USE OF THE SAMPLE COLLECTION AND CUSTODY SOFTWARE (RTI/ACS-AP-209-086)

    EPA Science Inventory

    This procedure describes field use of the sample collection and custody software developed for this pilot study. This is an easy-to-use, spreadsheet-based, two-part sample collection and custody software package. The software is for use on laptop computers and defines the kinds a...

  2. The GOODS-MUSIC sample: a multicolour catalog of near-IR selected galaxies in the GOODS-South field

    NASA Astrophysics Data System (ADS)

    Grazian, A.; Fontana, A.; de Santis, C.; Nonino, M.; Salimbeni, S.; Giallongo, E.; Cristiani, S.; Gallozzi, S.; Vanzella, E.

    2006-04-01

    Aims. We present a high quality multiwavelength (from 0.3 to 8.0 μm) catalog of the large and deep area in the GOODS Southern Field covered by the deep near-IR observations obtained with the ESO VLT. Methods. The catalog is entirely based on public data: in our analysis, we have included the F435W, F606W, F775W and F850LP ACS images, the JHKs VLT data, the Spitzer data provided by IRAC instrument (3.6, 4.5, 5.8 and 8.0 μm), and publicly available U-band data from the 2.2ESO and VLT-VIMOS. We describe in detail the procedures adopted to obtain this multiwavelength catalog. In particular, we developed a specific software for the accurate "PSF-matching" of space and ground-based images of different resolution and depth (ConvPhot), of which we analyse performances and limitations. We have included both z-selected, as well as Ks-selected objects, yielding a unique, self-consistent catalog. The largest fraction of the sample is 90% complete at z≃ 26 or Ks≃ 23.8 (AB scale). Finally, we cross-correlated our data with all the spectroscopic catalogs available to date, assigning a spectroscopic redshift to more than 1000 sources. Results. The final catalog is made up of 14 847 objects, at least 72 of which are known stars, 68 are AGNs, and 928 galaxies with spectroscopic redshift (668 galaxies with reliable redshift determination). We applied our photometric redshift code to this data set, and the comparison with the spectroscopic sample shows that the quality of the resulting photometric redshifts is excellent, with an average scatter of only 0.06. The full catalog, which we named GOODS-MUSIC (MUltiwavelength Southern Infrared Catalog), including the spectroscopic information, is made publicly available, together with the software specifically designed to this end.

  3. Meteorological field measurements at potential and actual wind turbine sites

    SciTech Connect

    Renne, D.S.; Sandusky, W.F.; Hadley, D.L.

    1982-09-01

    An overview of experiences gained in a meteorological measurement program conducted at a number of locations around the United States for the purpose of site evaluation for wind energy utilization is provided. The evolution of the measurement program from its inception in 1976 to the present day is discussed. Some of the major accomplishments and areas for improvement are outlined. Some conclusions on research using data from this program are presented.

  4. How to Conduct a Research Field Trip

    ERIC Educational Resources Information Center

    Wacker, David G.

    1974-01-01

    Discusses the three phases of a three-day intensive research study field trip: planning and pre-trip training; actual trip; and post-trip report, research and data organization, and final trip evaluation. Included is a sample program of the limnology field trip taken by the Grafton High School, Wisconsin. (CC)

  5. Novel Virus Discovery and Genome Reconstruction from Field RNA Samples Reveals Highly Divergent Viruses in Dipteran Hosts

    PubMed Central

    Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.

    2013-01-01

    We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463

  6. Linear models for airborne-laser-scanning-based operational forest inventory with small field sample size and highly correlated LiDAR data

    USGS Publications Warehouse

    Junttila, Virpi; Kauranne, Tuomo; Finley, Andrew O.; Bradford, John B.

    2015-01-01

    Modern operational forest inventory often uses remotely sensed data that cover the whole inventory area to produce spatially explicit estimates of forest properties through statistical models. The data obtained by airborne light detection and ranging (LiDAR) correlate well with many forest inventory variables, such as the tree height, the timber volume, and the biomass. To construct an accurate model over thousands of hectares, LiDAR data must be supplemented with several hundred field sample measurements of forest inventory variables. This can be costly and time consuming. Different LiDAR-data-based and spatial-data-based sampling designs can reduce the number of field sample plots needed. However, problems arising from the features of the LiDAR data, such as a large number of predictors compared with the sample size (overfitting) or a strong correlation among predictors (multicollinearity), may decrease the accuracy and precision of the estimates and predictions. To overcome these problems, a Bayesian linear model with the singular value decomposition of predictors, combined with regularization, is proposed. The model performance in predicting different forest inventory variables is verified in ten inventory areas from two continents, where the number of field sample plots is reduced using different sampling designs. The results show that, with an appropriate field plot selection strategy and the proposed linear model, the total relative error of the predicted forest inventory variables is only 5%–15% larger using 50 field sample plots than the error of a linear model estimated with several hundred field sample plots when we sum up the error due to both the model noise variance and the model’s lack of fit.

  7. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2006-10-18

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 222-S Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cs-137 sulfate, and sodium) were exceeded in all three of the flowsheet tests that were performed.

  8. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2007-04-13

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 2224 Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cesium-137 sulfate and sodium) were exceeded in all three of the flowsheet tests that were performed.

  9. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect

    Evans, S.K.

    2002-01-31

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  10. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect

    Evans, Susan Kay; Orchard, B. J.

    2002-01-01

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  11. The actual citation impact of European oncological research.

    PubMed

    López-Illescas, Carmen; de Moya-Anegón, Félix; Moed, Henk F

    2008-01-01

    This study provides an overview of the research performance of major European countries in the field Oncology, the most important journals in which they published their research articles, and the most important academic institutions publishing them. The analysis was based on Thomson Scientific's Web of Science (WoS) and calculated bibliometric indicators of publication activity and actual citation impact. Studying the time period 2000-2006, it gives an update of earlier studies, but at the same time it expands their methodologies, using a broader definition of the field, calculating indicators of actual citation impact, and analysing new and policy relevant aspects. Findings suggest that the emergence of Asian countries in the field Oncology has displaced European articles more strongly than articles from the USA; that oncologists who have published their articles in important, more general journals or in journals covering other specialties, rather than in their own specialist journals, have generated a relatively high actual citation impact; and that universities from Germany, and--to a lesser extent--those from Italy, the Netherlands, UK, and Sweden, dominate a ranking of European universities based on number of articles in oncology. The outcomes illustrate that different bibliometric methodologies may lead to different outcomes, and that outcomes should be interpreted with care. PMID:18039565

  12. Characterizing forest structure variations across an intact tropical peat dome using field samplings and airborne LiDAR.

    PubMed

    Nguyen, Ha T; Hutyra, Lucy R; Hardiman, Brady S; Raciti, Steve M

    2016-03-01

    Tropical peat swamp forests (PSF) are one of the most carbon dense ecosystems on the globe and are experiencing substantial natural and anthropogenic disturbances. In this study, we combined direct field sampling and airborne LiDAR to empirically quantify forest structure and aboveground live biomass (AGB) across a large, intact tropical peat dome in Northwestern Borneo. Moving up a 4 m elevational gradient, we observed increasing stem density but decreasing canopy height, crown area, and crown roughness. These findings were consistent with hypotheses that nutrient and hydrological dynamics co-influence forest structure and stature of the canopy individuals, leading to reduced productivity towards the dome interior. Gap frequency as a function of gap size followed a power law distribution with a shape factor (λ) of 1.76 ± 0.06. Ground-based and dome-wide estimates of AGB were 217.7 ± 28.3 Mg C/ha and 222.4 ± 24.4 Mg C/ha, respectively, which were higher than previously reported AGB for PSF and tropical forests in general. However, dome-wide AGB estimates were based on height statistics, and we found the coefficient of variation on canopy height was only 0.08, three times less than stem diameter measurements, suggesting LiDAR height metrics may not be a robust predictor of AGB in tall tropical forests with dense canopies. Our structural characterization of this ecosystem advances the understanding of the ecology of intact tropical peat domes and factors that influence biomass density and landscape-scale spatial variation. This ecological understanding is essential to improve estimates of forest carbon density and its spatial distribution in PSF and to effectively model the effects of disturbance and deforestation in these carbon dense ecosystems. PMID:27209797

  13. Realizing actual feedback control of complex network

    NASA Astrophysics Data System (ADS)

    Tu, Chengyi; Cheng, Yuhua

    2014-06-01

    In this paper, we present the concept of feedbackability and how to identify the Minimum Feedbackability Set of an arbitrary complex directed network. Furthermore, we design an estimator and a feedback controller accessing one MFS to realize actual feedback control, i.e. control the system to our desired state according to the estimated system internal state from the output of estimator. Last but not least, we perform numerical simulations of a small linear time-invariant dynamics network and a real simple food network to verify the theoretical results. The framework presented here could make an arbitrary complex directed network realize actual feedback control and deepen our understanding of complex systems.

  14. Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize

    PubMed Central

    Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

    2015-01-01

    Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers’ freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

  15. Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize.

    PubMed

    Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

    2015-01-01

    Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers' freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

  16. Petrographic description of calcite/opal samples collected on field trip of December 5-9, 1992. Special report No. 7

    SciTech Connect

    Hill, C.A.; Schluter, C.M.

    1993-06-01

    This study is part of the research program of the Yucca Mountain Project intended to provide the State of Nevada with a detailed analysis and assessment of the water-deposited minerals of Yucca Mountain and adjacent regions. Forty-three separate stops were made and 203 samples were collected during the five days of the field trip. This report describes petrographic observations made on the calcite/opal samples.

  17. Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples

    PubMed Central

    Voordouw, Gerrit; Menon, Priyesh; Pinnock, Tijan; Sharma, Mohita; Shen, Yin; Venturelli, Amanda; Voordouw, Johanna; Sexton, Aoife

    2016-01-01

    Microbially-influenced corrosion (MIC) contributes to the general corrosion rate (CR), which is typically measured with carbon steel coupons. Here we explore the use of carbon steel ball bearings, referred to as beads (55.0 ± 0.3 mg; Ø = 0.238 cm), for determining CRs. CRs for samples from an oil field in Oceania incubated with beads were determined by the weight loss method, using acid treatment to remove corrosion products. The release of ferrous and ferric iron was also measured and CRs based on weight loss and iron determination were in good agreement. Average CRs were 0.022 mm/yr for eight produced waters with high numbers (105/ml) of acid-producing bacteria (APB), but no sulfate-reducing bacteria (SRB). Average CRs were 0.009 mm/yr for five central processing facility (CPF) waters, which had no APB or SRB due to weekly biocide treatment and 0.036 mm/yr for 2 CPF tank bottom sludges, which had high numbers of APB (106/ml) and SRB (108/ml). Hence, corrosion monitoring with carbon steel beads indicated that biocide treatment of CPF waters decreased the CR, except where biocide did not penetrate. The CR for incubations with 20 ml of a produced water decreased from 0.061 to 0.007 mm/yr when increasing the number of beads from 1 to 40. CRs determined with beads were higher than those with coupons, possibly also due to a higher weight of iron per unit volume used in incubations with coupons. Use of 1 ml syringe columns, containing carbon steel beads, and injected with 10 ml/day of SRB-containing medium for 256 days gave a CR of 0.11 mm/yr under flow conditions. The standard deviation of the distribution of residual bead weights, a measure for the unevenness of the corrosion, increased with increasing CR. The most heavily corroded beads showed significant pitting. Hence the use of uniformly sized carbon steel beads offers new opportunities for screening and monitoring of corrosion including determination of the distribution of corrosion rates, which allows

  18. Star formation in the local Universe from the CALIFA sample. I. Calibrating the SFR using integral field spectroscopy data

    NASA Astrophysics Data System (ADS)

    Catalán-Torrecilla, C.; Gil de Paz, A.; Castillo-Morales, A.; Iglesias-Páramo, J.; Sánchez, S. F.; Kennicutt, R. C.; Pérez-González, P. G.; Marino, R. A.; Walcher, C. J.; Husemann, B.; García-Benito, R.; Mast, D.; González Delgado, R. M.; Muñoz-Mateos, J. C.; Bland-Hawthorn, J.; Bomans, D. J.; Del Olmo, A.; Galbany, L.; Gomes, J. M.; Kehrig, C.; López-Sánchez, Á. R.; Mendoza, M. A.; Monreal-Ibero, A.; Pérez-Torres, M.; Sánchez-Blázquez, P.; Vilchez, J. M.; Califa Collaboration

    2015-12-01

    Context. The star formation rate (SFR) is one of the main parameters used to analyze the evolution of galaxies through time. The need for recovering the light reprocessed by dust commonly requires the use of low spatial resolution far-infrared data. Recombination line luminosities provide an alternative, although uncertain dust-extinction corrections based on narrowband imaging or long-slit spectroscopy have traditionally posed a limit to their applicability. Integral field spectroscopy (IFS) is clearly the way to overcome this kind of limitation. Aims: We obtain integrated Hα, ultraviolet (UV) and infrared (IR)-based SFR measurements for 272 galaxies from the CALIFA survey at 0.005

  19. Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples.

    PubMed

    Voordouw, Gerrit; Menon, Priyesh; Pinnock, Tijan; Sharma, Mohita; Shen, Yin; Venturelli, Amanda; Voordouw, Johanna; Sexton, Aoife

    2016-01-01

    Microbially-influenced corrosion (MIC) contributes to the general corrosion rate (CR), which is typically measured with carbon steel coupons. Here we explore the use of carbon steel ball bearings, referred to as beads (55.0 ± 0.3 mg; Ø = 0.238 cm), for determining CRs. CRs for samples from an oil field in Oceania incubated with beads were determined by the weight loss method, using acid treatment to remove corrosion products. The release of ferrous and ferric iron was also measured and CRs based on weight loss and iron determination were in good agreement. Average CRs were 0.022 mm/yr for eight produced waters with high numbers (10(5)/ml) of acid-producing bacteria (APB), but no sulfate-reducing bacteria (SRB). Average CRs were 0.009 mm/yr for five central processing facility (CPF) waters, which had no APB or SRB due to weekly biocide treatment and 0.036 mm/yr for 2 CPF tank bottom sludges, which had high numbers of APB (10(6)/ml) and SRB (10(8)/ml). Hence, corrosion monitoring with carbon steel beads indicated that biocide treatment of CPF waters decreased the CR, except where biocide did not penetrate. The CR for incubations with 20 ml of a produced water decreased from 0.061 to 0.007 mm/yr when increasing the number of beads from 1 to 40. CRs determined with beads were higher than those with coupons, possibly also due to a higher weight of iron per unit volume used in incubations with coupons. Use of 1 ml syringe columns, containing carbon steel beads, and injected with 10 ml/day of SRB-containing medium for 256 days gave a CR of 0.11 mm/yr under flow conditions. The standard deviation of the distribution of residual bead weights, a measure for the unevenness of the corrosion, increased with increasing CR. The most heavily corroded beads showed significant pitting. Hence the use of uniformly sized carbon steel beads offers new opportunities for screening and monitoring of corrosion including determination of the distribution of corrosion rates, which allows

  20. Comparison of geochemical data obtained using four brine sampling methods at the SECARB Phase III Anthropogenic Test CO2 injection site, Citronelle Oil Field, Alabama

    USGS Publications Warehouse

    Conaway, Christopher; Thordsen, James J.; Manning, Michael A.; Cook, Paul J.; Trautz, Robert C.; Thomas, Burt; Kharaka, Yousif K.

    2016-01-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a characterization well in the Citronelle Oil Field, Alabama, as part of the Southeast Regional Carbon Sequestration Partnership (SECARB) Phase III Anthropogenic Test, which is an integrated carbon capture and storage project. In this study, formation water and gas samples were obtained from well D-9-8 #2 at Citronelle using gas lift, electric submersible pump, U-tube, and a downhole vacuum sampler (VS) and subjected to both field and laboratory analyses. Field chemical analyses included electrical conductivity, dissolved sulfide concentration, alkalinity, and pH; laboratory analyses included major, minor and trace elements, dissolved carbon, volatile fatty acids, free and dissolved gas species. The formation water obtained from this well is a Na–Ca–Cl-type brine with a salinity of about 200,000 mg/L total dissolved solids. Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity. There was little gas in samples, and gas composition results were strongly influenced by sampling methods. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the VS and U-tube system performing most favorably in this aspect.

  1. 50 CFR 253.16 - Actual cost.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Actual cost. 253.16 Section 253.16 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE AID TO FISHERIES FISHERIES ASSISTANCE PROGRAMS Fisheries Finance Program §...

  2. 50 CFR 253.16 - Actual cost.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 50 Wildlife and Fisheries 11 2013-10-01 2013-10-01 false Actual cost. 253.16 Section 253.16 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE AID TO FISHERIES FISHERIES ASSISTANCE PROGRAMS Fisheries Finance Program §...

  3. Humanistic Education and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1984-01-01

    Stresses the need for theoretical justification for the development of humanistic education programs in today's schools. Explores Abraham Maslow's hierarchy of needs and theory of self-actualization. Argues that Maslow's theory may be the best available for educators concerned with educating the whole child. (JHZ)

  4. Children's Rights and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1982-01-01

    Educators need to seriously reflect upon the concept of children's rights. Though the idea of children's rights has been debated numerous times, the idea remains vague and shapeless; however, Maslow's theory of self-actualization can provide the children's rights idea with a needed theoretical framework. (Author)

  5. Culture Studies and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1983-01-01

    True citizenship education is impossible unless students develop the habit of intelligently evaluating cultures. Abraham Maslow's theory of self-actualization, a theory of innate human needs and of human motivation, is a nonethnocentric tool which can be used by teachers and students to help them understand other cultures. (SR)

  6. Group Counseling for Self-Actualization.

    ERIC Educational Resources Information Center

    Streich, William H.; Keeler, Douglas J.

    Self-concept, creativity, growth orientation, an integrated value system, and receptiveness to new experiences are considered to be crucial variables to the self-actualization process. A regular, year-long group counseling program was conducted with 85 randomly selected gifted secondary students in the Farmington, Connecticut Public Schools. A…

  7. Racial Discrimination in Occupations: Perceived and Actual.

    ERIC Educational Resources Information Center

    Turner, Castellano B.; Turner, Barbara F.

    The relationship between the actual representation of Blacks in certain occupations and individual perceptions of the occupational opportunity structure were examined. A scale which rated the degree of perceived discrimination against Blacks in 21 occupations was administered to 75 black male, 70 black female, 1,429 white male and 1,457 white…

  8. Developing Human Resources through Actualizing Human Potential

    ERIC Educational Resources Information Center

    Clarken, Rodney H.

    2012-01-01

    The key to human resource development is in actualizing individual and collective thinking, feeling and choosing potentials related to our minds, hearts and wills respectively. These capacities and faculties must be balanced and regulated according to the standards of truth, love and justice for individual, community and institutional development,…

  9. Geospatial compilation of results from field sample collection in support of mineral resource investigations, Western Alaska Range, Alaska, July 2013

    USGS Publications Warehouse

    Johnson, Michaela R.; Graham, Garth E.; Hubbard, Bernard E.; Benzel, William M.

    2015-01-01

    This Data Series summarizes results from July 2013 sampling in the western Alaska Range near Mount Estelle, Alaska. The fieldwork combined in situ and camp-based spectral measurements of talus/soil and rock samples. Five rock and 48 soil samples were submitted for quantitative geochemi­cal analysis (for 55 major and trace elements), and the 48 soils samples were also analyzed by x-ray diffraction to establish mineralogy and geochemistry. The results and sample photo­graphs are presented in a geodatabase that accompanies this report. The spectral, mineralogical, and geochemical charac­terization of these samples and the sites that they represent can be used to validate existing remote-sensing datasets (for example, ASTER) and future hyperspectral studies. Empiri­cal evidence of jarosite (as identified by x-ray diffraction and spectral analysis) corresponding with gold concentrations in excess of 50 parts per billion in soil samples suggests that surficial mapping of jarosite in regional surveys may be use­ful for targeting areas of prospective gold occurrences in this sampling area.

  10. Multiplicity Sampling for Dropouts in the NHES Field Test. Contractor Report. National Household Education Survey Technical Report.

    ERIC Educational Resources Information Center

    Brick, J. Michael; West, Jerry

    The National Household Education Survey (NHES) was conducted for the first time in 1991 as a way to collect data on the early childhood education experiences of young children and participation in adult education. Because the NHES methodology is relatively new, field tests were necessary. A large field test of approximately 15,000 households was…

  11. Field guide for collecting samples for analysis of volatile organic compounds in stream water for the National Water-Quality Assessment Program

    USGS Publications Warehouse

    Shelton, Larry R.

    1997-01-01

    For many years, stream samples for analysis of volatile organic compounds have been collected without specific guidelines or a sampler designed to avoid analyte loss. In 1996, the U.S. Geological Survey's National Water-Quality Assessment Program began aggressively monitoring urban stream-water for volatile organic compounds. To assure representative samples and consistency in collection procedures, a specific sampler was designed to collect samples for analysis of volatile organic compounds in stream water. This sampler, and the collection procedures, were tested in the laboratory and in the field for compound loss, contamination, sample reproducibility, and functional capabilities. This report describes that sampler and its use, and outlines field procedures specifically designed to provide contaminant-free, reproducible volatile organic compound data from stream-water samples. These guidelines and the equipment described represent a significant change in U.S. Geological Survey instructions for collecting and processing stream-water samples for analysis of volatile organic compounds. They are intended to produce data that are both defensible and interpretable, particularly for concentrations below the microgram-per-liter level. The guidelines also contain detailed recommendations for quality-control samples.

  12. Endotoxin deposits on the inner surfaces of closed-face cassettes during bioaerosol sampling: a field investigation at composting facilities.

    PubMed

    Duquenne, Philippe; Simon, Xavier; Demange, Valérie; Harper, Martin; Wild, Pascal

    2015-05-01

    A set of 270 bioaerosol samples was taken from 15 composting facilities using polystyrene closed-face filter cassettes (CFCs). The objective was to measure the quantity of endotoxin deposits on the inner surfaces of the cassettes (sometimes referred to as 'wall deposits'). The results show that endotoxins are deposited on the inner surfaces of the CFCs through sampling and/or handling of samples. The quantity of endotoxins measured on inner surfaces range between 0.05 (the limit of detection of the method) and 3100 endotoxin units per cassette. The deposits can represent a large and variable percentage of the endotoxins sampled. More than a third of the samples presented a percentage of inner surface deposits >40% of the total quantity of endotoxins collected (filter + inner surfaces). Omitting these inner surface deposits in the analytical process lead to measurement errors relative to sampling all particles entering the CFC sampler, corresponding to a developing consensus on matching the inhalable particulate sampling convention. The result would be underestimated exposures and could affect the decision as to whether or not a result is acceptable in comparison to airborne concentration limits defined in terms of the inhalability convention. The results of this study suggest including the endotoxins deposited on the inner surfaces of CFCs during analysis. Further researches are necessary to investigate endotoxin deposits on the inner cassette surfaces in other working sectors. PMID:25535181

  13. Expedited characterization of ground water contamination at a large industrial site through field sampling and on-site analysis

    SciTech Connect

    Fusillo, T.V.; Potts, M.J.

    1995-09-01

    Ground water contamination by chlorinated solvents was detected at a former manufacturing facility in central New Jersey. The site, which occupies approximately 30 acres and is located in the Coastal Plain of New Jersey, is underlain by a thin layer of fine sand that extends to approximately 4 to 15 feet below ground surface (bgs) and a dense clay to silty clay that underlies the sand to a depth of at least 30 feet bgs, with ground water at a depth of 4 to 10 feet bgs. To expedite the ground water investigation, ENVIRON utilized a Geoprobe{reg_sign} sampling system together with an onsite mobile laboratory to perform site-wide ground water delineation sampling. Ground water samples were collected from the upper 5 feet of the water table using disposable tubing for on-site analysis of selected volatile organic compounds (VOCs) using a Photovac 10S Plus GC/PID. Sampling and analysis were conducted by On-Site Services of Newark, Delaware. Duplicate samples were also collected from all locations for analysis of VOCs by US EPA method 8240 at a commercial laboratory. Sampling began in the vicinity of the most highly contaminated monitoring well and proceeded in all directions until low or nondetectable concentrations were measured using the on-site GC or until the property boundaries were reached. Over the three-day sampling period, 33 ground water samples were collected. The sampling results provided a detailed picture of ground water quality across the large site, and contaminant distribution patterns confirmed the likely variability in ground water flow directions.

  14. Field Evaluation of Capillary Blood Samples as a Collection Specimen for the Rapid Diagnosis of Ebola Virus Infection During an Outbreak Emergency

    PubMed Central

    Strecker, Thomas; Palyi, Bernadett; Ellerbrok, Heinz; Jonckheere, Sylvie; de Clerck, Hilde; Bore, Joseph Akoi; Gabriel, Martin; Stoecker, Kilian; Eickmann, Markus; van Herp, Michel; Formenty, Pierre; Di Caro, Antonino; Becker, Stephan

    2015-01-01

    Background. Reliable reverse transcription polymerase chain reaction (RT-PCR)–based diagnosis of Ebola virus infection currently requires a blood sample obtained by intravenous puncture. During the current Ebola outbreak in Guinea, we evaluated the usability of capillary blood samples collected from fingersticks of patients suspected of having Ebola virus disease (EVD) for field diagnostics during an outbreak emergency. Methods. A total of 120 venous and capillary blood samples were collected from 53 patients admitted to the Ebola Treatment Centre in Guéckédou, Guinea, between July and August 2014. All sample specimens were analyzed by RT-PCR using the RealStar Filovirus Screen RT-PCR Kit 1.0 from altona Diagnostics (Germany). We compared samples obtained by venipuncture and those obtained by capillary blood sampling absorbed onto swab devices. Results. The resulting sensitivity and specificity of tests performed with capillary blood samples were 86.8% (95% confidence interval [CI], 71.9%–95.6%; 33/38 patients) and 100% (95% CI, 84.6%–100%; 22/22 patients), respectively. Conclusions. Our data suggest that capillary blood samples could serve as an alternative to venous blood samples for the diagnosis of EVD in resource-limited settings during a crisis. This can be of particular advantage in cases when venipuncture is difficult to perform—for example, with newborns and infants or when adult patients reject venipuncture for cultural or religious reasons. PMID:25991465

  15. A minimally invasive method of piscine tissue collection and an analysis of long-term field-storage conditions for samples

    PubMed Central

    Campanella, James J; Smalley, John V

    2006-01-01

    Background The acquisition of high-quality DNA for use in phylogenetic and molecular population genetic studies is a primary concern for evolutionary and genetic researchers. Many non-destructive DNA sampling methods have been developed and are used with a variety of taxa in applications ranging from genetic stock assessment to molecular forensics. Results The authors have developed a field sampling method for obtaining high-quality DNA from sunfish (Lepomis) and other freshwater fish that employs a variation on the buccal swab method and results in the collection of DNA suitable for PCR amplification and polymorphism analysis. Additionally, since the circumstances of storage are always a concern for field biologists, the authors have tested the potential storage conditions of swabbed samples and whether those conditions affect DNA extraction and PCR amplification. It was found that samples stored at room temperature in the dark for over 200 days could still yield DNA suitable for PCR amplification and polymorphism detection. Conclusion These findings suggest that valuable molecular genetic data may be obtained from tissues that have not been treated or stored under optimal field conditions. Furthermore, it is clear that the lack of adequately low temperatures during transport and long term storage should not be a barrier to anyone wishing to engage in field-based molecular genetic research. PMID:16734898

  16. Description of a computer program to calculate reacting supersonic internal flow fields with shock waves using viscous characteristics: Program manual and sample calculations

    NASA Technical Reports Server (NTRS)

    Cavalleri, R. J.; Agnone, A. M.

    1972-01-01

    A computer program for calculating internal supersonic flow fields with chemical reactions and shock waves typical of supersonic combustion chambers with either wall or mid-stream injectors is described. The usefulness and limitations of the program are indicated. The program manual and listing are presented along with a sample calculation.

  17. Chronically indwelling venous cannula and automatic blood sampling system for use with nonhuman primates exposed to 60 Hz electric and magnetic fields

    SciTech Connect

    Rogers, W.R.; Lucas, J.H.; Smith, H.D.; Orr, J.L.; Mikiten, B.C.

    1995-12-31

    An automated blood sampling system was developed for use with tethered baboons (Papio cynocephalus) during concurrent exposure to 60 Hz 30 kV/m electric fields and 0.1 mT (1.0 G) magnetic fields. The system was controlled by a FORTH-based microcomputer, which operated a pump, a fraction collector, and two pinch valves. A swivel mechanism at the end of the tether allowed the baboons to move freely in their cages. The hardware and software were designed for fail-safe operation. Heparinized saline was infused at a rate of 0.5 ml/min until a sample cycle was initiated. Then, blood was drawn from the animal into a storage tube at a rate of 12.5 ml/min, a sample of undiluted blood was taken from the end of the storage tube near the baboon, and the blood remaining in the storage tube was then flushed back into the animal. Use of the storage tube prevented the peristaltic pump rollers from pressing on tubing containing blood, and return of the blood diluted with saline limited the blood wasted per sample to less than 0.5 ml. The system functioned reliably in three experiments, collecting samples as scheduled 97% of the time. Although it was initially designed for and used successfully with primates in an electric and magnetic field environment, this type of system could be employed in many areas of biomedical research or medical treatment.

  18. Cropland Field Monitoring: MMV Page 1 Montana Cropland Enrolled Farm Fields Carbon Sequestration Field Sampling, Measurement, Monitoring, and Verification: Application of Visible-Near Infrared Diffuse Reflectance Spectroscopy (VNIR) and Laser-induced Breakdown Spectroscopy (LIBS)

    SciTech Connect

    Lee Spangler; Ross Bricklemyer; David Brown

    2012-03-15

    There is growing need for rapid, accurate, and inexpensive methods to measure, and verify soil organic carbon (SOC) change for national greenhouse gas accounting and the development of a soil carbon trading market. Laboratory based soil characterization typically requires significant soil processing, which is time and resource intensive. This severely limits application for large-region soil characterization. Thus, development of rapid and accurate methods for characterizing soils are needed to map soil properties for precision agriculture applications, improve regional and global soil carbon (C) stock and flux estimates and efficiently map sub-surface metal contamination, among others. The greatest gains for efficient soil characterization will come from collecting soil data in situ, thus minimizing soil sample transportation, processing, and lab-based measurement costs. Visible and near-infrared diffuse reflectance spectroscopy (VisNIR) and laser-induced breakdown spectroscopy (LIBS) are two complementary, yet fundamentally different spectroscopic techniques that have the potential to meet this need. These sensors have the potential to be mounted on a soil penetrometer and deployed for rapid soil profile characterization at field and landscape scales. Details of sensor interaction, efficient data management, and appropriate statistical analysis techniques for model calibrations are first needed. In situ or on-the-go VisNIR spectroscopy has been proposed as a rapid and inexpensive tool for intensively mapping soil texture and organic carbon (SOC). While lab-based VisNIR has been established as a viable technique for estimating various soil properties, few experiments have compared the predictive accuracy of on-the-go and lab-based VisNIR. Eight north central Montana wheat fields were intensively interrogated using on-the-go and lab-based VisNIR. Lab-based spectral data consistently provided more accurate predictions than on-the-go data. However, neither in situ

  19. Field-adapted sampling of whole blood to determine the levels of amodiaquine and its metabolite in children with uncomplicated malaria treated with amodiaquine plus artesunate combination

    PubMed Central

    Ntale, Muhammad; Obua, Celestino; Mukonzo, Jackson; Mahindi, Margarita; Gustafsson, Lars L; Beck, Olof; Ogwal-Okeng, Jasper W

    2009-01-01

    Background Artemisinin combination therapy (ACT) has been widely adopted as first-line treatment for uncomplicated falciparum malaria. In Uganda, amodiaquine plus artesunate (AQ+AS), is the alternative first-line regimen to Coartem® (artemether + lumefantrine) for the treatment of uncomplicated falciparum malaria. Currently, there are few field-adapted analytical techniques for monitoring amodiaquine utilization in patients. This study evaluates the field applicability of a new method to determine amodiaquine and its metabolite concentrations in whole blood dried on filter paper. Methods Twelve patients aged between 1.5 to 8 years with uncomplicated malaria received three standard oral doses of AQ+AS. Filter paper blood samples were collected before drug intake and at six different time points over 28 days period. A new field-adapted sampling procedure and liquid chromatographic method was used for quantitative determination of amodiaquine and its metabolite in whole blood. Results The sampling procedure was successively applied in the field. Amodiaquine could be quantified for at least three days and the metabolite up to 28 days. All parasites in all the 12 patients cleared within the first three days of treatment and no adverse drug effects were observed. Conclusion The methodology is suitable for field studies. The possibility to determine the concentration of the active metabolite of amodiaquine up to 28 days suggested that the method is sensitive enough to monitor amodiaquine utilization in patients. Amodiaquine plus artesunate seems effective for treatment of falciparum malaria. PMID:19331684

  20. Quantifying actual and theoretical ethanol yields for switchgrass strains using NIRS analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantifying actual and theoretical ethanol yields from biomass conversion processes such as simultanteous saccharification and fermentation (SSF) requires expensive, complex fermentation assays and extensive compositional analyses of the biomass sample. Near infrared reflectance spectroscopy (NIRS...

  1. On-line concentration of neutral analytes for micellar electrokinetic chromatography. 5. Field-enhanced sample injection with reverse migrating micelles.

    PubMed

    Quirino, J P; Terabe, S

    1998-05-01

    Elementary conditions for the on-line concentration of neutral analytes by field-enhanced sample injection with reverse migrating micelles for micellar electrokinetic chromatography is presented. Acidic phosphate buffers containing micelles of sodium dodecyl sulfate are utilized as both sample solvent and separation solution. After the capillary is conditioned with a separation solution, a water plug is hydrodynamically injected to achieve field enhancement at the injection end of the capillary during injection by application of voltage. A model is provided to give insight into the stacking scheme. Significant detector response improvements are confirmed experimentally. Moreover, utility of the technique for the analysis of a real sample is tested using urine spiked with testosterone and progesterone. PMID:21651282

  2. The Actual Apollo 13 Prime Crew

    NASA Technical Reports Server (NTRS)

    1970-01-01

    The actual Apollo 13 lunar landing mission prime crew from left to right are: Commander, James A. Lovell Jr., Command Module pilot, John L. Swigert Jr.and Lunar Module pilot, Fred W. Haise Jr. The original Command Module pilot for this mission was Thomas 'Ken' Mattingly Jr. but due to exposure to German measles he was replaced by his backup, Command Module pilot, John L. 'Jack' Swigert Jr.

  3. Assessment of the Minimum Sampling Frequency to Avoid Measurement Redundancy in Microclimate Field Surveys in Museum Buildings.

    PubMed

    García-Diego, Fernando-Juan; Verticchio, Elena; Beltrán, Pedro; Siani, Anna Maria

    2016-01-01

    Monitoring temperature and relative humidity of the environment to which artefacts are exposed is fundamental in preventive conservation studies. The common approach in setting measuring instruments is the choice of a high sampling rate to detect short fluctuations and increase the accuracy of statistical analysis. However, in recent cultural heritage standards the evaluation of variability is based on moving average and short fluctuations and therefore massive acquisition of data in slowly-changing indoor environments could end up being redundant. In this research, the sampling frequency to set a datalogger in a museum room and inside a microclimate frame is investigated by comparing the outcomes obtained from datasheets associated with different sampling conditions. Thermo-hygrometric data collected in the Sorolla room of the Pio V Museum of Valencia (Spain) were used and the widely consulted recommendations issued in UNI 10829:1999 and EN 15757:2010 standards and in the American Society of Heating, Air-Conditioning and Refrigerating Engineers (ASHRAE) guidelines were applied. Hourly sampling proved effective in obtaining highly reliable results. Furthermore, it was found that in some instances daily means of data sampled every hour can lead to the same conclusions as those of high frequency. This allows us to improve data logging design and manageability of the resulting datasheets. PMID:27537886

  4. Sampling blood from big brown bats (Eptesicus fuscus) in the field with and without anesthesia: Impacts on survival

    USGS Publications Warehouse

    Ellison, L.E.; O'Shea, T.J.; Wimsatt, J.; Pearce, R.D.; Neubaum, D.J.; Neubaum, M.A.; Bowen, R.A.

    2006-01-01

    Blood was collected from wild big brown bats (Eptesicus fuscus) with and without anesthesia in Fort Collins, Colorado in 2004 to assess the impacts of these procedures on short-term survival and 1-yr return rates. Short-term survival and 1-yr return rates after release were passively monitored using PIT tag detection hoops placed at selected buildings. Comparison of 14-day maximum likelihood survival estimates from bats not bled (142 adult females, 62 volant juveniles), and bats sampled for blood with anesthesia (96 adult females, 23 volant juveniles) and without anesthesia (112 adult females, 22 volant juveniles) indicated no adverse effects of either treatment (juveniles: X2=53.38, df=41, P=0.09; adults: X2=39.09, df=44, P=0.68). Return rates of bats one year after sampling were similar among adult female controls (75.4%, n=142, 95% CI=67.4-82.2%), females sampled for blood with anesthesia (83.0%, n=112, 95% CI=74.8-89.5%), and females sampled without anesthesia (87.5%, n=96, 95% CI=79.2-93.4%). Lack of an effect was also noted in 1-yr return rates of juvenile females. These data suggest that the use of anesthesia during sampling of blood has no advantages in terms of enhancement of survival in big brown bats. ?? Wildlife Disease Association 2006.

  5. From the field: Efficacy of detecting Chronic Wasting Disease via sampling hunter-killed white-tailed deer

    USGS Publications Warehouse

    Diefenbach, D.R.; Rosenberry, C.S.; Boyd, Robert C.

    2004-01-01

    Surveillance programs for Chronic Wasting Disease (CWD) in free-ranging cervids often use a standard of being able to detect 1% prevalence when determining minimum sample sizes. However, 1% prevalence may represent >10,000 infected animals in a population of 1 million, and most wildlife managers would prefer to detect the presence of CWD when far fewer infected animals exist. We wanted to detect the presence of CWD in white-tailed deer (Odocoileus virginianus) in Pennsylvania when the disease was present in only 1 of 21 wildlife management units (WMUs) statewide. We used computer simulation to estimate the probability of detecting CWD based on a sampling design to detect the presence of CWD at 0.1% and 1.0% prevalence (23-76 and 225-762 infected deer, respectively) using tissue samples collected from hunter-killed deer. The probability of detection at 0.1% prevalence was <30% with sample sizes of ???6,000 deer, and the probability of detection at 1.0% prevalence was 46-72% with statewide sample sizes of 2,000-6,000 deer. We believe that testing of hunter-killed deer is an essential part of any surveillance program for CWD, but our results demonstrated the importance of a multifaceted surveillance approach for CWD detection rather than sole reliance on testing hunter-killed deer.

  6. Denser Sampling of the Rosette Nebula with Faraday Rotation Measurements: Improved Estimates of Magnetic Fields in H II Regions

    NASA Astrophysics Data System (ADS)

    Costa, Allison H.; Spangler, Steven R.; Sink, Joseph R.; Brown, Shea; Mao, Sui Ann

    2016-04-01

    We report Faraday rotation measurements of 11 extragalactic radio sources with lines of sight through the Rosette Nebula, a prominent H ii region associated with the star cluster NGC 2244. The goal of these measurements is to better determine the strength and structure of the magnetic field in the nebula. We calculate the rotation measure (RM) through two methods, a least-squares fit to χ ({λ }2) and Rotation Measure Synthesis. In conjunction with our results from Savage et al., we find an excess RM due to the shell of the nebula of +40 to +1200 rad m-2 above a background RM of +147 rad m-2. We discuss two forms of a simple shell model intended to reproduce the magnitude of the observed RM as a function of distance from the center of the Rosette Nebula. The models represent different physical situations for the magnetic field within the shell of the nebula. The first assumes that there is an increase in the magnetic field strength and plasma density at the outer radius of the H ii region, such as would be produced by a strong magnetohydrodynamic shock wave. The second model assumes that any increase in the RM is due solely to an increase in the density, and the Galactic magnetic field is unaffected in the shell. We employ a Bayesian analysis to compare the two forms of the model. The results of this analysis were inconclusive, although the model without amplification of the interstellar magnetic field is weakly favored.

  7. A General Assignment Method for Oriented Sample (OS) Solid-state NMR of Proteins Based on The Correlation of Resonances through Heteronuclear Dipolar Couplings in Samples Aligned Parallel and Perpendicular to the Magnetic Field

    PubMed Central

    Lu, George J.; Son, Woo Sung; Opella, Stanley J.

    2011-01-01

    A general method for assigning oriented sample (OS) solid-state NMR spectra of proteins is demonstrated. In principle, this method requires only a single sample of a uniformly 15N-labeled membrane protein in magnetically aligned bilayers, and a previously assigned isotropic chemical shift spectrum obtained either from solution NMR on micelle or isotropic bicelle samples or from magic angle spinning (MAS) solid-state NMR on unoriented proteoliposomes. The sequential isotropic resonance assignments are transferred to the OS solid-state NMR spectra of aligned samples by correlating signals from the same residue observed in protein-containing bilayers aligned with their normals parallel and perpendicular to the magnetic field. The underlying principle is that the resonances from the same residue have heteronuclear dipolar couplings that differ by exactly a factor of two between parallel and perpendicular alignments. The method is demonstrated on the membrane-bound form of Pf1 coat protein in phospholipid bilayers, whose assignments have been previously made using an earlier generation of methods that relied on the preparation of many selectively labeled (by residue type) samples. The new method provides the correct resonance assignments using only a single uniformly 15N-labeled sample, two solid-state NMR spectra, and a previously assigned isotropic spectrum. Significantly, this approach is equally applicable to residues in alpha helices, beta sheets, loops, and any other elements of tertiary structure. Moreover, the strategy bridges between OS solid-state NMR of aligned samples and solution NMR or MAS solid-state NMR of unoriented samples. In combination with the development of complementary experimental methods, it provides a step towards unifying these apparently different NMR approaches. PMID:21316275

  8. A strip-shield improves the efficiency of a solenoid coil in probes for high field solid-state NMR of lossy biological samples

    PubMed Central

    Wu, Chin H.; Grant, Christopher V.; Cook, Gabriel A.; Park, Sang Ho; Opella, Stanley J.

    2009-01-01

    A strip-shield inserted between a high inductance double-tuned solenoid coil and the glass tube containing the sample improves the efficiency of probes used for high-field solid-state NMR experiments on lossy aqueous samples of proteins and other biopolymers. A strip-shield is a coil liner consisting of thin copper strips layered on a PTFE (polytetrafluoroethylene) insulator. With lossy samples, the shift in tuning frequency is smaller, the reduction in Q, and RF-induced heating are all significantly reduced when the strip-shield is present. The performance of 800 MHz 1H/15N and 1H/13C double-resonance probes is demonstrated on aqueous samples of membrane proteins in phospholipid bilayers. PMID:19559634

  9. Comparison of Precision of Biomass Estimates in Regional Field Sample Surveys and Airborne LiDAR-Assisted Surveys in Hedmark County, Norway

    NASA Technical Reports Server (NTRS)

    Naesset, Erik; Gobakken, Terje; Bollandsas, Ole Martin; Gregoire, Timothy G.; Nelson, Ross; Stahl, Goeran

    2013-01-01

    Airborne scanning LiDAR (Light Detection and Ranging) has emerged as a promising tool to provide auxiliary data for sample surveys aiming at estimation of above-ground tree biomass (AGB), with potential applications in REDD forest monitoring. For larger geographical regions such as counties, states or nations, it is not feasible to collect airborne LiDAR data continuously ("wall-to-wall") over the entire area of interest. Two-stage cluster survey designs have therefore been demonstrated by which LiDAR data are collected along selected individual flight-lines treated as clusters and with ground plots sampled along these LiDAR swaths. Recently, analytical AGB estimators and associated variance estimators that quantify the sampling variability have been proposed. Empirical studies employing these estimators have shown a seemingly equal or even larger uncertainty of the AGB estimates obtained with extensive use of LiDAR data to support the estimation as compared to pure field-based estimates employing estimators appropriate under simple random sampling (SRS). However, comparison of uncertainty estimates under SRS and sophisticated two-stage designs is complicated by large differences in the designs and assumptions. In this study, probability-based principles to estimation and inference were followed. We assumed designs of a field sample and a LiDAR-assisted survey of Hedmark County (HC) (27,390 km2), Norway, considered to be more comparable than those assumed in previous studies. The field sample consisted of 659 systematically distributed National Forest Inventory (NFI) plots and the airborne scanning LiDAR data were collected along 53 parallel flight-lines flown over the NFI plots. We compared AGB estimates based on the field survey only assuming SRS against corresponding estimates assuming two-phase (double) sampling with LiDAR and employing model-assisted estimators. We also compared AGB estimates based on the field survey only assuming two-stage sampling (the NFI

  10. LABORATORY ASSESSMENT OF THE PERMEABILITY AND DIFFUSION CHARACTERISTICS OF FLORIDA CONCRETES: PHASE II. FIELD SAMPLES AND ANALYSES

    EPA Science Inventory

    The report gives results of a study to: (1) establish the capability of measuring concrete's permeability and diffusivity, (2) measure these parameters in a small sampling of the typical types of Florida concrete, and (3) if possible, correlate the physical parameters of the conc...

  11. COMPARISON OF PORTABLE GAS CHROMATOGRAPHS AND PASSIVATED CANISTERS FOR FIELD SAMPLING AIRBORNE TOXIC ORGANIC VAPORS IN USA AND USSR

    EPA Science Inventory

    Collection of samples in passivated canisters is widely used for analysis of trace volatile organic compounds in air because a preconcentration step is usually required prior to analysis. ample integrity can be compromised by deterioration or artifact formation during storage and...

  12. Use of novel RT-PCR assay to detect picobirnavirus in Poultry Intestinal samples collected from the field

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent metagenomic analyses of the turkey gut ribonucleic acid (RNA) virus community in our laboratory have identified novel enteric RNA viruses that may play roles in the poultry enteric diseases and in performance problems noted in the field. This has lead to new molecular diagnostic assays for ce...

  13. A COMPARISON OF LIQUID AND GAS-PHASE PHOTOOXIDATION TREATMENT OF METHYL TERTIARY BUTYL ETHER: SYNTHETIC AND FIELD SAMPLES

    EPA Science Inventory

    The feasibility of photo-oxidation treatment of metyl tert-butyl either (MTBE) in water was investigated using two systems, 1) a slurry falling film photo-reactor, and 2) an integrated air-stripping with gas phase photooxidation system. MTBE-contaminated synthetic water and field...

  14. Spatial characteristics of white mould epidemics and the development of sequential sampling plans in Australian bean fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mould, caused by Sclerotinia sclerotiorum, causes losses to bean through reducing the marketable yield of pods by flower infections and stem rot. In Australia, entire fields may be rejected due to high disease incidence. The spatial characteristics of white mould epidemics were characterised...

  15. Evaluation of sampling methodology for determining the population dynamics of onion thrips (Thysanoptera: Thripidae) in Ontario onion fields.

    PubMed

    MacIntyre-Allen, J K; Scott-Dupree, C D; Tolman, J H; Harris, C R

    2005-12-01

    Onion thrips, Thrips tabaci Lindeman, are an economic pest of alliums worldwide. In Ontario onion-growing regions, seasonal abundance and population trends of onion thrips are not well known. The objectives of this research were to investigate onion thrips population dynamics by using both white sticky traps and plant counts, to gain insight into flight height, and to determine the genus and sex of thrips fauna present in monitored fields. Adult thrips were captured on white sticky traps placed in two commercial onion fields in the Thedford-Grand Bend Marsh region as early as mid-May in 2001, 2002, and 2003. Thrips were not recorded on onion plants in these fields until late June and early July. A comparison of sticky trap captures to plant counts revealed a strong, positive correlation, indicating that sticky traps, which consistently detected thrips earlier than plant counts, could be used instead of plant counts early in the season to monitor onion thrips populations. Pole traps placed in onion and an adjacent soybean, Glycine max (L.) Merr., field revealed that regardless of crop type, most thrips were captured 0.7-0.95 m above the soil surface. During this study, 70% of 137,000 thrips captured on sticky traps and 89% of 1,482 thrips captured in pan traps were female onion thrips. No male onion thrips were identified in this study: most of the remaining thrips were Frankliniella spp. PMID:16539160

  16. Testing the application of Teflon/quartz soil solution samplers for DOM sampling in the Critical Zone: Field and laboratory approaches

    NASA Astrophysics Data System (ADS)

    Dolan, E. M.; Perdrial, J. N.; Vazquez, A.; Hernández, S.; Chorover, J.

    2010-12-01

    Elizabeth Dolan1,2, Julia Perdrial3, Angélica Vázquez-Ortega3, Selene Hernández-Ruiz3, Jon Chorover3 1Deptartment of Soil, Environmental, and Atmospheric Science, University of Missouri. 2Biosphere 2, University of Arizona. 3Deptartment of Soil, Water, and Environmental Science, University of Arizona. Abstract: The behavior of dissolved organic matter (DOM) in soil is important to many biogeochemical processes. Extraction methods to obtain DOM from the unsaturated zone remain a current focus of research as different methods can influence the type and concentration of DOM obtained. Thus, the present comparison study involves three methods for soil solution sampling to assess their impact on DOM quantity and quality: 1) aqueous soil extracts, 2) solution yielded from laboratory installed suction cup samplers and 3) solutions from field installed suction cup samplers. All samples were analyzed for dissolved organic carbon and total nitrogen concentrations. Moreover, DOM quality was analyzed using fluorescence, UV-Vis and FTIR spectroscopies. Results indicate higher DOC values for laboratory extracted DOM: 20 mg/L for aqueous soil extracts and 31 mg/L for lab installed samplers compared to 12 mg/L for field installed samplers. Large variations in C/N ratios were also observed ranging from 1.5 in laboratory extracted DOM to 11 in field samples. Fluorescence excitation-emission matrices of DOM solutions obtained for the laboratory extraction methods showed higher intensities in regions typical for fulvic and humic acid-like materials relative to those extracted in the field. Similarly, the molar absorptivity calculated from DOC concentration normalization of UV-Vis absorbance of the laboratory-derived solutions was significantly higher as well, indicating greater aromaticity. The observed differences can be attributed to soil disturbance associated with obtaining laboratory derived solution samples. Our results indicate that laboratory extraction methods are not

  17. Use of depuration compounds in passive air samplers: results from active sampling-supported field deployment, potential uses, and recommendations.

    PubMed

    Moeckel, Claudia; Harner, Tom; Nizzetto, Luca; Strandberg, Bo; Lindroth, Anders; Jones, Kevin C

    2009-05-01

    Depuration compounds (DCs) are added to passive air samplers (PAS) prior to deployment to account for the wind-dependency of the sampling rate for gas-phase compounds. This correction is particularly useful for providing comparable data for samplers that are deployed in different environments and subject to different meteorological conditions such as wind speeds. Two types of PAS--the polyurethane foam (PUF) disk sampler and semipermeable membrane devices (SPMDs)--were deployed at eight heights on a 100 m tower to test whether the DC approach could yield air concentrations profiles for PCBs and organochlorine pesticides and account for the wind speed gradient with height. Average wind speeds ranged from 0.3 to 4.5 m s(-1) over the 40 day deployment, increasing with height Two low volume active air samples (AAS), one collected at 25 m and one at 73 m over the 40 day deployment showed no significant concentration differences for target compounds. As expected, the target compounds taken up by PAS reflected the wind profile with height This wind-dependency of the PAS was also reflected in the results of the DCs. A correction based on the DC approach successfully accounted for the effect of wind on PAS sampling rates, yielding a profile consistent with the AAS. Interestingly, in terms of absolute air concentrations, there were differences between the AAS and PAS-derived values for some target compounds. These were attributed to different sampling characteristics of the two approaches that may have resulted in slightly different air masses being sampled. Based on the results of this study, guidelines are presented for the use of DCs and for the calibration of PAS using AAS. PMID:19534139

  18. Geomapping generalized eigenvalue frequency distributions for predicting prolific Aedes albopictus and Culex quinquefasciatus habitats based on spatiotemporal field-sampled count data.

    PubMed

    Jacob, Benjamin G; Morris, Joel A; Caamano, Erick X; Griffith, Daniel A; Novak, Robert J

    2011-02-01

    Marked spatiotemporal variabilities in mosquito infection of arboviruses require adaptive strategies for determining optimal field-sampling timeframes, pool screening, and data analyses. In particular, the error distribution and aggregation patterns of adult arboviral mosquitoes can vary significantly by species, which can statistically bias analyses of spatiotemporal-sampled predictor variables generating misinterpretation of prolific habitat surveillance locations. Currently, there is a lack of reliable and consistent measures of risk exposure based on field-sampled georeferenced explanatory covariates which can compromise quantitative predictions generated from arboviral mosquito surveillance models for implementing larval control strategies targeting productive habitats. In this research we used spatial statistics and QuickBird visible and near-infra-red data for determining trapping sites that were related to Culex quinquefasciatus and Aedes albopictus species abundance and distribution in Birmingham, Alabama. Initially, a Land Use Land Cover (LULC) model was constructed from multiple spatiotemporal-sampled georeferenced predictors and the QuickBird data. A Poisson regression model with a non-homogenous, gamma-distributed mean then decomposed the data into positive and negative spatial filter eigenvectors. An autoregressive process in the error term then was used to derive the sample distribution of the Moran's I statistic for determining latent autocorrelation components in the model. Spatial filter algorithms established means, variances, distributional functions, and pairwise correlations for the predictor variables. In doing so, the eigenfunction spatial filter quantified the residual autocorrelation error in the mean response term of the model as a linear combination of various distinct Cx. quinquefasciatus and Ae. albopictus habitat map patterns. The analyses revealed 18-27% redundant information in the data. Prolific habitats of Cx. quinquefasciatus and

  19. Comparison of Two Techniques to Calculate Methane Oxidation rates in Samples Obtained From the Hudson Canyon Seep Field in the North Atlantic

    NASA Astrophysics Data System (ADS)

    Leonte, M.; Kessler, J. D.; Chepigin, A.; Kellermann, M. Y.; Arrington, E.; Valentine, D. L.; Sylva, S.

    2014-12-01

    Aerobic methane oxidation, or methanotrophy, is the dominant process by which methane is removed from the water column in oceanic environments. Therefore, accurately quantifying methane oxidation rates is crucial when constructing methane budgets on a local or global scale. Here we present a comparison of two techniques used to determine methane oxidation rates based on samples obtained over the Hudson Canyon seep field in the North Atlantic. Traditional methane oxidation rate measurements require inoculation of water samples with isotopically labeled methane and tracking the changes to methane concentrations and isotopes as the samples are incubated. However, the addition of methane above background levels is thought to increase the potential for methane oxidation in the sample. A new technique to calculate methane oxidation rates is based on kinetic isotope models and incorporates direct measurements of methane concentrations, methane 13C isotopes, and water current velocity. Acoustic instrumentation (ADCP) aboard the R/V Endeavor was used to obtain water current velocity data while water samples were collected for methane concentration and isotopic ratio analysis. Methane δ13C measurements allow us to attribute changes in methane concentration to either water dispersion or bacterial methane oxidation. The data obtained from this cruise will tell us a comprehensive story of methane removal processes from this active seep field. The kinetic isotope models will allow us to estimate the total flux of methane from the seep site and calculate methane oxidation rates at different depths and locations away from seafloor plumes.

  20. Design and evaluation of a field study on the contamination of selected volatile organic compounds and wastewater-indicator compounds in blanks and groundwater samples

    USGS Publications Warehouse

    Thiros, Susan A.; Bender, David A.; Mueller, David K.; Rose, Donna L.; Olsen, Lisa D.; Martin, Jeffrey D.; Bernard, Bruce; Zogorski, John S.

    2011-01-01

    The Field Contamination Study (FCS) was designed to determine the field processes that tend to result in clean field blanks and to identify potential sources of contamination to blanks collected in the field from selected volatile organic compounds (VOCs) and wastewater-indicator compounds (WICs). The VOCs and WICs analyzed in the FCS were detected in blanks collected by the U.S. Geological Survey (USGS) National Water-Quality Assessment (NAWQA) Program during 1996-2008 and 2002-08, respectively. To minimize the number of variables, the study required ordering of supplies just before sampling, storage of supplies and equipment in clean areas, and use of adequate amounts of purge-and-trap volatile-grade methanol and volatile pesticide-grade blank water (VPBW) to clean sampling equipment and to collect field blanks. Blanks and groundwater samples were collected during 2008-09 at 16 sites, which were a mix of water-supply and monitoring wells, located in 9 States. Five different sample types were collected for the FCS at each site: (1) a source-solution blank collected at the USGS National Water Quality Laboratory (NWQL) using laboratory-purged VPBW, (2) source-solution blanks collected in the field using laboratory-purged VPBW, (3) source-solution blanks collected in the field using field-purged VPBW, (4) a field blank collected using field-purged VPBW, and (5) a groundwater sample collected from a well. The source-solution blank and field-blank analyses were used to identify, quantify, and document extrinsic contamination and to help determine the sources and causes of data-quality problems that can affect groundwater samples. Concentrations of compounds detected in FCS analyses were quantified and results were stored in the USGS National Water Information System database after meeting rigorous identification and quantification criteria. The study also utilized information provided by laboratory analysts about evidence indicating the presence of selected compounds

  1. Field-enhanced sample injection micelle-to-solvent stacking capillary zone electrophoresis-electrospray ionization mass spectrometry of antibiotics in seawater after solid-phase extraction.

    PubMed

    Wuethrich, Alain; Haddad, Paul R; Quirino, Joselito P

    2016-05-01

    The synergistic stacking approach of field-enhanced sample injection-micelle-to-solvent stacking was used for high sensitivity CZE-ESI-MS of eight penicillins and sulfonamides. Sensitivity enhancement factors (peak height) were 1629-3328 compared to typical injection, with LODs from 0.11 to 0.55 ng/mL. The analytical figures of merit were acceptable. SPE on a fortified seawater sample resulted in 50-fold enrichment with recoveries of 85-110%. The overall method LODs were 0.002-0.011 ng/mL. PMID:27135307

  2. Development of a Multiplexed, Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples. Final Report

    SciTech Connect

    Lowe, M.; Halden, R.

    2002-10-09

    This was the final report for DOE NABIR grant DE-FG02-01ER63264 (PI Mary Lowe). The grant was entitled ''Development of a Multiplexed Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples.'' The grant duration was one year. The purpose was to develop a bead-based assay for measuring analyte DNAs in environmental PCR products and to apply the method to a field experiment. The primary experiment was located at the UMTRA Old Rifle site.

  3. Air resistance measurements on actual airplane parts

    NASA Technical Reports Server (NTRS)

    Weiselsberger, C

    1923-01-01

    For the calculation of the parasite resistance of an airplane, a knowledge of the resistance of the individual structural and accessory parts is necessary. The most reliable basis for this is given by tests with actual airplane parts at airspeeds which occur in practice. The data given here relate to the landing gear of a Siemanms-Schuckert DI airplane; the landing gear of a 'Luftfahrzeug-Gesellschaft' airplane (type Roland Dlla); landing gear of a 'Flugzeugbau Friedrichshafen' G airplane; a machine gun, and the exhaust manifold of a 269 HP engine.

  4. Laboratory validation and field verification of a new passive colorimetric air monitoring badge for sampling hydrogen sulfide in air.

    PubMed

    Kring, E V; Damrell, D J; Henry, T J; DeMoor, H M; Basilio, A N; Simon, C E

    1984-01-01

    The Pro-Tek passive colorimetric air monitoring badge for personal or area sampling of hydrogen sulfide is described. The badge has been validated over the range of 1.8 to 164 ppm-hours (0.23-21 ppm on an 8-hour TWA basis). It has an overall accuracy throughout this range of +/- 15.9% and meets the NIOSH accuracy criteria for an analytical and sampling method. The colorimetric analytical method used is based on the Texas Air Control Board's Molybdenum Blue method. Color-activated exposed badge solutions are read out on a standard laboratory spectrophotometer using 1 centimeter (10 mm) cells. Variations in exposure temperature (between 10 degrees and 40 degrees C), relative humidity, and face velocity (between 2 and 250 ft/min) do not affect badge performance. Unexposed badges are stable for more than 12 months refrigerated and for two months at room temperature. PMID:6702591

  5. High-field, hyperpolarized Xe-129 NMR: Preparation and transfer of pure spin-polarized xenon gas to the sample.

    NASA Astrophysics Data System (ADS)

    Patton, B.; Sachs, D. B.; Kuzma, N. N.; Lisitza, N. V.; Happer, W.

    2003-03-01

    Hyperpolarized ^129Xe has already found extensive applications in magnetic resonance imaging(M. S. Albert et al., Nature 370, 199 (1994)) and nuclear magnetic resonance spectroscopy(J. P. Mugler, et al., Magn. Reson. Med. 37, 809 (1997)). Using hyperpolarized xenon in high-field NMR spectroscopy opens up new prospects for medical diagnostics of many pathologies and disorders(R. K. Mazitov, et al., Doklady Biophysics 364-366, 28-31 (1999)). Here we present a new set-up for production(N. N. Kuzma, et al., Phys. Rev. Lett. 88, 147602 (2002)), delivery, and temporary storage of pure hyperpolarized xenon gas for high-field (9.4T) NMR spectroscopy, with an emphasis on in-situ monitoring of ^129Xe polarization along the gas flow path and using a 1.1 T permanent magnet for cryogenic separation of hyperpolarized xenon from the buffer gases.

  6. PACSAB: Coarse-Grained Force Field for the Study of Protein-Protein Interactions and Conformational Sampling in Multiprotein Systems.

    PubMed

    Emperador, Agustí; Sfriso, Pedro; Villarreal, Marcos Ariel; Gelpí, Josep Lluis; Orozco, Modesto

    2015-12-01

    Molecular dynamics simulations of proteins are usually performed on a single molecule, and coarse-grained protein models are calibrated using single-molecule simulations, therefore ignoring intermolecular interactions. We present here a new coarse-grained force field for the study of many protein systems. The force field, which is implemented in the context of the discrete molecular dynamics algorithm, is able to reproduce the properties of folded and unfolded proteins, in both isolation, complexed forming well-defined quaternary structures, or aggregated, thanks to its proper evaluation of protein-protein interactions. The accuracy and computational efficiency of the method makes it a universal tool for the study of the structure, dynamics, and association/dissociation of proteins. PMID:26597989

  7. Investigating temporal field sampling strategies for site-specific calibration of three soil moisture - neutron intensity parameterisation methods

    NASA Astrophysics Data System (ADS)

    Iwema, J.; Rosolem, R.; Baatz, R.; Wagener, T.; Bogena, H. R.

    2015-02-01

    The Cosmic-Ray Neutron Sensor (CRNS) can provide soil moisture information at scales relevant to hydrometeorological modeling applications. Site-specific calibration is needed to translate CRNS neutron intensities into sensor footprint average soil moisture contents. We investigated temporal sampling strategies for calibration of three CRNS parameterisations (modified N0, HMF, and COSMIC) by assessing the effects of the number of sampling days and soil wetness conditions on the performance of the calibration results, for three sites with distinct climate and land use: a semi-arid site, a temperate grassland and a temperate forest. When calibrated with a year of data, COSMIC performed relatively good at all three sites, and the modified N0 method performed best at the two humid sites. It is advisable to collect soil moisture samples on more than a single day regardless of which parameterisation is used. In any case, sampling on more than ten days would, despite the strong increase in work effort, improve calibration results only little. COSMIC needed the least number of days at each site. At the semi-arid site, the N0mod method was calibrated better under average wetness conditions, whereas HMF and COSMIC were calibrated better under drier conditions. Average soil wetness condition gave better calibration results at the two humid sites. The calibration results for the HMF method were better when calibrated with combinations of days with similar soil wetness conditions, opposed to N0mod and COSMIC, which profited from using days with distinct wetness conditions. The outcomes of this study can be used by researchers as a CRNS calibration strategy guideline.

  8. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  9. VMAT vs. 7-Field-IMRT: Assessing the Dosimetric Parameters of Prostate Cancer Treatment with a 292-Patient Sample

    SciTech Connect

    Kopp, Robert W.; Duff, Michael; Catalfamo, Frank; Shah, Dhiren; Rajecki, Michael; Ahmad, Kehkashan

    2011-01-01

    We compared normal tissue radiation dose for the treatment of prostate cancer using 2 different radiation therapy delivery methods: volumetric modulated arc therapy (VMAT) vs. fixed-field intensity-modulated radiation therapy (IMRT). Radiotherapy plans for 292 prostate cancer patients treated with VMAT to a total dose of 7740 cGy were analyzed retrospectively. Fixed-angle, 7-field IMRT plans were created using the same computed tomography datasets and contours. Radiation doses to the planning target volume (PTV) and organs at risk (bladder, rectum, penile bulb, and femoral heads) were measured, means were calculated for both treatment methods, and dose-volume comparisons were made with 2-tailed, paired t-tests. The mean dose to the bladder was lower with VMAT at all measured volumes: 5, 10, 15, 25, 35, and 50% (p < 0.05). The mean doses to 5 and 10% of the rectum, the high-dose regions, were lower with VMAT (p < 0.05). The mean dose to 15% of the rectal volume was not significantly different (p = 0.95). VMAT exposed larger rectal volumes (25, 35, and 50%) to more radiation than fixed-field IMRT (p < 0.05). Average mean dose to the penile bulb (p < 0.05) and mean dose to 10% of the femoral heads (p < 0.05) were lower with VMAT. VMAT therapy for prostate cancer has dosimetric advantages for critical structures, notably for high-dose regions compared with fixed-field IMRT, without compromising PTV coverage. This may translate into reduced acute and chronic toxicity.

  10. Development of a quantitative real-time PCR for the detection of Tenacibaculum maritimum and its application to field samples.

    PubMed

    Fringuelli, E; Savage, P D; Gordon, A; Baxter, E J; Rodger, H D; Graham, D A

    2012-08-01

    The development and the application of a quantitative real-time PCR for the detection of Tenacibaculum maritimum are described. A set of primers and probe was designed to amplify a 155-bp fragment specific to the T. maritimum 16S rRNA gene. The test was shown to be very sensitive, able to detect as little as 4.8 DNA copies number μL(-1) . In addition, the assay was found to have a high degree of repeatability and reproducibility, with a linear dynamic range (R(2)  = 0.999) extending over 6 log(10) dilutions and a high efficiency (100%). The assay was applied to DNA samples extracted from 48 formalin-fixed paraffin-embedded (FFPE) Atlantic salmon, Salmo salar, gill tissues showing varying degrees of gill pathology (scored 0-3) and from 26 jellyfish samples belonging to the species Phialella quadrata and Muggiaea atlantica. For each sample, the bacterial load was normalised against the level of the salmonid elongation factor alpha 1 (ELF) detected by a second real-time PCR using previously published primers and probe. Tenacibaculum maritimum DNA was detected in 89% of the blocks with no signs of gill disease as well as in 95% of the blocks with mild-to-severe gill pathology. Association between bacterial load and gill pathology severity was investigated. T. maritimum DNA was detected at low level in four of the 26 jellyfish tested. PMID:22724390

  11. Field sampling rate of BG-sentinel traps for Aedes aegypti (Diptera: Culicidae) in suburban Cairns, Australia.

    PubMed

    Johnson, P H; Spitzauer, V; Ritchie, S A

    2012-01-01

    Mini-mark-release-recapture experiments were conducted in suburban Cairns, Australia to establish the sampling rate of the Biogents-Sentinel (BGS) trap for adult Aedes aegypti (L.). Small cohorts of marked mosquitoes (30 females and 15 males) were released at typical Cairns residences, and the number of marked mosquitoes recaptured in the BGS trap after 24 h was recorded. The sampling rate was compared between two seasons and two common housing styles (high-set 'Queenslander-style' timber and low-set brick houses), between old gravid and young nulliparous females, and between mosquitoes released in different areas of a house. Overall, the BGS traps recaptured a mean (+/- SEM) of 24.6% (+/- 1.9) of the released marked female mosquitoes in 24 h. The mean recapture rate for females was significantly higher in the dry season (30.4% +/- 2.8) compared with the wet (18.8% +/- 2.2). The overall recapture rates did not differ significantly between the two house types, but variability between the individual premises was high. An overall mean of 18.2% (+/- 1.7) of males was collected. Recapture rates of young nullipars and older gravid females were similar. These recapture rates can be used to estimate the population density of Ae. aegypti females in north Queensland, although it will provide an underestimate as trap sample was largely representative of mosquitoes present in the same area as the trap, and not from other areas of the house. PMID:22308768

  12. Frequency distribution of mineral elements in samples of alfalfa and sugar beet leaves obtained from a common field in Imperial Valley, California

    SciTech Connect

    Wallace, A.; Romney, E.M.; Kinnear, J.

    1982-07-01

    Baseline measurements were made of mineral composition of alfalfa (Medicago sativa L.) and sugar beets (Beta vulgaris L.) from one field each in the Imperial Valley of California. The fields are in a geothermal area being developed for energy production, and the purpose of the investigation was to ascertain variablility within a relatively large number of samples from a common area, so that subsequent samplings could be made to satisfactorily detect whether there were changes resulting from the geothermal activity. Means, standard deviations, frequency distribution, correlations, cluster trees, and other statistics were examined for over 20 elements at each site.Most elements were normally distributed, but there was three- to fourfold range in the concentration for each.

  13. Comparison of culture versus quantitative real-time polymerase chain reaction for the detection of Taylorella equigenitalis in field samples from naturally infected horses in Canada and Germany

    PubMed Central

    Nadin-Davis, Susan; Knowles, Margaret K.; Burke, Teresa; Böse, Reinhard; Devenish, John

    2015-01-01

    A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment. PMID:26130847

  14. Continuous analysis of δ¹⁸O and δD values of water by diffusion sampling cavity ring-down spectrometry: a novel sampling device for unattended field monitoring of precipitation, ground and surface waters.

    PubMed

    Munksgaard, Niels C; Wurster, Chris M; Bird, Michael I

    2011-12-30

    A novel sampling device suitable for continuous, unattended field monitoring of rapid isotopic changes in environmental waters is described. The device utilises diffusion through porous PTFE tubing to deliver water vapour continuously from a liquid water source for analysis of δ¹⁸O and δD values by Cavity Ring-Down Spectrometry (CRDS). Separation of the analysed water vapour from non-volatile dissolved and particulate contaminants in the liquid sample minimises spectral interferences associated with CRDS analyses of many aqueous samples. Comparison of isotopic data for a range of water samples analysed by Diffusion Sampling-CRDS (DS-CRDS) and Isotope Ratio Mass Spectrometry (IRMS) shows significant linear correlations between the two methods allowing for accurate standardisation of DS-CRDS data. The internal precision for an integration period of 3 min (standard deviation (SD) = 0.1‰ and 0.3‰ for δ¹⁸O and δD values, respectively) is similar to analysis of water by CRDS using an autosampler to inject and evaporate discrete water samples. The isotopic effects of variable air temperature, water vapour concentration, water pumping rate and dissolved organic content were found to be either negligible or correctable by analysis of water standards. The DS-CRDS system was used to analyse the O and H isotope composition in short-lived rain events. Other applications where finely time resolved water isotope data may be of benefit include recharge/discharge in groundwater/river systems and infiltration-related changes in cave drip water. PMID:22468325

  15. Assessing the uncertainty of biomass change estimates obtained using multi-temporal field, lidar sampling, and satellite imagery on the Kenai Peninsula of Alaska (Invited)

    NASA Astrophysics Data System (ADS)

    Andersen, H.

    2013-12-01

    There is increasing interest in the development of statistical sampling designs for aboveground biomass (and carbon) inventory and monitoring programs that can make efficient use of a variety of available data sources, including field plots, airborne lidar sampling, and satellite imagery. While the use of multiple sources, or levels, of remote sensing data can significantly increase the precision of biomass change estimates, especially in remote areas (such as interior Alaska) where it is extremely expensive to establish field plots, it can be challenging to accurately characterize the uncertainty (i.e. variance and bias) of the estimates obtained from these complex multi-level designs. In this study we evaluate a model-based approach to estimate changes in biomass over the western lowlands of the Kenai Peninsula of Alaska during the period 2004-2009 using a combination of field plots, lidar sampling, and satellite imagery. The model-based approach -- where all inferences are conditioned on the model relating the remote-sensing measurements to the inventory parameter of interest (e.g. biomass) - is appropriate for cases where it is cost-prohibitive, or infeasible, to establish a probability sample of field plots that are both spatially and temporally coincident with each remote sensing data set. For example, a model-based approach can be used to obtain biomass estimates over a period of time, even when field data is only available for the current time period. In this study, lidar data were collected in 2004 and 2009 over single swaths that covered 130 Forest Inventory and Analysis (FIA) plots distributed on a regular grid over the entire western Kenai. Field measurements on FIA plots were initially acquired over the period 1999-2003 and fifty-percent of these plots were remeasured in the period 2004-2009. In addition, high-accuracy coordinates (< 1 meter error) were obtained for these FIA plots using survey-grade GLONASS-enabled GPS equipment. Changes in biomass

  16. Monitoring of selected pesticides residue levels in water samples of paddy fields and removal of cypermethrin and chlorpyrifos residues from water using rice bran.

    PubMed

    Bhattacharjee, Shubhra; Fakhruddin, A N M; Chowdhury, M A Z; Rahman, M A; Alam, M K

    2012-08-01

    Consumption of pesticides associated foods increased in recent decades in Bangladesh. Most of the pesticides come from paddy, as rice is the main food items here and about 70 % pesticides are used only on paddy fields. Water samples of paddy fields and Kaliganga River of Manikganj district were analyzed to provide base line data on cypermethrin, chlorpyrifos and diazinon residue by using high performance liquid chromatography. Levels of Cypermethrin, chlorpyrifos and diazinon detected in the paddy field water samples were (0.605 ± 0.011 μg/L), (0.06 ± 0.001 μg/L) and (0.039 ± 0.002 μg/L), respectively. 0.11 ± 0.003 μg/L of cypermethrin and 0.012 ± 0.0006 μg/L of chlorpyrifos were also identified in the water samples of Kaligonga River. Diazinon residue was not detected in the river water samples. The detected concentrations of pesticide residues in the river water were below the accepted maximum residue limit (MRL) value of drinking water (0.1 μg/l) adopted by the FAO/WHO Codex Alimentarius Commission. Cypermethrin and chlorpyrifos were chosen for decontamination through rice bran, as it was found in river water. Two gm rice bran could easily decontaminated 95.6 % and 96.4 % of cypermethrin and chlorpyrifos. The result of this study showed that pesticide residue was detected in water samples were below the MRLs value, which can easily be decontaminated through absorption of rice bran. PMID:22627618

  17. Coexistence in Field Samples of Two Variants of the Infectious Salmon Anemia Virus: A Putative Shift to Pathogenicity

    PubMed Central

    Cárdenas, Constanza; Carmona, Marisela; Gallardo, Alicia; Labra, Alvaro; Marshall, Sergio H.

    2014-01-01

    Genetic reassortment plays an important role in the evolution of several segmented RNA viruses and in the epidemiology of their associated diseases. In particular, orthomyxoviruses show rapid fluctuation in the proportion of viral variants coexisting in an infected individual, especially under strong selective pressure. This is particularly relevant in salmon production carried out under confined and stressful conditions where one of the most feared pathogenic agents is the Infectious Salmon Anemia Virus, an orthomyxovirus family member whose biological behavior is only recently beginning to be understood. Pathogenicity of the virus has been mainly associated with deletions of the HPR region in coding segment 6 and the presence or absence of a specific insertion in a key region in coding segment 5. In this study we report, for the first time in Chile, the coexistence of two variants in fully asymptomatic fish. Of five samples analyzed, two were identified as the non-pathogenic variant, HPR0, and two as the highly pathogenic HPR7b variant, though with no clinical signs detectable in the fish. Interestingly, one of the samples unequivocally carried both variants, again without any clinical signs. Considering that in none of the samples the typical insertion in coding segment 5 was detected, it is our impression that this may represent a shift from the non-pathogenic HPR0 variant towards the highly infective HPR7b variant. If this were the case, the transition may be triggered first by deleting the corresponding sequence of the HPR region of segment 6, followed by the putative insertion in segment 5 to generate a virulent strain. PMID:24498206

  18. Actual leisure participation of Norwegian adolescents with Down syndrome.

    PubMed

    Dolva, Anne-Stine; Kleiven, Jo; Kollstad, Marit

    2014-02-01

    This article reports the actual participation in leisure activities by a sample of Norwegian adolescents with Down syndrome aged 14. Representing a first generation to grow up in a relatively inclusive context, they live with their families, attend mainstream schools, and are part of common community life. Leisure information was obtained in individual, structured parent interviews, and added to existing longitudinal data from a project following the sample. Generally, the leisure activity may be viewed as varying along a continuum-reaching from formal, organized, and assisted activity participation outside home, to informal, self-organized, and independent participation at home. Formal leisure activities were either organized "for all" or "adapted for disabled." The adolescents' leisure appears as active and social. However, social participation largely involved parents and family, while socializing with other adolescents mainly took place within formal activities adapted for disabled. Clearly, formal and informal activities provide rather different opportunities for social encounters and assistance. PMID:24515503

  19. Development of a spatially targeted field sampling technique for the southern cattle tick, Rhipicephalus microplus, by mapping white-tailed deer, Odocoileus virginianus, habitat in South Texas.

    PubMed

    Phillips, Pamela L; Welch, John B; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field. PMID:25368044

  20. Development of a Spatially Targeted Field Sampling Technique for the Southern Cattle Tick, Rhipicephalus microplus, by Mapping Whitetailed Deer, Odocoileus virginianus, Habitat in South Texas

    PubMed Central

    Phillips, Pamela L.; Welch, John B.; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field. PMID:25368044

  1. Possibilities and limitations of the ART-Sample algorithm for reconstruction of 3D temperature fields and the influence of opaque obstacles

    PubMed Central

    Li, Yuanyang; Herman, Cila

    2013-01-01

    The need for the measurement of complex, unsteady, three-dimensional (3D) temperature distributions arises in a variety of engineering applications, and tomographic techniques are applied to accomplish this goal. Holographic interferometry (HI), one of the optical methods used for visualizing temperature fields, combined with tomographic reconstruction techniques requires multi-directional interferometric data to recover the 3D information. However, the presence of opaque obstacles (such as solid objects in the flow field and heaters) in the measurement volume, prevents the probing light beams from traversing the entire measurement volume. As a consequence, information on the average value of the field variable will be lost in regions located in the shade of the obstacle. The capability of the ART-Sample tomographic reconstruction method to recover 3D temperature distributions both in unobstructed temperature fields and in the presence of opaque obstacles is discussed in this paper. A computer code for tomographic reconstruction of 3D temperature fields from 2D projections was developed. In the paper, the reconstruction accuracy is discussed quantitatively both without and with obstacles in the measurement volume for a set of phantom functions mimicking realistic temperature distributions. The reconstruction performance is optimized while minimizing the number of irradiation directions (experimental hardware requirements) and computational effort. For the smooth temperature field both with and without obstacles, the reconstructions produced by this algorithm are good, both visually and using quantitative criteria. The results suggest that the location and the size of the obstacle and the number of viewing directions will affect the reconstruction of the temperature field. When the best performance parameters of the ART-Sample algorithm identified in this paper are used to reconstruct the 3D temperature field, the 3D reconstructions with and without obstacle are

  2. A Modified Alderman-Grant Coil makes possible an efficient cross-coil probe for high field solid-state NMR of lossy biological samples

    NASA Astrophysics Data System (ADS)

    Grant, Christopher V.; Yang, Yuan; Glibowicka, Mira; Wu, Chin H.; Park, Sang Ho; Deber, Charles M.; Opella, Stanley J.

    2009-11-01

    The design, construction, and performance of a cross-coil double-resonance probe for solid-state NMR experiments on lossy biological samples at high magnetic fields are described. The outer coil is a Modified Alderman-Grant Coil (MAGC) tuned to the 1H frequency. The inner coil consists of a multi-turn solenoid coil that produces a B 1 field orthogonal to that of the outer coil. This results in a compact nested cross-coil pair with the inner solenoid coil tuned to the low frequency detection channel. This design has several advantages over multiple-tuned solenoid coil probes, since RF heating from the 1H channel is substantially reduced, it can be tuned for samples with a wide range of dielectric constants, and the simplified circuit design and high inductance inner coil provides excellent sensitivity. The utility of this probe is demonstrated on two electrically lossy samples of membrane proteins in phospholipid bilayers (bicelles) that are particularly difficult for conventional NMR probes. The 72-residue polypeptide embedding the transmembrane helices 3 and 4 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (residues 194-241) requires a high salt concentration in order to be successfully reconstituted in phospholipid bicelles. A second application is to paramagnetic relaxation enhancement applied to the membrane-bound form of Pf1 coat protein in phospholipid bicelles where the resistance to sample heating enables high duty cycle solid-state NMR experiments to be performed.

  3. Monoclonal antibody-based dipstick assay: a reliable field applicable technique for diagnosis of Schistosoma mansoni infection using human serum and urine samples.

    PubMed

    Demerdash, Zeinab; Mohamed, Salwa; Hendawy, Mohamed; Rabia, Ibrahim; Attia, Mohy; Shaker, Zeinab; Diab, Tarek M

    2013-02-01

    A field applicable diagnostic technique, the dipstick assay, was evaluated for its sensitivity and specificity in diagnosing human Schistosoma mansoni infection. A monoclonal antibody (mAb) against S. mansoni adult worm tegumental antigen (AWTA) was employed in dipstick and sandwich ELISA for detection of circulating schistosome antigen (CSA) in both serum and urine samples. Based on clinical and parasitological examinations, 60 S. mansoni-infected patients, 30 patients infected with parasites other than schistosomiasis, and 30 uninfected healthy individuals were selected. The sensitivity and specificity of dipstick assay in urine samples were 86.7% and 90.0%, respectively, compared to 90.0% sensitivity and 91.7% specificity of sandwich ELISA. In serum samples, the sensitivity and specificity were 88.3% and 91.7% for dipstick assay vs. 91.7% and 95.0% for sandwich ELISA, respectively. The diagnostic efficacy of dipstick assay in urine and serum samples was 88.3% and 90.0%, while it was 90.8% and 93.3% for sandwich ELISA, respectively. The diagnostic indices of dipstick assay and ELISA either in serum or in urine were statistically comparable (P>0.05). In conclusion, the dipstick assay offers an alternative simple, rapid, non-invasive technique in detecting CSA or complement to stool examinations especially in field studies. PMID:23467705

  4. Terahertz cyclotron resonance spectroscopy of an AlGaN/GaN heterostructure using a high-field pulsed magnet and an asynchronous optical sampling technique

    NASA Astrophysics Data System (ADS)

    Spencer, B. F.; Smith, W. F.; Hibberd, M. T.; Dawson, P.; Beck, M.; Bartels, A.; Guiney, I.; Humphreys, C. J.; Graham, D. M.

    2016-05-01

    The effective mass, sheet carrier concentration, and mobility of electrons within a two-dimensional electron gas in an AlGaN/GaN heterostructure were determined using a laboratory-based terahertz cyclotron resonance spectrometer. The ability to perform terahertz cyclotron resonance spectroscopy with magnetic fields of up to 31 T was enabled by combining a high-field pulsed magnet with a modified asynchronous optical sampling terahertz detection scheme. This scheme allowed around 100 transmitted terahertz waveforms to be recorded over the 14 ms magnetic field pulse duration. The sheet density and mobility were measured to be 8.0 × 1012 cm-2 and 9000 cm2 V-1 s-1 at 77 K. The in-plane electron effective mass at the band edge was determined to be 0.228 ± 0.002m0.

  5. Pre-injection Comparison of Methods for Sampling Formation Water and Associated Gas from a Monitoring Well at a Carbon Dioxide Injection Site, Citronelle Oil Field, Alabama

    NASA Astrophysics Data System (ADS)

    Conaway, C.; Thordsen, J. J.; Manning, M. A.; Cook, P. J.; Abedini, A. A.; Trautz, R. C.; Thomas, B.; Kharaka, Y. K.

    2012-12-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a well in the Citronelle Oil Field, Alabama, a site that will be used for a carbon dioxide injection experiment. Prior to each of the two sampling periods, the well was cleaned from the drilling fluids and KCl solutions by producing at least three pore volumes of formation water. Accurate measurements of the chemical composition of groundwater or formation water, including dissolved gasses, and gas samples is essential in understanding subsurface geochemical processes occurring as a result of geologic carbon dioxide injection, which is used for enhanced oil recovery (EOR) and has been proposed as a means of carbon sequestration. In this study, formation water and gas samples for geochemical analyses were obtained from well D-9-8 #2 at Citronelle using nitrogen lift, submersible pump, U-Tube, and a downhole (Kuster) sampler. Field chemical analyses included electrical conductivity, hydrogen sulfide, alkalinity, and pH, and laboratory analyses included major, minor and trace elements by mass spectrometry and ion chromatography, dissolved carbon, organic acid anions, free and dissolved gas species. The formation water obtained from this well is a Na-Ca-Cl brine with a salinity of 160,000 and 200,000 mg/L total dissolved solids (TDS). Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity measurements. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the downhole sampler and U-Tube system performing most favorably in this aspect.

  6. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  7. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  8. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  9. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  10. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  11. A spectroscopic survey of the youngest field stars in the solar neighbourhood. I. The optically bright sample

    NASA Astrophysics Data System (ADS)

    Guillout, P.; Klutsch, A.; Frasca, A.; Freire Ferrero, R.; Marilli, E.; Mignemi, G.; Biazzo, K.; Bouvier, J.; Monier, R.; Motch, C.; Sterzik, M.

    2009-09-01

    Aims: We present the first results of an ambitious ground-based observation programme conducted on 1-4 m class telescopes. Our sample consists of 1097 active and presumably young stars, all of them being optical (Tycho Catalogue) counterparts of ROSAT All-Sky Survey X-ray sources in the northern hemisphere. In this paper, we concentrate on the optically brightest (V_T≤slant 9.5 m) candidates (704 objects). We acquired high-resolution optical spectroscopy in the Hα and/or lithium spectral regions for 426 of such stars without relevant data in the literature. We describe the star sample and the observations and we start to discuss the physical properties of the investigated stars. Methods: We used a cross-correlation technique and other tools developed by us to derive accurate radial and rotational velocities and to perform an automatic spectral classification for both single stars and double-lined systems. The spectral subtraction technique was used to derive chromospheric activity levels and lithium abundances. We estimated the fraction of young single stars and multiple systems in stellar soft X-ray surveys and the contamination by more evolved systems, like RS CVn binaries. We classified stars on the basis of their lithium abundance and give a glimpse of their sky distribution. Results: The sample appears to be a mixture of quite young Pleiades-like and Hyades-like stars plus an older lithium-poor population probably born within the last 1-2 Gyr. Seven stars with a lithium abundance compatible with the age of IC 2602 (about 30 Myr) or even younger were detected as well, although two appear to be lithium-rich giants.The discovery of a large number of highly or moderately lithium-rich giants is another outcome of the present survey. Conclusions: The contamination of soft X-ray surveys by old systems in which the activity level is enhanced by tidal synchronisation is not negligible, especially for K-type stars. Five stars with lithium content close to the

  12. The actual status of Astronomy in Moldova

    NASA Astrophysics Data System (ADS)

    Gaina, A.

    The astronomical research in the Republic of Moldova after Nicolae Donitch (Donici)(1874-1956(?)) were renewed in 1957, when a satellites observations station was open in Chisinau. Fotometric observations and rotations of first Soviet artificial satellites were investigated under a program SPIN put in action by the Academy of Sciences of former Socialist Countries. The works were conducted by Assoc. prof. Dr. V. Grigorevskij, which conducted also research in variable stars. Later, at the beginning of 60-th, an astronomical Observatory at the Chisinau State University named after Lenin (actually: the State University of Moldova), placed in Lozovo-Ciuciuleni villages was open, which were coordinated by Odessa State University (Prof. V.P. Tsesevich) and the Astrosovet of the USSR. Two main groups worked in this area: first conducted by V. Grigorevskij (till 1971) and second conducted by L.I. Shakun (till 1988), both graduated from Odessa State University. Besides this research areas another astronomical observations were made: Comets observations, astroclimate and atmospheric optics in collaboration with the Institute of the Atmospheric optics of the Siberian branch of the USSR (V. Chernobai, I. Nacu, C. Usov and A.F. Poiata). Comets observations were also made since 1988 by D. I. Gorodetskij which came to Chisinau from Alma-Ata and collaborated with Ukrainean astronomers conducted by K.I. Churyumov. Another part of space research was made at the State University of Tiraspol since the beggining of 70-th by a group of teaching staff of the Tiraspol State Pedagogical University: M.D. Polanuer, V.S. Sholokhov. No a collaboration between Moldovan astronomers and Transdniestrian ones actually exist due to War in Transdniestria in 1992. An important area of research concerned the Radiophysics of the Ionosphere, which was conducted in Beltsy at the Beltsy State Pedagogical Institute by a group of teaching staff of the University since the beginning of 70-th: N. D. Filip, E

  13. What Galvanic Vestibular Stimulation Actually Activates

    PubMed Central

    Curthoys, Ian S.; MacDougall, Hamish Gavin

    2012-01-01

    In a recent paper in Frontiers Cohen et al. (2012) asked “What does galvanic vestibular stimulation actually activate?” and concluded that galvanic vestibular stimulation (GVS) causes predominantly otolithic behavioral responses. In this Perspective paper we show that such a conclusion does not follow from the evidence. The evidence from neurophysiology is very clear: galvanic stimulation activates primary otolithic neurons as well as primary semicircular canal neurons (Kim and Curthoys, 2004). Irregular neurons are activated at lower currents. The answer to what behavior is activated depends on what is measured and how it is measured, including not just technical details, such as the frame rate of video, but the exact experimental context in which the measurement took place (visual fixation vs total darkness). Both canal and otolith dependent responses are activated by GVS. PMID:22833733

  14. MODIS Solar Diffuser: Modelled and Actual Performance

    NASA Technical Reports Server (NTRS)

    Waluschka, Eugene; Xiong, Xiao-Xiong; Esposito, Joe; Wang, Xin-Dong; Krebs, Carolyn (Technical Monitor)

    2001-01-01

    The Moderate Resolution Imaging Spectroradiometer (MODIS) instrument's solar diffuser is used in its radiometric calibration for the reflective solar bands (VIS, NTR, and SWIR) ranging from 0.41 to 2.1 micron. The sun illuminates the solar diffuser either directly or through a attenuation screen. The attenuation screen consists of a regular array of pin holes. The attenuated illumination pattern on the solar diffuser is not uniform, but consists of a multitude of pin-hole images of the sun. This non-uniform illumination produces small, but noticeable radiometric effects. A description of the computer model used to simulate the effects of the attenuation screen is given and the predictions of the model are compared with actual, on-orbit, calibration measurements.

  15. Geochemistry of stream-sediment samples from the Santa Renia Fields and Beaver Peak quadrangles, northern Carlin Trend, Nevada

    USGS Publications Warehouse

    Theodore, Ted G.; Kotlyar, Boris B.; Berger, Vladimir I.; Moring, Barry C.; Singer, Donald A.; Edstrom, Sven A.

    1999-01-01

    A broad west-to-east increase of many metal concentrations has been found in stream sediments during a reconnaissance investigation conducted in conjunction with geologic studies in the Santa Renia Fields and Beaver Peak 7–1/2 minute quadrangles near the northern end of the Carlin trend of gold deposits in the Tuscarora Mountains. This regional increase in metal concentrations coincides with a dramatic change in landform wherein high concentrations of metals in stream sediments appear to correlate directly with areas of high elevations and steep slopes in the Beaver Peak quadrangle. Robust erosion combined with high flow rates in streams from these higher elevations are envisaged to have contributed significantly to increased metal concentrations in the stream sediments by an enhanced presence of minerals with high specific gravities and a correspondingly diminished presence of minerals with low specific gravities. Minerals with low specific gravities probably have been preferentially flushed down stream because of high transporting capacities for sediment by streams in the Beaver Peak quadrangle. In addition, the Carlin trend, a generally northwest-alignment of gold deposits in the Santa Renia Fields quadrangle, is well outlined by arsenic concentrations that include a maximum of approximately 54 parts per million. Further, a weakly developed distal-to-proximal metal zonation towards these gold deposits appears to be defined respectively in plots showing distributions of thallium, arsenic, antimony, and zinc. A broad area of high metal concentrations—including sharply elevated abundances of Ag, As, Au, Cd, Co, Cu, Mn, Ni, P, Sb, Sc, Te, V, and especially Zn—near the southeast corner of the Beaver Peak quadrangle primarily could be the result of stratiform mineralized rocks in the Ordovician Vinini Formation or Devonian Slaven Chert, or the result of a subsequent Mesozoic or Tertiary epigenetic overprint.

  16. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; arsenic speciation in natural-water samples using laboratory and field methods

    USGS Publications Warehouse

    Garbarino, John R.; Bednar, Anthony J.; Burkhardt, Mark R.

    2002-01-01

    Analytical methods for the determination of arsenite [As(III)], arsenate [As(V)], dimethylarsinate (DMA), monomethylarsonate (MMA), and roxarsone in filtered natural-water samples are described. Various analytical methods can be used for the determination, depending on the arsenic species being determined. Arsenic concentration is determined by using inductively coupled plasma-mass spectrometry (ICP-MS) as an arsenic-specific detector for all methods. Laboratory-speciation methods are described that use an ion chromatographic column to separate the arsenic species; the column length, column packing, and mobile phase are dependent on the species of interest. Regardless of the separation technique, the arsenic species are introduced into plasma by eithe rpneumatic nebulization or arsine generation. Analysis times range from 2 to 8 minutes and method detection limits range from 0.1 to 0.6 microgram-arsenic per liter (ug-As/L), 10 to 60 picograms absolute (for a 100-microliter injection), depending on the arsenic species determined and the analytical method used. A field-generation specciation method also is described that uses a strong anion exchange cartridge to separate As(III) from As(V) in the field. As(III) in the eluate and the As(V) in the cartridge extract are determined by direct nebulization ICP-MS. Methylated arsenic species that also are retained on the cartridge will positively bias As(V) results without further laboratory separations. The method detection limit for field speciation is 0.3 ug-As/L. The distribution of arsenic species must be preserved in the field to eliminate changes caused by photochemical oxidation or metal oxyhydroxide precipitation. Preservation techniques, such as refrigeration, the addition of acides, or the additoin of ethylene-diaminetetraacetic acid (EDTA) and the effects of ambient light were tested. Of the preservatives evaluated, EDTA was found to work best with the laboratory- and field-speciation methods for all sample

  17. Respondent-driven sampling in a study of drug users in New York City: notes from the field.

    PubMed

    McKnight, Courtney; Des Jarlais, Don; Bramson, Heidi; Tower, Lisa; Abdul-Quader, Abu S; Nemeth, Chris; Heckathorn, Douglas

    2006-11-01

    Beth Israel Medical Center (BIMC), in collaboration with the Centers for Disease Control (CDC) and the New York State Department of Health (NYSDOH), used respondent-driven sampling (RDS) in a study of HIV seroprevalence among drug users in New York City in 2004. We report here on operational issues with RDS including recruitment, coupon distribution, storefront operations, police and community relations, and the overall lessons we learned. Project staff recruited eight seeds from a syringe exchange in Lower Manhattan to serve as the initial study participants. Upon completion of the interview that lasted approximately 1 h and a blood draw, each seed was given three coupons to recruit three drug users into the study. Each of the subsequent eligible participants was also given three coupons to recruit three of their drug-using acquaintances. Eligible participants had to have: injected, smoked or snorted an illicit drug in the last 6 months (other than marijuana), aged 18 or older, adequate English language knowledge to permit informed consent and complete questionnaire. From April to July 2004, 618 drug users were interviewed, including 263 (43%) current injectors, 119 (19%) former injectors, and 236 (38%) never injectors. Four hundred sixty nine (76%) participants were men, 147 (24%) were women, and two (<1%) were transgender. By race/ethnicity, 285 (46%) were black, 218 (35%) Hispanic, 88 (14%) white, 23 (4%) mixed/not specified, and four (<1%) native American. Interviews were initially done on a drop-in basis but this system changed to appointments 1 month into the study due to the large volume of subjects coming in for interviews. Data collection was originally proposed to last for 1 year with a target recruitment of 500 drug users. Utilizing RDS, we were able to recruit and interview 118 more drug users than originally proposed in one quarter of the time. RDS was efficient with respect to time and economics (we did not have to hire an outreach worker) and

  18. Field application of a planted fixed bed reactor (PFR) for support media and rhizosphere investigation using undisturbed samples from full-scale constructed wetlands.

    PubMed

    Barreto, A B; Vasconcellos, G R; von Sperling, M; Kuschk, P; Kappelmeyer, U; Vasel, J L

    2015-01-01

    This study presents a novel method for investigations on undisturbed samples from full-scale horizontal subsurface-flow constructed wetlands (HSSFCW). The planted fixed bed reactor (PFR), developed at the Helmholtz Center for Environmental Research (UFZ), is a universal test unit for planted soil filters that reproduces the operational conditions of a constructed wetland (CW) system in laboratory scale. The present research proposes modifications on the PFR original configuration in order to allow its operation in field conditions. A mobile device to obtain undisturbed samples from real-scale HSSFCW was also developed. The experimental setting is presented with two possible operational configurations. The first allows the removal and replacement of undisturbed samples in the CW bed for laboratory investigations, guaranteeing sample integrity with a mobile device. The second allows the continuous operation of the PFR and undisturbed samples as a fraction of the support media, reproducing the same environmental conditions outside the real-scale system. Investigations on the hydrodynamics of the adapted PFR were carried out with saline tracer tests, validating the proposed adaptation. Six adapted PFR units were installed next to full-scale HSSFCW beds and fed with interstitial liquid pumped from two regions of planted and unplanted support media. Fourteen points were monitored along the system, covering carbon fractions, nitrogen and sulfate. The results indicate the method as a promising tool for investigations on CW support media, rhizosphere and open space for studies on CW modeling, respirometry, kinetic parameters, microbial communities, redox potential and plant influence on HSSFCW. PMID:26247753

  19. Characterization of the geochemical and physical properties of wetland soils on the Savannah River Site: Field sampling activities. Final report

    SciTech Connect

    Dixon, K.L.

    1992-11-01

    There are 36,000 acres of wetlands on the Savannah River Site (SRS) and an additional 5,000 acres of floodplain. Recent studies of wetland soils near various waste sites at SRS have shown that some wetlands have been contaminated with pollutants resulting from SRS operations. In general, releases of contaminants to wetland areas have been indirect. These releases may have originated at disposal lagoons or waste facilities located in the vicinity of the wetland areas. Transport mechanisms such as surface runoff, soil erosion, sediment transport, and groundwater seepage into downgradient wetland areas are responsible for the indirect discharges to the wetland areas. The SRS determined that a database of background geochemical and physical properties for wetland soils on the SRS was needed to facilitate future remedial investigations, human health and ecological risk assessments, treatability studies, and feasibility studies for the wetland areas. These data are needed for comparison to contaminant data collected from wetland soils that have been affected by contamination from SRS operations. This report describes the efforts associated with the collection of soil cores, preparation of a lithologic log for each core, and the processing and packaging of individual soil samples for shipment to analytical laboratory facilities.

  20. Controlled field evaluation of water flow rate effects on sampling polar organic compounds using polar organic chemical integrative samplers.

    PubMed

    Li, Hongxia; Vermeirssen, Etiënne L M; Helm, Paul A; Metcalfe, Chris D

    2010-11-01

    The uptake of polar organic contaminants into polar organic chemical integrative samplers (POCIS) varies with environmental factors, such as water flow rate. To evaluate the influence of water flow rate on the uptake of contaminants into POCIS, flow-controlled field experiments were conducted with POCIS deployed in channel systems through which treated sewage effluent flowed at rates between 2.6 and 37 cm/s. Both pharmaceutical POCIS and pesticide POCIS were exposed to effluent for 21 d and evaluated for uptake of pharmaceuticals and personal care products (PPCPs) and endocrine disrupting substances (EDS). The pesticide POCIS had higher uptake rates for PPCPs and EDS than the pharmaceutical POCIS, but there are some practical advantages to using pharmaceutical POCIS. The uptake of contaminants into POCIS increased with flow rate, but these effects were relatively small (i.e., less than twofold) for most of the test compounds. There was no relationship observed between the hydrophobicity (log octanol/water partition coefficient, log K(OW)) of model compounds and the effects of flow rate on the uptake kinetics by POCIS. These data indicate that water flow rate has a relatively minor influence on the accumulation of PPCPs and EDS into POCIS. PMID:20865700

  1. Novel sample preparation methods and field testing procedures used to determine the chemical basis of cocaine detection by canines

    NASA Astrophysics Data System (ADS)

    Furton, Kenneth G.; Hsu, Ya-Li; Luo, Tien-Ying; Alvarez, Nayiby; Lagos, Pedro

    1997-02-01

    The use of canines to signal money associated with drug trafficking is a major point of contention among dog handlers, forensic scientists, and the legal community particularly in light of recent reports that a significant amount of money in circulation is contaminated with detectable amounts of cocaine. The questions raised include: What exactly are the dogs alerting to? How selective are the dogs? How sensitive are the dogs? How reliable are the dogs? Tests with various volatile cocaine by-products confirm that the dominant chemical in cocaine odor is methyl benzoate. Field tests on fifteen different drug detector dogs with varying breeds, ages and training regimes show a consistent threshold level of 1 (mu) g of methyl benzoate spiked along with cocaine on U.S. currency required to initiate an alert. The majority of the canines did not alert to pharmaceutical grade cocaine even at levels as high as 1 g. Methyl benzoate is shown to evaporate rapidly from individual bills and is a function of the available surface area for wrapped currency. The canines tested were remarkably selective and reliable even under varying test conditions and using different delivery devices.

  2. Three-step stacking of cationic analytes by field-enhanced sample injection, sweeping, and micelle to solvent stacking in capillary electrophoresis.

    PubMed

    Grochocki, Wojciech; Markuszewski, Michał J; Quirino, Joselito P

    2015-12-11

    The sensitivity enhancement factor (SEF) in field enhanced sample injection (FESI) in capillary electrophoresis is dictated by the conductivity ratio. The higher the conductivity ratio (using very low conductivity sample diluents such as water), the higher the SEF. Here, we improved the performance of FESI by combination with sweeping and micelle to solvent stacking (MSS) in a well-defined three-step stacking procedure using model cationic drugs. The separation was by capillary zone electrophoresis (CZE) using 100mM phosphoric acid as background solution (BGS). Under the experimental conditions studied, the SEF (vs. typical injection in CZE) range of FESI using a conductivity ratio of 10, 100, and 1000 (sample diluent with conductivity 10, 100, and 1000× lower than the BGS, respectively) was 5-6, 33-50, and 272-393, respectively. The SEF range of three-step stacking was 308-891, 2188-6463, and 3088-6499, correspondingly. The SEF enhancement factor due to three-step stacking (SEF of three-step stacking divided by SEF of FESI) was from 11 to 161. We evaluated the performance of proposed procedure using a conductivity ratio of 10 (10mM phosphoric acid as diluent) which is the minimum requirement for field-enhancement. The strategy was as follows: long FESI (e.g., 420s at 10kV) to form an overloaded stacked zone; sweeping (e.g., 315s at -10kV) with 10mM sodium dodecyl sulfate micelles; and MSS by injection (6s at 50mbar) of 30% acetonitrile. The strategy was studied in terms of sweeping and MSS conditions, FESI/sweeping time ratio, and FESI time at constant FESI/sweeping ratio. Analytical figures of merit including linearity, LOD (S/N=3), and repeatability (intraday and interday) were determined. Moreover, sample matrix effect was studied using acetone treated plasma sample. PMID:26592558

  3. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    SciTech Connect

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-04-15

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomen–pelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  4. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    PubMed Central

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-01-01

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomen–pelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  5. Variance of discharge estimates sampled using acoustic Doppler current profilers from moving boats

    USGS Publications Warehouse

    Garcia, Carlos M.; Tarrab, Leticia; Oberg, Kevin; Szupiany, Ricardo; Cantero, Mariano I.

    2012-01-01

    This paper presents a model for quantifying the random errors (i.e., variance) of acoustic Doppler current profiler (ADCP) discharge measurements from moving boats for different sampling times. The model focuses on the random processes in the sampled flow field and has been developed using statistical methods currently available for uncertainty analysis of velocity time series. Analysis of field data collected using ADCP from moving boats from three natural rivers of varying sizes and flow conditions shows that, even though the estimate of the integral time scale of the actual turbulent flow field is larger than the sampling interval, the integral time scale of the sampled flow field is on the order of the sampling interval. Thus, an equation for computing the variance error in discharge measurements associated with different sampling times, assuming uncorrelated flow fields is appropriate. The approach is used to help define optimal sampling strategies by choosing the exposure time required for ADCPs to accurately measure flow discharge.

  6. The incidence of calorie labeling on fast food choices: A comparison between stated preferences and actual choices.

    PubMed

    Loureiro, Maria L; Rahmani, Djamel

    2016-09-01

    In order to test the effect of calorie information on fast food choices, we conducted a questionnaire employing two types of stated preferences methods (the best-worst-scaling and intentional questions) and a follow-up randomized field experiment in a sample of 119 participants. This combined approach allowed us to test the internal validity of preferences for fast food meals across elicitation scenarios. The results showed that calorie information reduces the probability of selecting high calorie meals only in the questionnaire, while it did not have any significant impact on actual purchasing behavior in the field experiment. Thus, the findings show that there is a clear difference between the role of calorie information on immediate stated preference choices, and the relatively low level of responsiveness in real choices in a restaurant. We believe that the current results are quite suggestive, indicating the limits of predicting actual fast food behavior, and may open the way to using data sources that combine stated methods with field experiments. PMID:27037499

  7. The nonrelativistic limit of (central-extended) Poincare group and some consequences for quantum actualization

    SciTech Connect

    Ardenghi, Juan S.; Castagnino, M.; Campoamor-Stursberg, R.

    2009-10-15

    The nonrelativistic limit of the centrally extended Poincare group is considered and their consequences in the modal Hamiltonian interpretation of quantum mechanics are discussed [O. Lombardi and M. Castagnino, Stud. Hist. Philos. Mod. Phys 39, 380 (2008); J. Phys, Conf. Ser. 128, 012014 (2008)]. Through the assumption that in quantum field theory the Casimir operators of the Poincare group actualize, the nonrelativistic limit of the latter group yields to the actualization of the Casimir operators of the Galilei group, which is in agreement with the actualization rule of previous versions of modal Hamiltonian interpretation [Ardenghi et al., Found. Phys. (submitted)].

  8. A simulation-based approach for designing effective field-sampling programs to evaluate contamination risk of groundwater supplies

    USGS Publications Warehouse

    Nordqvist, R.; Voss, C.I.

    1996-01-01

    An approach to model discrimination and network design for evaluation of groundwater contamination risk is proposed and demonstrated by application to a site in a glaciofluvial aquifer in Sweden. The approach consists of first hypothesizing alternative conceptual models of hydrogeology at the site on the basis of both quantitative data and qualitative information. The conceptual models are then expressed as two-dimensional numerical models of groundwater flow and solute transport, and model attributes controlling risk to the water supply are determined by simulation. Model predictions of response to a specific field test are made with each model that affects risk. Regions for effective measurement networks are then identified. Effective networks are those that capture sufficient information to determine which of the hypothesized models best describes the system with a minimum of measurement points. For the example site in Sweden, the network is designed such that important system parameters may be accurately estimated at the same time as model discrimination is carried out. The site in Vansbro, Sweden, consists of a water-supply well in an esker separated (by 300m) from a wood preservation and treatment area on the esker flank by only a narrow inlet of a bordering stream. Application of the above-described risk analysis shows that, of all the hydrologic controls and parameters in the groundwater system, the only factor that controls the potential migration of wood-treatment contaminants to the well is whether the inlet's bed is pervious, creating a hydraulic barrier to lateral contaminant transport. Furthermore, the analysis localizes an area near the end of the inlet wherein the most effective measurements of drawdown would be made to discriminate between a permeable and impermeable bed. The location of this optimal area is not obvious prior to application of the above methodology.

  9. Central V4 Receptive Fields Are Scaled by the V1 Cortical Magnification and Correspond to a Constant Sized Sampling of the V1 Surface

    PubMed Central

    Motter, Brad C.

    2009-01-01

    The mapping of the topographic representation of the visual field onto cortical areas changes throughout the hierarchy of cortical visual areas. The changes are believed to reflect the establishment of modules with different spatial processing emphasis. The receptive fields (RFs) of neurons within these modules, however, may not be governed by the same spatial topographic map parameters. Here it is shown that the RFs of area V4 neurons (centered 1–12 degs in eccentricity) are based on a circularly symmetric sampling of the primary visual cortical retinotopic map. No eccentricity dependent magnification beyond that observed in V1 is apparent in the V4 neurons. The size and shape of V4 RFs can be explained by a simple, constant sized, 2D Gaussian sample of visual input from the retinotopic map laid out across the surface of V1. Inferences about the spatial scale of interactions within the receptive fields of neurons cannot be based on a visual area’s apparent cortical magnification derived from topographic mapping. PMID:19420243

  10. Giving Students Control over Their Learning; from Self-guided Museum Visits and Field Trips to Using Scanning Technology to Link Content to Earth Samples

    NASA Astrophysics Data System (ADS)

    Kirkby, K. C.; Phipps, M.

    2011-12-01

    While it may seem counterintuitive, sometimes stepping back is one of the more effective pedagogical approaches instructors can make. On museum visits, an instructor's presence fundamentally alters students' experiences and can curtail student learning by limiting questions or discouraging students from exploring their own interests. Students often rely on the instructor and become passive observers, rather than engaged learners. As an alternative to instructor-led visits, self-guided student explorations of museum exhibits proved to be both popular and pedagogically effective. On pre-instruction and post-instruction surveys, these ungraded, self-guided explorations match or exceed the efficacy of traditional graded lab instruction and completely eclipse gains normally achieved by traditional lecture instruction. In addition, these explorations achieve the remarkable goal of integrating undergraduate earth science instruction into students' social lives. Based on the success of the self-guided museum explorations, this fall saw the debut of an attempt to expand this concept to field experiences. A self-guided student field exploration of Saint Anthony Falls focuses on the intersections of geological processes with human history. Students explore the waterfalls' evolution, its early interpretation by 18th and 19th century Dakota and Euro-America societies, and its subsequent social and economic impacts on Upper Midwest societies. Self-guided explorations allow students to explore field settings on their own or with friends and family in a more relaxed manner. At the same time, these explorations give students control over, and responsibility for, their own learning - a powerful pedagogical approach. Student control over their learning is also the goal of an initiative to use scanning technologies, such as linear bar codes, 2D barcodes and radio-frequency identification (RFID), to revolutionize sample identification and study. Scanning technology allows students to

  11. Caustic-Side Solvent Extraction: Prediction of Cesium Extraction for Actual Wastes and Actual Waste Simulants

    SciTech Connect

    Delmau, L.H.; Haverlock, T.J.; Sloop, F.V., Jr.; Moyer, B.A.

    2003-02-01

    This report presents the work that followed the CSSX model development completed in FY2002. The developed cesium and potassium extraction model was based on extraction data obtained from simple aqueous media. It was tested to ensure the validity of the prediction for the cesium extraction from actual waste. Compositions of the actual tank waste were obtained from the Savannah River Site personnel and were used to prepare defined simulants and to predict cesium distribution ratios using the model. It was therefore possible to compare the cesium distribution ratios obtained from the actual waste, the simulant, and the predicted values. It was determined that the predicted values agree with the measured values for the simulants. Predicted values also agreed, with three exceptions, with measured values for the tank wastes. Discrepancies were attributed in part to the uncertainty in the cation/anion balance in the actual waste composition, but likely more so to the uncertainty in the potassium concentration in the waste, given the demonstrated large competing effect of this metal on cesium extraction. It was demonstrated that the upper limit for the potassium concentration in the feed ought to not exceed 0.05 M in order to maintain suitable cesium distribution ratios.

  12. Membrane supported liquid-liquid-liquid microextraction combined with field-amplified sample injection CE-UV for high-sensitivity analysis of six cardiovascular drugs in human urine sample.

    PubMed

    Zhou, Xiaoqing; He, Man; Chen, Beibei; Yang, Qing; Hu, Bin

    2016-05-01

    An effective dual preconcentration method involving off-line membrane supported liquid-liquid-liquid microextraction (MS-LLLME) and on-line field-amplified sample injection (FASI) was proposed for the extraction of six cardiovascular drugs, including mexiletine, xylocaine, propafenone, propranolol, metoprolol, and carvedilol from aqueous solution prior to CE-UV. In MS-LLLME, the analytes were extracted from 9 mL sample solution into toluene, and then back extracted into a drop of acceptor phase of 10 μL 20 mmol/L acetic acid. After that, the acceptor phase was directly introduced into CE for FASI without any modification. In FASI process, water plug was hydrodynamically injected (50 mbar, 3 s) into the capillary prior to sample injection (+6 kV, 18 s). Six target analytes were separated in less than 10 min at 25°C with a BGE consisting of 70 mmol/L Tris-H3 PO4 (pH 2.2) containing 10% v/v methanol. Under the optimized conditions, LODs obtained by the proposed MS-LLLME-FASI-CE-UV method were in the range of 0.02-0.82 μg/L (based on S/N = 3) with enrichment factors of 546- to 7300-fold for the target analytes. The RSDs of the developed method were in the range of 6.7-12.9% (n = 7). Good linearity (R(2) = 0.9928-0.9997) was obtained in concentration range of 0.1-100 μg/L for mexiletine and propranolol, 0.2-100 μg/L for xylocaine and metoprolol, 0.5-100 μg/L for propafenone and 2.0-100 μg/L for carvedilol, respectively. The developed method was successfully applied for real-time determination of metoprolol in human urine samples within 26 h after uptake. PMID:26763094

  13. Organophosphorus and Carbamate Pesticide Residues Detected in Water Samples Collected from Paddy and Vegetable Fields of the Savar and Dhamrai Upazilas in Bangladesh

    PubMed Central

    Chowdhury, Md. Alamgir Zaman; Banik, Sanjoy; Uddin, Borhan; Moniruzzaman, Mohammed; Karim, Nurul; Gan, Siew Hua

    2012-01-01

    Several types of organophosphorous and carbamate pesticides have been used extensively by the farmers in Bangladesh during the last few decades. Twenty seven water samples collected from both paddy and vegetable fields in the Savar and Dhamrai Upazilas in Bangladesh were analyzed to determine the occurrence and distribution of organo-phosphorus (chlorpyrifos, malathion and diazinon) and carbamate (carbaryl and carbofuran) pesticide residues. A high performance liquid chromatograph instrument equipped with a photodiode array detector was used to determine the concentrations of these pesticide residues. Diazinon and carbofuran were detected in water samples collected from Savar Upazila at 0.9 μg/L and 198.7 μg/L, respectively. Malathion was also detected in a single water sample at 105.2 μg/L from Dhamrai Upazila. Carbaryl was the most common pesticide detected in Dhamrai Upazila at 14.1 and 18.1 μg/L, while another water sample from Dhamrai Upazila was contaminated with carbofuran at 105.2 μg/L. Chlorpyrifos was not detected in any sample. Overall, the pesticide residues detected were well above the maximum acceptable levels of total and individual pesticide contamination, at 0.5 and 0.1 μg/L, respectively, in water samples recommended by the European Economic Community (Directive 98/83/EC). The presence of these pesticide residues may be attributed by their intense use by the farmers living in these areas. Proper handling of these pesticides should be ensured to avoid direct or indirect exposure to these pesticides. PMID:23202689

  14. High-Frequency/High-field electron spin echo envelope modulation study of nitrogen hyperfine and quadrupole interactions on a disordered powder sample

    PubMed

    Bloess; Mobius; Prisner

    1998-09-01

    High-frequency/high-field (95 GHz/3.4 T) electron spin echo envelope modulation (ESEEM) experiments on single crystals and disordered samples of dianisyl-nitroxide (DANO) radicals are reported. At these high microwave frequencies (W-band), the anisotropic g-matrix of the nitroxide radical is resolved in the EPR spectrum. Additionally ESEEM modulations from other than nitrogen nuclei, such as protons, are highly suppressed at these frequencies, because they are too far from the cancellation condition for effective mixing of the nuclear spin functions. Therefore the nitrogen (14N) hyperfine and quadrupole coupling tensors could be determined without ambiguity from powder measurements. The results obtained were checked by ESEEM measurements on single crystals. Advantages and disadvantages of high-field ESEEM on nitrogen couplings are briefly discussed and compared with electron nuclear double resonance (ENDOR) and X-band ESEEM. Copyright 1998 Academic Press. PMID:9740727

  15. Linking community tolerance and structure with low metallic contamination: a field study on 13 biofilms sampled across the Seine river basin.

    PubMed

    Fechner, Lise C; Gourlay-Francé, Catherine; Tusseau-Vuillemin, Marie-Hélène

    2014-03-15

    It is difficult to assess the biological consequences of diffuse water contamination by micropollutants which are present in rivers at low, even sublethal levels. River biofilms, which respond quickly to changes of environmental parameters, are good candidates to acquire knowledge on the response of aquatic organisms to diffuse chemical contamination in the field. The study was designed as an attempt to link biofilm metal tolerance and metallic contamination in a field survey covering 13 different sampling sites in the Seine river basin (north of France) with low contamination levels. Cd and Zn tolerance of heterotrophic communities was assessed using a short-term toxicity test based on β-glucosidase activity. Metal tolerance levels varied between sites but there was no obvious correlation between tolerance and corresponding water contamination levels for Cd and Zn. Indeed, metallic contamination at the sampling sites remained subtle when compared to water quality standards (only two sampling sites had either Zn or both Cu and Zn concentrations exceeding the Environmental Quality Standards set by the EU Water Framework Directive). Yet, multivariate analysis of the data using Partial Least Squares Regression revealed that both metallic and environmental parameters were important variables explaining the variability of metal tolerance levels. Automated Ribosomal Intergenic Spacer Analysis (ARISA) was also performed on both bacterial and eukaryotic biofilm communities from the 13 sampling sites. Multivariate analysis of ARISA fingerprints revealed that biofilms with similar tolerance levels have similar ARISA profiles. Those results confirm that river biofilms are potential indicators of low, diffuse contamination levels of aquatic systems. PMID:24429101

  16. Non-destructive Analysis of Oil-Contaminated Soil Core Samples by X-ray Computed Tomography and Low-Field Nuclear Magnetic Resonance Relaxometry: a Case Study

    PubMed Central

    Mitsuhata, Yuji; Nishiwaki, Junko; Kawabe, Yoshishige; Utsuzawa, Shin; Jinguuji, Motoharu

    2010-01-01

    Non-destructive measurements of contaminated soil core samples are desirable prior to destructive measurements because they allow obtaining gross information from the core samples without touching harmful chemical species. Medical X-ray computed tomography (CT) and time-domain low-field nuclear magnetic resonance (NMR) relaxometry were applied to non-destructive measurements of sandy soil core samples from a r