Science.gov

Sample records for actual field samples

  1. FIELD SAMPLING PROTOCOLS AND ANALYSIS

    EPA Science Inventory

    I have been asked to speak again to the environmental science class regarding actual research scenarios related to my work at Kerr Lab. I plan to discuss sampling protocols along with various field analyses performed during sampling activities. Many of the students have never see...

  2. CHARACTERIZATION AND ACTUAL WASTE TEST WITH TANK 5F SAMPLES

    SciTech Connect

    Hay, M. S.; Crapse, K. P.; Fink, S. D.; Pareizs, J. M.

    2007-08-30

    The initial phase of bulk waste removal operations was recently completed in Tank 5F. Video inspection of the tank indicates several mounds of sludge still remain in the tank. Additionally, a mound of white solids was observed under Riser 5. In support of chemical cleaning and heel removal programs, samples of the sludge and the mound of white solids were obtained from the tank for characterization and testing. A core sample of the sludge and Super Snapper sample of the white solids were characterized. A supernate dip sample from Tank 7F was also characterized. A portion of the sludge was used in two tank cleaning tests using oxalic acid at 50 C and 75 C. The filtered oxalic acid from the tank cleaning tests was subsequently neutralized by addition to a simulated Tank 7F supernate. Solids and liquid samples from the tank cleaning test and neutralization test were characterized. A separate report documents the results of the gas generation from the tank cleaning test using oxalic acid and Tank 5F sludge. The characterization results for the Tank 5F sludge sample (FTF-05-06-55) appear quite good with respect to the tight precision of the sample replicates, good results for the glass standards, and minimal contamination found in the blanks and glass standards. The aqua regia and sodium peroxide fusion data also show good agreement between the two dissolution methods. Iron dominates the sludge composition with other major contributors being uranium, manganese, nickel, sodium, aluminum, and silicon. The low sodium value for the sludge reflects the absence of supernate present in the sample due to the core sampler employed for obtaining the sample. The XRD and CSEM results for the Super Snapper salt sample (i.e., white solids) from Tank 5F (FTF-05-07-1) indicate the material contains hydrated sodium carbonate and bicarbonate salts along with some aluminum hydroxide. These compounds likely precipitated from the supernate in the tank. A solubility test showed the material

  3. Photovoltaic performance models: an evaluation with actual field data

    NASA Astrophysics Data System (ADS)

    TamizhMani, Govindasamy; Ishioye, John-Paul; Voropayev, Arseniy; Kang, Yi

    2008-08-01

    Prediction of energy production is crucial to the design and installation of the building integrated photovoltaic systems. This prediction should be attainable based on the commonly available parameters such as system size, orientation and tilt angle. Several commercially available as well as free downloadable software tools exist to predict energy production. Six software models have been evaluated in this study and they are: PV Watts, PVsyst, MAUI, Clean Power Estimator, Solar Advisor Model (SAM) and RETScreen. This evaluation has been done by comparing the monthly, seasonaly and annually predicted data with the actual, field data obtained over a year period on a large number of residential PV systems ranging between 2 and 3 kWdc. All the systems are located in Arizona, within the Phoenix metropolitan area which lies at latitude 33° North, and longitude 112 West, and are all connected to the electrical grid.

  4. Pulsed field sample neutralization

    DOEpatents

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  5. Variation in actual relationship as a consequence of Mendelian sampling and linkage

    PubMed Central

    HILL, W.G.; WEIR, B.S.

    2011-01-01

    Summary Although the expected relationship or proportion of genome shared by pairs of relatives can be obtained from their pedigrees, the actual quantities deviate as a consequence of Mendelian sampling and depend on the number of chromosomes and map length. Formulae have been published previously for the variance of actual relationship for a number of specific types of relatives but no general formula for non-inbred individuals is available. We provide here a unified framework that enables the variances for distant relatives to be easily computed, showing, for example, how the variance of sharing for great grandparent–great grandchild, great uncle–great nephew, half uncle–nephew and first cousins differ, even though they have the same expected relationship. Results are extended in order to include differences in map length between sexes, no recombination in males and sex linkage. We derive the magnitude of skew in the proportion shared, showing the skew becomes increasingly large the more distant the relationship. The results obtained for variation in actual relationship apply directly to the variation in actual inbreeding as both are functions of genomic coancestry, and we show how to partition the variation in actual inbreeding between and within families. Although the variance of actual relationship falls as individuals become more distant, its coefficient of variation rises, and so, exacerbated by the skewness, it becomes increasingly difficult to distinguish different pedigree relationships from the actual fraction of the genome shared. PMID:21226974

  6. Characterization, Leaching, and Filtration Testing for Tributyl Phosphate (TBP, Group 7) Actual Waste Sample Composites

    SciTech Connect

    Edwards, Matthew K.; Billing, Justin M.; Blanchard, David L.; Buck, Edgar C.; Casella, Amanda J.; Casella, Andrew M.; Crum, J. V.; Daniel, Richard C.; Draper, Kathryn E.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Snow, Lanee A.; Swoboda, Robert G.

    2009-03-09

    .A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. The tributyl phosphate sludge (TBP, Group 7) is the subject of this report. The Group 7 waste was anticipated to be high in phosphorus as well as aluminum in the form of gibbsite. Both are believed to exist in sufficient quantities in the Group 7 waste to address leaching behavior. Thus, the focus of the Group 7 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  7. Does equilibrium passive sampling reflect actual in situ bioaccumulation of PAHs and petroleum hydrocarbon mixtures in aquatic worms?

    PubMed

    Muijs, Barry; Jonker, Michiel T O

    2012-01-17

    Over the past couple of years, several analytical methods have been developed for assessing the bioavailability of environmental contaminants in sediments and soils. Comparison studies suggest that equilibrium passive sampling methods generally provide the better estimates of internal concentrations in organisms and thus of subsequent risks. However, field studies to validate the potential of passive sampling to predict actual in situ bioaccumulation are scarce and limited information only exists on selected, individual compounds. The present study investigated whether bioaccumulation of PAH and complex petroleum hydrocarbon mixtures in field-exposed aquatic worms could be predicted properly with passive samplers. To this end, in situ bioaccumulation in aquatic worms at 6 PAH-contaminated locations and 8 petroleum hydrocarbon (oil)-contaminated locations was compared with the results of in situ solid phase micro extraction (SPME) applications. For the oil-contaminated sediments, bioaccumulation was also assessed in the lab with polyoxymethylene solid phase extraction (POM-SPE). Actual PAH bioaccumulation was generally predicted within a factor of 4 with in situ SPME, using temperature-adjusted SPME fiber-water partition coefficients and lab-derived bioaccumulation factors (BAFs) for the worm species used, demonstrating the method's potential under field conditions. In situ SPME appeared to be less suitable for predicting bioaccumulation of oil however, in contrast to POM-SPE in the lab, which assessed in situ oil bioaccumulation within a factor of 3, while also closely reflecting the actual distribution of oil boiling point fractions (the hydrocarbon block profile) as accumulated by the worms. All in all, the results indicated that (specific) equilibrium passive samplers, either applied in the field or the lab, have great potential for assessing bioaccumulation of environmental contaminant mixtures from field-contaminated sediments.

  8. TESTING OF THE SPINTEK ROTARY MICROFILTER USING ACTUAL HANFORD WASTE SAMPLES

    SciTech Connect

    HUBER HJ

    2010-04-13

    The SpinTek rotary microfilter was tested on actual Hanford tank waste. The samples were a composite of archived Tank 241-AN-105 material and a sample representing single-shell tanks (SST). Simulants of the two samples have been used in non-rad test runs at the 222-S laboratory and at Savannah River National Laboratory (SRNL). The results of these studies are compared in this report. Two different nominal pore sizes for the sintered steel rotating disk filter were chosen: 0.5 and 0.1 {micro}m. The results suggest that the 0.5-{micro}m disk is preferable for Hanford tank waste for the following reasons: (1) The filtrate clarity is within the same range (<<4 ntu for both disks); (2) The filtrate flux is in general higher for the 0.5-{micro}m disk; and (3) The 0.1-{micro}m disk showed a higher likelihood of fouling. The filtrate flux of the actual tank samples is generally in the range of 20-30% compared to the equivalent non-rad tests. The AN-105 slurries performed at about twice the filtrate flux of the SST slurries. The reason for this difference has not been identified. Particle size distributions in both cases are very similar; comparison of the chemical composition is not conclusive. The sole hint towards what material was stuck in the filter pore holes came from the analysis of the dried flakes from the surface of the fouled 0.1-{micro}m disk. A cleaning approach developed by SRNL personnel to deal with fouled disks has been found adaptable when using actual Hanford samples. The use of 1 M nitric acid improved the filtrate flux by approximately two times; using the same simulants as in the non-rad test runs showed that the filtrate flux was restored to 1/2 of its original amount.

  9. Filtration and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Geeting, John GH; Hallen, Richard T.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Snow, Lanee A.; Swoboda, Robert G.

    2009-02-20

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.( ) The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP-RPP-WTP-467, eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste-testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan • Characterizing the homogenized sample groups • Performing parametric leaching testing on each group for compounds of interest • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on filtration/leaching tests performed on two of the eight waste composite samples and follow-on parametric tests to support aluminum leaching results from those tests.

  10. Filtration and Leach Testing for PUREX Cladding Sludge and REDOX Cladding Sludge Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hallen, Richard T.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-03-02

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan (Barnes and Voke 2006). The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Hanford Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP RPP WTP 467 (Fiskum et al. 2007), eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan. • Characterizing the homogenized sample groups. • Performing parametric leaching testing on each group for compounds of interest. • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on a filtration/leaching test performed using two of the eight waste composite samples. The sample groups examined in this report were the plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR). Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, thus requiring caustic leaching. WTP RPT 167 (Snow et al. 2008) describes the homogenization, characterization, and parametric leaching activities before benchtop filtration/leaching testing of these two waste groups. Characterization and initial parametric data in that report were used to plan a single filtration/leaching test using a blend of both wastes. The test focused on filtration testing of the waste and caustic leaching for aluminum, in the form

  11. Modeling of Boehmite Leaching from Actual Hanford High-Level Waste Samples

    SciTech Connect

    Peterson, Reid A.; Lumetta, Gregg J.; Rapko, Brian M.; Poloski, Adam P.

    2007-06-27

    The Department of Energy plans to vitrify approximately 60,000 metric tons of high level waste sludge from underground storage tanks at the Hanford Nuclear Reservation. To reduce the volume of high level waste requiring treatment, a goal has been set to remove about 90 percent of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum in the form of gibbsite and sodium aluminate can be easily dissolved by washing the waste stream with caustic, but boehmite, which comprises nearly half of the total aluminum, is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. In this work, the dissolution kinetics of aluminum species during caustic leaching of actual Hanford high level waste samples is examined. The experimental results are used to develop a shrinking core model that provides a basis for prediction of dissolution dynamics from known process temperature and hydroxide concentration. This model is further developed to include the effects of particle size polydispersity, which is found to strongly influence the rate of dissolution.

  12. Modeling of Boehmite Leaching from Actual Hanford High-Level Waste Samples

    SciTech Connect

    Snow, L.A.; Rapko, B.M.; Poloski, A.P.; Peterson, R.A.

    2007-07-01

    The U.S. Department of Energy plans to vitrify approximately 60,000 metric tons of high-level waste (HLW) sludge from underground storage tanks at the Hanford Site in Southwest Washington State. To reduce the volume of HLW requiring treatment, a goal has been set to remove a significant quantity of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum is found in the form of gibbsite and sodium aluminate, which can be easily dissolved by washing the waste stream with caustic, and boehmite, which comprises nearly half of the total aluminum, but is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. Chromium, which makes up a much smaller amount ({approx}3%) of the sludge, must also be removed because there is a low tolerance for chromium in the HLW immobilization process. In this work, the coupled dissolution kinetics of aluminum and chromium species during caustic leaching of actual Hanford HLW samples is examined. The experimental results are used to develop a model that provides a basis for predicting dissolution dynamics from known process temperature and hydroxide concentration. (authors)

  13. Field sampling and travel report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dr. Sigua was involved with two field visits of watersheds with different livestock production systems (poultry, swine, and beef/dairy cattle); one in the sub-basins of Pinhal River Watershed (October 23, 2008) and at the micro-basins of the Rio Pine Forest (October 29, 2008) where studies of assess...

  14. 12 CFR Appendix M3 to Part 226 - Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures M3 Appendix M3 to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z)...

  15. Comprehensive Evaluation of Attitude and Orbit Estimation Using Actual Earth Magnetic Field Data

    NASA Technical Reports Server (NTRS)

    Deutschmann, Julie K.; Bar-Itzhack, Itzhack Y.

    2000-01-01

    A single, augmented Extended Kalman Filter (EKF), which simultaneously and autonomously estimates spacecraft attitude and orbit has been developed and successfully tested with real magnetometer and gyro data only. Because the earth magnetic field is a function of time and position, and because time is known quite precisely, the differences between the computed and measured magnetic field components, as measured by the magnetometers throughout the entire spacecraft orbit, are a function of both orbit and attitude errors. Thus, conceivably these differences could be used to estimate both orbit and attitude; an observability study validated this assumption. The results of testing the EKF with actual magnetometer and gyro data, from four satellites supported by the NASA Goddard Space Flight Center (GSFC) Guidance, Navigation, and Control Center, are presented and evaluated. They confirm the assumption that a single EKF can estimate both attitude and orbit when using gyros and magnetometers only.

  16. Bioaerosol sampling: sampling mechanisms, bioefficiency and field studies.

    PubMed

    Haig, C W; Mackay, W G; Walker, J T; Williams, C

    2016-07-01

    Investigations into the suspected airborne transmission of pathogens in healthcare environments have posed a challenge to researchers for more than a century. With each pathogen demonstrating a unique response to environmental conditions and the mechanical stresses it experiences, the choice of sampling device is not obvious. Our aim was to review bioaerosol sampling, sampling equipment, and methodology. A comprehensive literature search was performed, using electronic databases to retrieve English language papers on bioaerosol sampling. The review describes the mechanisms of popular bioaerosol sampling devices such as impingers, cyclones, impactors, and filters, explaining both their strengths and weaknesses, and the consequences for microbial bioefficiency. Numerous successful studies are described that point to best practice in bioaerosol sampling, from the use of small personal samplers to monitor workers' pathogen exposure through to large static samplers collecting airborne microbes in various healthcare settings. Of primary importance is the requirement that studies should commence by determining the bioefficiency of the chosen sampler and the pathogen under investigation within laboratory conditions. From such foundations, sampling for bioaerosol material in the complexity of the field holds greater certainty of successful capture of low-concentration airborne pathogens. From the laboratory to use in the field, this review enables the investigator to make informed decisions about the choice of bioaerosol sampler and its application.

  17. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck

    2003-04-19

    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  18. Early detection of nonnative alleles in fish populations: When sample size actually matters

    USGS Publications Warehouse

    Croce, Patrick Della; Poole, Geoffrey C.; Payne, Robert A.; Gresswell, Bob

    2017-01-01

    Reliable detection of nonnative alleles is crucial for the conservation of sensitive native fish populations at risk of introgression. Typically, nonnative alleles in a population are detected through the analysis of genetic markers in a sample of individuals. Here we show that common assumptions associated with such analyses yield substantial overestimates of the likelihood of detecting nonnative alleles. We present a revised equation to estimate the likelihood of detecting nonnative alleles in a population with a given level of admixture. The new equation incorporates the effects of the genotypic structure of the sampled population and shows that conventional methods overestimate the likelihood of detection, especially when nonnative or F-1 hybrid individuals are present. Under such circumstances—which are typical of early stages of introgression and therefore most important for conservation efforts—our results show that improved detection of nonnative alleles arises primarily from increasing the number of individuals sampled rather than increasing the number of genetic markers analyzed. Using the revised equation, we describe a new approach to determining the number of individuals to sample and the number of diagnostic markers to analyze when attempting to monitor the arrival of nonnative alleles in native populations.

  19. Flame spread over thick polymethylmethacrylate samples in a simulated and actual microgravity environment

    NASA Astrophysics Data System (ADS)

    Shah, Tirthesh Jayesh

    The NASA Burning and Suppression of Solids-II (BASS II) experiment examines the combustion of different solid materials and material geometries in microgravity. While flames in microgravity are driven by diffusion and weak advection due to crew movements and ventilation, the current NASA spacecraft material selection test method (NASA-STD- 6001 Test 1) is driven by buoyant forces as gravity is present. The overall goal of this project is to understand the burning of intermediate and thick fuels in microgravity, and devise a normal gravity test to apply to future materials. Clear cast polymethylmethacrylate (PMMA) samples 10 cm long by 1 or 2 cm wide with thicknesses ranging from 1-5 mm were investigated. PMMA is the ideal choice since it is widely used and we know its stoichiometric chemistry. Tests included both one sided and two sided burns. Samples are ignited by heating a wire behind the sample. The samples are burned in a flow duct within the Microgravity Science Glovebox (MSG) on the International Space Station (ISS) to ensure true microgravity conditions. The experiment takes place in opposed flow with varying Oxygen concentrations and flow velocities. Flames are recorded on two cameras and later tracked to determine spread rate. Currently we are modeling combustion of PMMA using Fire Dynamics Simulator (FDS 5.5.3) and Smokeview. The entire modelling for BASS-II is done in DNS mode because of the laminar conditions and small domain. In DNS mode the Navier Stokes equations are solved without the Turbulence model. The model employs the same test sample and MSG geometry as the experiment; but in 2D. The experimental data gave upstream velocity at several points using an anemometer. A flow profile for the inlet velocity is obtained using Matlab and input into the model. The flame spread rates obtained after tracking are then compared with the experimental data and the results follow the trends but the spread rates are higher.

  20. Characterization and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Fiskum, Sandra K.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hubler, Timothy L.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; Lumetta, Gregg J.; MacFarlan, Paul J.; McNamara, Bruce K.; Peterson, Reid A.; Sinkov, Sergey I.; Snow, Lanee A.; Swoboda, Robert G.

    2008-07-10

    This report describes processing and analysis results of boehmite waste type (Group 5) and insoluble high Cr waste type (Group 6). The sample selection, compositing, subdivision, physical and chemical characterization are described. Extensive batch leach testing was conducted to define kinetics and leach factors of selected analytes as functions of NaOH concentration and temperature. Testing supports issue M-12 resolution for the Waste Treatment Plant.

  1. Using MODIS Thermal Data for Estimating Actual Evapotranspiration From Irrigated Fields

    NASA Astrophysics Data System (ADS)

    Senay, G. B.; Budde, M.; Verdin, J. P.

    2006-12-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Recently, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and to some extent relative production using satellite derived data and simulation models in Africa, Central America and Afghanistan where ground-based monitoring is limited due to a scarcity of weather stations. The commonly used crop monitoring models use a crop water balance algorithm with inputs from satellite-derived rainfall. While these models provide useful monitoring for rain-fed agriculture, they are ineffective for irrigated areas. This study has focused on Afghanistan where over 80 percent of the agricultural production comes from irrigated agriculture. We implemented a simplified energy balance approach to monitor and assess the performance of irrigated agriculture in Afghanistan using the combination of 1-km thermal data and 250-m NDVI from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. Up to 19 cloud free thermal and NDVI images were used for each year to estimate seasonal actual evapotranspiration (AET) for two major irrigation river basins (Kabul and Helmand) over 6 years (2000- 2005). Seasonal AET estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the different irrigated basins was indicative of the cropping patterns specific to the region. The results were comparable to field reports and watershed-wide crop water balance based estimates in that the 2003 seasonal AET was the highest of all six years. The advantage of this method over crop water balance methods is that the energy balance approach also helps identify spatial extents of irrigated fields and their spatial variability as opposed to a lumped watershed-wide assessment that can be obtained from large-scale water-balance models.

  2. Soil Sampling Techniques For Alabama Grain Fields

    NASA Technical Reports Server (NTRS)

    Thompson, A. N.; Shaw, J. N.; Mask, P. L.; Touchton, J. T.; Rickman, D.

    2003-01-01

    Characterizing the spatial variability of nutrients facilitates precision soil sampling. Questions exist regarding the best technique for directed soil sampling based on a priori knowledge of soil and crop patterns. The objective of this study was to evaluate zone delineation techniques for Alabama grain fields to determine which method best minimized the soil test variability. Site one (25.8 ha) and site three (20.0 ha) were located in the Tennessee Valley region, and site two (24.2 ha) was located in the Coastal Plain region of Alabama. Tennessee Valley soils ranged from well drained Rhodic and Typic Paleudults to somewhat poorly drained Aquic Paleudults and Fluventic Dystrudepts. Coastal Plain s o i l s ranged from coarse-loamy Rhodic Kandiudults to loamy Arenic Kandiudults. Soils were sampled by grid soil sampling methods (grid sizes of 0.40 ha and 1 ha) consisting of: 1) twenty composited cores collected randomly throughout each grid (grid-cell sampling) and, 2) six composited cores collected randomly from a -3x3 m area at the center of each grid (grid-point sampling). Zones were established from 1) an Order 1 Soil Survey, 2) corn (Zea mays L.) yield maps, and 3) airborne remote sensing images. All soil properties were moderately to strongly spatially dependent as per semivariogram analyses. Differences in grid-point and grid-cell soil test values suggested grid-point sampling does not accurately represent grid values. Zones created by soil survey, yield data, and remote sensing images displayed lower coefficient of variations (8CV) for soil test values than overall field values, suggesting these techniques group soil test variability. However, few differences were observed between the three zone delineation techniques. Results suggest directed sampling using zone delineation techniques outlined in this paper would result in more efficient soil sampling for these Alabama grain fields.

  3. Actual distribution of Cronobacter spp. in industrial batches of powdered infant formula and consequences for performance of sampling strategies.

    PubMed

    Jongenburger, I; Reij, M W; Boer, E P J; Gorris, L G M; Zwietering, M H

    2011-11-15

    The actual spatial distribution of microorganisms within a batch of food influences the results of sampling for microbiological testing when this distribution is non-homogeneous. In the case of pathogens being non-homogeneously distributed, it markedly influences public health risk. This study investigated the spatial distribution of Cronobacter spp. in powdered infant formula (PIF) on industrial batch-scale for both a recalled batch as well a reference batch. Additionally, local spatial occurrence of clusters of Cronobacter cells was assessed, as well as the performance of typical sampling strategies to determine the presence of the microorganisms. The concentration of Cronobacter spp. was assessed in the course of the filling time of each batch, by taking samples of 333 g using the most probable number (MPN) enrichment technique. The occurrence of clusters of Cronobacter spp. cells was investigated by plate counting. From the recalled batch, 415 MPN samples were drawn. The expected heterogeneous distribution of Cronobacter spp. could be quantified from these samples, which showed no detectable level (detection limit of -2.52 log CFU/g) in 58% of samples, whilst in the remainder concentrations were found to be between -2.52 and 2.75 log CFU/g. The estimated average concentration in the recalled batch was -2.78 log CFU/g and a standard deviation of 1.10 log CFU/g. The estimated average concentration in the reference batch was -4.41 log CFU/g, with 99% of the 93 samples being below the detection limit. In the recalled batch, clusters of cells occurred sporadically in 8 out of 2290 samples of 1g taken. The two largest clusters contained 123 (2.09 log CFU/g) and 560 (2.75 log CFU/g) cells. Various sampling strategies were evaluated for the recalled batch. Taking more and smaller samples and keeping the total sampling weight constant, considerably improved the performance of the sampling plans to detect such a type of contaminated batch. Compared to random sampling

  4. Mars Analogue Field Research and Sample Analysis

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.

    2016-07-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009 to 2016) in the Utah desert and in other extreme environments (Iceland, Eifel, La Reunion) relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution affected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with significant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare campaign results from 2009-2013 campaigns in Utah and other sites to new measurements concerning: the comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.

  5. Field evaluation of a VOST sampling method

    SciTech Connect

    Jackson, M.D.; Johnson, L.D.; Fuerst, R.G.; McGaughey, J.F.; Bursey, J.T.; Merrill, R.G.

    1994-12-31

    The VOST (SW-846 Method 0030) specifies the use of Tenax{reg_sign} and a particular petroleum-based charcoal (SKC Lot 104, or its equivalent), that is no longer commercially available. In field evaluation studies of VOST methodology, a replacement petroleum-based charcoal has been used: candidate replacement sorbents for charcoal were studied, and Anasorb{reg_sign} 747, a carbon-based sorbent, was selected for field testing. The sampling train was modified to use only Anasorb{reg_sign} in the back tube and Tenax{reg_sign} in the two front tubes to avoid analytical difficulties associated with the analysis of the sequential bed back tube used in the standard VOST train. The standard (SW-846 Method 0030) and the modified VOST methods were evaluated at a chemical manufacturing facility using a quadruple probe system with quadruple trains. In this field test, known concentrations of the halogenated volatile organic compounds, that are listed in the Clean Air Act Amendments of 1990, Title 3, were introduced into the VOST train and the modified VOST train, using the same certified gas cylinder as a source of test compounds. Statistical tests of the comparability of methods were performed on a compound-by-compound basis. For most compounds, the VOST and modified VOST methods were found to be statistically equivalent.

  6. Involved field radiation for Hodgkin's lymphoma: The actual dose to breasts in close proximity

    SciTech Connect

    Dabaja, Bouthaina; Wang Zhonglo; Stovall, Marilyn; Baker, Jamie S.; Smith, Susan A.; Khan, Meena; Ballas, Leslie; Salehpour, Mohammad R.

    2012-01-01

    To decrease the risk of late toxicities in Hodgkin's lymphoma (HL) patients treated with radiation therapy (RT) (HL), involved field radiation therapy (IFRT) has largely replaced the extended fields. To determine the out-of-field dose delivered from a typical IFRT to surrounding critical structures, we measured the dose at various points in an anthropomorphic phantom. The phantom is divided into 1-inch-thick slices with the ability to insert TLDs at 3-cm intervals grid spacing. Two treatment fields were designed, and a total of 45 TLDs were placed (equally spaced) at the margin of the each of the 2 radiation fields. After performing a computed tomography simulation, 2 treatment plans targeting the mediastinum, a typical treatment field in patients with early stage HL, were generated. A total dose of 3060 cGy was delivered to the gross tumor volume for each field consecutively. The highest measured dose detected at 1 cm from the field edge in the planning target volume was 496 cGy, equivalent to 16% of the isocentric dose. The dose dropped significantly with increasing distance from the field edge. It ranged from 1.1-3.9% of the isocentric dose at a distance of 3.2-4 cm to <1.6% at a distance of >6 cm. Although the computer treatment planning system (CTPS) frequently underestimated the dose delivered, the difference in dose between measured and generated by CTPS was <2.5% in 90 positions measured. The collateral dose of radiation to breasts from IFRT is minimal. The out-of-field dose, although mildly underestimated by CTPS, becomes insignificant at >3 cm from the field edge of the radiation field.

  7. Comparison of dechlorination rates for field DNAPL vs synthetic samples: effect of sample matrix

    NASA Astrophysics Data System (ADS)

    O'Carroll, D. M.; Sakulchaicharoen, N.; Herrera, J. E.

    2015-12-01

    Nanometals have received significant attention in recent years due to their ability to rapidly destroy numerous priority source zone contaminants in controlled laboratory studies. This has led to great optimism surrounding nanometal particle injection for insitu remediation. Reported dechlorination rates vary widely among different investigators. These differences have been ascribed to differences in the iron types (granular, micro, or nano-sized iron), matrix solution chemistry and the morphology of the nZVI surface. Among these, the effects of solution chemistry on rates of reductive dechlorination of various chlorinated compounds have been investigated in several short-term laboratory studies. Variables investigated include the effect of anions or groundwater solutes such as SO4-2, Cl-, NO3-, pH, natural organic matters (NOM), surfactant, and humic acid on dechlorination reaction of various chlorinated compounds such as TCE, carbon tetrachloride (CT), and chloroform (CF). These studies have normally centered on the assessment of nZVI reactivity toward dechlorination of an isolated individual contaminant spiked into a ground water sample under ideal conditions, with limited work conducted using real field samples. In this work, the DNAPL used for the dechlorination study was obtained from a contaminatied site. This approach was selected to adequately simulate a condition where the nZVI suspension was in direct contact with DNAPL and to isolate the dechlorination activity shown by the nZVI from the groundwater matrix effects. An ideal system "synthetic DNAPL" composed of a mixture of chlorinated compounds mimicking the composition of the actual DNAPL was also dechlorinated to evaluate the DNAPL "matrix effect" on NZVI dechlorination activity. This approach allowed us to evaluate the effect of the presence of different types of organic compounds (volatile fatty acids and humic acids) found in the actual DNAPL on nZVI dechlorination activity. This presentation will

  8. Making the Difference for Teachers: The Field Experience in Actual Practice.

    ERIC Educational Resources Information Center

    Slick, Gloria Appelt, Ed.

    This is the third in a series of four books presenting a variety of field experience program models and philosophies that drive the programs provided to preservice teachers during their undergraduate teacher preparation. This publication explores the internal workings of the relationships and events that have an impact on all the persons involved…

  9. Attosecond nanoscale near-field sampling

    PubMed Central

    Förg, B.; Schötz, J.; Süßmann, F.; Förster, M.; Krüger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; Pervak, V.; Kessel, A.; Trushin, S. A.; Azzeer, A. M.; Stockman, M. I.; Kim, D.; Krausz, F.; Hommelhoff, P.; Kling, M. F.

    2016-01-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted. PMID:27241851

  10. Attosecond nanoscale near-field sampling

    DOE PAGES

    Forg, B.; Schotz, J.; SuBmann, F.; ...

    2016-05-31

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. Furthermore, by comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  11. An Actual Design of AC Filter for Static Var Compensator and Verification Results from the Field Test

    NASA Astrophysics Data System (ADS)

    Tamura, Yuji; Takasaki, Shinji; Irokawa, Shoichi; Takeda, Hideo; Takagi, Kikuo; Noro, Yasuhiro; Ametani, Akihiro

    AC filter design method for SVC and HVDC is commonly known in the relevant CIGRE technical brochure and IEC technical report. However the conventional method requires many iterative calculations of the harmonic voltages and currents until the calculation results become within the regulation levels by changing filter parameters based on the experience. In this respect, a new improved design method is proposed, which enables efficient evaluation on the complex impedance plane to confirm as to whether the proposed filter impedance is in the permissible range. In an actual project of Okuura SVC of Kyusyu Electric Power Co., Inc., the new method was applied to the AC filter design. This paper describes on the actual procedure of the AC filter design with the new method, the actual references of the harmonic performance calculation, and the field test measurement results on Okuura SVC. The calculation results and the filed measurement results are consistent with each other, thus the validity of the new design method is verified on its accuracy and effectiveness.

  12. Comparison of first-order-decay modeled and actual field measured municipal solid waste landfill methane data.

    PubMed

    Amini, Hamid R; Reinhart, Debra R; Niskanen, Antti

    2013-12-01

    The first-order decay (FOD) model is widely used to estimate landfill gas generation for emissions inventories, life cycle assessments, and regulation. The FOD model has inherent uncertainty due to underlying uncertainty in model parameters and a lack of opportunities to validate it with complete field-scale landfill data sets. The objectives of this paper were to estimate methane generation, fugitive methane emissions, and aggregated collection efficiency for landfills through a mass balance approach using the FOD model for gas generation coupled with literature values for cover-specific collection efficiency and methane oxidation. This study is unique and valuable because actual field data were used in comparison with modeled data. The magnitude and variation of emissions were estimated for three landfills using site-specific model parameters and gas collection data, and compared to vertical radial plume mapping emissions measurements. For the three landfills, the modeling approach slightly under-predicted measured emissions and over-estimated aggregated collection efficiency, but the two approaches yielded statistically equivalent uncertainties expressed as coefficients of variation. Sources of uncertainty include challenges in large-scale field measurement of emissions and spatial and temporal fluctuations in methane flow balance components (generated, collected, oxidized, and emitted methane). Additional publication of sets of field-scale measurement data and methane flow balance components will reduce the uncertainty in future estimates of fugitive emissions.

  13. The theoretical, discrete, and actual response of the Barnes objective analysis scheme for one- and two-dimensional fields

    NASA Technical Reports Server (NTRS)

    Pauley, Patricia M.; Wu, Xiaohua

    1990-01-01

    The response of the Barnes objective analysis scheme is studied as a function of wavenumber or wavelength. The first- and second-pass theoretical response functions for continuous two-dimensional fields are derived using Fourier transforms. The results are compared with Barnes' (1973) responses for one-dimensional waves. The continuous theoretical response for one- and two-dimensional waves is compared with the response for discrete applications using uniformly spaced observations for the case where interpolation points and observation points are coincident and for the case where interpolation points are midway between observation points. The actual response of an idealized discrete application of the Barnes scheme is examined, confirming the results of the analysis of the discrete theoretical response.

  14. Intended release and actual retention of alfalfa leafcutting bees (Hymenoptera: Megachilidae) for pollination in commercial alfalfa seed fields.

    PubMed

    Pitts-Singer, Theresa L

    2013-04-01

    Low, medium, and high stocking densities (15,000; 30,000; and 45,000-50,000 bees per acre, respectively) of Megachile rotundata (F.) (Hymenoptera: Megachilidae), the alfalfa leafcutting bee, were released over 4 yr in three research plots of Utah alfalfa, Medicago sativa L. (Fabaceae), planted at seed-production rates. A low percentage of bees (46-79% of released) survived the incubation and field-emergence processes; of those bees, the number of females that established at the nesting sites was 25-100%. Of the three field sites, one site consistently retained more females and produced more completed nests than the other sites, all of which usually had poor female establishment and progeny production. In addition, floral resources were depleted over time, but many flowers remained unvisited over the season. Nest production decreased over time, as numbers of flowers and female bees declined. Significant positive relationships were found between the intended stocking densities and 1) the number of females that actually survived incubation and field emergence and 2) the number of females that established nests. The number of females that established nests was positively affected by the number of females that survived to emerge in the field. The percentage of females that established was not significantly affected by the intended number of released bees, countering a prediction that the release of fewer bees would allow more females to establish nests and achieve high reproductive success. For growers, it may be more frugal to use modest numbers of M. rotundata for pollination, because many of the bees at medium and high stocking densities do not nest in grower-provided bee boards.

  15. Characterization and Leach Testing for PUREX Cladding Waste Sludge (Group 3) and REDOX Cladding Waste Sludge (Group 4) Actual Waste Sample Composites

    SciTech Connect

    Snow, Lanee A.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-02-13

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.(a) The testing program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual wastetesting program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR)—are the subjects of this report. Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, requiring caustic leaching. Characterization of the composite Group 3 and Group 4 waste samples confirmed them to be high in gibbsite. The focus of the Group 3 and 4 testing was on determining the behavior of gibbsite during caustic leaching. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  16. Characterization, Leaching, and Filtration Testing for Bismuth Phosphate Sludge (Group 1) and Bismuth Phosphate Saltcake (Group 2) Actual Waste Sample Composites

    SciTech Connect

    Lumetta, Gregg J.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn; Edwards, Matthew K.; Fiskum, Sandra K.; Hallen, Richard T.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Sinkov, Sergey I.; Snow, Lanee A.

    2009-02-19

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.() The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—bismuth phosphate sludge (Group 1) and bismuth phosphate saltcake (Group 2)—are the subjects of this report. The Group 1 waste was anticipated to be high in phosphorus and was implicitly assumed to be present as BiPO4 (however, results presented here indicate that the phosphate in Group 1 is actually present as amorphous iron(III) phosphate). The Group 2 waste was also anticipated to be high in phosphorus, but because of the relatively low bismuth content and higher aluminum content, it was anticipated that the Group 2 waste would contain a mixture of gibbsite, sodium phosphate, and aluminum phosphate. Thus, the focus of the Group 1 testing was on determining the behavior of P removal during caustic leaching, and the focus of the Group 2 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  17. Straight ladder inclined angle in a field environment: the relationship among actual angle, method of set-up and knowledge

    PubMed Central

    Chang, Wen-Ruey; Huang, Yueng-Hsiang; Chang, Chien-Chi; Brunette, Christopher; Fallentin, Nils

    2016-01-01

    Abstract Ladder inclined angle is a critical factor that could lead to a slip at the base of portable straight ladders, a major cause of falls from heights. Despite several methods established to help workers achieve the recommended 75.5° angle for ladder set-up, it remains unclear if these methods are used in practice. This study explored ladder set-up behaviours in a field environment. Professional installers of a company in the cable and other pay TV industry were observed for ladder set-up at their worksites. The results showed that the actual angles of 265 ladder set-ups by 67 participants averaged 67.3° with a standard deviation of 3.22°. Although all the participants had training on recommended ladder set-up methods, only 3 out of 67 participants applied these methods in their daily work and even they failed to achieve the desired 75.5° angle. Therefore, ladder set-up remains problematic in real-world situations. Practitioner Summary: Professional installers of a cable company were observed for portable straight ladder set-up at their worksites. The ladder inclined angle averaged 67.3° with a standard deviation of 3.22°, while the recommended angle is 75.5°. Only a few participants used the methods that they learned during training in their daily work. PMID:26672809

  18. Straight ladder inclined angle in a field environment: the relationship among actual angle, method of set-up and knowledge.

    PubMed

    Chang, Wen-Ruey; Huang, Yueng-Hsiang; Chang, Chien-Chi; Brunette, Christopher; Fallentin, Nils

    2016-08-01

    Ladder inclined angle is a critical factor that could lead to a slip at the base of portable straight ladders, a major cause of falls from heights. Despite several methods established to help workers achieve the recommended 75.5° angle for ladder set-up, it remains unclear if these methods are used in practice. This study explored ladder set-up behaviours in a field environment. Professional installers of a company in the cable and other pay TV industry were observed for ladder set-up at their worksites. The results showed that the actual angles of 265 ladder set-ups by 67 participants averaged 67.3° with a standard deviation of 3.22°. Although all the participants had training on recommended ladder set-up methods, only 3 out of 67 participants applied these methods in their daily work and even they failed to achieve the desired 75.5° angle. Therefore, ladder set-up remains problematic in real-world situations. Practitioner Summary: Professional installers of a cable company were observed for portable straight ladder set-up at their worksites. The ladder inclined angle averaged 67.3° with a standard deviation of 3.22°, while the recommended angle is 75.5°. Only a few participants used the methods that they learned during training in their daily work.

  19. A coupled remote sensing and simplified surface energy balance approach to estimate actual evapotranspiration from irrigated fields

    USGS Publications Warehouse

    Senay, G.B.; Budde, M.; Verdin, J.P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  20. A Coupled Remote Sensing and Simplified Surface Energy Balance Approach to Estimate Actual Evapotranspiration from Irrigated Fields

    PubMed Central

    Senay, Gabriel B.; Budde, Michael; Verdin, James P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250-m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  1. Modelling nanofluidic field amplified sample stacking with inhomogeneous surface charge

    NASA Astrophysics Data System (ADS)

    McCallum, Christopher; Pennathur, Sumita

    2015-11-01

    Nanofluidic technology has exceptional applications as a platform for biological sample preconcentration, which will allow for an effective electronic detection method of low concentration analytes. One such preconcentration method is field amplified sample stacking, a capillary electrophoresis technique that utilizes large concentration differences to generate high electric field gradients, causing the sample of interest to form a narrow, concentrated band. Field amplified sample stacking has been shown to work well at the microscale, with models and experiments confirming expected behavior. However, nanofluidics allows for further concentration enhancement due to focusing of the sample ions toward the channel center by the electric double layer. We have developed a two-dimensional model that can be used for both micro- and nanofluidics, fully accounting for the electric double layer. This model has been used to investigate even more complex physics such as the role of inhomogeneous surface charge.

  2. Hybrid quantitative simulation on the in-line phase-contrast x-ray imaging of three dimensional samples under actual clinic imaging parameters

    SciTech Connect

    Yu Hong; Han Shensheng; Ding Jianhui; Jiang Zhaoxia; Peng Weijun

    2009-07-06

    A hybrid model combining Monte Carlo method with diffraction theory of wave optics has been developed and applied to quantitatively simulate the in-line diffractive phase-contrast x-ray imaging of three dimensional tissue samples under actual clinic imaging parameters. The primary microcosmic interactions of medical-energy x-ray within matter including photoabsorption, Compton scattering, and coherent scattering, have been taken into account in the Monte Carlo simulation. A diffraction processing based on Fresnel diffraction theory is carried out to simulate the macroscopic diffraction effect. A comparison with experiment results has also been performed.

  3. Development of field portable sampling and analysis systems

    SciTech Connect

    Beals, D.

    2000-06-08

    A rapid field portable sample and analysis system has been demonstrated at the Savannah River Site and the Hanford Site. The portable system can be used when rapid decisions are needed in the field during scoping or remediation activities, or when it is impractical to bring large volumes of water to the lab for analysis.

  4. Magnetostatic modes in ferromagnetic samples with inhomogeneous internal fields

    NASA Astrophysics Data System (ADS)

    Arias, Rodrigo

    2015-03-01

    Magnetostatic modes in ferromagnetic samples are very well characterized and understood in samples with uniform internal magnetic fields. More recently interest has shifted to the study of magnetization modes in ferromagnetic samples with inhomogeneous internal fields. The present work shows that under the magnetostatic approximation and for samples of arbitrary shape and/or arbitrary inhomogeneous internal magnetic fields the modes can be classified as elliptic or hyperbolic, and their associated frequency spectrum can be delimited. This results from the analysis of the character of the second order partial differential equation for the magnetostatic potential under these general conditions. In general, a sample with an inhomogeneous internal field and at a given frequency, may have regions of elliptic and hyperbolic character separated by a boundary. In the elliptic regions the magnetostatic modes have a smooth monotonic character (generally decaying form the surfaces (a ``tunneling'' behavior)) and in hyperbolic regions an oscillatory wave-like character. A simple local criterion distinguishes hyperbolic from elliptic regions: the sign of a susceptibility parameter. This study shows that one may control to some extent magnetostatic modes via external fields or geometry. R.E.A. acknowledges Financiamiento Basal para Centros Cientificos y Tecnologicos de Excelencia under Project No. FB 0807 (Chile), Grant No. ICM P10-061-F by Fondo de Innovacion para la Competitividad-MINECON, and Proyecto Fondecyt 1130192.

  5. Digital Curation of Earth Science Samples Starts in the Field

    NASA Astrophysics Data System (ADS)

    Lehnert, K. A.; Hsu, L.; Song, L.; Carter, M. R.

    2014-12-01

    Collection of physical samples in the field is an essential part of research in the Earth Sciences. Samples provide a basis for progress across many disciplines, from the study of global climate change now and over the Earth's history, to present and past biogeochemical cycles, to magmatic processes and mantle dynamics. The types of samples, methods of collection, and scope and scale of sampling campaigns are highly diverse, ranging from large-scale programs to drill rock and sediment cores on land, in lakes, and in the ocean, to environmental observation networks with continuous sampling, to single investigator or small team expeditions to remote areas around the globe or trips to local outcrops. Cyberinfrastructure for sample-related fieldwork needs to cater to the different needs of these diverse sampling activities, aligning with specific workflows, regional constraints such as connectivity or climate, and processing of samples. In general, digital tools should assist with capture and management of metadata about the sampling process (location, time, method) and the sample itself (type, dimension, context, images, etc.), management of the physical objects (e.g., sample labels with QR codes), and the seamless transfer of sample metadata to data systems and software relevant to the post-sampling data acquisition, data processing, and sample curation. In order to optimize CI capabilities for samples, tools and workflows need to adopt community-based standards and best practices for sample metadata, classification, identification and registration. This presentation will provide an overview and updates of several ongoing efforts that are relevant to the development of standards for digital sample management: the ODM2 project that has generated an information model for spatially-discrete, feature-based earth observations resulting from in-situ sensors and environmental samples, aligned with OGC's Observation & Measurements model (Horsburgh et al, AGU FM 2014

  6. Rotating sample magnetometer for cryogenic temperatures and high magnetic fields.

    PubMed

    Eisterer, M; Hengstberger, F; Voutsinas, C S; Hörhager, N; Sorta, S; Hecher, J; Weber, H W

    2011-06-01

    We report on the design and implementation of a rotating sample magnetometer (RSM) operating in the variable temperature insert (VTI) of a cryostat equipped with a high-field magnet. The limited space and the cryogenic temperatures impose the most critical design parameters: the small bore size of the magnet requires a very compact pick-up coil system and the low temperatures demand a very careful design of the bearings. Despite these difficulties the RSM achieves excellent resolution at high magnetic field sweep rates, exceeding that of a typical vibrating sample magnetometer by about a factor of ten. In addition the gas-flow cryostat and the high-field superconducting magnet provide a temperature and magnetic field range unprecedented for this type of magnetometer.

  7. Long-Term Ecological Monitoring Field Sampling Plan for 2007

    SciTech Connect

    T. Haney R. VanHorn

    2007-07-31

    This field sampling plan describes the field investigations planned for the Long-Term Ecological Monitoring Project at the Idaho National Laboratory Site in 2007. This plan and the Quality Assurance Project Plan for Waste Area Groups 1, 2, 3, 4, 5, 6, 7, 10, and Removal Actions constitute the sampling and analysis plan supporting long-term ecological monitoring sampling in 2007. The data collected under this plan will become part of the long-term ecological monitoring data set that is being collected annually. The data will be used t determine the requirements for the subsequent long-term ecological monitoring. This plan guides the 2007 investigations, including sampling, quality assurance, quality control, analytical procedures, and data management. As such, this plan will help to ensure that the resulting monitoring data will be scientifically valid, defensible, and of known and acceptable quality.

  8. FIELD SAMPLING OF RESIDUAL AVIATION GASOLINE IN SANDY SOIL

    EPA Science Inventory

    Two complimentary field sampling methods for the determination of residual aviation gasoline content in the contaminated capillary fringe of a fine, uniform, sandy soil were investigated. The first method featured filed extrusion of core barrels into pint size Mason jars, while ...

  9. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  10. Microcalorimetry: Wide Temperature Range, High Field, Small Sample Measurements

    NASA Astrophysics Data System (ADS)

    Hellman, Frances

    2000-03-01

    We have used Si micromachining techniques to fabricate devices for measuring specific heat or other calorimetric signals from microgram-quantity samples over a temperature range from 1 to 900K in magnetic fields to date up to 8T. The devices are based on a relatively robust silicon nitride membrane with thin film heaters and thermometers. Different types of thermometers are used for different purposes and in different temperature ranges. These devices are particularly useful for thin film samples (typically 200-400 nm thick at present) deposited directly onto the membrane through a Si micromachined evaporation mask. They have also been used for small single crystal samples attached by conducting grease or solder, and for powder samples dissolved in a solvent and dropped onto devices. The measurement technique used (relaxation method) is particularly suited to high field measurements because the thermal conductance can be measured once in zero field and is field independent, while the time constant of the relaxation does not depend on thermometer calibration. Present development efforts include designs which show promise for time-resolved calorimetry measurements of biological samples in small amounts of water. Samples measured to date include amorphous magnetic thin films (a-TbFe2 and giant negative magnetoresistance a-Gd-Si alloys), empty and filled fullerenes (C_60, K_3C_60, C_82, La@C_82, C_84, and Sc_2@C_84), single crystal manganites (La_1-xSr_xMnO_3), antiferromagnetic multilayers (NiO/CoO, NiO/MgO, and CoO/MgO), and nanoparticle magnetic materials (CoO in a Ag matrix).

  11. Field sampling method for quantifying odorants in humid environments.

    PubMed

    Trabue, Steven L; Scoggin, Kenwood D; Li, Hong; Burns, Robert; Xin, Hongwei

    2008-05-15

    Most air quality studies in agricultural environments use thermal desorption analysis for quantifying semivolatile organic compounds (SVOCs) associated with odor. The objective of this study was to develop a robust sampling technique for measuring SVOCs in humid environments. Test atmospheres were generated at ambient temperatures (23 +/- 1.5 degrees C) and 25, 50, and 80% relative humidity (RH). Sorbent material used included Tenax, graphitized carbon, and carbon molecular sieve (CMS). Sorbent tubes were challenged with 2, 4, 8, 12, and 24 L of air at various RHs. Sorbent tubes with CMS material performed poorly at both 50 and 80% RH dueto excessive sorption of water. Heating of CMS tubes during sampling or dry-purging of CMS tubes post sampling effectively reduced water sorption with heating of tubes being preferred due to the higher recovery and reproducibility. Tenaxtubes had breakthrough of the more volatile compounds and tended to form artifacts with increasing volumes of air sampled. Graphitized carbon sorbent tubes containing Carbopack X and Carbopack C performed best with quantitative recovery of all compounds at all RHs and sampling volumes tested. The graphitized carbon tubes were taken to the field for further testing. Field samples taken from inside swine feeding operations showed that butanoic acid, 4-methylphenol, 4-ethylphenol, indole, and 3-methylindole were the compounds detected most often above their odor threshold values. Field samples taken from a poultry facility demonstrated that butanoic acid, 3-methylbutanoic acid, and 4-methylphenol were the compounds above their odor threshold values detected most often, relative humidity, CAFO, VOC, SVOC, thermal desorption, swine, poultry, air quality, odor.

  12. Comparison of simulants to actual neutralized current acid waste: process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.; Elliott, M.L.

    1996-10-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs were established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste was performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property ,models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  13. Comparison of simulants to actual neutralized current acid waste: Process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.

    1996-04-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs have been established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste is being performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  14. External Validity of Contingent Valuation: Comparing Hypothetical and Actual Payments.

    PubMed

    Ryan, Mandy; Mentzakis, Emmanouil; Jareinpituk, Suthi; Cairns, John

    2016-10-09

    Whilst contingent valuation is increasingly used in economics to value benefits, questions remain concerning its external validity that is do hypothetical responses match actual responses? We present results from the first within sample field test. Whilst Hypothetical No is always an Actual No, Hypothetical Yes exceed Actual Yes responses. A constant rate of response reversals across bids/prices could suggest theoretically consistent option value responses. Certainty calibrations (verbal and numerical response scales) minimise hypothetical-actual discrepancies offering a useful solution. Helping respondents resolve uncertainty may reduce the discrepancy between hypothetical and actual payments and thus lead to more accurate policy recommendations. Copyright © 2016 John Wiley & Sons, Ltd.

  15. DESIGN, DEVELOPMENT AND FIELD DEPLOYMENT OF A TELEOPERATED SAMPLING SYSTEM

    SciTech Connect

    Dalmaso, M; Robert Fogle, R; Tony Hicks, T; Larry Harpring, L; Daniel Odell, D

    2007-11-09

    A teleoperated sampling system for the identification, collection and retrieval of samples following the detonation of an Improvised Nuclear Device (IND) or Radiological Dispersion Devise (RDD) has been developed and tested in numerous field exercises. The system has been developed as part of the Defense Threat Reduction Agency's (DTRA) National Technical Nuclear Forensic (NTNF) Program. The system is based on a Remotec ANDROS Mark V-A1 platform. Extensive modifications and additions have been incorporated into the platform to enable it to meet the mission requirements. The Defense Science Board Task Force on Unconventional Nuclear Warfare Defense, 2000 Summer Study Volume III report recommended the Department of Defense (DOD) improve nuclear forensics capabilities to achieve accurate and fast identification and attribution. One of the strongest elements of protection is deterrence through the threat of reprisal, but to accomplish this objective a more rapid and authoritative attribution system is needed. The NTNF program provides the capability for attribution. Early on in the NTNF program, it was recognized that there would be a desire to collect debris samples for analysis as soon as possible after a nuclear event. Based on nuclear test experience, it was recognized that mean radiation fields associated with even low yield events could be several thousand R/Hr near the detonation point for some time after the detonation. In anticipation of pressures to rapidly sample debris near the crater, considerable effort is being devoted to developing a remotely controlled vehicle that could enter the high radiation field area and collect one or more samples for subsequent analysis.

  16. Wide field of view multifocal scanning microscopy with sparse sampling

    NASA Astrophysics Data System (ADS)

    Wang, Jie; Wu, Jigang

    2016-02-01

    We propose to use sparsely sampled line scans with a sparsity-based reconstruction method to obtain images in a wide field of view (WFOV) multifocal scanning microscope. In the WFOV microscope, we used a holographically generated irregular focus grid to scan the sample in one dimension and then reconstructed the sample image from line scans by measuring the transmission of the foci through the sample during scanning. The line scans were randomly spaced with average spacing larger than the Nyquist sampling requirement, and the image was recovered with sparsity-based reconstruction techniques. With this scheme, the acquisition data can be significantly reduced and the restriction for equally spaced foci positions can be removed, indicating simpler experimental requirement. We built a prototype system and demonstrated the effectiveness of the reconstruction by recovering microscopic images of a U.S. Air Force target and an onion skin cell microscope slide with 40, 60, and 80% missing data with respect to the Nyquist sampling requirement.

  17. Comparison of aquatic macroinvertebrate samples collected using different field methods

    USGS Publications Warehouse

    Lenz, Bernard N.; Miller, Michael A.

    1996-01-01

    Government agencies, academic institutions, and volunteer monitoring groups in the State of Wisconsin collect aquatic macroinvertebrate data to assess water quality. Sampling methods differ among agencies, reflecting the differences in the sampling objectives of each agency. Lack of infor- mation about data comparability impedes data shar- ing among agencies, which can result in duplicated sampling efforts or the underutilization of avail- able information. To address these concerns, com- parisons were made of macroinvertebrate samples collected from wadeable streams in Wisconsin by personnel from the U.S. Geological Survey- National Water Quality Assessment Program (USGS-NAWQA), the Wisconsin Department of Natural Resources (WDNR), the U.S. Department of Agriculture-Forest Service (USDA-FS), and volunteers from the Water Action Volunteer-Water Quality Monitoring Program (WAV). This project was part of the Intergovernmental Task Force on Monitoring Water Quality (ITFM) Wisconsin Water Resources Coordination Project. The numbers, types, and environmental tolerances of the organ- isms collected were analyzed to determine if the four different field methods that were used by the different agencies and volunteer groups provide comparable results. Additionally, this study com- pared the results of samples taken from different locations and habitats within the same streams.

  18. Intended release and actual retention of alfalfa leafcutting bees (hymenoptera: megachilidae) for pollination in commercial alfalfa seed fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Low, medium, and high stocking densities of Megachile rotundata, the alfalfa leafcutting bee, were released over four years in three research plots of Utah alfalfa planted at seed-production rates. A low number of bees (46-79% of released) survived the incubation and field emergence processes, and ...

  19. Testing an Energy Balance Model for Estimating Actual Evapotranspiration Using Remotely Sensed Data. [Hannover, West Germany barley and wheat fields

    NASA Technical Reports Server (NTRS)

    Gurney, R. J.; Camillo, P. J.

    1985-01-01

    An energy-balance model is used to estimate daily evapotranspiration for 3 days for a barley field and a wheat field near Hannover, Federal Republic of Germany. The model was calibrated using once-daily estimates of surface temperatures, which may be remotely sensed. The evaporation estimates were within the 95% error bounds of independent eddy correlation estimates for the daytime periods for all three days for both sites, but the energy-balance estimates are generally higher; it is unclear which estimate is biassed. Soil moisture in the top 2 cm of soil, which may be remotely sensed, may be used to improve these evaporation estimates under partial ground cover. Sensitivity studies indicate the amount of ground data required is not excessive.

  20. Evaluation of membrane filter field monitors for microbiological air sampling

    NASA Technical Reports Server (NTRS)

    Fields, N. D.; Oxborrow, G. S.; Puleo, J. R.; Herring, C. M.

    1974-01-01

    Due to area constraints encountered in assembly and testing areas of spacecraft, the membrane filter field monitor (MF) and the National Aeronautics and Space Administration-accepted Reyniers slit air sampler were compared for recovery of airborne microbial contamination. The intramural air in a microbiological laboratory area and a clean room environment used for the assembly and testing of the Apollo spacecraft was studied. A significantly higher number of microorganisms was recovered by the Reyniers sampler. A high degree of consistency between the two sampling methods was shown by a regression analysis, with a correlation coefficient of 0.93. The MF samplers detected 79% of the concentration measured by the Reyniers slit samplers. The types of microorganisms identified from both sampling methods were similar.

  1. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field

    PubMed Central

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L.; Miloushev, Vesselin; Poot, Alex J.; Truong, Steven; Alvarez, Julio A.; Aldeborgh, Hannah N.; Keshari, Kayvan R.

    2016-01-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting 13C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength. PMID:27597137

  2. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field

    NASA Astrophysics Data System (ADS)

    Tee, Sui Seng; Digialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L.; Miloushev, Vesselin; Poot, Alex J.; Truong, Steven; Alvarez, Julio A.; Aldeborgh, Hannah N.; Keshari, Kayvan R.

    2016-09-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting 13C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength.

  3. [Status and actualization of tasks to improve the scientific-methodological and regulatory frameworks in the field of human ecology and environmental health].

    PubMed

    Rakhmanin, Iu A; Sinitsyna, O O

    2013-01-01

    Contemporary factors that affect the health of the population have been analyzed. There was shown the growing activity of chemical pollution of the environment. Therefore, in order to prevent the growth of negative health and environment consequences caused by increased levels of exposure to chemicals preventive potential for solutions of this complex problem and all strenuous efforts to assist possibly of the sound management of the chemicals should be enhanced. Problematic issues of harmonization of the Russian normative and guidance documents have been actualized. Perspective directions of science development in the field of human ecology and environmental health are suggested.

  4. Dimensioning IRGA gas sampling systems: laboratory and field experiments

    NASA Astrophysics Data System (ADS)

    Aubinet, Marc; Joly, Lilian; Loustau, Denis; De Ligne, Anne; Chopin, Henri; Cousin, Julien; Chauvin, Nicolas; Decarpenterie, Thomas; Gross, Patrick

    2016-03-01

    Both laboratory and field experiments were carried out in order to define suitable configuration ranges for the gas sampling systems (GSSs) of infrared gas analyzers (IRGAs) used in eddy covariance measurements.

    In the laboratory, an original dynamic calibration bench was developed in order to test the frequency attenuation and pressure drop generated by filters. In the field, three IRGAs of the same type equipped with different filters or different rain caps were installed and run and the real frequency response of the complete setup was tested. The main results are as follows. - Filters may have a strong impact on the pressure drop in the GSS and this impact increases with flow rate. - Conversely, no impact of the tested filters on cut-off frequency was found, GSSs with and without filters presenting similar cut-off frequencies. - The main limiting factor of cut-off frequency in the field was found to be the rain cap design. In addition, the impact of this design on pressure drop was also found to be noteworthy.

  5. Dimensioning IRGA gas sampling system : laboratory and field experiments

    NASA Astrophysics Data System (ADS)

    Aubinet, Marc; Joly, Lilian; Loustau, Denis; De Ligne, Anne; Chopin, Henri; Cousin, Julien; De Carpenterie, Thomas; Gross, Patrick; Chauvin, Nicolas

    2016-04-01

    Both laboratory and field experiments were carried out in order to define suitable configuration ranges for the gas sampling systems (GSS) of infrared gas analyzers (IRGA) used in eddy covariance measurements. In the laboratory, an original dynamic calibration bench was developed in order to test the frequency attenuation and pressure drop generated by filters. In the field, three IRGAs of the same type equipped with different filters or different rain caps were installed and run and the real frequency response of the complete set-up was tested. The main results are that: - Filters may have a strong impact on the pressure drop in the GSS and this impact increases with flow rate. - On the contrary, no impact of the tested filters on cut off frequency was found, GSS with and without filters presenting similar cut off frequencies. - The main limiting factor of cut off frequency in the field was found to be the rain cap design. In addition, the impact of this design on pressure drop was also found noteworthy.

  6. Field assisted hot pressing of sintering Inconel 718 MIM samples

    NASA Astrophysics Data System (ADS)

    Dugauguez, Olivier; Torralba, Jose Manuel; Barriere, Thierry; Gelin, Jean-Claude

    2016-10-01

    In this investigation on samples obtained by Metal Injection Molding (MIM), the conventional way of sintering in a furnace will be compared to Field Assisted Hot pressing (FAHP) sintering. The difficulty of this method is to be able to control the shrinkage of the sample and so its shape. It has yet not been investigated with a super alloy powder and so, the effects of a high sintering rate. By accelerating the sintering kinetics, the thermal behavior may be modified. Hence, the behavior of the Inconel 718 sintered by FAHP has been investigated. The sintered samples were all injected from a feedstock composed of a fine particle Inconel powder and a binder principally composed of Cellulose Acetate Butyrate CAB and Poly-Ethylene Glycol PEG. The effects of the two methods on the microstructure and the mechanical properties are then compared. There was no difference in distribution of pores between the conventional sintering and the FAHP sintering but a finer grain size showed better hardness.

  7. Actual Condition of Paddy Field Levee Maintenance by Various Farm Households including Large-scale Farming in the Developed Land Renting Area

    NASA Astrophysics Data System (ADS)

    Sakata, Yasuyo

    The survey of interview, resource acquisition, photographic operation, and questionnaire were carried out in the “n” Community in the “y” District in Hakusan City in Ishikawa Prefecture to investigate the actual condition of paddy field levee maintenance in the area where land-renting market was proceeding, large-scale farming was dominant, and the problems of geographically scattered farm-land existed. In the study zone, 1) an agricultural production legal person rent-cultivated some of the paddy fields and maintained the levees, 2) another agricultural production legal person rent-cultivated some of the soy bean fields for crop changeover and land owners maintained the levees. The results indicated that sufficient maintenance was executed on the levees of the paddy fields cultivated by the agricultural production legal person, the soy bean fields for crop changeover, and the paddy fields cultivated by the land owners. Each reason is considered to be the managerial strategy, the economic incentive, the mutual monitoring and cross-regulatory mechanism, etc.

  8. An Autosampler and Field Sample Carrier for Maximizing Throughput Using an Open-Air, Surface Sampling Ion Source for MS

    EPA Science Inventory

    A recently developed, commercially available, open-air, surface sampling ion source for mass spectrometers provides individual analyses in several seconds. To realize its full throughput potential, an autosampler and field sample carrier were designed and built. The autosampler ...

  9. A SAMPLE OF OB STARS THAT FORMED IN THE FIELD

    SciTech Connect

    Oey, M. S.; Lamb, J. B.; Kushner, C. T.; Pellegrini, E. W.; Graus, A. S.

    2013-05-01

    We present a sample of 14 OB stars in the Small Magellanic Cloud that meet strong criteria for having formed under extremely sparse star-forming conditions in the field. These stars are a minimum of 28 pc in projection from other OB stars, and they are centered within symmetric, round H II regions. They show no evidence of bow shocks, implying that the targets are not transverse runaway stars. Their radial velocities relative to local H I also indicate that they are not line-of-sight runaway stars. A friends-of-friends analysis shows that nine of the objects present a few low-mass companion stars, with typical mass ratios for the two highest-mass stars of around 0.1. This further substantiates that these OB stars formed in place, and that they can and do form in extremely sparse conditions. This poses strong constraints on theories of star formation and challenges proposed relations between cluster mass and maximum stellar mass.

  10. Effect of soil type patterns on the variability of bare soil evaporation within a field: comparison of eddy covariance measurements with potential and actual evaporation calculations

    NASA Astrophysics Data System (ADS)

    Vanderborght, J.; Graf, A.; Steenpass, C.; Scharnagl, B.; Prolingheuer, N.; Herbst, M.; Vereecken, H.

    2009-12-01

    Bare soil evaporation was measured with the eddy-covariance method at the Selhausen field site. The site has a distinct gradient in soil texture with a considerably higher stone content at the upper part of the field. Because of this gradient, a spatial variation in evaporation fluxes in the field is expected. Because of the higher stone content at the upper part of the field, it is expected that the water that is stored in the soil surface layer and can be evaporated at a maximal evaporation rate, which is determined by the energy that is available for evaporation, is considerable smaller in the upper than in the lower part of the field. We investigated whether this hypothesis is supported by eddy covariance (EC) measurements of the evaporation fluxes at the field site. The EC measurements were combined with a footprint model that predicts the location of the soil surface that contributes to the measured evaporation flux. In this way, evaporation measurements of the two parts of the field site could be distinguished. However, since only one EC station was available, simultaneous evaporation measurements for the two field parts were not available. As a consequence, the datasets of measurements had to be interpreted and put into context of the meteorological and soil hydrological conditions. The potential evapotranspiration was calculated using the FAO method (Allen et al., 1998) to represent the meteorological conditions whereas a simple soil evaporation model (Boesten and Stroosnijder, 1986) was used to represent the influence of the precipitation and soil hydrological conditions on the actual evaporation rate. Since different soil parameters were required to describe the evaporation measurements for the upper and lower part of the plot, our starting hypothesis that more water is evaporated in the lower part of the field could be confirmed. Allen, R. G., L. S. Pereira, D. Raes, and M. Smith (1998), Crop evapotranspiration: Guidelines for computing crop water

  11. COMPARISON OF USEPA FIELD SAMPLING METHODS FOR BENTHIC MACROINVERTEBRATE STUDIES

    EPA Science Inventory

    Two U.S. Environmental Protection Agency (USEPA) macroinvertebrate sampling protocols were compared in the Mid-Atlantic Highlands region. The Environmental Monitoring and Assessment Program (EMAP) wadeable streams protocol results in a single composite sample from nine transects...

  12. CTEPP NC DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Other Persistent...

  13. Field Evaluation of Personal Sampling Methods for Multiple Bioaerosols

    PubMed Central

    Wang, Chi-Hsun; Chen, Bean T.; Han, Bor-Cheng; Liu, Andrew Chi-Yeu; Hung, Po-Chen; Chen, Chih-Yong; Chao, Hsing Jasmine

    2015-01-01

    Ambient bioaerosols are ubiquitous in the daily environment and can affect health in various ways. However, few studies have been conducted to comprehensively evaluate personal bioaerosol exposure in occupational and indoor environments because of the complex composition of bioaerosols and the lack of standardized sampling/analysis methods. We conducted a study to determine the most efficient collection/analysis method for the personal exposure assessment of multiple bioaerosols. The sampling efficiencies of three filters and four samplers were compared. According to our results, polycarbonate (PC) filters had the highest relative efficiency, particularly for bacteria. Side-by-side sampling was conducted to evaluate the three filter samplers (with PC filters) and the NIOSH Personal Bioaerosol Cyclone Sampler. According to the results, the Button Aerosol Sampler and the IOM Inhalable Dust Sampler had the highest relative efficiencies for fungi and bacteria, followed by the NIOSH sampler. Personal sampling was performed in a pig farm to assess occupational bioaerosol exposure and to evaluate the sampling/analysis methods. The Button and IOM samplers yielded a similar performance for personal bioaerosol sampling at the pig farm. However, the Button sampler is more likely to be clogged at high airborne dust concentrations because of its higher flow rate (4 L/min). Therefore, the IOM sampler is a more appropriate choice for performing personal sampling in environments with high dust levels. In summary, the Button and IOM samplers with PC filters are efficient sampling/analysis methods for the personal exposure assessment of multiple bioaerosols. PMID:25799419

  14. A contemporary decennial global sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, E.; Roy, D. P.

    2011-12-01

    In the last several hundred years agriculture has caused significant human induced Land Cover Land Use Change (LCLUC) with dramatic cropland expansion and a marked increase in agricultural productivity. The size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLUC. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, diffusion of disease pathogens and pests, and loss or degradation in buffers to nutrient, herbicide and pesticide flows. In this study, globally distributed locations with significant contemporary field size change were selected guided by a global map of agricultural yield and literature review and were selected to be representative of different driving forces of field size change (associated with technological innovation, socio-economic conditions, government policy, historic patterns of land cover land use, and environmental setting). Seasonal Landsat data acquired on a decadal basis (for 1980, 1990, 2000 and 2010) were used to extract field boundaries and the temporal changes in field size quantified and their causes discussed.

  15. Estimation of Actual Crop ET of Paddy Using the Energy Balance Model SMARET and Validation with Field Water Balance Measurements and a Crop Growth Model (ORYZA)

    NASA Astrophysics Data System (ADS)

    Nallasamy, N. D.; Muraleedharan, B. V.; Kathirvel, K.; Narasimhan, B.

    2014-12-01

    Sustainable management of water resources requires reliable estimates of actual evapotranspiration (ET) at fine spatial and temporal resolution. This is significant in the case of rice based irrigation systems, one of the major consumers of surface water resources and where ET forms a major component of water consumption. However huge tradeoff in the spatial and temporal resolution of satellite images coupled with lack of adequate number of cloud free images within a growing season act as major constraints in deriving ET at fine spatial and temporal resolution using remote sensing based energy balance models. The scale at which ET is determined is decided by the spatial and temporal scale of Land Surface Temperature (LST) and Normalized Difference Vegetation Index (NDVI), which form inputs to energy balance models. In this context, the current study employed disaggregation algorithms (NL-DisTrad and DisNDVI) to generate time series of LST and NDVI images at fine resolution. The disaggregation algorithms aimed at generating LST and NDVI at finer scale by integrating temporal information from concurrent coarse resolution data and spatial information from a single fine resolution image. The temporal frequency of the disaggregated images is further improved by employing composite images of NDVI and LST in the spatio-temporal disaggregation method. The study further employed half-hourly incoming surface insolation and outgoing long wave radiation obtained from the Indian geostationary satellite (Kalpana-1) to convert the instantaneous ET into daily ET and subsequently to the seasonal ET, thereby improving the accuracy of ET estimates. The estimates of ET were validated with field based water balance measurements carried out in Gadana, a subbasin predominated by rice paddy fields, located in Tamil Nadu, India.

  16. CTEPP: RECRUITING AND FIELD SAMPLING IN NORTH CAROLINA AND OHIO

    EPA Science Inventory

    The research field study (CTEPP) of approximately 260 preschool children's exposures to persistent organic pollutants in their everyday environments began in early 2000. CTEPP is a multimedia study of the children's aggregate (total) exposures over a 48-hr period, both at thei...

  17. Procedures Used in Adjusting the Field Studies Sample.

    ERIC Educational Resources Information Center

    Bertram, Charles L.; And Others

    This paper describes procedures used to stratify and refine an original sample of 951 families with preschool children living in the Appalachia area, for a study to provide information on the target audience for Appalachia Educational Laboratory's Home-Oriented Preschool Education Program (HOPE). The procedure was to force-match the sample…

  18. An intelligent radiological instrument for field samples and contamination measurements

    NASA Astrophysics Data System (ADS)

    Drndarevic, Vujo R.; Djuric, Danko J.

    1993-09-01

    A new intelligent radiological instrument for fast and accurate measurements of mass α and β activities of samples of human and animal food and other materials and for the detection of surface contamination of different objects have been developed. The original concept of an iterative dialogue operator-instrument, based on the built-in intelligence into the instrument—has reduced to a minimum the chance of obtaining an erroneous result. The built-in intelligence specifies: the sequence of the measurements, the subsequence of selecting the necessary absorber for mass β activity measurement, the algorithms for all necessary calculations. Minimum detectable β activity of measured samples (40K) is 0.17 Bq/g with an error not exceeding ±30% and measurement time 1000 s. The sensitivity of α activity measurement is related to the method of sample preparation; it ranges from 0.04 up to 10 Bq/g, with a selectivity with respect to β activity exceeding 104.

  19. Field necropsy of cattle and diagnostic sample submission.

    PubMed

    Griffin, Dee

    2012-11-01

    Field necropsies can provide a wealth of information that can help guide production management decisions. Techniques outlined can allow a veterinary practitioner to complete a thorough necropsy of a bovine, including examination of the brain when indicated, in less than 20 minutes. An observation and history collection system using form templates and photographs is outlined that improves efficiency of recording necropsy results. One key to necropsy efficiency, speed, and enjoyment is having sharp knives. The first part of the article includes tips for sharpening knives. The article also includes detailed information on appropriate diagnostic specimen handling, packaging, and shipping.

  20. Tackling field-portable Raman spectroscopy of real world samples

    NASA Astrophysics Data System (ADS)

    Shand, Neil C.

    2008-10-01

    A major challenge confronting first responders, customs authorities and other security-related organisations is the accurate, rapid, and safe identification of potentially hazardous chemicals outside a laboratory environment. Currently, a range of hand portable Raman equipment is commercially available that is low cost and increasingly more sophisticated. These systems are generally based on the 785nm Stokes shifted Raman technique with many using dispersive grating spectrometers. This technique offers a broad range of capabilities including the ability to analyse illicit drugs, explosives, chemical weapons and pre-cursors but still has some fundamental constraints. 'Real world' samples, such as those found at a crime scene, will often not be presented in the most accessible manner. Simple issues such as glass fluorescence can make an otherwise tractable sample impossible to analyse in-situ. A new generation of portable Raman equipment is currently being developed to address these issues. Consideration is given to the use of longer wavelength for fluorescence reduction. Alternative optical designs are being tested to compensate for the signal reduction incurred by moving to longer wavelengths. Furthermore, the use of anti-Stokes spectroscopy is being considered as well as investigating the robustness and portability of traditional Fourier Transform interferometer designs along with future advances in detector technology and ultra small spectrometers.

  1. Sampling of soil moisture fields and related errors: implications to the optimal sampling design

    NASA Astrophysics Data System (ADS)

    Yoo, Chulsang

    Adequate knowledge of soil moisture storage as well as evaporation and transpiration at the land surface is essential to the understanding and prediction of the reciprocal influences between land surface processes and weather and climate. Traditional techniques for soil moisture measurements are ground-based, but space-based sampling is becoming available due to recent improvement of remote sensing techniques. A fundamental question regarding the soil moisture observation is to estimate the sampling error for a given sampling scheme [G.R. North, S. Nakamoto, J Atmos. Ocean Tech. 6 (1989) 985-992; G. Kim, J.B. Valdes, G.R. North, C. Yoo, J. Hydrol., submitted]. In this study we provide the formalism for estimating the sampling errors for the cases of ground-based sensors and space-based sensors used both separately and together. For the study a model for soil moisture dynamics by D. Entekhabi, I. Rodriguez-Iturbe [Adv. Water Res. 17 (1994) 35-45] is introduced and an example application is given to the Little Washita basin using the Washita '92 soil moisture data. As a result of the study we found that the ground-based sensor network is ineffective for large or continental scale observation, but should be limited to a small-scale intensive observation such as for a preliminary study.

  2. Assessment of sampling and analytical uncertainty of trace element contents in arable field soils.

    PubMed

    Buczko, Uwe; Kuchenbuch, Rolf O; Ubelhör, Walter; Nätscher, Ludwig

    2012-07-01

    Assessment of trace element contents in soils is required in Germany (and other countries) before sewage sludge application on arable soils. The reliability of measured element contents is affected by measurement uncertainty, which consists of components due to (1) sampling, (2) laboratory repeatability (intra-lab) and (3) reproducibility (between-lab). A complete characterization of average trace element contents in field soils should encompass the uncertainty of all these components. The objectives of this study were to elucidate the magnitude and relative proportions of uncertainty components for the metals As, B, Cd, Co, Cr, Mo, Ni, Pb, Tl and Zn in three arable fields of different field-scale heterogeneity, based on a collaborative trial (CT) (standardized procedure) and two sampling proficiency tests (PT) (individual sampling procedure). To obtain reference values and estimates of field-scale heterogeneity, a detailed reference sampling was conducted. Components of uncertainty (sampling person, sampling repetition, laboratory) were estimated by variance component analysis, whereas reproducibility uncertainty was estimated using results from numerous laboratory proficiency tests. Sampling uncertainty in general increased with field-scale heterogeneity; however, total uncertainty was mostly dominated by (total) laboratory uncertainty. Reproducibility analytical uncertainty was on average by a factor of about 3 higher than repeatability uncertainty. Therefore, analysis within one single laboratory and, for heterogeneous fields, a reduction of sampling uncertainty (for instance by larger numbers of sample increments and/or a denser coverage of the field area) would be most effective to reduce total uncertainty. On the other hand, when only intra-laboratory analytical uncertainty was considered, total sampling uncertainty on average prevailed over analytical uncertainty by a factor of 2. Both sampling and laboratory repeatability uncertainty were highly variable

  3. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 32 National Defense 1 2014-07-01 2014-07-01 false Application of 4-Week Summer Field Training Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  4. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 1 2011-07-01 2011-07-01 false Application of 4-Week Summer Field Training Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  5. Sample-Induced RF Perturbations in High-Field, High-Resolution NMR Spectroscopy

    NASA Astrophysics Data System (ADS)

    Crozier, Stuart; Brereton, Ian M.; Zelaya, Fernando O.; Roffmann, Wolfgang U.; Doddrell, David M.

    1997-05-01

    Conducting dielectric samples are often used in high-resolution experiments at high field. It is shown that significant amplitude and phase distortions of the RF magnetic field may result from perturbations caused by such samples. Theoretical analyses demonstrate the spatial variation of the RF field amplitude and phase across the sample, and comparisons of the effect are made for a variety of sample properties and operating field strengths. Although the effect is highly nonlinear, it tends to increase with increasing field strength, permittivity, conductivity, and sample size. There are cases, however, in which increasing the conductivity of the sample improves the homogeneity of the amplitude of the RF field across the sample at the expense of distorted RF phase. It is important that the perturbation effects be calculated for the experimental conditions used, as they have the potential to reduce the signal-to-noise ratio of NMR experiments and may increase the generation of spurious coherences. The effect of RF-coil geometry on the coherences is also modeled, with the use of homogeneous resonators such as the birdcage design being preferred. Recommendations are made concerning methods of reducing sample-induced perturbations. Experimental high-field imaging and high-resolution studies demonstrate the effect.

  6. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    SciTech Connect

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  7. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS?

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  8. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS ? (ABSTRACT)

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  9. A laboratory and field evaluation of a portable immunoassay test for triazine herbicides in environmental water samples

    USGS Publications Warehouse

    Schulze, P.A.; Capel, P.D.; Squillace, P.J.; Helsel, D.R.

    1993-01-01

    The usefulness and sensitivity, of a portable immunoassay test for the semiquantitative field screening of water samples was evaluated by means of laboratory and field studies. Laboratory results indicated that the tests were useful for the determination of atrazine concentrations of 0.1 to 1.5 μg/L. At a concentration of 1 μg/L, the relative standard deviation in the difference between the regression line and the actual result was about 40 percent. The immunoassay was less sensitive and produced similar errors for other triazine herbicides. After standardization, the test results were relatively insensitive to ionic content and variations in pH (range, 4 to 10), mildly sensitive to temperature changes, and quite sensitive to the timing of the final incubation step, variances in timing can be a significant source of error. Almost all of the immunoassays predicted a higher atrazine concentration in water samples when compared to results of gas chromatography. If these tests are used as a semiquantitative screening tool, this tendency for overprediction does not diminish the tests' usefulness. Generally, the tests seem to be a valuable method for screening water samples for triazine herbicides.

  10. Communication: Multiple atomistic force fields in a single enhanced sampling simulation

    SciTech Connect

    Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H.

    2015-07-14

    The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.

  11. Sample Optimization for Five Plant-Parasitic Nematodes in an Alfalfa Field

    PubMed Central

    Goodell, P. B.; Ferris, H.

    1981-01-01

    A data base representing nematode counts and soil weight from 1,936 individual soil cores taken from a 7-ha alfalfa field was used to investigate sample optimization for five plant-parasitic nematodes: Meloidogyne arenaria, Pratylenchus minyus, Merlinius brevidens, Helicotylenchus digonicus, and Paratrichodorus minor. Sample plans were evaluated by the accuracy and reliability of their estimation of the population and by the cost of collecting, processing, and counting the samples. Interactive FORTRAN programs were constructed to simulate four collecting patterns: random; division of the field into square sub-units (cells); and division of the field into rectangular sub-traits (strips) running in two directions. Depending on the pattern, sample numbers varied from 1 to 25 with each sample representing from 1 to 50 cores. Each pattern, sample, and core combination was replicated 50 times. Strip stratification north/south was the most optimal sampling pattern in this field because it isolated a streak of fine-textured soil. The mathematical optimmn was not found because of data range limitations. When practical economic time constraints (5 hr to collect, process, and count nematode samples) are placed on the optimization process, all species estimates deviate no more than 25 % from the true mean. If accuracy constraints are placed on the process (no more than 15% deviation from true field mean), all species except Merlinius required less than 5 hr to complete the sample process. PMID:19300768

  12. Field Sampling and Selecting On-Site Analytical Methods for Explosives in Soil

    EPA Pesticide Factsheets

    The purpose of this issue paper is to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods fordetecting and quantifying secondary explosive compounds in soils.

  13. Acupuncture injection for field amplified sample stacking and glass microchip-based capillary gel electrophoresis.

    PubMed

    Ha, Ji Won; Hahn, Jong Hoon

    2017-02-01

    Acupuncture sample injection is a simple method to deliver well-defined nanoliter-scale sample plugs in PDMS microfluidic channels. This acupuncture injection method in microchip CE has several advantages, including minimization of sample consumption, the capability of serial injections of different sample solutions into the same microchannel, and the capability of injecting sample plugs into any desired position of a microchannel. Herein, we demonstrate that the simple and cost-effective acupuncture sample injection method can be used for PDMS microchip-based field amplified sample stacking in the most simplified straight channel by applying a single potential. We achieved the increase in electropherogram signals for the case of sample stacking. Furthermore, we present that microchip CGE of ΦX174 DNA-HaeⅢ digest can be performed with the acupuncture injection method on a glass microchip while minimizing sample loss and voltage control hardware.

  14. COMPARISON OF TWO FIELD SAMPLING PROCEDURES (EN CORE AND FIELD METHANOL EXTRACTION) FOR VOLATILE ORGANIC COMPOUNDS

    EPA Science Inventory

    In-situ Lasagna technology was recently evaluated at a contaminated site at Offutt Air Force Base. The site was contaminated with low levels (< 30 mg/kg) of volatile organic compounds (VOCs). Originally, researchers planned to use field methanol extraction for both pre- and pos...

  15. Spruce budworm sampling program for Husky Hunter Field data recorders. Forest Service research note

    SciTech Connect

    Schmidt, F.H.

    1993-07-01

    A program for receiving sampling data for all immature stages of the western spruce budworm (Choristoneua occidentalis Freeman) is described. Versions were designed to be used on field data recorders with either CP/M or DOS operating systems, such as the HUSKY HUNTER (Models 1, 2, and 16), but they also may be used on personal computers with compatible operating systems. The program allows the user to review the current plot statistics, including sampling precision, at any time while still sampling the plot. It also allows the user to determine how many more trees need to be sampled to arrive at a sampling precision specified by the user.

  16. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  17. Improvement in day zero recoveries in field soil dissipation studies using larger diameter soil samples.

    PubMed

    Sharma, Ashok K; Strek, Harry J; Barefoot, Aldos C

    2014-05-07

    Obtaining acceptable recovery of the applied test substance at zero time in field soil dissipation studies has been a subject of considerable interest among scientists conducting regulatory field studies. In particular, achieving recoveries of ≥90% in soil samples collected immediately after applications in most studies has been elusive. This study investigated a modified soil sampling method, which could be used not only on day zero but for the entire study duration, to see if the recoveries in soil samples, especially in the early stages, can be improved. The modified sampling system has demonstrated that recoveries averaging 90% are possible and can be routinely obtained on day zero. Description of this modified sampling procedure and statistical analysis of the data collected for day zero samples are discussed.

  18. Development of an Evaluation System for Vertical Vibration of Railway Vehicles with Field-Portable Actuators (2nd Report, Excitation Tests of an Actual Commuter Vehicle)

    NASA Astrophysics Data System (ADS)

    Takigami, Tadao; Tomioka, Takahiro

    Bending vibration characteristics of railway vehicles have been investigated in general under excitation tests, in which a carbody was directly excited by a shaker. It is however very difficult with their results to evaluate the ride quality of passengers under conditions that the vehicle runs on a certain track. The authors are therefore developing an evaluation system for vertical vibration of railway vehicles. This system consists of an excitation system equipped with linear actuators, the elastic supporting device installed between wheels and rails, and analytical techniques to estimate the power spectral density (PSD) and the ride quality level (LT) which feature the ride quality. In this paper, we describe the excitation tests performed using an actual commuter car and the estimated PSD and LT are compared with what substantially measured under the running conditions.

  19. A field sampling strategy for semivariogram inference of fractures in rock outcrops

    SciTech Connect

    Ryan M. Pollyea; Jerry P. Fairley; Robert K. Podgorney; Travis L. Mcling

    2013-10-01

    The stochastic continuum (SC) representation is one common approach for simulating the effects of fracture heterogeneity in groundwater flow and transport models. These SC reservoir models are generally developed using geostatistical methods (e.g., kriging or sequential simulation) that rely on the model semivariogram to describe the spatial variability of each continuum. Although a number of strategies for sampling spatial distributions have been published in the literature, little attention has been paid to the optimization of sampling in resource- or access-limited environments. Here we present a strategy for estimating the minimum sample spacing needed to define the spatial distribution of fractures on a vertical outcrop of basalt, located in the Box Canyon, east Snake River Plain, Idaho. We used fracture maps of similar basalts from the published literature to test experimentally the effects of different sample spacings on the resulting semivariogram model. Our final field sampling strategy was based on the lowest sample density that reproduced the semivariogram of the exhaustively sampled fracture map. Application of the derived sampling strategy to an outcrop in our field area gave excellent results, and illustrates the utility of this type of sample optimization. The method will work for developing a sampling plan for any intensive property, provided prior information for a similar domain is available; for example, fracture maps or ortho-rectified photographs from analogous rock types could be used to plan for sampling of a fractured rock outcrop.

  20. QC of sampling processes- a first overview: from field to test portion.

    PubMed

    Esbensen, Kim H; Ramsey, Charles A

    2015-01-01

    Quality control (QC) is a systematic approach for estimating and minimizing significant error contributions to the measurement uncertainty from the full sampling and analysis process. Many types of QC measures can be implemented; the three dealt with here are primary sampling reproducibility, sample processing reproducibility, and contamination. Sampling processes can be subject to QC by applying a replication experiment, used either from the top by replication of the entire sampling/ preparation/analysis process, or in a hierarchical fashion successively at each subsequent sampling stage. The analytical repeatability is necessarily always included in either alternative. The replication experiment results in a quality index, the Relative Sampling Variability, which is used to assess the total error associated with the full field-to-analysis pathway. Contamination can occur at essentially all locations in the sampling regimen in the food/feed realm, affecting sample containers, sampling tools, sample processing equipment, environmental conditions, and sampling personnel. QC events to determine contamination should always be included where appropriate, but is of most concern for low concentration and/or volatile analytes. It is also of key importance in the development of new sampling protocols or carried-over protocols intended for use on new types of materials/lots than the ones for which they were originally developed. We here establish a first practical framework for QC as applied to the sampling context.

  1. Development of a Near-Field Scanning Optical Microscope for Imaging Biological Samples in Physiological Buffer

    NASA Astrophysics Data System (ADS)

    Seibel, Eric Jeffrey

    A near-field scanning optical microscope was constructed for imaging intact biological samples in physiological buffer at a resolution beyond the optical diffraction limit. Images are formed by raster scanning the sample within the near -field of the optical probe, which emits collimated light for a limited distance. The technical challenges that were encountered were making the probe, micropositioning the probe and sample with piezoelectrics, and maintaining the sample-probe separation to within the near-field ( <200 nm). By recording the measurement of probe-sample separation during a scan, a topographic image is generated simultaneously with the near-field optical image. The microscope having both imaging modalities was tested and judged fully operational by imaging fluorescently -labeled microspheres under water. The potential of near-field scanning optical microscopy for future biological research was investigated by imaging a fluorescently-labeled, biological test specimen, the single myofibril. Imaging the intact myofibril in buffered saline without chemical fixation provides a challenging, practical test for the microscope. Near-field fluorescence and topographic images of single myofibrils produced image resolution of <=q300 nm, versus ~500 nm for conventional optical microscopy. Interpretation of the images is facilitated by the protein-specific fluorescence labeling. Increasing sample thickness degrades the resolution of the fluorescence images only. Thus, biological samples having > 1 μm thickness, are the practical limit of sample thickness for generating high resolution near-field optical images, when fluorescence is collected in transmission. In contrast, the method of generating the topographic images (called lateral shear-force microscopy), has the advantage of being insensitive to sample thickness. In the topographic images of myofibrils, the change in topography and/or stiffness from the binding of antibodies was detected. The results of this

  2. Use of enveloping distribution sampling to evaluate important characteristics of biomolecular force fields.

    PubMed

    Huang, Wei; Lin, Zhixiong; van Gunsteren, Wilfred F

    2014-06-19

    The predictive power of biomolecular simulation critically depends on the quality of the force field or molecular model used and on the extent of conformational sampling that can be achieved. Both issues are addressed. First, it is shown that widely used force fields for simulation of proteins in aqueous solution appear to have rather different propensities to stabilize or destabilize α-, π-, and 3(10)- helical structures, which is an important feature of a biomolecular force field due to the omni-presence of such secondary structure in proteins. Second, the relative stability of secondary structure elements in proteins can only be computationally determined through so-called free-energy calculations, the accuracy of which critically depends on the extent of configurational sampling. It is shown that the method of enveloping distribution sampling is a very efficient method to extensively sample different parts of configurational space.

  3. The Course of Actualization

    ERIC Educational Resources Information Center

    De Smet, Hendrik

    2012-01-01

    Actualization is traditionally seen as the process following syntactic reanalysis whereby an item's new syntactic status manifests itself in new syntactic behavior. The process is gradual in that some new uses of the reanalyzed item appear earlier or more readily than others. This article accounts for the order in which new uses appear during…

  4. Magneto-optic imaging: Normal and parallel field components of in-plane magnetized samples

    NASA Astrophysics Data System (ADS)

    Ferrari, H.; Bekeris, V.; Thibeault, M.; Johansen, T. H.

    2007-06-01

    Magneto-optical (MO) imaging has become a powerful tool for determining magnetic properties of materials by detecting the stray magnetic fields. The technique consists in measuring the Faraday rotation, θF, in the light polarization plane when light travels through a transparent sensitive garnet (ferrite garnet film, FGF) placed in close contact to the sample. For in-plane magnetized samples, the MO image is not trivially related to the sample magnetization, and to contribute to this understanding we have imaged commercial audio tapes in which computer-generated functions were recorded. We present MO images of periodically in-plane magnetized tapes with square, sawtooth, triangular and sinusoidal waveforms, for which we analytically calculate the perpendicular and parallel stray magnetic field components generated by the tape. As a first approach we correlate the measured light intensity with the perpendicular magnetic field component at the FGF, and we show that it can be approximated to the gradient of the sample magnetization. A more detailed calculation, taking into account the effect of both field components in the Faraday rotation, is presented and satisfactorily compared with the obtained MO images. The presence of magnetic domains in the garnet is shown to be related to the change in sign of the parallel component of the stray magnetic field, which can be approximated to the second derivative of the sample magnetization.

  5. HRJCOSY: A three-dimensional NMR method for measuring complex samples in inhomogeneous magnetic fields

    NASA Astrophysics Data System (ADS)

    Huang, Yuqing; Zhang, Zhiyong; Wang, Kaiyu; Cai, Shuhui; Chen, Zhong

    2014-08-01

    Three-dimensional (3D) NMR plays an important role in structural elucidations of complex samples, whereas difficulty remains in its applications to inhomogeneous fields. Here, we propose an NMR approach based on intermolecular zero-quantum coherences (iZQCs) to obtain high-resolution 3D J-resolved-COSY spectra in inhomogeneous fields. Theoretical analyses are presented for verifying the proposed method. Experiments on a simple chemical solution and a complex brain phantom are performed under non-ideal field conditions to show the ability of the proposed method. This method is an application of iZQCs to high-resolution 3D NMR, and is useful for studies of complex samples in inhomogeneous fields.

  6. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  7. Toxicity evaluation of natural samples from the vicinity of rice fields using two trophic levels.

    PubMed

    Marques, Catarina R; Pereira, Ruth; Gonçalves, Fernando

    2011-09-01

    An ecotoxicological screening of environmental samples collected in the vicinity of rice fields followed a combination of physical and chemical measurements and chronic bioassays with two freshwater trophic levels (microalgae: Pseudokirchneriella subcapitata and Chlorella vulgaris; daphnids: Daphnia longispina and Daphnia magna). As so, water and sediment/soil elutriate samples were obtained from three sites: (1) in a canal reach crossing a protected wetland upstream, (2) in a canal reach surrounded by rice fields and (3) in a rice paddy. The sampling was performed before and during the rice culture. During the rice cropping, the whole system quality decreased comparatively to the situation before that period (e.g. nutrient overload, the presence of pesticides in elutriates from sites L2 and L3). This was reinforced by a significant inhibition of both microalgae growth, especially under elutriates. Contrary, the life-history traits of daphnids were significantly stimulated with increasing concentrations of water and elutriates, for both sampling periods.

  8. Quantitative Field Testing Heterodera glycines from Metagenomic DNA Samples Isolated Directly from Soil under Agronomic Production

    PubMed Central

    Li, Yan; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil. PMID:24587100

  9. Problems with sampling desert tortoises: A simulation analysis based on field data

    USGS Publications Warehouse

    Freilich, J.E.; Camp, R.J.; Duda, J.J.; Karl, A.E.

    2005-01-01

    The desert tortoise (Gopherus agassizii) was listed as a U.S. threatened species in 1990 based largely on population declines inferred from mark-recapture surveys of 2.59-km2 (1-mi2) plots. Since then, several census methods have been proposed and tested, but all methods still pose logistical or statistical difficulties. We conducted computer simulations using actual tortoise location data from 2 1-mi2 plot surveys in southern California, USA, to identify strengths and weaknesses of current sampling strategies. We considered tortoise population estimates based on these plots as "truth" and then tested various sampling methods based on sampling smaller plots or transect lines passing through the mile squares. Data were analyzed using Schnabel's mark-recapture estimate and program CAPTURE. Experimental subsampling with replacement of the 1-mi2 data using 1-km2 and 0.25-km2 plot boundaries produced data sets of smaller plot sizes, which we compared to estimates from the 1-mi 2 plots. We also tested distance sampling by saturating a 1-mi 2 site with computer simulated transect lines, once again evaluating bias in density estimates. Subsampling estimates from 1-km2 plots did not differ significantly from the estimates derived at 1-mi2. The 0.25-km2 subsamples significantly overestimated population sizes, chiefly because too few recaptures were made. Distance sampling simulations were biased 80% of the time and had high coefficient of variation to density ratios. Furthermore, a prospective power analysis suggested limited ability to detect population declines as high as 50%. We concluded that poor performance and bias of both sampling procedures was driven by insufficient sample size, suggesting that all efforts must be directed to increasing numbers found in order to produce reliable results. Our results suggest that present methods may not be capable of accurately estimating desert tortoise populations.

  10. Actual extension of sinkholes: Considerations about geophysical, geomorphological, and field inspection techniques in urban planning projects in the Ebro basin (NE Spain)

    NASA Astrophysics Data System (ADS)

    Pueyo Anchuela, Ó.; Pocoví Juan, A.; Casas-Sainz, A. M.; Ansón-López, D.; Gil-Garbi, H.

    2013-05-01

    Aerial photographs, historical cartographies, and field inspection are useful tools in urban planning design on mantled karst because they permit a wide time interval to be analyzed. In the case of Zaragoza city, several works have confirmed the interest of these approaches in configuring the urban planning code and therefore represent a promising technique. Nevertheless, some caveats should be taken into account when using this kind of information. A detailed analysis is presented comparing (in a case study from the surroundings of Zaragoza) geomorphological, historical analysis, and field inspection with geophysical data. Field inspection in a noncultivated area permits the constraint of the presence of karst indicators below the geomorphological resolution of aerial photographs and shows results consistent with geophysical surveys. The studied case shows an inner zone coinciding with the sinkhole mapped from aerial photographs that correlates with changes in the position of the substratum and changes in thickness of alluvial sediments. The integrated analysis permits us to define an external subsidence ring around the geomorphological sinkhole whose surface is twice the size of the inner zone. This outer ring is indicated by geometrical changes in GPR profiles, increases of thickness of the conductive shallower unit toward the collapse, and small collapses on marginal cracks. These results support the higher extension of karst hazards linked to sinkholes with respect to their geomorphological expression and the needed detailed analysis to constrain the real sinkhole size or the use of security radii surrounding this surficial evidence when geomorphological data is used for the hazard analyses or the urban planning at karstic zones.

  11. Backflushing Filters for Field Processing of Water Samples Prior to Trace-Element Analyses

    USGS Publications Warehouse

    Kennedy, V.C.; Jenne, E.A.; Burchard, J.M.

    1976-01-01

    A portable unit is described for filtering water samples at field sites in such a manner that the filtrate is suitable for analysis not only of major constituents but also of trace elments at the mocrogram-per-liter level. A battery-operated peristaltic pump forces the water sample through medical-grade silicone tubing into and through an all-plastic in-line filter which can be backflushed when sediment clogs the filter membrane. Initial filtration rate exceeds 500 milliliter/minute and, because of the backflushing feature, a total time for filtering high-sediment-bearing waster samples is greatly reduced. (Woodard-USGS)

  12. Intact preservation of environmental samples by freezing under an alternating magnetic field.

    PubMed

    Morono, Yuki; Terada, Takeshi; Yamamoto, Yuhji; Xiao, Nan; Hirose, Takehiro; Sugeno, Masaya; Ohwada, Norio; Inagaki, Fumio

    2015-04-01

    The study of environmental samples requires a preservation system that stabilizes the sample structure, including cells and biomolecules. To address this fundamental issue, we tested the cell alive system (CAS)-freezing technique for subseafloor sediment core samples. In the CAS-freezing technique, an alternating magnetic field is applied during the freezing process to produce vibration of water molecules and achieve a stable, super-cooled liquid phase. Upon further cooling, the temperature decreases further, achieving a uniform freezing of sample with minimal ice crystal formation. In this study, samples were preserved using the CAS and conventional freezing techniques at 4, -20, -80 and -196 (liquid nitrogen) °C. After 6 months of storage, microbial cell counts by conventional freezing significantly decreased (down to 10.7% of initial), whereas that by CAS-freezing resulted in minimal. When Escherichia coli cells were tested under the same freezing conditions and storage for 2.5 months, CAS-frozen E. coli cells showed higher viability than the other conditions. In addition, an alternating magnetic field does not impact on the direction of remanent magnetization in sediment core samples, although slight partial demagnetization in intensity due to freezing was observed. Consequently, our data indicate that the CAS technique is highly useful for the preservation of environmental samples.

  13. Using object-based image analysis to guide the selection of field sample locations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the most challenging tasks for resource management and research is designing field sampling schemes to achieve unbiased estimates of ecosystem parameters as efficiently as possible. This study focused on the potential of fine-scale image objects from object-based image analysis (OBIA) to be u...

  14. Laboratory spectra of field samples as a check on two atmospheric correction methods

    NASA Technical Reports Server (NTRS)

    Xu, Pung; Greeley, Ronald

    1993-01-01

    Atmospheric correction is the first step toward quantitative analysis of imaging spectroscopy data. Two methods, MODTRAN model and the empirical line, were used to convert AVIRIS radiance values to reflectance values. A set of laboratory spectra of field samples corresponding to AVIRIS coverage was used to assess these methods. This will also serve to select bands for future quantative analyses.

  15. Modification and Application of a Leaf Blower-vac for Field Sampling of Arthropods

    PubMed Central

    Zou, Yi; van Telgen, Mario D.; Chen, Junhui; Xiao, Haijun; de Kraker, Joop; Bianchi, Felix J. J. A.; van der Werf, Wopke

    2016-01-01

    Rice fields host a large diversity of arthropods, but investigating their population dynamics and interactions is challenging. Here we describe the modification and application of a leaf blower-vac for suction sampling of arthropod populations in rice. When used in combination with an enclosure, application of this sampling device provides absolute estimates of the populations of arthropods as numbers per standardized sampling area. The sampling efficiency depends critically on the sampling duration. In a mature rice crop, a two-minute sampling in an enclosure of 0.13 m2 yields more than 90% of the arthropod population. The device also allows sampling of arthropods dwelling on the water surface or the soil in rice paddies, but it is not suitable for sampling fast flying insects, such as predatory Odonata or larger hymenopterous parasitoids. The modified blower-vac is simple to construct, and cheaper and easier to handle than traditional suction sampling devices, such as D-vac. The low cost makes the modified blower-vac also accessible to researchers in developing countries. PMID:27584040

  16. Modification and Application of a Leaf Blower-vac for Field Sampling of Arthropods.

    PubMed

    Zou, Yi; van Telgen, Mario D; Chen, Junhui; Xiao, Haijun; de Kraker, Joop; Bianchi, Felix J J A; van der Werf, Wopke

    2016-08-10

    Rice fields host a large diversity of arthropods, but investigating their population dynamics and interactions is challenging. Here we describe the modification and application of a leaf blower-vac for suction sampling of arthropod populations in rice. When used in combination with an enclosure, application of this sampling device provides absolute estimates of the populations of arthropods as numbers per standardized sampling area. The sampling efficiency depends critically on the sampling duration. In a mature rice crop, a two-minute sampling in an enclosure of 0.13 m(2) yields more than 90% of the arthropod population. The device also allows sampling of arthropods dwelling on the water surface or the soil in rice paddies, but it is not suitable for sampling fast flying insects, such as predatory Odonata or larger hymenopterous parasitoids. The modified blower-vac is simple to construct, and cheaper and easier to handle than traditional suction sampling devices, such as D-vac. The low cost makes the modified blower-vac also accessible to researchers in developing countries.

  17. Sampling and Reconstruction of the Pupil and Electric Field for Phase Retrieval

    NASA Technical Reports Server (NTRS)

    Dean, Bruce; Smith, Jeffrey; Aronstein, David

    2012-01-01

    This technology is based on sampling considerations for a band-limited function, which has application to optical estimation generally, and to phase retrieval specifically. The analysis begins with the observation that the Fourier transform of an optical aperture function (pupil) can be implemented with minimal aliasing for Q values down to Q = 1. The sampling ratio, Q, is defined as the ratio of the sampling frequency to the band-limited cut-off frequency. The analytical results are given using a 1-d aperture function, and with the electric field defined by the band-limited sinc(x) function. Perfect reconstruction of the Fourier transform (electric field) is derived using the Whittaker-Shannon sampling theorem for 1sampling ratio such that 1field with no aliasing, which has been extended to 2-d optical apertures.

  18. Field spectroscopy sampling strategies for improved measurement of Earth surface reflectance

    NASA Astrophysics Data System (ADS)

    Mac Arthur, A.; Alonso, L.; Malthus, T. J.; Moreno, J. F.

    2013-12-01

    Over the last two decades extensive networks of research sites have been established to measure the flux of carbon compounds and water vapour between the Earth's surface and the atmosphere using eddy covariance (EC) techniques. However, contributing Earth surface components cannot be determined and (as the ';footprints' are spatially constrained) these measurements cannot be extrapolated to regional cover using this technique. At many of these EC sites researchers have been integrating spectral measurements with EC and ancillary data to better understand light use efficiency and carbon dioxide flux. These spectroscopic measurements could also be used to assess contributing components and provide support for imaging spectroscopy, from airborne or satellite platforms, which can provide unconstrained spatial cover. Furthermore, there is an increasing interest in ';smart' database and information retrieval systems such as that proposed by EcoSIS and OPTIMISE to store, analyse, QA and merge spectral and biophysical measurements and provide information to end users. However, as Earth surfaces are spectrally heterogeneous and imaging and field spectrometers sample different spatial extents appropriate field sampling strategies require to be adopted. To sample Earth surfaces spectroscopists adopt either single; random; regular grid; transect; or 'swiping' point sampling strategies, although little comparative work has been carried out to determine the most appropriate approach; the work by Goetz (2012) is a limited exception. Mac Arthur et al (2012) demonstrated that, for two full wavelength (400 nm to 2,500 nm) field spectroradiometers, the measurement area sampled is defined by each spectroradiometer/fore optic system's directional response function (DRF) rather than the field-of-view (FOV) specified by instrument manufacturers. Mac Arthur et al (2012) also demonstrated that each reflecting element within the sampled area was not weighted equally in the integrated

  19. Information Content of the Near-Field I: Two-Dimensional Samples

    NASA Technical Reports Server (NTRS)

    Frazin, Richard A.; Fischer, David G.; Carney, P. Scott

    2004-01-01

    Limits on the effective resolution of many optical near-field experiments are investigated. The results are applicable to variants of total-internal-reflection microscopy (TIRM), photon-scanning-tunneling microscopy (PSTM), and near-field-scanning-optical microscopy (NSOM) in which the sample is weakly scattering and the direction of illumination may be controlled. Analytical expressions for the variance of the estimate of the complex susceptibility of an unknown two-dimensional object as a function of spatial frequency are obtained for Gaussian and Poisson noise models, and a model-independent measure is examined. The results are used to explore the transition from near-zone to far-zone detection. It is demonstrated that the information content of the measurements made at a distance of even one wavelength away from the sample is already not much different from the information content of the far field. Copyright 2004 Optical Society of America

  20. Potential, velocity, and density fields from sparse and noisy redshift-distance samples - Method

    NASA Technical Reports Server (NTRS)

    Dekel, Avishai; Bertschinger, Edmund; Faber, Sandra M.

    1990-01-01

    A method for recovering the three-dimensional potential, velocity, and density fields from large-scale redshift-distance samples is described. Galaxies are taken as tracers of the velocity field, not of the mass. The density field and the initial conditions are calculated using an iterative procedure that applies the no-vorticity assumption at an initial time and uses the Zel'dovich approximation to relate initial and final positions of particles on a grid. The method is tested using a cosmological N-body simulation 'observed' at the positions of real galaxies in a redshift-distance sample, taking into account their distance measurement errors. Malmquist bias and other systematic and statistical errors are extensively explored using both analytical techniques and Monte Carlo simulations.

  1. Sampling the sound field in auditoria using large natural-scale array measurements.

    PubMed

    Witew, Ingo B; Vorländer, Michael; Xiang, Ning

    2017-03-01

    Suitable data for spatial wave field analyses in concert halls need to satisfy the sampling theorem and hence requires densely spaced measurement positions over extended regions. The described measurement apparatus is capable of automatically sampling the sound field in auditoria over a surface of 5.30 m × 8.00 m to any appointed resolutions. In addition to discussing design features, a case study based on measured impulse responses is presented. The experimental data allow wave field animations demonstrating how sound propagating at grazing incidence over theater seating is scattered from rows of chairs (seat-dip effect). The visualized data of reflections and scattering from an auditorium's boundaries give insights and opportunities for advanced analyses.

  2. Large aperture laser beam alignment system based on far field sampling technique

    NASA Astrophysics Data System (ADS)

    Zhang, J. C.; Liu, D. Z.; Ouyang, X. P.; Kang, J.; Xie, X. L.; Zhou, J.; Gong, L.; Zhu, B. Q.

    2016-11-01

    Laser beam alignment is very important for high-power laser facility. Long laser path and large-aperture lens for alignment are generally used, while the proposed alignment system with a wedge by far-field sampling technique reduces both space and cost requirements. General alignment system for large-aperture laser beam is long in distance and large in volum because of taking near-field sampling technique. With the development of laser fusion facilities, the space for alignment system is limited. A new alignment system for large-aperture laser beam is designed to save space and reduce operating costs. The new alignment for large-aperture laser beam with a wedge is based on far-field sampling technique. The wedge is placed behind the spatial filter to reflect some laser beam as signal light for alignment. Therefore, laser beam diameter in alignment system is small, which can save space for the laser facility. Comparing to general alignment system for large-aperture laser beam, large-aperture lenses for near-field and far-field sampling, long distance laser path are unnecessary for proposed alignment system, which saves cost and space greatly. This alignment system for large-aperture laser beam has been demonstrated well on the Muliti-PW Facility which uses the 7th beam of the SG-Ⅱ Facility as pump source. The experimental results indicate that the average near-field alignment error is less than 1% of reference, and the average far-filed alignment error is less than 5% of spatial filter pinhole diameter, which meet the alignment system requirements for laser beam of Multi-PW Facility.

  3. Proposal for field sampling of plants and processing in the lab for environmental metabolic fingerprinting

    PubMed Central

    2010-01-01

    Background Samples for plant metabolic fingerprinting are prepared generally by metabolism quenching, grinding of plant material and extraction of metabolites in solvents. Further concentration and derivatisation steps follow in dependence of the sample nature and the available analytical platform. For plant material sampled in the field, several methods are not applicable, such as, e.g., collection in liquid nitrogen. Therefore, a protocol was established for sample pre-treatment, grinding, extraction and storage, which can be used for analysis of field-collected plant material, which is further processed in the laboratory. Ribwort plantain (Plantago lanceolata L., Plantaginaceae) was used as model plant. The quality criteria for method suitability were high reproducibility, extraction efficiency and handling comfort of each subsequent processing step. Results Highest reproducibility of results was achieved by sampling fresh plant material in a solvent mixture of methanol:dichloromethane (2:1), crushing the tissue with a hand-held disperser and storing the material until further processing. In the laboratory the material was extracted threefold at different pH. The gained extracts were separated with water (2:1:1 methanol:dichloromethane:water) and the aqueous phases used for analysis by LC-MS, because the polar metabolites were in focus. Chromatograms were compared by calculating a value Ξ for similarities. Advantages and disadvantages of different sample pre-treatment methods, use of solvents and solvent mixtures, influence of pH, extraction frequency and duration, and storing temperature are discussed with regard to the quality criteria. Conclusions The proposed extraction protocol leads to highly reproducible metabolic fingerprints and allows optimal handling of field-collected plant material and further processing in the laboratory, which is demonstrated for an exemplary field data-set. Calculation of Ξ values is a useful tool to judge similarities between

  4. Oxidation efficiencies of nitrite to nitrate by freezing of field rain samples

    SciTech Connect

    Takenaka, Norimichi; Daimon, Tohru; Sato, Keiichi

    1996-12-31

    Nitrite is known to be oxidized to nitrate by freezing much more rapidly than in solution. Furthermore, the oxidation efficiency of nitrite to nitrate by freezing is varied by pH or kinds and concentration of coexistences. We report here the oxidation efficiencies of nitrite to nitrate by freezing of field rain samples. The field rain samples were collected at Mt. Ikoma, which is located at about 20 km east of Osaka city, and Osaka Prefecture University. Concentration of nitrite was usually sub to a few {mu}mol/L order in rain and {mu}mol/L order in fog and less than 1 {mu}mol/L in snow. The highest value of nitrite concentration was 43 {mu}mol/L in rain and 620 {mu}mol/L in fog. Nitrite was oxidized immediately to nitrate by freezing at pH lower than 5.2, even when the sample droplet (about 1 mm diameter) was frozen very quickly in liquid nitrogen (77K). The oxidation efficiency was higher at lower pH. However, the efficiency varied from sample to sample. This is probably due to that kinds and concentration of coexistences were difference between samples. The effect of solutes will be also reported. Freezing of rain droplets are observed in freezing of super cooled droplets, growing of graupel and hail, growing of cumulonimbus, and so on. Ratio of nitrate to nitrite was higher in snow than that in rain or fog.

  5. Recent developments on field gas extraction and sample preparation methods for radiokrypton dating of groundwater

    NASA Astrophysics Data System (ADS)

    Yokochi, Reika

    2016-09-01

    Current and foreseen population growths will lead to an increased demand in freshwater, large quantities of which is stored as groundwater. The ventilation age is crucial to the assessment of groundwater resources, complementing the hydrological model approach based on hydrogeological parameters. Ultra-trace radioactive isotopes of Kr (81 Kr and 85 Kr) possess the ideal physical and chemical properties for groundwater dating. The recent advent of atom trap trace analyses (ATTA) has enabled determination of ultra-trace noble gas radioisotope abundances using 5-10 μ L of pure Kr. Anticipated developments will enable ATTA to analyze radiokrypton isotope abundances at high sample throughput, which necessitates simple and efficient sample preparation techniques that are adaptable to various sample chemistries. Recent developments of field gas extraction devices and simple and rapid Kr separation method at the University of Chicago are presented herein. Two field gas extraction devices optimized for different sampling conditions were recently designed and constructed, aiming at operational simplicity and portability. A newly developed Kr purification system enriches Kr by flowing a sample gas through a moderately cooled (138 K) activated charcoal column, followed by a gentle fractionating desorption. This simple process uses a single adsorbent and separates 99% of the bulk atmospheric gases from Kr without significant loss. The subsequent two stages of gas chromatographic separation and a hot Ti sponge getter further purify the Kr-enriched gas. Abundant CH4 necessitates multiple passages through one of the gas chromatographic separation columns. The presented Kr separation system has a demonstrated capability of extracting Kr with > 90% yield and 99% purity within 75 min from 1.2 to 26.8 L STP of atmospheric air with various concentrations of CH4. The apparatuses have successfully been deployed for sampling in the field and purification of groundwater samples.

  6. Quantitative passive soil vapor sampling for VOCs--part 3: field experiments.

    PubMed

    McAlary, Todd; Groenevelt, Hester; Nicholson, Paul; Seethapathy, Suresh; Sacco, Paolo; Crump, Derrick; Tuday, Michael; Hayes, Heidi; Schumacher, Brian; Johnson, Paul; Górecki, Tadeusz; Rivera-Duarte, Ignacio

    2014-03-01

    Volatile organic compounds (VOCs) are commonly associated with contaminated land and may pose a risk to human health via subsurface vapor intrusion to indoor air. Soil vapor sampling is commonly used to assess the nature and extent of VOC contamination, but can be complicated because of the wide range of geologic material permeability and moisture content conditions that might be encountered, the wide variety of available sampling and analysis methods, and several potential causes of bias and variability, including leaks of atmospheric air, adsorption-desorption interactions, inconsistent sampling protocols and varying levels of experience among sampling personnel. Passive sampling onto adsorbent materials has been available as an alternative to conventional whole-gas sample collection for decades, but relationships between the mass sorbed with time and the soil vapor concentration have not been quantitatively established and the relative merits of various commercially available passive samplers for soil vapor concentration measurement is unknown. This paper presents the results of field experiments using several different passive samplers under a wide range of conditions. The results show that properly designed and deployed quantitative passive soil vapor samplers can be used to measure soil vapor concentrations with accuracy and precision comparable to conventional active soil vapor sampling (relative concentrations within a factor of 2 and RSD comparable to active sampling) where the uptake rate is low enough to minimize starvation and the exposure duration is not excessive for weakly retained compounds.

  7. Fractionated dynamic headspace sampling in the analysis of matrices of vegetable origin in the food field.

    PubMed

    Liberto, Erica; Cagliero, Cecilia; Cordero, Chiara; Rubiolo, Patrizia; Bicchi, Carlo; Sgorbini, Barbara

    2017-03-17

    Recent technological advances in dynamic headspace sampling (D-HS) and the possibility to automate this sampling method have lead to a marked improvement in its the performance, a strong renewal of interest in it, and have extended its fields of application. The introduction of in-parallel and in-series automatic multi-sampling and of new trapping materials, plus the possibility to design an effective sampling process by correctly applying the breakthrough volume theory, have make profiling more representative, and have enhanced selectivity, and flexibility, also offering the possibility of fractionated enrichment in particular for high-volatility compounds. This study deals with fractionated D-HS ability to produce a sample representative of the volatile fraction of solid or liquid matrices. Experiments were carried out on a model equimolar (0.5mM) EtOH/water solution, comprising 16 compounds with different polarities and volatilities, structures ranging from C5 to C15 and vapor pressures from 4.15kPa (2,3-pentandione) to 0.004kPa (t-β-caryophyllene), and on an Arabica roasted coffee powder. Three trapping materials were considered: Tenax TA™ (TX), Polydimethylsiloxane foam (PDMS), and a three-carbon cartridge Carbopack B/Carbopack C/Carbosieve S-III™ (CBS). The influence of several parameters on the design of successful fractionated D-HS sampling. Including the physical and chemical characteristics of analytes and matrix, trapping material, analyte breakthrough, purge gas volumes, and sampling temperature, were investigated. The results show that, by appropriately choosing sampling conditions, fractionated D-HS sampling, based on component volatility, can produce a fast and representative profile of the matrix volatile fraction, with total recoveries comparable to those obtained by full evaporation D-HS for liquid samples, and very high concentration factors for solid samples.

  8. A Field-Based Cleaning Protocol for Sampling Devices Used in Life-Detection Studies

    NASA Astrophysics Data System (ADS)

    Eigenbrode, Jennifer; Benning, Liane G.; Maule, Jake; Wainwright, Norm; Steele, Andrew; Amundsen, Hans E. F.

    2009-06-01

    Analytical approaches to extant and extinct life detection involve molecular detection often at trace levels. Thus, removal of biological materials and other organic molecules from the surfaces of devices used for sampling is essential for ascertaining meaningful results. Organic decontamination to levels consistent with null values on life-detection instruments is particularly challenging at remote field locations where Mars analog field investigations are carried out. Here, we present a seven-step, multi-reagent decontamination method that can be applied to sampling devices while in the field. In situ lipopolysaccharide detection via low-level endotoxin assays and molecular detection via gas chromatography-mass spectrometry were used to test the effectiveness of the decontamination protocol for sampling of glacial ice with a coring device and for sampling of sediments with a rover scoop during deployment at Arctic Mars-analog sites in Svalbard, Norway. Our results indicate that the protocols and detection technique sufficiently remove and detect low levels of molecular constituents necessary for life-detection tests.

  9. CALIFA: a diameter-selected sample for an integral field spectroscopy galaxy survey

    NASA Astrophysics Data System (ADS)

    Walcher, C. J.; Wisotzki, L.; Bekeraité, S.; Husemann, B.; Iglesias-Páramo, J.; Backsmann, N.; Barrera Ballesteros, J.; Catalán-Torrecilla, C.; Cortijo, C.; del Olmo, A.; Garcia Lorenzo, B.; Falcón-Barroso, J.; Jilkova, L.; Kalinova, V.; Mast, D.; Marino, R. A.; Méndez-Abreu, J.; Pasquali, A.; Sánchez, S. F.; Trager, S.; Zibetti, S.; Aguerri, J. A. L.; Alves, J.; Bland-Hawthorn, J.; Boselli, A.; Castillo Morales, A.; Cid Fernandes, R.; Flores, H.; Galbany, L.; Gallazzi, A.; García-Benito, R.; Gil de Paz, A.; González-Delgado, R. M.; Jahnke, K.; Jungwiert, B.; Kehrig, C.; Lyubenova, M.; Márquez Perez, I.; Masegosa, J.; Monreal Ibero, A.; Pérez, E.; Quirrenbach, A.; Rosales-Ortega, F. F.; Roth, M. M.; Sanchez-Blazquez, P.; Spekkens, K.; Tundo, E.; van de Ven, G.; Verheijen, M. A. W.; Vilchez, J. V.; Ziegler, B.

    2014-09-01

    We describe and discuss the selection procedure and statistical properties of the galaxy sample used by the Calar Alto Legacy Integral Field Area (CALIFA) survey, a public legacy survey of 600 galaxies using integral field spectroscopy. The CALIFA "mother sample" was selected from the Sloan Digital Sky Survey (SDSS) DR7 photometric catalogue to include all galaxies with an r-band isophotal major axis between 45'' and 79.2'' and with a redshift 0.005 < z < 0.03. The mother sample contains 939 objects, 600 of which will be observed in the course of the CALIFA survey. The selection of targets for observations is based solely on visibility and thus keeps the statistical properties of the mother sample. By comparison with a large set of SDSS galaxies, we find that the CALIFA sample is representative of galaxies over a luminosity range of -19 > Mr > -23.1 and over a stellar mass range between 109.7 and 1011.4 M⊙. In particular, within these ranges, the diameter selection does not lead to any significant bias against - or in favour of - intrinsically large or small galaxies. Only below luminosities of Mr = -19 (or stellar masses <109.7 M⊙) is there a prevalence of galaxies with larger isophotal sizes, especially of nearly edge-on late-type galaxies, but such galaxies form <10% of the full sample. We estimate volume-corrected distribution functions in luminosities and sizes and show that these are statistically fully compatible with estimates from the full SDSS when accounting for large-scale structure. For full characterization of the sample, we also present a number of value-added quantities determined for the galaxies in the CALIFA sample. These include consistent multi-band photometry based on growth curve analyses; stellar masses; distances and quantities derived from these; morphological classifications; and an overview of available multi-wavelength photometric measurements. We also explore different ways of characterizing the environments of CALIFA galaxies

  10. Field portable mobile phone based fluorescence microscopy for detection of Giardia lamblia cysts in water samples

    NASA Astrophysics Data System (ADS)

    Ceylan Koydemir, Hatice; Gorocs, Zoltan; McLeod, Euan; Tseng, Derek; Ozcan, Aydogan

    2015-03-01

    Giardia lamblia is a waterborne parasite that causes an intestinal infection, known as giardiasis, and it is found not only in countries with inadequate sanitation and unsafe water but also streams and lakes of developed countries. Simple, sensitive, and rapid detection of this pathogen is important for monitoring of drinking water. Here we present a cost-effective and field portable mobile-phone based fluorescence microscopy platform designed for automated detection of Giardia lamblia cysts in large volume water samples (i.e., 10 ml) to be used in low-resource field settings. This fluorescence microscope is integrated with a disposable water-sampling cassette, which is based on a flow-through porous polycarbonate membrane and provides a wide surface area for fluorescence imaging and enumeration of the captured Giardia cysts on the membrane. Water sample of interest, containing fluorescently labeled Giardia cysts, is introduced into the absorbent pads that are in contact with the membrane in the cassette by capillary action, which eliminates the need for electrically driven flow for sample processing. Our fluorescence microscope weighs ~170 grams in total and has all the components of a regular microscope, capable of detecting individual fluorescently labeled cysts under light-emitting-diode (LED) based excitation. Including all the sample preparation, labeling and imaging steps, the entire measurement takes less than one hour for a sample volume of 10 ml. This mobile phone based compact and cost-effective fluorescent imaging platform together with its machine learning based cyst counting interface is easy to use and can even work in resource limited and field settings for spatio-temporal monitoring of water quality.

  11. Field sampling method for quantifying volatile sulfur compounds from animal feeding operations

    NASA Astrophysics Data System (ADS)

    Trabue, Steven; Scoggin, Kenwood; Mitloehner, Frank; Li, Hong; Burns, Robert; Xin, Hongwei

    Volatile sulfur compounds (VSCs) are a major class of chemicals associated with odor from animal feeding operations (AFOs). Identifying and quantifying VSCs in air is challenging due to their volatility, reactivity, and low concentrations. In the present study, a canister-based method collected whole air in fused silica-lined (FSL) mini-canister (1.4 L) following passage through a calcium chloride drying tube. Sampled air from the canisters was removed (10-600 mL), dried, pre-concentrated, and cryofocused into a GC system with parallel detectors (mass spectrometer (MS) and pulsed flame photometric detector (PFPD)). The column effluent was split 20:1 between the MS and PFPD. The PFPD equimolar sulfur response enhanced quantitation and the location of sulfur peaks for mass spectral identity and quantitation. Limit of quantitation for the PFPD and MSD was set at the least sensitive VSC (hydrogen sulfide) and determined to be 177 and 28 pg S, respectively, or 0.300 and 0.048 μg m -3 air, respectively. Storage stability of hydrogen sulfide and methanethiol was problematic in warm humid air (25 °C, 96% relative humidity (RH)) without being dried first, however, stability in canisters dried was still only 65% after 24 h of storage. Storage stability of hydrogen sulfide sampled in the field at a swine facility was over 2 days. The greater stability of field samples compared to laboratory samples was due to the lower temperature and RH of field samples compared to laboratory generated samples. Hydrogen sulfide was the dominant odorous VSCs detected at all swine facilities with methanethiol and dimethyl sulfide detected notably above their odor threshold values. The main odorous VSC detected in aged poultry litter was dimethyl trisulfide. Other VSCs above odor threshold values for poultry facilities were methanethiol and dimethyl sulfide.

  12. Minimum detection limit and spatial resolution of thin-sample field-emission electron probe microanalysis.

    PubMed

    Kubo, Yugo; Hamada, Kotaro; Urano, Akira

    2013-12-01

    The minimum detection limit and spatial resolution for a thinned semiconductor sample were determined by electron probe microanalysis (EPMA) using a Schottky field emission (FE) electron gun and wavelength dispersive X-ray spectrometry. Comparison of the FE-EPMA results with those obtained using energy dispersive X-ray spectrometry in conjunction with scanning transmission electron microscopy, confirmed that FE-EPMA is largely superior in terms of detection sensitivity. Thin-sample FE-EPMA is demonstrated as a very effective method for high resolution, high sensitivity analysis in a laboratory environment because a high probe current and high signal-to-noise ratio can be achieved.

  13. Validation of in Situ Networks Via Field Sampling: Case Study in the South Fork Experimental Watershed

    NASA Astrophysics Data System (ADS)

    Cosh, M. H.; McKee, L.; Bindlish, R.; Coopersmith, E. J.; Jackson, T. J.; Prueger, J. H.

    2014-12-01

    The calibration and validation of soil moisture remote sensing products is complicated by the logistics of installing a soil moisture network for a long term period in an active landscape. Therefore, these stations are located along field boundaries or in non-representative sites with regards to soil type or soil moisture. The representative character of this network can only be established by large scale field sampling to provide a calibration dataset. A team of samplers were deployed twice a week for the summer of 2014 to collect surface soil moisture data across a variety of land covers at 44 sites. These samples were compared and scaled to the domain to get a better understanding of the large scale soil moisture distributions and dynamics. In addition, comparisons are made to the Soil Moisture Ocean Salinity (SMOS) soil moisture product for the length of the network installation.

  14. On the Methodology of Nematode Extraction from Field Samples: Density Flotation Techniques

    PubMed Central

    Viglierchio, David R.; Yamashita, Tom T.

    1983-01-01

    Density flotation has been frequently used for the extraction of nematodes from field samples. Density flotation curves for four nematode species and five solutes have been prepared. The curves confirm that flotation was governed by several factors: solute density, solute osmotic activity, and physiological properties of the nematode species. Nematode viability and function can be adversely affected by improper selection of solute for density extraction of nematodes; nevertheless, some nematode species can be enriched from mixtures by density and solute selection. PMID:19295831

  15. Aqueous dissolution of laboratory and field samples from the in-situ vitrification process

    SciTech Connect

    McGrail, B.P. ); Bates, S.O. )

    1991-08-01

    In-situ vitrification (ISV) is being evaluated in several countries as a remediation technology for immobilizing both hazardous and radioactive buried wastes. A combination of laboratory data and modeling results are presented that establishes the scientific basis for predicting the long-term stability of an ISV glass in the environment. Laboratory experiments included tests with ISV samples obtained from pilot- and intermediate-scale field tests, a nuclear waste glass, and a natural obsidian. 8 refs.

  16. Vertical sampling flights in support of the 1981 ASCOT cooling tower experiments: field effort and data

    SciTech Connect

    Gay, G.T.

    1982-03-01

    During the month of August 1981, three nights of experimental sampling of tracers released into the cooling tower plume of a geothermal power plant were conducted. In these experiments a tethered balloon was used to lift a payload so as to obtain vertical profiles of the cooling tower plume and the entrained tracers. A description of the equipment used, the field effort and the data acquired are presented here.

  17. A contemporary decennial global Landsat sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, Emma; Roy, David

    2014-05-01

    Agriculture has caused significant human induced Land Cover Land Use (LCLU) change, with dramatic cropland expansion in the last century and significant increases in productivity over the past few decades. Satellite data have been used for agricultural applications including cropland distribution mapping, crop condition monitoring, crop production assessment and yield prediction. Satellite based agricultural applications are less reliable when the sensor spatial resolution is small relative to the field size. However, to date, studies of agricultural field size distributions and their change have been limited, even though this information is needed to inform the design of agricultural satellite monitoring systems. Moreover, the size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLU change. In many parts of the world field sizes may have increased. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, and impacts on the diffusion of herbicides, pesticides, disease pathogens, and pests. The Landsat series of satellites provide the longest record of global land observations, with 30m observations available since 1982. Landsat data are used to examine contemporary field size changes in a period (1980 to 2010) when significant global agricultural changes have occurred. A multi-scale sampling approach is used to locate global hotspots of field size change by examination of a recent global agricultural yield map and literature review. Nine hotspots are selected where significant field size change is apparent and where change has been driven by technological advancements (Argentina and U.S.), abrupt societal changes (Albania and Zimbabwe), government land use and agricultural policy changes (China, Malaysia, Brazil), and/or constrained by

  18. Highly sampled tetranucleotide and tetraloop motifs enable evaluation of common RNA force fields.

    PubMed

    Bergonzo, Christina; Henriksen, Niel M; Roe, Daniel R; Cheatham, Thomas E

    2015-09-01

    Recent modifications and improvements to standard nucleic acid force fields have attempted to fix problems and issues that have been observed as longer timescale simulations have become routine. Although previous work has shown the ability to fold the UUCG stem-loop structure, until now no group has attempted to quantify the performance of current force fields using highly converged structural populations of the tetraloop conformational ensemble. In this study, we report the use of multiple independent sets of multidimensional replica exchange molecular dynamics (M-REMD) simulations with different initial conditions to generate well-converged conformational ensembles for the tetranucleotides r(GACC) and r(CCCC), as well as the larger UUCG tetraloop motif. By generating what is to our knowledge the most complete RNA structure ensembles reported to date for these systems, we remove the coupling between force field errors and errors due to incomplete sampling, providing a comprehensive comparison between current top-performing MD force fields for RNA. Of the RNA force fields tested in this study, none demonstrate the ability to correctly identify the most thermodynamically stable structure for all three systems. We discuss the deficiencies present in each potential function and suggest areas where improvements can be made. The results imply that although "short" (nsec-μsec timescale) simulations may stay close to their respective experimental structures and may well reproduce experimental observables, inevitably the current force fields will populate alternative incorrect structures that are more stable than those observed via experiment.

  19. Preservation of RNA and DNA from mammal samples under field conditions.

    PubMed

    Camacho-Sanchez, Miguel; Burraco, Pablo; Gomez-Mestre, Ivan; Leonard, Jennifer A

    2013-07-01

    Ecological and conservation genetics require sampling of organisms in the wild. Appropriate preservation of the collected samples, usually by cryostorage, is key to the quality of the genetic data obtained. Nevertheless, cryopreservation in the field to ensure RNA and DNA stability is not always possible. We compared several nucleic acid preservation solutions appropriate for field sampling and tested them on rat (Rattus rattus) blood, ear and tail tip, liver, brain and muscle. We compared the efficacy of a nucleic acid preservation (NAP) buffer for DNA preservation against 95% ethanol and Longmire buffer, and for RNA preservation against RNAlater (Qiagen) and Longmire buffer, under simulated field conditions. For DNA, the NAP buffer was slightly better than cryopreservation or 95% ethanol, but high molecular weight DNA was preserved in all conditions. The NAP buffer preserved RNA as well as RNAlater. Liver yielded the best RNA and DNA quantity and quality; thus, liver should be the tissue preferentially collected from euthanized animals. We also show that DNA persists in nonpreserved muscle tissue for at least 1 week at ambient temperature, although degradation is noticeable in a matter of hours. When cryopreservation is not possible, the NAP buffer is an economical alternative for RNA preservation at ambient temperature for at least 2 months and DNA preservation for at least 10 months.

  20. Realistic sampling of amino acid geometries for a multipolar polarizable force field.

    PubMed

    Hughes, Timothy J; Cardamone, Salvatore; Popelier, Paul L A

    2015-09-15

    The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X-ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF.

  1. Realistic sampling of amino acid geometries for a multipolar polarizable force field

    PubMed Central

    Hughes, Timothy J.; Cardamone, Salvatore

    2015-01-01

    The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X‐ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF. © 2015 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:26235784

  2. The Dust Content and Radiation Fields of Sample of Galaxies in the ELAIS-N1 Field

    NASA Astrophysics Data System (ADS)

    Shalima, P.; Gogoi, Rupjyoti; Pathak, Amit; Misra, Ranjeev; Gupta, Ranjan; Vaidya, D. B.

    2015-08-01

    The Mid-IR colors ($F_{8}/F_{24}$) of galaxies together with their IR-UV luminosity correlations can be used to get some insight into the relative abundance of the different dust grain populations present in them. The ELAIS-N1 field contains thousands of galaxies which do not have optical spectra but have been observed in the Mid-IR by {\\it Spitzer} and UV by {\\it GALEX} making it ideal for these studies. As part of this work we have selected a sample of galaxies from the ELAIS-N1 field which have photometric observations in the MIR and UV as well as photometric redshifts from the SDSS database. We put the constraint that the redshifts are $\\le$ 0.1, thereby giving us a total of 309 galaxies. We find that the majority of the galaxies in the sample are PAH dominated due to their high MIR flux ratio. We also find a reasonable correlation between the Mid-IR and the UV luminosities out of which the Mid-IR emission from PAHs at 8 $\\mu$m is marginally better correlated than the 24 $\\mu$m VSG emission with the UV luminosities. However, if we divide the sample based on their $F_{8}/F_{24}$ ratios which is also an indicator of metallicity, the MIR-UV correlation seems to increase with the $F_{8}/F_{24}$ ratio. But the MIR-UV correlations are not very different for the PAHs and the VSG population within the individual metallicity groups.

  3. Search for life on Mars in surface samples: Lessons from the 1999 Marsokhod rover field experiment

    USGS Publications Warehouse

    Newsom, Horton E.; Bishop, J.L.; Cockell, C.; Roush, T.L.; Johnson, J. R.

    2001-01-01

    The Marsokhod 1999 field experiment in the Mojave Desert included a simulation of a rover-based sample selection mission. As part of this mission, a test was made of strategies and analytical techniques for identifying past or present life in environments expected to be present on Mars. A combination of visual clues from high-resolution images and the detection of an important biomolecule (chlorophyll) with visible/near-infrared (NIR) spectroscopy led to the successful identification of a rock with evidence of cryptoendolithic organisms. The sample was identified in high-resolution images (3 times the resolution of the Imager for Mars Pathfinder camera) on the basis of a green tinge and textural information suggesting the presence of a thin, partially missing exfoliating layer revealing the organisms. The presence of chlorophyll bands in similar samples was observed in visible/NIR spectra of samples in the field and later confirmed in the laboratory using the same spectrometer. Raman spectroscopy in the laboratory, simulating a remote measurement technique, also detected evidence of carotenoids in samples from the same area. Laboratory analysis confirmed that the subsurface layer of the rock is inhabited by a community of coccoid Chroococcidioposis cyanobacteria. The identification of minerals in the field, including carbonates and serpentine, that are associated with aqueous processes was also demonstrated using the visible/NIR spectrometer. Other lessons learned that are applicable to future rover missions include the benefits of web-based programs for target selection and for daily mission planning and the need for involvement of the science team in optimizing image compression schemes based on the retention of visual signature characteristics. Copyright 2000 by the American Geophysical Union.

  4. Rapid analysis of non-uniformly sampled pulsed field gradient data for velocity estimation.

    PubMed

    Raghavan, K; Park, J C; Pavlovskaya, G E; Gibbs, S J

    2001-06-01

    Bretthorst's recent generalization of the Lomb-Scargle periodogram shows that a sufficient statistic for frequency estimation from non-uniformly, but simultaneously sampled quadrature data is equivalent to the FFT of those data with the missing samples replaced by zeros. We have applied this concept to the rapid analysis of pulsed field gradient MRI data which have been non-uniformly sampled in the velocity encoding wave vector q. For a small number of q samples, it is more computationally efficient to calculate the periodogram directly rather than using the FFT algorithm with a large number of zeros. The algorithm we have implemented for finding the peak of the generalized periodogram is simple and robust; it involves repeated apodization and grid searching of the periodogram until the desired velocity resolution is achieved. The final estimate is refined by quadratic interpolation. We have tested the method for fully developed Poiseuille flow of a Newtonian fluid and have demonstrated substantial improvement in the precision of velocity measurement achievable in a fixed acquisition time with non-uniform sampling. The method is readily extendible to multidimensional data. Analysis of a 256 by 256 pixel image with 8 q samples and an effective velocity resolution of better than 1/680 of the Nyquist range requires approximately 1 minute computation time on a 400 MHz SUN Ultrasparc II processor.

  5. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  6. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  7. Detection of Microbial Life in Glacial Samples - Laboratories Studies and Development for Field use

    NASA Astrophysics Data System (ADS)

    Barnett, M. J.; Cullen, D. C.; Telling, J.; Wadham, J. L.; Holt, J.; Sims, M.

    2007-12-01

    Adenosine triphosphate (ATP) is frequently used as a proxy for bulk microbial biomass in environmental sciences and, in the food and health industries. Despite successful ATP detection in a variety of ecosystems, very little data are available on ATP levels in the glacial system. In this study, protocols for ATP detection on glacial ice and sediment samples are investigated, in order to aid in the development of a single-use device for in-field life detection, and also to increase the available data on biomass estimates in the cryosphere. ATP detection in two glacial samples reveals concentrations indistinguishable from internal blanks. Therefore, the samples were centrifuged and their particulate loads were subjected to four different extraction processes. Applying these extraction methods resulted in higher ATP concentration than samples with no extraction process; the different techniques increase the ATP detected between 5 and 15 times (also relative to an internal standard). Concurrent with the laboratory based development of extraction protocols is the development of a single-use device for the detection of ATP at the sampling site, in icy environments. The device is microfluidic-based, using commercially available reagents for the detection of ATP by bioluminescence. In order to produce a robust measure of biomass, both laboratory and field based analyses need to be carried out. This work shows the potential of ATP detection in glacial samples and the early development of a device for in situ life detection. The quantification of ATP in microfluidic format is being developed as the preliminary target for an integrated life detection and characterisation device.

  8. Sampling Strategies for Evaluating the Rate of Adventitious Transgene Presence in Non-Genetically Modified Crop Fields.

    PubMed

    Makowski, David; Bancal, Rémi; Bensadoun, Arnaud; Monod, Hervé; Messéan, Antoine

    2017-02-23

    According to E.U. regulations, the maximum allowable rate of adventitious transgene presence in non-genetically modified (GM) crops is 0.9%. We compared four sampling methods for the detection of transgenic material in agricultural non-GM maize fields: random sampling, stratified sampling, random sampling + ratio reweighting, random sampling + regression reweighting. Random sampling involves simply sampling maize grains from different locations selected at random from the field concerned. The stratified and reweighting sampling methods make use of an auxiliary variable corresponding to the output of a gene-flow model (a zero-inflated Poisson model) simulating cross-pollination as a function of wind speed, wind direction, and distance to the closest GM maize field. With the stratified sampling method, an auxiliary variable is used to define several strata with contrasting transgene presence rates, and grains are then sampled at random from each stratum. With the two methods involving reweighting, grains are first sampled at random from various locations within the field, and the observations are then reweighted according to the auxiliary variable. Data collected from three maize fields were used to compare the four sampling methods, and the results were used to determine the extent to which transgene presence rate estimation was improved by the use of stratified and reweighting sampling methods. We found that transgene rate estimates were more accurate and that substantially smaller samples could be used with sampling strategies based on an auxiliary variable derived from a gene-flow model.

  9. DNA from Dust: Comparative Genomics of Large DNA Viruses in Field Surveillance Samples.

    PubMed

    Pandey, Utsav; Bell, Andrew S; Renner, Daniel W; Kennedy, David A; Shreve, Jacob T; Cairns, Chris L; Jones, Matthew J; Dunn, Patricia A; Read, Andrew F; Szpara, Moriah L

    2016-01-01

    The intensification of the poultry industry over the last 60 years facilitated the evolution of increased virulence and vaccine breaks in Marek's disease virus (MDV-1). Full-genome sequences are essential for understanding why and how this evolution occurred, but what is known about genome-wide variation in MDV comes from laboratory culture. To rectify this, we developed methods for obtaining high-quality genome sequences directly from field samples without the need for sequence-based enrichment strategies prior to sequencing. We applied this to the first characterization of MDV-1 genomes from the field, without prior culture. These viruses were collected from vaccinated hosts that acquired naturally circulating field strains of MDV-1, in the absence of a disease outbreak. This reflects the current issue afflicting the poultry industry, where virulent field strains continue to circulate despite vaccination and can remain undetected due to the lack of overt disease symptoms. We found that viral genomes from adjacent field sites had high levels of overall DNA identity, and despite strong evidence of purifying selection, had coding variations in proteins associated with virulence and manipulation of host immunity. Our methods empower ecological field surveillance, make it possible to determine the basis of viral virulence and vaccine breaks, and can be used to obtain full genomes from clinical samples of other large DNA viruses, known and unknown. IMPORTANCE Despite both clinical and laboratory data that show increased virulence in field isolates of MDV-1 over the last half century, we do not yet understand the genetic basis of its pathogenicity. Our knowledge of genome-wide variation between strains of this virus comes exclusively from isolates that have been cultured in the laboratory. MDV-1 isolates tend to lose virulence during repeated cycles of replication in the laboratory, raising concerns about the ability of cultured isolates to accurately reflect virus in

  10. DNA from Dust: Comparative Genomics of Large DNA Viruses in Field Surveillance Samples

    PubMed Central

    Pandey, Utsav; Bell, Andrew S.; Renner, Daniel W.; Kennedy, David A.; Shreve, Jacob T.; Cairns, Chris L.; Jones, Matthew J.; Dunn, Patricia A.; Read, Andrew F.

    2016-01-01

    ABSTRACT The intensification of the poultry industry over the last 60 years facilitated the evolution of increased virulence and vaccine breaks in Marek’s disease virus (MDV-1). Full-genome sequences are essential for understanding why and how this evolution occurred, but what is known about genome-wide variation in MDV comes from laboratory culture. To rectify this, we developed methods for obtaining high-quality genome sequences directly from field samples without the need for sequence-based enrichment strategies prior to sequencing. We applied this to the first characterization of MDV-1 genomes from the field, without prior culture. These viruses were collected from vaccinated hosts that acquired naturally circulating field strains of MDV-1, in the absence of a disease outbreak. This reflects the current issue afflicting the poultry industry, where virulent field strains continue to circulate despite vaccination and can remain undetected due to the lack of overt disease symptoms. We found that viral genomes from adjacent field sites had high levels of overall DNA identity, and despite strong evidence of purifying selection, had coding variations in proteins associated with virulence and manipulation of host immunity. Our methods empower ecological field surveillance, make it possible to determine the basis of viral virulence and vaccine breaks, and can be used to obtain full genomes from clinical samples of other large DNA viruses, known and unknown. IMPORTANCE Despite both clinical and laboratory data that show increased virulence in field isolates of MDV-1 over the last half century, we do not yet understand the genetic basis of its pathogenicity. Our knowledge of genome-wide variation between strains of this virus comes exclusively from isolates that have been cultured in the laboratory. MDV-1 isolates tend to lose virulence during repeated cycles of replication in the laboratory, raising concerns about the ability of cultured isolates to accurately

  11. A multipurpose scanning near-field optical microscope: Reflectivity and photocurrent on semiconductor and biological samples

    NASA Astrophysics Data System (ADS)

    Cricenti, A.; Generosi, R.; Barchesi, C.; Luce, M.; Rinaldi, M.

    1998-09-01

    A multipurpose scanning near field optical microscope (SNOM) operating at ambient pressure is described with the aim of characterizing the inner parts of biological molecules and any semiconductor or metal microstructure. Therefore, in addition to the requirements of reliability and mechanical stability we have carefully considered analyzing a sample with all available geometries for input/output of photons, in order to get as much information as possible. The SNOM unit consists of two separable cylindrical supports; the lower one contains the sample holder mounted on top of a piezoelectric scanner which is contained in a motor controlled x-y-z stage. A piezo-modulated stretched optical fiber with a few tens of nanometer pinhole and a shear-force apparatus mounted inside the top cylinder allow for topography measurements. The reflectivity of the sample can be measured by applying different methods: the sample can be illuminated on top by an external source, as well as by the optical fiber used for the detection of the reflectivity signal. An aperture in the lower cylinder allows for illumination of the sample on the back: in this case the fiber collects the evanescent wave induced at the top of the sample. Another aperture in the lower cylinder allows measurement of the reflected light which includes a contribution due to the interaction with the fiber. Also photocurrent experiments can be easily performed by illuminating the sample with the fiber and detecting the transmitted signal using a current-voltage converter mounted inside the top cylinder. A video-camera that can reach 170 enlargements is mounted on the top cylinder for positioning the fiber on particular regions of the sample. Reflectivity and photocurrent measurements have been performed on uncoated neurons, CsI compound, Au/GaAs, and PtSi/Si systems, reaching a resolution well below the diffraction limit.

  12. Analysis of wave behavior in lossy dielectric samples at high field.

    PubMed

    Yang, Qing X; Wang, Jinghua; Zhang, Xiaoliang; Collins, Christopher M; Smith, Michael B; Liu, Haiying; Zhu, Xiao-Hong; Vaughan, J Thomas; Ugurbil, Kamil; Chen, Wei

    2002-05-01

    Radiofrequency (RF) field wave behavior and associated nonuniform image intensity at high magnetic field strengths are examined experimentally and numerically. The RF field produced by a 10-cm-diameter surface coil at 300 MHz is evaluated in a 16-cm-diameter spherical phantom with variable salinity, and in the human head. Temporal progression of the RF field indicates that the standing wave and associated dielectric resonance occurring in a pure water phantom near 300 MHz is greatly dampened in the human head due to the strong decay of the electromagnetic wave. The characteristic image intensity distribution in the human head is the result of spatial phase distribution and amplitude modulation by the interference of the RF traveling waves determined by a given sample-coil configuration. The numerical calculation method is validated with experimental results. The general behavior of the RF field with respect to the average brain electrical properties in a frequency range of 42-350 MHz is also analyzed.

  13. Detection of Campylobacter in human and animal field samples in Cambodia.

    PubMed

    Osbjer, Kristina; Tano, Eva; Chhayheng, Leang; Mac-Kwashie, Akofa Olivia; Fernström, Lise-Lotte; Ellström, Patrik; Sokerya, Seng; Sokheng, Choup; Mom, Veng; Chheng, Kannarath; San, Sorn; Davun, Holl; Boqvist, Sofia; Rautelin, Hilpi; Magnusson, Ulf

    2016-06-01

    Campylobacter are zoonotic bacteria and a leading cause of human gastroenteritis worldwide with Campylobacter jejuni and C. coli being the most commonly detected species. The aim of this study was to detect Campylobacter in humans and livestock (chickens, ducks, pigs, cattle, water buffalo, quail, pigeons and geese) in rural households by routine culturing and multiplex PCR in faecal samples frozen before analysis. Of 681 human samples, 82 (12%) tested positive by PCR (C. jejuni in 66 samples and C. coli in 16), but none by routine culture. Children were more commonly Campylobacter positive (19%) than adult males (8%) and females (7%). Of 853 livestock samples, 106 (12%) tested positive by routine culture and 352 (41%) by PCR. Campylobacter jejuni was more frequent in chickens and ducks and C. coli in pigs. In conclusion, Campylobacter proved to be highly prevalent by PCR in children (19%), ducks (24%), chickens (56%) and pigs (72%). Routine culturing was insufficiently sensitive in detecting Campylobacter in field samples frozen before analysis. These findings suggest that PCR should be the preferred diagnostic method for detection of Campylobacter in humans and livestock where timely culture is not feasible.

  14. Confirmatory analysis of field-presumptive GSR test sample using SEM/EDS

    NASA Astrophysics Data System (ADS)

    Toal, Sarah J.; Niemeyer, Wayne D.; Conte, Sean; Montgomery, Daniel D.; Erikson, Gregory S.

    2014-09-01

    RedXDefense has developed an automated red-light/green-light field presumptive lead test using a sampling pad which can be subsequently processed in a Scanning Electron Microscope for GSR confirmation. The XCAT's sampling card is used to acquire a sample from a suspect's hands on the scene and give investigators an immediate presumptive as to the presence of lead possibly from primer residue. Positive results can be obtained after firing as little as one shot. The same sampling card can then be sent to a crime lab and processed on the SEM for GSR following ASTM E-1588-10 Standard Guide for Gunshot Residue Analysis by Scanning Electron Microscopy/Energy Dispersive X-Ray Spectrometry, in the same manner as the existing tape lifts currently used in the field. Detection of GSR-characteristic particles (fused lead, barium, and antimony) as small as 0.8 microns (0.5 micron resolution) has been achieved using a JEOL JSM-6480LV SEM equipped with an Oxford Instruments INCA EDS system with a 50mm2 SDD detector, 350X magnification, in low-vacuum mode and in high vacuum mode after coating with carbon in a sputter coater. GSR particles remain stable on the sampling pad for a minimum of two months after chemical exposure (long term stability tests are in progress). The presumptive result provided by the XCAT yields immediate actionable intelligence to law enforcement to facilitate their investigation, without compromising the confirmatory test necessary to further support the investigation and legal case.

  15. Deoxynivalenol, zearalenone, and Fusarium graminearum contamination of cereal straw; field distribution; and sampling of big bales.

    PubMed

    Häggblom, P; Nordkvist, E

    2015-05-01

    Sampling of straw bales from wheat, barley, and oats was carried out after harvest showing large variations in deoxynivalenol (DON) and zearalenone (ZEN) levels. In the wheat field, DON was detected in all straw samples with an average DON concentration of 976 μg/kg and a median of 525 μg/kg, while in four bales, the concentrations were above 3000 μg/kg. For ZEN, the concentrations were more uniform with an average concentration of 11 μg/kg. The barley straw bales were all positive for DON with an average concentration of 449 μg/kg and three bales above 800 μg/kg. In oat straw, the average DON concentration was 6719 μg/kg with the lowest concentration at 2614 μg/kg and eight samples above 8000 μg/kg. ZEN contamination was detected in all bales with an average concentration of 53 μg/kg with the highest concentration at 219 μg/kg. Oat bales from another field showed an average concentration of 16,382 μg/kg. ZEN concentrations in the oat bales were on average 153 μg/kg with a maximum at 284 μg/kg. Levels of Fusarium graminearum DNA were higher in oat straw (max 6444 pg DNA/mg straw) compared to straw from wheat or barley. The significance of mycotoxin exposure from straw should not be neglected particularly in years when high levels of DON and ZEN are also detected in the feed grain. With a limited number of samples preferably using a sampling probe, it is possible to distinguish lots of straw that should not be used as bedding material for pigs.

  16. Field methods for sampling and storing nectar from flowers with low nectar volumes

    PubMed Central

    Morrant, D. S.; Schumann, R.; Petit, S.

    2009-01-01

    Background and Aims Although several methods of sampling and storing floral nectar are available, little information exists on sampling and storing nectar from flowers with low nectar volumes. Methods for sampling and storing nectar from the flowers of species with low floral nectar volumes (<1 µL) were investigated using the flowers of Eucalyptus species. Methods Sampling with microcapillary tubes, blotting up with filter paper, washing and rinsing were compared to determine masses of sugars recovered and differences in sugar ratios. Storage methods included room temperature, refrigeration and freezing treatments; the addition of antimicrobial agents benzyl alcohol or methanol to some of these treatments was also evaluated. Nectar samples were analysed using high-performance liquid chromatography and the masses of sucrose, glucose and fructose in each sample were determined. Key Results Masses of sugars varied significantly among sampling treatments, but the highest yielding methods, rinsing and washing, were not significantly different. A washing time of 1 min was as effective as one of 20 min. Storage trials showed that the sugar concentration measurements of nectar solutions changed rapidly, with the best results achieved for refrigeration with no additive (sucrose and fructose were stable for at least 2 weeks). Sugar ratios, however, remained relatively stable in most treatments and did not change significantly across 4 weeks for the methanol plus refrigerator and freezing treatments, and 2 weeks for the refrigeration treatment with no additive. Conclusions Washing is recommended for nectar collection from flowers with low nectar volumes in the field (with the understanding that one wash underestimates the amounts of sugars present in a flower), as is immediate analysis of sugar mass. In view of the great variation in results depending on nectar collection and storage methods, caution should be exercised in their choice, and their accuracy should be evaluated

  17. Field Portable Low Temperature Porous Layer Open Tubular Cryoadsorption Headspace Sampling and Analysis Part II: Applications*

    PubMed Central

    Harries, Megan; Bukovsky-Reyes, Santiago; Bruno, Thomas J.

    2016-01-01

    This paper details the sampling methods used with the field portable porous layer open tubular cryoadsorption (PLOT-cryo) approach, described in Part I of this two-part series, applied to several analytes of interest. We conducted tests with coumarin and 2,4,6-trinitrotoluene (two solutes that were used in initial development of PLOT-cryo technology), naphthalene, aviation turbine kerosene, and diesel fuel, on a variety of matrices and test beds. We demonstrated that these analytes can be easily detected and reliably identified using the portable unit for analyte collection. By leveraging efficiency-boosting temperature control and the high flow rate multiple capillary wafer, very short collection times (as low as 3 s) yielded accurate detection. For diesel fuel spiked on glass beads, we determined a method detection limit below 1 ppm. We observed greater variability among separate samples analyzed with the portable unit than previously documented in work using the laboratory-based PLOT-cryo technology. We identify three likely sources that may help explain the additional variation: the use of a compressed air source to generate suction, matrix geometry, and variability in the local vapor concentration around the sampling probe as solute depletion occurs both locally around the probe and in the test bed as a whole. This field-portable adaptation of the PLOT-cryo approach has numerous and diverse potential applications. PMID:26726934

  18. Geographical variation in inorganic arsenic in paddy field samples and commercial rice from the Iberian Peninsula.

    PubMed

    Signes-Pastor, Antonio J; Carey, Manus; Carbonell-Barrachina, Angel A; Moreno-Jiménez, Eduardo; Green, Andy J; Meharg, Andrew A

    2016-07-01

    This study investigated total arsenic and arsenic speciation in rice using ion chromatography with mass spectrometric detection (IC-ICP-MS), covering the main rice-growing regions of the Iberian Peninsula in Europe. The main arsenic species found were inorganic and dimethylarsinic acid. Samples surveyed were soil, shoots and field-collected rice grain. From this information soil to plant arsenic transfer was investigated plus the distribution of arsenic in rice across the geographical regions of Spain and Portugal. Commercial polished rice was also obtained from each region and tested for arsenic speciation, showing a positive correlation with field-obtained rice grain. Commercial polished rice had the lowest i-As content in Andalucia, Murcia and Valencia while Extremadura had the highest concentrations. About 26% of commercial rice samples exceeded the permissible concentration for infant food production as governed by the European Commission. Some cadmium data is also presented, available with ICP-MS analyses, and show low concentration in rice samples.

  19. Strategy to obtain axenic cultures from field-collected samples of the cyanobacterium Phormidium animalis.

    PubMed

    Vázquez-Martínez, Guadalupe; Rodriguez, Mario H; Hernández-Hernández, Fidel; Ibarra, Jorge E

    2004-04-01

    An efficient strategy, based on a combination of procedures, was developed to obtain axenic cultures from field-collected samples of the cyanobacterium Phormidium animalis. Samples were initially cultured in solid ASN-10 medium, and a crude separation of major contaminants from P. animalis filaments was achieved by washing in a series of centrifugations and resuspensions in liquid medium. Then, manageable filament fragments were obtained by probe sonication. Fragmentation was followed by forceful washing, using vacuum-driven filtration through an 8-microm pore size membrane and an excess of water. Washed fragments were cultured and treated with a sequential exposure to four different antibiotics. Finally, axenic cultures were obtained from serial dilutions of treated fragments. Monitoring under microscope examination and by inoculation in Luria-Bertani (LB) agar plates indicated either axenicity or the degree of contamination throughout the strategy.

  20. GeoLab's First Field Trials, 2010 Desert RATS: Evaluating Tools for Early Sample Characterization

    NASA Technical Reports Server (NTRS)

    Evans, Cindy A.; Bell, M. S.; Calaway, M. J.; Graff, Trevor; Young, Kelsey

    2011-01-01

    As part of an accelerated prototyping project to support science operations tests for future exploration missions, we designed and built a geological laboratory, GeoLab, that was integrated into NASA's first generation Habitat Demonstration Unit-1/Pressurized Excursion Module (HDU1-PEM). GeoLab includes a pressurized glovebox for transferring and handling samples collected on geological traverses, and a suite of instruments for collecting preliminary data to help characterize those samples. The GeoLab and the HDU1-PEM were tested for the first time as part of the 2010 Desert Research and Technology Studies (DRATS), NASA's analog field exercise for testing mission technologies. The HDU1- PEM and GeoLab participated in two weeks of joint operations in northern Arizona with two crewed rovers and the DRATS science team.

  1. Quantitative reverse sample genome probing of microbial communities and its application to oil field production waters

    SciTech Connect

    Voordouw, G.; Shen, Y.; Harrington, C.S.; Teland, A.J. ); Jack, T.R. ); Westlake, W.S. )

    1993-12-01

    This paper presents a protocol for quantitative analysis of microbial communities by reverse sample genome probing is presented in which (i) whole community DNA is isolated and labeled in the presence of a known amount of an added internal standard and (ii) the resulting spiked reverse genome probe is hybridized with a master filter on which denatured genomic DNAs from bacterial standards isolated from the target environment were spotted in large amounts (up to 1,500 ng) in order to improve detection sensitivity. This protocol allowed reproducible fingerprinting of the microbial community in oil field production waters at 19 sites from which water and biofilm samples were collected. It appeared that selected sulfate-reducing bacteria were significantly enhanced in biofilms covering the metal surfaces in contact with the production waters.

  2. Review of concepts useful for maintaining quality of male reproductive field samples for laboratory study

    USGS Publications Warehouse

    Jenkins, Jill A.

    2011-01-01

    Investigations into cellular and molecular characteristics of male gametes obtained from fish in natural ecosystems require careful sample handling and shipping in order to minimize artifacts. Maintaining sample integrity engenders confident assessments of ecosystem health, whereby animal condition is often reflected by gamete biomarkers - indicators that respond in measurable ways to changes. A number of our investigations have addressed the hypothesis that biomarkers from fish along a pollution gradient are reflective of site location. Species biology and the selected biological endpoints direct choice of parameters such as: temperature, buffer osmolality, time in transit, fixation, cryoprotectants, protease inhibition, and antibiotic inclusion in extender. This paper will highlight case studies, and outline parameters and thoughts on approaches for use by field and laboratory researchers.

  3. Field enhancement sample stacking for analysis of organic acids in traditional Chinese medicine by capillary electrophoresis.

    PubMed

    Zhu, Qianqian; Xu, Xueqin; Huang, Yuanyuan; Xu, Liangjun; Chen, Guonan

    2012-07-13

    A technique known as field enhancement sample stacking (FESS) and capillary electrophoresis (CE) separation has been developed to analyze and detect organic acids in the three traditional Chinese medicines (such as Portulaca oleracea L., Crataegus pinnatifida and Aloe vera L.). In FESS, a reverse electrode polarity-stacking mode (REPSM) was applied as on-line preconcentration strategy. Under the optimized condition, the baseline separation of eight organic acids (linolenic acid, lauric acid, p-coumaric acid, ascorbic acid, benzoic acid, caffeic acid, succinic acid and fumaric acid) could be achieved within 20 min. Validation parameters of this method (such as detection limits, linearity and precision) were also evaluated. The detection limits ranged from 0.4 to 60 ng/mL. The results indicated that the proposed method was effective for the separation of mixtures of organic acids. Satisfactory recoveries were also obtained in the analysis of these organic acids in the above traditional Chinese medicine samples.

  4. Four p67 alleles identified in South African Theileria parva field samples.

    PubMed

    Sibeko, Kgomotso P; Geysen, Dirk; Oosthuizen, Marinda C; Matthee, Conrad A; Troskie, Milana; Potgieter, Frederick T; Coetzer, Jacobus A W; Collins, Nicola E

    2010-02-10

    Previous studies characterizing the Theileria parva p67 gene in East Africa revealed two alleles. Cattle-derived isolates associated with East Coast fever (ECF) have a 129bp deletion in the central region of the p67 gene (allele 1), compared to buffalo-derived isolates with no deletion (allele 2). In South Africa, Corridor disease outbreaks occur if there is contact between infected buffalo and susceptible cattle in the presence of vector ticks. Although ECF was introduced into South Africa in the early 20th century, it has been eradicated and it is thought that there has been no cattle to cattle transmission of T. parva since. The variable region of the p67 gene was amplified and the gene sequences analyzed to characterize South African T. parva parasites that occur in buffalo, in cattle from farms where Corridor disease outbreaks were diagnosed and in experimentally infected cattle. Four p67 alleles were identified, including alleles 1 and 2 previously detected in East African cattle and buffalo, respectively, as well as two novel alleles, one with a different 174bp deletion (allele 3), the other with a similar sequence to allele 3 but with no deletion (allele 4). Sequence variants of allele 1 were obtained from field samples originating from both cattle and buffalo. Allele 1 was also obtained from a bovine that tested T. parva positive from a farm near Ladysmith in the KwaZulu-Natal Province. East Coast fever was not diagnosed on this farm, but the p67 sequence was identical to that of T. parva Muguga, an isolate that causes ECF in Kenya. Variants of allele 2 were obtained from all T. parva samples from both buffalo and cattle, except Lad 10 and Zam 5. Phylogenetic analysis revealed that alleles 3 and 4 are monophyletic and diverged early from the other alleles. These novel alleles were not identified from South African field samples collected from cattle; however allele 3, with a p67 sequence identical to those obtained in South African field samples from

  5. Comparison of dust sampling methods in Estonia and Sweden--a field study.

    PubMed

    Berg, P; Jaakmees, V; Bodin, L

    1999-09-01

    The purpose of this field study was to compare an Estonian dust sampling method, a method also used in other former East Block countries, with a Swedish method and to estimate inter-method agreement with statistical analyses. The Estonian standard method (ESM), used to assess exposure in Estonia since the early 1950s, is based on a strategy where air samples are collected for 10 minutes every hour over a full shift. This method was compared to a Swedish standard method (SSM), a modified NIOSH method, comparable to international standards, where one air sample is collected during a full shift. The study was carried out at a cement plant that in the beginning of the 1990s was subjected to an epidemiological study, including collection of exposure data. The results of the analysis from 31 clusters of parallel samples of the two methods, when dust consisting of Portland cement was collected, showed a relatively weak correlation between the SSM and the ESM, ri = 0.81 (Pearson's intra-class correlation coefficient). A conversion factor between the two methods was estimated, where SSM is 0.69 times ESM and the limits of agreement are 0.25 and 1.84, respectively. These results indicate a substantial inter-method difference. We therefore recommend that measurements obtained from the two methods should not be used interchangeably. Because the present study is of limited extent, our findings are confined to the operations studied and further studies covering other exposure situations will be needed.

  6. Comparison of dust sampling methods in Estonia and Sweden -- A field study

    SciTech Connect

    Berg, P.; Jaakmees, V.; Bodin, L.

    1999-09-01

    The purpose of this field study was to compare an Estonian dust sampling method, a method also used in other former East Block countries, with a Swedish method and to estimate inter-method agreement with statistical analyses. The Estonian standard method (ESM), used to assess exposure in Estonia since the early 1950s, is based on a strategy where air samples are collected for 10 minutes every hour over a full shift. This method was compared to a Swedish standard method (SSM), a modified NIOSH method, comparable to international standards, where one air sample is collected during a full shift. The study was carried out at a cement plant that in the beginning of the 1990s was subjected to an epidemiological study, including collection of exposure data. The results of the analysis from 31 clusters of parallel samples of the two methods, when dust consisting of Portland cement was collected, showed a relatively weak correlation between the SSM and the ESM, r{sub i} = 0.91 (Pearson's intro-class correlation coefficient). A conversion factor between the two methods was estimated, where SSM is 0.69 times ESm and the limits of agreement are 0.25 and 1.84, respectively. These results indicate a substantial intermethod difference. The authors therefore recommend that measurements obtained from the two methods should not be used interchangeably. Because the present study is of limited extent, the findings are confined to the operations studied and further studies covering other exposure situation will be needed.

  7. Wood dust sampling: field evaluation of personal samplers when large particles are present.

    PubMed

    Lee, Taekhee; Harper, Martin; Slaven, James E; Lee, Kiyoung; Rando, Roy J; Maples, Elizabeth H

    2011-03-01

    Recent recommendations for wood dust sampling include sampling according to the inhalable convention of International Organization for Standardization (ISO) 7708 (1995) Air quality--particle size fraction definitions for health-related sampling. However, a specific sampling device is not mandated, and while several samplers have laboratory performance approaching theoretical for an 'inhalable' sampler, the best choice of sampler for wood dust is not clear. A side-by-side field study was considered the most practical test of samplers as laboratory performance tests consider overall performance based on a wider range of particle sizes than are commonly encountered in the wood products industry. Seven companies in the wood products industry of the Southeast USA (MS, KY, AL, and WV) participated in this study. The products included hardwood flooring, engineered hardwood flooring, door skins, shutter blinds, kitchen cabinets, plywood, and veneer. The samplers selected were 37-mm closed-face cassette with ACCU-CAP™, Button, CIP10-I, GSP, and Institute of Occupational Medicine. Approximately 30 of each possible pairwise combination of samplers were collected as personal sample sets. Paired samplers of the same type were used to calculate environmental variance that was then used to determine the number of pairs of samples necessary to detect any difference at a specified level of confidence. Total valid sample number was 888 (444 valid pairs). The mass concentration of wood dust ranged from 0.02 to 195 mg m(-3). Geometric mean (geometric standard deviation) and arithmetic mean (standard deviation) of wood dust were 0.98 mg m(-3) (3.06) and 2.12 mg m(-3) (7.74), respectively. One percent of the samples exceeded 15 mg m(-3), 6% exceeded 5 mg m(-3), and 48% exceeded 1 mg m(-3). The number of collected pairs is generally appropriate to detect a 35% difference when outliers (negative mass loadings) are removed. Statistical evaluation of the nonsimilar sampler pair results

  8. Field observations of particle impacts by debris flows and debris floods on instrumented rock samples

    NASA Astrophysics Data System (ADS)

    McArdell, B. W.; Hsu, L.; Fritschi, B.; Dietrich, W. E.

    2011-12-01

    Bedrock incision and sediment entrainment by debris flows are important processes in torrent channels. As part of our effort to gain a better understanding of these processes, we installed instrumented rock samples in the bed of the Illgraben channel. Three rock samples, 0.4 m long (in the flow direction), 0.3 m wide, and 0.2 m thick, were installed in steel frames which were mounted on the upslope side of a concrete check dam, with the surface of the stones flush with the channel bed. Accelerometer sensors were installed on the bottom of one rock sample, with a range of up to 500 g (vertical) and 200 g (horizontal, parallel to the channel axis), where g is the acceleration due to gravity. Elastomer elements, typically used in the field as overload protection for load sensors, were placed between the rock samples and the steel frames. Data were sampled at 2 kHz and stored on a computer outside of the channel. The sensors provided data for 4 debris floods and part of one debris flow. For all of the events, the vertical acceleration data indicate a large background noise in the range of ±10 g, punctuated by very short duration impulses of up to several hundred g. The large accelerations are interpreted to represent hard impacts of cobbles or boulders in the flow with the rock tablet. Using a value of >20 g to define the occurrence of a large particle impact, it is possible to differentiate between debris floods (which have on the order of 0.1 impact per second) and the debris flow (on the order of 1 impact per second). The frequency of the sampling is too small to resolve details about the impacts, so it is not possible to precisely determine the maximum accelerations. However the peak recorded values are larger for debris flows, with values up to the measurement limit of the sensors, whereas for floods the maximum accelerations are typically less than 100 g. The results for the accelerometer which measures accelerations in the downstream direction generally mirror

  9. ff14IDPs force field improving the conformation sampling of intrinsically disordered proteins.

    PubMed

    Song, Dong; Wang, Wei; Ye, Wei; Ji, Dingjue; Luo, Ray; Chen, Hai-Feng

    2017-01-01

    Intrinsically disordered proteins are proteins which lack of specific tertiary structure and unable to fold spontaneously without the partner binding. These intrinsically disordered proteins are found to associate with various diseases, such as diabetes, cancer, and neurodegenerative diseases. However, current widely used force fields, such as ff99SB, ff14SB, OPLS/AA, and Charmm27, are insufficient in sampling the conformational characters of intrinsically disordered proteins. In this study, the CMAP method was used to correct the φ/ψ distributions of disorder-promoting amino acids. The simulation results show that the force filed parameters (ff14IDPs) can improve the φ/ψ distributions of the disorder-promoting amino acids, with RMSD less than 0.10% relative to the benchmark data of intrinsically disordered proteins. Further test suggests that the calculated secondary chemical shifts under ff14IDPs are in quantitative agreement with the data of NMR experiment for five tested systems. In addition, the simulation results show that ff14IDPs can still be used to model structural proteins, such as tested lysozyme and ubiquitin, with better performance in coil regions than the original general Amber force field ff14SB. These findings confirm that the newly developed Amber ff14IDPs is a robust model for improving the conformation sampling of intrinsically disordered proteins.

  10. Integrated Field Lysimetry and Porewater Sampling for Evaluation of Chemical Mobility in Soils and Established Vegetation

    PubMed Central

    Gannon, Travis W.; Polizzotto, Matthew L.

    2014-01-01

    Potentially toxic chemicals are routinely applied to land to meet growing demands on waste management and food production, but the fate of these chemicals is often not well understood. Here we demonstrate an integrated field lysimetry and porewater sampling method for evaluating the mobility of chemicals applied to soils and established vegetation. Lysimeters, open columns made of metal or plastic, are driven into bareground or vegetated soils. Porewater samplers, which are commercially available and use vacuum to collect percolating soil water, are installed at predetermined depths within the lysimeters. At prearranged times following chemical application to experimental plots, porewater is collected, and lysimeters, containing soil and vegetation, are exhumed. By analyzing chemical concentrations in the lysimeter soil, vegetation, and porewater, downward leaching rates, soil retention capacities, and plant uptake for the chemical of interest may be quantified. Because field lysimetry and porewater sampling are conducted under natural environmental conditions and with minimal soil disturbance, derived results project real-case scenarios and provide valuable information for chemical management. As chemicals are increasingly applied to land worldwide, the described techniques may be utilized to determine whether applied chemicals pose adverse effects to human health or the environment. PMID:25045915

  11. Classification of underwater targets from autonomous underwater vehicle sampled bistatic acoustic scattered fields.

    PubMed

    Fischell, Erin M; Schmidt, Henrik

    2015-12-01

    One of the long term goals of autonomous underwater vehicle (AUV) minehunting is to have multiple inexpensive AUVs in a harbor autonomously classify hazards. Existing acoustic methods for target classification using AUV-based sensing, such as sidescan and synthetic aperture sonar, require an expensive payload on each outfitted vehicle and post-processing and/or image interpretation. A vehicle payload and machine learning classification methodology using bistatic angle dependence of target scattering amplitudes between a fixed acoustic source and target has been developed for onboard, fully autonomous classification with lower cost-per-vehicle. To achieve the high-quality, densely sampled three-dimensional (3D) bistatic scattering data required by this research, vehicle sampling behaviors and an acoustic payload for precision timed data acquisition with a 16 element nose array were demonstrated. 3D bistatic scattered field data were collected by an AUV around spherical and cylindrical targets insonified by a 7-9 kHz fixed source. The collected data were compared to simulated scattering models. Classification and confidence estimation were shown for the sphere versus cylinder case on the resulting real and simulated bistatic amplitude data. The final models were used for classification of simulated targets in real time in the LAMSS MOOS-IvP simulation package [M. Benjamin, H. Schmidt, P. Newman, and J. Leonard, J. Field Rob. 27, 834-875 (2010)].

  12. Integrated field lysimetry and porewater sampling for evaluation of chemical mobility in soils and established vegetation.

    PubMed

    Matteson, Audrey R; Mahoney, Denis J; Gannon, Travis W; Polizzotto, Matthew L

    2014-07-04

    Potentially toxic chemicals are routinely applied to land to meet growing demands on waste management and food production, but the fate of these chemicals is often not well understood. Here we demonstrate an integrated field lysimetry and porewater sampling method for evaluating the mobility of chemicals applied to soils and established vegetation. Lysimeters, open columns made of metal or plastic, are driven into bareground or vegetated soils. Porewater samplers, which are commercially available and use vacuum to collect percolating soil water, are installed at predetermined depths within the lysimeters. At prearranged times following chemical application to experimental plots, porewater is collected, and lysimeters, containing soil and vegetation, are exhumed. By analyzing chemical concentrations in the lysimeter soil, vegetation, and porewater, downward leaching rates, soil retention capacities, and plant uptake for the chemical of interest may be quantified. Because field lysimetry and porewater sampling are conducted under natural environmental conditions and with minimal soil disturbance, derived results project real-case scenarios and provide valuable information for chemical management. As chemicals are increasingly applied to land worldwide, the described techniques may be utilized to determine whether applied chemicals pose adverse effects to human health or the environment.

  13. Near-field acoustic holography using sparse regularization and compressive sampling principles.

    PubMed

    Chardon, Gilles; Daudet, Laurent; Peillot, Antoine; Ollivier, François; Bertin, Nancy; Gribonval, Rémi

    2012-09-01

    Regularization of the inverse problem is a complex issue when using near-field acoustic holography (NAH) techniques to identify the vibrating sources. This paper shows that, for convex homogeneous plates with arbitrary boundary conditions, alternative regularization schemes can be developed based on the sparsity of the normal velocity of the plate in a well-designed basis, i.e., the possibility to approximate it as a weighted sum of few elementary basis functions. In particular, these techniques can handle discontinuities of the velocity field at the boundaries, which can be problematic with standard techniques. This comes at the cost of a higher computational complexity to solve the associated optimization problem, though it remains easily tractable with out-of-the-box software. Furthermore, this sparsity framework allows us to take advantage of the concept of compressive sampling; under some conditions on the sampling process (here, the design of a random array, which can be numerically and experimentally validated), it is possible to reconstruct the sparse signals with significantly less measurements (i.e., microphones) than classically required. After introducing the different concepts, this paper presents numerical and experimental results of NAH with two plate geometries, and compares the advantages and limitations of these sparsity-based techniques over standard Tikhonov regularization.

  14. Size-dependent Turbidimatric Quantification of Mobile Colloids in Field Samples

    NASA Astrophysics Data System (ADS)

    Yan, J.; Meng, X.; Jin, Y.

    2015-12-01

    Natural colloids, often defined as entities with sizes < 1.0 μm, have attracted much research attention because of their ability to facilitate the transport of contaminants in the subsurface environment. However, due to their small size and generally low concentrations in field samples, quantification of mobile colloids, especially the smaller fractions (< 0.45 µm), which are operationally defined as dissolved, is largely impeded and hence the natural colloidal pool is greatly overlooked and underestimated. The main objectives of this study are to: (1) develop an experimentally and economically efficient methodology to quantify natural colloids in different size fractions (0.1-0.45 and 0.45-1 µm); (2) quantify mobile colloids including small colloids, < 0.45 µm particularly, in different natural aquatic samples. We measured and generated correlations between mass concentration and turbidity of colloid suspensions, made by extracting and fractionating water dispersible colloids in 37 soils from different areas in the U.S. and Denmark, for colloid size fractions 0.1-0.45 and 0.45-1 µm. Results show that the correlation between turbidity and colloid mass concentration is largely affected by colloid size and iron content, indicating the need to generate different correlations for colloids with constrained size range and iron content. This method enabled quick quantification of colloid concentrations in a large number of field samples collected from freshwater, wetland and estuaries in different size fractions. As a general trend, we observed high concentrations of colloids in the < 0.45 µm fraction, which constitutes a significant percentage of the total mobile colloidal pool (< 1 µm). This observation suggests that the operationally defined cut-off size for "dissolved" phase can greatly underestimate colloid concentration therefore the role that colloids play in the transport of associated contaminants or other elements.

  15. Technical note: Dimensioning IRGA gas sampling system: laboratory and field experiments

    NASA Astrophysics Data System (ADS)

    Aubinet, M.; Joly, L.; Loustau, D.; De Ligne, A.; Chopin, H.; Cousin, J.; Chauvin, N.; Decarpenterie, T.; Gross, P.

    2015-10-01

    Both laboratory and field experiments were carried out in order to define suitable configuration ranges for the gas sampling systems (GSS) of infrared gas analyzers (IRGA) used in eddy covariance measurements. In the laboratory, an original dynamic calibration bench was developed in order to test the frequency attenuation and pressure drop generated by filters. In the field, IRGAs equipped with different filters or different rain cups were installed and run and the real frequency response of the complete set-up was tested. The main results are that: - Filters may have a strong impact on the pressure drop in the GSS and this impact increases with flow rate. - On the contrary, no impact of the tested filters on cut off frequency was found, GSS with and without filters presenting similar cut off frequencies. - The main limiting factor of cut off frequency in the field was found to be the rain cup design. In addition, the impact of this design on pressure drop was also found noteworthy.

  16. [Analysis of nine narcotics in urine by microemulsion electrokinetic chromatography-field samplified sample injection].

    PubMed

    Zhang, Yu; Li, Qin; Lu, Minghua; Zhang, Lan; Chen, Guonan; Cai, Zongwei

    2011-08-01

    A simple, sensitive and reproducible method using microemulsion electrokinetic chromatography (MEEKC)-field amplified sample injection (FASI) was developed for the analysis of nine narcotics (morphine, codeine, naloxone, heroin, thebaine, cocaine, pethidine, fentanyl and methadone) in urine. In the MEEKC method, sodium dodecyl sulfate (SDS), 1-butanol and ethyl acetate were used as surfactant, co-surfactant and organic solvent, respectively. The effects of the acidity and concentration of borate buffer, SDS, 1-butanol and ethyl acetate contents were investigated. The optimum concentrations (by mass fraction) of microemulsion system were 0.6% SDS, 1.2% 1-butanol, 0.6% ethyl acetate and 97.6% 10 mmol/L Na2B4O7 buffer (pH 9.5). The applied voltage was 25 kV. FASI was coupled with the MEEKC method to increase the sensitivity. Under the optimum conditions, the nine narcotics were baseline separated within 15 min and the detection limits (S/N = 3) were in the range of 0.3 - 8.0 microg/L. The spiked recoveries in urine samples were between 79.4% and 119.9% with the intraday relative standard deviations (RSDs) less than 5.5%. The developed method has been successfully applied to the analysis of methadone in the samples from in vitro metabolism study.

  17. On-line Sample Preconcentration Using Field-amplified Stacking Injection in Microchip Capillary Electrophoresis

    PubMed Central

    Gong, Maojun; Wehmeyer, Kenneth R.; Limbach, Patrick A.; Arias, Francisco; Heineman, William R.

    2008-01-01

    Previous reports describing sample stacking on microchip capillary electrophoresis (μCE) have regarded the microchip channels as a closed system and treated the bulk flow as in traditional capillary electrophoresis. This work demonstrates that the flows arising from the cross region should be investigated as an open system. It is shown that the pressure-driven flows into or from the branch channels due to bulk velocity mismatch in the main channel should not be neglected but can be used for liquid transportation in the channels. Based on these concepts, a sample preconcentration scheme was developed in a commercially available glass, single-cross chip for μCE. Similar to field-amplified stacking injection in traditional CE, a low conductivity sample buffer plug was introduced into the separation channel immediately before the negatively charged analyte molecules were injected. The detection sensitivity was improved by 94-, 108- and 160-fold for fluorescein-5-isothiocyanate, fluorescein disodium and 5-carboxyfluorescein, respectively, relative to a traditional pinched injection. The calibration curves for fluorescein and 5-carboxyfluorescein demonstrated good linearity in the concentration range (1 to 60 nM) investigated with acceptable reproducibility of migration time and peak height and area ratios (4 to 5% RSD). This preconcentration scheme will be of particular significance to the practical use of μCE in the emerging miniaturized analytical instrumentation. PMID:16737230

  18. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  19. Using analog field and sample data to understand remote data of Mars

    NASA Astrophysics Data System (ADS)

    Wright, Shawn

    2015-04-01

    The primary geologic processes on Mars are basaltic volcanism, sedimentation, impact cratering, and alteration. All potentially create amorphous materials and complex mineralogies, and these must be measured by rovers sent to Mars to characterize the geology. This paper addresses the field measurements and sample analyses of a terrestrial analog impact crater to interpret rover and perhaps orbital data of Mars. Motivation: OMEGA and CRISM have shown alteration minerals in Martian ejecta blankets. These phyllosilicates may represent altered crust that was excavated, and only exposed, by the impact, or could represent ejecta that was altered in part during impact or fractured/fragmented material that was altered at higher rate than surrounding terrain after ejecta emplacement. Study Site and Geologic History: Lonar Crater, India is a young (~570 ka), ~1.8 km impact site emplaced in ~65 Ma Deccan basalt, which is an excellent analog material for Mars with ~45-50% labradorite and ~35% augite/pigeonite before lower flows were altered and then excavated and/or shocked. Pre-impact stratigraphy was not complex: 3 flows of fresh basalt overlying 3 flows of aqueously-altered basalt, and both are found as impact breccia clasts in a ~8 m thick lithic (unshocked, "throw out") and ~1 m suevite (all ranges of shock pressure, "fall out") breccia units in the ejecta. Two geologic histories for shocked clasts in the Lonar suevite breccia are compared: 1.) the alteration of impactites (impact glasses and melts) of a range of shock pressures ("post-impact alteration"), which likely increase the rate of alteration and affects the order of alteration where compared to pristine, igneous minerals, and 2.) the existence of altered basalt protoliths ("pre-impact alteration") now vitrified as in-situ breccia clasts or float. Both of these geologic histories and their alteration pathways are compared to those of unshocked fresh and unshocked altered basalts found in the lithic breccia and

  20. Comparison of aerosol backscatter and wind field estimates from the REAL and the SAMPLE

    NASA Astrophysics Data System (ADS)

    Mayor, Shane D.; Dérian, Pierre; Mauzey, Christopher F.; Spuler, Scott M.; Ponsardin, Patrick; Pruitt, Jeff; Ramsey, Darrell; Higdon, Noah S.

    2015-09-01

    Although operating at the same near-infrared 1.5- m wavelength, the Raman-shifted Eye-safe Aerosol Lidar (REAL) and the Scanning Aerosol Micro-Pulse Lidar-Eye-safe (SAMPLE) are very different in how they generate and detect laser radiation. We present results from an experiment where the REAL and the SAMPLE were operated side-by-side in Chico, California, in March of 2015. During the non-continuous, eleven day test period, the SAMPLE instrument was operated at maximum pulse repetition frequency (15 kHz) and integrated over the interpulse period of the REAL (0.1 s). Operation at the high pulse repetition frequency resulted in second trip echoes which contaminated portions of the data. The performance of the SAMPLE instrument varied with background brightness--as expected with a photon counting receiver|--yet showed equal or larger backscatter intensity signal to noise ratio throughout the intercomparison experiment. We show that a modest low-pass filter or smooth applied to the REAL raw waveforms (that have 5x higher range resolution) results in significant increases in raw signal-to-noise ratio and image signal-to-noise ratio--a measure of coherent aerosol feature content in the images resulting from the scans. Examples of wind fields and time series of wind estimates from both systems are presented. We conclude by reviewing the advantages and disadvantages of each system and sketch a plan for future research and development activities to optimize the design of future systems.

  1. Quality assurance guidance for field sampling and measurement assessment plates in support of EM environmental sampling and analysis activities

    SciTech Connect

    Not Available

    1994-05-01

    This document is one of several guidance documents developed by the US Department of Energy (DOE) Office of Environmental Restoration and Waste Management (EM). These documents support the EM Analytical Services Program (ASP) and are based on applicable regulatory requirements and DOE Orders. They address requirements in DOE Orders by providing guidance that pertains specifically to environmental restoration and waste management sampling and analysis activities. DOE 5700.6C Quality Assurance (QA) defines policy and requirements to establish QA programs ensuring that risks and environmental impacts are minimized and that safety, reliability, and performance are maximized. This is accomplished through the application of effective management systems commensurate with the risks imposed by the facility and the project. Every organization supporting EM`s environmental sampling and analysis activities must develop and document a QA program. Management of each organization is responsible for appropriate QA program implementation, assessment, and improvement. The collection of credible and cost-effective environmental data is critical to the long-term success of remedial and waste management actions performed at DOE facilities. Only well established and management supported assessment programs within each EM-support organization will enable DOE to demonstrate data quality. The purpose of this series of documents is to offer specific guidance for establishing an effective assessment program for EM`s environmental sampling and analysis (ESA) activities.

  2. Field Comparison of the Sampling Efficacy of Two Smear Media: Cotton Fiber and Kraft Paper

    SciTech Connect

    Hogue, M.G.

    2002-02-07

    Two materials were compared in field tests at the Defense Waste Processing Facility: kraft paper (a strong, brown paper made from wood pulp prepared with a sodium sulfate solution) and cotton fiber. Based on a sampling of forty-six pairs of smears, the cotton fiber smears provide a greater sensitivity. The cotton fiber smears collected an average of forty-four percent more beta activity than the kraft paper smears and twenty-nine percent more alpha activity. Results show a greater sensitivity with cotton fiber over kraft paper at the 95 percent confidence level. Regulatory requirements for smear materials are vague. The data demonstrate that the difference in sensitivity of smear materials could lead to a large difference in reported results that are subsequently used for meeting shipping regulations or evaluating workplace contamination levels.

  3. Floral diversity in desert ecosystems: Comparing field sampling to image analyses in assessing species cover

    PubMed Central

    2013-01-01

    Background Developing a quick and reliable technique to estimate floral cover in deserts will assist in monitoring and management. The present attempt was to estimate plant cover in the UAE desert using both digital photography and field sampling. Digital photographs were correlated with field data to estimate floral cover in moderately (Al-Maha) and heavily (DDCR) grazed areas. The Kruskal-Wallis test was also used to assess compatibility between the two techniques within and across grazing intensities and soil substrates. Results Results showed that photographs could be a reliable technique within the sand dune substrate under moderate grazing (r = 0.69). The results were very poorly correlated (r =−0.24) or even inversely proportional (r =−0.48) when performed within DDCR. Overall, Chi-square values for Al-Maha and DDCR were not significant at P > 0.05, indicating similarities between the two methods. At the soil type level, the Kruskal-Wallis analysis was not significant (P > 0.05), except for gravel plains (P < 0.05). Across grazing intensities and soil substrates, the two techniques were in agreement in ranking most plant species, except for Lycium shawii. Conclusions Consequently, the present study has proven that digital photography could not be used reliably to asses floral cover, while further testing is required to support such claim. An image-based sampling approach of plant cover at the species level, across different grazing and substrate variations in desert ecosystems, has its uses, but results are to be cautiously interpreted. PMID:23758667

  4. Solar magnetic field studies using the 12 micron emission lines. II - Stokes profiles and vector field samples in sunspots

    NASA Technical Reports Server (NTRS)

    Hewagama, Tilak; Deming, Drake; Jennings, Donald E.; Osherovich, Vladimir; Wiedemann, Gunter; Zipoy, David; Mickey, Donald L.; Garcia, Howard

    1993-01-01

    Polarimetric observations at 12 microns of two sunpots are reported. The horizontal distribution of parameters such as magnetic field strength, inclination, azimuth, and magnetic field filling factors are presented along with information about the height dependence of the magnetic field strength. Comparisons with contemporary magnetostatic sunspot models are made. The magnetic data are used to estimate the height of 12 micron line formation. From the data, it is concluded that within a stable sunspot there are no regions that are magnetically filamentary, in the sense of containing both strong-field and field-free regions.

  5. FIELD-DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-09-12

    Methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of aqueous spent fuel storage basins and determine the oxide thickness on the spent fuel basin materials were developed to assess the corrosion potential of a basin. this assessment can then be used to determine the amount of time fuel has spent in a storage basin to ascertain if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations and assist in evaluating general storage basin operations. The test kit was developed based on the identification of key physical, chemical and microbiological parameters identified using a review of the scientific and basin operations literature. The parameters were used to design bench scale test cells for additional corrosion analyses, and then tools were purchased to analyze the key parameters. The tools were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The sampling kit consisted of a total organic carbon analyzer, an YSI multiprobe, and a thickness probe. The tools were field tested to determine their ease of use, reliability, and determine the quality of data that each tool could provide. Characterization confirmed that the L Area basin is a well operated facility with low corrosion potential.

  6. Efficient time-sampling method in Coulomb-corrected strong-field approximation.

    PubMed

    Xiao, Xiang-Ru; Wang, Mu-Xue; Xiong, Wei-Hao; Peng, Liang-You

    2016-11-01

    One of the main goals of strong-field physics is to understand the complex structures formed in the momentum plane of the photoelectron. For this purpose, different semiclassical methods have been developed to seek an intuitive picture of the underlying mechanism. The most popular ones are the quantum trajectory Monte Carlo (QTMC) method and the Coulomb-corrected strong-field approximation (CCSFA), both of which take the classical action into consideration and can describe the interference effect. The CCSFA is more widely applicable in a large range of laser parameters due to its nonadiabatic nature in treating the initial tunneling dynamics. However, the CCSFA is much more time consuming than the QTMC method because of the numerical solution to the saddle-point equations. In the present work, we present a time-sampling method to overcome this disadvantage. Our method is as efficient as the fast QTMC method and as accurate as the original treatment in CCSFA. The performance of our method is verified by comparing the results of these methods with that of the exact solution to the time-dependent Schrödinger equation.

  7. Efficient time-sampling method in Coulomb-corrected strong-field approximation

    NASA Astrophysics Data System (ADS)

    Xiao, Xiang-Ru; Wang, Mu-Xue; Xiong, Wei-Hao; Peng, Liang-You

    2016-11-01

    One of the main goals of strong-field physics is to understand the complex structures formed in the momentum plane of the photoelectron. For this purpose, different semiclassical methods have been developed to seek an intuitive picture of the underlying mechanism. The most popular ones are the quantum trajectory Monte Carlo (QTMC) method and the Coulomb-corrected strong-field approximation (CCSFA), both of which take the classical action into consideration and can describe the interference effect. The CCSFA is more widely applicable in a large range of laser parameters due to its nonadiabatic nature in treating the initial tunneling dynamics. However, the CCSFA is much more time consuming than the QTMC method because of the numerical solution to the saddle-point equations. In the present work, we present a time-sampling method to overcome this disadvantage. Our method is as efficient as the fast QTMC method and as accurate as the original treatment in CCSFA. The performance of our method is verified by comparing the results of these methods with that of the exact solution to the time-dependent Schrödinger equation.

  8. In-Field Diffuse Ultraviolet Spectroscopy and Imaging of the Stardust Sample Return Capsule

    NASA Technical Reports Server (NTRS)

    Pugel, D. Elizabeth; Stackpoole, Mairead; McNamara, Karen; Schwartz, C.; Warren, J.; Kontinos, Dean

    2008-01-01

    In-field diffuse Ultraviolet (UV) spectroscopy and imaging systems were developed for the purposes of evaluating the surface chemical composition of spacecraft thermal control coatings and materials. The investigation of these systems and the compilation of an associated UV reflectance and luminescence database were conducted using the Stardust Sample Return Capsule (SRC), located at the Johnson Space Center. Spectral responses of the surfaces of the Stardust forebody and aftbody in both reflectance and fluorescence modes were examined post-flight. In this paper, we report on two primary findings of in-field diffuse UV spectroscopy and imaging: (1) deduction of the thermal history of thermal control coatings of the forebody and (2) bond line variations in the aftbody. In the forebody, the thermal history of thermal control coatings may be deduced from the presence of particular semiconducting defect states associated with ZnO, a common emissivity constituent in thermal control coatings. A spatial dependence of this history was mapped for these regions. In the aftbody, luminescing defect states, associated with Si and SiO2 color centers were found along regions of bond variability.

  9. Sediment grain size estimation using airborne remote sensing, field sampling, and robust statistic.

    PubMed

    Castillo, Elena; Pereda, Raúl; Luis, Julio Manuel de; Medina, Raúl; Viguri, Javier

    2011-10-01

    Remote sensing has been used since the 1980s to study parameters in relation with coastal zones. It was not until the beginning of the twenty-first century that it started to acquire imagery with good temporal and spectral resolution. This has encouraged the development of reliable imagery acquisition systems that consider remote sensing as a water management tool. Nevertheless, the spatial resolution that it provides is not adapted to carry out coastal studies. This article introduces a new methodology for estimating the most fundamental physical property of intertidal sediment, the grain size, in coastal zones. The study combines hyperspectral information (CASI-2 flight), robust statistic, and simultaneous field work (chemical and radiometric sampling), performed over Santander Bay, Spain. Field data acquisition was used to build a spectral library in order to study different atmospheric correction algorithms for CASI-2 data and to develop algorithms to estimate grain size in an estuary. Two robust estimation techniques (MVE and MCD multivariate M-estimators of location and scale) were applied to CASI-2 imagery, and the results showed that robust adjustments give acceptable and meaningful algorithms. These adjustments have given the following R(2) estimated results: 0.93 in the case of sandy loam contribution, 0.94 for the silty loam, and 0.67 for clay loam. The robust statistic is a powerful tool for large dataset.

  10. Field evaluation of a sampling and analytical method for environmental levels of airborne hexavalent chromium.

    PubMed

    Sheehan, P; Ricks, R; Ripple, S; Paustenbach, D

    1992-01-01

    Hexavalent chromium, Cr(VI), has been classified as a human respiratory carcinogen. Airborne Cr(VI) emissions are associated with a number of industrial sources including metal plating, tanning, chromite ore processing, and spray painting operations; combustion sources such as automobiles and incinerators; and fugitive dusts from contaminated soil. There has been considerable interest within industry and the regulatory community to assess the potential cancer risks of workers exposed to Cr(VI) at levels substantially below the threshold limit value (TLV) of 50 micrograms/m3. To date, only the workplace sampling and analytical method (National Institute for Occupational Safety and Health [NIOSH] Method 7600) has been validated for measuring airborne Cr(VI), and it can accurately measure concentrations only as low as 500 ng/m3. This paper describes the field evaluation of a sampling and analytical method for the quantitation of airborne Cr(VI) at concentrations 5000 times lower than the current standard method (as low as 0.1 ng/m3). The collection method uses three 500-mL Greenberg-Smith impingers in series, operated at 15 Lpm for 24 hr. All three impingers are filled with 200 mL of a slightly alkaline (pH approximately 8) sodium bicarbonate buffer solution. The results of validation tests showed that both Cr(VI) and trivalent chromium, Cr(III), were stable in the collection medium and that samples may be stored for up to 100 days without appreciable loss of Cr(VI). Method precision based on the pooled coefficient of variation for replicate samples was 10.4%, and method accuracy based on the mean percent recovery of spiked samples was 94%. Both the precision and accuracy of the impinger method were within NIOSH criteria. This method could be used to measure ambient concentrations of Cr(VI) in the workplace caused by fugitive emissions from manufacturing processes or chromium-contaminated soils at workplace concentrations well below the current TLV (50 micrograms/m3

  11. Acquisition of a High Resolution Field Emission Scanning Electron Microscope for the Analysis of Returned Samples

    NASA Technical Reports Server (NTRS)

    Nittler, Larry R.

    2003-01-01

    This grant furnished funds to purchase a state-of-the-art scanning electron microscope (SEM) to support our analytical facilities for extraterrestrial samples. After evaluating several instruments, we purchased a JEOL 6500F thermal field emission SEM with the following analytical accessories: EDAX energy-dispersive x-ray analysis system with fully automated control of instrument and sample stage; EDAX LEXS wavelength-dispersive x-ray spectrometer for high sensitivity light-element analysis; EDAX/TSL electron backscatter diffraction (EBSD) system with software for phase identification and crystal orientation mapping; Robinson backscatter electron detector; and an in situ micro-manipulator (Kleindiek). The total price was $550,000 (with $150,000 of the purchase supported by Carnegie institution matching funds). The microscope was delivered in October 2002, and most of the analytical accessories were installed by January 2003. With the exception of the wavelength spectrometer (which has been undergoing design changes) everything is working well and the SEM is in routine use in our laboratory.

  12. Exponentially Biased Ground-State Sampling of Quantum Annealing Machines with Transverse-Field Driving Hamiltonians

    NASA Astrophysics Data System (ADS)

    Mandrà, Salvatore; Zhu, Zheng; Katzgraber, Helmut G.

    2017-02-01

    We study the performance of the D-Wave 2X quantum annealing machine on systems with well-controlled ground-state degeneracy. While obtaining the ground state of a spin-glass benchmark instance represents a difficult task, the gold standard for any optimization algorithm or machine is to sample all solutions that minimize the Hamiltonian with more or less equal probability. Our results show that while naive transverse-field quantum annealing on the D-Wave 2X device can find the ground-state energy of the problems, it is not well suited in identifying all degenerate ground-state configurations associated with a particular instance. Even worse, some states are exponentially suppressed, in agreement with previous studies on toy model problems [New J. Phys. 11, 073021 (2009), 10.1088/1367-2630/11/7/073021]. These results suggest that more complex driving Hamiltonians are needed in future quantum annealing machines to ensure a fair sampling of the ground-state manifold.

  13. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal field, California, was measured at 150, 200, and 250 C as a function of steam pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption and desorption runs were made in order to investigate the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were made on the same rock samples. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there was no direct correlation between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The hysteresis decreased significantly at 250 C. The results indicate that multilayer adsorption, rather than capillary condensation, is the dominant water storage mechanism at high temperatures.

  14. Determination of ephedrine and pseudoephedrine by field-amplified sample injection capillary electrophoresis.

    PubMed

    Deng, Dongli; Deng, Hao; Zhang, Lichun; Su, Yingying

    2014-04-01

    A simple and rapid capillary electrophoresis method was developed for the separation and determination of ephedrine (E) and pseudoephedrine (PE) in a buffer solution containing 80 mM of NaH2PO4 (pH 3.0), 15 mM of β-cyclodextrin and 0.3% of hydroxypropyl methylcellulose. The field-amplified sample injection (FASI) technique was applied to the online concentration of the alkaloids. With FASI in the presence of a low conductivity solvent plug (water), an approximately 1,000-fold improvement in sensitivity was achieved without any loss of separation efficiency when compared to conventional sample injection. Under these optimized conditions, a baseline separation of the two analytes was achieved within 16 min and the detection limits for E and PE were 0.7 and 0.6 µg/L, respectively. Without expensive instruments or labeling of the compounds, the limits of detection for E and PE obtained by the proposed method are comparable with (or even lower than) those obtained by capillary electrophoresis laser-induced fluorescence, liquid chromatography-tandem mass spectrometry and gas chromatography-mass spectrometry. The method was validated in terms of precision, linearity and accuracy, and successfully applied for the determination of the two alkaloids in Ephedra herbs.

  15. Exponentially Biased Ground-State Sampling of Quantum Annealing Machines with Transverse-Field Driving Hamiltonians.

    PubMed

    Mandrà, Salvatore; Zhu, Zheng; Katzgraber, Helmut G

    2017-02-17

    We study the performance of the D-Wave 2X quantum annealing machine on systems with well-controlled ground-state degeneracy. While obtaining the ground state of a spin-glass benchmark instance represents a difficult task, the gold standard for any optimization algorithm or machine is to sample all solutions that minimize the Hamiltonian with more or less equal probability. Our results show that while naive transverse-field quantum annealing on the D-Wave 2X device can find the ground-state energy of the problems, it is not well suited in identifying all degenerate ground-state configurations associated with a particular instance. Even worse, some states are exponentially suppressed, in agreement with previous studies on toy model problems [New J. Phys. 11, 073021 (2009)NJOPFM1367-263010.1088/1367-2630/11/7/073021]. These results suggest that more complex driving Hamiltonians are needed in future quantum annealing machines to ensure a fair sampling of the ground-state manifold.

  16. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling.

    PubMed

    Aerts, Sam; Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-01

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information-inside hotspots or in search of them-based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km2. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96.

  17. Development of sampling approaches for the determination of the presence of genetically modified organisms at the field level.

    PubMed

    Sustar-Vozlic, Jelka; Rostohar, Katja; Blejec, Andrej; Kozjak, Petra; Cergan, Zoran; Meglic, Vladimir

    2010-03-01

    In order to comply with the European Union regulatory threshold for the adventitious presence of genetically modified organisms (GMOs) in food and feed, it is important to trace GMOs from the field. Appropriate sampling methods are needed to accurately predict the presence of GMOs at the field level. A 2-year field experiment with two maize varieties differing in kernel colour was conducted in Slovenia. Based on the results of data mining analyses and modelling, it was concluded that spatial relations between the donor and receptor field were the most important factors influencing the distribution of outcrossing rate (OCR) in the field. The approach for estimation fitting function parameters in the receptor (non-GM) field at two distances from the donor (GM) field (10 and 25 m) for estimation of the OCR (GMO content) in the whole receptor field was developed. Different sampling schemes were tested; a systematic random scheme in rows was proposed to be applied for sampling at the two distances for the estimation of fitting function parameters for determination of OCR. The sampling approach had already been validated with some other OCR data and was practically applied in the 2009 harvest in Poland. The developed approach can be used for determination of the GMO presence at the field level and for making appropriate labelling decisions. The importance of this approach lies in its possibility to also address other threshold levels beside the currently prescribed labelling threshold of 0.9% for food and feed.

  18. Moving your laboratories to the field – Advantages and limitations of the use of field portable instruments in environmental sample analysis

    SciTech Connect

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M.; Namieśnik, Jacek

    2015-07-15

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet–visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. - Highlights: • Field portable instruments are widely used in environmental sample analysis. • Field portable instruments are indispensable for analysis in emergency response. • Miniaturization of field portable instruments reduces resource consumption. • In situ analysis is in agreement with green analytical chemistry

  19. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  20. Characterisation of radiation field for irradiation of biological samples at nuclear reactor-comparison of twin detector and recombination methods.

    PubMed

    Golnik, N; Gryziński, M A; Kowalska, M; Meronka, K; Tulik, P

    2014-10-01

    Central Laboratory for Radiological Protection is involved in achieving scientific project on biological dosimetry. The project includes irradiation of blood samples in radiation fields of nuclear reactor. A simple facility for irradiation of biological samples has been prepared at horizontal channel of the nuclear reactor MARIA in NCBJ in Poland. The radiation field, composed mainly of gamma radiation and thermal neutrons, has been characterised in terms of tissue kerma using twin-detector technique and recombination chambers.

  1. Use of field-applied quality control samples to monitor performance of a Goulden large-sample extractor/GC-MS method for pesticides in water

    USGS Publications Warehouse

    Foreman, W.T.; Gates, Paul M.; Foster, G.D.; Rinella, F.A.; McKenzie, S.W.

    2000-01-01

    Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4'-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50-ng/L each. Recoveries ranged from not detected to greater than 100%. Variability in pesticide recoveries from triplicate 10-L water samples collected at one site averaged 5.7% relative standard deviation and did not exceed 19%.Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4???-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50

  2. Spatially-Optimized Sequential Sampling Plan for Cabbage Aphids Brevicoryne brassicae L. (Hemiptera: Aphididae) in Canola Fields.

    PubMed

    Severtson, Dustin; Flower, Ken; Nansen, Christian

    2016-08-01

    The cabbage aphid is a significant pest worldwide in brassica crops, including canola. This pest has shown considerable ability to develop resistance to insecticides, so these should only be applied on a "when and where needed" basis. Thus, optimized sampling plans to accurately assess cabbage aphid densities are critically important to determine the potential need for pesticide applications. In this study, we developed a spatially optimized binomial sequential sampling plan for cabbage aphids in canola fields. Based on five sampled canola fields, sampling plans were developed using 0.1, 0.2, and 0.3 proportions of plants infested as action thresholds. Average sample numbers required to make a decision ranged from 10 to 25 plants. Decreasing acceptable error from 10 to 5% was not considered practically feasible, as it substantially increased the number of samples required to reach a decision. We determined the relationship between the proportions of canola plants infested and cabbage aphid densities per plant, and proposed a spatially optimized sequential sampling plan for cabbage aphids in canola fields, in which spatial features (i.e., edge effects) and optimization of sampling effort (i.e., sequential sampling) are combined. Two forms of stratification were performed to reduce spatial variability caused by edge effects and large field sizes. Spatially optimized sampling, starting at the edge of fields, reduced spatial variability and therefore increased the accuracy of infested plant density estimates. The proposed spatially optimized sampling plan may be used to spatially target insecticide applications, resulting in cost savings, insecticide resistance mitigation, conservation of natural enemies, and reduced environmental impact.

  3. Pre-Mission Input Requirements to Enable Successful Sample Collection by A Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Lim, D. S. S.; Young, K. E.; Brunner, A.; Elphic, R. E.; Horne, A.; Kerrigan, M. C.; Osinski, G. R.; Skok, J. R.; Squyres, S. W.; Saint-Jacques, D.; Heldmann, J. L.

    2016-01-01

    The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team, part of the Solar System Exploration Virtual Institute (SSERVI), is a field-based research program aimed at generating strategic knowledge in preparation for human and robotic exploration of the Moon, near-Earth asteroids, Phobos and Deimos, and beyond. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused and, moreover, is sampling-focused with the explicit intent to return the best samples for geochronology studies in the laboratory. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. We examined the in situ sample characterization and real-time decision-making process of the astronauts, with a guiding hypothesis that pre-mission training that included detailed background information on the analytical fate of a sample would better enable future astronauts to select samples that would best meet science requirements. We conducted three tests of this hypothesis over several days in the field. Our investigation was designed to document processes, tools and procedures for crew sampling of planetary targets. This was not meant to be a blind, controlled test of crew efficacy, but rather an effort to explicitly recognize the relevant variables that enter into sampling protocol and to be able to develop recommendations for crew and backroom training in future endeavors.

  4. DEVELOPMENT OF METHODOLOGY AND FIELD DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-06-04

    This project developed methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of the fuel storage medium and determine the oxide thickness on the spent fuel basin materials. The overall objective of this project was to determine the amount of time fuel has spent in a storage basin to determine if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations. This project developed and validated forensic tools that can be used to predict the age and condition of spent nuclear fuels stored in liquid basins based on key physical, chemical and microbiological basin characteristics. Key parameters were identified based on a literature review, the parameters were used to design test cells for corrosion analyses, tools were purchased to analyze the key parameters, and these were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The key parameters identified in the literature review included chloride concentration, conductivity, and total organic carbon level. Focus was also placed on aluminum based cladding because of their application to weapons production. The literature review was helpful in identifying important parameters, but relationships between these parameters and corrosion rates were not available. Bench scale test systems were designed, operated, harvested, and analyzed to determine corrosion relationships between water parameters and water conditions, chemistry and microbiological conditions. The data from the bench scale system indicated that corrosion rates were dependent on total organic carbon levels and chloride concentrations. The highest corrosion rates were observed in test cells amended with sediment, a large microbial inoculum and an organic carbon source. A complete characterization test kit was field tested to characterize the SRS L-Area spent fuel basin. The sampling kit consisted of a TOC analyzer, a YSI

  5. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling

    SciTech Connect

    Aerts, Sam Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-15

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information—inside hotspots or in search of them—based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km{sup 2}. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2 dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96. -- Highlights: • We present an

  6. Experiments with central-limit properties of spatial samples from locally covariant random fields

    USGS Publications Warehouse

    Barringer, T.H.; Smith, T.E.

    1992-01-01

    When spatial samples are statistically dependent, the classical estimator of sample-mean standard deviation is well known to be inconsistent. For locally dependent samples, however, consistent estimators of sample-mean standard deviation can be constructed. The present paper investigates the sampling properties of one such estimator, designated as the tau estimator of sample-mean standard deviation. In particular, the asymptotic normality properties of standardized sample means based on tau estimators are studied in terms of computer experiments with simulated sample-mean distributions. The effects of both sample size and dependency levels among samples are examined for various value of tau (denoting the size of the spatial kernel for the estimator). The results suggest that even for small degrees of spatial dependency, the tau estimator exhibits significantly stronger normality properties than does the classical estimator of standardized sample means. ?? 1992.

  7. Microcystin-Bound Protein Patterns in Different Cultures of Microcystis aeruginosa and Field Samples

    PubMed Central

    Wei, Nian; Hu, Lili; Song, Lirong; Gan, Nanqin

    2016-01-01

    Micocystin (MC) exists in Microcystis cells in two different forms, free and protein-bound. We examined the dynamic change in extracellular free MCs, intracellular free MCs and protein-bound MCs in both batch cultures and semi-continuous cultures, using high performance liquid chromatography and Western blot. The results showed that the free MC per cell remained constant, while the quantity of protein-bound MCs increased with the growth of Microcystis cells in both kinds of culture. Significant changes in the dominant MC-bound proteins occurred in the late exponential growth phase of batch cultures, while the dominant MC-bound proteins in semi-continuous cultures remained the same. In field samples collected at different months in Lake Taihu, the dominant MC-bound proteins were shown to be similar, but the amount of protein-bound MC varied and correlated with the intracellular MC content. We identified MC-bound proteins by two-dimensional electrophoresis immunoblots and mass spectrometry. The 60 kDa chaperonin GroEL was a prominent MC-bound protein. Three essential glycolytic enzymes and ATP synthase alpha subunit were also major targets of MC-binding, which might contribute to sustained growth in semi-continuous culture. Our results indicate that protein-bound MC may be important for sustaining growth and adaptation of Microcystis sp. PMID:27754336

  8. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    SciTech Connect

    Armas-Perez, Julio C.; Londono-Hurtado, Alejandro; Guzman, Orlando; Hernandez-Ortiz, Juan P.; de Pablo, Juan J.

    2015-07-27

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  9. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields

    SciTech Connect

    Armas-Pérez, Julio C.; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P.; Pablo, Juan J. de

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  10. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    PubMed

    Armas-Pérez, Julio C; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P; de Pablo, Juan J

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  11. Field guide for collecting and processing stream-water samples for the National Water-Quality Assessment Program

    USGS Publications Warehouse

    Shelton, Larry R.

    1994-01-01

    The U.S. Geological Survey's National Water-Quality Assessment program includes extensive data- collection efforts to assess the quality of the Nations's streams. These studies require analyses of stream samples for major ions, nutrients, sediments, and organic contaminants. For the information to be comparable among studies in different parts of the Nation, consistent procedures specifically designed to produce uncontaminated samples for trace analysis in the laboratory are critical. This field guide describes the standard procedures for collecting and processing samples for major ions, nutrients, organic contaminants, sediment, and field analyses of conductivity, pH, alkalinity, and dissolved oxygen. Samples are collected and processed using modified and newly designed equipment made of Teflon to avoid contamination, including nonmetallic samplers (D-77 and DH-81) and a Teflon sample splitter. Field solid-phase extraction procedures developed to process samples for organic constituent analyses produce an extracted sample with stabilized compounds for more accurate results. Improvements to standard operational procedures include the use of processing chambers and capsule filtering systems. A modified collecting and processing procedure for organic carbon is designed to avoid contamination from equipment cleaned with methanol. Quality assurance is maintained by strict collecting and processing procedures, replicate sampling, equipment blank samples, and a rigid cleaning procedure using detergent, hydrochloric acid, and methanol.

  12. Laboratory development and field evaluation of a generic method for sampling and analysis of isocyanates. Revised final report

    SciTech Connect

    McGaughey, J.F.; Foster, S.C.; Merrill, R.G.

    1995-09-01

    The U.S. Environmental Protection Agency (EPA), under the authority of Title III of the Clean Air Act Amendments (CAAA) of 1990, requires the identification and validation of sampling and analytical methods for the isocyanate compounds which are listed among the 189 hazardous air pollutants identified in Title III. In all, three field tests were performed to accomplish the isocyanate field evaluation. The objective of this work was to develop and evaluate the isocyanate sampling and analytical test method through field testing at operating stationary sources. The method was evaluated by collecting flue gas samples for the analysis of the individual isocyanate and evaluating the data for bias and precision. EPA Method 301, Field Validation of Pollutant Measurement Methods from Various Waste Media, was used as the model for the experimental design of this method evaluation project.

  13. Field geologic observation and sample collection strategies for planetary surface exploration: Insights from the 2010 Desert RATS geologist crewmembers

    NASA Astrophysics Data System (ADS)

    Hurtado, José M.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W.

    2013-10-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic fieldwork, the Desert RATS (Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crewmembers who participated in the 2010 field test. We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies related to duplication of samples and observations; logistical constraints on the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to "flexibly execute" their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  14. The actual goals of geoethics

    NASA Astrophysics Data System (ADS)

    Nemec, Vaclav

    2014-05-01

    The most actual goals of geoethics have been formulated as results of the International Conference on Geoethics (October 2013) held at the geoethics birth-place Pribram (Czech Republic): In the sphere of education and public enlightenment an appropriate needed minimum know how of Earth sciences should be intensively promoted together with cultivating ethical way of thinking and acting for the sustainable well-being of the society. The actual activities of the Intergovernmental Panel of Climate Changes are not sustainable with the existing knowledge of the Earth sciences (as presented in the results of the 33rd and 34th International Geological Congresses). This knowledge should be incorporated into any further work of the IPCC. In the sphere of legislation in a large international co-operation following steps are needed: - to re-formulate the term of a "false alarm" and its legal consequences, - to demand very consequently the needed evaluation of existing risks, - to solve problems of rights of individuals and minorities in cases of the optimum use of mineral resources and of the optimum protection of the local population against emergency dangers and disasters; common good (well-being) must be considered as the priority when solving ethical dilemmas. The precaution principle should be applied in any decision making process. Earth scientists presenting their expert opinions are not exempted from civil, administrative or even criminal liabilities. Details must be established by national law and jurisprudence. The well known case of the L'Aquila earthquake (2009) should serve as a serious warning because of the proven misuse of geoethics for protecting top Italian seismologists responsible and sentenced for their inadequate superficial behaviour causing lot of human victims. Another recent scandal with the Himalayan fossil fraud will be also documented. A support is needed for any effort to analyze and to disclose the problems of the deformation of the contemporary

  15. Field Geologic Observation and Sample Collection Strategies for Planetary Surface Exploration: Insights from the 2010 Desert RATS Geologist Crewmembers

    NASA Technical Reports Server (NTRS)

    Hurtado, Jose M., Jr.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W., Jr.

    2012-01-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic field- work, the Desert RATS(Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crew members who participated in the 2010 field test.We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies relatedtoduplicationofsamplesandobservations;logisticalconstraintson the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to flexibly execute their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  16. THE IMPORTANCE OF THE MAGNETIC FIELD FROM AN SMA-CSO-COMBINED SAMPLE OF STAR-FORMING REGIONS

    SciTech Connect

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Chen, Huei-Ru Vivien; Liu, Hau-Yu Baobab; Yen, Hsi-Wei; Lai, Shih-Ping; Zhang, Qizhou; Chen, How-Huan; Ching, Tao-Chung; Girart, Josep M.; Frau, Pau; Li, Hua-Bai; Li, Zhi-Yun; Padovani, Marco; Qiu, Keping; Rao, Ramprasad

    2014-12-20

    Submillimeter dust polarization measurements of a sample of 50 star-forming regions, observed with the Submillimeter Array (SMA) and the Caltech Submillimeter Observatory (CSO) covering parsec-scale clouds to milliparsec-scale cores, are analyzed in order to quantify the magnetic field importance. The magnetic field misalignment δ—the local angle between magnetic field and dust emission gradient—is found to be a prime observable, revealing distinct distributions for sources where the magnetic field is preferentially aligned with or perpendicular to the source minor axis. Source-averaged misalignment angles (|δ|) fall into systematically different ranges, reflecting the different source-magnetic field configurations. Possible bimodal (|δ|) distributions are found for the separate SMA and CSO samples. Combining both samples broadens the distribution with a wide maximum peak at small (|δ|) values. Assuming the 50 sources to be representative, the prevailing source-magnetic field configuration is one that statistically prefers small magnetic field misalignments |δ|. When interpreting |δ| together with a magnetohydrodynamics force equation, as developed in the framework of the polarization-intensity gradient method, a sample-based log-linear scaling fits the magnetic field tension-to-gravity force ratio (Σ {sub B}) versus (|δ|) with (Σ {sub B}) = 0.116 · exp (0.047 · (|δ|)) ± 0.20 (mean error), providing a way to estimate the relative importance of the magnetic field, only based on measurable field misalignments |δ|. The force ratio Σ {sub B} discriminates systems that are collapsible on average ((Σ {sub B}) < 1) from other molecular clouds where the magnetic field still provides enough resistance against gravitational collapse ((Σ {sub B}) > 1). The sample-wide trend shows a transition around (|δ|) ≈ 45°. Defining an effective gravitational force ∼1 – (Σ {sub B}), the average magnetic-field-reduced star formation efficiency is at least a

  17. Surveying immigrants without sampling frames - evaluating the success of alternative field methods.

    PubMed

    Reichel, David; Morales, Laura

    2017-01-01

    This paper evaluates the sampling methods of an international survey, the Immigrant Citizens Survey, which aimed at surveying immigrants from outside the European Union (EU) in 15 cities in seven EU countries. In five countries, no sample frame was available for the target population. Consequently, alternative ways to obtain a representative sample had to be found. In three countries 'location sampling' was employed, while in two countries traditional methods were used with adaptations to reach the target population. The paper assesses the main methodological challenges of carrying out a survey among a group of immigrants for whom no sampling frame exists. The samples of the survey in these five countries are compared to results of official statistics in order to assess the accuracy of the samples obtained through the different sampling methods. It can be shown that alternative sampling methods can provide meaningful results in terms of core demographic characteristics although some estimates differ to some extent from the census results.

  18. Sampling and Analysis of Impact Crater Residues found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R. P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years on orbit, the Wide Field Planetary Camera-2 (WFPC-2) was recovered from the Hubble Space Telescope in May 2009 during the 12 day shuttle mission designated STS-125. During that exposure to the low Earth orbit environment, the WFPC-2 radiator was struck by approximately 700 impactors producing crater features 300 micrometers and larger in size. Following an optical inspection of these features in 2009, an agreement was reached for the joint NASA-ESA examination and characterization of crater residues, the remnants of the projectile, in 2011. Active examination began in 2012, with 486 of the impact features being cored at NASA Johnson Space Center fs (JSC) Space Exposed Hardware cleanroom and curation facility. The core samples were subsequently divided between NASA and ESA. NASA's analysis was conducted at JSC fs Astromaterials Research and Exploration Science (ARES) Division, using scanning electron microscopy (SEM)/ energy dispersive X-ray spectrometry (EDS) methods, and ESA's analysis was conducted at the Natural History Museum (NHM) again using SEM/EDS, and at the University of Surrey Ion Beam Centre (IBC) using ion beam analysis (IBA) with a scanned proton microbeam. As detailed discussion of the joint findings remains premature at this point, this paper reports on the coring technique developed; the practical taxonomy developed to classify residues as belonging either to anthropogenic "orbital debris" or micrometeoroids; and the protocols for examination of crater residues. Challenges addressed in coring were the relative thickness of the surface to be cut, protection of the impact feature from contamination while coring, and the need to preserve the cleanroom environment so as to preclude or minimize cross-contamination. Classification criteria are summarized, including the assessment of surface contamination and surface cleaning. Finally, we discuss the analytical techniques used to examine the crater residues. We employed EDS from

  19. Optimized Field Sampling and Monitoring of Airborne Hazardous Transport Plumes; A Geostatistical Simulation Approach

    SciTech Connect

    Chen, DI-WEN

    2001-11-21

    Airborne hazardous plumes inadvertently released during nuclear/chemical/biological incidents are mostly of unknown composition and concentration until measurements are taken of post-accident ground concentrations from plume-ground deposition of constituents. Unfortunately, measurements often are days post-incident and rely on hazardous manned air-vehicle measurements. Before this happens, computational plume migration models are the only source of information on the plume characteristics, constituents, concentrations, directions of travel, ground deposition, etc. A mobile ''lighter than air'' (LTA) system is being developed at Oak Ridge National Laboratory that will be part of the first response in emergency conditions. These interactive and remote unmanned air vehicles will carry light-weight detectors and weather instrumentation to measure the conditions during and after plume release. This requires a cooperative computationally organized, GPS-controlled set of LTA's that self-coordinate around the objectives in an emergency situation in restricted time frames. A critical step before an optimum and cost-effective field sampling and monitoring program proceeds is the collection of data that provides statistically significant information, collected in a reliable and expeditious manner. Efficient aerial arrangements of the detectors taking the data (for active airborne release conditions) are necessary for plume identification, computational 3-dimensional reconstruction, and source distribution functions. This report describes the application of stochastic or geostatistical simulations to delineate the plume for guiding subsequent sampling and monitoring designs. A case study is presented of building digital plume images, based on existing ''hard'' experimental data and ''soft'' preliminary transport modeling results of Prairie Grass Trials Site. Markov Bayes Simulation, a coupled Bayesian/geostatistical methodology, quantitatively combines soft information

  20. The WSRT wide-field H I survey. I. The background galaxy sample

    NASA Astrophysics Data System (ADS)

    Braun, R.; Thilker, D.; Walterbos, R. A. M.

    2003-08-01

    We have used the Westerbork array to carry out an unbiased wide-field survey for H I emission features, achieving an RMS sensitivity of about 18 mJy/Beam at a velocity resolution of 17 km s-1 over 1800 deg2 and between -1000 < VHel <+6500 km s-1. The primary data consists of auto-correlation spectra with an effective angular resolution of 49' FWHM, although cross-correlation data were also acquired. The survey region is centered approximately on the position of Messier 31 and is Nyquist-sampled over 60x 30o in RA x Dec. More than 100 distinct features are detected at high significance in each of the two velocity regimes (negative and positive LGSR velocities). In this paper we present the results for our H I detections of external galaxies at positive LGSR velocity. We detect 155 external galaxies in excess of 8sigma in integrated H I flux density. Plausible optical associations are found within a 30' search radius for all but one of our H I detections in DSS images, although several are not previously cataloged or do not have published red-shift determinations. Our detection without a DSS association is at low galactic latitude. Twenty-three of our objects are detected in H I for the first time. We classify almost half of our detections as ``confused'', since one or more companions is cataloged within a radius of 30' and a velocity interval of 400 km s-1. We identify a handful of instances of significant positional offsets exceeding 10 kpc of unconfused optical galaxies with the associated H I centroid, possibly indicative of severe tidal distortions or uncataloged gas-rich companions. A possible trend is found for an excess of detected H I flux in unconfused galaxies within our large survey beam relative to that detected previously in smaller telescope beams, both as function of increasing distance and increasing gas mass. This may be an indication for a diffuse gaseous component on 100 kpc scales in the environment of massive galaxies or a population of

  1. 2003 Mars Exploration Rover Mission: Robotic Field Geologists for a Mars Sample Return Mission

    NASA Technical Reports Server (NTRS)

    Ming, Douglas W.

    2008-01-01

    The Mars Exploration Rover (MER) Spirit landed in Gusev crater on Jan. 4, 2004 and the rover Opportunity arrived on the plains of Meridiani Planum on Jan. 25, 2004. The rovers continue to return new discoveries after 4 continuous Earth years of operations on the surface of the red planet. Spirit has successfully traversed 7.5 km over the Gusev crater plains, ascended to the top of Husband Hill, and entered into the Inner Basin of the Columbia Hills. Opportunity has traveled nearly 12 km over flat plains of Meridiani and descended into several impact craters. Spirit and Opportunity carry an integrated suite of scientific instruments and tools called the Athena science payload. The Athena science payload consists of the 1) Panoramic Camera (Pancam) that provides high-resolution, color stereo imaging, 2) Miniature Thermal Emission Spectrometer (Mini-TES) that provides spectral cubes at mid-infrared wavelengths, 3) Microscopic Imager (MI) for close-up imaging, 4) Alpha Particle X-Ray Spectrometer (APXS) for elemental chemistry, 5) Moessbauer Spectrometer (MB) for the mineralogy of Fe-bearing materials, 6) Rock Abrasion Tool (RAT) for removing dusty and weathered surfaces and exposing fresh rock underneath, and 7) Magnetic Properties Experiment that allow the instruments to study the composition of magnetic martian materials [1]. The primary objective of the Athena science investigation is to explore two sites on the martian surface where water may once have been present, and to assess past environmental conditions at those sites and their suitability for life. The Athena science instruments have made numerous scientific discoveries over the 4 plus years of operations. The objectives of this paper are to 1) describe the major scientific discoveries of the MER robotic field geologists and 2) briefly summarize what major outstanding questions were not answered by MER that might be addressed by returning samples to our laboratories on Earth.

  2. Brevibacillus halotolerans sp. nov., isolated from saline soil sample collected from paddy field.

    PubMed

    Song, Jinlong; Wang, Yanwei; Song, Yi; Zhao, Bingqiang; Wang, Huimin; Zhou, Shan; Kong, Delong; Guo, Xiang; Li, Yanting; He, Mingxiong; Ma, Kedong; Ruan, Zhiyong; Yan, Yanchun

    2016-10-17

    Two novel aerobic bacteria, designated strains LAM0312T and LAM0313, were isolated from saline soil sample collected from paddy field in Dezhou city, Shandong Province in China. The Cells of these strains were Gram-stain positive, sporogenous, rod-shaped and motile with peritrichous flagella. The optimal growth temperature and pH were 30 ºC and pH 7.0-8.0, repesctively. Strain LAM0312T was found to be able to grow in the presence of 12 % (w/v) NaCl. The major fatty acids of strains were identified as anteiso-C15:0 and iso-C15:0. The dominant polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, glycolipids, five unidentitied lipids and phosphatidylmonomethylethanolamine. The cell wall peptidoglycan was found to contain meso-diaminopimelic acid. The predominant menaquinone was identified as menaquinone-7. The G+C content of genomic DNA of strains LAM0312T and LAM0313 were 45.0 mol% and 46.0 mol%, respectively as determined by the Tm method. The 16S rRNA gene sequence similarity analysis indicated that the strains were closely related to Brevibacillus laterosporus DSM 25T and Brevibacillus fluminis JCM 15716T with 98.5 % and 96.4 % sequence similarity, respectively. The DNA-DNA hybridization values between strain LAM0312T and LAM0313 was 92 ± 0.6 % (reciprocal 90 ± 0.2 %)and the value between LAM0312T andBrevibacillus laterosporus DSM 25T was 48 ± 0.5 % (reciprocal 40 ± 0.4 %). On the basis of the phenotypic, phylogenetic and chemotaxonomic characteristics, the strains are proposed to represent a novel species of the genus Brevibacillus, for which the name Brevibacillus halotolerans sp. nov. is proposed. The type strain is LAM0312T (=ACCC 06527T =JCM 30849T).

  3. Get the most out of blow hormones: validation of sampling materials, field storage and extraction techniques for whale respiratory vapour samples

    PubMed Central

    Burgess, Elizabeth A.; Hunt, Kathleen E.; Kraus, Scott D.; Rolland, Rosalind M.

    2016-01-01

    Studies are progressively showing that vital physiological data may be contained in the respiratory vapour (blow) of cetaceans. Nonetheless, fundamental methodological issues need to be addressed before hormone analysis of blow can become a reliable technique. In this study, we performed controlled experiments in a laboratory setting, using known doses of pure parent hormones, to validate several technical factors that may play a crucial role in hormone analyses. We evaluated the following factors: (i) practical field storage of samples on small boats during daylong trips; (ii) efficiency of hormone extraction methods; and (iii) assay interference of different sampler types (i.e. veil nylon, nitex nylon mesh and polystyrene dish). Sampling materials were dosed with mock blow samples of known mixed hormone concentrations (progesterone, 17β-estradiol, testosterone, cortisol, aldosterone and triiodothyronine), designed to mimic endocrine profiles characteristic of pregnant females, adult males, an adrenal glucocorticoid response or a zero-hormone control (distilled H2O). Results showed that storage of samples in a cooler on ice preserved hormone integrity for at least 6 h (P = 0.18). All sampling materials and extraction methods yielded the correct relative patterns for all six hormones. However, veil and nitex mesh produced detectable assay interference (mean 0.22 ± 0.04 and 0.18 ± 0.03 ng/ml, respectively), possibly caused by some nylon-based component affecting antibody binding. Polystyrene dishes were the most efficacious sampler for accuracy and precision (P < 0.001), but required an ethanol rinse for improved progesterone recovery (increased 81%; P < 0.001). Awareness of assay interference from exogenous materials is crucial to future studies. This study establishes critical groundwork to help ensure that hormones can be measured accurately in samples obtained from field collections of whale blow. PMID:27928506

  4. Recovering the full velocity and density fields from large-scale redshift-distance samples

    NASA Technical Reports Server (NTRS)

    Bertschinger, Edmund; Dekel, Avishai

    1989-01-01

    A new method for extracting the large-scale three-dimensional velocity and mass density fields from measurements of the radial peculiar velocities is presented. Galaxies are assumed to trace the velocity field rather than the mass. The key assumption made is that the Lagrangian velocity field has negligible vorticity, as might be expected from perturbations that grew by gravitational instability. By applying the method to cosmological N-body simulations, it is demonstrated that it accurately reconstructs the velocity field. This technique promises a direct determination of the mass density field and the initial conditions for the formation of large-scale structure from galaxy peculiar velocity surveys.

  5. A Field Comparison of Sampling Protocols for Measuring Lead in Drinking Water

    EPA Science Inventory

    US EPA Region 5 conducted a sampling study that demonstrates existing sampling protocols used for the Lead and Copper Rule (LCR) underestimate peak and probable mass of lead released in a system with lead service lines (LSLs). This comparative stagnation sampling was conducted i...

  6. Stressing biological samples with pulsed magnetic fields: physical aspects and experimental results

    NASA Astrophysics Data System (ADS)

    Delle Side, D.; Specchia, V.; D'Attis, S.; Giuffreda, E.; Quarta, G.; Calcagnile, L.; Bozzetti, M. P.; Nassisi, V.

    2016-05-01

    Magnetic field effects are diffused among living organisms. They are mainly studied with static or extremely low frequency fields, while scarce information is available for pulsed fields. This work is devoted to the study of the interaction between Drosophila melanogaster, both adults and larvae, and pulsed magnetic fields. We exposed the organisms to a peak field of 0.4 T, lasting for about 2 μ s, within an ad hoc designed copper coil. Adult individuals didn't present any deregulation of repetitive sequences in the germ line of Drosophila. Instead, we noticed a marked magnetic field effect in larvae. Polytene chromosomes coming from treated individuals showed the presence of heat shock puffs; the same organisms revealed also an upregulation of the genes encoding for the Hsp70 protein. These observations suggest that the larvae underwent an oxidative stress caused by the modulation of free radicals' yield induced by the magnetic field through a radical pair mechanism.

  7. Analysis of field-sampled, in-situ network, and PALS airborne soil moisture observations over SMAPVEX12

    NASA Astrophysics Data System (ADS)

    Adams, J. R.; Berg, A. A.; McNairn, H.; Cosh, M. H.

    2014-12-01

    The Soil Moisture Active Passive Validation Experiment in 2012 (SMAPVEX12) was conducted over an agricultural domain in southern Manitoba, Canada. The purpose of the campaign was to develop ground and airborne datasets for pre-launch validation of SMAP satellite soil moisture retrieval algorithms. Three key soil moisture datasets were collected in support of the campaign objectives: 1) intensive field sampling over (up to) 55 agricultural fields on 17 sampling days; 2) a continuously operated temporary in-situ network (> 30 stations) distributed over the domain; and 3) L-band microwave data from NASA's Passive Active L-band Sensor (PALS) onboard a Twin-Otter aircraft. This presentation addresses whether dense temporary in-situ networks can supplant intensive field-sampling during pre-/post-launch validation campaigns. SMAPVEX12 datasets are examined at the field and aircraft pixel (~800 m) scale, and at the domain scale. Preliminary results demonstrate that, at the field-scale, there is generally limited agreement between a single station and sampled data over its field. Over the duration of the campaign, the majority of temporary soil moisture stations have > 0.04 m3m-3 RMSE with sampled field data, suggesting that a single station has limited representativeness of an agricultural field. Furthermore, the in-situ stations and field-sampled data are compared with PALS generated soil moisture to assess differences in daily RMSE. For wet-periods, both ground datasets provide a comparable RMSE for the PALS estimate. Although for dry-periods, the difference in RMSE between the ground datasets becomes more significant (> 0.04 m3m-3). This is because the field-sampled data exhibit a sharper dry-down than the in-situ station measurements. However, at the domain scale there is strong agreement between the soil moisture datasets. Additional results describe the sources of variability affecting these soil moisture datasets and the statistical number of stations needed to

  8. Underground storage tanks 200W-FS-34 and 200W-FS-35 excavated soil field sample plan

    SciTech Connect

    Lucas, J.G.

    1994-09-07

    This plan outlines the process that will be used to collect samples from soil excavated during removal of underground storage tanks 200W-FS-34 and 200W-FS-35. The samples will be analyzed to determine if gasoline and diesel fuel are present in the soil at levels above action levels specified by the Washington State Department of Ecology. On April 15, 1992, the underground storage tanks were removed and soil samples were collected at each former tank location and from around the associated piping. Soil was excavated from the site until field instrumentation indicated that the former tank sites were clean in the judgment of the field team leader. Field monitoring consisted of using an organic vapor monitor to survey soil shaken in a plastic bag. Monitoring indicated that petroleum contamination ranged from 40 to 800 ppm.

  9. Reverse Sample Genome Probing, a New Technique for Identification of Bacteria in Environmental Samples by DNA Hybridization, and Its Application to the Identification of Sulfate-Reducing Bacteria in Oil Field Samples

    PubMed Central

    Voordouw, Gerrit; Voordouw, Johanna K.; Karkhoff-Schweizer, Roxann R.; Fedorak, Phillip M.; Westlake, Donald W. S.

    1991-01-01

    A novel method for the identification of bacteria in environmental samples by DNA hybridization is presented. It is based on the fact that, even within a genus, the genomes of different bacteria may have little overall sequence homology. This allows the use of the labeled genomic DNA of a given bacterium (referred to as a “standard”) to probe for its presence and that of bacteria with highly homologous genomes in total DNA obtained from an environmental sample. Alternatively, total DNA extracted from the sample can be labeled and used to probe filters on which denatured chromosomal DNA from relevant bacterial standards has been spotted. The latter technique is referred to as reverse sample genome probing, since it is the reverse of the usual practice of deriving probes from reference bacteria for analyzing a DNA sample. Reverse sample genome probing allows identification of bacteria in a sample in a single step once a master filter with suitable standards has been developed. Application of reverse sample genome probing to the identification of sulfate-reducing bacteria in 31 samples obtained primarily from oil fields in the province of Alberta has indicated that there are at least 20 genotypically different sulfate-reducing bacteria in these samples. Images PMID:16348574

  10. Adsorptive Films in Support of In-field UF6 Destructive Assay Sample Collection and Analysis

    SciTech Connect

    Barrett, Christopher A.; Martinez, Alonzo; McNamara, Bruce K.; Cannon, Bret D.; Anheier, Norman C.

    2014-07-20

    International Atom Energy Agency (IAEA) safeguard verification measures in gaseous centrifuge enrichment plants (GCEPs) rely on environmental sampling, non-destructive assay (NDA), and destructive assay (DA) sampling and analysis to determine uranium enrichment. UF6 bias defect measurements are made by DA sampling and analysis to assure that enrichment is consistent with declarations. DA samples are collected from a limited number of cylinders for high precision, offsite mass spectrometer analysis. Samples are typically drawn from a sampling tap into a UF6 sample bottle, then packaged, sealed, and shipped under IAEA chain of custody to an offsite analytical laboratory. Future DA safeguard measures may require improvements in efficiency and effectiveness as GCEP capacities increase and UF6 shipping regulations become increasingly more restrictive. The Pacific Northwest National Laboratory (PNNL) DA sampler concept and Laser Ablation Absorption Ratio Spectrometry (LAARS) assay method are under development to potentially provide DA safeguard tools that increase inspection effectiveness and reduce sample shipping constraints. The PNNL DA sampler concept uses a handheld sampler to collect DA samples for either onsite LAARS assay or offsite laboratory analysis. The DA sampler design will use a small sampling planchet that is coated with an adsorptive film to collect controlled quantities of UF6 gas directly from a cylinder or process sampling tap. Development efforts are currently underway at PNNL to enhance LAARS assay performance to allow high-precision onsite bias defect measurements. In this paper, we report on the experimental investigation to develop adsorptive films for the PNNL DA sampler concept. These films are intended to efficiently capture UF6 and then stabilize the collected DA sample prior to onsite LAARS or offsite laboratory analysis. Several porous material composite films were investigated, including a film designed to maximize the chemical adsorption

  11. Whiteheadian Actual Entitities and String Theory

    NASA Astrophysics Data System (ADS)

    Bracken, Joseph A.

    2012-06-01

    In the philosophy of Alfred North Whitehead, the ultimate units of reality are actual entities, momentary self-constituting subjects of experience which are too small to be sensibly perceived. Their combination into "societies" with a "common element of form" produces the organisms and inanimate things of ordinary sense experience. According to the proponents of string theory, tiny vibrating strings are the ultimate constituents of physical reality which in harmonious combination yield perceptible entities at the macroscopic level of physical reality. Given that the number of Whiteheadian actual entities and of individual strings within string theory are beyond reckoning at any given moment, could they be two ways to describe the same non-verifiable foundational reality? For example, if one could establish that the "superject" or objective pattern of self- constitution of an actual entity vibrates at a specific frequency, its affinity with the individual strings of string theory would be striking. Likewise, if one were to claim that the size and complexity of Whiteheadian 'societies" require different space-time parameters for the dynamic interrelationship of constituent actual entities, would that at least partially account for the assumption of 10 or even 26 instead of just 3 dimensions within string theory? The overall conclusion of this article is that, if a suitably revised understanding of Whiteheadian metaphysics were seen as compatible with the philosophical implications of string theory, their combination into a single world view would strengthen the plausibility of both schemes taken separately. Key words: actual entities, subject/superjects, vibrating strings, structured fields of activity, multi-dimensional physical reality.

  12. Linguistic Theory and Actual Language.

    ERIC Educational Resources Information Center

    Segerdahl, Par

    1995-01-01

    Examines Noam Chomsky's (1957) discussion of "grammaticalness" and the role of linguistics in the "correct" way of speaking and writing. It is argued that the concern of linguistics with the tools of grammar has resulted in confusion, with the tools becoming mixed up with the actual language, thereby becoming the central…

  13. Solid-phase extraction and field-amplified sample injection-capillary zone electrophoresis for the analysis of benzophenone UV filters in environmental water samples.

    PubMed

    Purrà, Miquel; Cinca, Roser; Legaz, Jessica; Núñez, Oscar

    2014-10-01

    A field-amplified sample injection-capillary zone electrophoresis (FASI-CZE) method for the analysis of benzophenone (BP) UV filters in environmental water samples was developed, allowing the separation of all compounds in less than 8 min. A 9- to 25-fold sensitivity enhancement was obtained with FASI-CZE, achieving limits of detection down to 21-59 μg/L for most of the analyzed BPs, with acceptable run-to-run and day-to-day precisions (relative standard deviations lower than 17%). In order to remove water sample salinity and to enhance FASI sensitivity, an off-line solid-phase extraction (SPE) procedure using a Strata X polymeric reversed-phase sorbent was used and afforded recoveries up to 72-90% for most BPs. With the combination of off-line SPE and FASI-CZE, limits of detection in the range 0.06-0.6 μg/L in a river water matrix, representing a 2,400- to 6,500-fold enhancement, were obtained. Method performance was evaluated by quantifying a blank river water sample spiked at 1 μg/L. For a 95% confidence level, no statistical differences were observed between found concentrations and spiked concentrations (probability at the confidence level, p value, of 0.60), showing that the proposed off-line SPE-FASI-CZE method is suitable for the analysis of BP UV filters in environmental water samples at low microgram per liter levels. The method was successfully applied to the analysis of BPs in river water samples collected up- and downstream of industrialized and urban areas, and in some drinking water samples.

  14. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  15. Field assessments of control agents for lesser mealworm (Coleoptera: Tenebrionidae) using litter sampling.

    PubMed

    Lambkin, Trevor A; Swain, Anthony J; Rice, Steven J; Bartlett, Justin S; Zalucki, Myron P

    2012-06-01

    Spinosad, diatomaceous earth, and cyfluthrin were assessed on two broiler farms at Gleneagle and Gatton in southeastern Queensland, Australia in 2004-2005 and 2007-2009, respectively to determine their effectiveness in controlling lesser mealworm, Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae). Insecticide treatments were applied mostly to earth or 'hard' cement floors of broiler houses before the placement of new bedding. Efficacy of each agent was assessed by regular sampling of litter and counting of immature stages and adult beetles, and comparing insect counts in treatments to counts in untreated houses. Generally, the lowest numbers of lesser mealworm were recorded in the house with hard floors, these numbers equalling the most effective spinosad applications. The most effective treatment was a strategic application of spinosad under feed supply lines on a hard floor. In compacted earth floor houses, mean numbers of lesser mealworms for two under-feed-line spinosad treatments (i.e., 2-m-wide application at 0.18 g of active insecticide (g [AI]) in 100-ml water/m2, and 1-m-wide application at 0.11 g ([AI] in 33-ml water/m2), and an entire floor spinosad treatment (0.07 g [AI] in 86-ml water/m2) were significantly lower (i.e., better control) than those numbers for cyfluthrin, and no treatment (controls). The 1-m-wide under-feed-line treatment was the most cost-effective dose, providing similar control to the other two most effective spinosad treatments, but using less than half the active component per broiler house. No efficacy was demonstrated when spinosad was applied to the surface of bedding in relatively large volumes of water. All applications of diatomaceous earth, applied with and without spinosad, and cyfluthrin at the label rate of 0.02 g (AI)/100-ml water/m2 showed no effect, with insect counts not significantly different to untreated controls. Overall, the results of this field assessment indicate that cyfluthrin (the Australian

  16. Flavobacterium aquaticum sp. nov., isolated from a water sample of a rice field.

    PubMed

    Subhash, Y; Sasikala, Ch; Ramana, Ch V

    2013-09-01

    Strain JC164(T) was isolated from a water sample from a rice field at Jamdih, Mau, Uttar Pradesh, India. Colonies of strain JC164(T) were brown-yellow and cells were Gram-stain-negative. Catalase, oxidase and amylase were present. iso-C(15:0), iso-C(16:0), iso-C15 1 G, iso-C(15:0) 3-OH and iso-C(14:0) were the predominant fatty acids with minor amounts of iso-C(16:0) 3-OH, anteiso-C(15:0), C(16:0), iso-C(16:1) H, iso-C(14:0) 3-OH and iso-C(13:0). Strain JC164(T) contained phosphatidylethanolamine and a few unidentified lipids (L1, L3 and L6) as major polar lipids. Bacteriohopane derivative 1 (BHD1) and diplopterol (DPL) were the major hopanoids. β-Carotene was one among the several spirilloxanthin series carotenoids present in strain JC164(T). Genomic DNA G+C content was 39.6 mol%. 16S rRNA gene sequence comparisons indicated that strain JC164(T) represents a member of the genus Flavobacterium (family Flavobacteriaceae, class Flavobacteriia). The most closely related taxa to strain JC164(T) were Flavobacterium sasangense YC6274(T) (98.5%), Flavobacterium cucumis R2A45-3(T) (98.1%), Flavobacterium cheniae NJ-26(T) (97.2%) and the novel strain possessed <95.1% sequence similarity with other members of the genus Flavobacterium. However, strain JC164(T) showed 12.5 ± 2, 13.6 ± 1 and 17.4 ± 2% genomic DNA association (based on DNA-DNA hybridization) with Flavobacterium sasangense KCTC 22246(T), Flavobacterium cucumis DSM 18830(T) and Flavobacterium cheniae CGMCC 1.6844(T), respectively. The distinct genomic difference and morphological, physiological and chemotaxonomic differences from the previously described taxa support the classification of strain JC164(T) as a representative of a novel species of the genus Flavobacterium, for which the name Flavobacterium aquaticum sp. nov. is proposed. The type strain is JC164(T) ( = KCTC 32196(T) = CGMCC 1.12398=LMG 27251(T)).

  17. Estimating Population Size for Capercaillie (Tetrao urogallus L.) with Spatial Capture-Recapture Models Based on Genotypes from One Field Sample

    PubMed Central

    Mollet, Pierre; Kéry, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, J. Andrew

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species. PMID:26087321

  18. Estimating population size for Capercaillie (Tetrao urogallus L.) with spatial capture-recapture models based on genotypes from one field sample

    USGS Publications Warehouse

    Mollet, Pierre; Kery, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, Andy

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species.

  19. Detection of African Swine Fever Antibodies in Experimental and Field Samples from the Russian Federation: Implications for Control.

    PubMed

    Mur, L; Igolkin, A; Varentsova, A; Pershin, A; Remyga, S; Shevchenko, I; Zhukov, I; Sánchez-Vizcaíno, J M

    2016-10-01

    African swine fever (ASF) re-entered in Europe in 2007 by Georgia rapidly affecting neighbouring countries. Since then, ASF has caused severe problems to the Russian Federation (RF) and spread to Northern and Western regions, including Ukraine (2012 and 2014) and Belarus (2013). At the beginning of 2014, dead wild boars were found in Lithuania and Poland. Several outbreaks have been later notified in the European Union(EU), affecting domestic pigs and wild boar of Latvia, Lithuania and Poland, and also wild boar in Estonia, causing major problems for the EU pig sector. Some studies have been performed with this ASFV isolate, revealing that it belongs to genotype II and causes an acute form of the disease. However, few data are available about the presence of antibodies in field and experimental samples from the affected area. This study analysed samples from experimental infections with ASFV isolated from the RF in 2013 (74 sera and 3 tissue exudates), and field samples from the RF from 2013 to 2014 (266 samples, including 32 and 7 tissue exudates from domestic pigs and wild boar, respectively). All samples were tested by a commercial ELISA and, some of them (79), also by immunochromatographic tests. Positive and doubtful samples were confirmed by immunoblotting test. Positive results were found in experimental and field samples, which confirm the presence of antibodies against ASFV in the RF. Antibodies were detected in animals inoculated with three different ASFV isolates, with some differences found among them. Only a small percentage of field samples was positive for ASF antibodies (3.7%), in agreement with other observations that reported a high virulence for the ASFV isolates in the area. These results confirm the potential presence of survivor animals that should be considered in affected areas to help design effective control and eradication plans against ASF.

  20. High-frequency isotopic analysis of liquid water samples in the field - initial results from continuous water sampling and cavity ring-down spectroscopy

    NASA Astrophysics Data System (ADS)

    von Freyberg, Jana; Studer, Bjørn; Kirchner, James

    2016-04-01

    Studying rapidly changing hydrochemical signals in catchments can help to improve our mechanistic understanding of their water flow pathways and travel times. For these purposes, stable water isotopes (18O and 2H) are commonly used as natural tracers. However, high-frequency isotopic analyses of liquid water samples are challenging. One must capture highly dynamic behavior with high precision and accuracy, but the lab workload (and sample storage artifacts) involved in collecting and analyzing thousands of bottled samples should also be avoided. Therefore, we have tested Picarro, Inc.'s newly developed Continuous Water Sampler Module (CoWS), which is coupled to their L2130-i Cavity Ring-Down Spectrometer to enable real-time on-line measurements of 18O and 2H in liquid water samples. We coupled this isotope analysis system to a dual-channel ion chomatograph (Metrohm AG, Herisau, Switzerland) for analysis of major cations and anions, as well as a UV-Vis spectroscopy system (s::can Messtechnik GmbH, Vienna, Austria) and electrochemical probes for characterization of basic water quality parameters. The system was run unattended for up to a week at a time in the laboratory and at a small catchment. At the field site, stream-water and precipitation samples were analyzed, alternating at sub-hourly intervals. We observed that measured isotope ratios were highly sensitive to the liquid water flow rate in the CoWS, and thus to the hydraulic head difference between the CoWS and the samples from which water was drawn. We used a programmable high-precision dosing pump to control the injection flow rate and eliminate this flow-rate artifact. Our experiments showed that the precision of the CoWS-L2130-i-system for 2-minute average values was typically better than 0.06‰ for δ18O and 0.16‰ for δ2H. Carryover effects were 1% or less between isotopically contrasting water samples for 30-minute sampling intervals. Instrument drift could be minimized through periodic analysis of

  1. The intensity of the ancient lunar field from magnetic studies on lunar samples

    NASA Technical Reports Server (NTRS)

    Stephenson, A.; Collinson, D. W.; Runcorn, S. K.

    1974-01-01

    Palaeointensity determinations on Apollo 11, 16 and 17 rocks have indicated that 3.9 - 4.0 AE ago the strength of the surface lunar magnetic field was about 1.3 Oe while there is evidence from younger rocks that a field of about one quarter of this value was present at a later time (3.6 AE).

  2. The intensity of the ancient lunar field from magnetic studies on lunar samples

    NASA Technical Reports Server (NTRS)

    Stephenson, A.; Collinson, D. W.; Runchorn, S. K.

    1977-01-01

    Palaeointensity determination on Apollo 11, 16, and 17 rocks have indicated that from 3.9 to 4.0 AE ago the strength of the surface lunar magnetic field was about 1.3 Oe, while there is evidence from younger rocks that a field of about one quarter of this value was present at a later time (3.6 AE).

  3. Integrating Field-Based Research into the Classroom: An Environmental Sampling Exercise

    ERIC Educational Resources Information Center

    DeSutter, T.; Viall, E.; Rijal, I.; Murdoff, M.; Guy, A.; Pang, X.; Koltes, S.; Luciano, R.; Bai, X.; Zitnick, K.; Wang, S.; Podrebarac, F.; Casey, F.; Hopkins, D.

    2010-01-01

    A field-based, soil methods, and instrumentation course was developed to expose graduate students to numerous strategies for measuring soil parameters. Given the northern latitude of North Dakota State University and the rapid onset of winter, this course met once per week for the first 8 weeks of the fall semester and centered on the field as a…

  4. Design and development of low cost, simple, rapid and safe, modified field kits for the visual detection and determination of arsenic in drinking water samples.

    PubMed

    Cherukurii, Jyotsna; Anjaneyulu, Y

    2005-08-01

    Arsenic is naturally found in surface and ground waters and the inorganic forms of arsenic are the most toxic forms. The adverse health effects of arsenic may involve the respiratory, gastrointestinal, cardiovascular, nervous, and haematopoietic systems. Arsenic contamination in drinking water is a global problem widely seen in Bangladesh and West Bengal of the Indian sub continent. As there is a great demand for field test kits due to the anticipated reduction of the US EPA arsenic standard from 50ppb to 10ppb a field kit which offers rapid, simple and safe method for precise estimation of arsenic at 10ppb in drinking water samples is developed. Field methods, based on the mercuric-bromide-stain, consist of three different major parts, which are carried out stepwise. The first part of the procedure is to remove serious interference caused by hydrogen sulphide. In commercially available kits either the sulphide is oxidized to sulphate and the excess oxidizing reagent removed prior to the hydride generation step or, the hydrogen sulphide is filtered out by passing the gas stream through a filter impregnated with lead acetate during the hydride generation step. The present method employs cupric chloride in combination with ferric chloride or Fentonis reagent for the removal of hydrogen sulphide, which is rapid, simple and more efficient. Other interferences at this step of the analyses are normally not expected for drinking water analysis. In the second step, the generation of the arsine gas involves the classical way of using zinc metal and hydrochloric acid, which produce the enascenti hydrogen, which is the actual reducing agent. Hydrochloric acid can be replaced by sulfamic acid, which is solid and avoids a major disadvantage of having to handle a corrosive liquid in the field. The arsine gas produces a yellowish spot on the reagent paper. Depending on the arsenic content, either, Yellow n H (HgBr)2 As (10-50ppb), Brown n (HgBr)3 As (50-100ppb) or Black n Hg3 As2

  5. Design, construction and use of a large-sample field-cycled PEDRI imager

    NASA Astrophysics Data System (ADS)

    Lurie, David J.; Foster, Margaret A.; Yeung, David; Hutchison, James M. S.

    1998-07-01

    The design, construction and use of a large-scale field-cycled proton-electron double-resonance imaging (FC-PEDRI) imager is described. The imager is based on a whole-body sized, vertical field, 59 mT permanent magnet. Field cycling is accomplished by the field compensation method, and uses a secondary, resistive magnet with an internal diameter of 52 cm. The magnetic field can be switched from zero to 59 mT or vice versa in 40 ms. It is used with a double-resonance coil assembly (NMR/EPR) comprising a solenoidal NMR transmit/receive coil and a coaxial, external birdcage resonator for EPR irradiation. Experiments to image the distribution of an exogenous nitroxide free radical in anaesthetized rabbits are described.

  6. Design, construction and use of a large-sample field-cycled PEDRI imager.

    PubMed

    Lurie, D J; Foster, M A; Yeung, D; Hutchison, J M

    1998-07-01

    The design, construction and use of a large-scale field-cycled proton-electron double-resonance imaging (FC-PEDRI) imager is described. The imager is based on a whole-body sized, vertical field, 59 mT permanent magnet. Field cycling is accomplished by the field compensation method, and uses a secondary, resistive magnet with an internal diameter of 52 cm. The magnetic field can be switched from zero to 59 mT or vice versa in 40 ms. It is used with a double-resonance coil assembly (NMR/EPR) comprising a solenoidal NMR transmit/receive coil and a coaxial, external birdcage resonator for EPR irradiation. Experiments to image the distribution of an exogenous nitroxide free radical in anaesthetized rabbits are described.

  7. CTEPP-OH DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table for CTEPP-OH. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Oth...

  8. Field Evaluation of a Passive Sampling Device for Hydrazines in Ambient Air

    DTIC Science & Technology

    1990-04-06

    1I1 Liquid Impinger Analysis.............................................. 12 Vanillin Color Dosimeter Analysis...colorimetric or coulometric spike); C - vanillin , D - impinger; and E - firebrick. The analytical laboratory only received the coded samples. The data...of absorbed light is proportional to the concentration of the hydrazone in the sample [12]. Vanillin Color Dosimeter Analysis. The same basic chemistry

  9. Cloud point sample clean-up and capillary zone electrophoresis with field enhanced sample injection and micelle to solvent stacking for the analysis of herbicides in milk.

    PubMed

    Kukusamude, Chunyapuk; Srijaranai, Supalax; Kato, Masaru; Quirino, Joselito P

    2014-07-18

    Sample clean-up by cloud point phase separation and analysis by capillary electrophoresis with stacking was developed for quaternary ammonium herbicides (i.e., paraquat and diquat) in milk. For sample clean-up, a mixture of 845μL of milk sample, 5μL of 100mM phosphoric acid, and 150μL of Triton X-114 was heated (60°C for 2min) and centrifugated (3000rpm for 2min) in 2-mL Eppendorf tube. The upper phase was directly analysed by capillary electrophoresis via electrokinetic injection at 10kV for 150s. The separation electrolyte was 100mM phosphate buffer with 20% acetonitrile at pH 2.5. Before sample injection, a micellar solution (10mM SDS in 80mM phosphate buffer at pH 2.5) and an organic solvent rich solution (30% ACN) was hydrodynamically introduced into the capillary. These solutions provided the necessary conditions for stacking the cationic herbicides via the combination of field enhanced sample injection and micelle to solvent stacking. The LODs (S/N=3) obtained from the entire strategy for paraquat and diquat in milk was 0.004 and 0.018μg/mL, respectively. This is 1.5 to >2 orders of magnitude better than the corresponding LODs obtained from the electrophoretic analysis of herbicide standards prepared in the separation electrolyte. The strategy was also successfully applied to 5 milk samples available in the market.

  10. Traditional sampling with laboratory analysis and solid phase microextraction sampling with field gas chromatography/mass spectrometry by military industrial hygienists.

    PubMed

    Smith, Philip A; Kluchinsky, Timothy A; Savage, Paul B; Erickson, Richard P; Lee, Arthur P; Williams, Kenneth; Stevens, Michael; Thomas, Richard J

    2002-01-01

    The opinions or assertions contained herein are the private ones of the authors and are not to be construed as official or reflecting the views of the United States Department of Defense or the Uniformed Services University of the Health Sciences. Rapid on-site detection and identification of environmental contaminants to which personnel may be exposed is often needed during military deployment situations. The availability of military industrial hygienists with capabilities for "complete" on-site exposure assessment of chemical species should allow detection and identification of a number of important stressors almost immediately following sample collection. Portable gas chromatography/mass spectrometry (GC/MS) provides a rapid and efficient separation of volatile and semivolatile organic analytes, accompanied by sensitive electron impact ionization-mass spectrometry (EI-MS) detection. The use of GC/MS in the field is limited, however, by equipment cost, complexity of the equipment, and the analytical process. Additionally, a skilled operator is needed to obtain useful separations and to interpret mass spectral data. To demonstrate benefits and limitations of "complete" exposure assessment capabilities, a previously unidentified complex mixture, produced by thermal dispersion of riot control agents, was examined. Established active sampling methods were used with laboratory analyses. Solid phase microextraction, a passive sampling method that simplifies preparation for GC/MS analysis, also was used with a field-portable GC/MS system. Both sampling/analysis methods were used to detect CS riot control agent-derived air contaminants dispersed from riot control type canisters through oxidizer-supported combustion of a chemical fuel.

  11. Pre-Mission Input Requirements to Enable Successful Sample Collection by a Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Young, K. E.; Lim, D. S.

    2015-01-01

    This paper is intended to evaluate the sample collection process with respect to sample characterization and decision making. In some cases, it may be sufficient to know whether a given outcrop or hand sample is the same as or different from previous sampling localities or samples. In other cases, it may be important to have more in-depth characterization of the sample, such as basic composition, mineralogy, and petrology, in order to effectively identify the best sample. Contextual field observations, in situ/handheld analysis, and backroom evaluation may all play a role in understanding field lithologies and their importance for return. For example, whether a rock is a breccia or a clast-laden impact melt may be difficult based on a single sample, but becomes clear as exploration of a field site puts it into context. The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team is a new activity focused on a science and exploration field based research program aimed at generating strategic knowledge in preparation for the human and robotic exploration of the Moon, near-Earth asteroids (NEAs) and Phobos and Deimos. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused, and moreover, is sampling-focused, with the explicit intent to return the best samples for geochronology studies in the laboratory. This specific objective effectively reduces the number of variables in the goals of the field test and enables a more controlled investigation of the role of the crewmember in selecting samples. We formulated one hypothesis to test: that providing details regarding the analytical fate of the samples (e.g. geochronology, XRF/XRD, etc.) to the crew prior to their traverse will result in samples that are more likely to meet specific analytical

  12. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies.

    PubMed

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A

    2014-12-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg(-1) pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern.

  13. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies

    PubMed Central

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A.

    2014-01-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg-1 pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern. PMID:25580031

  14. Genetic variability of spined soldier bugs (Hemiptera: Pentatomidae) sampled from distinct field sites and laboratory colonies in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The spined soldier bug, Podisus maculiventris (Say), is an important biological control agent for agricultural and forest pests that preys on eggs and larvae of lepidopteran and coleopteran species. Genetic variability among field collected samples from Michigan, Mississippi, Missouri, and Florida, ...

  15. Guidelines for collection and field analysis of water-quality samples from streams in Texas

    USGS Publications Warehouse

    Wells, F.C.; Gibbons, W.J.; Dorsey, M.E.

    1990-01-01

    Analyses for unstable constituents or properties are by necessity performed in the field. This manual addresses analytical techniques and quality assurance for: (1) Water temperature; (2) specific conductance; (3) pH; (4) alkalinity; (5) dissolved oxygen; and (6) bacteria.

  16. Simultaneous sample preconcentration and matrix removal using field-flow fractionation coupled to inductively coupled plasma mass spectrometry

    NASA Astrophysics Data System (ADS)

    Al-Ammar, Assad; Siripinyanond, Atitaya; Barnes, Ramon M.

    2001-10-01

    An on-channel sample preconcentration-matrix removal arrangement, based on coupling field-flow fractionation (FFF) to inductively coupled plasma mass spectrometry (ICP-MS), has been constructed for on-line sample pretreatment ICP-MS trace element determination. A commercial FFF system is modified to incorporate an on-channel preconcentration procedure allowing injection of up to 50 ml of sample, which could be preconcentrated by 50-1400 fold. A high molecular weight complexing agent added to the sample forms strong complexes with the measured trace analytes but not with the sample matrix. When the sample-complexing agent mixture is introduced to the FFF unit, the uncomplexed matrix element is removed by permeation through a membrane that separates the FFF sample compartment. The trace analytes remain in the FFF channel, because their high molecular weight complexes do not permeate through the membrane. Preconcentration and matrix elimination occur simultaneously. The matrix-free, preconcentrated sample is introduced directly to the ICP-MS nebulizer. The method was tested using 10-ml sample aliquots that contain As, Cd, Cu, Mo, Pb, Re, Sn, Te, Tl, Y, Zn and Zr analytes and 5000 mg l -1 Ca or Na matrices and ethylene imine polymer complexing agent. Copper and Re isotopic ratio values in reference standards also were determined after preconcentration and matrix element removal.

  17. MICROBIOLOGICAL FIELD SAMPLING AND INSTRUMENTATION IN THE ASSESSMENT OF SOIL AND GROUND-WATER POLLUTION

    EPA Science Inventory

    This chapter emphasizes the importance of microbiological sampling of soil and ground water with respect to human heath risks, laws and regulations dealing with safe drinking water, and more prevalent subsurface monitoring activities associated with chlorinated organic compounds,...

  18. FIELD AND LABORATORY PERFORMANCE CHARACTERISTICS OF A NEW SAMPLING PROTOCOL FOR RIVERINE MACROINVERTEBRATE ASSEMBLAGES

    EPA Science Inventory

    Measurement and estimation of performance characteristics (i.e., precision, bias, performance range, interferences and sensitivity) are often neglected in the development and use of new biological sampling methods. However, knowledge of this information is critical in enabling p...

  19. Preliminary field evaluation of EPA Method CTM-039 (PM2.5 Stack Sampling Method)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Agricultural operations are encountering difficulties complying with current air pollution regulations for particulate matter (PM). These regulations are based on the National Ambient Air Quality Standards which set maximum concentration limits for ambient air PM. Source sampling for compliance purp...

  20. Update on field evaluation of EPA Method CTM-039 (PM2.5 Stack Sampling Method)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Agricultural operations are encountering difficulties complying with current air pollution regulations for particulate matter (PM). These regulations are based on the National Ambient Air Quality Standards, which set maximum concentration limits for ambient air PM. Source sampling for compliance pur...

  1. FIELD EVALUATION OF A SAMPLING APPROACH FOR PM-COARSE AEROSOLS

    EPA Science Inventory

    Subsequent to a 1997 revision of the national ambient air quality standards (NAAQS) for particulate matter (PM), the US Environmental Protection Agency is investigating the development of sampling methodology for a possible new coarse particle standard. When developed, this me...

  2. Student Participation in Mars Sample Return Rover Field Tests, Silver Lake, California

    NASA Technical Reports Server (NTRS)

    Anderson, R. C.; Arvidson, R. E.; Bowman, J. D.; Dunham, C. D.; Backes, P.; Baumgartner, E. T.; Bell, J.; Dworetzky, S. C.; Klug, S.; Peck, N.

    2000-01-01

    An integrated team of students and teachers from four high schools across the country developed and implemented their own mission of exploration and discovery using the Mars Sample Return prototype rover, FIDO, at Silver Lake in the Mojave Desert.

  3. Field Sampling Plan/Quality Assurance Project Plan Volume I of III

    EPA Pesticide Factsheets

    This document contains procedures related to the collection and analysis of soil, sediment, groundwater, surface water, air and biota samples at GE’s Pittsfield, Massachusetts facility and at other areas.

  4. Field and sample history dependence of the compensation temperature in Sm 0.97Gd 0.03Al 2

    NASA Astrophysics Data System (ADS)

    Vaidya, U. V.; Rakhecha, V. C.; Sumithra, S.; Ramakrishnan, S.; Grover, A. K.

    2007-03-01

    We present magnetization data on three polycrystalline specimens of Sm 0.97Gd 0.03Al 2: (1) as-cast (grainy texture), (2) powder, and (3) re-melted fast-quenched (plate). The data are presented for nominally zero- (ZFC) and high-field-cooling (HFC) histories. A zero cross-over in magnetization curve at some temperature T= T0 was seen in ZFC data on grainy and powder samples, but not in the plate sample. At fields surpassing magnetocrystalline anisotropy, a 4f magnetic moment flip was still evidenced by HFC data in all samples at a compensation temperature Tcomp, which must necessarily be treated as distinct from T0 ( T0 may not even exist). Proper understanding of Tcomp should take account of thermomagnetic history effects.

  5. Study of Low Temperature Baking Effect on Field Emission on Nb Samples Treated by BEP, EP, and BCP

    SciTech Connect

    Andy Wu, Song Jin, Robert Rimmer, Xiang Yang Lu, K. Zhao, Laura MacIntyre, Robert Ike

    2010-05-01

    Field emission is still one of the major obstacles facing Nb superconducting radio frequency (SRF) community for allowing Nb SRF cavities to reach routinely accelerating gradient of 35 MV/m that is required for the international linear collider. Nowadays, the well know low temperature backing at 120 oC for 48 hours is a common procedure used in the SRF community to improve the high field Q slope. However, some cavity production data have showed that the low temperature baking may induce field emission for cavities treated by EP. On the other hand, an earlier study of field emission on Nb flat samples treated by BCP showed an opposite conclusion. In this presentation, the preliminary measurements of Nb flat samples treated by BEP, EP, and BCP via our unique home-made scanning field emission microscope before and after the low temperature baking are reported. Some correlations between surface smoothness and the number of the observed field emitters were found. The observed experimental results can be understood, at least partially, by a simple model that involves the change of the thickness of the pent-oxide layer on Nb surfaces.

  6. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data.

    PubMed

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Kohn, Jordan; Yuan, Michael L; Gesquiere, Laurence; Grieneisen, Laura E; Tung, Jenny

    2016-08-16

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples-unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts.

  7. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-12-01

    This study is a contribution to development of a heterogeneity characterization facility for "next-generation" soil sampling aimed, for example, at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity in quantification of a set of exemplar parameters is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The theory of sampling (TOS) and variographic analysis has been applied to develop a more general fit-for-purpose soil heterogeneity characterization approach. All parameters were assessed in large-scale transect (1-100 m) vs. small-scale (0.1-0.5 m) replication sampling point variability. Variographic profiles of experimental analytical results from a specific well-mixed soil type show that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among other soils types. This study has a significant carrying-over potential for related research areas, e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  8. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-06-01

    This study is a contribution to development of a heterogeneity characterisation facility for "next generation" sampling aimed at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity on quantification of a set of exemplar parameters, organic matter, loss on ignition (LOI), biomass, soil microbiology, MCPA sorption and mineralization is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The Theory of Sampling (TOS) and variographic analysis has been applied to develop a fit-for-purpose heterogeneity characterization approach. All parameters were assessed in large-scale profile (1-100 m) vs. small-scale (0.1-1 m) replication sampling pattern. Variographic profiles of experimental analytical results concludes that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among soils types. This study has a significant carrying-over potential for related research areas e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  9. Comparison and Field Validation of Binomial Sampling Plans for Oligonychus perseae (Acari: Tetranychidae) on Hass Avocado in Southern California.

    PubMed

    Lara, Jesus R; Hoddle, Mark S

    2015-08-01

    Oligonychus perseae Tuttle, Baker, & Abatiello is a foliar pest of 'Hass' avocados [Persea americana Miller (Lauraceae)]. The recommended action threshold is 50-100 motile mites per leaf, but this count range and other ecological factors associated with O. perseae infestations limit the application of enumerative sampling plans in the field. Consequently, a comprehensive modeling approach was implemented to compare the practical application of various binomial sampling models for decision-making of O. perseae in California. An initial set of sequential binomial sampling models were developed using three mean-proportion modeling techniques (i.e., Taylor's power law, maximum likelihood, and an empirical model) in combination with two-leaf infestation tally thresholds of either one or two mites. Model performance was evaluated using a robust mite count database consisting of >20,000 Hass avocado leaves infested with varying densities of O. perseae and collected from multiple locations. Operating characteristic and average sample number results for sequential binomial models were used as the basis to develop and validate a standardized fixed-size binomial sampling model with guidelines on sample tree and leaf selection within blocks of avocado trees. This final validated model requires a leaf sampling cost of 30 leaves and takes into account the spatial dynamics of O. perseae to make reliable mite density classifications for a 50-mite action threshold. Recommendations for implementing this fixed-size binomial sampling plan to assess densities of O. perseae in commercial California avocado orchards are discussed.

  10. Field Chemical Emissions Monitoring (FCEM) generic sampling and analytical plan. Final report

    SciTech Connect

    Behrens, G.P.; Huyck, K.A.; Youngerman, E.G.

    1995-03-01

    This report outlines a comprehensive approach to FCEM test planning, including the overall format for presentation of a typical test plan and examples of the type of information that is important to include. It discusses the following key topics: sampling locations and process monitoring for air toxics; specific sampling procedures for detecting and measuring toxic substances such as trace metals, semivolatile and volatile compounds, aldehydes, and mercury; currently preferred sample preparation and analytical methods; quality assurance considerations for precision, accuracy, and completeness; and data reduction and reporting methods and format. The report contains numerous helpful tables and illustrations, references to other available material, a glossary, and an appendix on defining and reporting detection limits.

  11. Optimizing electrostatic field calculations with the adaptive Poisson-Boltzmann Solver to predict electric fields at protein-protein interfaces. I. Sampling and focusing.

    PubMed

    Ritchie, Andrew W; Webb, Lauren J

    2013-10-03

    Continuum electrostatics methods are commonly used to calculate electrostatic potentials in proteins and at protein-protein interfaces to aid many types of biophysical studies. Despite their ubiquity throughout the biophysical literature, these calculations are difficult to test against experimental data to determine their accuracy and validity. To address this, we have calculated the Boltzmann-weighted electrostatic field at the midpoint of a nitrile bond placed at a variety of locations on the surface of the protein RalGDS, both in its monomeric form as well as when docked to four different constructs of the protein Rap, and compared the computation results to vibrational absorption energy measurements of the nitrile oscillator. This was done by generating a statistical ensemble of protein structures using enhanced molecular dynamics sampling with the Amber03 force field, followed by solving the linear Poisson-Boltzmann equation for each structure using the Applied Poisson-Boltzmann Solver (APBS) software package. Using a two-stage focusing strategy, we examined numerous second stage box dimensions, grid point densities, box locations, and compared the numerical result to the result obtained from the sum of the numeric reaction field and the analytic Coulomb field. It was found that the reaction field method yielded higher correlation with experiment for the absolute calculation of fields, while the numeric solutions yielded higher correlation with experiment for the relative field calculations. Finer grid spacing typically improved the calculation, although this effect was less pronounced in the reaction field method. These sorts of calculations were also very sensitive to the box location, particularly for the numeric calculations of absolute fields using a 10(3) Å(3) box.

  12. Groundwater Monitoring and Field Sampling Plan for Operable Unit 10-08

    SciTech Connect

    M. S. Roddy

    2007-05-01

    This plan describes the groundwater sampling and water level monitoring that will be conducted to evaluate contaminations in the Snake River Plain Aquifer entering and leaving the Idaho National Laboratory. The sampling and monitoring locations were selected to meet the data quality objectives detailed in this plan. Data for the Snake River Plain Aquifer obtained under this plan will be evaluated in the Operable Unit 10-08 Remedial Investigation/Feasibility Study report and will be used to support the Operable Unit 10-08 Sitewide groundwater model.

  13. Validation of in situ networks via field sampling: case study in the South Fork Experimental Watershed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The calibration and validation of soil moisture remote sensing products is complicated by the logistics of installing a soil moisture network for a long term period in an active landscape. Therefore, these stations are located along field boundaries or in non-representative sites with regards to so...

  14. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    PubMed Central

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-01-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases. PMID:27357449

  15. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample.

    PubMed

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-06-30

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases.

  16. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    NASA Astrophysics Data System (ADS)

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-06-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases.

  17. Geologic Field Notes, Geochemical Analyses, and Field Photographs of Outcrops and Rock Samples from the Big Delta B-1 Quadrangle, East-Central Alaska

    USGS Publications Warehouse

    Day, Warren C.; O'Neill, J. Michael

    2008-01-01

    The U.S. Geological Survey, in cooperation with the Alaska Department of Natural Resources Division of Mining, Land, and Water, has released a geologic map of the Big Delta B-1 quadrangle of east-central Alaska (Day and others, 2007). This companion report presents the major element oxide and trace element geochemical analyses, including those for gold, silver, and base metals, for representative rock units and for grab samples from quartz veins and mineralized zones within the quadrangle. Also included are field station locations, field notes, structural data, and field photographs based primarily on observations by W.C. Day with additions by J.M. O'Neill and B.M. Gamble, all of the U.S. Geological Survey. The data are provided in both Microsoft Excel spread sheet format and as a Microsoft Access database.

  18. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data

    PubMed Central

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A.; Barreiro, Luis B.; Johnson, Zachary P.; Wilson, Mark E.; Kohn, Jordan; Yuan, Michael L.; Gesquiere, Laurence; Grieneisen, Laura E.; Tung, Jenny

    2016-01-01

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples—unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  19. Sediment and radionuclide transport in rivers. Phase 3. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Ecker, R.M.; Walters, W.H.; Onishi, Y.

    1982-08-01

    A field sampling program was conducted on Cattaraugus and Buttermilk Creeks, New York during April 1979 to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Bed sediment, suspended sediment and water samples were collected during unsteady flow conditions over a 45 mile reach of stream channel. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239, 240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, Cs-134, Co-60, Pu-238, Pu-239, 240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks. This field sampling effort was the last of a three phase program to collect hydrologic and radiologic data at different flow conditions.

  20. Maximizing the chances of detecting pathogenic leptospires in mammals: the evaluation of field samples and a multi-sample-per-mammal, multi-test approach.

    PubMed

    Tulsiani, S M; Graham, G C; Dohnt, M F; Burns, M-A; Craig, S B

    2011-03-01

    Identification of wild animals that harbour the causative leptospires, and the identification of the most important of these 'wild reservoirs' (in terms of threat to human health), are key factors in the epidemiology of human leptospirosis. In an epidemiological investigation in the Australian state of Queensland, in 2007-2008, samples were collected from fruit bats (Pteropus conspicillatus) and rodents (to investigate the potential role of fruit bats in the maintenance and transmission of leptospires to ground-dwelling rodents) and checked for pathogenic leptospires. The results of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire-positive, culture only yielded four isolates, probably because many cultures were contaminated. The main aims of the present study were to quantify the performance of the individual diagnostic tests and examine the reasons behind the high incidence of culture contamination. The results of sensitivity and specificity analyses for the different diagnostic tests indicated that isolation by culture (the definitive diagnostic test for leptospiral shedding) had perfect (100%) sensitivity when compared with the results of the PCR but a low specificity (40%). The MAT performed poorly, with a sensitivity of 50% when compared against the results of culture. The prevalence of leptospiral carriage revealed by the PCR-based investigation of kidney and urine samples (59.2%) was higher than

  1. Maximizing the chances of detecting pathogenic leptospires in mammals: the evaluation of field samples and a multi-sample-per-mammal, multi-test approach

    PubMed Central

    Tulsiani, S M; Graham, G C; Dohnt, M F; Burns, M-A; Craig, S B

    2011-01-01

    Identification of wild animals that harbour the causative leptospires, and the identification of the most important of these ‘wild reservoirs’ (in terms of threat to human health), are key factors in the epidemiology of human leptospirosis. In an epidemiological investigation in the Australian state of Queensland, in 2007–2008, samples were collected from fruit bats (Pteropus conspicillatus) and rodents (to investigate the potential role of fruit bats in the maintenance and transmission of leptospires to ground-dwelling rodents) and checked for pathogenic leptospires. The results of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27·6% of the rodents investigated were found leptospire-positive, culture only yielded four isolates, probably because many cultures were contaminated. The main aims of the present study were to quantify the performance of the individual diagnostic tests and examine the reasons behind the high incidence of culture contamination. The results of sensitivity and specificity analyses for the different diagnostic tests indicated that isolation by culture (the definitive diagnostic test for leptospiral shedding) had perfect (100%) sensitivity when compared with the results of the PCR but a low specificity (40%). The MAT performed poorly, with a sensitivity of 50% when compared against the results of culture. The prevalence of leptospiral carriage revealed by the PCR-based investigation of kidney and urine samples (59·2%) was

  2. How People Actually Use Thermostats

    SciTech Connect

    Meier, Alan; Aragon, Cecilia; Hurwitz, Becky; Mujumdar, Dhawal; Peffer, Therese; Perry, Daniel; Pritoni, Marco

    2010-08-15

    Residential thermostats have been a key element in controlling heating and cooling systems for over sixty years. However, today's modern programmable thermostats (PTs) are complicated and difficult for users to understand, leading to errors in operation and wasted energy. Four separate tests of usability were conducted in preparation for a larger study. These tests included personal interviews, an on-line survey, photographing actual thermostat settings, and measurements of ability to accomplish four tasks related to effective use of a PT. The interviews revealed that many occupants used the PT as an on-off switch and most demonstrated little knowledge of how to operate it. The on-line survey found that 89% of the respondents rarely or never used the PT to set a weekday or weekend program. The photographic survey (in low income homes) found that only 30% of the PTs were actually programmed. In the usability test, we found that we could quantify the difference in usability of two PTs as measured in time to accomplish tasks. Users accomplished the tasks in consistently shorter times with the touchscreen unit than with buttons. None of these studies are representative of the entire population of users but, together, they illustrate the importance of improving user interfaces in PTs.

  3. Field evaluation of sampling and analysis for organic pollutants in indoor air

    SciTech Connect

    Chuang, J.C.; Mack, G.A.; Stockrahm, J.W.; Hannan, S.W.; Bridges, C.

    1988-08-01

    The objectives of the study were to determine the feasibility of the use of newly developed indoor air samplers in residential indoor air sampling and to evaluate methodology for characterization of the concentrations of polynuclear aromatic hydrocarbons (PAH), PAH derivatives, and nicotine in residential air. Residential air sampling was conducted in Columbus, Ohio during the winter of 1986/87. The PAH derivatives were found at much lower levels than their parent PAH. Higher average indoor levels of all but three target compounds were found compared to outdoor levels. The higher outdoor levels of these three compounds (naphthalene dicarboxylic acid anhydride, pyrene dicarboxylic acid anhydride, and 2-nitrofluoranthene) are probably due to atmospheric transformation. Cigarette smoking was identified as the most-significant contributor to indoor levels of PAH and PAH derivatives. Homes with gas-heating systems appeared to have higher pollutant levels compared to homes with electric-heating systems.

  4. Origin and correction of magnetic field inhomogeneity at the interface in biphasic NMR samples.

    PubMed

    Martin, Bryan T; Chingas, G C; McDougal, Owen M

    2012-05-01

    The use of susceptibility matching to minimize spectral distortion of biphasic samples layered in a standard 5 mm NMR tube is described. The approach uses magic angle spinning (MAS) to first extract chemical shift differences by suppressing bulk magnetization. Then, using biphasic coaxial samples, magnetic susceptibilities are matched by titration with a paramagnetic salt. The matched phases are then layered in a standard NMR tube where they can be shimmed and examined. Linewidths of two distinct spectral lines, selected to characterize homogeneity in each phase, are simultaneously optimized. Two-dimensional distortion-free, slice-resolved spectra of an octanol/water system illustrate the method. These data are obtained using a 2D stepped-gradient pulse sequence devised for this application. Advantages of this sequence over slice-selective methods are that acquisition efficiency is increased and processing requires only conventional software.

  5. Work Plan and Field Sampling Plan Site Investigations Fort Devens, Massachusetts

    DTIC Science & Technology

    1992-02-01

    Sampling Plan Comments received from: U.S. Environmental Protection Agency Note: All comments have been retyped exactly as submitted. RC422 1 February...B-7) re’~cyc’ dpý p f T 1 Site Investigations Work Plan Comments received from: U.S. Environmental Protection Agency U.S. Department of the Interior...Fish and Wildlife Service Massachusetts Department of Environmental Protection Note: All comments have been retyped exactly as submitted. RC316 1 U.S

  6. Sampling Rhodnius neglectus in Mauritia flexuosa palm trees: a field study in the Brazilian savanna.

    PubMed

    Gurgel-Gonçalves, R; Palma, A R T; Menezes, M N A; Leite, R N; Cuba, C A C

    2003-09-01

    Two sampling methods (manual capture and live-baited adhesive traps) were compared for collecting the bug Rhodnius neglectus Lent (Hemiptera: Reduviidae: Triatominae) from palm trees, Mauritia flexuosa L. (Arecaceae), in the savanna of Brasília DF. R. neglectus was found in 19/50 (38%) of palm trees sampled. The detection rate was much higher by visual inspection and manual capture (18/50=36%) than by our trapping method (5/50=10%), although one tree was found to be positive by trapping but not by manual capture. Bugs collected manually were mostly (146/154=95%) found among the dead organic material in palm crowns. In combination, these sampling techniques are useful for quick detection of triatomine bug infestation in palm trees, especially in areas of high ecological value where the palms should not be cut and dissected, but arboreal Rhodnius are suspected to transmit enzootic Trypanosoma cruzi that might represent a risk of causing human cases of Chagas disease.

  7. Chemical Aerosol Characterization Sampling in Santa Ana during the MCMA-2003 Field Campaign

    NASA Astrophysics Data System (ADS)

    Bernabe, R.; Castro, T.; Marquez, C.; Cardenas, B.; Salcedo, D.

    2004-12-01

    Aerosol samples were collected during the intensive MCMA-2003 campaign in Santa Ana (19.1772° N, 98.99° W), Mexico City. This small rural town lies near the southeastern border of Mexico City and on the western rim of a mountain pass that channels the southern outflow of air from the city. Particles smaller than 10 μ m in aerodynamic diameter were collected on aluminum foils using three 8-stage micro orifice uniform deposit impactor (MOUDI), while fine particles (PM2.5) were collected in quartz fiber filters using manual samplers (MiniVol air samplers, Airmetrics). Samples were taken every 3 days starting at 2am in 6 hr intervals (total time 18 hrs for MOUDI and 24 hrs for MiniVol) from April 10-22, 2003. The MOUDI was operated at a flow rate of 30 l/min with calibrated impaction cut-points in the range of 10 - 0.18 μ m; while the MiniVol operation flow rate was 5 l/min. Prior to sampling, the aluminum foils were pre-conditioned (at 450° C) in a furnace for 8 hrs to eliminate impurities. Both types of filters were weighted using an Ultra Microbalance (Cahn, with a sensitivity of 0.1 μ g) for particulate matter under controlled conditions (20° C and 50% relative humidity). The aluminum foils were cut in halves, one half for Total Carbon (TC) determination with a thermal method, Evolved Gas Analysis (EGA), and the other half for analysis of inorganic ions (Cl-, NO3, SO42-, NA+, NH4+, K+, Ca2+ and Mg+) by liquid chromatography and mass spectrometer analytic method. Organic and elemental carbon was done according to the IMPROVE Thermal Protocol. Aerosol measurements made with MOUDI showed that the particle size distribution was bimodal in the three sampling periods. During daylight periods, 75% of the collected samples consisted of particles with aerodynamic diameter < 1 μ m whereas the major mass concentration was dominated by particles > 1 μ m during night. PM2.5 results reveal that the highest and lowest levels were obtained during the afternoon (60.6 μ g

  8. Laboratory and field testing of bednet traps for mosquito (Diptera: Culicidae) sampling in West Java, Indonesia.

    PubMed

    Stoops, Craig A; Gionar, Yoyo R; Rusmiarto, Saptoro; Susapto, Dwiko; Andris, Heri; Elyazar, Iqbal R F; Barbara, Kathryn A; Munif, Amrul

    2010-06-01

    Surveillance of medically important mosquitoes is critical to determine the risk of mosquito-borne disease transmission. The purpose of this research was to test self-supporting, exposure-free bednet traps to survey mosquitoes. In the laboratory we tested human-baited and unbaited CDC light trap/cot bednet (CDCBN) combinations against three types of traps: the Mbita Trap (MIBITA), a Tent Trap (TENT), and a modified Townes style Malaise trap (TSM). In the laboratory, 16 runs comparing MBITA, TSM, and TENT to the CDCBN were conducted for a total of 48 runs of the experiment using 13,600 mosquitoes. The TENT trap collected significantly more mosquitoes than the CDCBN. The CDCBN collected significantly more than the MBITA and there was no difference between the TSM and the CDCBN. Two field trials were conducted in Cibuntu, Sukabumi, West Java, Indonesia. The first test compared human-baited and unbaited CDCBN, TENT, and TSM traps during six nights over two consecutive weeks per month from January, 2007 to September, 2007 for a total of 54 trapnights. A total of 8,474 mosquitoes representing 33 species were collected using the six trapping methods. The TENT-baited trap collected significantly more mosquitoes than both the CDCBN and the TSM. The second field trial was a comparison of the baited and unbaited TENT and CDCBN traps and Human Landing Collections (HLCs). The trial was carried out from January, 2008 to May, 2008 for a total of 30 trap nights. A total of 11,923 mosquitoes were collected representing 24 species. Human Landing Collections captured significantly more mosquitoes than either the TENT or the CDCBN. The baited and unbaited TENT collected significantly more mosquitoes than the CDCBN. The TENT trap was found to be an effective, light-weight substitute for the CDC light-trap, bednet combination in the field and should be considered for use in surveys of mosquito-borne diseases such as malaria, arboviruses, and filariasis.

  9. Sparse temporal sampling for fast time-domain wide-field fluorescence molecular tomography

    NASA Astrophysics Data System (ADS)

    Yao, Ruoyang; Zhao, Lingling; Intes, Xavier

    2016-03-01

    Fluorescence Molecular Tomography (FMT) is a powerful optical imaging tool for preclinical research. Especially, its implementation with time-domain (TD) techniques allows lifetime multiplexing for simultaneously imaging multiple biomarkers and provides enhanced data sets for improved resolution and quantification compared to continuous wave (CW) and frequency domain (FD) methodologies. When performing time-domain reconstructions, one important aspect is the selection of a temporal sub-data set. Typically, such selection is performed a posteriori after dense temporal sampling during the acquisition. In this work, we investigate the potential to collect a priori sparse data sets for fast experimental acquisition without compromising FMT performances.

  10. X-ray spectral properties of the AGN sample in the northern XMM-XXL field

    NASA Astrophysics Data System (ADS)

    Liu, Zhu; Merloni, Andrea; Georgakakis, Antonis; Menzel, Marie-Luise; Buchner, Johannes; Nandra, Kirpal; Salvato, Mara; Shen, Yue; Brusa, Marcella; Streblyanska, Alina

    2016-06-01

    In this paper we describe and publicly release a catalogue consisting of 8445 point-like X-ray sources detected in the XMM-XXL north survey. For the 2512 AGN which have reliable spectroscopy from SDSS-III/BOSS, we present the X-ray spectral fitting which has been computed with a Bayesian approach. We have also applied an X-ray spectral stacking method to different sub-samples, selected on the basis of the AGN physical properties (L2-10 keV, z, MBH, λEdd and NH). We confirm the well-known Iwasawa-Taniguchi effect in our luminosity-redshift sub-samples, and argue that such an effect is due to a decrease in the covering factor of a distant obscuring `torus' with increasing X-ray luminosity. By comparing the distribution of the reflection fraction, the ratio of the normalization of the reflected component to the direct radiation, we find that the low-luminosity, low-redshift sub-sample had systematically higher reflection fraction values than the high-redshift, high-luminosity one. On the other hand, no significant difference is found between samples having similar luminosity but different redshift, suggesting that the structure of the torus does not evolve strongly with redshift. Contrary to previous works, we do not find evidence for an increasing photon index at high Eddington ratio. This may be an indication that the structure of the accretion disc changes as the Eddington ratio approaches unity. Comparing our X-ray spectral analysis results with the optical spectral classification, we find that ˜20 per cent of optical type-1 AGN show an X-ray absorbing column density higher than 1021.5 cm- 2, and about 50 per cent of type-2 AGN have an X-ray absorbing column density less than 1021.5 cm- 2. We suggest that the excess X-ray absorption shown in the high-luminosity optical type-1 AGN can be due to small-scale dust-free gas within (or close to) the broad-line region, while in the low-luminosity ones it can be due to a clumpy torus with a large covering factor.

  11. Field and Lab Methods to Reduce Sampling Variation in Soil Carbon

    NASA Astrophysics Data System (ADS)

    Mattson, K. G.; Zhang, J.

    2015-12-01

    Natural variability in soil and detrital carbon sampling is typically large enough that it hinders accurate assessment of standing stock and changes that may occur following disturbances and experimental treatments. We are developing carbon budgets in forests of Northern California and wish to see how experimental canopy thinning may affect carbon cycling in these forests. In the pre-treatment phase, we have sought methods to quantify detrital carbon pools in an accurate and efficient manner. We have found that small soil excavations 15 cm diameter to a depth of 10 cm work very well to reduce variation an avoid introducing sampling biases. We excavate a pit carefully of uniform dimensions using cutting chisels and scoops. We fill the void created using small pebbles contained in a small net and then weigh the pebbles to obtain a volume estimate of the soil collected. The samples are sorted moist through a series of sieves of 6, 4, and 2 mm into rocks, live roots, dead roots, woody debris, and remaining soil and its organic matter. From a single sample, we estimate proportional rock volume, fine soil bulk density (soil bulk density of the 2 mm fraction), live roots, dead roots, woody debris, and proportion of organic matter in the 2 mm fraction. The standard deviations of soil measures (soil carbon, loss on ignition, bulk density, rock volume, live and dead root mass) were universally reduced over similar measures by soil corers, in some instances by up to 5-fold. Coefficient of variation using excavation pits are typically 5 to 10 %, whereas cores were 20 to 30 %. We have observed that variation in soil organic matter is more a function of variation in soil bulk density than with variation in percent soil organic matter content. As a result, we often see increased soil organic matter stores at depths below 10 cm. Soils beneath highly decayed logs show increases in soil carbon in the mineral soil suggesting woody debris is a source of soil carbon. Below

  12. Estimating wildfire risk on a Mojave Desert landscape using remote sensing and field sampling

    USGS Publications Warehouse

    Van Linn, Peter F.; Nussear, Kenneth E.; Esque, Todd C.; DeFalco, Lesley A.; Inman, Richard D.; Abella, Scott R.

    2013-01-01

    Predicting wildfires that affect broad landscapes is important for allocating suppression resources and guiding land management. Wildfire prediction in the south-western United States is of specific concern because of the increasing prevalence and severe effects of fire on desert shrublands and the current lack of accurate fire prediction tools. We developed a fire risk model to predict fire occurrence in a north-eastern Mojave Desert landscape. First we developed a spatial model using remote sensing data to predict fuel loads based on field estimates of fuels. We then modelled fire risk (interactions of fuel characteristics and environmental conditions conducive to wildfire) using satellite imagery, our model of fuel loads, and spatial data on ignition potential (lightning strikes and distance to roads), topography (elevation and aspect) and climate (maximum and minimum temperatures). The risk model was developed during a fire year at our study landscape and validated at a nearby landscape; model performance was accurate and similar at both sites. This study demonstrates that remote sensing techniques used in combination with field surveys can accurately predict wildfire risk in the Mojave Desert and may be applicable to other arid and semiarid lands where wildfires are prevalent.

  13. Predicting water-to-cyclohexane partitioning of the SAMPL5 molecules using dielectric balancing of force fields

    NASA Astrophysics Data System (ADS)

    Paranahewage, S. Shanaka; Gierhart, Cassidy S.; Fennell, Christopher J.

    2016-11-01

    Alchemical transformation of solutes using classical fixed-charge force fields is a popular strategy for assessing the free energy of transfer in different environments. Accurate estimations of transfer between phases with significantly different polarities can be difficult because of the static nature of the force fields. Here, we report on an application of such calculations in the SAMPL5 experiment that also involves an effort in balancing solute and solvent interactions via their expected static dielectric constants. This strategy performs well with respect to predictive accuracy and correlation with unknown experimental values. We follow this by performing a series of retrospective investigations which highlight the potential importance of proper balancing in these systems, and we use a null hypothesis analysis to explore potential biases in the comparisons with experiment. The collective findings indicate that considerations of force field compatibility through dielectric behavior is a potential strategy for future improvements in transfer processes between disparate environments.

  14. Magnetic Fields of Be Stars: Preliminary Results from a Hybrid Analysis of the MiMeS Sample

    NASA Astrophysics Data System (ADS)

    Wade, G. A.; Petit, V.; Grunhut, J. H.; Neiner, C.; MiMeS Collaboration

    2016-11-01

    In the context of the MiMeS survey of magnetism in massive stars, 85 classical Be stars were observed in circular polarization with the aim of detecting magnetic fields at their surfaces. No direct evidence of such fields is found, in contrast to the significant rate of detection (5-10%) in non-Be B-type stars. In this paper we describe the sample properties, the methodology and the data quality. We describe a novel method, previously applied to Herbig Ae/Be stars, that allows us to infer upper limits on organized (dipolar) magnetic fields present in the photospheres of our targets. We review the characteristics and robustness of this null result, and discuss its implications.

  15. Detection of pesticides residues in water samples from organic and conventional paddy fields of Ledang, Johor, Malaysia

    NASA Astrophysics Data System (ADS)

    Abdullah, Md Pauzi; Othman, Mohamed Rozali; Ishak, Anizan; Nabhan, Khitam Jaber

    2016-11-01

    Pesticides have been used extensively by the farmers in Malaysia during the last few decades. Sixteen water samples, collected from paddy fields both organic and conventional, from Ledang, Johor, were analyzed to determine the occurrence and distribution of organochlorine (OCPs) and organophosphorus (OPPs) pesticide residues. GC-ECD instrument was used to identify and determine the concentrations of these pesticide residues. Pesticide residues were detected in conventional fields in the range about 0.036-0.508 µg/L higher than detected in organic fields about 0.015-0.428 µg/L. However the level of concentration of pesticide residues in water sample from both paddy fields are in the exceed limit for human consumption, according to European Economic Commission (EEC) (Directive 98/83/EC) at 0.1 µg/L for any pesticide or 0.5 µg/L for total pesticides. The results that the organic plot is still contaminated with pesticides although pesticides were not use at all in plot possibly from historical used as well as from airborne contamination.

  16. Rapid and sensitive determination of tellurium in soil and plant samples by sector-field inductively coupled plasma mass spectrometry.

    PubMed

    Yang, Guosheng; Zheng, Jian; Tagami, Keiko; Uchida, Shigeo

    2013-11-15

    In this work, we report a rapid and highly sensitive analytical method for the determination of tellurium in soil and plant samples using sector field inductively coupled plasma mass spectrometry (SF-ICP-MS). Soil and plant samples were digested using Aqua regia. After appropriate dilution, Te in soil and plant samples was directly analyzed without any separation and preconcentration. This simple sample preparation approach avoided to a maximum extent any contamination and loss of Te prior to the analysis. The developed analytical method was validated by the analysis of soil/sediment and plant reference materials. Satisfactory detection limits of 0.17 ng g(-1) for soil and 0.02 ng g(-1) for plant samples were achieved, which meant that the developed method was applicable to studying the soil-to-plant transfer factor of Te. Our work represents for the first time that data on the soil-to-plant transfer factor of Te were obtained for Japanese samples which can be used for the estimation of internal radiation dose of radioactive tellurium due to the Fukushima Daiichi Nuclear Power Plant accident.

  17. Performance evaluation of currently used portable X ray fluorescence instruments for measuring the lead content of paint in field samples.

    PubMed

    Muller, Yan; Favreau, Philippe; Kohler, Marcel

    2014-01-01

    Field-portable X-ray fluorescence (FP-XRF) instruments are important for non-destructive, rapid and convenient measurements of lead in paint, in view of potential remediation. Using real-life paint samples, we compared measurements from three FP-XRF instruments currently used in Switzerland with laboratory measurements using inductively coupled plasma mass spectrometry after complete sample dissolution. Two FP-XRF devices that functioned by lead L shell excitation frequently underestimated the lead concentration of samples. Lack of accuracy correlated with lead depth and/or the presence of additional metal elements (Zn, Ba or Ti). A radioactive source emitter XRF that enabled the additional K shell excitation showed higher accuracy and precision, regardless of the depth of the lead layer in the sample or the presence of other elements. Inspection of samples by light and electron microscopy revealed the diversity of real-life samples, with multi-layered paints showing various depths of lead and other metals. We conclude that the most accurate measurements of lead in paint are currently obtained with instruments that provide at least sufficient energy for lead K shell excitation.

  18. On-field measurement trial of 4×128 Gbps PDM-QPSK signals by linear optical sampling

    NASA Astrophysics Data System (ADS)

    Bin Liu; Wu, Zhichao; Fu, Songnian; Feng, Yonghua; Liu, Deming

    2017-02-01

    Linear optical sampling is a promising characterization technique for advanced modulation formats, together with digital signal processing (DSP) and software-synchronized algorithm. We theoretically investigate the acquisition of optical sampling, when the high-speed signal under test is either periodic or random. Especially, when the profile of optical sampling pulse is asymmetrical, the repetition frequency of sampling pulse needs careful adjustment in order to obtain correct waveform. Then, we demonstrate on-field measurement trial of commercial four-channel 128 Gbps polarization division multiplexing quadrature phase shift keying (PDM-QPSK) signals with truly random characteristics by self-developed equipment. A passively mode-locked fiber laser (PMFL) with a repetition frequency of 95.984 MHz is used as optical sampling source, meanwhile four balanced photo detectors (BPDs) with 400 MHz bandwidth and four-channel analog-to-digital convertor (ADC) with 1.25 GS/s sampling rate are used for data acquisition. The performance comparison with conventional optical modulation analyzer (OMA) verifies that the self-developed equipment has the advantages of low cost, easy implementation, and fast response.

  19. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal reservoir, California, was measured at 150, 200, and 250 C as a function of pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption (increasing pressure) and desorption (decreasing pressure) runs were made in order to investigate the nature and the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were performed on the same rock samples. Nitrogen or krypton adsorption and desorption isotherms at 77 K were used to obtain BET specific surface areas, pore volumes and their distributions with respect to pore sizes. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there is in general no proportionality between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The results indicate that multilayer adsorption rather than capillary condensation is the dominant water storage mechanism at high temperatures.

  20. Utilization of 100 mb midlatitude height fields as an indicator of sampling effects on total ozone variations

    NASA Technical Reports Server (NTRS)

    Miller, A. J.; Nagatani, R. M.; Laver, J. D.; Korty, B.

    1979-01-01

    Midlatitude 100-mb height fields are employed to determine the effects of ground based sampling locations on measurements of variations in the total ozone content of the atmosphere. The precision of the zonal average heights computed by the technique of Angell and Korshover (1978) from data over ozone sampling areas at 50 deg N is compared to the zonal average computed from the entire data set. Linear regressions of ozone contents determined by an analysis of backscatter UV satellite data with respect to 100 mb heights are utilized to transform zonal differences in height to ozone levels. The zonal average total ozone sampling error is found to be on the order of 2% for midlatitudes of the Northern hemisphere, indicating that the general shape of ozone trends determined by ground-based observations appears to be real and the increase of ozone from the mid-1960's to the early 1970's may be greater than previously suggested.

  1. Field Sampling Plan for the Operable Units 6-05 and 10-04 Remedial Action, Phase IV

    SciTech Connect

    R. Wells

    2006-11-14

    This Field Sampling Plan outlines the collection and analysis of samples in support of Phase IV of the Waste Area Group 10, Operable Units 6-05 and 10-04 remedial action. Phase IV addresses the remedial actions to areas with the potential for unexploded ordnance at the Idaho National Laboratory Site. These areas include portions of the Naval Proving Ground, the Arco High-Altitude Bombing Range, and the Twin Buttes Bombing Range. The remedial action consists of removal and disposal of ordnance by high-order detonation, followed by sampling to determine the extent, if any, of soil that might have been contaminated by the detonation activities associated with the disposal of ordnance during the Phase IV activities and explosives during the Phase II activities.

  2. Two-photon luminescence contrast by tip-sample coupling in femtosecond near-field optical microscopy

    NASA Astrophysics Data System (ADS)

    Horneber, Anke; Wackenhut, Frank; Braun, Kai; Wang, Xiao; Wang, Jiyong; Zhang, Dai; Meixner, Alfred J.

    2017-01-01

    We investigate the role of tip-sample interaction in nonlinear optical scanning near-field microscopy. The experiment was performed by tightly focusing femtosecond laser pulses onto a sharp gold tip that was positioned in close proximity to the surface of a sample with gold nanostructures on a Si-substrate by shear force feedback. The nonlinear optical signal consists of two-photon photoluminescence and second harmonic signal from the gold tip and the gold nanostructures. These signals can be used to characterize different coupling parameters such as geometry, material and width of the tip-sample gap and enable to reveal the mechanism responsible for the image contrast. Under the excitation with 776-nm and 110-fs laser pulses nonlinear imaging is almost background free and yields super resolution showing features with dimensions significantly below the diffraction limit with a signal intensity following quadratic excitation power law.

  3. Prediction of SAMPL3 Host-Guest Binding Affinities: Evaluating the Accuracy of Generalized Force-Fields

    PubMed Central

    Muddana, Hari S.; Gilson, Michael K.

    2012-01-01

    We used the second-generation mining minima method (M2) to compute the binding affinities of the novel host-guest complexes in the SAMPL3 blind prediction challenge. The predictions were in poor agreement with experiment, and we conjectured that much of the error might derive from the force field, CHARMm with Vcharge charges. Repeating the calculations with other generalized force-fields led to no significant improvement, and we observed that the predicted affinities were highly sensitive to the choice of force-field. We therefore embarked on a systematic evaluation of a set of generalized force fields, based upon comparisons with PM6-DH2, a fast yet accurate semi-empirical quantum mechanics method. In particular, we compared gas-phase interaction energies and entropies for the host-guest complexes themselves, as well as for smaller chemical fragments derived from the same molecules. The mean deviations of the force field interaction energies from the quantum results were greater than 3 kcal/mol and 9 kcal/mol, for the fragments and host-guest systems respectively. We further evaluated the accuracy of force-fields for computing the vibrational entropies and found the mean errors to be greater than 4 kcal/mol. Given these errors in energy and entropy, it is not surprising in retrospect that the predicted binding affinities deviated from the experiment by several kcal/mol. These results emphasize the need for improvements in generalized force-fields and also highlight the importance of systematic evaluation of force-field parameters prior to evaluating different free-energy methods. PMID:22274835

  4. It's about time; Repeated field sampling and flexible UAV platforms for a changing globe

    NASA Astrophysics Data System (ADS)

    Crutsinger, G.

    2015-12-01

    Unmanned Aerial Vehicles (UAVs) are quickly being adopted across the field sciences and will revolutionizing the speed and spatial scale of data collection. As a result, UAVs will alleviate much of the burden placed on boots-on-the-ground researchers as they seek to address fundamental scientific questionsa ssociated with global change. Concurrently, UAVs will initiate a rapid rise in time-series data, whether from monitoring weather patterns, measuring shifts in phenology due to a warming temperatures, or tracking range expansion and contraction of species. The challenges within the scientific community will be in the standardization of data collection, protocol sharing, and data management. The emergence of flexible aerial platforms within the commercial UAV space with multiple sensor configurations, open software application development, and cloud-based services should do much to address these challenges, but only if there is close collaboration between the industry and academic research partners.

  5. Sampling and Analysis of Impact Crater Residues Found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R, P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years in low Earth orbit (LEO), the Wide Field Planetary Camera-2 (WFPC2) was recovered from the Hubble Space Telescope (HST) in May 2009, during the 12 day shuttle mission designated STS-125. The WFPC-2 radiator had been struck by approximately 700 impactors producing crater features 300 microns and larger in size. Following optical inspection in 2009, agreement was reached for joint NASA-ESA study of crater residues, in 2011. Over 480 impact features were extracted at NASA Johnson Space Center's (JSC) Space Exposed Hardware clean-room and curation facility during 2012, and were shared between NASA and ESA. We describe analyses conducted using scanning electron microscopy (SEM) - energy dispersive X-ray spectrometry (EDX): by NASA at JSC's Astromaterials Research and Exploration Science (ARES) Division; and for ESA at the Natural History Museum (NHM), with Ion beam analysis (IBA) using a scanned proton microbeam at the University of Surrey Ion Beam Centre (IBC).

  6. Statistical wiring of thalamic receptive fields optimizes spatial sampling of the retinal image

    PubMed Central

    Wang, Xin; Sommer, Friedrich T.; Hirsch, Judith A.

    2014-01-01

    Summary It is widely assumed that mosaics of retinal ganglion cells establish the optimal representation of visual space. However, relay cells in the visual thalamus often receive convergent input from several retinal afferents and, in cat, outnumber ganglion cells. To explore how the thalamus transforms the retinal image, we built a model of the retinothalamic circuit using experimental data and simple wiring rules. The model shows how the thalamus might form a resampled map of visual space with the potential to facilitate detection of stimulus position in the presence of sensor noise. Bayesian decoding conducted with the model provides support for this scenario. Despite its benefits, however, resampling introduces image blur, thus impairing edge perception. Whole-cell recordings obtained in vivo suggest that this problem is mitigated by arrangements of excitation and inhibition within the receptive field that effectively boost contrast borders, much like strategies used in digital image processing. PMID:24559681

  7. Field sampling of soil pore water to evaluate trace element mobility and associated environmental risk.

    PubMed

    Moreno-Jiménez, Eduardo; Beesley, Luke; Lepp, Nicholas W; Dickinson, Nicholas M; Hartley, William; Clemente, Rafael

    2011-10-01

    Monitoring soil pollution is a key aspect in sustainable management of contaminated land but there is often debate over what should be monitored to assess ecological risk. Soil pore water, containing the most labile pollutant fraction in soils, can be easily collected in situ offering a routine way to monitor this risk. We present a compilation of data on concentration of trace elements (As, Cd, Cu, Pb, and Zn) in soil pore water collected in field conditions from a range of polluted and non-polluted soils in Spain and the UK during single and repeated monitoring, and propose a simple eco-toxicity test using this media. Sufficient pore water could be extracted for analysis both under semi-arid and temperate conditions, and eco-toxicity comparisons could be effectively made between polluted and non-polluted soils. We propose that in-situ pore water extraction could enhance the realism of risk assessment at some contaminated sites.

  8. Sampling and Analysis of Impact Crater Residues Found on the Wide Field Planetary Camera-2 Radiator

    NASA Astrophysics Data System (ADS)

    Anz-Meador, P. D.; Liou, J.-C.; Ross, D.; Robinson, G. A.; Opiela, J. N.; Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R. P.; Griffin, T. J.; Reed, B. B.; Gerlach, L.

    2013-08-01

    After nearly 16 years in low Earth orbit (LEO), the Wide Field Planetary Camera-2 (WFPC2) was recovered from the Hubble Space Telescope (HST) in May 2009, during the 12 day shuttle mission designated STS-125. The WFPC-2 radiator had been struck by approximately 700 impactors producing crater features 300 μ m and larger in size. Following optical inspection in 2009, agreement was reached for joint NASA-ESA study of crater residues, in 2011. Over 480 impact features were extracted at NASA Johnson Space Center's (JSC) Space Exposed Hardware clean-room and curation facility during 2012, and were shared between NASA and ESA. We describe analyses conducted using scanning electron microscopy (SEM) - energy dispersive X-ray spectrometry (EDX): by NASA at JSC's Astromaterials Research and Exploration Science (ARES) Division; and for ESA at the Natural History Museum (NHM), with Ion beam analysis (IBA) using a scanned proton microbeam at the University of Surrey Ion Beam Centre (IBC).

  9. Field Sampling and Modeling of Creosote-Derived Contamination in a Tdally Forced Aquifer

    NASA Astrophysics Data System (ADS)

    Bishop, C.

    2003-12-01

    We are investigating the fate and transport of a creosote-derived groundwater contaminant plume found in an aquifer adjacent to and beneath a large, tidally forced river. The site, located in Coquitlam, BC, is adjacent to the Fraser River, and has been an active wood preserving facility since the 1920's. In the on-shore source zone, creosote has penetrated into the aquifer and a dissolved-phase plume, composed primarily of naphthalene, flows in the site aquifer from the source zone towards and below the river, eventually discharging from the river bottom. A capture well has been operated since 1996 to contain and capture the contaminant source. Previous research at this site has documented that biodegradation of naphthalene takes place in the plume fringe in the region of the aquifer that is beneath the river, but not onshore. Abundant methane and ferrous iron in the aquifer suggests that iron reduction and methanogenesis are the dominant terminal electron accepting processes. High offshore naphthalene concentrations sampled in 1999 despite three years of source containment and degradation led to the hypothesis that the plume may be at steady state due to buffering of contaminant concentrations by desorption from aquifer sediments. Naphthalene concentrations sampled in this study show that the contaminant plume is not at steady state. Results of groundwater flow modelling and sorption data show that the continued presence of high concentrations of naphthalene offshore are likely due to incomplete source containment or to slow migration of contaminants from upgradient regions of the aqueous plume. Although naphthalene has been the focus of all previous investigations of the offshore plume at this site, recent sampling shows that two other components of creosote, indane and benzothiophene, become the dominant components of the aqueous phase plume as it approaches the discharge point. Significant concentrations of these contaminants are likely discharging to the river

  10. Using adaptive sampling and triangular meshes for the processing and inversion of potential field data

    NASA Astrophysics Data System (ADS)

    Foks, Nathan Leon

    The interpretation of geophysical data plays an important role in the analysis of potential field data in resource exploration industries. Two categories of interpretation techniques are discussed in this thesis; boundary detection and geophysical inversion. Fault or boundary detection is a method to interpret the locations of subsurface boundaries from measured data, while inversion is a computationally intensive method that provides 3D information about subsurface structure. My research focuses on these two aspects of interpretation techniques. First, I develop a method to aid in the interpretation of faults and boundaries from magnetic data. These processes are traditionally carried out using raster grid and image processing techniques. Instead, I use unstructured meshes of triangular facets that can extract inferred boundaries using mesh edges. Next, to address the computational issues of geophysical inversion, I develop an approach to reduce the number of data in a data set. The approach selects the data points according to a user specified proxy for its signal content. The approach is performed in the data domain and requires no modification to existing inversion codes. This technique adds to the existing suite of compressive inversion algorithms. Finally, I develop an algorithm to invert gravity data for an interfacing surface using an unstructured mesh of triangular facets. A pertinent property of unstructured meshes is their flexibility at representing oblique, or arbitrarily oriented structures. This flexibility makes unstructured meshes an ideal candidate for geometry based interface inversions. The approaches I have developed provide a suite of algorithms geared towards large-scale interpretation of potential field data, by using an unstructured representation of both the data and model parameters.

  11. NGSI FY15 Final Report. Innovative Sample Preparation for in-Field Uranium Isotopic Determinations

    SciTech Connect

    Yoshida, Thomas M.; Meyers, Lisa

    2015-11-10

    Our FY14 Final Report included an introduction to the project, background, literature search of uranium dissolution methods, assessment of commercial off the shelf (COTS) automated sample preparation systems, as well as data and results for dissolution of bulk quantities of uranium oxides, and dissolution of uranium oxides from swipe filter materials using ammonium bifluoride (ABF). Also, discussed were reaction studies of solid ABF with uranium oxide that provided a basis for determining the ABF/uranium oxide dissolution mechanism. This report details the final experiments for optimizing dissolution of U3O8 and UO2 using ABF and steps leading to development of a Standard Operating Procedure (SOP) for dissolution of uranium oxides on swipe filters.

  12. Applying high resolution SyXRD analysis on sulfate attacked concrete field samples

    SciTech Connect

    Stroh, J.; Schlegel, M.-C.; Irassar, E.F.; Meng, B.; Emmerling, F.

    2014-12-15

    High resolution synchrotron X-ray diffraction (SyXRD) was applied for a microstructural profile analysis of concrete deterioration after sulfate attack. The cement matrices consist of ordinary Portland cement and different amounts of supplementary cementitious materials, such as fly ash, natural pozzolana and granulated blast furnace slag. The changes of the phase composition were determined along the direction of sulfate ingress. This approach allows the identification of reaction fronts and zones of different phase compositions and conclusions about the mechanisms of sulfate attack. Two reaction fronts were localized in the initial 4 mm from the sample surface. The mechanism of deterioration caused by the exposition in the sulfate-bearing soil is discussed. SyXRD is shown to be a reliable method for investigation of cementitious materials with aggregates embedded in natural environments.

  13. Field Evaluations of Sampling Methods for Long-Term Monitoring of Upland Ecosystems on the Colorado Plateau

    USGS Publications Warehouse

    Miller, Mark E.; Witwicki, Dana L.; Mann, Rebecca K.; Tancreto, Nicole J.

    2007-01-01

    . There also were no differences among methods with respect to mean and median measures of among-plot variability in total live understory canopy cover. But among-plot variability was least for the line-point technique at seven of 11 ecological sites. Sampling activities had greatest impacts on plot conditions at macroplots where there was a high degree of cover by biological and physical soil crusts. Of all sampling procedures, 10-m2 quadrat sampling, line-point sampling, and gap-intercept sampling had the most impacts on soil conditions due to trampling of soil crusts by the field team.

  14. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland: Volume 2, Quality Assurance Project Plan

    SciTech Connect

    Prasad, S.; Martino, L.; Patton, T.

    1995-03-01

    J-Field encompasses about 460 acres at the southern end of the Gunpowder Neck Peninsula in the Edgewood Area of APG (Figure 2.1). Since World War II, the Edgewood Area of APG has been used to develop, manufacture, test, and destroy chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). For the purposes of this project, J-Field has been divided into eight geographic areas or facilities that are designated as areas of concern (AOCs): the Toxic Burning Pits (TBP), the White Phosphorus Burning Pits (WPP), the Riot Control Burning Pit (RCP), the Robins Point Demolition Ground (RPDG), the Robins Point Tower Site (RPTS), the South Beach Demolition Ground (SBDG), the South Beach Trench (SBT), and the Prototype Building (PB). The scope of this project is to conduct a remedial investigation/feasibility study (RI/FS) and ecological risk assessment to evaluate the impacts of past disposal activities at the J-Field site. Sampling for the RI will be carried out in three stages (I, II, and III) as detailed in the FSP. A phased approach will be used for the J-Field ecological risk assessment (ERA).

  15. A new method to detect and correct sample tilt in scanning transmission electron microscopy bright-field imaging.

    PubMed

    Brown, H G; Ishikawa, R; Sánchez-Santolino, G; Lugg, N R; Ikuhara, Y; Allen, L J; Shibata, N

    2017-02-01

    Important properties of functional materials, such as ferroelectric shifts and octahedral distortions, are associated with displacements of the positions of lighter atoms in the unit cell. Annular bright-field scanning transmission electron microscopy is a good experimental method for investigating such phenomena due to its ability to image light and heavy atoms simultaneously. To map atomic positions at the required accuracy precise angular alignment of the sample with the microscope optical axis is necessary, since misalignment (tilt) of the specimen contributes to errors in position measurements of lighter elements in annular bright-field imaging. In this paper it is shown that it is possible to detect tilt with the aid of images recorded using a central bright-field detector placed within the inner radius of the annular bright-field detector. For a probe focus near the middle of the specimen the central bright-field image becomes especially sensitive to tilt and we demonstrate experimentally that misalignment can be detected with a precision of less than a milliradian, as we also confirm in simulation. Coma in the probe, an aberration that can be misidentified as tilt of the specimen, is also investigated and it is shown how the effects of coma and tilt can be differentiated. The effects of tilt may be offset to a large extent by shifting the diffraction plane detector an amount equivalent to the specimen tilt and we provide an experimental proof of principle of this using a segmented detector system.

  16. Megacrystic Clinopyroxene Basalts Sample A Deep Crustal Underplate To The Mount Taylor Volcanic Field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, M. E.; Schrader, C. M.; Crumpler, L. S.; Wolff, J. A.

    2012-12-01

    The alkaline and compositionally diverse (basanite to high-Si rhyolite) Mount Taylor Volcanic Field (MTVF), New Mexico comprises 4 regions that cover ~75 x 40 km2: (1) Mount Taylor, a large composite volcano and a surrounding field of basaltic vents; (2) Grants Ridge, constructed of topaz rhyolitic ignimbrite and coulees; (3) Mesa Chivato, a plateau of alkali basalts and mugearitic to trachytic domes; and (4) the Rio Puero basaltic necks. Distributed throughout its history (~3.6 to 1.26 Ma; Crumpler and Goff, 2012) and area (excepting Rio Puerco Necks) is a texturally distinct family of differentiated basalts (Mg# 43.2-53.4). These basalts contain resorbed and moth-eaten megacrysts (up to 2 cm) of plagioclase, clinopyroxene, and olivine ±Ti-magnetite ±ilmenite ±rare orthopyroxene. Some megacrystic lava flows have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. For instance, gabbroic and megacrystic clinopyroxenes form linear positive arrays in TiO2 (0.2-2.3 wt%) with respect to Al2O3 (0.7-9.3 wt%). The lowest Al clinopyroxenes are found in a gabbroic inclusion and are associated with partially melted intercumulus orthopyroxene. Megacrystic and gabbroic plagioclase (An 41-80) in 4 representative thin sections were analyzed for 87Sr/86Sr by Laser Ablation ICP-MS. 87Sr/86Sr values for the suite range from 0.7036 to 0.7047. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, these megacrysts track the differentiation of an intrusive body (or related bodies) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. The intrusive body likely underplates portions of the MTVF that have generated silicic magmas (Mount Taylor, Grants Ridge, Mesa Chivato). Although disequilibrium is implied by resorbed

  17. You wouldn't go into the field with dirty sampling gear, would you?

    NASA Astrophysics Data System (ADS)

    Rummel, J. D.; Voytek, M. A.; Hipkin, V.

    2014-12-01

    Planetary protection is a precautionary principle that brought together Western and Soviet interests at the height of the Cold War. Scientists on both sides lobbied for a guiding principle in the design of planetary missions that included how to prevent biological contamination of target planetary bodies to preserve their pristine nature until they could be studied in detail. Planetary protection policies today remain as relevant because the pace of exploration has been far slower than their expectation, which was to have completed the search for life in our solar system within 50 years. Today Planetary Protection Policy rides on our definitions of terran life and what we know of its limits on Earth and our limited knowledge of extraterrestrial environments. A brief history of planetary protection is presented with a reminder that the harmful contamination it protects against for Mars is the inability to detect biosignatures should they exist. For illustration, an imaginary life detection mission without planetary protection requirements is discussed. Finally, a brief review is given of current planetary protection implementation methods and new areas of research in this field.

  18. Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

    USGS Publications Warehouse

    Cecil, L.D.; Knobel, L.L.; Wegner, S.J.; Moore, L.L.

    1989-01-01

    Water from four wells completed in the Snake River Plain aquifer was sampled as part of the U.S. Geological Survey 's quality assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in groundwater at the Idaho National Engineering Laboratory. Water from each well was filtered through either a 0.45-micrometer membrane or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered samples was preserved in the field with reagent-grade hydrochloric acid and the other set of samples was not acidified. For water from wells with strontium-90 concentrations at or above the reporting level, 94% or more of the strontium-90 is in true solution or in colloidal particles smaller than 0.1 micrometer. These results suggest that within-laboratory reproducibility for strontium-90 in groundwater at the INEL is not significantly affected by changes in filtration and preservation methods used for sample collections. (USGS)

  19. Partitioning of alcohol ethoxylates and polyethylene glycols in the marine environment: field samplings vs laboratory experiments.

    PubMed

    Traverso-Soto, Juan M; Brownawell, Bruce J; González-Mazo, Eduardo; Lara-Martín, Pablo A

    2014-08-15

    Nowadays, alcohol ethoxylates (AEOs) constitute the most important group of non-ionic surfactants, used in a wide range of applications such as household cleaners and detergents. Significant amounts of these compounds and their degradation products (polyethylene glycols, PEGs, which are also used for many other applications) reach aquatic environments, and are eliminated from the water column by degradation and sorption processes. This work deals with the environmental distribution of AEOs and PEGs in the Long Island Sound Estuary, a setting impacted by sewage discharges from New York City (NYC). The distribution of target compounds in seawater was influenced by tides, consistent with salinity differences, and concentrations in suspended solid samples ranged from 1.5 to 20.5 μg/g. The more hydrophobic AEOs were mostly attached to the particulate matter whereas the more polar PEGs were predominant in the dissolved form. Later, the sorption of these chemicals was characterized in the laboratory. Experimental and environmental sorption coefficients for AEOs and PEGs showed average values from 3607 to 164,994 L/kg and from 74 to 32,862 L/kg, respectively. The sorption data were fitted to a Freundlich isotherm model with parameters n and log KF between 0.8-1.2 and 1.46-4.39 L/kg, respectively. AEO and PEG sorptions on marine sediment were also found to be mostly not affected by changes in salinity.

  20. Field Research and Laboratory Sample Analysis of Dust-Water-Organics-Life from Mars Analogue Extreme Environments

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.; Ehrenfreund, Pascale; ILEWG EuroMoonMars Team

    2015-08-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009* to 2013) in the extreme environment of the Utah desert relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution a ected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with signi cant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare 2009 campaign results to new measurements from 2010-2013 campaigns: comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.References * in Foing, Stoker Ehrenfreund (Editors, 2011) Astrobiology field Research in Moon/Mars Analogue Environments", Special Issue of International Journal of Astrobiology

  1. Megacrystic pyroxene basalts sample deep crustal gabbroic cumulates beneath the Mount Taylor volcanic field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, Mariek E.; Schrader, Christian M.; Crumpler, Larry S.; Rowe, Michael C.; Wolff, John A.; Boroughs, Scott P.

    2016-04-01

    Distributed over the ~ 2.3 m.y. history of the alkaline and compositionally diverse Mount Taylor Volcanic Field (MTVF), New Mexico is a widespread texturally distinct family of differentiated basalts that contain resorbed megacrysts (up to 3 cm) of plagioclase, clinopyroxene, and olivine ± Ti-magnetite ± ilmenite ± orthopyroxene. These lavas have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. Gabbroic and megacrystic clinopyroxenes form positive linear arrays in TiO2 (0.2-2.3 wt.%) with respect to Al2O3 (0.7-9.3 wt.%). Plagioclase (An41-80) from representative thin sections analyzed for 87Sr/86Sr by laser ablation ICP-MS range from 0.7036 to 0.7048. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, the pyroxene and plagioclase megacrysts appear to track the differentiation of a gabbroic pluton (or related plutons) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. Clinopyroxene-liquid geobarometry calculations suggest that crystallization occurred near the crust-mantle transition at an average of ~ 1200 °C and 12-13 kbar. The distribution of the megacrystic pyroxene basalts suggests that a gabbroic intrusive body underlies subregions of the MTVF that have generated silicic magmas. The gabbro is interpreted to be a significant heat and mass input into the lower crust that is capable of driving the petrogenesis of diverse silicic compositions (through fractionation and crustal assimilation), including mugearites, trachytes, trachy-andesites and dacites, high-Si rhyolites, and topaz rhyolites of the MTVF.

  2. Effect of Nitrate Injection on the Microbial Community in an Oil Field as Monitored by Reverse Sample Genome Probing

    PubMed Central

    Telang, A. J.; Ebert, S.; Foght, J. M.; Westlake, D.; Jenneman, G. E.; Gevertz, D.; Voordouw, G.

    1997-01-01

    The reverse sample genome probe (RSGP) method, developed for monitoring the microbial community in oil fields with a moderate subsurface temperature, has been improved by (i) isolation of a variety of heterotrophic bacteria and inclusion of their genomes on the oil field master filter and (ii) use of phosphorimaging technology for the rapid quantitation of hybridization signals. The new master filter contains the genomes of 30 sulfate-reducing, 1 sulfide-oxidizing, and 16 heterotrophic bacteria. Most have been identified by partial 16S rRNA sequencing. Use of improved RSGP in monitoring the effect of nitrate injection in an oil field indicated that the sulfide-oxidizing, nitrate-reducing isolate CVO (a Campylobacter sp.) becomes the dominant community component immediately after injection. No significant enhancement of other community members, including the sulfate-reducing bacteria, was observed. The elevated level of CVO decayed at most sampling sites within 30 days after nitrate injection was terminated. Chemical analyses indicated a corresponding decrease and subsequent increase in sulfide concentrations. Thus, transient injection of a higher potential electron acceptor into an anaerobic subsurface system can have desirable effects (i.e., reduction of sulfide levels) without a permanent adverse influence on the resident microbial community. PMID:16535595

  3. Preservation of field samples for enzymatic and proteomic characterization: analysis of proteins from the trophallactic fluid of hornets and yellowjackets.

    PubMed

    Roskens, Violet A; Carpenter, James M; Pickett, Kurt M; Ballif, Bryan A

    2010-10-01

    Proteomics is fast becoming one of the most interdisciplinary fields, bridging many chemical and biological disciplines. Major challenges, however, can limit the reach of proteomics to studies of model organisms. Challenges include the adequate preservation of field samples and the reliance of in-depth proteomics on sequenced genomes. Seeking to better establish the evolutionary relationships of hornets and yellowjackets comprising the subfamily Vespinae, we are combining classical morphological and genomic information with a functional genomics trait using proteomics. Vespine species form highly social colonies and exhibit division of labor in almost all aspects of colony life. An extreme digestive division of labor has been reported in Vespa orientalis, in which larvae but not adult workers exhibit the capacity to digest proteins fully. This makes the colony dependent upon the amino acid-rich trophallactic fluid released to adults by larvae and implies that the V. orientalis superorganism possesses larval-specific proteases. Identifying the proteases and the species exhibiting such extreme partitioning of digestive labor will allow for tracing the phylogenetic origins and elaboration of that digestive partitioning in the Vespinae. Herein we describe methods, generally applicable to field samples, showing the preservation of proteins and proteolytic activity from adult and larval vespine trophallactic fluid.

  4. Identification of Distinct Communities of Sulfate-Reducing Bacteria in Oil Fields by Reverse Sample Genome Probing

    PubMed Central

    Voordouw, Gerrit; Voordouw, Johanna K.; Jack, Thomas R.; Foght, Julia; Fedorak, Phillip M.; Westlake, Donald W. S.

    1992-01-01

    Thirty-five different standards of sulfate-reducing bacteria, identified by reverse sample genome probing and defined as bacteria with genomes showing little or no cross-hybridization, were in part characterized by Southern blotting, using 16S rRNA and hydrogenase gene probes. Samples from 56 sites in seven different western Canadian oil field locations were collected and enriched for sulfate-reducing bacteria by using different liquid media containing one of the following carbon sources: lactate, ethanol, benzoate, decanoate, propionate, or acetate. DNA was isolated from the enrichments and probed by reverse sample genome probing using master filters containing denatured chromosomal DNAs from the 35 sulfate-reducing bacterial standards. Statistical analysis of the microbial compositions at 44 of the 56 sites indicated the presence of two distinct communities of sulfate-reducing bacteria. The discriminating factor between the two communities was the salt concentration of the production waters, which were either fresh water or saline. Of 34 standards detected, 10 were unique to the fresh water and 18 were unique to the saline oil field environment, while only 6 organisms were cultured from both communities. Images PMID:16348801

  5. Spatial Distribution and Minimum Sample Size for Overwintering Larvae of the Rice Stem Borer Chilo suppressalis (Walker) in Paddy Fields.

    PubMed

    Arbab, A

    2014-10-01

    The rice stem borer, Chilo suppressalis (Walker), feeds almost exclusively in paddy fields in most regions of the world. The study of its spatial distribution is fundamental for designing correct control strategies, improving sampling procedures, and adopting precise agricultural techniques. Field experiments were conducted during 2011 and 2012 to estimate the spatial distribution pattern of the overwintering larvae. Data were analyzed using five distribution indices and two regression models (Taylor and Iwao). All of the indices and Taylor's model indicated random spatial distribution pattern of the rice stem borer overwintering larvae. Iwao's patchiness regression was inappropriate for our data as shown by the non-homogeneity of variance, whereas Taylor's power law fitted the data well. The coefficients of Taylor's power law for a combined 2 years of data were a = -0.1118, b = 0.9202 ± 0.02, and r (2) = 96.81. Taylor's power law parameters were used to compute minimum sample size needed to estimate populations at three fixed precision levels, 5, 10, and 25% at 0.05 probabilities. Results based on this equation parameters suggesting that minimum sample sizes needed for a precision level of 0.25 were 74 and 20 rice stubble for rice stem borer larvae when the average larvae is near 0.10 and 0.20 larvae per rice stubble, respectively.

  6. Woodbridge Army Research Facility RI/FS; volume 1. Field sampling plan. Report for 1995-1996

    SciTech Connect

    Choynowski, J.; Ehlers, M.; Elias, M.; Garcia, M.; Henry, C.

    1996-02-01

    U.S. Army Woodbridge Research Facility (WRF) was used in the past as a major military communications center and a research and development laboratory where electromagnetic pulse energy was tested on military and other equipment. WRF is presently an inactive facility pursuant to the 1991 Base Realignment and Closure list. Past investigation activities indicate that polychlorinated biphenyl compounds (PCBs) are primary chemicals of concern. The WRF is presently in the process of being turned over to the United States Fish and Wildlife Service (USFWS) to be used as a wildlife refuge and training facility. This task calls for provision of the necessary staff and equipment to provide remedial investigation/feasibility support for the USAEC BRAC Program investigation at WRF. The scope of work includes Focused Feasibility Studies, Remedial Investigations, Feasibility Studies, ecological assessments, risk assessments, proposed plans, RODs, and community relations support. This Field Sampling Plan contains a description of the site, sample location rationale, technical approach to field operations, site safety procedures, and methods for ecological assessments, analyses of samples, data management, and disposal of investigation-derived wastes. Information contained in other plans which accompany this submittal is identified.

  7. Iodine-129 Analysis of NTS Near-Field Groundwater Samples on the Multi-Collector ICP-MS

    SciTech Connect

    Williams, R; Ramon, E; Moran, J E; Rose, T P

    2005-02-01

    Iodine was chemically separated from NTS near-field groundwater samples and analyzed for its {sup 129}I/{sup 129}I ratio on a Multi-Collector Inductively Coupled Plasma Mass Spectrometer (MC-ICPMS). The measured ratios were then compared to {sup 129}I/{sup 129}I ratios for identical samples run on the Accelerator Mass Spectrometer (AMS). The MC-ICPMS results in some cases differed from the AMS values by more than an order of magnitude. The disparity in the results is due to isobaric interferences at mass 129 from polyatomic species and {sup 129}Xe in the MC-ICPMS plasma gas. It is anticipated that the interferences can be largely eliminated by (1) improving the molybdenum separation chemistry using a {sup 92}Mo-spike precipitation method, and (2) introducing O{sub 2} to the plasma gas to reduce the {sup 129}Xe interference. The MC-ICPMS detection limit for {sup 129}I/{sup 127}I (measured on reference standards) is on the order of 1E-6 or slightly lower. Most near-field groundwater samples have {sup 129}I/{sup 127}I ratios >1E-6, and should be measurable on the MC-ICPMS once the isobaric interference issues are resolved.

  8. Ultrasensitive detection of bacteria by microchip electrophoresis based on multiple-concentration approaches combining chitosan sweeping, field-amplified sample stacking, and reversed-field stacking.

    PubMed

    Wang, Zhi-Fang; Cheng, Shuang; Ge, Shu-Li; Wang, Huan; Wang, Qing-Jiang; He, Pin-Gang; Fang, Yu-Zhi

    2012-02-07

    In this paper we describe an on-chip multiple-concentration method combining chitosan (CS) sweeping, reversed-field stacking, and field-amplified sample stacking for highly efficient detection of bacteria. Escherichia coli was selected as a model bacterium to investigate the efficiency of this multiple-concentration method. CS was the most suitable sweeping agent for microchip electrophoresis, replacing the usually used cetyltrimethylammonium bromide for capillary electrophoresis. The additive taurine had a synergistic effect by enhancing the interaction between CS and the surface of the bacteria, thus improving the analysis sensitivity. All steps of the concentration method and related mechanisms are described and discussed in detail. A concentration enhancement factor of approximately 6000 was obtained using this concentration method under optimal conditions as compared to using no concentration step, and the detection limit of E. coli was 145 CFU/mL. The multiple-concentration methodology was also applied for the quantification of bacteria in surface water, and satisfactory results were achieved. The application of this methodology showed that the concentration enhancement of bacteria clearly conferred advantageous sensitivity, speed, and sample volume compared to established methods.

  9. Gas and Isotope Geochemistry of 81 Steam Samples from Wells in The Geysers Geothermal Field, Sonoma and Lake Counties, California

    USGS Publications Warehouse

    Lowenstern, Jacob B.; Janik, Cathy J.; Fahlquist, Lynne; Johnson, Linda S.

    1999-01-01

    The Geysers geothermal field in northern California, with about 2000-MW electrical capacity, is the largest geothermal field in the world. Despite its importance as a resource and as an example of a vapor-dominated reservoir, very few complete geochemical analyses of the steam have been published (Allen and Day, 1927; Truesdell and others, 1987). This report presents data from 90 steam, gas, and condensate samples from wells in The Geysers geothermal field in northern California. Samples were collected between 1978 and 1991. Well attributes include sampling date, well name, location, total depth, and the wellhead temperature and pressure at which the sample was collected. Geochemical characteristics include the steam/gas ratio, composition of noncondensable gas (relative proportions of CO2, H2S, He, H2, O2, Ar, N2, CH4, and NH3), and isotopic values for deltaD and delta18O of H2O, delta13C of CO2, and delta34S of H2S. The compilation includes 81 analyses from 74 different production wells, 9 isotopic analyses of steam condensate pumped into injection wells, and 5 complete geochemical analyses on gases from surface fumaroles and bubbling pools. Most samples were collected as saturated steam and plot along the liquid-water/steam boiling curve. Steam-togas ratios are highest in the southeastern part of the geothermal field and lowest in the northwest, consistent with other studies. Wells in the Northwest Geysers are also enriched in N2/Ar, CO2 and CH4, deltaD, and delta18O. Well discharges from the Southeast Geysers are high in steam/gas and have isotopic compositions and N2/Ar ratios consistent with recharge by local meteoric waters. Samples from the Central Geysers show characteristics found in both the Southeast and Northwest Geysers. Gas and steam characteristics of well discharges from the Northwest Geysers are consistent with input of components from a high-temperature reservoir containing carbonrich gases derived from the host Franciscan rocks. Throughout the

  10. Influence of high-conductivity buffer composition on field-enhanced sample injection coupled to sweeping in CE.

    PubMed

    Anres, Philippe; Delaunay, Nathalie; Vial, Jérôme; Thormann, Wolfgang; Gareil, Pierre

    2013-02-01

    The aim of this work was to clarify the mechanism taking place in field-enhanced sample injection coupled to sweeping and micellar EKC (FESI-Sweep-MEKC), with the utilization of two acidic high-conductivity buffers (HCBs), phosphoric acid or sodium phosphate buffer, in view of maximizing sensitivity enhancements. Using cationic model compounds in acidic media, a chemometric approach and simulations with SIMUL5 were implemented. Experimental design first enabled to identify the significant factors and their potential interactions. Simulation demonstrates the formation of moving boundaries during sample injection, which originate at the initial sample/HCB and HCB/buffer discontinuities and gradually change the compositions of HCB and BGE. With sodium phosphate buffer, the HCB conductivity increased during the injection, leading to a more efficient preconcentration by staking (about 1.6 times) than with phosphoric acid alone, for which conductivity decreased during injection. For the same injection time at constant voltage, however, a lower amount of analytes was injected with sodium phosphate buffer than with phosphoric acid. Consequently sensitivity enhancements were lower for the whole FESI-Sweep-MEKC process. This is why, in order to maximize sensitivity enhancements, it is proposed to work with sodium phosphate buffer as HCB and to use constant current during sample injection.

  11. Separation and detection of isoquinoline alkaloids using MEEKC coupled with field-amplified sample injection induced by ACN.

    PubMed

    Yu, Li-Shuang; Xu, Xue-Qin; Huang, Lu; Lin, Jin-Ming; Chen, Guo-Nan

    2009-02-01

    New methods based on MEEKC coupling with field-amplified sample injection (FASI) induced by ACN were proposed for five isoquinoline alkaloids (berberine, palmatine, jatrorrhizine, sinomenine and homoharringtonine) in no salt and high salt sample solution (HS). For the separation of five isoquinoline alkaloids, a running buffer composed of 18 mM sodium cholate, 2.4% v/v butan-1-ol, 0.6% v/v ethyl acetate, 10% v/v (or 30% v/v) methanol and 87.0% v/v (or 67% v/v) 5 mM Na2B4O7~10 mM NaH2PO4 buffer (pH 7.5) was developed. In order to improve the sensitivity, FASI induced by ACN was applied to increase the detection sensitivity. The detection limit was found to be as low as 0.0002 microg/mL in no salt sample solution and 0.062 microg/mL in HS. The method has been applied for the analysis of human urine spiked with analytes, and the assay results were proved to be satisfactory, and also the determination of berberine in urine sample after oral administration berberine.

  12. Statistical properties of the surface velocity field in the northern Gulf of Mexico sampled by GLAD drifters

    NASA Astrophysics Data System (ADS)

    Mariano, A. J.; Ryan, E. H.; Huntley, H. S.; Laurindo, L. C.; Coelho, E.; Griffa, A.; Özgökmen, T. M.; Berta, M.; Bogucki, D.; Chen, S. S.; Curcic, M.; Drouin, K. L.; Gough, M.; Haus, B. K.; Haza, A. C.; Hogan, P.; Iskandarani, M.; Jacobs, G.; Kirwan, A. D.; Laxague, N.; Lipphardt, B.; Magaldi, M. G.; Novelli, G.; Reniers, A.; Restrepo, J. M.; Smith, C.; Valle-Levinson, A.; Wei, M.

    2016-07-01

    The Grand LAgrangian Deployment (GLAD) used multiscale sampling and GPS technology to observe time series of drifter positions with initial drifter separation of O(100 m) to O(10 km), and nominal 5 min sampling, during the summer and fall of 2012 in the northern Gulf of Mexico. Histograms of the velocity field and its statistical parameters are non-Gaussian; most are multimodal. The dominant periods for the surface velocity field are 1-2 days due to inertial oscillations, tides, and the sea breeze; 5-6 days due to wind forcing and submesoscale eddies; 9-10 days and two weeks or longer periods due to wind forcing and mesoscale variability, including the period of eddy rotation. The temporal e-folding scales of a fitted drifter velocity autocorrelation function are bimodal with time scales, 0.25-0.50 days and 0.9-1.4 days, and are the same order as the temporal e-folding scales of observed winds from nearby moored National Data Buoy Center stations. The Lagrangian integral time scales increase from coastal values of 8 h to offshore values of approximately 2 days with peak values of 3-4 days. The velocity variance is large, O>(1>) m2/s2, the surface velocity statistics are more anisotropic, and increased dispersion is observed at flow bifurcations. Horizontal diffusivity estimates are O>(103>) m2/s in coastal regions with weaker flow to O>(105>) m2/s in flow bifurcations, a strong jet, and during the passage of Hurricane Isaac. The Gulf of Mexico surface velocity statistics sampled by the GLAD drifters are a strong function of the feature sampled, topography, and wind forcing.

  13. Actualities and Perspectives in Neurosurgery

    PubMed Central

    Iencean, SM; Brehar, FM

    2008-01-01

    In the field of neurosurgery, like in other surgical specialties, the last decades have brought major achievements. The series of revolutionary discoveries has started during the last century in the fifties, with stereotactic radiosurgery, then continued with the implementation of operative microscope (during the seventies), the endovascular embolisation in the nineties and finally with the major improvement in robotic neurosurgery and molecular neurosurgery at the beginning of this century. The major innovation has been brought not only in the field of therapeutical measures but also in the field of neuro– imaging. Thus, the modern MRI with more than 3 Tesla, can reveal to the neurosurgeon the most intimate structures of the nervous system. Several important areas in neurosurgery like: vascular neurosurgery, functional neurosurgery and brain tumors pathology, benefit from the modern technology and from the latest discoveries from genetic and molecular biology. In conclusion, summarizing the discoveries of the last decade, we emphasize that the related areas like genetics, molecular biology, computer technology become more and more important in the future progress of the neurosurgery. PMID:20108475

  14. Boehmite Actual Waste Dissolutions Studies

    SciTech Connect

    Snow, Lanee A.; Lumetta, Gregg J.; Fiskum, Sandra K.; Peterson, Reid A.

    2008-07-15

    The U.S. Department of Energy plans to vitrify approximately 60,000 metric tons of high-level waste (HLW) sludge from underground storage tanks at the Hanford Nuclear Reservation. To reduce the volume of HLW requiring treatment, a goal has been set to remove a significant quantity of the aluminum, which comprises nearly 70 percent of the sludge. Aluminum is found in the form of gibbsite, sodium aluminate and boehmite. Gibbsite and sodium aluminate can be easily dissolved by washing the waste stream with caustic. Boehmite, which comprises nearly half of the total aluminum, is more resistant to caustic dissolution and requires higher treatment temperatures and hydroxide concentrations. Samples were taken from four Hanford tanks and homogenized in order to give a sample that is representative of REDOX (Reduction Oxidation process for Pu recovery) sludge solids. Bench scale testing was performed on the homogenized waste to study the dissolution of boehmite. Dissolution was studied at three different hydroxide concentrations, with each concentration being run at three different temperatures. Samples were taken periodically over the 170 hour runs in order to determine leaching kinetics. Results of the dissolution studies and implications for the proposed processing of these wastes will be discussed.

  15. Small-Scale DNA Sample Preparation Method for Field PCR Detection of Microbial Cells and Spores in Soil

    PubMed Central

    Kuske, Cheryl R.; Banton, Kaysie L.; Adorada, Dante L.; Stark, Peter C.; Hill, Karen K.; Jackson, Paul J.

    1998-01-01

    Efficient, nonselective methods to obtain DNA from the environment are needed for rapid and thorough analysis of introduced microorganisms in environmental samples and for analysis of microbial community diversity in soil. A small-scale procedure to rapidly extract and purify DNA from soils was developed for in-the-field use. Amounts of DNA released from bacterial vegetative cells, bacterial endospores, and fungal conidia were compared by using hot-detergent treatment, freeze-thaw cycles, and bead mill homogenization. Combining a hot-detergent treatment with bead mill homogenization gave the highest DNA yields from all three microbial cell types and provided DNA from the broadest range of microbial groups in a natural soil community. Only the bead mill homogenization step was effective for DNA extraction from Bacillus globigii (B. subtilis subsp. niger) endospores or Fusarium moniliforme conidia. The hot-detergent–bead mill procedure was simplified and miniaturized. By using this procedure and small-scale, field-adapted purification and quantification procedures, DNA was prepared from four different soils seeded with Pseudomonas putida cells or B. globigii spores. In a New Mexico soil, seeded bacterial targets were detected with the same sensitivity as when assaying pure bacterial DNA (2 to 20 target gene copies in a PCR mixture). The detection limit of P. putida cells and B. globigii spores in different soils was affected by the amount of background DNA in the soil samples, the physical condition of the DNA, and the amount of DNA template used in the PCR. PMID:9647816

  16. Laboratory and field testing of an automated atmospheric particle-bound reactive oxygen species sampling-analysis system.

    PubMed

    Wang, Yungang; Hopke, Philip K; Sun, Liping; Chalupa, David C; Utell, Mark J

    2011-01-01

    In this study, various laboratory and field tests were performed to develop an effective automated particle-bound ROS sampling-analysis system. The system uses 2' 7'-dichlorofluorescin (DCFH) fluorescence method as a nonspecific, general indicator of the particle-bound ROS. A sharp-cut cyclone and a particle-into-liquid sampler (PILS) were used to collect PM(2.5) atmospheric particles into slurry produced by a DCFH-HRP solution. The laboratory results show that the DCFH and H(2)O(2) standard solutions could be kept at room temperature for at least three and eight days, respectively. The field test in Rochester, NY, shows that the average ROS concentration was 8.3 ± 2.2 nmol of equivalent H(2)O(2) m(-3) of air. The ROS concentrations were observed to be greater after foggy conditions. This study demonstrates the first practical automated sampling-analysis system to measure this ambient particle component.

  17. Laboratory and Field Testing of an Automated Atmospheric Particle-Bound Reactive Oxygen Species Sampling-Analysis System

    PubMed Central

    Wang, Yungang; Hopke, Philip K.; Sun, Liping; Chalupa, David C.; Utell, Mark J.

    2011-01-01

    In this study, various laboratory and field tests were performed to develop an effective automated particle-bound ROS sampling-analysis system. The system uses 2′ 7′-dichlorofluorescin (DCFH) fluorescence method as a nonspecific, general indicator of the particle-bound ROS. A sharp-cut cyclone and a particle-into-liquid sampler (PILS) were used to collect PM2.5 atmospheric particles into slurry produced by a DCFH-HRP solution. The laboratory results show that the DCFH and H2O2 standard solutions could be kept at room temperature for at least three and eight days, respectively. The field test in Rochester, NY, shows that the average ROS concentration was 8.3 ± 2.2 nmol of equivalent H2O2 m−3 of air. The ROS concentrations were observed to be greater after foggy conditions. This study demonstrates the first practical automated sampling-analysis system to measure this ambient particle component. PMID:21577270

  18. Sampling in the Snow: High School Winter Field Experiences Provide Relevant, Real World Connections Between Scientific Practices and Disciplinary Core Ideas

    NASA Astrophysics Data System (ADS)

    Hanson, E. W.; Burakowski, E. A.

    2014-12-01

    For much of the northern United States, the months surrounding the winter solstice are times of increased darkness, low temperatures, and frozen landscapes. It's a time when many high school science educators, who otherwise would venture outside with their classes, hunker down and are wary of the outdoors. However, a plethora of learning opportunities lies just beyond the classroom. Working collaboratively, a high school science teacher and a snow scientist have developed multiple activities to engage students in the scientific process of collecting, analyzing and interpreting the winter world using snow data to (1) learn about the insulative properties of snow, and (2) to learn about the role of snow cover on winter climate through its reflective properties while participating in a volunteer network that collects snow depth, albedo (reflectivity), and density data. These outdoor field-based snow investigations incorporate Next Generation Science Standards (NGSS) and disciplinary core ideas, including ESS2.C: The roles of water in Earth's surface processes and ESS2.D: Weather and Climate. Additionally, the lesson plans presented address Common Core State Standards (CCSS) in Mathematics, including the creation and analysis of bar graphs and time series plots (CCSS.Math.HSS-ID.A.1) and xy scatter plots (CCSS.Math.HSS-ID.B.6). High school students participating in the 2013/2014 snow sampling season described their outdoor learning experience as "authentic" and "hands-on" as compared to traditional class indoors. They emphasized that learning outdoors was essential to their understanding of underlying content and concepts because they "learn through actual experience."

  19. A novel capillary electrophoresis method with pressure assisted field amplified sample injection in determination of thiol collectors in flotation process waters.

    PubMed

    Sihvonen, T; Aaltonen, A; Leppinen, J; Hiltunen, S; Sirén, H

    2014-01-17

    A new capillary electrophoresis method was developed for the quantification of diisobutyldithiophosphate (DTP), diisobutyldithiophosphinate (DTPI) and ethyl and isobutyl xanthates (EX, IBX) all of which are used as thiol collectors in froth flotation. This method uses pressure assisted field amplified sample injection (PA-FASI) to concentrate the analytes at the capillary inlet. The background electrolyte in electrophoretic separation was 60millimolar (mM) from 3-(cyclohexylamino)propane-1-sulfonic acid (CAPS) in 40mM NaOH solution. The similar CAPS electrolyte solution has earlier been used for screening for diuretics that contained sulphonamide and/or carboxylic groups. In this study, the functional groups are xanthate, phosphate and phosphinate. The method was developed using actual flotation process waters. The results showed that the water delivered from the plant did not contain significant amount of collectors; therefore, method development was accomplished by spiking analytes in these waters. Separation of analytes was achieved in 15min. The range of quantification was 0.27-66.6mg/L (R(2) 0.9991-0.9999) for all analytes other than ethyl xanthate, for which the range was 0.09-66.6mg/L (R(2) 0.9999). LOD (S/N=3) and LOQ (S/N=10) values for DTP, DTPI, IBX and EX were 0.05, 0.07, 0.06 and 0.01mg/L and 0.16, 0.25, 0.21 and 0.04mg/L, respectively. No interference from the matrices was observed, when the method was tested at a gold concentrator plant.

  20. Nuclear Quadrupole Resonance (NQR) Method and Probe for Generating RF Magnetic Fields in Different Directions to Distinguish NQR from Acoustic Ringing Induced in a Sample

    DTIC Science & Technology

    1997-08-01

    77,719 TITLE OF THE INVENTION NUCLEAR QUADRUPOLE RESONANCE ( NQR ) METHOD AND PROBE FOR GENERATING RF MAGNETIC FIELDS IN DIFFERENT DIRECTIONS TO...DISTINGUISH NQR FROM ACOUSTIC RINGING INDUCED IN A SAMPLE BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a...nuclear quadrupole 15 resonance ( NQR ) method and probe for generating RF magnetic fields in different directions towards a sample. More specifically

  1. First Transmitted Hyperspectral Light Measurements and Cloud Properties from Recent Field Campaign Sampling Clouds Under Biomass Burning Aerosol

    NASA Technical Reports Server (NTRS)

    Leblanc, S.; Redemann, Jens; Shinozuka, Yohei; Flynn, Connor J.; Segal Rozenhaimer, Michal; Kacenelenbogen, Meloe Shenandoah; Pistone, Kristina Marie Myers; Schmidt, Sebastian; Cochrane, Sabrina

    2016-01-01

    We present a first view of data collected during a recent field campaign aimed at measuring biomass burning aerosol above clouds from airborne platforms. The NASA ObseRvations of CLouds above Aerosols and their intEractionS (ORACLES) field campaign recently concluded its first deployment sampling clouds and overlying aerosol layer from the airborne platform NASA P3. We present results from the Spectrometer for Sky-Scanning, Sun-Tracking Atmospheric Research (4STAR), in conjunction with the Solar Spectral Flux Radiometers (SSFR). During this deployment, 4STAR sampled transmitted solar light either via direct solar beam measurements and scattered light measurements, enabling the measurement of aerosol optical thickness and the retrieval of information on aerosol particles in addition to overlying cloud properties. We focus on the zenith-viewing scattered light measurements, which are used to retrieve cloud optical thickness, effective radius, and thermodynamic phase of clouds under a biomass burning layer. The biomass burning aerosol layer present above the clouds is the cause of potential bias in retrieved cloud optical depth and effective radius from satellites. We contrast the typical reflection based approach used by satellites to the transmission based approach used by 4STAR during ORACLES for retrieving cloud properties. It is suspected that these differing approaches will yield a change in retrieved properties since light transmitted through clouds is sensitive to a different cloud volume than reflected light at cloud top. We offer a preliminary view of the implications of these differences in sampling volumes to the calculation of cloud radiative effects (CRE).

  2. Sediment and radionuclide transport in rivers. Phase 2. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-04-01

    As part of a study on sediment and radionuclide transport in rivers, Pacific Northwest Laboratory (PNL) is investigating the effect of sediment on the transport of radionuclides in Cattaraugus and Buttermilk Creeks, New York. A source of radioactivity in these creeks is the Western New York Nuclear Service Center which consists of a low-level waste disposal site and a nuclear fuel reprocessing plant. Other sources of radioactivity include fallout from worldwide weapons testing and natural background radioactivity. The major objective of the PNL Field Sampling Program is to provide data on sediment and radionuclide characteristics in Cattaraugus and Buttermilk Creeks to verify the use of the Sediment and Radionuclide Transport model, SERATRA, for nontidal rivers. This report covers the results of field data collection conducted during September 1978. Radiological analysis of sand, silt, and clay size fractions of suspended and bed sediment, and water were performed. Results of these analyses indicate that the principal radionuclides occurring in these two water courses, with levels significantly higher than background levels, during the Phase 2 sampling program were Cesium-137 and Strontium-90. These radionuclides had significantly higher activity levels above background in the bed sediment, suspended sediment, and water samples. Other radionuclides that are possibly being released into the surface water environment by the Nuclear Fuel Services facilities are Plutonium-238, 239, and 240, Americium-241, Curium-244, and Tritium. More radionuclides were consistently found in the bed sediment as compared to suspended sediment. The fewest radionuclides were found in the water of Buttermilk and Cattaraugus Creeks. The higher levels were found in the bed sediments for the gamma-emitters and in the suspended sediment for the alpha and beta-emitters (not including Tritium).

  3. The psychometric properties of the personality inventory for DSM-5 in an APA DSM-5 field trial sample.

    PubMed

    Quilty, Lena C; Ayearst, Lindsay; Chmielewski, Michael; Pollock, Bruce G; Bagby, R Michael

    2013-06-01

    Section 3 of the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) includes a hybrid model of personality pathology, in which dimensional personality traits are used to derive one of seven categorical personality disorder diagnoses. The Personality Inventory for DSM-5 (PID-5) was developed by the DSM-5 Personality and Personality Disorders workgroup and their consultants to produce a freely available instrument to assess the personality traits within this new system. To date, the psychometric properties of the PID-5 have been evaluated primarily in undergraduate student and community adult samples. In the current investigation, we extend this line of research to a psychiatric patient sample who participated in the APA DSM-5 Field Trial (Centre for Addiction and Mental Health site). A total of 201 psychiatric patients (102 men, 99 women) completed the PID-5 and the Revised NEO Personality Inventory (NEO PI-R). The internal consistencies of the PID-5 domain and facet trait scales were acceptable. Results supported the unidimensional structure of all trait scales but one, and the convergence between the PID-5 and analogous NEO PI-R scales. Evidence for discriminant validity was mixed. Overall, the current investigation provides support for the psychometric properties of this diagnostic instrument in psychiatric samples.

  4. Preliminary Evaluation of the Field and Laboratory Emission Cell (FLEC) for Sampling Attribution Signatures from Building Materials

    SciTech Connect

    Harvey, Scott D.; He, Lijian; Wahl, Jon H.

    2012-08-30

    This study provides a preliminary evaluation of the Field and Laboratory Emission Cell (FLEC) for its suitability for sampling building materials for toxic compounds and their associated impurities and residues that might remain after a terrorist chemical attack. Chemical warfare (CW) agents and toxic industrial chemicals were represented by a range of test probes that included CW surrogates. The test probes encompassed the acid-base properties, volatilities, and polarities of the expected chemical agents and residual compounds. Results indicated that dissipation of the test probes depended heavily on the underlying material. Near complete dissipation of almost all test probes occurred from galvanized stainless steel within 3.0 hrs, whereas far stronger retention with concomitant slower release was observed for vinyl composition floor tiles. The test probes displayed immediated permanence on Teflon. FLEC sampling was further evaluated by profiling residues remaining after the evaporation of 2-chloroethyl ethyl sulfide, a sulfur mustard simulant. This study lays the groundwork for the eventual goal of applying this sampling approach for collection of forensic attribution signatures that remain after a terrorist chemical attack.

  5. Sensitive determination of sertraline by capillary electrophoresis with dispersive liquid-liquid microextraction and field-amplified sample stacking.

    PubMed

    Huang, Shiou-Wen; Hsieh, Ming-Mu; Chang, Sarah Y

    2012-11-15

    A novel method for the determination of sertraline using dispersive liquid-liquid microextraction (DLLME) coupled with capillary electrophoresis (CE) was developed. Acetone and dichloromethane were used as the disperser solvent and extraction solvent, respectively. A mixture of the extraction and disperser solvents was rapidly injected into a 1.0 mL aqueous sample to form a cloudy solution. After the extraction, sertraline was analyzed using CE that was equipped with UV detection. A 74-fold improvement in the sensitivity was observed when DLLME was used to extract sertraline. Since the DLLME extract residue was redissolved with 5 μL of water that contained 20% methanol, the detection sensitivity was further enhanced through the use of field-amplified sample stacking (FASS). A 11-fold improvement in the sensitivity was obtained when FASS was used to on-line concentrate sertraline. Under optimal extraction and stacking conditions, the calibration curve, which ranged from 0.01 to 1 μM was observed to be linear. The limit of detection (LOD) at a signal-to-noise ratio of 3 was 2.5 nM for sertraline. An approximately 814-fold improvement in the sensitivity was observed for sertraline compare with injection of standard solution without the DLLME and FASS procedures. This developed method was successfully applied to the determination of sertraline in human urine samples.

  6. Physical properties of two core samples from Well 34-9RD2 at the Coso geothermal field, California

    USGS Publications Warehouse

    Morrow, C.A.; Lockner, D.A.

    2006-01-01

    The Coso geothermal field, located along the Eastern California Shear Zone, is composed of fractured granitic rocks above a shallow heat source. Temperatures exceed 640 ?F (~338 ?C) at a depth of less than 10000 feet (3 km). Permeability varies throughout the geothermal field due to the competing processes of alteration and mineral precipitation, acting to reduce the interconnectivity of faults and fractures, and the generation of new fractures through faulting and brecciation. Currently, several hot regions display very low permeability, not conducive to the efficient extraction of heat. Because high rates of seismicity in the field indicate that the area is highly stressed, enhanced permeability can be stimulated by increasing the fluid pressure at depth to induce faulting along the existing network of fractures. Such an Enhanced Geothermal System (EGS), planned for well 46A-19RD, would greatly facilitate the extraction of geothermal fluids from depth by increasing the extent and depth of the fracture network. In order to prepare for and interpret data from such a stimulation experiment, the physical properties and failure behavior of the target rocks must be fully understood. Various diorites and granodiorites are the predominant rock types in the target area of the well, which will be pressurized from 10000 feet measured depth (MD) (3048m MD) to the bottom of the well at 13,000 feet MD (3962 m MD). Because there are no core rocks currently available from well 46A-19RD, we report here on the results of compressive strength, frictional sliding behavior, and elastic measurements of a granodiorite and diorite from another well, 34-9RD2, at the Coso site. Rocks cored from well 34-9RD2 are the deepest samples to date available for testing, and are representative of rocks from the field in general.

  7. Integrating silicon nanowire field effect transistor, microfluidics and air sampling techniques for real-time monitoring biological aerosols.

    PubMed

    Shen, Fangxia; Tan, Miaomiao; Wang, Zhenxing; Yao, Maosheng; Xu, Zhenqiang; Wu, Yan; Wang, Jindong; Guo, Xuefeng; Zhu, Tong

    2011-09-01

    Numerous threats from biological aerosol exposures, such as those from H1N1 influenza, SARS, bird flu, and bioterrorism activities necessitate the development of a real-time bioaerosol sensing system, which however is a long-standing challenge in the field. Here, we developed a real-time monitoring system for airborne influenza H3N2 viruses by integrating electronically addressable silicon nanowire (SiNW) sensor devices, microfluidics and bioaerosol-to-hydrosol air sampling techniques. When airborne influenza H3N2 virus samples were collected and delivered to antibody-modified SiNW devices, discrete nanowire conductance changes were observed within seconds. In contrast, the conductance levels remained relatively unchanged when indoor air or clean air samples were delivered. A 10-fold increase in virus concentration was found to give rise to about 20-30% increase in the sensor response. The selectivity of the sensing device was successfully demonstrated using H1N1 viruses and house dust allergens. From the simulated aerosol release to the detection, we observed a time scale of 1-2 min. Quantitative polymerase chain reaction (qPCR) tests revealed that higher virus concentrations in the air samples generally corresponded to higher conductance levels in the SiNW devices. In addition, the display of detection data on remote platforms such as cell phone and computer was also successfully demonstrated with a wireless module. The work here is expected to lead to innovative methods for biological aerosol monitoring, and further improvements in each of the integrated elements could extend the system to real world applications.

  8. Isolation of Legionella species from Noyu (unattended natural hot springs in mountains and fields) samples in Japan.

    PubMed

    Furuhata, Katsunori; Edagawa, Akiko; Ishizaki, Naoto; Fukuyama, Masafumi

    2013-01-01

    In order to understand the habitation conditions of the bacteria of the genus Legionella in Noyu (unattended natural hot springs in mountains and fields) in Japan, isolation of Legionella spp. was attempted in the Noyu samples from 11 prefectures nationwide between May and September 2012, and the following results were obtained. Overall, Legionella spp. was isolated from 16 of 43 samples (37.2%). The species was isolated from the Hokkaido region to the Chugoku region but not from the Shikoku region to the Kyushu region. The number of bacteria detected was usually small, less than 5.0 × 10(1) CFU/100 ml, as found in 11 samples (68.8%), while counts of 10(2) or more to 10(3) or less CFU/100 ml were found in two samples (12.5%). Legionella pneumophila was the most commonly found strain, with 19 strains (90.5%) found, and was the dominant species. Regarding the serogrouping, four strains (21.1%) fell under group 1, the most common grouping, followed by three strains (15.8%) in group 3, two strains (10.5%) in group 5, etc. Moreover, the detected bacterial strains other than L. pneumophila included two strains (9.5%) of L. londiniensis. The temperature of the Noyu from which Legionella spp. was isolated was between 33.1°C and 41.5°C with a pH ranging from 5.2 to 8.1. The present report is the first report to clarify the habitation conditions of strains of Legionella spp. isolated from Noyu in Japan.

  9. A Sample of Very Young Field L Dwarfs and Implications for the Brown Dwarf "Lithium Test" at Early Ages

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, J. Davy; Cruz, Kelle L.; Barman, Travis S.; Burgasser, Adam J.; Looper, Dagny L.; Tinney, C. G.; Gelino, Christopher R.; Lowrance, Patrick J.; Liebert, James; Carpenter, John M.; Hillenbrand, Lynne A.; Stauffer, John R.

    2008-12-01

    Using a large sample of optical spectra of late-type dwarfs, we identify a subset of late-M through L field dwarfs that, because of the presence of low-gravity features in their spectra, are believed to be unusually young. From a combined sample of 303 field L dwarfs, we find observationally that 7.6% +/- 1.6% are younger than 100 Myr. This percentage is in agreement with theoretical predictions once observing biases are taken into account. We find that these young L dwarfs tend to fall in the southern hemisphere (decl . < 0°) and may be previously unrecognized, low-mass members of nearby, young associations like Tucana-Horologium, TW Hydrae, β Pictoris, and AB Doradus. We use a homogeneously observed sample of ~150 optical spectra to examine lithium strength as a function of L/T spectral type and further corroborate the trends noted by Kirkpatrick and coworkers. We use our low-gravity spectra to investigate lithium strength as a function of age. The data weakly suggest that for early- to mid-L dwarfs the line strength reaches a maximum for a few × 100 Myr, whereas for much older (few Gyr) and much younger (<100 Myr) L dwarfs the line is weaker or undetectable. We show that a weakening of lithium at lower gravities is predicted by model atmosphere calculations, an effect partially corroborated by existing observational data. Larger samples containing L dwarfs of well-determined ages are needed to further test this empirically. If verified, this result would reinforce the caveat first cited by Kirkpatrick and coworkers that the lithium test should be used with caution when attempting to confirm the substellar nature of the youngest brown dwarfs. Most of the spectroscopic data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous

  10. Persistent Organic Pollutant Determination in Killer Whale Scat Samples: Optimization of a Gas Chromatography/Mass Spectrometry Method and Application to Field Samples.

    PubMed

    Lundin, Jessica I; Dills, Russell L; Ylitalo, Gina M; Hanson, M Bradley; Emmons, Candice K; Schorr, Gregory S; Ahmad, Jacqui; Hempelmann, Jennifer A; Parsons, Kim M; Wasser, Samuel K

    2016-01-01

    Biologic sample collection in wild cetacean populations is challenging. Most information on toxicant levels is obtained from blubber biopsy samples; however, sample collection is invasive and strictly regulated under permit, thus limiting sample numbers. Methods are needed to monitor toxicant levels that increase temporal and repeat sampling of individuals for population health and recovery models. The objective of this study was to optimize measuring trace levels (parts per billion) of persistent organic pollutants (POPs), namely polychlorinated-biphenyls (PCBs), polybrominated-diphenyl-ethers (PBDEs), dichlorodiphenyltrichloroethanes (DDTs), and hexachlorocyclobenzene, in killer whale scat (fecal) samples. Archival scat samples, initially collected, lyophilized, and extracted with 70 % ethanol for hormone analyses, were used to analyze POP concentrations. The residual pellet was extracted and analyzed using gas chromatography coupled with mass spectrometry. Method detection limits ranged from 11 to 125 ng/g dry weight. The described method is suitable for p,p'-DDE, PCBs-138, 153, 180, and 187, and PBDEs-47 and 100; other POPs were below the limit of detection. We applied this method to 126 scat samples collected from Southern Resident killer whales. Scat samples from 22 adult whales also had known POP concentrations in blubber and demonstrated significant correlations (p < 0.01) between matrices across target analytes. Overall, the scat toxicant measures matched previously reported patterns from blubber samples of decreased levels in reproductive-age females and a decreased p,p'-DDE/∑PCB ratio in J-pod. Measuring toxicants in scat samples provides an unprecedented opportunity to noninvasively evaluate contaminant levels in wild cetacean populations; these data have the prospect to provide meaningful information for vital management decisions.

  11. Determination of alkaloids in Sinomenium acutum by field-amplified sample stacking in capillary electrophoresis with chemiluminescene detection.

    PubMed

    Shi, Guiying; Li, Jiang; Yin, Yingchun; Xu, Xueqin; Chen, Guonan

    2013-01-01

    A simple and rapid capillary electrophoresis (CE) with an acidic potassium permanganate chemiluminescence (CL) detection method was developed to determine three alkaloids (curine, sinomenine and magnoflorine) simultaneously. A laboratory-built CE-CL detection interface was used. The field-amplified sample stacking technique was applied to the online concentration of alkaloids. Experimental conditions for CE separation and CL detection were investigated in detail to acquire optimum conditions. Under optimal conditions, the three alkaloids were baseline separated within 6 min, and the detection limits (S/N = 3) ranged from 0.03 µg/mL to 0.49 µg/mL. This method was successfully applied to determine the above three alkaloids in Sinomenium acutum, and the result of the determination of sinomenine was in good agreement with those given by high-performance liquid chromatography and CE methods. In addition, a possible CL reaction mechanism of sinomenine-KMnO4-H2SO4 was proposed.

  12. Advantages of a Synchrotron Bending Magnet as the Sample Illuminator for a Wide-field X-ray Microscope

    SciTech Connect

    Feser, M.; Howells, M. R.; Kirz, J.; Rudati, J.; Yun, W.

    2012-09-01

    In our paper the choice between bending magnets and insertion devices as sample illuminators for a hard X-ray full-field microscope is investigated. An optimized bending-magnet beamline design is presented. Its imaging speed is very competitive with the performance of similar microscopes installed currently at insertion-device beamlines. The fact that imaging X-ray microscopes can accept a large phase space makes them very well suited to the output characteristics of bending magnets which are often a plentiful and paid-for resource. There exist opportunities at all synchrotron light sources to take advantage of this finding to build bending-magnet beamlines that are dedicated to transmission X-ray microscope facilities. We expect that demand for such facilities will increase as three-dimensional tomography becomes routine and advanced techniques such as mosaic tomography and XANES tomography (taking three-dimensional tomograms at different energies to highlight elemental and chemical differences) become more widespread.

  13. Capillary electrophoresis with field-amplified sample stacking for rapid and sensitive determination of sulfadiazine and sulfamethoxazole.

    PubMed

    Li, Yuqin; Cui, Yingjie; Jia, Baoxiu; Wang, Hao; Liu, Caihong; Qi, Yongxiu

    2012-09-01

    A new capillary electrophoresis method with field-amplified sample stacking (FASS) was developed for the analysis of sulfadiazine and sulfamethoxazole. After optimization of the separation and concentration conditions, the two compounds can be separated within 7 min and quantified with high sensitivity, with detection limits of 0.48 ng/mL for sulfadiazine and 0.76 ng/mL for sulfamethoxazole. This resulted in a 300-1500-fold improvement in concentration sensitivity relative to conventional capillary electrophoresis methods. The method was useful for qualitative and quantitative analysis of sulfadiazine and sulfamethoxazole in their preparations with recovery of 99.0%-102% for sulfadiazine and 99.5% - 99.7% for sulfamethoxazole.

  14. Precise Strong Lensing Mass Modeling of Four Hubble Frontier Field Clusters and a Sample of Magnified High-redshift Galaxies

    NASA Astrophysics Data System (ADS)

    Kawamata, Ryota; Oguri, Masamune; Ishigaki, Masafumi; Shimasaku, Kazuhiro; Ouchi, Masami

    2016-03-01

    We conduct precise strong lensing mass modeling of four Hubble Frontier Field (HFF) clusters, Abell 2744, MACS J0416.1-2403, MACS J0717.5+3745, and MACS J1149.6+2223, for which HFF imaging observations are completed. We construct a refined sample of more than 100 multiple images for each cluster by taking advantage of the full-depth HFF images, and conduct mass modeling using the glafic software, which assumes simply parametrized mass distributions. Our mass modeling also exploits a magnification constraint from the lensed SN Ia HFF14Tom for Abell 2744 and positional constraints from the multiple images S1-S4 of the lensed supernova SN Refsdal for MACS J1149.6+2223. We find that our best-fitting mass models reproduce the observed image positions with rms errors of ˜0.″4, which are smaller than rms errors in previous mass modeling that adopted similar numbers of multiple images. Our model predicts a new image of SN Refsdal with a relative time delay and magnification that are fully consistent with a recent detection of reappearance. We then construct catalogs of z ˜ 6-9 dropout galaxies behind the four clusters and estimate magnification factors for these dropout galaxies with our best-fitting mass models. The dropout sample from the four cluster fields contains ˜120 galaxies at z ≳ 6, about 20 of which are predicted to be magnified by a factor of more than 10. Some of the high-redshift galaxies detected in the HFF have lensing-corrected magnitudes of MUV ˜ -15 to -14. Our analysis demonstrates that the HFF data indeed offer an ideal opportunity to study faint high-redshift galaxies. All lensing maps produced from our mass modeling will be made available on the Space Telescope Science Institute website (https://archive.stsci.edu/prepds/frontier/lensmodels/).

  15. The 2-degree Field Lensing Survey: photometric redshifts from a large new training sample to r < 19.5

    NASA Astrophysics Data System (ADS)

    Wolf, C.; Johnson, A. S.; Bilicki, M.; Blake, C.; Amon, A.; Erben, T.; Glazebrook, K.; Heymans, C.; Hildebrandt, H.; Joudaki, S.; Klaes, D.; Kuijken, K.; Lidman, C.; Marin, F.; Parkinson, D.; Poole, G.

    2017-04-01

    We present a new training set for estimating empirical photometric redshifts of galaxies, which was created as part of the 2-degree Field Lensing Survey project. This training set is located in a ∼700 deg2 area of the Kilo-Degree-Survey South field and is randomly selected and nearly complete at r < 19.5. We investigate the photometric redshift performance obtained with ugriz photometry from VST-ATLAS and W1/W2 from WISE, based on several empirical and template methods. The best redshift errors are obtained with kernel-density estimation (KDE), as are the lowest biases, which are consistent with zero within statistical noise. The 68th percentiles of the redshift scatter for magnitude-limited samples at r < (15.5, 17.5, 19.5) are (0.014, 0.017, 0.028). In this magnitude range, there are no known ambiguities in the colour-redshift map, consistent with a small rate of redshift outliers. In the fainter regime, the KDE method produces p(z) estimates per galaxy that represent unbiased and accurate redshift frequency expectations. The p(z) sum over any subsample is consistent with the true redshift frequency plus Poisson noise. Further improvements in redshift precision at r < 20 would mostly be expected from filter sets with narrower passbands to increase the sensitivity of colours to small changes in redshift.

  16. The effects of composition, temperature and sample size on the sintering of chem-prep high field varistors.

    SciTech Connect

    Garino, Terry J.

    2007-09-01

    The sintering behavior of Sandia chem-prep high field varistor materials was studied using techniques including in situ shrinkage measurements, optical and scanning electron microscopy and x-ray diffraction. A thorough literature review of phase behavior, sintering and microstructure in Bi{sub 2}O{sub 3}-ZnO varistor systems is included. The effects of Bi{sub 2}O{sub 3} content (from 0.25 to 0.56 mol%) and of sodium doping level (0 to 600 ppm) on the isothermal densification kinetics was determined between 650 and 825 C. At {ge} 750 C samples with {ge}0.41 mol% Bi{sub 2}O{sub 3} have very similar densification kinetics, whereas samples with {le}0.33 mol% begin to densify only after a period of hours at low temperatures. The effect of the sodium content was greatest at {approx}700 C for standard 0.56 mol% Bi{sub 2}O{sub 3} and was greater in samples with 0.30 mol% Bi{sub 2}O{sub 3} than for those with 0.56 mol%. Sintering experiments on samples of differing size and shape found that densification decreases and mass loss increases with increasing surface area to volume ratio. However, these two effects have different causes: the enhancement in densification as samples increase in size appears to be caused by a low oxygen internal atmosphere that develops whereas the mass loss is due to the evaporation of bismuth oxide. In situ XRD experiments showed that the bismuth is initially present as an oxycarbonate that transforms to metastable {beta}-Bi{sub 2}O{sub 3} by 400 C. At {approx}650 C, coincident with the onset of densification, the cubic binary phase, Bi{sub 38}ZnO{sub 58} forms and remains stable to >800 C, indicating that a eutectic liquid does not form during normal varistor sintering ({approx}730 C). Finally, the formation and morphology of bismuth oxide phase regions that form on the varistors surfaces during slow cooling were studied.

  17. Simultaneous Separation of Eight Benzodiazepines in Human Urine Using Field-Amplified Sample Stacking Micellar Electrokinetic Chromatography.

    PubMed

    Oledzka, Ilona; Kulińska, Zofia; Prahl, Adam; Baczek, Tomasz

    2015-01-01

    A novel approach for the simultaneous quantification of eight benzodiazepines (BZDs) using dispersive liquid-liquid microextraction (DLLME) and field-amplified sample stacking (FASS) combined with micellar electrokinetic chromatography (MEKC) was investigated and evaluated in the context of precision, accuracy, sensitivity, linearity, detection and limits of quantification (LOQ). The absolute recovery rates of BZDs were above 90.65%. The limits of detection (LOD) were 20 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 30 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam, while the LOQ was set at 50 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 100 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam. Linearity was confirmed in the range of 50-2,000 ng/mL for chlordiazepoxide, estazolam, temazepam and midazolam, and 100-2,000 ng/mL for clonazepam, lorazepam, lormetazepam and medazepam, with a correlation coefficient greater than 0.9987 for all analytes. The elaborated procedure meets all the requirements of analytical methods. During the extraction procedure, a mixture of 1 mL of ethanol and 500 µL of dichloromethane, used as the disperser and extraction solvent, respectively, was rapidly injected into 3 mL of a urine sample. A significant improvement in sensitivity was achieved when DLLME was used to extract BZDs from the urine sample and FASS as an on-line preconcentration technique was developed. For the best separation of analytes, the running buffer was composed of 30 mM SDS, 10 mM sodium tetraborate and 15% methanol (pH 8.8), whereas a sample buffer was composed of 10 mM SDS and 2 mM sodium tetraborate. Moreover, a fused-silica capillary [inner diameter (i.d.) of 75 µm and length of 50 cm], photodiode array detection, pneumatic injection for 15 s and a voltage of 23 kV were applied. The applicability of the method has been confirmed for the analysis of BZD in urine samples collected from patients who

  18. Field-amplified sample injection in capillary electrophoresis with amperometric detection for the ultratrace analysis of diastereomeric ephedrine alkaloids.

    PubMed

    Chen, Xiaoyan; Tang, Yanxia; Wang, Shaoyun; Song, Yunping; Tang, Fengxiang; Wu, Xiaoping

    2015-08-01

    A coupling method of field-amplified sample injection (FASI) CE with amperometric detection is developed for ultratrace analysis of ephedrine alkaloids stereoisomers. FASI was introduced by injecting electrokinetically the sample solution for 10 s into the capillary filled with highly conductive background electrolyte (BGE). The diastereomeric selectivity and the detection sensitivity were improved by using borate buffer of high ionic strength as BGE. Parameters affecting FASI and CE separation were investigated to achieve the optimal conditions. Four analytes were separated within 15 min using 200 mmol/L borate buffer (pH 9.5) and separation voltage of +18 kV, with detection potential at +1.0 V (vs. Ag/AgCl) and carbon disc electrode as working electrode. Excellent linearity was observed between peak current and concentration of analytes in the range of 0.1-100 ng/mL. The LODs (S/N = 3) for (-)-ephedrine, (+)-pseudoephedrine, (-)-N-methylephedrine and (+)-N-methylpseudoephedrine were 39.3, 54.9, 30.8, and 44.1 pg/mL, respectively. The proposed method was successfully applied to the determination of alkaloids in Ephedra sinica, with results agreed well with HPLC method. Mean recoveries of 102.1-109.7% and RSDs less than 6% were found. And the merits of high sensitivity and selectivity, as well as a simple and stable operation, have been demonstrated.

  19. Versatile pulsed laser setup for depth profiling analysis of multilayered samples in the field of cultural heritage

    NASA Astrophysics Data System (ADS)

    Mendes, N. F. C.; Osticioli, I.; Striova, J.; Sansonetti, A.; Becucci, M.; Castellucci, E.

    2009-04-01

    The present study considers the use of a nanosecond pulsed laser setup capable of performing laser induced breakdown spectroscopy (LIBS) and pulsed Raman spectroscopy for the study of multilayered objects in the field of cultural heritage. Controlled etching using the 4th harmonic 266 nm emission of a Nd:YAG laser source with a 8 ns pulse duration was performed on organic films and mineral strata meant to simulate different sequence of layers usually found in art objects such as in easel and mural paintings. The process of micro ablation coupled with powerful spectroscopic techniques operating with the same laser source, constitutes an interesting alternative to mechanical sampling especially when dealing with artworks such as ceramics and metal works which are problematic due to their hardness and brittleness. Another case is that of valuable pieces where sampling is not an option and the materials to analyse lie behind the surface. The capabilities and limitations of such instrumentation were assessed through several tests in order to characterize the trend of the laser ablation on different materials. Monitored ablation was performed on commercial sheets of polyethylene terephthalate (PET), a standard material of known thickness and mechanical stability, and rabbit glue, an adhesive often used in works of art. Measurements were finally carried out on a specimen with a stratigraphy similar to those found in real mural paintings.

  20. Field-amplified sample stacking capillary electrophoresis with electrochemiluminescence applied to the determination of illicit drugs on banknotes.

    PubMed

    Xu, Yuanhong; Gao, Ying; Wei, Hui; Du, Yan; Wang, Erkang

    2006-05-19

    Capillary electrophoresis (CE) with Ru(bpy)3(2+) electrochemiluminescence (ECL) detection system was established to the determination of contamination of banknotes with controlled drugs and a high efficiency on-column field-amplified sample stacking (FASS) technique was also optimized to increase the ECL intensity. The method was illustrated using heroin and cocaine, which are two typical and popular illicit drugs. Highest sample stacking was obtained when 0.01 mM acetic acid was chosen for sample dissolution with electrokinetical injection for 6 s at 17 kV. Under the optimized conditions: ECL detection at 1.2 V, separation voltage 10.0 kV, 20 mM phosphate-acetate (pH 7.2) as running buffer, 5 mM Ru(bpy)3(2+) with 50 mM phosphate-acetate (pH 7.2) in the detection cell, the standard curves were linear in the range of 7.50x10(-8) to 1.00x10(-5) M for heroin and 2.50x10(-7) to 1.00x10(-4) M for cocaine and detection limits of 50 nM for heroin and 60 nM for cocaine were achieved (S/N = 3), respectively. Relative standard derivations of the ECL intensity and the migration time were 3.50 and 0.51% for heroin and 4.44 and 0.12% for cocaine, respectively. The developed method was successfully applied to the determination of heroin and cocaine on illicit drug contaminated banknotes without any damage of the paper currency. A baseline resolution for heroin and cocaine was achieved within 6 min.

  1. A Quantitative Approach for Collocating NEON's Sensor-Based Ecological Measurements and in-situ Field Sampling and Observations

    NASA Astrophysics Data System (ADS)

    Zulueta, R. C.; Metzger, S.; Ayres, E.; Luo, H.; Meier, C. L.; Barnett, D.; Sanclements, M.; Elmendorf, S.

    2013-12-01

    The National Ecological Observatory Network (NEON) is a continental-scale research platform currently in development to assess the causes of ecological change and biological responses to change across a projected 30-year timeframe. A suite of standardized sensor-based measurements (i.e., Terrestrial Instrument System (TIS) measurements) and in-situ field sampling and observations (i.e., Terrestrial Observation System (TOS) activities) will be conducted across 20 ecoclimatic domains in the U.S. where NEON is establishing 60 terrestrial research sites. NEON's TIS measurements and TOS activities are designed to observe the temporal and spatial dynamics of key drivers and ecological processes and responses to change within each of the 60 terrestrial research sites. The TIS measurements are non-destructive and designed to provide in-situ, continuous, and areally integrated observations of the surrounding ecosystem and environment, while TOS sampling and observation activities are designed to encompass a hierarchy of measurable biological states and processes including diversity, abundance, phenology, demography, infectious disease prevalence, ecohydrology, and biogeochemistry. To establish valid relationships between these drivers and site-specific responses, two contradicting requirements must be fulfilled: (i) both types of observations shall be representative of the same ecosystem, and (ii) they shall not significantly influence one another. Here we outline the theoretical background and algorithmic process for determining areas of mutual representativeness and exclusion around NEON's TIS measurements and develop a procedure which quantitatively optimizes this trade-off through: (i) quantifying the source area distributions of TIS measurements, (ii) determining the ratio of user-defined impact threshold to effective impact area for different TOS activities, and (iii) determining the range of feasible distances between TIS locations and TOS activities. This approach

  2. Sampling and Analysis Plan for Ground-Water Monitoring of Wells Near the Metropolitan Utilities District’s Platte River West Well Field Near Wann, Nebraska: Part I, Field Sampling Plan and Part II, Quality Assurance Project Plan

    DTIC Science & Technology

    2005-01-01

    Sample documentation, such as bottle lot numbers as received from supplier; • Sample transportation information, including the name of the...stabilization is achieved; • Sample preservation procedures, including the HCL lot numbers ; and • For QC blank samples, the manufacturer’s lot numbers of the...obtain from OWQRL for Hach acid cartridges of certain lot numbers — default value is 1.00) Vs = volume of sample, in milliliters For samples with pH

  3. Vent 7504 of the San Francisco Volcanic Field (SFVF), Arizona: Sample Geochemistry and Implications for Cone Formation

    NASA Astrophysics Data System (ADS)

    Needham, D. H.; Eppler, D. B.; Bleacher, J. E.; Skinner, J. A.; Evans, C. A.; Feng, W.; Gruener, J. E.; Whitson, P. A.; Janoiko, B. A.; Mertzman, S. A.

    2015-12-01

    Vent 7504 is a complex structure in the SFVF that has 3 unit classes: a central cone with exposed dikes and cinder-covered rheomorphic facies; a SE/NW-trending ridge north of the cone with cinder-covered rheomorphic facies; and three discrete lava flows that emanate to the N from the ridge and to the SW and NW from the cone. Field observations suggest the ridge was the northern crest of an initial, larger cone. The NW portion of this cone was most likely disrupted during a catastrophic breach of lava that had accumulated within the cone; this third of three lava flows carried rafted packages of the rheomorphic cone facies to the NW, forming the linear N ridge. The final phase of pyroclastic activity was concentrated in the SW portion of the original cone, covering the top of the cone with cinders and forming the more traditional conic-shaped construct observed today. This study describes the geochemistry of 9 samples collected from the mapped units (2 from the cone, 1 from the N ridge, 1 from the N lava flow, 2 from the SW lava flow, and 3 from the NW lava flow) to further constrain the formation of Vent 7504. Geochemical analyses including back-scatter electron scanning electron microscopy and laboratory X-ray fluorescence spectroscopy were conducted on the 9 collected samples to measure bulk rock and olivine phenocryst compositions. Major element concentrations in the bulk rock and olivine compositions are strongly clustered in all samples, indicating they likely originated from a single magmatic source. Bulk rock SiO2 (~47.5 wt%) and alkali (Na2O + K2O, ~2.7 wt% + 0.71 wt%) concentrations are consistent with a basaltic classification for these samples. Trends in major elements relative to MgO are observed for the olivine phenocrysts: SiO2, Al2O3, Na2O, and TiO2 remain constant relative to MgO, but strong linear trends are observed in MnO, FeO, and NiO relative to MgO. These linear trends are expected given the potential for bivalent cation exchanges in the

  4. Investigation of differences between field and laboratory pH measurements of national atmospheric deposition program/national trends network precipitation samples

    USGS Publications Warehouse

    Latysh, N.; Gordon, J.

    2004-01-01

    A study was undertaken to investigate differences between laboratory and field pH measurements for precipitation samples collected from 135 weekly precipitation-monitoring sites in the National Trends Network from 12/30/1986 to 12/28/1999. Differences in pH between field and laboratory measurements occurred for 96% of samples collected during this time period. Differences between the two measurements were evaluated for precipitation samples collected before and after January 1994, when modifications to sample-handling protocol and elimination of the contaminating bucket o-ring used in sample shipment occurred. Median hydrogen-ion and pH differences between field and laboratory measurements declined from 3.9 ??eq L-1 or 0.10 pH units before the 1994 protocol change to 1.4 ??eq L-1 or 0.04 pH units after the 1994 protocol change. Hydrogen-ion differences between field and laboratory measurements had a high correlation with the sample pH determined in the field. The largest pH differences between the two measurements occurred for high-pH samples (>5.6), typical of precipitation collected in Western United States; however low- pH samples (<5.0) displayed the highest variability in hydrogen-ion differences between field and laboratory analyses. Properly screened field pH measurements are a useful alternative to laboratory pH values for trend analysis, particularly before 1994 when laboratory pH values were influenced by sample-collection equipment.

  5. Dependence of B1+ and B1− Field Patterns of Surface Coils on the Electrical Properties of the Sample and the MR Operating Frequency

    PubMed Central

    Vaidya, Manushka V.; Collins, Christopher M.; Sodickson, Daniel K.; Brown, Ryan; Wiggins, Graham C.; Lattanzi, Riccardo

    2016-01-01

    In high field MRI, the spatial distribution of the radiofrequency magnetic (B1) field is usually affected by the presence of the sample. For hardware design and to aid interpretation of experimental results, it is important both to anticipate and to accurately simulate the behavior of these fields. Fields generated by a radiofrequency surface coil were simulated using dyadic Green’s functions, or experimentally measured over a range of frequencies inside an object whose electrical properties were varied to illustrate a variety of transmit (B1+) and receive (B1−) field patterns. In this work, we examine how changes in polarization of the field and interference of propagating waves in an object can affect the B1 spatial distribution. Results are explained conceptually using Maxwell’s equations and intuitive illustrations. We demonstrate that the electrical conductivity alters the spatial distribution of distinct polarized components of the field, causing “twisted” transmit and receive field patterns, and asymmetries between |B1+| and |B1−|. Additionally, interference patterns due to wavelength effects are observed at high field in samples with high relative permittivity and near-zero conductivity, but are not present in lossy samples due to the attenuation of propagating EM fields. This work provides a conceptual framework for understanding B1 spatial distributions for surface coils and can provide guidance for RF engineers. PMID:27795697

  6. Nonuniform sampling techniques for antenna applications

    NASA Technical Reports Server (NTRS)

    Rahmat-Samii, Yahya; Cheung, Rudolf Lap-Tung

    1987-01-01

    A two-dimensional sampling technique, which can employ irregularly spaced samples (amplitude and phase) in order to generate the complete far-field patterns is presented. The technique implements a matrix inversion algorithm, which depends only on the nonuniform sampled data point locations and with no dependence on the actual field values at these points. A powerful simulation algorithm is presented to allow a real-life simulation of many reflector/feed configurations and to determine the usefulness of the nonuniform sampling technique for the copolar and cross-polar patterns. Additionally, an overlapped window concept and a generalized error simulation model are discussed to identify the stability of the technique for recovering the field data among the nonuniform sampled data. Numerical results are tailored for the pattern reconstruction of a 20-m offset reflector antenna operating at L-band. This reflector is planned to be used in a proposed measurement concept of large antenna aboard the Space Shuttle, whereby it would be almost impractical to accurately control the movement of the Shuttle with respect to the RF source in prescribed directions in order to generate uniform sampled points. Also, application of the nonuniform sampling technique to patterns obtained using near-field measured data is demonstrated. Finally, results of an actual far-field measurement are presented for the construction of patterns of a reflector antenna from a set of nonuniformly distributed measured amplitude and phase data.

  7. Elevating sampling

    PubMed Central

    Labuz, Joseph M.; Takayama, Shuichi

    2014-01-01

    Sampling – the process of collecting, preparing, and introducing an appropriate volume element (voxel) into a system – is often under appreciated and pushed behind the scenes in lab-on-a-chip research. What often stands in the way between proof-of-principle demonstrations of potentially exciting technology and its broader dissemination and actual use, however, is the effectiveness of sample collection and preparation. The power of micro- and nanofluidics to improve reactions, sensing, separation, and cell culture cannot be accessed if sampling is not equally efficient and reliable. This perspective will highlight recent successes as well as assess current challenges and opportunities in this area. PMID:24781100

  8. Three-dimensional temperature fields of the North Patagonian Sea recorded by Magellanic penguins as biological sampling platforms

    NASA Astrophysics Data System (ADS)

    Sala, Juan E.; Pisoni, Juan P.; Quintana, Flavio

    2017-04-01

    Temperature is a primary determinant of biogeographic patterns and ecosystem processes. Standard techniques to study the ocean temperature in situ are, however, particularly limited by their time and spatial coverage, problems which might be partially mitigated by using marine top predators as biological platforms for oceanographic sampling. We used small archival tags deployed on 33 Magellanic penguins (Spheniscus magellanicus), and obtained 21,070 geo-localized profiles of water temperature, during late spring of 2008, 2011, 2012 and 2013; in a region of the North Patagonian Sea with limited oceanographic records in situ. We compared our in situ data of sea surface temperature (SST) with those available from satellite remote sensing; to describe the three-dimensional temperature fields around the area of influence of two important tidal frontal systems; and to study the inter-annual variation in the three-dimensional temperature fields. There was a strong positive relationship between satellite- and animal-derived SST data although there was an overestimation by remote-sensing by a maximum difference of +2 °C. Little inter-annual variability in the 3-dimensional temperature fields was found, with the exception of 2012 (and to a lesser extent in 2013) where the SST was significantly higher. In 2013, we found weak stratification in a region which was unexpected. In addition, during the same year, a warm small-scale vortex is indicated by the animal-derived temperature data. This allowed us to describe and better understand the dynamics of the water masses, which, so far, have been mainly studied by remote sensors and numerical models. Our results highlight again the potential of using marine top predators as biological platforms to collect oceanographic data, which will enhance and accelerate studies on the Southwest Atlantic Ocean. In a changing world, threatened by climate change, it is urgent to fill information gaps on the coupled ocean-atmosphere system

  9. Advantages of a synchrotron bending magnet as the sample illuminator for a wide-field X-ray microscope.

    PubMed

    Feser, M; Howells, M R; Kirz, J; Rudati, J; Yun, W

    2012-09-01

    In this paper the choice between bending magnets and insertion devices as sample illuminators for a hard X-ray full-field microscope is investigated. An optimized bending-magnet beamline design is presented. Its imaging speed is very competitive with the performance of similar microscopes installed currently at insertion-device beamlines. The fact that imaging X-ray microscopes can accept a large phase space makes them very well suited to the output characteristics of bending magnets which are often a plentiful and paid-for resource. There exist opportunities at all synchrotron light sources to take advantage of this finding to build bending-magnet beamlines that are dedicated to transmission X-ray microscope facilities. It is expected that demand for such facilities will increase as three-dimensional tomography becomes routine and advanced techniques such as mosaic tomography and XANES tomography (taking three-dimensional tomograms at different energies to highlight elemental and chemical differences) become more widespread.

  10. Radio frequency magnetic field mapping of a 3 Tesla birdcage coil: experimental and theoretical dependence on sample properties.

    PubMed

    Alecci, M; Collins, C M; Smith, M B; Jezzard, P

    2001-08-01

    The RF B(1) distribution was studied, theoretically and experimentally, in phantoms and in the head of volunteers using a 3 T MRI system equipped with a birdcage coil. Agreement between numerical simulation and experiment demonstrates that B(1) distortion at high field can be explained with 3D full-Maxwell calculations. It was found that the B(1) distribution in the transverse plane is strongly dependent on the dielectric properties of the sample. We show that this is a consequence of RF penetration effects combined with RF standing wave effects. In contrast, along the birdcage coil z-axis the B(1) distribution is determined mainly by the coil geometry. In the transverse plane, the region of B(1) uniformity (within 10% of the maximum) was 15 cm with oil, 6 cm with distilled water, 11 cm with saline, and 10 cm in the head. Along z the B(1) uniformity was 9 cm with phantoms and 7 cm in the head.

  11. Sensitive determination of pyrrolizidine alkaloids in Tussilago farfara L. by field-amplified, sample-stacking, sweeping micellar electrokinetic chromatography.

    PubMed

    Cao, Kun; Xu, Yi; Mu, Xiuni; Zhang, Qing; Wang, Renjie; Lv, Junjiang

    2016-11-01

    Pyrrolizidine alkaloids are the toxic components in Tussilago farfara L. Due to the lack of standard substances for quantitative analysis and traces of pyrrolizidine alkaloids in total alkaloids, the full quality control of Tussilago farfara L has been limited. In this study, we aimed to solve the difficulty of determination of pyrrolizidine alkaloids and identify more components in the total alkaloids. An on-line preconcentration method has been applied to improve determining sensitivity of pyrrolizidine alkaloids in Tussilago farfara L. in which included field-amplified sample stacking and sweeping in micellar electrokinetic capillary chromatography. The main parameters that affected separation and stacking efficiency were investigated in details. Under the optimal conditions, the sensitivity enhancement factors obtained by the developed method for the analytes were from 15- to 12-fold, the limits of detection of senkirkine and senecionine were 2∼5 μg/L. Senkirkine and senecionine have been detected in alkaloids (c) of Tussilago farfara L, along ferulic acid methyl ester and methyl caffeate. The developed method was also applied to the analysis of acid extraction (a) of Tussilago farfara L, and senkirkine could be detected directly. The results indicated that the developed method is feasible for the analysis of pyrrolizidine alkaloids in Tussilago farfara L with good recoveries.

  12. Novel Virus Discovery and Genome Reconstruction from Field RNA Samples Reveals Highly Divergent Viruses in Dipteran Hosts

    PubMed Central

    Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.

    2013-01-01

    We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463

  13. Linear models for airborne-laser-scanning-based operational forest inventory with small field sample size and highly correlated LiDAR data

    USGS Publications Warehouse

    Junttila, Virpi; Kauranne, Tuomo; Finley, Andrew O.; Bradford, John B.

    2015-01-01

    Modern operational forest inventory often uses remotely sensed data that cover the whole inventory area to produce spatially explicit estimates of forest properties through statistical models. The data obtained by airborne light detection and ranging (LiDAR) correlate well with many forest inventory variables, such as the tree height, the timber volume, and the biomass. To construct an accurate model over thousands of hectares, LiDAR data must be supplemented with several hundred field sample measurements of forest inventory variables. This can be costly and time consuming. Different LiDAR-data-based and spatial-data-based sampling designs can reduce the number of field sample plots needed. However, problems arising from the features of the LiDAR data, such as a large number of predictors compared with the sample size (overfitting) or a strong correlation among predictors (multicollinearity), may decrease the accuracy and precision of the estimates and predictions. To overcome these problems, a Bayesian linear model with the singular value decomposition of predictors, combined with regularization, is proposed. The model performance in predicting different forest inventory variables is verified in ten inventory areas from two continents, where the number of field sample plots is reduced using different sampling designs. The results show that, with an appropriate field plot selection strategy and the proposed linear model, the total relative error of the predicted forest inventory variables is only 5%–15% larger using 50 field sample plots than the error of a linear model estimated with several hundred field sample plots when we sum up the error due to both the model noise variance and the model’s lack of fit.

  14. Detailed Observations and Sampling of the Sea Cliff Hydrothermal Field (GR-14) on the Northern Gorda Ridge

    NASA Astrophysics Data System (ADS)

    McClain, J. S.; Zierenberg, R.; Clague, D. A.; Von Damm, K. L.; Davis, A.; Goffredi, S.; Mayer, N.; Orphan, V.; Olsen, E.; Ross, S. L.

    2001-12-01

    During the summer of 2000, on a research cruise of the MBARI research ship, Western Flyer, we deployed the ROV Tiburon for a series of dives at the Sea Cliff Hydrothermal site on the northern Gorda Ridge. The Sea Cliff site is near the top of a terrace on the west facing rift valley wall (fault), about 300 meters above, and 3 km east of the ridge axis. The 1996 Gorda Ridge eruption occurred on axis in the region west and south of the vent site. The vents were first predicted on the basis of water column anomalies and seafloor structure, and the field was discovered in 1988 during dives of the Sea Cliff submersible. In 2000, we made 4 dives at the site and collected a suite of rock and vent fluid samples. The high temperature water vents from as many as 10 individual chimneys. Measured vent temperatures at several of the chimneys fall in a narrow range of around 304\\deg C. The chimneys are arrayed along two low ridges that are oriented roughly perpendicular to the strike of the rift valley. Venting fluids have low salinity indicating subsurface phase separation. The waters are isotopically enriched (\\delta 18O = 1.9%), suggesting extensive water-rock interaction. The chimneys themselves are primarily anhydrite and a pale green Mg-rich clay with minor amounts of amorphous silica, pyrrhotite, wurtzite, and isocubanite. The chimneys are delicate and are surrounded by aprons (5 -10 m) of collapsed chimney material. As a result, no macro fauna were observed colonizing the high temperature vents. Silica-rich hydrothermal crust and talus cover the fault slope. A broad region of diffuse venting surrounds the active chimneys and locally supports a rich biological community that includes blue ciliate mats near the vents, that give way to tube worm fields and low tube worm mounds formed on massive barite. The Sea Cliff Hydrothermal site is unusual in that it lies off axis and above the rift valley floor. Faulting must play a role in its location and perhaps geometry, and the

  15. Calculation of susceptibility through multiple orientation sampling (COSMOS): a method for conditioning the inverse problem from measured magnetic field map to susceptibility source image in MRI.

    PubMed

    Liu, Tian; Spincemaille, Pascal; de Rochefort, Ludovic; Kressler, Bryan; Wang, Yi

    2009-01-01

    Magnetic susceptibility differs among tissues based on their contents of iron, calcium, contrast agent, and other molecular compositions. Susceptibility modifies the magnetic field detected in the MR signal phase. The determination of an arbitrary susceptibility distribution from the induced field shifts is a challenging, ill-posed inverse problem. A method called "calculation of susceptibility through multiple orientation sampling" (COSMOS) is proposed to stabilize this inverse problem. The field created by the susceptibility distribution is sampled at multiple orientations with respect to the polarization field, B(0), and the susceptibility map is reconstructed by weighted linear least squares to account for field noise and the signal void region. Numerical simulations and phantom and in vitro imaging validations demonstrated that COSMOS is a stable and precise approach to quantify a susceptibility distribution using MRI.

  16. Sampling and Studying Permafrost in Alaska and on Mars: Mars Arctic Regions Science Field Experience for Secondary Teachers (MARSFEST)

    NASA Astrophysics Data System (ADS)

    Keller, J. M.; Buxner, S. R.; Douglas, T. A.; Lombardi, D. A.; Shaner, A. J.

    2006-12-01

    Both neutron and gamma ray data from the Gamma Ray Spectrometer (GRS) instrument suite aboard the 2001 Mars Odyssey spacecraft provide compelling evidence for the presence of water ice buried within the upper few tens of centimeters of Mars at high latitudes.^{1-3} In May 2008, the Phoenix Mars Lander mission will arrive at the northern high latitudes of Mars to ground-truth the presence of this water ice. The mission will use a robotic arm to deliver samples of permafrost to several instruments on the deck of the spacecraft for detailed chemical and microscopic analyses. Two primary science objectives at the landing site are to study the history of water in all its phases and to characterize soil habitability.4 As part of the Education and Public Outreach efforts for both the Phoenix and Odyssey missions, 20 secondary science teachers from across the U.S. and Canada were selected to spend a week in Summer 2006 immersed in arctic region science around Fairbanks, Alaska. The focal point of the experience involved investigations conducted at the Cold Regions Research and Engineering Laboratory (CRREL) Permafrost Tunnel.5 Teacher participants combined remote sensing and in situ observations of permafrost regions, conducted sample collection and analyses to investigate research questions generated by participants at the Permafrost Tunnel, explored comparisons between the terrestrial and Martian arctic, and completed inquiry- based classroom curriculum activities related to Mars and arctic science. A video documentary of the field experience is being produced by the NASA Mars Public Engagement program for education and public outreach purposes. The ten teacher teams involved in the workshop will now serve as educational ambassadors for the Phoenix Mars Lander mission over the next two years through to the completion of surface operations for the mission. They will be supported through monthly teleconferences updating them on mission status and continued research

  17. Characterizing forest structure variations across an intact tropical peat dome using field samplings and airborne LiDAR.

    PubMed

    Nguyen, Ha T; Hutyra, Lucy R; Hardiman, Brady S; Raciti, Steve M

    2016-03-01

    Tropical peat swamp forests (PSF) are one of the most carbon dense ecosystems on the globe and are experiencing substantial natural and anthropogenic disturbances. In this study, we combined direct field sampling and airborne LiDAR to empirically quantify forest structure and aboveground live biomass (AGB) across a large, intact tropical peat dome in Northwestern Borneo. Moving up a 4 m elevational gradient, we observed increasing stem density but decreasing canopy height, crown area, and crown roughness. These findings were consistent with hypotheses that nutrient and hydrological dynamics co-influence forest structure and stature of the canopy individuals, leading to reduced productivity towards the dome interior. Gap frequency as a function of gap size followed a power law distribution with a shape factor (λ) of 1.76 ± 0.06. Ground-based and dome-wide estimates of AGB were 217.7 ± 28.3 Mg C/ha and 222.4 ± 24.4 Mg C/ha, respectively, which were higher than previously reported AGB for PSF and tropical forests in general. However, dome-wide AGB estimates were based on height statistics, and we found the coefficient of variation on canopy height was only 0.08, three times less than stem diameter measurements, suggesting LiDAR height metrics may not be a robust predictor of AGB in tall tropical forests with dense canopies. Our structural characterization of this ecosystem advances the understanding of the ecology of intact tropical peat domes and factors that influence biomass density and landscape-scale spatial variation. This ecological understanding is essential to improve estimates of forest carbon density and its spatial distribution in PSF and to effectively model the effects of disturbance and deforestation in these carbon dense ecosystems.

  18. Effect of variable rates of daily sampling of fly larvae on decomposition and carrion insect community assembly: implications for forensic entomology field study protocols.

    PubMed

    Michaud, Jean-Philippe; Moreau, Gaétan

    2013-07-01

    Experimental protocols in forensic entomology successional field studies generally involve daily sampling of insects to document temporal changes in species composition on animal carcasses. One challenge with that method has been to adjust the sampling intensity to obtain the best representation of the community present without affecting the said community. To this date, little is known about how such investigator perturbations affect decomposition-related processes. Here, we investigated how different levels of daily sampling of fly eggs and fly larvae affected, over time, carcass decomposition rate and the carrion insect community. Results indicated that a daily sampling of <5% of the egg and larvae volumes present on a carcass, a sampling intensity believed to be consistent with current accepted practices in successional field studies, had little effect overall. Higher sampling intensities, however, slowed down carcass decomposition, affected the abundance of certain carrion insects, and caused an increase in the volume of eggs laid by dipterans. This study suggests that the carrion insect community not only has a limited resilience to recurrent perturbations but that a daily sampling intensity equal to or <5% of the egg and larvae volumes appears adequate to ensure that the system is representative of unsampled conditions. Hence we propose that this threshold be accepted as best practice in future forensic entomology successional field studies.

  19. The actual citation impact of European oncological research.

    PubMed

    López-Illescas, Carmen; de Moya-Anegón, Félix; Moed, Henk F

    2008-01-01

    This study provides an overview of the research performance of major European countries in the field Oncology, the most important journals in which they published their research articles, and the most important academic institutions publishing them. The analysis was based on Thomson Scientific's Web of Science (WoS) and calculated bibliometric indicators of publication activity and actual citation impact. Studying the time period 2000-2006, it gives an update of earlier studies, but at the same time it expands their methodologies, using a broader definition of the field, calculating indicators of actual citation impact, and analysing new and policy relevant aspects. Findings suggest that the emergence of Asian countries in the field Oncology has displaced European articles more strongly than articles from the USA; that oncologists who have published their articles in important, more general journals or in journals covering other specialties, rather than in their own specialist journals, have generated a relatively high actual citation impact; and that universities from Germany, and--to a lesser extent--those from Italy, the Netherlands, UK, and Sweden, dominate a ranking of European universities based on number of articles in oncology. The outcomes illustrate that different bibliometric methodologies may lead to different outcomes, and that outcomes should be interpreted with care.

  20. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2007-04-13

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 2224 Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cesium-137 sulfate and sodium) were exceeded in all three of the flowsheet tests that were performed.

  1. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2006-10-18

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 222-S Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cs-137 sulfate, and sodium) were exceeded in all three of the flowsheet tests that were performed.

  2. Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize

    PubMed Central

    Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

    2015-01-01

    Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers’ freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

  3. Towards high concentration enhancement of microfluidic temperature gradient focusing of sample solutes using combined AC and DC field induced Joule heating.

    PubMed

    Ge, Zhengwei; Wang, Wei; Yang, Chun

    2011-04-07

    It is challenging to continuously concentrate sample solutes in microfluidic channels. We present an improved electrokinetic technique for enhancing microfluidic temperature gradient focusing (TGF) of sample solutes using combined AC and DC field induced Joule heating effects. The introduction of an AC electric field component services dual functions: one is to produce Joule heat for generating temperature gradient; the other is to suppress electroosmotic flow. Consequently the required DC voltages for achieving sample concentration by Joule heating induced TGF are reduced, thereby leading to smaller electroosmotic flow (EOF) and thus backpressure effects. As a demonstration, the proposed technique can lead to concentration enhancement of sample solutes of more than 2500-fold, which is much higher than the existing literature reported microfluidic concentration enhancement by utilizing the Joule heating induced TGF technique.

  4. Effects of Data Sampling on the Results of Fourier Analysis of Radial-Velocity Fields in Spiral-Galaxy Disks

    NASA Astrophysics Data System (ADS)

    Burlak, A. N.; Zasov, A. V.; Fridman, A. M.; Khoruzhi, O. V.

    2000-12-01

    Our main goal is to investigate the effects of data incompleteness on the results of Fourier analysis of line-of-sight velocity fields in the disks of spiral galaxies. We have carried out a number of numerical experiments, first with an artificially created simple velocity field and then with the velocity fields of two real galaxies, which qualitatively differ in data filling: NGC 157 and NGC 3631 with good and bad data filling, respectively. The field of purely circular velocities is chosen as the simplest artificial velocity field, because the circular velocities of spiral galaxies are much high than the residual (noncircular) velocities. Superimposing a "mask" simulating blank spots (holes) in the map of observational data on this artificial field has no effect on the results of Fourier analysis of this simplest field. A similar result is obtained for real galaxies with good data filling of the observed velocity fields. Superimposing arbitrarily shaped masks on the observed velocity field of NGC 157 in such a way that the field was filled by a mere 50% (at each radius) could not change appreciably the radial variations of large-scale Fourier harmonics. The situation qualitatively changes in attempting to fill the holes in the observed velocity field of NGC 3631 in some way. When missing velocities are artificially introduced by using the simplest model of purely circular gas rotation, the amplitudes and phases of the principal Fourier harmonics are distorted. In particular, a substantial distortion of the third harmonic also causes an increase in the error when determining the corotation radius from data of the filled field. When the filling of the velocity field is increased by degrading the spatial resolution, the amplitudes of most harmonics decrease throughout the entire disk region; as a result, their radial variations are smoothed out and the behavior of harmonic phases in the range of moderately high initial amplitudes can be distorted. An abnormal

  5. A mud-sampling technique for the study of the ecology of aquatic snails, and its use in the evaluation of the efficacy of molluscicides in field trials*

    PubMed Central

    Crossland, N. O.

    1962-01-01

    The author describes a sampling technique suitable for estimating the population densities of African aquatic snails in the field by the removal of a plug of mud and its subsequent detailed examination. This device has been used in field trials with the molluscicides ICI 24223 and Bayer 73. Estimates of percentage kills were based on counts of live and dead snails in each mud sample before and after molluscicide treatment. Statistical analysis of these counts suggests that most snails killed by the molluscicides were subsequently recovered, thus providing some confirmatory evidence of the validity of these estimates. PMID:13882393

  6. Star formation in the local Universe from the CALIFA sample. I. Calibrating the SFR using integral field spectroscopy data

    NASA Astrophysics Data System (ADS)

    Catalán-Torrecilla, C.; Gil de Paz, A.; Castillo-Morales, A.; Iglesias-Páramo, J.; Sánchez, S. F.; Kennicutt, R. C.; Pérez-González, P. G.; Marino, R. A.; Walcher, C. J.; Husemann, B.; García-Benito, R.; Mast, D.; González Delgado, R. M.; Muñoz-Mateos, J. C.; Bland-Hawthorn, J.; Bomans, D. J.; Del Olmo, A.; Galbany, L.; Gomes, J. M.; Kehrig, C.; López-Sánchez, Á. R.; Mendoza, M. A.; Monreal-Ibero, A.; Pérez-Torres, M.; Sánchez-Blázquez, P.; Vilchez, J. M.; Califa Collaboration

    2015-12-01

    Context. The star formation rate (SFR) is one of the main parameters used to analyze the evolution of galaxies through time. The need for recovering the light reprocessed by dust commonly requires the use of low spatial resolution far-infrared data. Recombination line luminosities provide an alternative, although uncertain dust-extinction corrections based on narrowband imaging or long-slit spectroscopy have traditionally posed a limit to their applicability. Integral field spectroscopy (IFS) is clearly the way to overcome this kind of limitation. Aims: We obtain integrated Hα, ultraviolet (UV) and infrared (IR)-based SFR measurements for 272 galaxies from the CALIFA survey at 0.005

  7. Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples

    PubMed Central

    Voordouw, Gerrit; Menon, Priyesh; Pinnock, Tijan; Sharma, Mohita; Shen, Yin; Venturelli, Amanda; Voordouw, Johanna; Sexton, Aoife

    2016-01-01

    Microbially-influenced corrosion (MIC) contributes to the general corrosion rate (CR), which is typically measured with carbon steel coupons. Here we explore the use of carbon steel ball bearings, referred to as beads (55.0 ± 0.3 mg; Ø = 0.238 cm), for determining CRs. CRs for samples from an oil field in Oceania incubated with beads were determined by the weight loss method, using acid treatment to remove corrosion products. The release of ferrous and ferric iron was also measured and CRs based on weight loss and iron determination were in good agreement. Average CRs were 0.022 mm/yr for eight produced waters with high numbers (105/ml) of acid-producing bacteria (APB), but no sulfate-reducing bacteria (SRB). Average CRs were 0.009 mm/yr for five central processing facility (CPF) waters, which had no APB or SRB due to weekly biocide treatment and 0.036 mm/yr for 2 CPF tank bottom sludges, which had high numbers of APB (106/ml) and SRB (108/ml). Hence, corrosion monitoring with carbon steel beads indicated that biocide treatment of CPF waters decreased the CR, except where biocide did not penetrate. The CR for incubations with 20 ml of a produced water decreased from 0.061 to 0.007 mm/yr when increasing the number of beads from 1 to 40. CRs determined with beads were higher than those with coupons, possibly also due to a higher weight of iron per unit volume used in incubations with coupons. Use of 1 ml syringe columns, containing carbon steel beads, and injected with 10 ml/day of SRB-containing medium for 256 days gave a CR of 0.11 mm/yr under flow conditions. The standard deviation of the distribution of residual bead weights, a measure for the unevenness of the corrosion, increased with increasing CR. The most heavily corroded beads showed significant pitting. Hence the use of uniformly sized carbon steel beads offers new opportunities for screening and monitoring of corrosion including determination of the distribution of corrosion rates, which allows

  8. Petrographic description of calcite/opal samples collected on field trip of December 5-9, 1992. Special report No. 7

    SciTech Connect

    Hill, C.A.; Schluter, C.M.

    1993-06-01

    This study is part of the research program of the Yucca Mountain Project intended to provide the State of Nevada with a detailed analysis and assessment of the water-deposited minerals of Yucca Mountain and adjacent regions. Forty-three separate stops were made and 203 samples were collected during the five days of the field trip. This report describes petrographic observations made on the calcite/opal samples.

  9. Comparison of geochemical data obtained using four brine sampling methods at the SECARB Phase III Anthropogenic Test CO2 injection site, Citronelle Oil Field, Alabama

    USGS Publications Warehouse

    Conaway, Christopher; Thordsen, James J.; Manning, Michael A.; Cook, Paul J.; Trautz, Robert C.; Thomas, Burt; Kharaka, Yousif K.

    2016-01-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a characterization well in the Citronelle Oil Field, Alabama, as part of the Southeast Regional Carbon Sequestration Partnership (SECARB) Phase III Anthropogenic Test, which is an integrated carbon capture and storage project. In this study, formation water and gas samples were obtained from well D-9-8 #2 at Citronelle using gas lift, electric submersible pump, U-tube, and a downhole vacuum sampler (VS) and subjected to both field and laboratory analyses. Field chemical analyses included electrical conductivity, dissolved sulfide concentration, alkalinity, and pH; laboratory analyses included major, minor and trace elements, dissolved carbon, volatile fatty acids, free and dissolved gas species. The formation water obtained from this well is a Na–Ca–Cl-type brine with a salinity of about 200,000 mg/L total dissolved solids. Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity. There was little gas in samples, and gas composition results were strongly influenced by sampling methods. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the VS and U-tube system performing most favorably in this aspect.

  10. B fields in OB stars (BOB): Low-resolution FORS2 spectropolarimetry of the first sample of 50 massive stars

    NASA Astrophysics Data System (ADS)

    Fossati, L.; Castro, N.; Schöller, M.; Hubrig, S.; Langer, N.; Morel, T.; Briquet, M.; Herrero, A.; Przybilla, N.; Sana, H.; Schneider, F. R. N.; de Koter, A.; BOB Collaboration

    2015-10-01

    Within the context of the collaboration "B fields in OB stars" (BOB), we used the FORS2 low-resolution spectropolarimeter to search for a magnetic field in 50 massive stars, including two reference magnetic massive stars. Because of the many controversies of magnetic field detections obtained with the FORS instruments, we derived the magnetic field values with two completely independent reduction and analysis pipelines. We compare and discuss the results obtained from the two pipelines. We obtained a general good agreement, indicating that most of the discrepancies on magnetic field detections reported in the literature are caused by the interpretation of the significance of the results (i.e., 3-4σ detections considered as genuine, or not), instead of by significant differences in the derived magnetic field values. By combining our results with past FORS1 measurements of HD 46328, we improve the estimate of the stellar rotation period, obtaining P = 2.17950 ± 0.00009 days. For HD 125823, our FORS2 measurements do not fit the available magnetic field model, based on magnetic field values obtained 30 years ago. We repeatedly detect a magnetic field for the O9.7V star HD 54879, the HD 164492C massive binary, and the He-rich star CPD -57 3509. We obtain a magnetic field detection rate of 6 ± 4%, while by considering only the apparently slow rotators we derive a detection rate of 8 ± 5%, both comparable with what was previously reported by other similar surveys. We are left with the intriguing result that, although the large majority of magnetic massive stars is rotating slowly, our detection rate is not a strong function of the stellar rotational velocity. Based on observations made with ESO Telescopes at the La Silla Paranal Observatory under programme ID 191.D-0255(A, C).

  11. Geospatial compilation of results from field sample collection in support of mineral resource investigations, Western Alaska Range, Alaska, July 2013

    USGS Publications Warehouse

    Johnson, Michaela R.; Graham, Garth E.; Hubbard, Bernard E.; Benzel, William M.

    2015-07-16

    This Data Series summarizes results from July 2013 sampling in the western Alaska Range near Mount Estelle, Alaska. The fieldwork combined in situ and camp-based spectral measurements of talus/soil and rock samples. Five rock and 48 soil samples were submitted for quantitative geochemi­cal analysis (for 55 major and trace elements), and the 48 soils samples were also analyzed by x-ray diffraction to establish mineralogy and geochemistry. The results and sample photo­graphs are presented in a geodatabase that accompanies this report. The spectral, mineralogical, and geochemical charac­terization of these samples and the sites that they represent can be used to validate existing remote-sensing datasets (for example, ASTER) and future hyperspectral studies. Empiri­cal evidence of jarosite (as identified by x-ray diffraction and spectral analysis) corresponding with gold concentrations in excess of 50 parts per billion in soil samples suggests that surficial mapping of jarosite in regional surveys may be use­ful for targeting areas of prospective gold occurrences in this sampling area.

  12. Realizing actual feedback control of complex network

    NASA Astrophysics Data System (ADS)

    Tu, Chengyi; Cheng, Yuhua

    2014-06-01

    In this paper, we present the concept of feedbackability and how to identify the Minimum Feedbackability Set of an arbitrary complex directed network. Furthermore, we design an estimator and a feedback controller accessing one MFS to realize actual feedback control, i.e. control the system to our desired state according to the estimated system internal state from the output of estimator. Last but not least, we perform numerical simulations of a small linear time-invariant dynamics network and a real simple food network to verify the theoretical results. The framework presented here could make an arbitrary complex directed network realize actual feedback control and deepen our understanding of complex systems.

  13. Field guide for collecting samples for analysis of volatile organic compounds in stream water for the National Water-Quality Assessment Program

    USGS Publications Warehouse

    Shelton, Larry R.

    1997-01-01

    For many years, stream samples for analysis of volatile organic compounds have been collected without specific guidelines or a sampler designed to avoid analyte loss. In 1996, the U.S. Geological Survey's National Water-Quality Assessment Program began aggressively monitoring urban stream-water for volatile organic compounds. To assure representative samples and consistency in collection procedures, a specific sampler was designed to collect samples for analysis of volatile organic compounds in stream water. This sampler, and the collection procedures, were tested in the laboratory and in the field for compound loss, contamination, sample reproducibility, and functional capabilities. This report describes that sampler and its use, and outlines field procedures specifically designed to provide contaminant-free, reproducible volatile organic compound data from stream-water samples. These guidelines and the equipment described represent a significant change in U.S. Geological Survey instructions for collecting and processing stream-water samples for analysis of volatile organic compounds. They are intended to produce data that are both defensible and interpretable, particularly for concentrations below the microgram-per-liter level. The guidelines also contain detailed recommendations for quality-control samples.

  14. Endotoxin deposits on the inner surfaces of closed-face cassettes during bioaerosol sampling: a field investigation at composting facilities.

    PubMed

    Duquenne, Philippe; Simon, Xavier; Demange, Valérie; Harper, Martin; Wild, Pascal

    2015-05-01

    A set of 270 bioaerosol samples was taken from 15 composting facilities using polystyrene closed-face filter cassettes (CFCs). The objective was to measure the quantity of endotoxin deposits on the inner surfaces of the cassettes (sometimes referred to as 'wall deposits'). The results show that endotoxins are deposited on the inner surfaces of the CFCs through sampling and/or handling of samples. The quantity of endotoxins measured on inner surfaces range between 0.05 (the limit of detection of the method) and 3100 endotoxin units per cassette. The deposits can represent a large and variable percentage of the endotoxins sampled. More than a third of the samples presented a percentage of inner surface deposits >40% of the total quantity of endotoxins collected (filter + inner surfaces). Omitting these inner surface deposits in the analytical process lead to measurement errors relative to sampling all particles entering the CFC sampler, corresponding to a developing consensus on matching the inhalable particulate sampling convention. The result would be underestimated exposures and could affect the decision as to whether or not a result is acceptable in comparison to airborne concentration limits defined in terms of the inhalability convention. The results of this study suggest including the endotoxins deposited on the inner surfaces of CFCs during analysis. Further researches are necessary to investigate endotoxin deposits on the inner cassette surfaces in other working sectors.

  15. Possibilities and limitations of the ART-Sample algorithm for reconstruction of 3D temperature fields and the influence of opaque obstacles.

    PubMed

    Li, Yuanyang; Herman, Cila

    2013-07-01

    The need for the measurement of complex, unsteady, three-dimensional (3D) temperature distributions arises in a variety of engineering applications, and tomographic techniques are applied to accomplish this goal. Holographic interferometry (HI), one of the optical methods used for visualizing temperature fields, combined with tomographic reconstruction techniques requires multi-directional interferometric data to recover the 3D information. However, the presence of opaque obstacles (such as solid objects in the flow field and heaters) in the measurement volume, prevents the probing light beams from traversing the entire measurement volume. As a consequence, information on the average value of the field variable will be lost in regions located in the shade of the obstacle. The capability of the ART-Sample tomographic reconstruction method to recover 3D temperature distributions both in unobstructed temperature fields and in the presence of opaque obstacles is discussed in this paper. A computer code for tomographic reconstruction of 3D temperature fields from 2D projections was developed. In the paper, the reconstruction accuracy is discussed quantitatively both without and with obstacles in the measurement volume for a set of phantom functions mimicking realistic temperature distributions. The reconstruction performance is optimized while minimizing the number of irradiation directions (experimental hardware requirements) and computational effort. For the smooth temperature field both with and without obstacles, the reconstructions produced by this algorithm are good, both visually and using quantitative criteria. The results suggest that the location and the size of the obstacle and the number of viewing directions will affect the reconstruction of the temperature field. When the best performance parameters of the ART-Sample algorithm identified in this paper are used to reconstruct the 3D temperature field, the 3D reconstructions with and without obstacle are

  16. Description of a computer program to calculate reacting supersonic internal flow fields with shock waves using viscous characteristics: Program manual and sample calculations

    NASA Technical Reports Server (NTRS)

    Cavalleri, R. J.; Agnone, A. M.

    1972-01-01

    A computer program for calculating internal supersonic flow fields with chemical reactions and shock waves typical of supersonic combustion chambers with either wall or mid-stream injectors is described. The usefulness and limitations of the program are indicated. The program manual and listing are presented along with a sample calculation.

  17. A minimally invasive method of piscine tissue collection and an analysis of long-term field-storage conditions for samples

    PubMed Central

    Campanella, James J; Smalley, John V

    2006-01-01

    Background The acquisition of high-quality DNA for use in phylogenetic and molecular population genetic studies is a primary concern for evolutionary and genetic researchers. Many non-destructive DNA sampling methods have been developed and are used with a variety of taxa in applications ranging from genetic stock assessment to molecular forensics. Results The authors have developed a field sampling method for obtaining high-quality DNA from sunfish (Lepomis) and other freshwater fish that employs a variation on the buccal swab method and results in the collection of DNA suitable for PCR amplification and polymorphism analysis. Additionally, since the circumstances of storage are always a concern for field biologists, the authors have tested the potential storage conditions of swabbed samples and whether those conditions affect DNA extraction and PCR amplification. It was found that samples stored at room temperature in the dark for over 200 days could still yield DNA suitable for PCR amplification and polymorphism detection. Conclusion These findings suggest that valuable molecular genetic data may be obtained from tissues that have not been treated or stored under optimal field conditions. Furthermore, it is clear that the lack of adequately low temperatures during transport and long term storage should not be a barrier to anyone wishing to engage in field-based molecular genetic research. PMID:16734898

  18. Cropland Field Monitoring: MMV Page 1 Montana Cropland Enrolled Farm Fields Carbon Sequestration Field Sampling, Measurement, Monitoring, and Verification: Application of Visible-Near Infrared Diffuse Reflectance Spectroscopy (VNIR) and Laser-induced Breakdown Spectroscopy (LIBS)

    SciTech Connect

    Lee Spangler; Ross Bricklemyer; David Brown

    2012-03-15

    There is growing need for rapid, accurate, and inexpensive methods to measure, and verify soil organic carbon (SOC) change for national greenhouse gas accounting and the development of a soil carbon trading market. Laboratory based soil characterization typically requires significant soil processing, which is time and resource intensive. This severely limits application for large-region soil characterization. Thus, development of rapid and accurate methods for characterizing soils are needed to map soil properties for precision agriculture applications, improve regional and global soil carbon (C) stock and flux estimates and efficiently map sub-surface metal contamination, among others. The greatest gains for efficient soil characterization will come from collecting soil data in situ, thus minimizing soil sample transportation, processing, and lab-based measurement costs. Visible and near-infrared diffuse reflectance spectroscopy (VisNIR) and laser-induced breakdown spectroscopy (LIBS) are two complementary, yet fundamentally different spectroscopic techniques that have the potential to meet this need. These sensors have the potential to be mounted on a soil penetrometer and deployed for rapid soil profile characterization at field and landscape scales. Details of sensor interaction, efficient data management, and appropriate statistical analysis techniques for model calibrations are first needed. In situ or on-the-go VisNIR spectroscopy has been proposed as a rapid and inexpensive tool for intensively mapping soil texture and organic carbon (SOC). While lab-based VisNIR has been established as a viable technique for estimating various soil properties, few experiments have compared the predictive accuracy of on-the-go and lab-based VisNIR. Eight north central Montana wheat fields were intensively interrogated using on-the-go and lab-based VisNIR. Lab-based spectral data consistently provided more accurate predictions than on-the-go data. However, neither in situ

  19. Methodological Comparison between a Novel Automatic Sampling System for Gas Chromatography versus Photoacoustic Spectroscopy for Measuring Greenhouse Gas Emissions under Field Conditions

    PubMed Central

    Schmithausen, Alexander J.; Trimborn, Manfred; Büscher, Wolfgang

    2016-01-01

    Trace gases such as nitrous oxide (N2O), methane (CH4), and carbon dioxide (CO2) are climate-related gases, and their emissions from agricultural livestock barns are not negligible. Conventional measurement systems in the field (Fourier transform infrared spectroscopy (FTIR); photoacoustic system (PAS)) are not sufficiently sensitive to N2O. Laser-based measurement systems are highly accurate, but they are very expensive to purchase and maintain. One cost-effective alternative is gas chromatography (GC) with electron capture detection (ECD), but this is not suitable for field applications due to radiation. Measuring samples collected automatically under field conditions in the laboratory at a subsequent time presents many challenges. This study presents a sampling designed to promote laboratory analysis of N2O concentrations sampled under field conditions. Analyses were carried out using PAS in the field (online system) and GC in the laboratory (offline system). Both measurement systems showed a good correlation for CH4 and CO2 concentrations. Measured N2O concentrations were near the detection limit for PAS. GC achieved more reliable results for N2O in very low concentration ranges. PMID:27706101

  20. Assessment of the Worldwide Antimalarial Resistance Network Standardized Procedure for In Vitro Malaria Drug Sensitivity Testing Using SYBR Green Assay for Field Samples with Various Initial Parasitemia Levels.

    PubMed

    Cheruiyot, Agnes C; Auschwitz, Jennifer M; Lee, Patricia J; Yeda, Redemptah A; Okello, Charles O; Leed, Susan E; Talwar, Mayank; Murthy, Tushar; Gaona, Heather W; Hickman, Mark R; Akala, Hoseah M; Kamau, Edwin; Johnson, Jacob D

    2016-04-01

    The malaria SYBR green assay, which is used to profilein vitrodrug susceptibility ofPlasmodium falciparum, is a reliable drug screening and surveillance tool. Malaria field surveillance efforts provide isolates with various low levels of parasitemia. To be advantageous, malaria drug sensitivity assays should perform reproducibly among various starting parasitemia levels rather than at one fixed initial value. We examined the SYBR green assay standardized procedure developed by the Worldwide Antimalarial Resistance Network (WWARN) for its sensitivity and ability to accurately determine the drug concentration that inhibits parasite growth by 50% (IC50) in samples with a range of initial parasitemia levels. The initial sensitivity determination of the WWARN procedure yielded a detection limit of 0.019% parasitemia.P. falciparumlaboratory strains and field isolates with various levels of initial parasitemia were then subjected to a range of doses of common antimalarials. The IC50s were comparable for laboratory strains with between 0.0375% and 0.6% parasitemia and for field isolates with between 0.075% and 0.6% parasitemia for all drugs tested. Furthermore, assay quality (Z') analysis indicated that the WWARN procedure displays high robustness, allowing for drug testing of malaria field samples within the derived range of initial parasitemia. The use of the WWARN procedure should allow for the inclusion of more malaria field samples in malaria drug sensitivity screens that would have otherwise been excluded due to low initial parasitemia levels.

  1. Assessment of the Worldwide Antimalarial Resistance Network Standardized Procedure for In Vitro Malaria Drug Sensitivity Testing Using SYBR Green Assay for Field Samples with Various Initial Parasitemia Levels

    PubMed Central

    Cheruiyot, Agnes C.; Auschwitz, Jennifer M.; Lee, Patricia J.; Yeda, Redemptah A.; Okello, Charles O.; Leed, Susan E.; Talwar, Mayank; Murthy, Tushar; Gaona, Heather W.; Hickman, Mark R.; Akala, Hoseah M.; Kamau, Edwin

    2016-01-01

    The malaria SYBR green assay, which is used to profile in vitro drug susceptibility of Plasmodium falciparum, is a reliable drug screening and surveillance tool. Malaria field surveillance efforts provide isolates with various low levels of parasitemia. To be advantageous, malaria drug sensitivity assays should perform reproducibly among various starting parasitemia levels rather than at one fixed initial value. We examined the SYBR green assay standardized procedure developed by the Worldwide Antimalarial Resistance Network (WWARN) for its sensitivity and ability to accurately determine the drug concentration that inhibits parasite growth by 50% (IC50) in samples with a range of initial parasitemia levels. The initial sensitivity determination of the WWARN procedure yielded a detection limit of 0.019% parasitemia. P. falciparum laboratory strains and field isolates with various levels of initial parasitemia were then subjected to a range of doses of common antimalarials. The IC50s were comparable for laboratory strains with between 0.0375% and 0.6% parasitemia and for field isolates with between 0.075% and 0.6% parasitemia for all drugs tested. Furthermore, assay quality (Z′) analysis indicated that the WWARN procedure displays high robustness, allowing for drug testing of malaria field samples within the derived range of initial parasitemia. The use of the WWARN procedure should allow for the inclusion of more malaria field samples in malaria drug sensitivity screens that would have otherwise been excluded due to low initial parasitemia levels. PMID:26856829

  2. Children's Rights and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1982-01-01

    Educators need to seriously reflect upon the concept of children's rights. Though the idea of children's rights has been debated numerous times, the idea remains vague and shapeless; however, Maslow's theory of self-actualization can provide the children's rights idea with a needed theoretical framework. (Author)

  3. Group Counseling for Self-Actualization.

    ERIC Educational Resources Information Center

    Streich, William H.; Keeler, Douglas J.

    Self-concept, creativity, growth orientation, an integrated value system, and receptiveness to new experiences are considered to be crucial variables to the self-actualization process. A regular, year-long group counseling program was conducted with 85 randomly selected gifted secondary students in the Farmington, Connecticut Public Schools. A…

  4. Culture Studies and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1983-01-01

    True citizenship education is impossible unless students develop the habit of intelligently evaluating cultures. Abraham Maslow's theory of self-actualization, a theory of innate human needs and of human motivation, is a nonethnocentric tool which can be used by teachers and students to help them understand other cultures. (SR)

  5. Humanistic Education and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1984-01-01

    Stresses the need for theoretical justification for the development of humanistic education programs in today's schools. Explores Abraham Maslow's hierarchy of needs and theory of self-actualization. Argues that Maslow's theory may be the best available for educators concerned with educating the whole child. (JHZ)

  6. Developing Human Resources through Actualizing Human Potential

    ERIC Educational Resources Information Center

    Clarken, Rodney H.

    2012-01-01

    The key to human resource development is in actualizing individual and collective thinking, feeling and choosing potentials related to our minds, hearts and wills respectively. These capacities and faculties must be balanced and regulated according to the standards of truth, love and justice for individual, community and institutional development,…

  7. 50 CFR 253.16 - Actual cost.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Actual cost. 253.16 Section 253.16 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE AID TO FISHERIES FISHERIES ASSISTANCE PROGRAMS Fisheries Finance Program §...

  8. Chronically indwelling venous cannula and automatic blood sampling system for use with nonhuman primates exposed to 60 Hz electric and magnetic fields

    SciTech Connect

    Rogers, W.R.; Lucas, J.H.; Smith, H.D.; Orr, J.L.; Mikiten, B.C.

    1995-12-31

    An automated blood sampling system was developed for use with tethered baboons (Papio cynocephalus) during concurrent exposure to 60 Hz 30 kV/m electric fields and 0.1 mT (1.0 G) magnetic fields. The system was controlled by a FORTH-based microcomputer, which operated a pump, a fraction collector, and two pinch valves. A swivel mechanism at the end of the tether allowed the baboons to move freely in their cages. The hardware and software were designed for fail-safe operation. Heparinized saline was infused at a rate of 0.5 ml/min until a sample cycle was initiated. Then, blood was drawn from the animal into a storage tube at a rate of 12.5 ml/min, a sample of undiluted blood was taken from the end of the storage tube near the baboon, and the blood remaining in the storage tube was then flushed back into the animal. Use of the storage tube prevented the peristaltic pump rollers from pressing on tubing containing blood, and return of the blood diluted with saline limited the blood wasted per sample to less than 0.5 ml. The system functioned reliably in three experiments, collecting samples as scheduled 97% of the time. Although it was initially designed for and used successfully with primates in an electric and magnetic field environment, this type of system could be employed in many areas of biomedical research or medical treatment.

  9. Topography and near-field image measurement of soft biological samples in liquid by using a tuning fork based bent optical-fiber sensor.

    PubMed

    Kwon, Sangjin; Jeong, Sungho; Kang, Yongseok

    2011-04-01

    The fabrication of a tuning fork based bent optical-fiber sensor and its application for topography and near-field image measurement of soft biological samples in physiological solution are reported. By adopting the bent optical fiber and tuning fork feedback scheme, the possibility of signal interference with stray light is minimized, which is especially important for near-field applications. From the measured tuning fork amplitude and its calibration with the preamplifier output voltage, it was determined that the interaction force between the fiber tip and a soft sample in liquid needs to be controlled within approximately 10 nN level and that the image quality depends sensitively to the interaction force. The results of topography measurements of fixed COS-7 and MCF-7 cells in phosphate buffered saline and of the near-field imaging of red blood cell also in phosphate buffered saline with a resolution of about 100 nm are presented.

  10. Highly sensitive detection of five typical fluoroquinolones in low-fat milk by field-enhanced sample injection-based CE in bubble cell capillary.

    PubMed

    Deng, Yan; Gasilova, Natalia; Qiao, Liang; Zhou, Ying-Lin; Zhang, Xin-Xiang; Girault, Hubert H

    2014-12-01

    Fluoroquinolones are a group of synthetic antibiotics with a broad activity spectrum against mycoplasma, Gram-positive, and Gram-negative bacteria. Due to the extensive use of fluoroquinolones in farming and veterinary science, there is a constant need in the analytical methods able to efficiently monitor their residues in food products of animal origin, regulated by Commission Regulation (European Union) no. 37/2010. Herein, field-enhanced sample injection for sample stacking prior the CZE separation was developed inside a bubble cell capillary for highly sensitive detection of five typical fluoroquinolones in bovine milk. Ethylenediamine was proposed as the main component of BGE for the antibiotics separation. The effect of BGE composition, injection parameters, and water plug length on the field-enhanced sample injection-based CE with UV detection was investigated. Under the optimized conditions, described field-enhanced sample injection-based CE-UV analysis of fluoroquinolones provides LODs varying from 0.4 to 1.3 ng/mL. These LOD values are much lower (from 460 to 1500 times) than those obtained by a conventional CE in a standard capillary without bubble cell. The developed method was finally applied for the analysis of fluoroquinolones in low-fat milk from a Swiss supermarket. Sample recovery values from 93.6 to 106.0% for different fluoroquinolones, and LODs from 0.7 to 2.5 μg/kg, were achieved. Moreover, the proposed ethylenediamine-based BGE as volatile and compatible with MS system, enabled the coupling of the field-enhanced sample injection-based CE with a recently introduced electrostatic spray ionization MS via an iontophoretic fraction collection interface for qualitative fluoroquinolones identification.

  11. Evaluating Complex Mixtures in the Zebrafish Embryo by Reconstituting Field Water Samples: A Metal Pollution Case Study.

    PubMed

    Michiels, Ellen D G; Vergauwen, Lucia; Hagenaars, An; Fransen, Erik; Dongen, Stefan Van; Van Cruchten, Steven J; Bervoets, Lieven; Knapen, Dries

    2017-03-02

    Accurately assessing the toxicity of complex, environmentally relevant mixtures remains an important challenge in ecotoxicology. The goal was to identify biological effects after exposure to environmental water samples and to determine whether the observed effects could be explained by the waterborne metal mixture found in the samples. Zebrafish embryos were exposed to water samples of five different sites originating from two Flemish (Mol and Olen, Belgium) metal contaminated streams: "Scheppelijke Nete" (SN) and "Kneutersloop" (K), and a ditch (D), which is the contamination source of SN. Trace metal concentrations, and Na, K, Mg and Ca concentrations were measured using ICP-MS and were used to reconstitute site-specific water samples. We assessed whether the effects that were observed after exposure to environmental samples could be explained by metal mixture toxicity under standardized laboratory conditions. Exposure to "D" or "reconstituted D" water caused 100% mortality. SN and reconstituted SN water caused similar effects on hatching, swim bladder inflation, growth and swimming activity. A canonical discriminant analysis confirmed a high similarity between both exposure scenarios, indicating that the observed toxicity was indeed primarily caused by metals. The applied workflow could be a valuable approach to evaluate mixture toxicity that limits time and costs while maintaining biological relevance.

  12. From the field: Efficacy of detecting Chronic Wasting Disease via sampling hunter-killed white-tailed deer

    USGS Publications Warehouse

    Diefenbach, D.R.; Rosenberry, C.S.; Boyd, Robert C.

    2004-01-01

    Surveillance programs for Chronic Wasting Disease (CWD) in free-ranging cervids often use a standard of being able to detect 1% prevalence when determining minimum sample sizes. However, 1% prevalence may represent >10,000 infected animals in a population of 1 million, and most wildlife managers would prefer to detect the presence of CWD when far fewer infected animals exist. We wanted to detect the presence of CWD in white-tailed deer (Odocoileus virginianus) in Pennsylvania when the disease was present in only 1 of 21 wildlife management units (WMUs) statewide. We used computer simulation to estimate the probability of detecting CWD based on a sampling design to detect the presence of CWD at 0.1% and 1.0% prevalence (23-76 and 225-762 infected deer, respectively) using tissue samples collected from hunter-killed deer. The probability of detection at 0.1% prevalence was <30% with sample sizes of ???6,000 deer, and the probability of detection at 1.0% prevalence was 46-72% with statewide sample sizes of 2,000-6,000 deer. We believe that testing of hunter-killed deer is an essential part of any surveillance program for CWD, but our results demonstrated the importance of a multifaceted surveillance approach for CWD detection rather than sole reliance on testing hunter-killed deer.

  13. Sampling blood from big brown bats (Eptesicus fuscus) in the field with and without anesthesia: Impacts on survival

    USGS Publications Warehouse

    Ellison, L.E.; O'Shea, T.J.; Wimsatt, J.; Pearce, R.D.; Neubaum, D.J.; Neubaum, M.A.; Bowen, R.A.

    2006-01-01

    Blood was collected from wild big brown bats (Eptesicus fuscus) with and without anesthesia in Fort Collins, Colorado in 2004 to assess the impacts of these procedures on short-term survival and 1-yr return rates. Short-term survival and 1-yr return rates after release were passively monitored using PIT tag detection hoops placed at selected buildings. Comparison of 14-day maximum likelihood survival estimates from bats not bled (142 adult females, 62 volant juveniles), and bats sampled for blood with anesthesia (96 adult females, 23 volant juveniles) and without anesthesia (112 adult females, 22 volant juveniles) indicated no adverse effects of either treatment (juveniles: X2=53.38, df=41, P=0.09; adults: X2=39.09, df=44, P=0.68). Return rates of bats one year after sampling were similar among adult female controls (75.4%, n=142, 95% CI=67.4-82.2%), females sampled for blood with anesthesia (83.0%, n=112, 95% CI=74.8-89.5%), and females sampled without anesthesia (87.5%, n=96, 95% CI=79.2-93.4%). Lack of an effect was also noted in 1-yr return rates of juvenile females. These data suggest that the use of anesthesia during sampling of blood has no advantages in terms of enhancement of survival in big brown bats. ?? Wildlife Disease Association 2006.

  14. Assessment of the Minimum Sampling Frequency to Avoid Measurement Redundancy in Microclimate Field Surveys in Museum Buildings

    PubMed Central

    García-Diego, Fernando-Juan; Verticchio, Elena; Beltrán, Pedro; Siani, Anna Maria

    2016-01-01

    Monitoring temperature and relative humidity of the environment to which artefacts are exposed is fundamental in preventive conservation studies. The common approach in setting measuring instruments is the choice of a high sampling rate to detect short fluctuations and increase the accuracy of statistical analysis. However, in recent cultural heritage standards the evaluation of variability is based on moving average and short fluctuations and therefore massive acquisition of data in slowly-changing indoor environments could end up being redundant. In this research, the sampling frequency to set a datalogger in a museum room and inside a microclimate frame is investigated by comparing the outcomes obtained from datasheets associated with different sampling conditions. Thermo-hygrometric data collected in the Sorolla room of the Pio V Museum of Valencia (Spain) were used and the widely consulted recommendations issued in UNI 10829:1999 and EN 15757:2010 standards and in the American Society of Heating, Air-Conditioning and Refrigerating Engineers (ASHRAE) guidelines were applied. Hourly sampling proved effective in obtaining highly reliable results. Furthermore, it was found that in some instances daily means of data sampled every hour can lead to the same conclusions as those of high frequency. This allows us to improve data logging design and manageability of the resulting datasheets. PMID:27537886

  15. Assessment of the Minimum Sampling Frequency to Avoid Measurement Redundancy in Microclimate Field Surveys in Museum Buildings.

    PubMed

    García-Diego, Fernando-Juan; Verticchio, Elena; Beltrán, Pedro; Siani, Anna Maria

    2016-08-15

    Monitoring temperature and relative humidity of the environment to which artefacts are exposed is fundamental in preventive conservation studies. The common approach in setting measuring instruments is the choice of a high sampling rate to detect short fluctuations and increase the accuracy of statistical analysis. However, in recent cultural heritage standards the evaluation of variability is based on moving average and short fluctuations and therefore massive acquisition of data in slowly-changing indoor environments could end up being redundant. In this research, the sampling frequency to set a datalogger in a museum room and inside a microclimate frame is investigated by comparing the outcomes obtained from datasheets associated with different sampling conditions. Thermo-hygrometric data collected in the Sorolla room of the Pio V Museum of Valencia (Spain) were used and the widely consulted recommendations issued in UNI 10829:1999 and EN 15757:2010 standards and in the American Society of Heating, Air-Conditioning and Refrigerating Engineers (ASHRAE) guidelines were applied. Hourly sampling proved effective in obtaining highly reliable results. Furthermore, it was found that in some instances daily means of data sampled every hour can lead to the same conclusions as those of high frequency. This allows us to improve data logging design and manageability of the resulting datasheets.

  16. Evaluating Complex Mixtures in the Zebrafish Embryo by Reconstituting Field Water Samples: A Metal Pollution Case Study

    PubMed Central

    Michiels, Ellen D. G.; Vergauwen, Lucia; Hagenaars, An; Fransen, Erik; Dongen, Stefan Van; Van Cruchten, Steven J.; Bervoets, Lieven; Knapen, Dries

    2017-01-01

    Accurately assessing the toxicity of complex, environmentally relevant mixtures remains an important challenge in ecotoxicology. The goal was to identify biological effects after exposure to environmental water samples and to determine whether the observed effects could be explained by the waterborne metal mixture found in the samples. Zebrafish embryos were exposed to water samples of five different sites originating from two Flemish (Mol and Olen, Belgium) metal contaminated streams: “Scheppelijke Nete” (SN) and “Kneutersloop” (K), and a ditch (D), which is the contamination source of SN. Trace metal concentrations, and Na, K, Mg and Ca concentrations were measured using ICP-MS and were used to reconstitute site-specific water samples. We assessed whether the effects that were observed after exposure to environmental samples could be explained by metal mixture toxicity under standardized laboratory conditions. Exposure to “D” or “reconstituted D” water caused 100% mortality. SN and reconstituted SN water caused similar effects on hatching, swim bladder inflation, growth and swimming activity. A canonical discriminant analysis confirmed a high similarity between both exposure scenarios, indicating that the observed toxicity was indeed primarily caused by metals. The applied workflow could be a valuable approach to evaluate mixture toxicity that limits time and costs while maintaining biological relevance. PMID:28257097

  17. In situ chemistry and microbial community compositions in five deep-sea hydrothermal fluid samples from Irina II in the Logatchev field.

    PubMed

    Perner, Mirjam; Gonnella, Giorgio; Hourdez, Stephane; Böhnke, Stefanie; Kurtz, Stefan; Girguis, Peter

    2013-05-01

    We present data on the co-registered geochemistry (in situ mass spectrometry) and microbiology (pyrosequencing of 16S rRNA genes; V1, V2, V3 regions) in five fluid samples from Irina II in the Logatchev hydrothermal field. Two samples were collected over 24 min from the same spot and further three samples were from spatially distinct locations (20 cm, 3 m and the overlaying plume). Four low-temperature hydrothermal fluids from the Irina II are composed of the same core bacterial community, namely specific Gammaproteobacteria and Epsilonproteobacteria, which, however, differs in the relative abundance. The microbial composition of the fifth sample (plume) is considerably different. Although a significant correlation between sulfide enrichment and proportions of Sulfurovum (Epsilonproteobacteria) was found, no other significant linkages between abiotic factors, i.e. temperature, hydrogen, methane, sulfide and oxygen, and bacterial lineages were evident. Intriguingly, bacterial community compositions of some time series samples from the same spot were significantly more similar to a sample collected 20 cm away than to each other. Although this finding is based on three single samples only, it provides first hints that single hydrothermal fluid samples collected on a small spatial scale may also reflect unrecognized temporal variability. However, further studies are required to support this hypothesis.

  18. Using Inverse Probability Bootstrap Sampling to Eliminate Sample Induced Bias in Model Based Analysis of Unequal Probability Samples.

    PubMed

    Nahorniak, Matthew; Larsen, David P; Volk, Carol; Jordan, Chris E

    2015-01-01

    In ecology, as in other research fields, efficient sampling for population estimation often drives sample designs toward unequal probability sampling, such as in stratified sampling. Design based statistical analysis tools are appropriate for seamless integration of sample design into the statistical analysis. However, it is also common and necessary, after a sampling design has been implemented, to use datasets to address questions that, in many cases, were not considered during the sampling design phase. Questions may arise requiring the use of model based statistical tools such as multiple regression, quantile regression, or regression tree analysis. However, such model based tools may require, for ensuring unbiased estimation, data from simple random samples, which can be problematic when analyzing data from unequal probability designs. Despite numerous method specific tools available to properly account for sampling design, too often in the analysis of ecological data, sample design is ignored and consequences are not properly considered. We demonstrate here that violation of this assumption can lead to biased parameter estimates in ecological research. In addition, to the set of tools available for researchers to properly account for sampling design in model based analysis, we introduce inverse probability bootstrapping (IPB). Inverse probability bootstrapping is an easily implemented method for obtaining equal probability re-samples from a probability sample, from which unbiased model based estimates can be made. We demonstrate the potential for bias in model-based analyses that ignore sample inclusion probabilities, and the effectiveness of IPB sampling in eliminating this bias, using both simulated and actual ecological data. For illustration, we considered three model based analysis tools--linear regression, quantile regression, and boosted regression tree analysis. In all models, using both simulated and actual ecological data, we found inferences to be

  19. Using Inverse Probability Bootstrap Sampling to Eliminate Sample Induced Bias in Model Based Analysis of Unequal Probability Samples

    PubMed Central

    Nahorniak, Matthew

    2015-01-01

    In ecology, as in other research fields, efficient sampling for population estimation often drives sample designs toward unequal probability sampling, such as in stratified sampling. Design based statistical analysis tools are appropriate for seamless integration of sample design into the statistical analysis. However, it is also common and necessary, after a sampling design has been implemented, to use datasets to address questions that, in many cases, were not considered during the sampling design phase. Questions may arise requiring the use of model based statistical tools such as multiple regression, quantile regression, or regression tree analysis. However, such model based tools may require, for ensuring unbiased estimation, data from simple random samples, which can be problematic when analyzing data from unequal probability designs. Despite numerous method specific tools available to properly account for sampling design, too often in the analysis of ecological data, sample design is ignored and consequences are not properly considered. We demonstrate here that violation of this assumption can lead to biased parameter estimates in ecological research. In addition, to the set of tools available for researchers to properly account for sampling design in model based analysis, we introduce inverse probability bootstrapping (IPB). Inverse probability bootstrapping is an easily implemented method for obtaining equal probability re-samples from a probability sample, from which unbiased model based estimates can be made. We demonstrate the potential for bias in model-based analyses that ignore sample inclusion probabilities, and the effectiveness of IPB sampling in eliminating this bias, using both simulated and actual ecological data. For illustration, we considered three model based analysis tools—linear regression, quantile regression, and boosted regression tree analysis. In all models, using both simulated and actual ecological data, we found inferences to be

  20. A COMPARISON OF LIQUID AND GAS-PHASE PHOTOOXIDATION TREATMENT OF METHYL TERTIARY BUTYL ETHER: SYNTHETIC AND FIELD SAMPLES

    EPA Science Inventory

    The feasibility of photo-oxidation treatment of metyl tert-butyl either (MTBE) in water was investigated using two systems, 1) a slurry falling film photo-reactor, and 2) an integrated air-stripping with gas phase photooxidation system. MTBE-contaminated synthetic water and field...

  1. Spatial characteristics of white mould epidemics and the development of sequential sampling plans in Australian bean fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mould, caused by Sclerotinia sclerotiorum, causes losses to bean through reducing the marketable yield of pods by flower infections and stem rot. In Australia, entire fields may be rejected due to high disease incidence. The spatial characteristics of white mould epidemics were characterised...

  2. Prediction of cyclohexane-water distribution coefficient for SAMPL5 drug-like compounds with the QMPFF3 and ARROW polarizable force fields

    NASA Astrophysics Data System (ADS)

    Kamath, Ganesh; Kurnikov, Igor; Fain, Boris; Leontyev, Igor; Illarionov, Alexey; Butin, Oleg; Olevanov, Michael; Pereyaslavets, Leonid

    2016-11-01

    We present the performance of blind predictions of water—cyclohexane distribution coefficients for 53 drug-like compounds in the SAMPL5 challenge by three methods currently in use within our group. Two of them utilize QMPFF3 and ARROW, polarizable force-fields of varying complexity, and the third uses the General Amber Force-Field (GAFF). The polarizable FF's are implemented in an in-house MD package, Arbalest. We find that when we had time to parametrize the functional groups with care (batch 0), the polarizable force-fields outperformed the non-polarizable one. Conversely, on the full set of 53 compounds, GAFF performed better than both QMPFF3 and ARROW. We also describe the torsion-restrain method we used to improve sampling of molecular conformational space and thus the overall accuracy of prediction. The SAMPL5 challenge highlighted several drawbacks of our force-fields, such as our significant systematic over-estimation of hydrophobic interactions, specifically for alkanes and aromatic rings.

  3. MOF-5 metal-organic framework as sorbent for in-field sampling and preconcentration in combination with thermal desorption GC/MS for determination of atmospheric formaldehyde.

    PubMed

    Gu, Zhi-Yuan; Wang, Gen; Yan, Xiu-Ping

    2010-02-15

    Metal-organic frameworks (MOFs) are one kind of highly porous crystalline materials, which are constructed by metal-containing inorganic nodes and organic linkers. With large surface area and high thermal stability, MOFs have great potential as sorbents for the preconcentration of trace analytes. However, such application of MOFs to the analysis of real samples has not been reported before. Here we report the utilization of MOF-5 as sorbent for in-field sampling and preconcentration of atmospheric formaldehyde before thermal desorption (TD) GC/MS (TD-GC/MS) determination without the need for any chemical derivatization. MOF-5 gave a 53 and 73 times better concentration effect than Tenax TA (organic polymers) and Carbograph 1TD (graphitized carbon black), respectively, for TD-GC/MS determination of formaldehyde. MOF-5 showed good performance for in-field sampling and preconcentration of formaldehyde from air samples with a relative humidity less than 45%. The collected formaldehyde on MOF-5 sorbent was stable for at least 72 h at room temperature before TD-GC/MS analysis. One tube packed with 300 mg of MOF-5 lasted 200 cycles of adsorption/TD without significant loss of collection efficiency. The breakthrough volume of such a tube was 1.2 L of 28.35 mg m(-3) formaldehyde at a sampling flow rate of 100 mL min(-1). The use of MOF-5 for in-field sampling and preconcentration in combination with TD-GC/MS for the determination of formaldehyde offered a linear range covering 3 orders of magnitude, and a detection limit of 0.6 microg m(-3). The precision for six replicate cycles of in-field sampling and preconcentration for TD-GC/MS determination using one 300 mg MOF-5 packed tube ranged from 2.8% to 5.3%. The tube-to-tube reproducibility of three MOF-5 tubes prepared in parallel was 7.7%. The developed method was applied to analysis of local indoor and outdoor air samples for formaldehyde and validated by the standard method TO-11A of the United States Environmental

  4. Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

    PubMed

    Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

    2013-06-01

    Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

  5. Quantifying actual and theoretical ethanol yields for switchgrass strains using NIRS analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantifying actual and theoretical ethanol yields from biomass conversion processes such as simultanteous saccharification and fermentation (SSF) requires expensive, complex fermentation assays and extensive compositional analyses of the biomass sample. Near infrared reflectance spectroscopy (NIRS...

  6. Comparison of Precision of Biomass Estimates in Regional Field Sample Surveys and Airborne LiDAR-Assisted Surveys in Hedmark County, Norway

    NASA Technical Reports Server (NTRS)

    Naesset, Erik; Gobakken, Terje; Bollandsas, Ole Martin; Gregoire, Timothy G.; Nelson, Ross; Stahl, Goeran

    2013-01-01

    Airborne scanning LiDAR (Light Detection and Ranging) has emerged as a promising tool to provide auxiliary data for sample surveys aiming at estimation of above-ground tree biomass (AGB), with potential applications in REDD forest monitoring. For larger geographical regions such as counties, states or nations, it is not feasible to collect airborne LiDAR data continuously ("wall-to-wall") over the entire area of interest. Two-stage cluster survey designs have therefore been demonstrated by which LiDAR data are collected along selected individual flight-lines treated as clusters and with ground plots sampled along these LiDAR swaths. Recently, analytical AGB estimators and associated variance estimators that quantify the sampling variability have been proposed. Empirical studies employing these estimators have shown a seemingly equal or even larger uncertainty of the AGB estimates obtained with extensive use of LiDAR data to support the estimation as compared to pure field-based estimates employing estimators appropriate under simple random sampling (SRS). However, comparison of uncertainty estimates under SRS and sophisticated two-stage designs is complicated by large differences in the designs and assumptions. In this study, probability-based principles to estimation and inference were followed. We assumed designs of a field sample and a LiDAR-assisted survey of Hedmark County (HC) (27,390 km2), Norway, considered to be more comparable than those assumed in previous studies. The field sample consisted of 659 systematically distributed National Forest Inventory (NFI) plots and the airborne scanning LiDAR data were collected along 53 parallel flight-lines flown over the NFI plots. We compared AGB estimates based on the field survey only assuming SRS against corresponding estimates assuming two-phase (double) sampling with LiDAR and employing model-assisted estimators. We also compared AGB estimates based on the field survey only assuming two-stage sampling (the NFI

  7. Testing the application of Teflon/quartz soil solution samplers for DOM sampling in the Critical Zone: Field and laboratory approaches

    NASA Astrophysics Data System (ADS)

    Dolan, E. M.; Perdrial, J. N.; Vazquez, A.; Hernández, S.; Chorover, J.

    2010-12-01

    Elizabeth Dolan1,2, Julia Perdrial3, Angélica Vázquez-Ortega3, Selene Hernández-Ruiz3, Jon Chorover3 1Deptartment of Soil, Environmental, and Atmospheric Science, University of Missouri. 2Biosphere 2, University of Arizona. 3Deptartment of Soil, Water, and Environmental Science, University of Arizona. Abstract: The behavior of dissolved organic matter (DOM) in soil is important to many biogeochemical processes. Extraction methods to obtain DOM from the unsaturated zone remain a current focus of research as different methods can influence the type and concentration of DOM obtained. Thus, the present comparison study involves three methods for soil solution sampling to assess their impact on DOM quantity and quality: 1) aqueous soil extracts, 2) solution yielded from laboratory installed suction cup samplers and 3) solutions from field installed suction cup samplers. All samples were analyzed for dissolved organic carbon and total nitrogen concentrations. Moreover, DOM quality was analyzed using fluorescence, UV-Vis and FTIR spectroscopies. Results indicate higher DOC values for laboratory extracted DOM: 20 mg/L for aqueous soil extracts and 31 mg/L for lab installed samplers compared to 12 mg/L for field installed samplers. Large variations in C/N ratios were also observed ranging from 1.5 in laboratory extracted DOM to 11 in field samples. Fluorescence excitation-emission matrices of DOM solutions obtained for the laboratory extraction methods showed higher intensities in regions typical for fulvic and humic acid-like materials relative to those extracted in the field. Similarly, the molar absorptivity calculated from DOC concentration normalization of UV-Vis absorbance of the laboratory-derived solutions was significantly higher as well, indicating greater aromaticity. The observed differences can be attributed to soil disturbance associated with obtaining laboratory derived solution samples. Our results indicate that laboratory extraction methods are not

  8. The Actual Apollo 13 Prime Crew

    NASA Technical Reports Server (NTRS)

    1970-01-01

    The actual Apollo 13 lunar landing mission prime crew from left to right are: Commander, James A. Lovell Jr., Command Module pilot, John L. Swigert Jr.and Lunar Module pilot, Fred W. Haise Jr. The original Command Module pilot for this mission was Thomas 'Ken' Mattingly Jr. but due to exposure to German measles he was replaced by his backup, Command Module pilot, John L. 'Jack' Swigert Jr.

  9. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    PubMed

    Knüsel, R; Bergmann, S M; Einer-Jensen, K; Casey, J; Segner, H; Wahli, T

    2007-09-01

    This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and/or demonstrated positive anti-VHSV-antibody titres (83 sites, 121 positive blood samples) in a serum plaque neutralization test (SPNT). The RT-PCR technique confirmed the four VHSV-positive tissue sample pools detected by virus isolation and additionally identified one VHSV-positive sample that showed positive anti-VHSV-AB titres, but was negative in virus isolation. With IHNV, RT-PCR detected two positive samples not identified by virus isolation while in these fish the SPNT result had been questionable. One of the IHNV-positive samples represents the first detection of IHNV-RNA in wild brown trout in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus isolation. However, in a titration experiment under laboratory conditions, the sensitivity of RT-PCR was not significantly higher when compared with virus isolation.

  10. Use of depuration compounds in passive air samplers: results from active sampling-supported field deployment, potential uses, and recommendations.

    PubMed

    Moeckel, Claudia; Harner, Tom; Nizzetto, Luca; Strandberg, Bo; Lindroth, Anders; Jones, Kevin C

    2009-05-01

    Depuration compounds (DCs) are added to passive air samplers (PAS) prior to deployment to account for the wind-dependency of the sampling rate for gas-phase compounds. This correction is particularly useful for providing comparable data for samplers that are deployed in different environments and subject to different meteorological conditions such as wind speeds. Two types of PAS--the polyurethane foam (PUF) disk sampler and semipermeable membrane devices (SPMDs)--were deployed at eight heights on a 100 m tower to test whether the DC approach could yield air concentrations profiles for PCBs and organochlorine pesticides and account for the wind speed gradient with height. Average wind speeds ranged from 0.3 to 4.5 m s(-1) over the 40 day deployment, increasing with height Two low volume active air samples (AAS), one collected at 25 m and one at 73 m over the 40 day deployment showed no significant concentration differences for target compounds. As expected, the target compounds taken up by PAS reflected the wind profile with height This wind-dependency of the PAS was also reflected in the results of the DCs. A correction based on the DC approach successfully accounted for the effect of wind on PAS sampling rates, yielding a profile consistent with the AAS. Interestingly, in terms of absolute air concentrations, there were differences between the AAS and PAS-derived values for some target compounds. These were attributed to different sampling characteristics of the two approaches that may have resulted in slightly different air masses being sampled. Based on the results of this study, guidelines are presented for the use of DCs and for the calibration of PAS using AAS.

  11. Analysis of a novel field dilution method for testing samples that exceed the analytic range of point-of-care blood lead analyzers.

    PubMed

    Neri, Antonio James; Roy, Joannie; Jarrett, Jeffery; Pan, Yi; Dooyema, Carrie; Caldwell, Kathleen; Umar-Tsafe, Nasir Tsafe; Olubiyo, Ruth; Brown, Mary Jean

    2014-01-01

    Investigators developed and evaluated a dilution method for the LeadCare II analyzer (LCII) for blood lead levels >65 μg/dL, the analyzer's maximum reporting value. Venous blood samples from lead-poisoned children were initially analyzed in the field using the dilution method. Split samples were analyzed at the US Centers for Disease Control and Prevention (CDC) laboratory using both the dilution method and inductively coupled plasma-mass spectrometry (ICP-MS). The concordance correlation coefficient of CDC LCII vs. ICP-MS values (N = 211) was 0.976 (95 % confidence interval (CI) 0.970-0.981); of Field LCII vs. ICP-MS (N = 68) was 0.910 (95% CI 0.861-0.942), and CDC LCII vs. Field LCII (N = 53) was 0.721 (95% CI 0.565-0.827). Sixty percent of CDC and 54% of Field LCII values were within ±10% of the ICP-MS value. Results from the dilution method approximated ICP-MS values and were useful for field-based decision-making. Specific recommendations for additional evaluation are provided.

  12. Design and evaluation of a field study on the contamination of selected volatile organic compounds and wastewater-indicator compounds in blanks and groundwater samples

    USGS Publications Warehouse

    Thiros, Susan A.; Bender, David A.; Mueller, David K.; Rose, Donna L.; Olsen, Lisa D.; Martin, Jeffrey D.; Bernard, Bruce; Zogorski, John S.

    2011-01-01

    The Field Contamination Study (FCS) was designed to determine the field processes that tend to result in clean field blanks and to identify potential sources of contamination to blanks collected in the field from selected volatile organic compounds (VOCs) and wastewater-indicator compounds (WICs). The VOCs and WICs analyzed in the FCS were detected in blanks collected by the U.S. Geological Survey (USGS) National Water-Quality Assessment (NAWQA) Program during 1996-2008 and 2002-08, respectively. To minimize the number of variables, the study required ordering of supplies just before sampling, storage of supplies and equipment in clean areas, and use of adequate amounts of purge-and-trap volatile-grade methanol and volatile pesticide-grade blank water (VPBW) to clean sampling equipment and to collect field blanks. Blanks and groundwater samples were collected during 2008-09 at 16 sites, which were a mix of water-supply and monitoring wells, located in 9 States. Five different sample types were collected for the FCS at each site: (1) a source-solution blank collected at the USGS National Water Quality Laboratory (NWQL) using laboratory-purged VPBW, (2) source-solution blanks collected in the field using laboratory-purged VPBW, (3) source-solution blanks collected in the field using field-purged VPBW, (4) a field blank collected using field-purged VPBW, and (5) a groundwater sample collected from a well. The source-solution blank and field-blank analyses were used to identify, quantify, and document extrinsic contamination and to help determine the sources and causes of data-quality problems that can affect groundwater samples. Concentrations of compounds detected in FCS analyses were quantified and results were stored in the USGS National Water Information System database after meeting rigorous identification and quantification criteria. The study also utilized information provided by laboratory analysts about evidence indicating the presence of selected compounds

  13. Development of a Multiplexed, Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples. Final Report

    SciTech Connect

    Lowe, M.; Halden, R.

    2002-10-09

    This was the final report for DOE NABIR grant DE-FG02-01ER63264 (PI Mary Lowe). The grant was entitled ''Development of a Multiplexed Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples.'' The grant duration was one year. The purpose was to develop a bead-based assay for measuring analyte DNAs in environmental PCR products and to apply the method to a field experiment. The primary experiment was located at the UMTRA Old Rifle site.

  14. Potential, velocity, and density fields from redshift-distance samples: Application - Cosmography within 6000 kilometers per second

    NASA Technical Reports Server (NTRS)

    Bertschinger, Edmund; Dekel, Avishai; Faber, Sandra M.; Dressler, Alan; Burstein, David

    1990-01-01

    A potential flow reconstruction algorithm has been applied to the real universe to reconstruct the three-dimensional potential, velocity, and mass density fields smoothed on large scales. The results are shown as maps of these fields, revealing the three-dimensional structure within 6000 km/s distance from the Local Group. The dominant structure is an extended deep potential well in the Hydra-Centaurus region, stretching across the Galactic plane toward Pavo, broadly confirming the Great Attractor (GA) model of Lynden-Bell et al. (1988). The Local Supercluster appears to be an extended ridge on the near flank of the GA, proceeding through the Virgo Southern Extension to the Virgo and Ursa Major clusters. The Virgo cluster and the Local Group are both falling toward the bottom of the GA potential well with peculiar velocities of 658 + or - 121 km/s and 565 + or - 125 km/s, respectively.

  15. Development of novel enzyme potentiometric biosensor based on pH-sensitive field-effect transistors for aflatoxin B1 analysis in real samples.

    PubMed

    Stepurska, K V; Soldatkin, O O; Arkhypova, V M; Soldatkin, A P; Lagarde, F; Jaffrezic-Renault, N; Dzyadevych, S V

    2015-11-01

    This study aimed at the development and optimization of a potentiometric biosensor based on pH-sensitive field-effect transistors and acetylcholinesterase for aflatoxin B1 determination in real samples. Optimal conditions for bioselective elements operation were defined and analytical characteristics of the proposed biosensor were studied. The proposed biosensor characterized high operational stability and reproducibility of signal. Selectivity of acetylcholinesterase-biosensor to aflatoxins in relation to other groups of toxic substances was analyzed. The developed biosensor was applied to the determination of aflatoxin B1 in real samples (sesame, walnut and pea).

  16. Characterizing the risk assessment of heavy metals and sampling uncertainty analysis in paddy field by geostatistics and GIS.

    PubMed

    Liu, Xingmei; Wu, Jianjun; Xu, Jianming

    2006-05-01

    For many practical problems in environmental management, information about soil heavy metals, relative to threshold values that may be of practical importance is needed at unsampled sites. The Hangzhou-Jiaxing-Huzhou (HJH) Plain has always been one of the most important rice production areas in Zhejiang province, China, and the soil heavy metal concentration is directly related to the crop quality and ultimately the health of people. Four hundred and fifty soil samples were selected in topsoil in HJH Plain to characterize the spatial variability of Cu, Zn, Pb, Cr and Cd. Ordinary kriging and lognormal kriging were carried out to map the spatial patterns of heavy metals and disjunctive kriging was used to quantify the probability of heavy metal concentrations higher than their guide value. Cokriging method was used to minimize the sampling density for Cu, Zn and Cr. The results of this study could give insight into risk assessment of environmental pollution and decision-making for agriculture.

  17. Field trial of applicability of lot quality assurance sampling survey method for rapid assessment of prevalence of active trachoma.

    PubMed Central

    Myatt, Mark; Limburg, Hans; Minassian, Darwin; Katyola, Damson

    2003-01-01

    OBJECTIVE: To test the applicability of lot quality assurance sampling (LQAS) for the rapid assessment of the prevalence of active trachoma. METHODS: Prevalence of active trachoma in six communities was found by examining all children aged 2-5 years. Trial surveys were conducted in these communities. A sampling plan appropriate for classifying communities with prevalences < or =20% and > or =40% was applied to the survey data. Operating characteristic and average sample number curves were plotted, and screening test indices were calculated. The ability of LQAS to provide a three-class classification system was investigated. FINDINGS: Ninety-six trial surveys were conducted. All communities with prevalences < or =20% and > or =40% were identified correctly. The method discriminated between communities with prevalences < or =30% and >30%, with sensitivity of 98% (95% confidence interval (CI)=88.2-99.9%), specificity of 84.4% (CI=69.9-93.0%), positive predictive value of 87.7% (CI=75.7-94.5%), negative predictive value of 97.4% (CI=84.9-99.9%), and accuracy of 91.7% (CI=83.8-96.1%). Agreement between the three prevalence classes and survey classifications was 84.4% (CI=75.2-90.7%). The time needed to complete the surveys was consistent with the need to complete a survey in one day. CONCLUSION: Lot quality assurance sampling provides a method of classifying communities according to the prevalence of active trachoma. It merits serious consideration as a replacement for the assessment of the prevalence of active trachoma with the currently used trachoma rapid assessment method. It may be extended to provide a multi-class classification method. PMID:14997240

  18. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  19. Field sampling rate of BG-sentinel traps for Aedes aegypti (Diptera: Culicidae) in suburban Cairns, Australia.

    PubMed

    Johnson, P H; Spitzauer, V; Ritchie, S A

    2012-01-01

    Mini-mark-release-recapture experiments were conducted in suburban Cairns, Australia to establish the sampling rate of the Biogents-Sentinel (BGS) trap for adult Aedes aegypti (L.). Small cohorts of marked mosquitoes (30 females and 15 males) were released at typical Cairns residences, and the number of marked mosquitoes recaptured in the BGS trap after 24 h was recorded. The sampling rate was compared between two seasons and two common housing styles (high-set 'Queenslander-style' timber and low-set brick houses), between old gravid and young nulliparous females, and between mosquitoes released in different areas of a house. Overall, the BGS traps recaptured a mean (+/- SEM) of 24.6% (+/- 1.9) of the released marked female mosquitoes in 24 h. The mean recapture rate for females was significantly higher in the dry season (30.4% +/- 2.8) compared with the wet (18.8% +/- 2.2). The overall recapture rates did not differ significantly between the two house types, but variability between the individual premises was high. An overall mean of 18.2% (+/- 1.7) of males was collected. Recapture rates of young nullipars and older gravid females were similar. These recapture rates can be used to estimate the population density of Ae. aegypti females in north Queensland, although it will provide an underestimate as trap sample was largely representative of mosquitoes present in the same area as the trap, and not from other areas of the house.

  20. Frequency distribution of mineral elements in samples of alfalfa and sugar beet leaves obtained from a common field in Imperial Valley, California

    SciTech Connect

    Wallace, A.; Romney, E.M.; Kinnear, J.

    1982-07-01

    Baseline measurements were made of mineral composition of alfalfa (Medicago sativa L.) and sugar beets (Beta vulgaris L.) from one field each in the Imperial Valley of California. The fields are in a geothermal area being developed for energy production, and the purpose of the investigation was to ascertain variablility within a relatively large number of samples from a common area, so that subsequent samplings could be made to satisfactorily detect whether there were changes resulting from the geothermal activity. Means, standard deviations, frequency distribution, correlations, cluster trees, and other statistics were examined for over 20 elements at each site.Most elements were normally distributed, but there was three- to fourfold range in the concentration for each.

  1. Delineating high-density areas in spatial Poisson fields from strip-transect sampling using indicator geostatistics: application to unexploded ordnance removal.

    PubMed

    Saito, Hirotaka; McKenna, Sean A

    2007-07-01

    An approach for delineating high anomaly density areas within a mixture of two or more spatial Poisson fields based on limited sample data collected along strip transects was developed. All sampled anomalies were transformed to anomaly count data and indicator kriging was used to estimate the probability of exceeding a threshold value derived from the cdf of the background homogeneous Poisson field. The threshold value was determined so that the delineation of high-density areas was optimized. Additionally, a low-pass filter was applied to the transect data to enhance such segmentation. Example calculations were completed using a controlled military model site, in which accurate delineation of clusters of unexploded ordnance (UXO) was required for site cleanup.

  2. Comparison of culture versus quantitative real-time polymerase chain reaction for the detection of Taylorella equigenitalis in field samples from naturally infected horses in Canada and Germany.

    PubMed

    Nadin-Davis, Susan; Knowles, Margaret K; Burke, Teresa; Böse, Reinhard; Devenish, John

    2015-07-01

    A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment.

  3. Monitoring of selected pesticides residue levels in water samples of paddy fields and removal of cypermethrin and chlorpyrifos residues from water using rice bran.

    PubMed

    Bhattacharjee, Shubhra; Fakhruddin, A N M; Chowdhury, M A Z; Rahman, M A; Alam, M K

    2012-08-01

    Consumption of pesticides associated foods increased in recent decades in Bangladesh. Most of the pesticides come from paddy, as rice is the main food items here and about 70 % pesticides are used only on paddy fields. Water samples of paddy fields and Kaliganga River of Manikganj district were analyzed to provide base line data on cypermethrin, chlorpyrifos and diazinon residue by using high performance liquid chromatography. Levels of Cypermethrin, chlorpyrifos and diazinon detected in the paddy field water samples were (0.605 ± 0.011 μg/L), (0.06 ± 0.001 μg/L) and (0.039 ± 0.002 μg/L), respectively. 0.11 ± 0.003 μg/L of cypermethrin and 0.012 ± 0.0006 μg/L of chlorpyrifos were also identified in the water samples of Kaligonga River. Diazinon residue was not detected in the river water samples. The detected concentrations of pesticide residues in the river water were below the accepted maximum residue limit (MRL) value of drinking water (0.1 μg/l) adopted by the FAO/WHO Codex Alimentarius Commission. Cypermethrin and chlorpyrifos were chosen for decontamination through rice bran, as it was found in river water. Two gm rice bran could easily decontaminated 95.6 % and 96.4 % of cypermethrin and chlorpyrifos. The result of this study showed that pesticide residue was detected in water samples were below the MRLs value, which can easily be decontaminated through absorption of rice bran.

  4. Coexistence in Field Samples of Two Variants of the Infectious Salmon Anemia Virus: A Putative Shift to Pathogenicity

    PubMed Central

    Cárdenas, Constanza; Carmona, Marisela; Gallardo, Alicia; Labra, Alvaro; Marshall, Sergio H.

    2014-01-01

    Genetic reassortment plays an important role in the evolution of several segmented RNA viruses and in the epidemiology of their associated diseases. In particular, orthomyxoviruses show rapid fluctuation in the proportion of viral variants coexisting in an infected individual, especially under strong selective pressure. This is particularly relevant in salmon production carried out under confined and stressful conditions where one of the most feared pathogenic agents is the Infectious Salmon Anemia Virus, an orthomyxovirus family member whose biological behavior is only recently beginning to be understood. Pathogenicity of the virus has been mainly associated with deletions of the HPR region in coding segment 6 and the presence or absence of a specific insertion in a key region in coding segment 5. In this study we report, for the first time in Chile, the coexistence of two variants in fully asymptomatic fish. Of five samples analyzed, two were identified as the non-pathogenic variant, HPR0, and two as the highly pathogenic HPR7b variant, though with no clinical signs detectable in the fish. Interestingly, one of the samples unequivocally carried both variants, again without any clinical signs. Considering that in none of the samples the typical insertion in coding segment 5 was detected, it is our impression that this may represent a shift from the non-pathogenic HPR0 variant towards the highly infective HPR7b variant. If this were the case, the transition may be triggered first by deleting the corresponding sequence of the HPR region of segment 6, followed by the putative insertion in segment 5 to generate a virulent strain. PMID:24498206

  5. Possibilities and limitations of the ART-Sample algorithm for reconstruction of 3D temperature fields and the influence of opaque obstacles

    PubMed Central

    Li, Yuanyang; Herman, Cila

    2013-01-01

    The need for the measurement of complex, unsteady, three-dimensional (3D) temperature distributions arises in a variety of engineering applications, and tomographic techniques are applied to accomplish this goal. Holographic interferometry (HI), one of the optical methods used for visualizing temperature fields, combined with tomographic reconstruction techniques requires multi-directional interferometric data to recover the 3D information. However, the presence of opaque obstacles (such as solid objects in the flow field and heaters) in the measurement volume, prevents the probing light beams from traversing the entire measurement volume. As a consequence, information on the average value of the field variable will be lost in regions located in the shade of the obstacle. The capability of the ART-Sample tomographic reconstruction method to recover 3D temperature distributions both in unobstructed temperature fields and in the presence of opaque obstacles is discussed in this paper. A computer code for tomographic reconstruction of 3D temperature fields from 2D projections was developed. In the paper, the reconstruction accuracy is discussed quantitatively both without and with obstacles in the measurement volume for a set of phantom functions mimicking realistic temperature distributions. The reconstruction performance is optimized while minimizing the number of irradiation directions (experimental hardware requirements) and computational effort. For the smooth temperature field both with and without obstacles, the reconstructions produced by this algorithm are good, both visually and using quantitative criteria. The results suggest that the location and the size of the obstacle and the number of viewing directions will affect the reconstruction of the temperature field. When the best performance parameters of the ART-Sample algorithm identified in this paper are used to reconstruct the 3D temperature field, the 3D reconstructions with and without obstacle are

  6. Terahertz cyclotron resonance spectroscopy of an AlGaN/GaN heterostructure using a high-field pulsed magnet and an asynchronous optical sampling technique

    NASA Astrophysics Data System (ADS)

    Spencer, B. F.; Smith, W. F.; Hibberd, M. T.; Dawson, P.; Beck, M.; Bartels, A.; Guiney, I.; Humphreys, C. J.; Graham, D. M.

    2016-05-01

    The effective mass, sheet carrier concentration, and mobility of electrons within a two-dimensional electron gas in an AlGaN/GaN heterostructure were determined using a laboratory-based terahertz cyclotron resonance spectrometer. The ability to perform terahertz cyclotron resonance spectroscopy with magnetic fields of up to 31 T was enabled by combining a high-field pulsed magnet with a modified asynchronous optical sampling terahertz detection scheme. This scheme allowed around 100 transmitted terahertz waveforms to be recorded over the 14 ms magnetic field pulse duration. The sheet density and mobility were measured to be 8.0 × 1012 cm-2 and 9000 cm2 V-1 s-1 at 77 K. The in-plane electron effective mass at the band edge was determined to be 0.228 ± 0.002m0.

  7. Development of a Spatially Targeted Field Sampling Technique for the Southern Cattle Tick, Rhipicephalus microplus, by Mapping Whitetailed Deer, Odocoileus virginianus, Habitat in South Texas

    PubMed Central

    Phillips, Pamela L.; Welch, John B.; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field. PMID:25368044

  8. Development of a spatially targeted field sampling technique for the southern cattle tick, Rhipicephalus microplus, by mapping white-tailed deer, Odocoileus virginianus, habitat in South Texas.

    PubMed

    Phillips, Pamela L; Welch, John B; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field.

  9. Explosive Percolation Transition is Actually Continuous

    NASA Astrophysics Data System (ADS)

    da Costa, R. A.; Dorogovtsev, S. N.; Goltsev, A. V.; Mendes, J. F. F.

    2010-12-01

    Recently a discontinuous percolation transition was reported in a new “explosive percolation” problem for irreversible systems [D. Achlioptas, R. M. D’Souza, and J. Spencer, Science 323, 1453 (2009)SCIEAS0036-807510.1126/science.1167782] in striking contrast to ordinary percolation. We consider a representative model which shows that the explosive percolation transition is actually a continuous, second order phase transition though with a uniquely small critical exponent of the percolation cluster size. We describe the unusual scaling properties of this transition and find its critical exponents and dimensions.

  10. Neoadjuvant Treatment in Rectal Cancer: Actual Status

    PubMed Central

    Garajová, Ingrid; Di Girolamo, Stefania; de Rosa, Francesco; Corbelli, Jody; Agostini, Valentina; Biasco, Guido; Brandi, Giovanni

    2011-01-01

    Neoadjuvant (preoperative) concomitant chemoradiotherapy (CRT) has become a standard treatment of locally advanced rectal adenocarcinomas. The clinical stages II (cT3-4, N0, M0) and III (cT1-4, N+, M0) according to International Union Against Cancer (IUCC) are concerned. It can reduce tumor volume and subsequently lead to an increase in complete resections (R0 resections), shows less toxicity, and improves local control rate. The aim of this review is to summarize actual approaches, main problems, and discrepancies in the treatment of locally advanced rectal adenocarcinomas. PMID:22295206

  11. Air resistance measurements on actual airplane parts

    NASA Technical Reports Server (NTRS)

    Weiselsberger, C

    1923-01-01

    For the calculation of the parasite resistance of an airplane, a knowledge of the resistance of the individual structural and accessory parts is necessary. The most reliable basis for this is given by tests with actual airplane parts at airspeeds which occur in practice. The data given here relate to the landing gear of a Siemanms-Schuckert DI airplane; the landing gear of a 'Luftfahrzeug-Gesellschaft' airplane (type Roland Dlla); landing gear of a 'Flugzeugbau Friedrichshafen' G airplane; a machine gun, and the exhaust manifold of a 269 HP engine.

  12. A Modified Alderman-Grant Coil Makes Possible an Efficient Cross-Coil Probe for High Field Solid-state NMR of Lossy Biological Samples

    PubMed Central

    Grant, Christopher V.; Yang, Yuan; Glibowicka, Mira; Wu, Chin H.; Park, Sang Ho; Deber, Charles M.; Opella, Stanley J.

    2009-01-01

    The design, construction, and performance of a cross-coil double-resonance probe for solid-state NMR experiments on lossy biological samples at high magnetic fields are described. The outer coil is a Modified Alderman-Grant Coil (MAGC) tuned to the 1H frequency. The inner coil consists of a multi-turn solenoid coil that produces a B1 field orthogonal to that of the outer coil. This results in a compact nested cross-coil pair with the inner solenoid coil tuned to the low frequency detection channel. This design has several advantages over multiple-tuned solenoid coil probes, since RF heating from the 1H channel is substantially reduced, it can be tuned for samples with a wide range of dielectric constants, and the simplified circuit design and high inductance inner coil provides excellent sensitivity. The utility of this probe is demonstrated on two electrically lossy samples of membrane proteins in phospholipid bilayers (bicelles) that are particularly difficult for conventional NMR probes. The 72-residue polypeptide embedding the transmembrane helices 3 and 4 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (residues 194 – 241) requires a high salt concentration in order to be successfully reconstituted in phospholipid bicelles. A second application is to paramagnetic relaxation enhancement applied to the membrane-bound form of Pf1 coat protein in phospholipid bicelles where the resistance to sample heating enables high duty cycle solid-state NMR experiments to be performed. PMID:19733108

  13. An online field-amplification sample stacking method for the determination of diuretics in urine by capillary electrophoresis-amperometric detection.

    PubMed

    Zheng, Xinyu; Lu, Minghua; Zhang, Lan; Chi, Yuwu; Zheng, Lihui; Chen, Guonan

    2008-06-30

    A simple and sensitive online field-amplification sample stacking (FASS) pre-enrichment method following by capillary electrophoresis with amperometric detection has been developed for the determination of diuretics, such as indapamide (IDP), hydrochlorothiazide (HCT) and bumetanide (BMTN) in urine. Under the optimum conditions, it was found that the low concentration buffer solution could be used as the diluents for simultaneous field-amplification injection of three diuretics after electrokinetically injecting a short water plug (15 kV, 3 s). Three analytes could be well separated within 10 min in an uncoated fused-silica capillary with H(3)BO(3)-Na(2)B(4)O(7) (BB) buffer solution (pH 8.98). The detection limits (S/N=3) were 9.0 ng/mL for IDP, 20 ng/mL for HCT and 1.5 ng/mL for BMTN, respectively. The detection limits of three diuretics were much lower by FASS than that by conventional sample injection, of which the detection limits were 340, 890 and 330 ng/mL for IDP, HCT and BMTN, respectively. Especially, for bumetanide the detection limit was 220-time lower by FASS. The linear ranges of three diuretics were all over three orders of magnitude. The proposed method has been successfully applied to analyze the diuretics in human urine samples without off-column sample pre-concentration.

  14. A Modified Alderman-Grant Coil makes possible an efficient cross-coil probe for high field solid-state NMR of lossy biological samples

    NASA Astrophysics Data System (ADS)

    Grant, Christopher V.; Yang, Yuan; Glibowicka, Mira; Wu, Chin H.; Park, Sang Ho; Deber, Charles M.; Opella, Stanley J.

    2009-11-01

    The design, construction, and performance of a cross-coil double-resonance probe for solid-state NMR experiments on lossy biological samples at high magnetic fields are described. The outer coil is a Modified Alderman-Grant Coil (MAGC) tuned to the 1H frequency. The inner coil consists of a multi-turn solenoid coil that produces a B 1 field orthogonal to that of the outer coil. This results in a compact nested cross-coil pair with the inner solenoid coil tuned to the low frequency detection channel. This design has several advantages over multiple-tuned solenoid coil probes, since RF heating from the 1H channel is substantially reduced, it can be tuned for samples with a wide range of dielectric constants, and the simplified circuit design and high inductance inner coil provides excellent sensitivity. The utility of this probe is demonstrated on two electrically lossy samples of membrane proteins in phospholipid bilayers (bicelles) that are particularly difficult for conventional NMR probes. The 72-residue polypeptide embedding the transmembrane helices 3 and 4 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (residues 194-241) requires a high salt concentration in order to be successfully reconstituted in phospholipid bicelles. A second application is to paramagnetic relaxation enhancement applied to the membrane-bound form of Pf1 coat protein in phospholipid bicelles where the resistance to sample heating enables high duty cycle solid-state NMR experiments to be performed.

  15. Linking community tolerance and structure with low metallic contamination: a field study on 13 biofilms sampled across the Seine river basin.

    PubMed

    Fechner, Lise C; Gourlay-Francé, Catherine; Tusseau-Vuillemin, Marie-Hélène

    2014-03-15

    It is difficult to assess the biological consequences of diffuse water contamination by micropollutants which are present in rivers at low, even sublethal levels. River biofilms, which respond quickly to changes of environmental parameters, are good candidates to acquire knowledge on the response of aquatic organisms to diffuse chemical contamination in the field. The study was designed as an attempt to link biofilm metal tolerance and metallic contamination in a field survey covering 13 different sampling sites in the Seine river basin (north of France) with low contamination levels. Cd and Zn tolerance of heterotrophic communities was assessed using a short-term toxicity test based on β-glucosidase activity. Metal tolerance levels varied between sites but there was no obvious correlation between tolerance and corresponding water contamination levels for Cd and Zn. Indeed, metallic contamination at the sampling sites remained subtle when compared to water quality standards (only two sampling sites had either Zn or both Cu and Zn concentrations exceeding the Environmental Quality Standards set by the EU Water Framework Directive). Yet, multivariate analysis of the data using Partial Least Squares Regression revealed that both metallic and environmental parameters were important variables explaining the variability of metal tolerance levels. Automated Ribosomal Intergenic Spacer Analysis (ARISA) was also performed on both bacterial and eukaryotic biofilm communities from the 13 sampling sites. Multivariate analysis of ARISA fingerprints revealed that biofilms with similar tolerance levels have similar ARISA profiles. Those results confirm that river biofilms are potential indicators of low, diffuse contamination levels of aquatic systems.

  16. A Modified Alderman-Grant Coil makes possible an efficient cross-coil probe for high field solid-state NMR of lossy biological samples.

    PubMed

    Grant, Christopher V; Yang, Yuan; Glibowicka, Mira; Wu, Chin H; Park, Sang Ho; Deber, Charles M; Opella, Stanley J

    2009-11-01

    The design, construction, and performance of a cross-coil double-resonance probe for solid-state NMR experiments on lossy biological samples at high magnetic fields are described. The outer coil is a Modified Alderman-Grant Coil (MAGC) tuned to the (1)H frequency. The inner coil consists of a multi-turn solenoid coil that produces a B(1) field orthogonal to that of the outer coil. This results in a compact nested cross-coil pair with the inner solenoid coil tuned to the low frequency detection channel. This design has several advantages over multiple-tuned solenoid coil probes, since RF heating from the (1)H channel is substantially reduced, it can be tuned for samples with a wide range of dielectric constants, and the simplified circuit design and high inductance inner coil provides excellent sensitivity. The utility of this probe is demonstrated on two electrically lossy samples of membrane proteins in phospholipid bilayers (bicelles) that are particularly difficult for conventional NMR probes. The 72-residue polypeptide embedding the transmembrane helices 3 and 4 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (residues 194-241) requires a high salt concentration in order to be successfully reconstituted in phospholipid bicelles. A second application is to paramagnetic relaxation enhancement applied to the membrane-bound form of Pf1 coat protein in phospholipid bicelles where the resistance to sample heating enables high duty cycle solid-state NMR experiments to be performed.

  17. Combining field-amplified sample stacking with moving reaction boundary electrophoresis on a paper chip for the preconcentration and separation of metal ions.

    PubMed

    Ouyang, Liangfei; Liu, Qian; Liang, Heng

    2017-02-01

    A common drawback of paper-based separation devices is their poor detection limit. In this study, we combined field-amplified sample stacking with moving reaction boundary electrophoresis on a paper chip with six array channels for the parallel separation and concentration of multiple samples. With a new hyphenated technique, the brown I2 from the Fe(3+) /I(-) oxidation-reduction reaction emerged near the boundary between the dilute ethylene diamine tetraacetic acid and potassium iodide and highly concentrated KCl solutions. For the separation and concentration of three components, Cr(3+) , Cu(2+) , and Fe(3+) , the Fe(3+) detection limit was improved at least 266-fold by comparing the hyphenated technique with moving reaction boundary electrophoresis. The detection limit of Fe(3+) was found to be as low as 0.34 ng (20 μM) on the paper chip. We also demonstrated the analysis of a real sample of four metal ions, with detection limits as follows: 0.16 μg Cr(3+) , 1.5 μg Ni(2+) , 0.64 μg Cu(2+) , and 1.5 μg Co(2+) . The synergy of field-amplified sample stacking and moving reaction boundary electrophoresis in the micron paper-based array channels dramatically improved the detection limit and throughput of paper-based electrophoresis.

  18. Pre-injection Comparison of Methods for Sampling Formation Water and Associated Gas from a Monitoring Well at a Carbon Dioxide Injection Site, Citronelle Oil Field, Alabama

    NASA Astrophysics Data System (ADS)

    Conaway, C.; Thordsen, J. J.; Manning, M. A.; Cook, P. J.; Abedini, A. A.; Trautz, R. C.; Thomas, B.; Kharaka, Y. K.

    2012-12-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a well in the Citronelle Oil Field, Alabama, a site that will be used for a carbon dioxide injection experiment. Prior to each of the two sampling periods, the well was cleaned from the drilling fluids and KCl solutions by producing at least three pore volumes of formation water. Accurate measurements of the chemical composition of groundwater or formation water, including dissolved gasses, and gas samples is essential in understanding subsurface geochemical processes occurring as a result of geologic carbon dioxide injection, which is used for enhanced oil recovery (EOR) and has been proposed as a means of carbon sequestration. In this study, formation water and gas samples for geochemical analyses were obtained from well D-9-8 #2 at Citronelle using nitrogen lift, submersible pump, U-Tube, and a downhole (Kuster) sampler. Field chemical analyses included electrical conductivity, hydrogen sulfide, alkalinity, and pH, and laboratory analyses included major, minor and trace elements by mass spectrometry and ion chromatography, dissolved carbon, organic acid anions, free and dissolved gas species. The formation water obtained from this well is a Na-Ca-Cl brine with a salinity of 160,000 and 200,000 mg/L total dissolved solids (TDS). Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity measurements. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the downhole sampler and U-Tube system performing most favorably in this aspect.

  19. Geochemistry of stream-sediment samples from the Santa Renia Fields and Beaver Peak quadrangles, northern Carlin Trend, Nevada

    USGS Publications Warehouse

    Theodore, Ted G.; Kotlyar, Boris B.; Berger, Vladimir I.; Moring, Barry C.; Singer, Donald A.; Edstrom, Sven A.

    1999-01-01

    A broad west-to-east increase of many metal concentrations has been found in stream sediments during a reconnaissance investigation conducted in conjunction with geologic studies in the Santa Renia Fields and Beaver Peak 7–1/2 minute quadrangles near the northern end of the Carlin trend of gold deposits in the Tuscarora Mountains. This regional increase in metal concentrations coincides with a dramatic change in landform wherein high concentrations of metals in stream sediments appear to correlate directly with areas of high elevations and steep slopes in the Beaver Peak quadrangle. Robust erosion combined with high flow rates in streams from these higher elevations are envisaged to have contributed significantly to increased metal concentrations in the stream sediments by an enhanced presence of minerals with high specific gravities and a correspondingly diminished presence of minerals with low specific gravities. Minerals with low specific gravities probably have been preferentially flushed down stream because of high transporting capacities for sediment by streams in the Beaver Peak quadrangle. In addition, the Carlin trend, a generally northwest-alignment of gold deposits in the Santa Renia Fields quadrangle, is well outlined by arsenic concentrations that include a maximum of approximately 54 parts per million. Further, a weakly developed distal-to-proximal metal zonation towards these gold deposits appears to be defined respectively in plots showing distributions of thallium, arsenic, antimony, and zinc. A broad area of high metal concentrations—including sharply elevated abundances of Ag, As, Au, Cd, Co, Cu, Mn, Ni, P, Sb, Sc, Te, V, and especially Zn—near the southeast corner of the Beaver Peak quadrangle primarily could be the result of stratiform mineralized rocks in the Ordovician Vinini Formation or Devonian Slaven Chert, or the result of a subsequent Mesozoic or Tertiary epigenetic overprint.

  20. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; arsenic speciation in natural-water samples using laboratory and field methods

    USGS Publications Warehouse

    Garbarino, John R.; Bednar, Anthony J.; Burkhardt, Mark R.

    2002-01-01

    Analytical methods for the determination of arsenite [As(III)], arsenate [As(V)], dimethylarsinate (DMA), monomethylarsonate (MMA), and roxarsone in filtered natural-water samples are described. Various analytical methods can be used for the determination, depending on the arsenic species being determined. Arsenic concentration is determined by using inductively coupled plasma-mass spectrometry (ICP-MS) as an arsenic-specific detector for all methods. Laboratory-speciation methods are described that use an ion chromatographic column to separate the arsenic species; the column length, column packing, and mobile phase are dependent on the species of interest. Regardless of the separation technique, the arsenic species are introduced into plasma by eithe rpneumatic nebulization or arsine generation. Analysis times range from 2 to 8 minutes and method detection limits range from 0.1 to 0.6 microgram-arsenic per liter (ug-As/L), 10 to 60 picograms absolute (for a 100-microliter injection), depending on the arsenic species determined and the analytical method used. A field-generation specciation method also is described that uses a strong anion exchange cartridge to separate As(III) from As(V) in the field. As(III) in the eluate and the As(V) in the cartridge extract are determined by direct nebulization ICP-MS. Methylated arsenic species that also are retained on the cartridge will positively bias As(V) results without further laboratory separations. The method detection limit for field speciation is 0.3 ug-As/L. The distribution of arsenic species must be preserved in the field to eliminate changes caused by photochemical oxidation or metal oxyhydroxide precipitation. Preservation techniques, such as refrigeration, the addition of acides, or the additoin of ethylene-diaminetetraacetic acid (EDTA) and the effects of ambient light were tested. Of the preservatives evaluated, EDTA was found to work best with the laboratory- and field-speciation methods for all sample

  1. Laboratory flume experiments with the Swiss plate geophone bed load monitoring system: 2. Application to field sites with direct bed load samples

    NASA Astrophysics Data System (ADS)

    Wyss, Carlos R.; Rickenmann, Dieter; Fritschi, Bruno; Turowski, Jens M.; Weitbrecht, Volker; Travaglini, Eric; Bardou, Eric; Boes, Robert M.

    2016-10-01

    The Swiss plate geophone is a bed load surrogate monitoring system that had been calibrated in several gravel bed streams through field calibration measurements. Field calibration measurements are generally expensive and time consuming, therefore we investigated the possibility to replace it by a flume-based calibration approach. We applied impulse-diameter relations for the Swiss plate geophone obtained from systematic flume experiments to field calibration measurements in four different gravel bed streams. The flume-based relations were successfully validated with direct bed load samples from field measurements, by estimating the number of impulses based on observed bed load masses per grain-size class. We estimated bed load transport mass by developing flume-based and stream-dependent calibration procedures for the Swiss plate geophone system using an additional empirical function. The estimated masses are on average in the range of ±90% of measured bed load masses in the field, but the accuracy is generally improved for larger transported bed load masses. We discuss the limitations of the presented flume-based calibration approach.

  2. Respondent-driven sampling in a study of drug users in New York City: notes from the field.

    PubMed

    McKnight, Courtney; Des Jarlais, Don; Bramson, Heidi; Tower, Lisa; Abdul-Quader, Abu S; Nemeth, Chris; Heckathorn, Douglas

    2006-11-01

    Beth Israel Medical Center (BIMC), in collaboration with the Centers for Disease Control (CDC) and the New York State Department of Health (NYSDOH), used respondent-driven sampling (RDS) in a study of HIV seroprevalence among drug users in New York City in 2004. We report here on operational issues with RDS including recruitment, coupon distribution, storefront operations, police and community relations, and the overall lessons we learned. Project staff recruited eight seeds from a syringe exchange in Lower Manhattan to serve as the initial study participants. Upon completion of the interview that lasted approximately 1 h and a blood draw, each seed was given three coupons to recruit three drug users into the study. Each of the subsequent eligible participants was also given three coupons to recruit three of their drug-using acquaintances. Eligible participants had to have: injected, smoked or snorted an illicit drug in the last 6 months (other than marijuana), aged 18 or older, adequate English language knowledge to permit informed consent and complete questionnaire. From April to July 2004, 618 drug users were interviewed, including 263 (43%) current injectors, 119 (19%) former injectors, and 236 (38%) never injectors. Four hundred sixty nine (76%) participants were men, 147 (24%) were women, and two (<1%) were transgender. By race/ethnicity, 285 (46%) were black, 218 (35%) Hispanic, 88 (14%) white, 23 (4%) mixed/not specified, and four (<1%) native American. Interviews were initially done on a drop-in basis but this system changed to appointments 1 month into the study due to the large volume of subjects coming in for interviews. Data collection was originally proposed to last for 1 year with a target recruitment of 500 drug users. Utilizing RDS, we were able to recruit and interview 118 more drug users than originally proposed in one quarter of the time. RDS was efficient with respect to time and economics (we did not have to hire an outreach worker) and

  3. EPR and EOM studies in well samples from some Venezuelan oil fields: possible mechanisms of magnetic authigenesis

    NASA Astrophysics Data System (ADS)

    Aldana, M.; Díaz, M.; Costanzo-Alvarez, V.; Jiménez, S. M.; Sequera, P.

    2003-04-01

    In the last few years we have conducted Electron Paramagnetic Resonance (EPR) and Magnetic Susceptibility (MS) studies in drilling fines, from near-surface levels, from producer and non-producer wells. These studies were aimed at examining a possible causal relationship between magnetic contrasts and underlying hydrocarbons. In this work we have extended these studies to some new wells, trying to identify the possible origin (microbial and/or thermochemical) of the observed anomalies. Together with EPR and MS studies, quantification of extractable organic matter (EOM) has been also performed. The samples were pulverized and split into two aliquots. One aliquot was treated with chloroform in order to separate de EOM and obtain the sample without EOM and the EOM itself. The other aliquot was not solvent extracted. The EOM was quantified and EPR measurements were performed on both aliquots in order to determine the organic matter free radical concentration (OMFRC). The treatments performed allow identifying whether the OMFRC belongs to the EOM or to the total organic matter (TOM). Asphaltenes tend to be the major components in highly biodegraded crude oils. Then the presence of OMFRC belonging to the TOM or to the EOM could indicate a possible microbial or thermochemical origin, respectively, of the detected MS anomalies. We have found OMFRC and EOM anomalies only at the producer wells, in the same zone where MS anomalies, associated with the presence of spherical aggregates of magnetic minerals, were observed. For some of these wells our results indicate the solely presence of free radicals of kerogen at OMFRC anomalous level. In fact, the EOM of these wells has no EPR signal and precipitation of asphaltene in n-heptane was not observed. In other instances, free radicals of kerogen and asphaltenes and precipitation of asphaltene from the EOM in n-heptane was observed. In the former case we suggest the existence of a reducing zone where thermochemical conditions are

  4. [The assessment of radionuclide contamination and toxicity of soils sampled from "experimental field" site of Semipalatinsk nuclear test site].

    PubMed

    Evseeva, T I; Maĭstrenko, T A; Belykh, E S; Geras'kin, S A; Kriazheva, E Iu

    2009-01-01

    Large-scale maps (1:25000) of soil contamination with radionuclides, lateral distribution of 137Cs, 90Sr, Fe and Mn water-soluble compounds and soil toxicity in "Experimental field" site of Semipalatinsk nuclear test site were charted. At present soils from studied site (4 km2) according to basic sanitary standards of radiation safety adopted in Russian Federation (OSPORB) do not attributed to radioactive wastes with respect to data on artificial radionuclide concentration, but they do in compliance with IAEA safety guide. The soils studied can not be released from regulatory control due to radioactive decay of 137Cs and 90Sr and accumulation-decay of 241Am up to 2106 year according to IAEA concept of exclusion, exemption and clearance. Data on bioassay "increase of Chlorella vulgaris Beijer biomass production in aqueous extract from soils" show that the largest part of soils from the studied site (74%) belongs to stimulating or insignificantly influencing on the algae reproduction due to water-soluble compounds effect. Toxic soils occupy 26% of the territory. The main factors effecting the algae reproduction in the aqueous extracts from soil are Fe concentration and 90Sr specific activity: 90Sr inhibits but Fe stimulates algae biomass production.

  5. Application of CE with novel dynamic coatings and field-amplified sample injection to the sensitive determination of isomeric benzoic acids in atmospheric aerosols and vehicular emission.