Science.gov

Sample records for actual field samples

  1. FIELD SAMPLING PROTOCOLS AND ANALYSIS

    EPA Science Inventory

    I have been asked to speak again to the environmental science class regarding actual research scenarios related to my work at Kerr Lab. I plan to discuss sampling protocols along with various field analyses performed during sampling activities. Many of the students have never see...

  2. CHARACTERIZATION AND ACTUAL WASTE TEST WITH TANK 5F SAMPLES

    SciTech Connect

    Hay, M. S.; Crapse, K. P.; Fink, S. D.; Pareizs, J. M.

    2007-08-30

    The initial phase of bulk waste removal operations was recently completed in Tank 5F. Video inspection of the tank indicates several mounds of sludge still remain in the tank. Additionally, a mound of white solids was observed under Riser 5. In support of chemical cleaning and heel removal programs, samples of the sludge and the mound of white solids were obtained from the tank for characterization and testing. A core sample of the sludge and Super Snapper sample of the white solids were characterized. A supernate dip sample from Tank 7F was also characterized. A portion of the sludge was used in two tank cleaning tests using oxalic acid at 50 C and 75 C. The filtered oxalic acid from the tank cleaning tests was subsequently neutralized by addition to a simulated Tank 7F supernate. Solids and liquid samples from the tank cleaning test and neutralization test were characterized. A separate report documents the results of the gas generation from the tank cleaning test using oxalic acid and Tank 5F sludge. The characterization results for the Tank 5F sludge sample (FTF-05-06-55) appear quite good with respect to the tight precision of the sample replicates, good results for the glass standards, and minimal contamination found in the blanks and glass standards. The aqua regia and sodium peroxide fusion data also show good agreement between the two dissolution methods. Iron dominates the sludge composition with other major contributors being uranium, manganese, nickel, sodium, aluminum, and silicon. The low sodium value for the sludge reflects the absence of supernate present in the sample due to the core sampler employed for obtaining the sample. The XRD and CSEM results for the Super Snapper salt sample (i.e., white solids) from Tank 5F (FTF-05-07-1) indicate the material contains hydrated sodium carbonate and bicarbonate salts along with some aluminum hydroxide. These compounds likely precipitated from the supernate in the tank. A solubility test showed the material

  3. Photovoltaic performance models: an evaluation with actual field data

    NASA Astrophysics Data System (ADS)

    TamizhMani, Govindasamy; Ishioye, John-Paul; Voropayev, Arseniy; Kang, Yi

    2008-08-01

    Prediction of energy production is crucial to the design and installation of the building integrated photovoltaic systems. This prediction should be attainable based on the commonly available parameters such as system size, orientation and tilt angle. Several commercially available as well as free downloadable software tools exist to predict energy production. Six software models have been evaluated in this study and they are: PV Watts, PVsyst, MAUI, Clean Power Estimator, Solar Advisor Model (SAM) and RETScreen. This evaluation has been done by comparing the monthly, seasonaly and annually predicted data with the actual, field data obtained over a year period on a large number of residential PV systems ranging between 2 and 3 kWdc. All the systems are located in Arizona, within the Phoenix metropolitan area which lies at latitude 33° North, and longitude 112 West, and are all connected to the electrical grid.

  4. Pulsed field sample neutralization

    DOEpatents

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  5. Variation in actual relationship as a consequence of Mendelian sampling and linkage

    PubMed Central

    HILL, W.G.; WEIR, B.S.

    2011-01-01

    Summary Although the expected relationship or proportion of genome shared by pairs of relatives can be obtained from their pedigrees, the actual quantities deviate as a consequence of Mendelian sampling and depend on the number of chromosomes and map length. Formulae have been published previously for the variance of actual relationship for a number of specific types of relatives but no general formula for non-inbred individuals is available. We provide here a unified framework that enables the variances for distant relatives to be easily computed, showing, for example, how the variance of sharing for great grandparent–great grandchild, great uncle–great nephew, half uncle–nephew and first cousins differ, even though they have the same expected relationship. Results are extended in order to include differences in map length between sexes, no recombination in males and sex linkage. We derive the magnitude of skew in the proportion shared, showing the skew becomes increasingly large the more distant the relationship. The results obtained for variation in actual relationship apply directly to the variation in actual inbreeding as both are functions of genomic coancestry, and we show how to partition the variation in actual inbreeding between and within families. Although the variance of actual relationship falls as individuals become more distant, its coefficient of variation rises, and so, exacerbated by the skewness, it becomes increasingly difficult to distinguish different pedigree relationships from the actual fraction of the genome shared. PMID:21226974

  6. Actual and 'optimum' flight speeds: field data reassessed

    PubMed

    Pennycuick

    1997-01-01

    Previously published field observations of the air speeds of 36 species of birds, all observed by the same method (ornithodolite), were compared with estimates of the corresponding minimum power speeds, calculated with a default body drag coefficient of 0.1. This value, which was derived from recent wind tunnel studies, represents a downward revision from default values previously used and leads, in turn, to an upward revision of estimated minimum power speeds. The mean observed air speeds are now distributed around the minimum power speed, rather than in between the speeds for minimum power and maximum range, as they were before. Although the field data do not represent migration, examination of the marginal effects of small changes of speed, on power and lift:drag ratio, indicates that flying at the maximum range speed on migration may not represent an 'optimal' or even a practical strategy and that cruising speeds may be limited by the muscle power available or by aerobic capacity. Caution in constructing 'optimisation' theories is indicated.

  7. Characterization, Leaching, and Filtration Testing for Tributyl Phosphate (TBP, Group 7) Actual Waste Sample Composites

    SciTech Connect

    Edwards, Matthew K.; Billing, Justin M.; Blanchard, David L.; Buck, Edgar C.; Casella, Amanda J.; Casella, Andrew M.; Crum, J. V.; Daniel, Richard C.; Draper, Kathryn E.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Snow, Lanee A.; Swoboda, Robert G.

    2009-03-09

    .A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. The tributyl phosphate sludge (TBP, Group 7) is the subject of this report. The Group 7 waste was anticipated to be high in phosphorus as well as aluminum in the form of gibbsite. Both are believed to exist in sufficient quantities in the Group 7 waste to address leaching behavior. Thus, the focus of the Group 7 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  8. TESTING OF THE SPINTEK ROTARY MICROFILTER USING ACTUAL HANFORD WASTE SAMPLES

    SciTech Connect

    HUBER HJ

    2010-04-13

    The SpinTek rotary microfilter was tested on actual Hanford tank waste. The samples were a composite of archived Tank 241-AN-105 material and a sample representing single-shell tanks (SST). Simulants of the two samples have been used in non-rad test runs at the 222-S laboratory and at Savannah River National Laboratory (SRNL). The results of these studies are compared in this report. Two different nominal pore sizes for the sintered steel rotating disk filter were chosen: 0.5 and 0.1 {micro}m. The results suggest that the 0.5-{micro}m disk is preferable for Hanford tank waste for the following reasons: (1) The filtrate clarity is within the same range (<<4 ntu for both disks); (2) The filtrate flux is in general higher for the 0.5-{micro}m disk; and (3) The 0.1-{micro}m disk showed a higher likelihood of fouling. The filtrate flux of the actual tank samples is generally in the range of 20-30% compared to the equivalent non-rad tests. The AN-105 slurries performed at about twice the filtrate flux of the SST slurries. The reason for this difference has not been identified. Particle size distributions in both cases are very similar; comparison of the chemical composition is not conclusive. The sole hint towards what material was stuck in the filter pore holes came from the analysis of the dried flakes from the surface of the fouled 0.1-{micro}m disk. A cleaning approach developed by SRNL personnel to deal with fouled disks has been found adaptable when using actual Hanford samples. The use of 1 M nitric acid improved the filtrate flux by approximately two times; using the same simulants as in the non-rad test runs showed that the filtrate flux was restored to 1/2 of its original amount.

  9. Filtration and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Geeting, John GH; Hallen, Richard T.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Snow, Lanee A.; Swoboda, Robert G.

    2009-02-20

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.( ) The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP-RPP-WTP-467, eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste-testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan • Characterizing the homogenized sample groups • Performing parametric leaching testing on each group for compounds of interest • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on filtration/leaching tests performed on two of the eight waste composite samples and follow-on parametric tests to support aluminum leaching results from those tests.

  10. Evaluation of TENORMs field measurement with actual activity concentration in contaminated soil matrices.

    PubMed

    Saint-Fort, Roger; Alboiu, Mirtyll; Hettiaratchi, Patrick

    2007-09-01

    The occurrence of technologically enhanced naturally occurring radioactive materials (TENORMs) concentrated through anthropogenic processes in contaminated soils at oil and gas facilities represent one of the most challenging issues facing the Canadian and US oil and gas industry today. Natural occurring radioactivity materials (NORMs) field survey techniques are widely used as a rapid and cost-effective method for ascertaining NORMs risks associated with contaminated soils and waste matrices as well other components comprising the environment. Because of potentially significant liability issues with Norms if not properly managed, the development of quantitative relationships between TENORMs field measurement techniques and laboratory analysis present a practical approach in facilitating the interim safe decision process since laboratory results can take days. The primary objective of this study was to evaluate the relationships between direct measurements of field radioactivity and various laboratory batch techniques using data collection technologies for NORM and actual laboratory radioactivity concentrations. The significance of selected soil characteristics that may improve or confound these relationships in the formulation of empirical models was also achieved as an objective. The soil samples used in this study were collected from 4 different locations in western Canada and represented a wide range in terms of their selected chemical and physical properties. Multiple regression analyses for both field and batch data showed a high level of correlation between radionuclides Ra-226 and Ra-228 as a function of data collection technologies and relevant soil parameters. All R2 values for the empirical models were greater than 0.80 and significant at P<0.05. The creation of these empirical models could be valuable in improving predictability of radium contamination in soils and therefore, reduce analytical costs as well as environmental liabilities.

  11. Filtration and Leach Testing for PUREX Cladding Sludge and REDOX Cladding Sludge Actual Waste Sample Composites

    SciTech Connect

    Shimskey, Rick W.; Billing, Justin M.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hallen, Richard T.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-03-02

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan (Barnes and Voke 2006). The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Hanford Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Under test plan TP RPP WTP 467 (Fiskum et al. 2007), eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. Under this test plan, a waste testing program was implemented that included: • Homogenizing the archive samples by group as defined in the test plan. • Characterizing the homogenized sample groups. • Performing parametric leaching testing on each group for compounds of interest. • Performing bench-top filtration/leaching tests in the hot cell for each group to simulate filtration and leaching activities if they occurred in the UFP2 vessel of the WTP Pretreatment Facility. This report focuses on a filtration/leaching test performed using two of the eight waste composite samples. The sample groups examined in this report were the plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR). Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, thus requiring caustic leaching. WTP RPT 167 (Snow et al. 2008) describes the homogenization, characterization, and parametric leaching activities before benchtop filtration/leaching testing of these two waste groups. Characterization and initial parametric data in that report were used to plan a single filtration/leaching test using a blend of both wastes. The test focused on filtration testing of the waste and caustic leaching for aluminum, in the form

  12. Cadmium and zinc interactions and their transfer in soil-crop system under actual field conditions.

    PubMed

    Nan, Zhongren; Li, Jijun; Zhang, Jianming; Cheng, Guodong

    2002-02-21

    The transfer of Cd and Zn from calcareous soils nearby a non-ferrous mining and smelting bases to the spring wheat (Triticum aestivum L.) and corn (Zea mays L.) tissues and the interactions between the two metals concerned were investigated under actual field conditions. Samples of soils and entire crops were randomly collected during harvest time in 1998 in the Baiyin region. The soil metal contents showed that the furrows had been polluted (mean values: 3.16 mg kg(-1) for Cd; 146.78 mg kg(-1) for Zn) and the significant spatial variation of the soil contamination existed here (ranges, Cd: 0.14-19.3 mg kg(-1); Zn: 43.5-565.0 mg kg(-1)). The translocation ratios of the two metals from soil to crop parts in the region studied were relatively lower and the order of the element transfer in different plant tissues was root > stem > grain. The transfer ratio of element Cd was lower than that of element Zn. Cd and Zn uptake by the crop structures could be best described by four models (P < 0.01): linear; exponential; quadratic; and cubic. Apart from a linear relationship between the element Cd in the corn grains and soils, models were generally non-lincar. An analysis of Cd-Zn interaction mechanism led to the conclusion that the effects of the two metals were synergistic to each other under field conditions, in which increasing Cd and Zn contents in soils could increase the accumulations of Zn or Cd in the two crops.

  13. Field techniques for sampling ants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ants occur in most environments and ecologists ask a diverse array of questions involving ants. Thus, a key consideration in ant studies is to match the environment and question (and associated environmental variables) to the ant sampling technique. Since each technique has distinct limitations, usi...

  14. Characterization of personal RF electromagnetic field exposure and actual absorption for the general public.

    PubMed

    Joseph, W; Vermeeren, G; Verloock, L; Heredia, Mauricio Masache; Martens, Luc

    2008-09-01

    In this paper, personal electromagnetic field exposure of the general public due to 12 different radiofrequency sources is characterized. Twenty-eight different realistic exposure scenarios based upon time, environment, activity, and location have been defined and a relevant number of measurements were performed with a personal exposure meter. Indoor exposure in office environments can be higher than outdoor exposure: 95th percentiles of field values due to WiFi ranged from 0.36 to 0.58 V m(-1), and for DECT values of 0.33 V m(-1) were measured. The downlink signals of GSM and DCS caused the highest outdoor exposures up to 0.52 V m(-1). The highest total field exposure occurred for mobile scenarios (inside a train or bus) from uplink signals of GSM and DCS (e.g., mobile phones) due to changing environmental conditions, handovers, and higher required transmitted signals from mobile phones due to penetration through windows while moving. A method to relate the exposure to the actual whole-body absorption in the human body is proposed. An application is shown where the actual absorption in a human body model due to a GSM downlink signal is determined. Fiftieth, 95th, and 99 th percentiles of the whole-body specific absorption rate (SAR) due to this GSM signal of 0.58 microW kg(-1), 2.08 microW kg(-1), and 5.01 microW kg(-1) are obtained for a 95th percentile of 0.26 V m(-1). A practical usable function is proposed for the relation between the whole-body SAR and the electric fields. The methodology of this paper enables epidemiological studies to make an analysis in combination with both electric field and actual whole-body SAR values and to compare exposure with basic restrictions. PMID:18695413

  15. Strontium and Actinides Removal from Savannah River Site Actual Waste Samples by Freshly Precipitated Manganese Oxide

    SciTech Connect

    Barnes, M.J.

    2003-10-30

    The authors investigated the performance of freshly precipitated manganese oxide and monosodium titanate (MST) for the removal of strontium (Sr) and actinides from actual high-level waste. Manganese oxide precipitation occurs upon addition of a reductant such as formate (HCO2-) or peroxide (H2O2) to a waste solution containing permanganate (MnO4-). Tests described in this document address the capability of manganese oxide treatment to remove Rs, Pu, and Np from actual high-level waste containing elevated concentrations of Pu. Additionally, tests investigate MST (using two unique batches) performance with the same waste for direct comparison to the manganese oxide performance.

  16. 12 CFR Appendix M3 to Part 226 - Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Sample Calculations of Generic Repayment Estimates and Actual Repayment Disclosures M3 Appendix M3 to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z)...

  17. Comprehensive Evaluation of Attitude and Orbit Estimation Using Actual Earth Magnetic Field Data

    NASA Technical Reports Server (NTRS)

    Deutschmann, Julie K.; Bar-Itzhack, Itzhack Y.

    2000-01-01

    A single, augmented Extended Kalman Filter (EKF), which simultaneously and autonomously estimates spacecraft attitude and orbit has been developed and successfully tested with real magnetometer and gyro data only. Because the earth magnetic field is a function of time and position, and because time is known quite precisely, the differences between the computed and measured magnetic field components, as measured by the magnetometers throughout the entire spacecraft orbit, are a function of both orbit and attitude errors. Thus, conceivably these differences could be used to estimate both orbit and attitude; an observability study validated this assumption. The results of testing the EKF with actual magnetometer and gyro data, from four satellites supported by the NASA Goddard Space Flight Center (GSFC) Guidance, Navigation, and Control Center, are presented and evaluated. They confirm the assumption that a single EKF can estimate both attitude and orbit when using gyros and magnetometers only.

  18. Bioaerosol sampling: sampling mechanisms, bioefficiency and field studies.

    PubMed

    Haig, C W; Mackay, W G; Walker, J T; Williams, C

    2016-07-01

    Investigations into the suspected airborne transmission of pathogens in healthcare environments have posed a challenge to researchers for more than a century. With each pathogen demonstrating a unique response to environmental conditions and the mechanical stresses it experiences, the choice of sampling device is not obvious. Our aim was to review bioaerosol sampling, sampling equipment, and methodology. A comprehensive literature search was performed, using electronic databases to retrieve English language papers on bioaerosol sampling. The review describes the mechanisms of popular bioaerosol sampling devices such as impingers, cyclones, impactors, and filters, explaining both their strengths and weaknesses, and the consequences for microbial bioefficiency. Numerous successful studies are described that point to best practice in bioaerosol sampling, from the use of small personal samplers to monitor workers' pathogen exposure through to large static samplers collecting airborne microbes in various healthcare settings. Of primary importance is the requirement that studies should commence by determining the bioefficiency of the chosen sampler and the pathogen under investigation within laboratory conditions. From such foundations, sampling for bioaerosol material in the complexity of the field holds greater certainty of successful capture of low-concentration airborne pathogens. From the laboratory to use in the field, this review enables the investigator to make informed decisions about the choice of bioaerosol sampler and its application.

  19. Bioaerosol sampling: sampling mechanisms, bioefficiency and field studies.

    PubMed

    Haig, C W; Mackay, W G; Walker, J T; Williams, C

    2016-07-01

    Investigations into the suspected airborne transmission of pathogens in healthcare environments have posed a challenge to researchers for more than a century. With each pathogen demonstrating a unique response to environmental conditions and the mechanical stresses it experiences, the choice of sampling device is not obvious. Our aim was to review bioaerosol sampling, sampling equipment, and methodology. A comprehensive literature search was performed, using electronic databases to retrieve English language papers on bioaerosol sampling. The review describes the mechanisms of popular bioaerosol sampling devices such as impingers, cyclones, impactors, and filters, explaining both their strengths and weaknesses, and the consequences for microbial bioefficiency. Numerous successful studies are described that point to best practice in bioaerosol sampling, from the use of small personal samplers to monitor workers' pathogen exposure through to large static samplers collecting airborne microbes in various healthcare settings. Of primary importance is the requirement that studies should commence by determining the bioefficiency of the chosen sampler and the pathogen under investigation within laboratory conditions. From such foundations, sampling for bioaerosol material in the complexity of the field holds greater certainty of successful capture of low-concentration airborne pathogens. From the laboratory to use in the field, this review enables the investigator to make informed decisions about the choice of bioaerosol sampler and its application. PMID:27112048

  20. Characterization and Leach Testing for REDOX Sludge and S-Saltcake Actual Waste Sample Composites

    SciTech Connect

    Fiskum, Sandra K.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Hubler, Timothy L.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; Lumetta, Gregg J.; MacFarlan, Paul J.; McNamara, Bruce K.; Peterson, Reid A.; Sinkov, Sergey I.; Snow, Lanee A.; Swoboda, Robert G.

    2008-07-10

    This report describes processing and analysis results of boehmite waste type (Group 5) and insoluble high Cr waste type (Group 6). The sample selection, compositing, subdivision, physical and chemical characterization are described. Extensive batch leach testing was conducted to define kinetics and leach factors of selected analytes as functions of NaOH concentration and temperature. Testing supports issue M-12 resolution for the Waste Treatment Plant.

  1. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck

    2003-04-19

    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  2. A Validation Study of Bullet and Cartridge Case Comparisons Using Samples Representative of Actual Casework.

    PubMed

    Smith, Tasha P; Andrew Smith, G; Snipes, Jeffrey B

    2016-07-01

    The foundation of firearm and tool mark identification is that no two tools should produce the same microscopic marks on two separate objects that they would be inaccurately or wrongly identified. Studies addressing the validity of identification infrequently employ tests that mirror realistic casework scenarios. This study attempted to do so using a double-blind process, reducing test-taking bias. Test kits including bullets and cartridge cases but not the associated firearms were completed by 31 analysts from 22 agencies. Analysis of the results demonstrated an overall error rate of 0.303%, sensitivity of 85.2%, and specificity of 86.8%. Variability in performance across examiners is addressed, and the effect of examiners' years of experience on identification accuracy is explored. Finally, the article discusses the importance of studies using realistic case work scenarios when validating the field's performance and in providing courts with usable indicators of the accuracy of firearm and tool mark identification. PMID:27135174

  3. Evaluation of a total dissolved solids model in comparison to actual field data measurements in the Cheyenne River, South Dakota, U.S.A.

    PubMed

    Berdanier, Bruce W; Ziadat, Anf H

    2006-06-01

    During the summers of 2002 and 2004, in-stream integrated flow and concentration measurements for the total dissolved solids in the Cheyenne River, South Dakota, USA was conducted in order to compare the obtained actual field measurements with the predictions values made by the Bureau of Reclamation in the Environmental Impact Statement. In comparison to the actual field measurements conducted in this study, The Bureau of Reclamation extension of a small database used in the analysis for the impact of operations at the Angostura Unit over the past 50 years and into the future to predict the annual total dissolved solid loadings doesn't represent the actual loading values and various conditions in the study area. Additional integrated flow and concentration sampling is required to characterize the impact of the current Angostura Dam operations and Angostura Irrigation District return flows on the Cheyenne River in different seasons of the year. PMID:16917716

  4. Soil Sampling Techniques For Alabama Grain Fields

    NASA Technical Reports Server (NTRS)

    Thompson, A. N.; Shaw, J. N.; Mask, P. L.; Touchton, J. T.; Rickman, D.

    2003-01-01

    Characterizing the spatial variability of nutrients facilitates precision soil sampling. Questions exist regarding the best technique for directed soil sampling based on a priori knowledge of soil and crop patterns. The objective of this study was to evaluate zone delineation techniques for Alabama grain fields to determine which method best minimized the soil test variability. Site one (25.8 ha) and site three (20.0 ha) were located in the Tennessee Valley region, and site two (24.2 ha) was located in the Coastal Plain region of Alabama. Tennessee Valley soils ranged from well drained Rhodic and Typic Paleudults to somewhat poorly drained Aquic Paleudults and Fluventic Dystrudepts. Coastal Plain s o i l s ranged from coarse-loamy Rhodic Kandiudults to loamy Arenic Kandiudults. Soils were sampled by grid soil sampling methods (grid sizes of 0.40 ha and 1 ha) consisting of: 1) twenty composited cores collected randomly throughout each grid (grid-cell sampling) and, 2) six composited cores collected randomly from a -3x3 m area at the center of each grid (grid-point sampling). Zones were established from 1) an Order 1 Soil Survey, 2) corn (Zea mays L.) yield maps, and 3) airborne remote sensing images. All soil properties were moderately to strongly spatially dependent as per semivariogram analyses. Differences in grid-point and grid-cell soil test values suggested grid-point sampling does not accurately represent grid values. Zones created by soil survey, yield data, and remote sensing images displayed lower coefficient of variations (8CV) for soil test values than overall field values, suggesting these techniques group soil test variability. However, few differences were observed between the three zone delineation techniques. Results suggest directed sampling using zone delineation techniques outlined in this paper would result in more efficient soil sampling for these Alabama grain fields.

  5. Field portable XRF analysis of environmental samples.

    PubMed

    Kalnicky, D J; Singhvi, R

    2001-05-01

    One of the critical factors for successfully conducting contamination characterization, removal, and remedial operations at hazardous waste sites is rapid and appropriate response to analyze samples in a timely fashion. Turnaround time associated with off-site analysis is often too slow to support efficient utilization of the data. Field portable X-ray fluorescence (FPXRF) techniques provide viable and effective analytical approaches to meet on-site analysis needs for many types of environmental samples. Applications include the in situ analysis of metals in soils and sediments, thin films/particulates, and lead in paint.

  6. Bidimensional near-field sampling spectrometry.

    PubMed

    Renault, Mikael; Hadjar, Yassine; Blaize, Sylvain; Bruyant, Aurélien; Arnaud, Laurent; Lerondel, Gilles; Royer, Pascal

    2010-10-01

    We report on a concept of compact optical Fourier-transform spectrometer based on bidimensional (2D) spatial sampling of a confined interferogram. The spectrometer consists of a nanostructured glass surface on which two light beams interfere in total internal reflection. Subwavelength spatial sampling of the interferogram near field is achieved by introducing a tilt angle between a 2D array of optical nanoantennas and the interferogram pattern. The intensity distribution of the scattered light is recorded on a 2D CCD camera, and a one-dimensional Fourier transform of the interferogram is used to recover the input light spectrum. Experimental results show a wide spectral bandwidth in the visible range, down to 380 nm, with spectral resolution of 1.6 nm around 780 nm.

  7. Mars Analogue Field Research and Sample Analysis

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.

    2016-07-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009 to 2016) in the Utah desert and in other extreme environments (Iceland, Eifel, La Reunion) relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution affected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with significant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare campaign results from 2009-2013 campaigns in Utah and other sites to new measurements concerning: the comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.

  8. Field evaluation of a VOST sampling method

    SciTech Connect

    Jackson, M.D.; Johnson, L.D.; Fuerst, R.G.; McGaughey, J.F.; Bursey, J.T.; Merrill, R.G.

    1994-12-31

    The VOST (SW-846 Method 0030) specifies the use of Tenax{reg_sign} and a particular petroleum-based charcoal (SKC Lot 104, or its equivalent), that is no longer commercially available. In field evaluation studies of VOST methodology, a replacement petroleum-based charcoal has been used: candidate replacement sorbents for charcoal were studied, and Anasorb{reg_sign} 747, a carbon-based sorbent, was selected for field testing. The sampling train was modified to use only Anasorb{reg_sign} in the back tube and Tenax{reg_sign} in the two front tubes to avoid analytical difficulties associated with the analysis of the sequential bed back tube used in the standard VOST train. The standard (SW-846 Method 0030) and the modified VOST methods were evaluated at a chemical manufacturing facility using a quadruple probe system with quadruple trains. In this field test, known concentrations of the halogenated volatile organic compounds, that are listed in the Clean Air Act Amendments of 1990, Title 3, were introduced into the VOST train and the modified VOST train, using the same certified gas cylinder as a source of test compounds. Statistical tests of the comparability of methods were performed on a compound-by-compound basis. For most compounds, the VOST and modified VOST methods were found to be statistically equivalent.

  9. Assessment of actual transpiration rate in olive tree field combining sap-flow, leaf area index and scintillometer measurements

    NASA Astrophysics Data System (ADS)

    Agnese, C.; Cammalleri, C.; Ciraolo, G.; Minacapilli, M.; Provenzano, G.; Rallo, G.; de Bruin, H. A. R.

    2009-09-01

    Models to estimate the actual evapotranspiration (ET) in sparse vegetation area can be fundamental for agricultural water managements, especially when water availability is a limiting factor. Models validation must be carried out by considering in situ measurements referred to the field scale, which is the relevant scale of the modelled variables. Moreover, a particular relevance assumes to consider separately the components of plant transpiration (T) and soil evaporation (E), because only the first is actually related to the crop stress conditions. Objective of the paper was to assess a procedure aimed to estimate olive trees actual transpiration by combining sap flow measurements with the scintillometer technique at field scale. The study area, located in Western Sicily (Italy), is mainly cultivated with olive crop and is characterized by typical Mediterranean semi-arid climate. Measurements of sap flow and crop actual evapotranspiration rate were carried out during 2008 irrigation season. Crop transpiration fluxes, measured on some plants by means of sap flow sensors, were upscaled considering the leaf area index (LAI). The comparison between evapotranspiration values, derived by displaced-beam small-aperture scintillometer (DBSAS-SLS20, Scintec AG), with the transpiration fluxes obtained by the sap flow sensors, also allowed to evaluate the contribute of soil evaporation in an area characterized by low vegetation coverage.

  10. Involved field radiation for Hodgkin's lymphoma: The actual dose to breasts in close proximity

    SciTech Connect

    Dabaja, Bouthaina; Wang Zhonglo; Stovall, Marilyn; Baker, Jamie S.; Smith, Susan A.; Khan, Meena; Ballas, Leslie; Salehpour, Mohammad R.

    2012-01-01

    To decrease the risk of late toxicities in Hodgkin's lymphoma (HL) patients treated with radiation therapy (RT) (HL), involved field radiation therapy (IFRT) has largely replaced the extended fields. To determine the out-of-field dose delivered from a typical IFRT to surrounding critical structures, we measured the dose at various points in an anthropomorphic phantom. The phantom is divided into 1-inch-thick slices with the ability to insert TLDs at 3-cm intervals grid spacing. Two treatment fields were designed, and a total of 45 TLDs were placed (equally spaced) at the margin of the each of the 2 radiation fields. After performing a computed tomography simulation, 2 treatment plans targeting the mediastinum, a typical treatment field in patients with early stage HL, were generated. A total dose of 3060 cGy was delivered to the gross tumor volume for each field consecutively. The highest measured dose detected at 1 cm from the field edge in the planning target volume was 496 cGy, equivalent to 16% of the isocentric dose. The dose dropped significantly with increasing distance from the field edge. It ranged from 1.1-3.9% of the isocentric dose at a distance of 3.2-4 cm to <1.6% at a distance of >6 cm. Although the computer treatment planning system (CTPS) frequently underestimated the dose delivered, the difference in dose between measured and generated by CTPS was <2.5% in 90 positions measured. The collateral dose of radiation to breasts from IFRT is minimal. The out-of-field dose, although mildly underestimated by CTPS, becomes insignificant at >3 cm from the field edge of the radiation field.

  11. Comparison of dechlorination rates for field DNAPL vs synthetic samples: effect of sample matrix

    NASA Astrophysics Data System (ADS)

    O'Carroll, D. M.; Sakulchaicharoen, N.; Herrera, J. E.

    2015-12-01

    Nanometals have received significant attention in recent years due to their ability to rapidly destroy numerous priority source zone contaminants in controlled laboratory studies. This has led to great optimism surrounding nanometal particle injection for insitu remediation. Reported dechlorination rates vary widely among different investigators. These differences have been ascribed to differences in the iron types (granular, micro, or nano-sized iron), matrix solution chemistry and the morphology of the nZVI surface. Among these, the effects of solution chemistry on rates of reductive dechlorination of various chlorinated compounds have been investigated in several short-term laboratory studies. Variables investigated include the effect of anions or groundwater solutes such as SO4-2, Cl-, NO3-, pH, natural organic matters (NOM), surfactant, and humic acid on dechlorination reaction of various chlorinated compounds such as TCE, carbon tetrachloride (CT), and chloroform (CF). These studies have normally centered on the assessment of nZVI reactivity toward dechlorination of an isolated individual contaminant spiked into a ground water sample under ideal conditions, with limited work conducted using real field samples. In this work, the DNAPL used for the dechlorination study was obtained from a contaminatied site. This approach was selected to adequately simulate a condition where the nZVI suspension was in direct contact with DNAPL and to isolate the dechlorination activity shown by the nZVI from the groundwater matrix effects. An ideal system "synthetic DNAPL" composed of a mixture of chlorinated compounds mimicking the composition of the actual DNAPL was also dechlorinated to evaluate the DNAPL "matrix effect" on NZVI dechlorination activity. This approach allowed us to evaluate the effect of the presence of different types of organic compounds (volatile fatty acids and humic acids) found in the actual DNAPL on nZVI dechlorination activity. This presentation will

  12. Making the Difference for Teachers: The Field Experience in Actual Practice.

    ERIC Educational Resources Information Center

    Slick, Gloria Appelt, Ed.

    This is the third in a series of four books presenting a variety of field experience program models and philosophies that drive the programs provided to preservice teachers during their undergraduate teacher preparation. This publication explores the internal workings of the relationships and events that have an impact on all the persons involved…

  13. Attosecond nanoscale near-field sampling

    DOE PAGES

    Forg, B.; Schotz, J.; SuBmann, F.; Forster, M.; Kruger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; et al

    2016-05-31

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. Furthermore, by comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  14. Attosecond nanoscale near-field sampling

    PubMed Central

    Förg, B.; Schötz, J.; Süßmann, F.; Förster, M.; Krüger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; Pervak, V.; Kessel, A.; Trushin, S. A.; Azzeer, A. M.; Stockman, M. I.; Kim, D.; Krausz, F.; Hommelhoff, P.; Kling, M. F.

    2016-01-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted. PMID:27241851

  15. Attosecond nanoscale near-field sampling

    NASA Astrophysics Data System (ADS)

    Förg, B.; Schötz, J.; Süßmann, F.; Förster, M.; Krüger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; Pervak, V.; Kessel, A.; Trushin, S. A.; Azzeer, A. M.; Stockman, M. I.; Kim, D.; Krausz, F.; Hommelhoff, P.; Kling, M. F.

    2016-05-01

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. By comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  16. Discrimination of rapeseed and weeds under actual field conditions based on principal component analysis and artificial neural network by VIS/NIR spectroscopy

    NASA Astrophysics Data System (ADS)

    Huang, Min; Bao, Yidan; He, Yong

    2007-11-01

    The study documented successful discrimination between five weed species and rapeseed plants under actual field conditions using visible and near infrared (Vis/NIR) spectroscopy. A hybrid recognition model, BP artificial neural networks (BP-ANN) combined with principal component analysis (PCA), had been established for discrimination of weeds in rapeseed field. Spectra tests were performed on the rapeseed and five-weed species canopy of 180 samples in the field using a spectrophotometer (325-1075 nm). 6 optimal PCs were selected as the input of BP neural networks to build the prediction model. Rapeseed samples were marked as 1, while the five weed species marked as 2, 3, 4, 5, 6, which were used as output set of BP-ANN. 120 samples were randomly selected as the training set, and the remainder as prediction set. It showed excellent predictions with the correlation value of 0.9745, and the relative standard deviation (RSD) was under 5% thus 100% of prediction accuracy was achieved. The results are promising for further work in real-time identification of weed patches in rapeseed fields for precision weed management.

  17. Numerical reconstruction of part of an actual blast-wave flow field to agree with available experimental data

    NASA Astrophysics Data System (ADS)

    Lau, S. C. M.; Gottlieb, J. J.

    1983-11-01

    A method of solution is presented and validated for the numerical reconstruction of a certain part of an actual blast-wave flow field of interest for planar, cylindrical and spherical explosions, away from the explosion source where the blast-wave has become sufficiently weak that real-gas effects are unimportant. This method involves, essentially, a trial-and-error process of constructing the best possible path of a fluid particle or equivalent piston at the upstream side of the flow field of interest such that the resulting flow field constructed numerically in front of the equivalent moving piston agrees as well as possible with all available although limited experimental data. The relatively new random-choice method was suitably modified to easily handle the numerical computations of the nonstationary flow in front of the moving piston. Finally, the present method is used to reconstruct the flow field for past TNT and ANFO explosions, for which the blast-wave amplitudes are less than about 1 MPa. These results are presented in convenient graphical and tabular form, scaled for the case of a 1-kg TNT surface explosion or its equivalent in a standard atmosphere, so that they can be utilized readily for different sized explosions at the same or other atmospheric conditions.

  18. Intended release and actual retention of alfalfa leafcutting bees (Hymenoptera: Megachilidae) for pollination in commercial alfalfa seed fields.

    PubMed

    Pitts-Singer, Theresa L

    2013-04-01

    Low, medium, and high stocking densities (15,000; 30,000; and 45,000-50,000 bees per acre, respectively) of Megachile rotundata (F.) (Hymenoptera: Megachilidae), the alfalfa leafcutting bee, were released over 4 yr in three research plots of Utah alfalfa, Medicago sativa L. (Fabaceae), planted at seed-production rates. A low percentage of bees (46-79% of released) survived the incubation and field-emergence processes; of those bees, the number of females that established at the nesting sites was 25-100%. Of the three field sites, one site consistently retained more females and produced more completed nests than the other sites, all of which usually had poor female establishment and progeny production. In addition, floral resources were depleted over time, but many flowers remained unvisited over the season. Nest production decreased over time, as numbers of flowers and female bees declined. Significant positive relationships were found between the intended stocking densities and 1) the number of females that actually survived incubation and field emergence and 2) the number of females that established nests. The number of females that established nests was positively affected by the number of females that survived to emerge in the field. The percentage of females that established was not significantly affected by the intended number of released bees, countering a prediction that the release of fewer bees would allow more females to establish nests and achieve high reproductive success. For growers, it may be more frugal to use modest numbers of M. rotundata for pollination, because many of the bees at medium and high stocking densities do not nest in grower-provided bee boards.

  19. Intended release and actual retention of alfalfa leafcutting bees (Hymenoptera: Megachilidae) for pollination in commercial alfalfa seed fields.

    PubMed

    Pitts-Singer, Theresa L

    2013-04-01

    Low, medium, and high stocking densities (15,000; 30,000; and 45,000-50,000 bees per acre, respectively) of Megachile rotundata (F.) (Hymenoptera: Megachilidae), the alfalfa leafcutting bee, were released over 4 yr in three research plots of Utah alfalfa, Medicago sativa L. (Fabaceae), planted at seed-production rates. A low percentage of bees (46-79% of released) survived the incubation and field-emergence processes; of those bees, the number of females that established at the nesting sites was 25-100%. Of the three field sites, one site consistently retained more females and produced more completed nests than the other sites, all of which usually had poor female establishment and progeny production. In addition, floral resources were depleted over time, but many flowers remained unvisited over the season. Nest production decreased over time, as numbers of flowers and female bees declined. Significant positive relationships were found between the intended stocking densities and 1) the number of females that actually survived incubation and field emergence and 2) the number of females that established nests. The number of females that established nests was positively affected by the number of females that survived to emerge in the field. The percentage of females that established was not significantly affected by the intended number of released bees, countering a prediction that the release of fewer bees would allow more females to establish nests and achieve high reproductive success. For growers, it may be more frugal to use modest numbers of M. rotundata for pollination, because many of the bees at medium and high stocking densities do not nest in grower-provided bee boards. PMID:23786042

  20. Characterization and Leach Testing for PUREX Cladding Waste Sludge (Group 3) and REDOX Cladding Waste Sludge (Group 4) Actual Waste Sample Composites

    SciTech Connect

    Snow, Lanee A.; Buck, Edgar C.; Casella, Amanda J.; Crum, Jarrod V.; Daniel, Richard C.; Draper, Kathryn E.; Edwards, Matthew K.; Fiskum, Sandra K.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Swoboda, Robert G.

    2009-02-13

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.(a) The testing program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual wastetesting program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—plutonium-uranium extraction (PUREX) cladding waste sludge (Group 3, or CWP) and reduction-oxidation (REDOX) cladding waste sludge (Group 4, or CWR)—are the subjects of this report. Both the Group 3 and 4 waste composites were anticipated to be high in gibbsite, requiring caustic leaching. Characterization of the composite Group 3 and Group 4 waste samples confirmed them to be high in gibbsite. The focus of the Group 3 and 4 testing was on determining the behavior of gibbsite during caustic leaching. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  1. Characterization, Leaching, and Filtration Testing for Bismuth Phosphate Sludge (Group 1) and Bismuth Phosphate Saltcake (Group 2) Actual Waste Sample Composites

    SciTech Connect

    Lumetta, Gregg J.; Buck, Edgar C.; Daniel, Richard C.; Draper, Kathryn; Edwards, Matthew K.; Fiskum, Sandra K.; Hallen, Richard T.; Jagoda, Lynette K.; Jenson, Evan D.; Kozelisky, Anne E.; MacFarlan, Paul J.; Peterson, Reid A.; Shimskey, Rick W.; Sinkov, Sergey I.; Snow, Lanee A.

    2009-02-19

    A testing program evaluating actual tank waste was developed in response to Task 4 from the M-12 External Flowsheet Review Team (EFRT) issue response plan.() The test program was subdivided into logical increments. The bulk water-insoluble solid wastes that are anticipated to be delivered to the Waste Treatment and Immobilization Plant (WTP) were identified according to type such that the actual waste testing could be targeted to the relevant categories. Eight broad waste groupings were defined. Samples available from the 222S archive were identified and obtained for testing. The actual waste-testing program included homogenizing the samples by group, characterizing the solids and aqueous phases, and performing parametric leaching tests. Two of the eight defined groups—bismuth phosphate sludge (Group 1) and bismuth phosphate saltcake (Group 2)—are the subjects of this report. The Group 1 waste was anticipated to be high in phosphorus and was implicitly assumed to be present as BiPO4 (however, results presented here indicate that the phosphate in Group 1 is actually present as amorphous iron(III) phosphate). The Group 2 waste was also anticipated to be high in phosphorus, but because of the relatively low bismuth content and higher aluminum content, it was anticipated that the Group 2 waste would contain a mixture of gibbsite, sodium phosphate, and aluminum phosphate. Thus, the focus of the Group 1 testing was on determining the behavior of P removal during caustic leaching, and the focus of the Group 2 testing was on the removal of both P and Al. The waste-type definition, archived sample conditions, homogenization activities, characterization (physical, chemical, radioisotope, and crystal habit), and caustic leaching behavior as functions of time, temperature, and hydroxide concentration are discussed in this report. Testing was conducted according to TP-RPP-WTP-467.

  2. Straight ladder inclined angle in a field environment: the relationship among actual angle, method of set-up and knowledge

    PubMed Central

    Chang, Wen-Ruey; Huang, Yueng-Hsiang; Chang, Chien-Chi; Brunette, Christopher; Fallentin, Nils

    2016-01-01

    Abstract Ladder inclined angle is a critical factor that could lead to a slip at the base of portable straight ladders, a major cause of falls from heights. Despite several methods established to help workers achieve the recommended 75.5° angle for ladder set-up, it remains unclear if these methods are used in practice. This study explored ladder set-up behaviours in a field environment. Professional installers of a company in the cable and other pay TV industry were observed for ladder set-up at their worksites. The results showed that the actual angles of 265 ladder set-ups by 67 participants averaged 67.3° with a standard deviation of 3.22°. Although all the participants had training on recommended ladder set-up methods, only 3 out of 67 participants applied these methods in their daily work and even they failed to achieve the desired 75.5° angle. Therefore, ladder set-up remains problematic in real-world situations. Practitioner Summary: Professional installers of a cable company were observed for portable straight ladder set-up at their worksites. The ladder inclined angle averaged 67.3° with a standard deviation of 3.22°, while the recommended angle is 75.5°. Only a few participants used the methods that they learned during training in their daily work. PMID:26672809

  3. Straight ladder inclined angle in a field environment: the relationship among actual angle, method of set-up and knowledge.

    PubMed

    Chang, Wen-Ruey; Huang, Yueng-Hsiang; Chang, Chien-Chi; Brunette, Christopher; Fallentin, Nils

    2016-08-01

    Ladder inclined angle is a critical factor that could lead to a slip at the base of portable straight ladders, a major cause of falls from heights. Despite several methods established to help workers achieve the recommended 75.5° angle for ladder set-up, it remains unclear if these methods are used in practice. This study explored ladder set-up behaviours in a field environment. Professional installers of a company in the cable and other pay TV industry were observed for ladder set-up at their worksites. The results showed that the actual angles of 265 ladder set-ups by 67 participants averaged 67.3° with a standard deviation of 3.22°. Although all the participants had training on recommended ladder set-up methods, only 3 out of 67 participants applied these methods in their daily work and even they failed to achieve the desired 75.5° angle. Therefore, ladder set-up remains problematic in real-world situations. Practitioner Summary: Professional installers of a cable company were observed for portable straight ladder set-up at their worksites. The ladder inclined angle averaged 67.3° with a standard deviation of 3.22°, while the recommended angle is 75.5°. Only a few participants used the methods that they learned during training in their daily work.

  4. A coupled remote sensing and simplified surface energy balance approach to estimate actual evapotranspiration from irrigated fields

    USGS Publications Warehouse

    Senay, G.B.; Budde, M.; Verdin, J.P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  5. A Coupled Remote Sensing and Simplified Surface Energy Balance Approach to Estimate Actual Evapotranspiration from Irrigated Fields

    PubMed Central

    Senay, Gabriel B.; Budde, Michael; Verdin, James P.; Melesse, Assefa M.

    2007-01-01

    Accurate crop performance monitoring and production estimation are critical for timely assessment of the food balance of several countries in the world. Since 2001, the Famine Early Warning Systems Network (FEWS NET) has been monitoring crop performance and relative production using satellite-derived data and simulation models in Africa, Central America, and Afghanistan where ground-based monitoring is limited because of a scarcity of weather stations. The commonly used crop monitoring models are based on a crop water-balance algorithm with inputs from satellite-derived rainfall estimates. These models are useful to monitor rainfed agriculture, but they are ineffective for irrigated areas. This study focused on Afghanistan, where over 80 percent of agricultural production comes from irrigated lands. We developed and implemented a Simplified Surface Energy Balance (SSEB) model to monitor and assess the performance of irrigated agriculture in Afghanistan using a combination of 1-km thermal data and 250-m Normalized Difference Vegetation Index (NDVI) data, both from the Moderate Resolution Imaging Spectroradiometer (MODIS) sensor. We estimated seasonal actual evapotranspiration (ETa) over a period of six years (2000-2005) for two major irrigated river basins in Afghanistan, the Kabul and the Helmand, by analyzing up to 19 cloud-free thermal and NDVI images from each year. These seasonal ETa estimates were used as relative indicators of year-to-year production magnitude differences. The temporal water-use pattern of the two irrigated basins was indicative of the cropping patterns specific to each region. Our results were comparable to field reports and to estimates based on watershed-wide crop water-balance model results. For example, both methods found that the 2003 seasonal ETa was the highest of all six years. The method also captured water management scenarios where a unique year-to-year variability was identified in addition to water-use differences between

  6. Copy number variants in a sample of patients with psychotic disorders: is standard screening relevant for actual clinical practice?

    PubMed Central

    Van de Kerkhof, Noortje WA; Feenstra, Ilse; van der Heijden, Frank MMA; de Leeuw, Nicole; Pfundt, Rolph; Stöber, Gerald; Egger, Jos IM; Verhoeven, Willem MA

    2012-01-01

    With the introduction of new genetic techniques such as genome-wide array comparative genomic hybridization, studies on the putative genetic etiology of schizophrenia have focused on the detection of copy number variants (CNVs), ie, microdeletions and/or microduplications, that are estimated to be present in up to 3% of patients with schizophrenia. In this study, out of a sample of 100 patients with psychotic disorders, 80 were investigated by array for the presence of CNVs. The assessment of the severity of psychiatric symptoms was performed using standardized instruments and ICD-10 was applied for diagnostic classification. In three patients, a submicroscopic CNV was demonstrated, one with a loss in 1q21.1 and two with a gain in 1p13.3 and 7q11.2, respectively. The association between these or other CNVs and schizophrenia or schizophrenia-like psychoses and their clinical implications still remain equivocal. While the CNV affected genes may enhance the vulnerability for psychiatric disorders via effects on neuronal architecture, these insights have not resulted in major changes in clinical practice as yet. Therefore, genome-wide array analysis should presently be restricted to those patients in whom psychotic symptoms are paired with other signs, particularly dysmorphisms and intellectual impairment. PMID:22848183

  7. Effects of Satellite Sampling Configurations on Derived Gridded Fields

    NASA Technical Reports Server (NTRS)

    Lait, Leslie R.

    1998-01-01

    Various configurations of a scanning satellite instrument are simulated by sampling realistic fields of nitrous oxide. Synoptic grids are computed from the resulting simulated orbital data and compared to the original sampled data fields. Results are compared with those obtained by flying a simulated satellite over low-resolution fields and fields that are static in time. Although increasing the number of instrument scan positions does provide more information along an orbital swath, using more than three to five scan positions does not significantly increase the accuracy of global synoptic grids using the gridding techniques described here.

  8. Astronaut Neil Armstrong studies rock samples during geological field trip

    NASA Technical Reports Server (NTRS)

    1969-01-01

    Astronaut Neil Armstrong, commander of the Apollo 11 lunar landing mission, studies rock samples during a geological field trip to the Quitman Mountains area near the Fort Quitman ruins in far west Texas.

  9. Development of field portable sampling and analysis systems

    SciTech Connect

    Beals, D.

    2000-06-08

    A rapid field portable sample and analysis system has been demonstrated at the Savannah River Site and the Hanford Site. The portable system can be used when rapid decisions are needed in the field during scoping or remediation activities, or when it is impractical to bring large volumes of water to the lab for analysis.

  10. Magnetostatic modes in ferromagnetic samples with inhomogeneous internal fields

    NASA Astrophysics Data System (ADS)

    Arias, Rodrigo

    2015-03-01

    Magnetostatic modes in ferromagnetic samples are very well characterized and understood in samples with uniform internal magnetic fields. More recently interest has shifted to the study of magnetization modes in ferromagnetic samples with inhomogeneous internal fields. The present work shows that under the magnetostatic approximation and for samples of arbitrary shape and/or arbitrary inhomogeneous internal magnetic fields the modes can be classified as elliptic or hyperbolic, and their associated frequency spectrum can be delimited. This results from the analysis of the character of the second order partial differential equation for the magnetostatic potential under these general conditions. In general, a sample with an inhomogeneous internal field and at a given frequency, may have regions of elliptic and hyperbolic character separated by a boundary. In the elliptic regions the magnetostatic modes have a smooth monotonic character (generally decaying form the surfaces (a ``tunneling'' behavior)) and in hyperbolic regions an oscillatory wave-like character. A simple local criterion distinguishes hyperbolic from elliptic regions: the sign of a susceptibility parameter. This study shows that one may control to some extent magnetostatic modes via external fields or geometry. R.E.A. acknowledges Financiamiento Basal para Centros Cientificos y Tecnologicos de Excelencia under Project No. FB 0807 (Chile), Grant No. ICM P10-061-F by Fondo de Innovacion para la Competitividad-MINECON, and Proyecto Fondecyt 1130192.

  11. Digital Curation of Earth Science Samples Starts in the Field

    NASA Astrophysics Data System (ADS)

    Lehnert, K. A.; Hsu, L.; Song, L.; Carter, M. R.

    2014-12-01

    Collection of physical samples in the field is an essential part of research in the Earth Sciences. Samples provide a basis for progress across many disciplines, from the study of global climate change now and over the Earth's history, to present and past biogeochemical cycles, to magmatic processes and mantle dynamics. The types of samples, methods of collection, and scope and scale of sampling campaigns are highly diverse, ranging from large-scale programs to drill rock and sediment cores on land, in lakes, and in the ocean, to environmental observation networks with continuous sampling, to single investigator or small team expeditions to remote areas around the globe or trips to local outcrops. Cyberinfrastructure for sample-related fieldwork needs to cater to the different needs of these diverse sampling activities, aligning with specific workflows, regional constraints such as connectivity or climate, and processing of samples. In general, digital tools should assist with capture and management of metadata about the sampling process (location, time, method) and the sample itself (type, dimension, context, images, etc.), management of the physical objects (e.g., sample labels with QR codes), and the seamless transfer of sample metadata to data systems and software relevant to the post-sampling data acquisition, data processing, and sample curation. In order to optimize CI capabilities for samples, tools and workflows need to adopt community-based standards and best practices for sample metadata, classification, identification and registration. This presentation will provide an overview and updates of several ongoing efforts that are relevant to the development of standards for digital sample management: the ODM2 project that has generated an information model for spatially-discrete, feature-based earth observations resulting from in-situ sensors and environmental samples, aligned with OGC's Observation & Measurements model (Horsburgh et al, AGU FM 2014

  12. Rotating sample magnetometer for cryogenic temperatures and high magnetic fields.

    PubMed

    Eisterer, M; Hengstberger, F; Voutsinas, C S; Hörhager, N; Sorta, S; Hecher, J; Weber, H W

    2011-06-01

    We report on the design and implementation of a rotating sample magnetometer (RSM) operating in the variable temperature insert (VTI) of a cryostat equipped with a high-field magnet. The limited space and the cryogenic temperatures impose the most critical design parameters: the small bore size of the magnet requires a very compact pick-up coil system and the low temperatures demand a very careful design of the bearings. Despite these difficulties the RSM achieves excellent resolution at high magnetic field sweep rates, exceeding that of a typical vibrating sample magnetometer by about a factor of ten. In addition the gas-flow cryostat and the high-field superconducting magnet provide a temperature and magnetic field range unprecedented for this type of magnetometer.

  13. Long-Term Ecological Monitoring Field Sampling Plan for 2007

    SciTech Connect

    T. Haney R. VanHorn

    2007-07-31

    This field sampling plan describes the field investigations planned for the Long-Term Ecological Monitoring Project at the Idaho National Laboratory Site in 2007. This plan and the Quality Assurance Project Plan for Waste Area Groups 1, 2, 3, 4, 5, 6, 7, 10, and Removal Actions constitute the sampling and analysis plan supporting long-term ecological monitoring sampling in 2007. The data collected under this plan will become part of the long-term ecological monitoring data set that is being collected annually. The data will be used t determine the requirements for the subsequent long-term ecological monitoring. This plan guides the 2007 investigations, including sampling, quality assurance, quality control, analytical procedures, and data management. As such, this plan will help to ensure that the resulting monitoring data will be scientifically valid, defensible, and of known and acceptable quality.

  14. Astronauts Armstrong and Aldrin study rock samples during field trip

    NASA Technical Reports Server (NTRS)

    1969-01-01

    Astronaut Neil Armstrong, commander of the Apollo 11 lunar landing mission, and Astronaut Edwin Aldrin, Lunar module pilot for Apollo 11, study rock samples during a geological field trip to the Quitman Mountains area near the Fort Quitman ruins in far west Texas.

  15. FIELD SAMPLING OF RESIDUAL AVIATION GASOLINE IN SANDY SOIL

    EPA Science Inventory

    Two complimentary field sampling methods for the determination of residual aviation gasoline content in the contaminated capillary fringe of a fine, uniform, sandy soil were investigated. The first method featured filed extrusion of core barrels into pint size Mason jars, while ...

  16. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  17. Field sampling method for quantifying odorants in humid environments.

    PubMed

    Trabue, Steven L; Scoggin, Kenwood D; Li, Hong; Burns, Robert; Xin, Hongwei

    2008-05-15

    Most air quality studies in agricultural environments use thermal desorption analysis for quantifying semivolatile organic compounds (SVOCs) associated with odor. The objective of this study was to develop a robust sampling technique for measuring SVOCs in humid environments. Test atmospheres were generated at ambient temperatures (23 +/- 1.5 degrees C) and 25, 50, and 80% relative humidity (RH). Sorbent material used included Tenax, graphitized carbon, and carbon molecular sieve (CMS). Sorbent tubes were challenged with 2, 4, 8, 12, and 24 L of air at various RHs. Sorbent tubes with CMS material performed poorly at both 50 and 80% RH dueto excessive sorption of water. Heating of CMS tubes during sampling or dry-purging of CMS tubes post sampling effectively reduced water sorption with heating of tubes being preferred due to the higher recovery and reproducibility. Tenaxtubes had breakthrough of the more volatile compounds and tended to form artifacts with increasing volumes of air sampled. Graphitized carbon sorbent tubes containing Carbopack X and Carbopack C performed best with quantitative recovery of all compounds at all RHs and sampling volumes tested. The graphitized carbon tubes were taken to the field for further testing. Field samples taken from inside swine feeding operations showed that butanoic acid, 4-methylphenol, 4-ethylphenol, indole, and 3-methylindole were the compounds detected most often above their odor threshold values. Field samples taken from a poultry facility demonstrated that butanoic acid, 3-methylbutanoic acid, and 4-methylphenol were the compounds above their odor threshold values detected most often, relative humidity, CAFO, VOC, SVOC, thermal desorption, swine, poultry, air quality, odor. PMID:18546717

  18. Comparison of simulants to actual neutralized current acid waste: Process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.

    1996-04-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs have been established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste is being performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  19. Comparison of simulants to actual neutralized current acid waste: process and product testing of three NCAW core samples from Tanks 101-AZ and 102-AZ

    SciTech Connect

    Morrey, E.V.; Tingey, J.M.; Elliott, M.L.

    1996-10-01

    A vitrification plant is planned to process the high-level waste (HLW) solids from Hanford Site tanks into canistered glass logs for disposal in a national repository. Programs were established within the Pacific Northwest Laboratory Vitrification Technology Development (PVTD) Project to test and model simulated waste to support design, feed processability, operations, permitting, safety, and waste-form qualification. Parallel testing with actual radioactive waste was performed on a laboratory-scale to confirm the validity of using simulants and glass property models developed from simulants. Laboratory-scale testing has been completed on three radioactive core samples from tanks 101-AZ and 102-AZ containing neutralized current acid waste (NCAW), which is one of the first waste types to be processed in the high-level waste vitrification plant under a privatization scenario. Properties of the radioactive waste measured during process and product testing were compared to simulant properties and model predictions to confirm the validity of simulant and glass property ,models work. This report includes results from the three NCAW core samples, comparable results from slurry and glass simulants, and comparisons to glass property model predictions.

  20. Field procedures manual: Sample handling, Salton Sea Scientific Drilling Project

    SciTech Connect

    Goff, S.; Mehegan, J.; Michels, D.

    1989-02-01

    This Field Procedures Manual is the comprehensive operations guide that was used to curate samples obtained from the Salton Sea Scientific Drilling Project (SSSDP). It is being published in the form used on site by the curation team. Samples recovered from the SSSDP were curated following the Policy Guidelines established for the Department of Energy/Office of Basic Energy Sciences (DOE/OBES) Continental Scientific Drilling Program (CSDP)/Thermal Regimes effort, which recognizes the uniqueness and site-specific nature of each drilling project. The SSSDP is a rotary drilling project that has provided cuttings and spot cores as well as liquid and gas samples. This manual provides details on handling all of these sample types. 6 refs., 10 figs.

  1. Sampling atmospheric pesticides with SPME: Laboratory developments and field study.

    PubMed

    Wang, Junxia; Tuduri, Ludovic; Mercury, Maud; Millet, Maurice; Briand, Olivier; Montury, Michel

    2009-02-01

    To estimate the atmospheric exposure of the greenhouse workers to pesticides, solid phase microextraction (SPME) was used under non-equilibrium conditions. Using Fick's law of diffusion, the concentrations of pesticides in the greenhouse can be calculated using pre-determined sampling rates (SRs). Thus the sampling rates (SRs) of two modes of SPME in the lab and in the field were determined and compared. The SRs for six pesticides in the lab were 20.4-48.3 mL min(-1) for the exposed fiber and 0.166-0.929 mL min(-1) for the retracted fiber. In field sampling, two pesticides, dichlorvos and cyprodinil were detected with exposed SPME. SR with exposed SPME for dichlorvos in the field (32.4 mL min(-1)) was consistent with that in the lab (34.5 mL min(-1)). SR for dichlorvos in the field (32.4 mL min(-1)) was consistent with that in the lab (34.5 mL min(-1)). The trends of temporal concentration and the inhalation exposure were also obtained.

  2. DESIGN, DEVELOPMENT AND FIELD DEPLOYMENT OF A TELEOPERATED SAMPLING SYSTEM

    SciTech Connect

    Dalmaso, M; Robert Fogle, R; Tony Hicks, T; Larry Harpring, L; Daniel Odell, D

    2007-11-09

    A teleoperated sampling system for the identification, collection and retrieval of samples following the detonation of an Improvised Nuclear Device (IND) or Radiological Dispersion Devise (RDD) has been developed and tested in numerous field exercises. The system has been developed as part of the Defense Threat Reduction Agency's (DTRA) National Technical Nuclear Forensic (NTNF) Program. The system is based on a Remotec ANDROS Mark V-A1 platform. Extensive modifications and additions have been incorporated into the platform to enable it to meet the mission requirements. The Defense Science Board Task Force on Unconventional Nuclear Warfare Defense, 2000 Summer Study Volume III report recommended the Department of Defense (DOD) improve nuclear forensics capabilities to achieve accurate and fast identification and attribution. One of the strongest elements of protection is deterrence through the threat of reprisal, but to accomplish this objective a more rapid and authoritative attribution system is needed. The NTNF program provides the capability for attribution. Early on in the NTNF program, it was recognized that there would be a desire to collect debris samples for analysis as soon as possible after a nuclear event. Based on nuclear test experience, it was recognized that mean radiation fields associated with even low yield events could be several thousand R/Hr near the detonation point for some time after the detonation. In anticipation of pressures to rapidly sample debris near the crater, considerable effort is being devoted to developing a remotely controlled vehicle that could enter the high radiation field area and collect one or more samples for subsequent analysis.

  3. Wide field of view multifocal scanning microscopy with sparse sampling

    NASA Astrophysics Data System (ADS)

    Wang, Jie; Wu, Jigang

    2016-02-01

    We propose to use sparsely sampled line scans with a sparsity-based reconstruction method to obtain images in a wide field of view (WFOV) multifocal scanning microscope. In the WFOV microscope, we used a holographically generated irregular focus grid to scan the sample in one dimension and then reconstructed the sample image from line scans by measuring the transmission of the foci through the sample during scanning. The line scans were randomly spaced with average spacing larger than the Nyquist sampling requirement, and the image was recovered with sparsity-based reconstruction techniques. With this scheme, the acquisition data can be significantly reduced and the restriction for equally spaced foci positions can be removed, indicating simpler experimental requirement. We built a prototype system and demonstrated the effectiveness of the reconstruction by recovering microscopic images of a U.S. Air Force target and an onion skin cell microscope slide with 40, 60, and 80% missing data with respect to the Nyquist sampling requirement.

  4. Comparison of aquatic macroinvertebrate samples collected using different field methods

    USGS Publications Warehouse

    Lenz, Bernard N.; Miller, Michael A.

    1996-01-01

    Government agencies, academic institutions, and volunteer monitoring groups in the State of Wisconsin collect aquatic macroinvertebrate data to assess water quality. Sampling methods differ among agencies, reflecting the differences in the sampling objectives of each agency. Lack of infor- mation about data comparability impedes data shar- ing among agencies, which can result in duplicated sampling efforts or the underutilization of avail- able information. To address these concerns, com- parisons were made of macroinvertebrate samples collected from wadeable streams in Wisconsin by personnel from the U.S. Geological Survey- National Water Quality Assessment Program (USGS-NAWQA), the Wisconsin Department of Natural Resources (WDNR), the U.S. Department of Agriculture-Forest Service (USDA-FS), and volunteers from the Water Action Volunteer-Water Quality Monitoring Program (WAV). This project was part of the Intergovernmental Task Force on Monitoring Water Quality (ITFM) Wisconsin Water Resources Coordination Project. The numbers, types, and environmental tolerances of the organ- isms collected were analyzed to determine if the four different field methods that were used by the different agencies and volunteer groups provide comparable results. Additionally, this study com- pared the results of samples taken from different locations and habitats within the same streams.

  5. Testing an Energy Balance Model for Estimating Actual Evapotranspiration Using Remotely Sensed Data. [Hannover, West Germany barley and wheat fields

    NASA Technical Reports Server (NTRS)

    Gurney, R. J.; Camillo, P. J.

    1985-01-01

    An energy-balance model is used to estimate daily evapotranspiration for 3 days for a barley field and a wheat field near Hannover, Federal Republic of Germany. The model was calibrated using once-daily estimates of surface temperatures, which may be remotely sensed. The evaporation estimates were within the 95% error bounds of independent eddy correlation estimates for the daytime periods for all three days for both sites, but the energy-balance estimates are generally higher; it is unclear which estimate is biassed. Soil moisture in the top 2 cm of soil, which may be remotely sensed, may be used to improve these evaporation estimates under partial ground cover. Sensitivity studies indicate the amount of ground data required is not excessive.

  6. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field.

    PubMed

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L; Miloushev, Vesselin; Poot, Alex J; Truong, Steven; Alvarez, Julio A; Aldeborgh, Hannah N; Keshari, Kayvan R

    2016-01-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting (13)C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength. PMID:27597137

  7. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field

    NASA Astrophysics Data System (ADS)

    Tee, Sui Seng; Digialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L.; Miloushev, Vesselin; Poot, Alex J.; Truong, Steven; Alvarez, Julio A.; Aldeborgh, Hannah N.; Keshari, Kayvan R.

    2016-09-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting 13C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength.

  8. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field.

    PubMed

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L; Miloushev, Vesselin; Poot, Alex J; Truong, Steven; Alvarez, Julio A; Aldeborgh, Hannah N; Keshari, Kayvan R

    2016-09-06

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting (13)C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength.

  9. Sampling Hyperpolarized Molecules Utilizing a 1 Tesla Permanent Magnetic Field

    PubMed Central

    Tee, Sui Seng; DiGialleonardo, Valentina; Eskandari, Roozbeh; Jeong, Sangmoo; Granlund, Kristin L.; Miloushev, Vesselin; Poot, Alex J.; Truong, Steven; Alvarez, Julio A.; Aldeborgh, Hannah N.; Keshari, Kayvan R.

    2016-01-01

    Hyperpolarized magnetic resonance spectroscopy (HP MRS) using dynamic nuclear polarization (DNP) is a technique that has greatly enhanced the sensitivity of detecting 13C nuclei. However, the HP MRS polarization decays in the liquid state according to the spin-lattice relaxation time (T1) of the nucleus. Sampling of the signal also destroys polarization, resulting in a limited temporal ability to observe biologically interesting reactions. In this study, we demonstrate that sampling hyperpolarized signals using a permanent magnet at 1 Tesla (1T) is a simple and cost-effective method to increase T1s without sacrificing signal-to-noise. Biologically-relevant information may be obtained with a permanent magnet using enzyme solutions and in whole cells. Of significance, our findings indicate that changes in pyruvate metabolism can also be quantified in a xenograft model at this field strength. PMID:27597137

  10. Actual Condition of Paddy Field Levee Maintenance by Various Farm Households including Large-scale Farming in the Developed Land Renting Area

    NASA Astrophysics Data System (ADS)

    Sakata, Yasuyo

    The survey of interview, resource acquisition, photographic operation, and questionnaire were carried out in the “n” Community in the “y” District in Hakusan City in Ishikawa Prefecture to investigate the actual condition of paddy field levee maintenance in the area where land-renting market was proceeding, large-scale farming was dominant, and the problems of geographically scattered farm-land existed. In the study zone, 1) an agricultural production legal person rent-cultivated some of the paddy fields and maintained the levees, 2) another agricultural production legal person rent-cultivated some of the soy bean fields for crop changeover and land owners maintained the levees. The results indicated that sufficient maintenance was executed on the levees of the paddy fields cultivated by the agricultural production legal person, the soy bean fields for crop changeover, and the paddy fields cultivated by the land owners. Each reason is considered to be the managerial strategy, the economic incentive, the mutual monitoring and cross-regulatory mechanism, etc.

  11. Dimensioning IRGA gas sampling systems: laboratory and field experiments

    NASA Astrophysics Data System (ADS)

    Aubinet, Marc; Joly, Lilian; Loustau, Denis; De Ligne, Anne; Chopin, Henri; Cousin, Julien; Chauvin, Nicolas; Decarpenterie, Thomas; Gross, Patrick

    2016-03-01

    Both laboratory and field experiments were carried out in order to define suitable configuration ranges for the gas sampling systems (GSSs) of infrared gas analyzers (IRGAs) used in eddy covariance measurements.

    In the laboratory, an original dynamic calibration bench was developed in order to test the frequency attenuation and pressure drop generated by filters. In the field, three IRGAs of the same type equipped with different filters or different rain caps were installed and run and the real frequency response of the complete setup was tested. The main results are as follows. - Filters may have a strong impact on the pressure drop in the GSS and this impact increases with flow rate. - Conversely, no impact of the tested filters on cut-off frequency was found, GSSs with and without filters presenting similar cut-off frequencies. - The main limiting factor of cut-off frequency in the field was found to be the rain cap design. In addition, the impact of this design on pressure drop was also found to be noteworthy.

  12. Dimensioning IRGA gas sampling system : laboratory and field experiments

    NASA Astrophysics Data System (ADS)

    Aubinet, Marc; Joly, Lilian; Loustau, Denis; De Ligne, Anne; Chopin, Henri; Cousin, Julien; De Carpenterie, Thomas; Gross, Patrick; Chauvin, Nicolas

    2016-04-01

    Both laboratory and field experiments were carried out in order to define suitable configuration ranges for the gas sampling systems (GSS) of infrared gas analyzers (IRGA) used in eddy covariance measurements. In the laboratory, an original dynamic calibration bench was developed in order to test the frequency attenuation and pressure drop generated by filters. In the field, three IRGAs of the same type equipped with different filters or different rain caps were installed and run and the real frequency response of the complete set-up was tested. The main results are that: - Filters may have a strong impact on the pressure drop in the GSS and this impact increases with flow rate. - On the contrary, no impact of the tested filters on cut off frequency was found, GSS with and without filters presenting similar cut off frequencies. - The main limiting factor of cut off frequency in the field was found to be the rain cap design. In addition, the impact of this design on pressure drop was also found noteworthy.

  13. Virtual MEG Helmet: Computer Simulation of an Approach to Neuromagnetic Field Sampling.

    PubMed

    Medvedovsky, Mordekhay; Nenonen, Jukka; Koptelova, Alexandra; Butorina, Anna; Paetau, Ritva; Mäkelä, Jyrki P; Ahonen, Antti; Simola, Juha; Gazit, Tomer; Taulu, Samu

    2016-03-01

    Head movements during an MEG recording are commonly considered an obstacle. In this computer simulation study, we introduce an approach, the virtual MEG helmet (VMH), which employs the head movements for data quality improvement. With a VMH, a denser MEG helmet is constructed by adding new sensors corresponding to different head positions. Based on the Shannon's theory of communication, we calculated the total information as a figure of merit for comparing the actual 306-sensor Elekta Neuromag helmet to several types of the VMH. As source models, we used simulated randomly distributed source current (RDSC), simulated auditory and somatosensory evoked fields. Using the RDSC model with the simulation of 360 recorded events, the total information (bits/sample) was 989 for the most informative single head position and up to 1272 for the VMH (addition of 28.6%). Using simulated AEFs, the additional contribution of a VMH was 12.6% and using simulated SEF only 1.1%. For the distributed and bilateral sources, a VMH can provide a more informative sampling of the neuromagnetic field during the same recording time than measuring the MEG from one head position. VMH can, in some situations, improve source localization of the neuromagnetic fields related to the normal and pathological brain activity. This should be investigated further employing real MEG recordings.

  14. Field sampling of unfed adults of Amblyomma hebraeum Koch.

    PubMed

    Norval, R A; Yunker, C E; Butler, J F

    1987-08-01

    No methods have previously been available for the field sampling of unfed adults of Amblyomma hebraeum. We released 2000 unfed adults into a 5-m2 area in mopane woodland in southeastern Zimbabwe. The ticks sought shelter beneath the debris on the soil surface but emerged and became active in host seeking when stimulated. Effective stimuli were the odours of cattle and sheep and high concentrations of carbon dioxide from dry ice. The ticks did not respond to low concentrations of carbon dioxide, vibrations generated by stamping the ground with poles, or two volatile components of ox breath known to attract tsetse flies. The presence of humans in the release area also had little or no effect in stimulating the ticks. As adults of A. hebraeum are large and conspicuous they can easily be collected from the soil surface, either manually or using a vacuum device, after stimulation by cattle or the release of high concentrations of carbon dioxide.

  15. Cryogen free high magnetic field sample environment for neutron scattering

    NASA Astrophysics Data System (ADS)

    Down, R. B. E.; Kouzmenko, G.; Kirichek, O.; Wotherspoon, R.; Brown, J.; Bowden, Z. A.

    2010-11-01

    Cryogenic equipment can be found in the majority of neutron scattering experiments. Recent increases in liquid helium cost caused by global helium supply problems lead to significant concern about affordability of conventional cryogenic equipment. However the latest progress in cryo-cooler technology offers a new generation of cryogenic systems in which the cryogen consumption can be significantly reduced and in some cases completely eliminated. These systems also offer the advantage of operational simplicity, require less space than conventional cryogen-cooled systems and can significantly improve user safety. At the ISIS facility it is possible to substitute conventional cryostats with cryogen free systems. Such systems are based on the pulse tube refrigerator (PTR) which possesses no cold moving parts. Oxford Instruments in collaboration with ISIS have developed new high magnetic field sample environment equipment based on re-condensing technology. This project includes 9T wide angle chopper magnet for spectrometry and 14T magnet for diffraction. The main advantage of these systems is that all magnet operating procedures, for example cooling, running up to the field and quenching remain the same as for a standard magnet in a bath cryostat. This approach also provides a homogeneous temperature distribution, which is crucial for optimum magnet performance.

  16. An Autosampler and Field Sample Carrier for Maximizing Throughput Using an Open-Air, Surface Sampling Ion Source for MS

    EPA Science Inventory

    A recently developed, commercially available, open-air, surface sampling ion source for mass spectrometers provides individual analyses in several seconds. To realize its full throughput potential, an autosampler and field sample carrier were designed and built. The autosampler ...

  17. Total Cyanide Field Spikes for Industrial Wastewater Samples Verify Successful Sample Integrity, Preservation, Pre-Treatment and Testing.

    PubMed

    Delaney, Michael F; Blodget, Charles

    2015-06-01

    Obtaining accurate and precise results for total cyanide concentrations in wastewater samples is fraught with positive and negative interferences. Even the United States Environmental Protection Agency has acknowledged that it may be difficult or impossible to adequately mitigate all interferences. We demonstrated that a field spike of complex cyanide can be successfully used to demonstrate when sampling, preservation, pre-treatment, and analysis techniques are working adequately to retain any cyanide present in the sample without causing false positives or false negatives. For 257 industrial wastewater effluent samples collected at a wide variety of Greater Boston industries, 237 (92.2%) had usable field spike recoveries, averaging 86.2% recovery. Field spike recoveries for problematic industries that had very high or very low field spike recoveries were useful to show when alternative preservations and field dilutions were successfully preserving total cyanide. The field spike approach is general and should also work in a similar manner for raw and treated drinking water samples.

  18. Terahertz imaging using full-field electrooptic sampling

    NASA Astrophysics Data System (ADS)

    Ayesheshim, Ayesheshim Kebie

    Real time terahertz imaging is emerging as an important non-destructive imaging tool for medical, quality control, security and other industrial applications. In this thesis, we demonstrate real-time full-field terahertz (THz) imaging of still, moving, and concealed objects, and real-time THz images of the field distribution on the imaging plane. A femtosecond laser pulse from an amplified Ti:sapphire laser system with a pulse duration of 100 fs, repetition rate of 1 kHz, and 800 nm center wavelength is used to generate THz pulses via optical rectification in a 15x15 mm2 by 2 mm thick [110] ZnTe crystal. The THz pulses are collimated to a 1" diameter beam using off-axis parabolic reflectors. An object is placed in the collimated THz beam, and a plastic lens is used to form an image of the object on a second ZnTe crystal (detector). The THz image is detected by free-space electro-optic sampling using a large diameter gating beam derived from the laser source. Video or still images are captured by an 8-bit (30 fps) grayscale CCD camera, and objects hidden behind paper or inside Styrofoam can be clearly seen in real-time. We also study the ring-like spatial intensity distribution of the various frequency components of the THz pulse focused in the image plane by varying the time-delay between the THz and probe beams. Methods for improving signal-to-noise such as frame averaging and dynamic subtraction are also studied.

  19. Field evaluation of endotoxin air sampling assay methods.

    PubMed

    Thorne, P S; Reynolds, S J; Milton, D K; Bloebaum, P D; Zhang, X; Whitten, P; Burmeister, L F

    1997-11-01

    This study tested the importance of filter media, extraction and assay protocol, and bioaerosol source on the determination of endotoxin under field conditions in swine and poultry confinement buildings. Multiple simultaneous air samples were collected using glass fiber (GF) and polycarbonate (PC) filters, and these were assayed using two methods in two separate laboratories: an endpoint chromogenic Limulus amebocyte lysate (LAL) assay (QCL) performed in water and a kinetic chromogenic LAL assay (KQCL) performed in buffer with resistant-parallel line estimation analysis (KLARE). In addition, two aqueous filter extraction methods were compared in the QCL assay: 120 min extraction at 22 degrees C with vigorous shaking and 30 min extraction at 68 degrees C with gentle rocking. These extraction methods yielded endotoxin activities that were not significantly different and were very highly correlated. Reproducibility of endotoxin determinations from duplicate air sampling filters was very high (Cronbach alpha all > 0.94). When analyzed by the QCL method GF filters yielded significantly higher endotoxin activity than PC filters. QCL and KLARE methods gave similar estimates for endotoxin activity from PC filters; however, GF filters analyzed by the QCL method yielded significantly higher endotoxin activity estimates, suggesting enhancement of the QCL assay or inhibition of the KLARE asay with GF filters. Correlation between QCL-GF and QCL-PC was high (r = 0.98) while that between KLARE-GF and KLARE-PC was moderate (r = 0.68). Analysis of variance demonstrated that assay methodology, filter-type, barn-type, and interactions between assay and filter-type and between assay and barn-type were important factors influencing endotoxin exposure assessment.

  20. A Sample of OB Stars that Formed in the Field

    NASA Astrophysics Data System (ADS)

    Oey, M. S.; Lamb, J. B.; Kushner, C. T.; Pellegrini, E. W.; Graus, A. S.

    2013-05-01

    We present a sample of 14 OB stars in the Small Magellanic Cloud that meet strong criteria for having formed under extremely sparse star-forming conditions in the field. These stars are a minimum of 28 pc in projection from other OB stars, and they are centered within symmetric, round H II regions. They show no evidence of bow shocks, implying that the targets are not transverse runaway stars. Their radial velocities relative to local H I also indicate that they are not line-of-sight runaway stars. A friends-of-friends analysis shows that nine of the objects present a few low-mass companion stars, with typical mass ratios for the two highest-mass stars of around 0.1. This further substantiates that these OB stars formed in place, and that they can and do form in extremely sparse conditions. This poses strong constraints on theories of star formation and challenges proposed relations between cluster mass and maximum stellar mass.

  1. A SAMPLE OF OB STARS THAT FORMED IN THE FIELD

    SciTech Connect

    Oey, M. S.; Lamb, J. B.; Kushner, C. T.; Pellegrini, E. W.; Graus, A. S.

    2013-05-01

    We present a sample of 14 OB stars in the Small Magellanic Cloud that meet strong criteria for having formed under extremely sparse star-forming conditions in the field. These stars are a minimum of 28 pc in projection from other OB stars, and they are centered within symmetric, round H II regions. They show no evidence of bow shocks, implying that the targets are not transverse runaway stars. Their radial velocities relative to local H I also indicate that they are not line-of-sight runaway stars. A friends-of-friends analysis shows that nine of the objects present a few low-mass companion stars, with typical mass ratios for the two highest-mass stars of around 0.1. This further substantiates that these OB stars formed in place, and that they can and do form in extremely sparse conditions. This poses strong constraints on theories of star formation and challenges proposed relations between cluster mass and maximum stellar mass.

  2. Preliminary Study on the Radar Vegetation Index (RVI) Application to Actual Paddy Fields by ALOS/PALSAR Full-polarimetry SAR Data

    NASA Astrophysics Data System (ADS)

    Yamada, Y.

    2015-04-01

    Kim and van Zyl (2001) proposed a kind of radar vegetation index (RVI). RVI = 4*min(λ1, λ2, λ3) / (λ1 + λ2 + λ3) They modified the equation as follows. (2009) RVI = 8 * σ0hv / (σ0hh + σ0vv +σ0hv ) by L-band full-polarimetric SAR data. They applied it into rice crop and soybean. (Y.Kim, T.Jackson et al., 2012) They compared RVI for L-, C- and X-bands to crop growth data, LAI and NDVI. They found L-band RVI was well correlated with Vegetation Water Content, LAI and NDVI. But the field data were collected by the multifrequency polarimetric scatterometer. The platform height was 4.16 meters from the ground. The author tried to apply the method to actual paddy fields near Tsukuba science city in Japan using ALOS/PALSAR, full-polarimetry L-band SAR data. The staple crop in Eastern Asia is rice and paddy fields are dominant land use. A rice-planting machine comes into wide use in this areas. The young rice plants were bedded regularly ridged line in the paddy fields by the machine. The space between two ridges of rice plants is about 30 cm and the wave length of PALSAR sensor is about 23 cm. Hence the Bragg scattering will appear depending upon the direction of the ridges of paddy fields. Once the Bragg scattering occurs, the backscattering values from the pixels should be very high comparing the surrounding region. Therefore the radar vegetation index (RVI) would be saturated. The RVI did not follow the increasing of vegetation anymore. Japan has launched ALOS-2 satellite and it has PALSAR-2, L-band SAR. Therefore RVI application product by PALSAR-2 will be watched with deep interest.

  3. COMPARISON OF USEPA FIELD SAMPLING METHODS FOR BENTHIC MACROINVERTEBRATE STUDIES

    EPA Science Inventory

    Two U.S. Environmental Protection Agency (USEPA) macroinvertebrate sampling protocols were compared in the Mid-Atlantic Highlands region. The Environmental Monitoring and Assessment Program (EMAP) wadeable streams protocol results in a single composite sample from nine transects...

  4. MAGNETIC FIELDS IN A SAMPLE OF NEARBY SPIRAL GALAXIES

    SciTech Connect

    Van Eck, C. L.; Brown, J. C.; Shukurov, A.; Fletcher, A. E-mail: jocat@ucalgary.ca E-mail: andrew.fletcher@ncl.ac.uk

    2015-01-20

    Both observations and modeling of magnetic fields in the diffuse interstellar gas of spiral galaxies are well developed, but the theory has been confronted with observations for only a handful of individual galaxies. There is now sufficient data to consider the statistical properties of galactic magnetic fields. We have collected data from the literature on the magnetic fields and interstellar media of 20 spiral galaxies, and tested for various physically motivated correlations between magnetic field and interstellar medium parameters. Clear correlations emerge between the total magnetic field strength and molecular gas density as well as the star formation rate. The magnetic pitch angle exhibits correlations with the total gas density, the star formation rate, and the strength of the axisymmetric component of the mean magnetic field. The total and mean magnetic field strengths exhibit a noticeable degree of correlation, suggesting a universal behavior of the degree of order in galactic magnetic fields. We also compare the predictions of galactic dynamo theory to observed magnetic field parameters and identify directions in which theory and observations might be usefully developed.

  5. CTEPP NC DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Other Persistent...

  6. A contemporary decennial global sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, E.; Roy, D. P.

    2011-12-01

    In the last several hundred years agriculture has caused significant human induced Land Cover Land Use Change (LCLUC) with dramatic cropland expansion and a marked increase in agricultural productivity. The size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLUC. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, diffusion of disease pathogens and pests, and loss or degradation in buffers to nutrient, herbicide and pesticide flows. In this study, globally distributed locations with significant contemporary field size change were selected guided by a global map of agricultural yield and literature review and were selected to be representative of different driving forces of field size change (associated with technological innovation, socio-economic conditions, government policy, historic patterns of land cover land use, and environmental setting). Seasonal Landsat data acquired on a decadal basis (for 1980, 1990, 2000 and 2010) were used to extract field boundaries and the temporal changes in field size quantified and their causes discussed.

  7. Estimation of Actual Crop ET of Paddy Using the Energy Balance Model SMARET and Validation with Field Water Balance Measurements and a Crop Growth Model (ORYZA)

    NASA Astrophysics Data System (ADS)

    Nallasamy, N. D.; Muraleedharan, B. V.; Kathirvel, K.; Narasimhan, B.

    2014-12-01

    Sustainable management of water resources requires reliable estimates of actual evapotranspiration (ET) at fine spatial and temporal resolution. This is significant in the case of rice based irrigation systems, one of the major consumers of surface water resources and where ET forms a major component of water consumption. However huge tradeoff in the spatial and temporal resolution of satellite images coupled with lack of adequate number of cloud free images within a growing season act as major constraints in deriving ET at fine spatial and temporal resolution using remote sensing based energy balance models. The scale at which ET is determined is decided by the spatial and temporal scale of Land Surface Temperature (LST) and Normalized Difference Vegetation Index (NDVI), which form inputs to energy balance models. In this context, the current study employed disaggregation algorithms (NL-DisTrad and DisNDVI) to generate time series of LST and NDVI images at fine resolution. The disaggregation algorithms aimed at generating LST and NDVI at finer scale by integrating temporal information from concurrent coarse resolution data and spatial information from a single fine resolution image. The temporal frequency of the disaggregated images is further improved by employing composite images of NDVI and LST in the spatio-temporal disaggregation method. The study further employed half-hourly incoming surface insolation and outgoing long wave radiation obtained from the Indian geostationary satellite (Kalpana-1) to convert the instantaneous ET into daily ET and subsequently to the seasonal ET, thereby improving the accuracy of ET estimates. The estimates of ET were validated with field based water balance measurements carried out in Gadana, a subbasin predominated by rice paddy fields, located in Tamil Nadu, India.

  8. Effect of sample size in the evaluation of "in-field" sampling plans for aflatoxin B(1) determination in corn.

    PubMed

    Brera, Carlo; De Santis, Barbara; Prantera, Elisabetta; Debegnach, Francesca; Pannunzi, Elena; Fasano, Floriana; Berdini, Clara; Slate, Andrew B; Miraglia, Marina; Whitaker, Thomas B

    2010-08-11

    Use of proper sampling methods throughout the agri-food chain is crucial when it comes to effectively detecting contaminants in foods and feeds. The objective of the study was to estimate the performance of sampling plan designs to determine aflatoxin B(1) (AFB(1)) contamination in corn fields. A total of 840 ears were selected from a corn field suspected of being contaminated with aflatoxin. The mean and variance among the aflatoxin values for each ear were 10.6 mug/kg and 2233.3, respectively. The variability and confidence intervals associated with sample means of a given size could be predicted using an equation associated with the normal distribution. Sample sizes of 248 and 674 ears would be required to estimate the true field concentration of 10.6 mug/kg within +/-50 and +/-30%, respectively. Using the distribution information from the study, operating characteristic curves were developed to show the performance of various sampling plan designs.

  9. CTEPP: RECRUITING AND FIELD SAMPLING IN NORTH CAROLINA AND OHIO

    EPA Science Inventory

    The research field study (CTEPP) of approximately 260 preschool children's exposures to persistent organic pollutants in their everyday environments began in early 2000. CTEPP is a multimedia study of the children's aggregate (total) exposures over a 48-hr period, both at thei...

  10. Field test of the IMEEDS radionuclide sampling system

    SciTech Connect

    Bandong, B; Bianchini, G; Esser, B; Volpe, A M.

    1998-09-15

    This report describes the function and performance of a seawater sampling system. The purpose of the sampling system is to process water and isolate, or concentrate man-made radionuclides present in the marine environment. Many of these isotopes are present in natural waters at extremely low levels, if at all. Also, biogeochemical processes in the environment sequester elements so that any given analyte may be in a compound, molecular, or ionic state, and associated with solid, colloidal and dissolved phases. The distribution of radioisotopes in natural waters is controlled by chemical speciation, pH, temperature, redox conditions, complex formation, adsorption and desorption, salinity, conductivity, and hydrolytic colloid formation (Harvey et al., 1990; von Gunten and Benes, 1995). Therefore, the goal of this work is to develop a sampler that is capable of isolating suites of radionuclides as they are found in the environment.

  11. Development and field testing of a miniaturized sampling system for simultaneous sampling of vapours and droplets.

    PubMed

    Breuer, Dietmar; Dragan, George C; Friedrich, Claudia; Möhlmann, Carsten; Zimmermann, Ralf

    2015-02-01

    The sampling of semi volatiles (SV) in workplaces may lead to different results as measurements may be affected by sampling bias. The new European Standard EN 13936 defines "semi-volatiles" as substances with vapour pressures in the range between 0.001 and 100 Pa at room temperature. EN 13936 regulates the basic requirements for SV compounds that can occur as vapour and particle at the same time. Vapour and particles shall not be sampled separately and particles have to be sampled as inhalable fraction. Following EN 13936, the Institute for Occupational Safety and Health (Institut für Arbeitsschutz - IFA) has developed a miniaturized droplet-vapour sampler (GGP-Mini) which is designed to sample the inhalable aerosol fraction at low flow rates. The GGP-Mini uses 13 mm filters for particle sampling combined with adsorption tubes for vapour sampling. Laboratory tests were performed on 11 polar and non-polar compounds in a boiling point range from 188 °C to 318 °C. The substances were spiked directly on the filter followed by aspiration of 40 litres of air. Substances with boiling points below 230 °C were almost completely evaporated. Substances with boiling points above 230 °C up to 300 °C were found on both filter and charcoal tube. Lower-volatile compounds remained almost completely on the filter. For polar substances, the atmospheric humidity had a considerable influence upon the distribution of the liquid and vaporous components. A strong influence of the sampling temperature was found in the range from 0 °C to 50 °C. Droplet-vapour mixtures of n-hexadecane and diethylene glycol with droplet sizes between 1 μm and 4 μm were generated in a flow tube to verify the laboratory results. The aerosol concentrations were analysed on-line with a particle sizer and a flame ionisation detector, while parallel off-line samples were taken with the GGP-Mini. Evaporation losses from filters could be studied by comparing the on-line with off-line measurements. All

  12. Tackling field-portable Raman spectroscopy of real world samples

    NASA Astrophysics Data System (ADS)

    Shand, Neil C.

    2008-10-01

    A major challenge confronting first responders, customs authorities and other security-related organisations is the accurate, rapid, and safe identification of potentially hazardous chemicals outside a laboratory environment. Currently, a range of hand portable Raman equipment is commercially available that is low cost and increasingly more sophisticated. These systems are generally based on the 785nm Stokes shifted Raman technique with many using dispersive grating spectrometers. This technique offers a broad range of capabilities including the ability to analyse illicit drugs, explosives, chemical weapons and pre-cursors but still has some fundamental constraints. 'Real world' samples, such as those found at a crime scene, will often not be presented in the most accessible manner. Simple issues such as glass fluorescence can make an otherwise tractable sample impossible to analyse in-situ. A new generation of portable Raman equipment is currently being developed to address these issues. Consideration is given to the use of longer wavelength for fluorescence reduction. Alternative optical designs are being tested to compensate for the signal reduction incurred by moving to longer wavelengths. Furthermore, the use of anti-Stokes spectroscopy is being considered as well as investigating the robustness and portability of traditional Fourier Transform interferometer designs along with future advances in detector technology and ultra small spectrometers.

  13. Assessment of sampling and analytical uncertainty of trace element contents in arable field soils.

    PubMed

    Buczko, Uwe; Kuchenbuch, Rolf O; Ubelhör, Walter; Nätscher, Ludwig

    2012-07-01

    Assessment of trace element contents in soils is required in Germany (and other countries) before sewage sludge application on arable soils. The reliability of measured element contents is affected by measurement uncertainty, which consists of components due to (1) sampling, (2) laboratory repeatability (intra-lab) and (3) reproducibility (between-lab). A complete characterization of average trace element contents in field soils should encompass the uncertainty of all these components. The objectives of this study were to elucidate the magnitude and relative proportions of uncertainty components for the metals As, B, Cd, Co, Cr, Mo, Ni, Pb, Tl and Zn in three arable fields of different field-scale heterogeneity, based on a collaborative trial (CT) (standardized procedure) and two sampling proficiency tests (PT) (individual sampling procedure). To obtain reference values and estimates of field-scale heterogeneity, a detailed reference sampling was conducted. Components of uncertainty (sampling person, sampling repetition, laboratory) were estimated by variance component analysis, whereas reproducibility uncertainty was estimated using results from numerous laboratory proficiency tests. Sampling uncertainty in general increased with field-scale heterogeneity; however, total uncertainty was mostly dominated by (total) laboratory uncertainty. Reproducibility analytical uncertainty was on average by a factor of about 3 higher than repeatability uncertainty. Therefore, analysis within one single laboratory and, for heterogeneous fields, a reduction of sampling uncertainty (for instance by larger numbers of sample increments and/or a denser coverage of the field area) would be most effective to reduce total uncertainty. On the other hand, when only intra-laboratory analytical uncertainty was considered, total sampling uncertainty on average prevailed over analytical uncertainty by a factor of 2. Both sampling and laboratory repeatability uncertainty were highly variable

  14. Effect of sample size in the evaluation of "in-field" sampling plans for aflatoxin B(1) determination in corn.

    PubMed

    Brera, Carlo; De Santis, Barbara; Prantera, Elisabetta; Debegnach, Francesca; Pannunzi, Elena; Fasano, Floriana; Berdini, Clara; Slate, Andrew B; Miraglia, Marina; Whitaker, Thomas B

    2010-08-11

    Use of proper sampling methods throughout the agri-food chain is crucial when it comes to effectively detecting contaminants in foods and feeds. The objective of the study was to estimate the performance of sampling plan designs to determine aflatoxin B(1) (AFB(1)) contamination in corn fields. A total of 840 ears were selected from a corn field suspected of being contaminated with aflatoxin. The mean and variance among the aflatoxin values for each ear were 10.6 mug/kg and 2233.3, respectively. The variability and confidence intervals associated with sample means of a given size could be predicted using an equation associated with the normal distribution. Sample sizes of 248 and 674 ears would be required to estimate the true field concentration of 10.6 mug/kg within +/-50 and +/-30%, respectively. Using the distribution information from the study, operating characteristic curves were developed to show the performance of various sampling plan designs. PMID:20608734

  15. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    SciTech Connect

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  16. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS ? (ABSTRACT)

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  17. FIELD-SCALE STUDIES: HOW DOES SOIL SAMPLE PRETREATMENT AFFECT REPRESENTATIVENESS?

    EPA Science Inventory

    Samples from field-scale studies are very heterogeneous and can contain large soil and rock particles. Oversize materials are often removed before chemical analysis of the soil samples because it is not practical to include these materials. Is the extracted sample representativ...

  18. Optimization of field-amplified sample injection for analysis of peptides by capillary electrophoresis-mass spectrometry.

    PubMed

    Yang, Yuanzhong; Boysen, Reinhard I; Hearn, Milton T W

    2006-07-15

    A versatile experimental approach is described to achieve very high sensitivity analysis of peptides by capillary electrophoresis-mass spectrometry with sheath flow configuration based on optimization of field-amplified sample injection. Compared to traditional hydrodynamic injection methods, signal enhancement in terms of detection sensitivity of the bioanalytes by more than 3000-fold can be achieved. The effects of injection conditions, composition of the acid and organic solvent in the sample solution, length of the water plug, sample injection time, and voltage on the efficiency of the sample stacking have been systematically investigated, with peptides in the low-nanomolar (10(-9) M) range readily detected under the optimized conditions. Linearity of the established stacking method was found to be excellent over 2 orders of magnitude of concentration. The method was further evaluated for the analysis of low concentration bioactive peptide mixtures and tryptic digests of proteins. A distinguishing feature of the described approach is that it can be employed directly for the analysis of low-abundance protein fragments generated by enzymatic digestion and a reversed-phase-based sample-desalting procedure. Thus, rapid identification of protein fragments as low-abundance analytes can be achieved with this new approach by comparison of the actual tandem mass spectra of selected peptides with the predicted fragmentation patterns using online database searching algorithms. PMID:16841892

  19. Communication: Multiple atomistic force fields in a single enhanced sampling simulation

    SciTech Connect

    Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H.

    2015-07-14

    The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.

  20. Communication: Multiple atomistic force fields in a single enhanced sampling simulation.

    PubMed

    Hoang Viet, Man; Derreumaux, Philippe; Nguyen, Phuong H

    2015-07-14

    The main concerns of biomolecular dynamics simulations are the convergence of the conformational sampling and the dependence of the results on the force fields. While the first issue can be addressed by employing enhanced sampling techniques such as simulated tempering or replica exchange molecular dynamics, repeating these simulations with different force fields is very time consuming. Here, we propose an automatic method that includes different force fields into a single advanced sampling simulation. Conformational sampling using three all-atom force fields is enhanced by simulated tempering and by formulating the weight parameters of the simulated tempering method in terms of the energy fluctuations, the system is able to perform random walk in both temperature and force field spaces. The method is first demonstrated on a 1D system and then validated by the folding of the 10-residue chignolin peptide in explicit water.

  1. A laboratory and field evaluation of a portable immunoassay test for triazine herbicides in environmental water samples

    USGS Publications Warehouse

    Schulze, P.A.; Capel, P.D.; Squillace, P.J.; Helsel, D.R.

    1993-01-01

    The usefulness and sensitivity, of a portable immunoassay test for the semiquantitative field screening of water samples was evaluated by means of laboratory and field studies. Laboratory results indicated that the tests were useful for the determination of atrazine concentrations of 0.1 to 1.5 μg/L. At a concentration of 1 μg/L, the relative standard deviation in the difference between the regression line and the actual result was about 40 percent. The immunoassay was less sensitive and produced similar errors for other triazine herbicides. After standardization, the test results were relatively insensitive to ionic content and variations in pH (range, 4 to 10), mildly sensitive to temperature changes, and quite sensitive to the timing of the final incubation step, variances in timing can be a significant source of error. Almost all of the immunoassays predicted a higher atrazine concentration in water samples when compared to results of gas chromatography. If these tests are used as a semiquantitative screening tool, this tendency for overprediction does not diminish the tests' usefulness. Generally, the tests seem to be a valuable method for screening water samples for triazine herbicides.

  2. Case study of sample spacing in planar near-field measurement of high gain antennas

    NASA Technical Reports Server (NTRS)

    Acosta, R. J.; Lee, R. Q.

    1984-01-01

    Far field antenna patterns can be reconstructed from planar near field measurements acquired at a sample spacing of lambda/2 or less. For electrically large antennas, sampling at the Nyquist rate may result in errors due to system electronic drift over long acquisition times. The computer capacity may limit the largest size of the near field data set. The requirement to sample at the Nyquist rate is relaxed for high gain antennas which concentrate most of the radiated energy into a small angular region of the far field. The criteria for sample spacing at greater than lambda/e through the use of a priori information of the antenna radiation characteristics are presented. Far field patterns of a 30 GHz dual offset reflector system with a 2.7 m parabolic main reflector are computed from near field data obtained at sample spacings ranging from 0.1 lambda to 10 lambda. The effects of sampling interval and spectrum cutoff on the far field patterns are discussed.

  3. Field guidelines for collection, treatment, and analysis of water samples, Montana district

    USGS Publications Warehouse

    Knapton, J.R.

    1985-01-01

    This manual provides a set of standardized guidelines and quality-control procedures for the collection and preservation of water samples and defines procedures for field analyses of unstable constituents or properties. Seldom is the water being samples of such uniformity that a single grab sample is representative of the whole. For this reason a variety of sampler types and sampling methods have been devised. Descriptions and procedures for field use are given for a number of sampler types. Several methods of sampling are described for which these samplers can be used. Sample-processing devices such as sample splitters and filtration apparatus are discussed along with methods of cleaning. Depending on the type of analysis to be performed in the laboratory, samples may need to be preserved shortly after collection. Various types of preservation are described in detail. Analyses for unstable constituents or properties are of necessity accomplished in the field. This manual addresses analytical techniques and quality assurance for: (1) Water temperature, (2) specific conductance, (3) pH, (4) alkalinity, (5) dissolved oxygen, and (6) bacteria. Examples of field report forms are given as attachments. Information pertinent to certain field calculations is also presented. (USGS)

  4. A portable x-ray fluorescence instrument for analyzing dust wipe samples for lead: evaluation with field samples.

    PubMed

    Sterling, D A; Lewis, R D; Luke, D A; Shadel, B N

    2000-06-01

    Dust wipe samples collected in the field were tested by nondestructive X-ray fluorescence (XRF) followed by laboratory analysis with flame atomic absorption spectrophotometry (FAAS). Data were analyzed for precision and accuracy of measurement. Replicate samples with the XRF show high precision with an intraclass correlation coefficient (ICC) of 0.97 (P<0.0001) and an overall coefficient of variation of 11.6%. Paired comparison indicates no statistical difference (P=0.272) between XRF and FAAS analysis. Paired samples are highly correlated with an R(2) ranging between 0.89 for samples that contain paint chips and 0.93 for samples that do not contain paint chips. The ICC for absolute agreement between XRF and laboratory results was 0.95 (P<0.0001). The relative error over the concentration range of 25 to 14,200 microgram Pb is -12% (95% CI, -18 to -5). The XRF appears to be an excellent method for rapid on-site evaluation of dust wipes for clearance and risk assessment purposes, although there are indications of some confounding when paint chips are present.

  5. COMPARISON OF TWO FIELD SAMPLING PROCEDURES (EN CORE AND FIELD METHANOL EXTRACTION) FOR VOLATILE ORGANIC COMPOUNDS

    EPA Science Inventory

    In-situ Lasagna technology was recently evaluated at a contaminated site at Offutt Air Force Base. The site was contaminated with low levels (< 30 mg/kg) of volatile organic compounds (VOCs). Originally, researchers planned to use field methanol extraction for both pre- and pos...

  6. Probes for High Field Solid-state NMR of Lossy Biological Samples

    PubMed Central

    Grant, Christopher V.; Wu, Chin H.; Opella, Stanley J.

    2010-01-01

    In solid-state NMR exphydrated samples biopolymers are susceptible to radio-frequency heating and have a significant impact on probe tuning frequency and performance parameters such as sensitivity. These considerations are increasingly important as magnetic field strengths increase with improved magnet technology. Recent developments in the design, construction, and performance of probes for solid-state NMR experiments on stationary lossy biological samples at high magnetic fields are reviewed. PMID:20435493

  7. Form and Actuality

    NASA Astrophysics Data System (ADS)

    Bitbol, Michel

    A basic choice underlies physics. It consists of banishing actual situations from theoretical descriptions, in order to reach a universal formal construct. Actualities are then thought of as mere local appearances of a transcendent reality supposedly described by the formal construct. Despite its impressive success, this method has left major loopholes in the foundations of science. In this paper, I document two of these loopholes. One is the problem of time asymmetry in statistical thermodynamics, and the other is the measurement problem of quantum mechanics. Then, adopting a broader philosophical standpoint, I try to turn the whole picture upside down. Here, full priority is given to actuality (construed as a mode of the immanent reality self-reflectively being itself) over formal constructs. The characteristic aporias of this variety of "Copernican revolution" are discussed.

  8. Spruce budworm sampling program for Husky Hunter Field data recorders. Forest Service research note

    SciTech Connect

    Schmidt, F.H.

    1993-07-01

    A program for receiving sampling data for all immature stages of the western spruce budworm (Choristoneua occidentalis Freeman) is described. Versions were designed to be used on field data recorders with either CP/M or DOS operating systems, such as the HUSKY HUNTER (Models 1, 2, and 16), but they also may be used on personal computers with compatible operating systems. The program allows the user to review the current plot statistics, including sampling precision, at any time while still sampling the plot. It also allows the user to determine how many more trees need to be sampled to arrive at a sampling precision specified by the user.

  9. Pre-Mission Input Requirements to Enable Successful Sample Collection by a Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Young, K. E.; Lim, D. S.

    2015-01-01

    This paper is intended to evaluate the sample collection process with respect to sample characterization and decision making. In some cases, it may be sufficient to know whether a given outcrop or hand sample is the same as or different from previous sampling localities or samples. In other cases, it may be important to have more in-depth characterization of the sample, such as basic composition, mineralogy, and petrology, in order to effectively identify the best sample. Contextual field observations, in situ/handheld analysis, and backroom evaluation may all play a role in understanding field lithologies and their importance for return. For example, whether a rock is a breccia or a clast-laden impact melt may be difficult based on a single sample, but becomes clear as exploration of a field site puts it into context. The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team is a new activity focused on a science and exploration field based research program aimed at generating strategic knowledge in preparation for the human and robotic exploration of the Moon, near-Earth asteroids (NEAs) and Phobos and Deimos. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused, and moreover, is sampling-focused, with the explicit intent to return the best samples for geochronology studies in the laboratory. This specific objective effectively reduces the number of variables in the goals of the field test and enables a more controlled investigation of the role of the crewmember in selecting samples. We formulated one hypothesis to test: that providing details regarding the analytical fate of the samples (e.g. geochronology, XRF/XRD, etc.) to the crew prior to their traverse will result in samples that are more likely to meet specific analytical

  10. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  11. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  12. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  13. 32 CFR Appendix E to Part 110 - Application of 4-Week Summer Field Training Formula (Sample)

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Formula (Sample) E Appendix E to Part 110 National Defense Department of Defense OFFICE OF THE SECRETARY... COMMUTATION INSTEAD OF UNIFORMS FOR MEMBERS OF THE SENIOR RESERVE OFFICERS' TRAINING CORPS Pt. 110, App. E Appendix E to Part 110—Application of 4-Week Summer Field Training Formula (Sample) Zone I Zone II...

  14. Improvement in day zero recoveries in field soil dissipation studies using larger diameter soil samples.

    PubMed

    Sharma, Ashok K; Strek, Harry J; Barefoot, Aldos C

    2014-05-01

    Obtaining acceptable recovery of the applied test substance at zero time in field soil dissipation studies has been a subject of considerable interest among scientists conducting regulatory field studies. In particular, achieving recoveries of ≥90% in soil samples collected immediately after applications in most studies has been elusive. This study investigated a modified soil sampling method, which could be used not only on day zero but for the entire study duration, to see if the recoveries in soil samples, especially in the early stages, can be improved. The modified sampling system has demonstrated that recoveries averaging 90% are possible and can be routinely obtained on day zero. Description of this modified sampling procedure and statistical analysis of the data collected for day zero samples are discussed.

  15. A field sampling strategy for semivariogram inference of fractures in rock outcrops

    SciTech Connect

    Ryan M. Pollyea; Jerry P. Fairley; Robert K. Podgorney; Travis L. Mcling

    2013-10-01

    The stochastic continuum (SC) representation is one common approach for simulating the effects of fracture heterogeneity in groundwater flow and transport models. These SC reservoir models are generally developed using geostatistical methods (e.g., kriging or sequential simulation) that rely on the model semivariogram to describe the spatial variability of each continuum. Although a number of strategies for sampling spatial distributions have been published in the literature, little attention has been paid to the optimization of sampling in resource- or access-limited environments. Here we present a strategy for estimating the minimum sample spacing needed to define the spatial distribution of fractures on a vertical outcrop of basalt, located in the Box Canyon, east Snake River Plain, Idaho. We used fracture maps of similar basalts from the published literature to test experimentally the effects of different sample spacings on the resulting semivariogram model. Our final field sampling strategy was based on the lowest sample density that reproduced the semivariogram of the exhaustively sampled fracture map. Application of the derived sampling strategy to an outcrop in our field area gave excellent results, and illustrates the utility of this type of sample optimization. The method will work for developing a sampling plan for any intensive property, provided prior information for a similar domain is available; for example, fracture maps or ortho-rectified photographs from analogous rock types could be used to plan for sampling of a fractured rock outcrop.

  16. Obtaining Vector Magnetic Field Maps of Geological Samples with Single-Axis Scanning Magnetic Microscopes

    NASA Astrophysics Data System (ADS)

    Lima, E. A.; Weiss, B. P.

    2008-12-01

    Magnetic scanning microscopy can be used to study inhomogeneous magnetization in geological samples with submillimiter spatial resolution. In particular, Superconducting Quantum Interference Device (SQUID) microscopes offer a unique combination of high spatial resolution and outstanding field sensitivity. However, due to physical constraints, most magnetic microscopes only measure a single component of the magnetic field. Nevertheless, Maxwell's equations can be used to demonstrate that the components of a static magnetic field in a region of space devoid of sources are not independent. This means that single-axis scanning magnetometers can potentially obtain all of three components of the field external to the sample. We present an improved technique in the Fourier domain which can obtain the complete vector field planar map from just the planar map of one component. This technique is fast, robust, does not rely on any specific source type or configuration and does not require the formulation of an inverse problem. In contrast to other applications in geomagnetic remote sensing, the assumptions and conditions imposed on the field distribution by the technique can be naturally satisfied in scanning microscopy of geological samples. We analyze the advantages and shortcomings of the technique, and establish which sensor and mapping configurations may yield high quality three-component field maps with virtually no information loss. We present results obtained both with synthetic data and experimental data measured with our SQUID microscope system.

  17. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  18. Quantitative Field Testing Heterodera glycines from Metagenomic DNA Samples Isolated Directly from Soil under Agronomic Production

    PubMed Central

    Li, Yan; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil. PMID:24587100

  19. Quantitative field testing Heterodera glycines from metagenomic DNA samples isolated directly from soil under agronomic production.

    PubMed

    Li, Yan; Lawrence, Gary W; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil.

  20. Problems with sampling desert tortoises: A simulation analysis based on field data

    USGS Publications Warehouse

    Freilich, J.E.; Camp, R.J.; Duda, J.J.; Karl, A.E.

    2005-01-01

    The desert tortoise (Gopherus agassizii) was listed as a U.S. threatened species in 1990 based largely on population declines inferred from mark-recapture surveys of 2.59-km2 (1-mi2) plots. Since then, several census methods have been proposed and tested, but all methods still pose logistical or statistical difficulties. We conducted computer simulations using actual tortoise location data from 2 1-mi2 plot surveys in southern California, USA, to identify strengths and weaknesses of current sampling strategies. We considered tortoise population estimates based on these plots as "truth" and then tested various sampling methods based on sampling smaller plots or transect lines passing through the mile squares. Data were analyzed using Schnabel's mark-recapture estimate and program CAPTURE. Experimental subsampling with replacement of the 1-mi2 data using 1-km2 and 0.25-km2 plot boundaries produced data sets of smaller plot sizes, which we compared to estimates from the 1-mi 2 plots. We also tested distance sampling by saturating a 1-mi 2 site with computer simulated transect lines, once again evaluating bias in density estimates. Subsampling estimates from 1-km2 plots did not differ significantly from the estimates derived at 1-mi2. The 0.25-km2 subsamples significantly overestimated population sizes, chiefly because too few recaptures were made. Distance sampling simulations were biased 80% of the time and had high coefficient of variation to density ratios. Furthermore, a prospective power analysis suggested limited ability to detect population declines as high as 50%. We concluded that poor performance and bias of both sampling procedures was driven by insufficient sample size, suggesting that all efforts must be directed to increasing numbers found in order to produce reliable results. Our results suggest that present methods may not be capable of accurately estimating desert tortoise populations.

  1. Backflushing Filters for Field Processing of Water Samples Prior to Trace-Element Analyses

    USGS Publications Warehouse

    Kennedy, V.C.; Jenne, E.A.; Burchard, J.M.

    1976-01-01

    A portable unit is described for filtering water samples at field sites in such a manner that the filtrate is suitable for analysis not only of major constituents but also of trace elments at the mocrogram-per-liter level. A battery-operated peristaltic pump forces the water sample through medical-grade silicone tubing into and through an all-plastic in-line filter which can be backflushed when sediment clogs the filter membrane. Initial filtration rate exceeds 500 milliliter/minute and, because of the backflushing feature, a total time for filtering high-sediment-bearing waster samples is greatly reduced. (Woodard-USGS)

  2. Using object-based image analysis to guide the selection of field sample locations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the most challenging tasks for resource management and research is designing field sampling schemes to achieve unbiased estimates of ecosystem parameters as efficiently as possible. This study focused on the potential of fine-scale image objects from object-based image analysis (OBIA) to be u...

  3. Modification and Application of a Leaf Blower-vac for Field Sampling of Arthropods.

    PubMed

    Zou, Yi; van Telgen, Mario D; Chen, Junhui; Xiao, Haijun; de Kraker, Joop; Bianchi, Felix J J A; van der Werf, Wopke

    2016-01-01

    Rice fields host a large diversity of arthropods, but investigating their population dynamics and interactions is challenging. Here we describe the modification and application of a leaf blower-vac for suction sampling of arthropod populations in rice. When used in combination with an enclosure, application of this sampling device provides absolute estimates of the populations of arthropods as numbers per standardized sampling area. The sampling efficiency depends critically on the sampling duration. In a mature rice crop, a two-minute sampling in an enclosure of 0.13 m(2) yields more than 90% of the arthropod population. The device also allows sampling of arthropods dwelling on the water surface or the soil in rice paddies, but it is not suitable for sampling fast flying insects, such as predatory Odonata or larger hymenopterous parasitoids. The modified blower-vac is simple to construct, and cheaper and easier to handle than traditional suction sampling devices, such as D-vac. The low cost makes the modified blower-vac also accessible to researchers in developing countries.

  4. Modification and Application of a Leaf Blower-vac for Field Sampling of Arthropods.

    PubMed

    Zou, Yi; van Telgen, Mario D; Chen, Junhui; Xiao, Haijun; de Kraker, Joop; Bianchi, Felix J J A; van der Werf, Wopke

    2016-01-01

    Rice fields host a large diversity of arthropods, but investigating their population dynamics and interactions is challenging. Here we describe the modification and application of a leaf blower-vac for suction sampling of arthropod populations in rice. When used in combination with an enclosure, application of this sampling device provides absolute estimates of the populations of arthropods as numbers per standardized sampling area. The sampling efficiency depends critically on the sampling duration. In a mature rice crop, a two-minute sampling in an enclosure of 0.13 m(2) yields more than 90% of the arthropod population. The device also allows sampling of arthropods dwelling on the water surface or the soil in rice paddies, but it is not suitable for sampling fast flying insects, such as predatory Odonata or larger hymenopterous parasitoids. The modified blower-vac is simple to construct, and cheaper and easier to handle than traditional suction sampling devices, such as D-vac. The low cost makes the modified blower-vac also accessible to researchers in developing countries. PMID:27584040

  5. Sampling and Reconstruction of the Pupil and Electric Field for Phase Retrieval

    NASA Technical Reports Server (NTRS)

    Dean, Bruce; Smith, Jeffrey; Aronstein, David

    2012-01-01

    This technology is based on sampling considerations for a band-limited function, which has application to optical estimation generally, and to phase retrieval specifically. The analysis begins with the observation that the Fourier transform of an optical aperture function (pupil) can be implemented with minimal aliasing for Q values down to Q = 1. The sampling ratio, Q, is defined as the ratio of the sampling frequency to the band-limited cut-off frequency. The analytical results are given using a 1-d aperture function, and with the electric field defined by the band-limited sinc(x) function. Perfect reconstruction of the Fourier transform (electric field) is derived using the Whittaker-Shannon sampling theorem for 1sampling ratio such that 1field with no aliasing, which has been extended to 2-d optical apertures.

  6. Information Content of the Near-Field I: Two-Dimensional Samples

    NASA Technical Reports Server (NTRS)

    Frazin, Richard A.; Fischer, David G.; Carney, P. Scott

    2004-01-01

    Limits on the effective resolution of many optical near-field experiments are investigated. The results are applicable to variants of total-internal-reflection microscopy (TIRM), photon-scanning-tunneling microscopy (PSTM), and near-field-scanning-optical microscopy (NSOM) in which the sample is weakly scattering and the direction of illumination may be controlled. Analytical expressions for the variance of the estimate of the complex susceptibility of an unknown two-dimensional object as a function of spatial frequency are obtained for Gaussian and Poisson noise models, and a model-independent measure is examined. The results are used to explore the transition from near-zone to far-zone detection. It is demonstrated that the information content of the measurements made at a distance of even one wavelength away from the sample is already not much different from the information content of the far field. Copyright 2004 Optical Society of America

  7. Proposal for field sampling of plants and processing in the lab for environmental metabolic fingerprinting

    PubMed Central

    2010-01-01

    Background Samples for plant metabolic fingerprinting are prepared generally by metabolism quenching, grinding of plant material and extraction of metabolites in solvents. Further concentration and derivatisation steps follow in dependence of the sample nature and the available analytical platform. For plant material sampled in the field, several methods are not applicable, such as, e.g., collection in liquid nitrogen. Therefore, a protocol was established for sample pre-treatment, grinding, extraction and storage, which can be used for analysis of field-collected plant material, which is further processed in the laboratory. Ribwort plantain (Plantago lanceolata L., Plantaginaceae) was used as model plant. The quality criteria for method suitability were high reproducibility, extraction efficiency and handling comfort of each subsequent processing step. Results Highest reproducibility of results was achieved by sampling fresh plant material in a solvent mixture of methanol:dichloromethane (2:1), crushing the tissue with a hand-held disperser and storing the material until further processing. In the laboratory the material was extracted threefold at different pH. The gained extracts were separated with water (2:1:1 methanol:dichloromethane:water) and the aqueous phases used for analysis by LC-MS, because the polar metabolites were in focus. Chromatograms were compared by calculating a value Ξ for similarities. Advantages and disadvantages of different sample pre-treatment methods, use of solvents and solvent mixtures, influence of pH, extraction frequency and duration, and storing temperature are discussed with regard to the quality criteria. Conclusions The proposed extraction protocol leads to highly reproducible metabolic fingerprints and allows optimal handling of field-collected plant material and further processing in the laboratory, which is demonstrated for an exemplary field data-set. Calculation of Ξ values is a useful tool to judge similarities between

  8. Field-deployable and near-real-time optical microfluidic biosensors for single-oocyst-level detection of Cryptosporidium parvum from field water samples.

    PubMed

    Angus, Scott V; Kwon, Hyuck-Jin; Yoon, Jeong-Yeol

    2012-12-01

    Cryptosporidium spp. is an obligate, parasitic protozoan that is difficult to detect and causes diarrhea in healthy adults while potentially causing death in the immunocompromised and children. Its treatment options are few and treat the symptoms, not the actual parasite. Current methods of detection are inefficient and rely too heavily upon laboratory sample preparations and technician skill, including differential staining, negative staining, and immunofluorescence methods [especially U.S. Environmental Protection Agency (EPA) Method 1623]. These assays can take from hours to days and require a laboratory environment. In this work, we demonstrated the microbead immunoagglutination assay combined with Mie scatter detection in a microfluidic device to provide a field-deployable and near-real-time alternative to the laboratory-based method (especially EPA Method 1623). Two main challenges were the relatively big diameter of Cryptosporidium oocysts (5-6 μm) and the contaminants in field water samples that negatively affected the immunoagglutination and its scatter detection. We used 4 min sonication to liberate Cryptosporidium oocyst wall proteins (COWP), which was previously used to inactivate Cryptosporidium oocysts. As for the contaminants, we optimized the microbead diameter (920 nm) and the wavelength of incident light (375 nm) to find the angle of scatter detection (45°) where the Mie scatter from immunoagglutinated microbeads was maximum and the background scatter from contaminants was minimum. This enabled the sub-single-oocyst-level detection despite the fact that only a very small volume of water sample (15 μL) was introduced to the microfluidic biosensor. When combined with filtration/concentration, this method is able to detect ≤1 oocyst per large volume of water, comparable to or potentially better than the EPA method 1623, while effectively reducing the time and labor necessary for staining and microscopic analysis. For faster, near

  9. Oxidation efficiencies of nitrite to nitrate by freezing of field rain samples

    SciTech Connect

    Takenaka, Norimichi; Daimon, Tohru; Sato, Keiichi

    1996-12-31

    Nitrite is known to be oxidized to nitrate by freezing much more rapidly than in solution. Furthermore, the oxidation efficiency of nitrite to nitrate by freezing is varied by pH or kinds and concentration of coexistences. We report here the oxidation efficiencies of nitrite to nitrate by freezing of field rain samples. The field rain samples were collected at Mt. Ikoma, which is located at about 20 km east of Osaka city, and Osaka Prefecture University. Concentration of nitrite was usually sub to a few {mu}mol/L order in rain and {mu}mol/L order in fog and less than 1 {mu}mol/L in snow. The highest value of nitrite concentration was 43 {mu}mol/L in rain and 620 {mu}mol/L in fog. Nitrite was oxidized immediately to nitrate by freezing at pH lower than 5.2, even when the sample droplet (about 1 mm diameter) was frozen very quickly in liquid nitrogen (77K). The oxidation efficiency was higher at lower pH. However, the efficiency varied from sample to sample. This is probably due to that kinds and concentration of coexistences were difference between samples. The effect of solutes will be also reported. Freezing of rain droplets are observed in freezing of super cooled droplets, growing of graupel and hail, growing of cumulonimbus, and so on. Ratio of nitrate to nitrite was higher in snow than that in rain or fog.

  10. Field portable low temperature porous layer open tubular cryoadsorption headspace sampling and analysis part I: Instrumentation.

    PubMed

    Bruno, Thomas J

    2016-01-15

    Building on the successful application in the laboratory of PLOT-cryoadsorption as a means of collecting vapor (or headspace) samples for chromatographic analysis, in this paper a field portable apparatus is introduced. This device fits inside of a briefcase (aluminum tool carrier), and can be easily transported by vehicle or by air. The portable apparatus functions entirely on compressed air, making it suitable for use in locations lacking electrical power, and for use in flammable and explosive environments. The apparatus consists of four aspects: a field capable PLOT-capillary platform, the supporting equipment platform, the service interface between the PLOT-capillary and the supporting equipment, and the necessary peripherals. Vapor sampling can be done with either a hand piece (containing the PLOT capillary) or with a custom fabricated standoff module. Both the hand piece and the standoff module can be heated and cooled to facilitate vapor collection and subsequent vapor sample removal. The service interface between the support platform and the sampling units makes use of a unique counter current approach that minimizes loss of cooling and heating due to heat transfer with the surroundings (recuperative thermostatting). Several types of PLOT-capillary elements and sampling probes are described in this report. Applications to a variety of samples relevant to forensic and environmental analysis are discussed in a companion paper. PMID:26687166

  11. Recent developments on field gas extraction and sample preparation methods for radiokrypton dating of groundwater

    NASA Astrophysics Data System (ADS)

    Yokochi, Reika

    2016-09-01

    Current and foreseen population growths will lead to an increased demand in freshwater, large quantities of which is stored as groundwater. The ventilation age is crucial to the assessment of groundwater resources, complementing the hydrological model approach based on hydrogeological parameters. Ultra-trace radioactive isotopes of Kr (81 Kr and 85 Kr) possess the ideal physical and chemical properties for groundwater dating. The recent advent of atom trap trace analyses (ATTA) has enabled determination of ultra-trace noble gas radioisotope abundances using 5-10 μ L of pure Kr. Anticipated developments will enable ATTA to analyze radiokrypton isotope abundances at high sample throughput, which necessitates simple and efficient sample preparation techniques that are adaptable to various sample chemistries. Recent developments of field gas extraction devices and simple and rapid Kr separation method at the University of Chicago are presented herein. Two field gas extraction devices optimized for different sampling conditions were recently designed and constructed, aiming at operational simplicity and portability. A newly developed Kr purification system enriches Kr by flowing a sample gas through a moderately cooled (138 K) activated charcoal column, followed by a gentle fractionating desorption. This simple process uses a single adsorbent and separates 99% of the bulk atmospheric gases from Kr without significant loss. The subsequent two stages of gas chromatographic separation and a hot Ti sponge getter further purify the Kr-enriched gas. Abundant CH4 necessitates multiple passages through one of the gas chromatographic separation columns. The presented Kr separation system has a demonstrated capability of extracting Kr with > 90% yield and 99% purity within 75 min from 1.2 to 26.8 L STP of atmospheric air with various concentrations of CH4. The apparatuses have successfully been deployed for sampling in the field and purification of groundwater samples.

  12. Quantitative passive soil vapor sampling for VOCs--part 3: field experiments.

    PubMed

    McAlary, Todd; Groenevelt, Hester; Nicholson, Paul; Seethapathy, Suresh; Sacco, Paolo; Crump, Derrick; Tuday, Michael; Hayes, Heidi; Schumacher, Brian; Johnson, Paul; Górecki, Tadeusz; Rivera-Duarte, Ignacio

    2014-03-01

    Volatile organic compounds (VOCs) are commonly associated with contaminated land and may pose a risk to human health via subsurface vapor intrusion to indoor air. Soil vapor sampling is commonly used to assess the nature and extent of VOC contamination, but can be complicated because of the wide range of geologic material permeability and moisture content conditions that might be encountered, the wide variety of available sampling and analysis methods, and several potential causes of bias and variability, including leaks of atmospheric air, adsorption-desorption interactions, inconsistent sampling protocols and varying levels of experience among sampling personnel. Passive sampling onto adsorbent materials has been available as an alternative to conventional whole-gas sample collection for decades, but relationships between the mass sorbed with time and the soil vapor concentration have not been quantitatively established and the relative merits of various commercially available passive samplers for soil vapor concentration measurement is unknown. This paper presents the results of field experiments using several different passive samplers under a wide range of conditions. The results show that properly designed and deployed quantitative passive soil vapor samplers can be used to measure soil vapor concentrations with accuracy and precision comparable to conventional active soil vapor sampling (relative concentrations within a factor of 2 and RSD comparable to active sampling) where the uptake rate is low enough to minimize starvation and the exposure duration is not excessive for weakly retained compounds.

  13. An Evaluation of Plotless Sampling Using Vegetation Simulations and Field Data from a Mangrove Forest

    PubMed Central

    Hijbeek, Renske; Koedam, Nico; Khan, Md Nabiul Islam; Kairo, James Gitundu; Schoukens, Johan; Dahdouh-Guebas, Farid

    2013-01-01

    In vegetation science and forest management, tree density is often used as a variable. To determine the value of this variable, reliable field methods are necessary. When vegetation is sparse or not easily accessible, the use of sample plots is not feasible in the field. Therefore, plotless methods, like the Point Centred Quarter Method, are often used as an alternative. In this study we investigate the accuracy of different plotless sampling methods. To this end, tree densities of a mangrove forest were determined and compared with estimates provided by several plotless methods. None of these methods proved accurate across all field sites with mean underestimations up to 97% and mean overestimations up to 53% in the field. Applying the methods to different vegetation patterns shows that when random spatial distributions were used the true density was included within the 95% confidence limits of all the plotless methods tested. It was also found that, besides aggregation and regularity, density trends often found in mangroves contribute to the unreliability. This outcome raises questions about the use of plotless sampling in forest monitoring and management, as well as for estimates of density-based carbon sequestration. We give recommendations to minimize errors in vegetation surveys and recommendations for further in-depth research. PMID:23826233

  14. A Field-Based Cleaning Protocol for Sampling Devices Used in Life-Detection Studies

    NASA Astrophysics Data System (ADS)

    Eigenbrode, Jennifer; Benning, Liane G.; Maule, Jake; Wainwright, Norm; Steele, Andrew; Amundsen, Hans E. F.

    2009-06-01

    Analytical approaches to extant and extinct life detection involve molecular detection often at trace levels. Thus, removal of biological materials and other organic molecules from the surfaces of devices used for sampling is essential for ascertaining meaningful results. Organic decontamination to levels consistent with null values on life-detection instruments is particularly challenging at remote field locations where Mars analog field investigations are carried out. Here, we present a seven-step, multi-reagent decontamination method that can be applied to sampling devices while in the field. In situ lipopolysaccharide detection via low-level endotoxin assays and molecular detection via gas chromatography-mass spectrometry were used to test the effectiveness of the decontamination protocol for sampling of glacial ice with a coring device and for sampling of sediments with a rover scoop during deployment at Arctic Mars-analog sites in Svalbard, Norway. Our results indicate that the protocols and detection technique sufficiently remove and detect low levels of molecular constituents necessary for life-detection tests.

  15. CALIFA: a diameter-selected sample for an integral field spectroscopy galaxy survey

    NASA Astrophysics Data System (ADS)

    Walcher, C. J.; Wisotzki, L.; Bekeraité, S.; Husemann, B.; Iglesias-Páramo, J.; Backsmann, N.; Barrera Ballesteros, J.; Catalán-Torrecilla, C.; Cortijo, C.; del Olmo, A.; Garcia Lorenzo, B.; Falcón-Barroso, J.; Jilkova, L.; Kalinova, V.; Mast, D.; Marino, R. A.; Méndez-Abreu, J.; Pasquali, A.; Sánchez, S. F.; Trager, S.; Zibetti, S.; Aguerri, J. A. L.; Alves, J.; Bland-Hawthorn, J.; Boselli, A.; Castillo Morales, A.; Cid Fernandes, R.; Flores, H.; Galbany, L.; Gallazzi, A.; García-Benito, R.; Gil de Paz, A.; González-Delgado, R. M.; Jahnke, K.; Jungwiert, B.; Kehrig, C.; Lyubenova, M.; Márquez Perez, I.; Masegosa, J.; Monreal Ibero, A.; Pérez, E.; Quirrenbach, A.; Rosales-Ortega, F. F.; Roth, M. M.; Sanchez-Blazquez, P.; Spekkens, K.; Tundo, E.; van de Ven, G.; Verheijen, M. A. W.; Vilchez, J. V.; Ziegler, B.

    2014-09-01

    We describe and discuss the selection procedure and statistical properties of the galaxy sample used by the Calar Alto Legacy Integral Field Area (CALIFA) survey, a public legacy survey of 600 galaxies using integral field spectroscopy. The CALIFA "mother sample" was selected from the Sloan Digital Sky Survey (SDSS) DR7 photometric catalogue to include all galaxies with an r-band isophotal major axis between 45'' and 79.2'' and with a redshift 0.005 < z < 0.03. The mother sample contains 939 objects, 600 of which will be observed in the course of the CALIFA survey. The selection of targets for observations is based solely on visibility and thus keeps the statistical properties of the mother sample. By comparison with a large set of SDSS galaxies, we find that the CALIFA sample is representative of galaxies over a luminosity range of -19 > Mr > -23.1 and over a stellar mass range between 109.7 and 1011.4 M⊙. In particular, within these ranges, the diameter selection does not lead to any significant bias against - or in favour of - intrinsically large or small galaxies. Only below luminosities of Mr = -19 (or stellar masses <109.7 M⊙) is there a prevalence of galaxies with larger isophotal sizes, especially of nearly edge-on late-type galaxies, but such galaxies form <10% of the full sample. We estimate volume-corrected distribution functions in luminosities and sizes and show that these are statistically fully compatible with estimates from the full SDSS when accounting for large-scale structure. For full characterization of the sample, we also present a number of value-added quantities determined for the galaxies in the CALIFA sample. These include consistent multi-band photometry based on growth curve analyses; stellar masses; distances and quantities derived from these; morphological classifications; and an overview of available multi-wavelength photometric measurements. We also explore different ways of characterizing the environments of CALIFA galaxies

  16. Flux measurements and sampling strategies: Applications to methane emissions from rice fields

    NASA Astrophysics Data System (ADS)

    Khalil, M. A. K.; Rasmussen, R. A.; Shearer, M. J.

    1998-10-01

    The emissions of methane from rice fields and other sources are often measured by placing chambers on the surface and taking sequential samples. Although static chambers pose several problems that affect the accuracy of the data, there are a few parameters that, if carefully chosen, can improve the reliability of the data and reduce the uncertainties. These parameters are the length of time the chamber is kept on the rice plants, the number of samples that are drawn to estimate the flux, the basal area and height of the chamber, the frequency of measurements during the growing season, and the number of plots sampled. In this paper we analyze a large data set to determine how these parameters can be chosen to improve data quality. The results show that, for individual flux measurements, extending the time the chambers are left on the plots improves precision more effectively than taking more sequential samples for each flux measurement. The exposure time cannot be extended too far, however, as it leads to a saturation effect so that the rate of accumulation in the chamber slows down. This can compromise the accuracy of the measurement. There is an optimum exposure time that balances these two effects. Many individual measurements are needed to characterize the emissions from the larger area of the fields and the seasonal patterns. For methane emissions from rice fields, the amplitude of the systematic seasonal cycle is usually large compared to the variability on shorter timescales. Consequently, reducing the sampling frequency increases the uncertainty of the seasonal flux very slowly. The spatial variability is large and random on the small scales of the basal area of the chambers. Reducing the number of plots sampled, therefore, has a major effect on the uncertainty of the seasonal average flux.

  17. Field portable mobile phone based fluorescence microscopy for detection of Giardia lamblia cysts in water samples

    NASA Astrophysics Data System (ADS)

    Ceylan Koydemir, Hatice; Gorocs, Zoltan; McLeod, Euan; Tseng, Derek; Ozcan, Aydogan

    2015-03-01

    Giardia lamblia is a waterborne parasite that causes an intestinal infection, known as giardiasis, and it is found not only in countries with inadequate sanitation and unsafe water but also streams and lakes of developed countries. Simple, sensitive, and rapid detection of this pathogen is important for monitoring of drinking water. Here we present a cost-effective and field portable mobile-phone based fluorescence microscopy platform designed for automated detection of Giardia lamblia cysts in large volume water samples (i.e., 10 ml) to be used in low-resource field settings. This fluorescence microscope is integrated with a disposable water-sampling cassette, which is based on a flow-through porous polycarbonate membrane and provides a wide surface area for fluorescence imaging and enumeration of the captured Giardia cysts on the membrane. Water sample of interest, containing fluorescently labeled Giardia cysts, is introduced into the absorbent pads that are in contact with the membrane in the cassette by capillary action, which eliminates the need for electrically driven flow for sample processing. Our fluorescence microscope weighs ~170 grams in total and has all the components of a regular microscope, capable of detecting individual fluorescently labeled cysts under light-emitting-diode (LED) based excitation. Including all the sample preparation, labeling and imaging steps, the entire measurement takes less than one hour for a sample volume of 10 ml. This mobile phone based compact and cost-effective fluorescent imaging platform together with its machine learning based cyst counting interface is easy to use and can even work in resource limited and field settings for spatio-temporal monitoring of water quality.

  18. Use of percolation theory and Latin hypercube sampling in field-scale solute transport investigations

    SciTech Connect

    Luxmoore, R.J.; Jardine, P.M.; Gardner, R.H. ); Wilson, G.V. . Dept. of Plant and Soil Science)

    1990-01-01

    Investigations of rain-fed solute transport have been conducted at a forested hillslope site by using an in situ soil pedon and a subsurface hydrologic monitoring facility. Complementary solute transport studies on undisturbed soil columns taken from the field site have not provided data that can be directly applied to the field situation. Scaling up from columns to pedons and from pedons to hillslopes is being evaluated with percolation theory and Latin hypercube sampling methods. Percolation theory provides a means of identifying mobile zones and stagnant zones for given soil structural attributes which can be compared with column dye tracing results. The generation of frequency distributions of backwater and backbone porosities for a range of total soil porosities and pore arrangements may provide a stochastic representation of soil systems suitable for scaling up from the column scale to the pedon using the Latin hypercube sampling method. 9 refs.

  19. On the Methodology of Nematode Extraction from Field Samples: Density Flotation Techniques

    PubMed Central

    Viglierchio, David R.; Yamashita, Tom T.

    1983-01-01

    Density flotation has been frequently used for the extraction of nematodes from field samples. Density flotation curves for four nematode species and five solutes have been prepared. The curves confirm that flotation was governed by several factors: solute density, solute osmotic activity, and physiological properties of the nematode species. Nematode viability and function can be adversely affected by improper selection of solute for density extraction of nematodes; nevertheless, some nematode species can be enriched from mixtures by density and solute selection. PMID:19295831

  20. Vertical sampling flights in support of the 1981 ASCOT cooling tower experiments: field effort and data

    SciTech Connect

    Gay, G.T.

    1982-03-01

    During the month of August 1981, three nights of experimental sampling of tracers released into the cooling tower plume of a geothermal power plant were conducted. In these experiments a tethered balloon was used to lift a payload so as to obtain vertical profiles of the cooling tower plume and the entrained tracers. A description of the equipment used, the field effort and the data acquired are presented here.

  1. Aqueous dissolution of laboratory and field samples from the in-situ vitrification process

    SciTech Connect

    McGrail, B.P. ); Bates, S.O. )

    1991-08-01

    In-situ vitrification (ISV) is being evaluated in several countries as a remediation technology for immobilizing both hazardous and radioactive buried wastes. A combination of laboratory data and modeling results are presented that establishes the scientific basis for predicting the long-term stability of an ISV glass in the environment. Laboratory experiments included tests with ISV samples obtained from pilot- and intermediate-scale field tests, a nuclear waste glass, and a natural obsidian. 8 refs.

  2. Realistic sampling of amino acid geometries for a multipolar polarizable force field

    PubMed Central

    Hughes, Timothy J.; Cardamone, Salvatore

    2015-01-01

    The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X‐ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF. © 2015 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:26235784

  3. Realistic sampling of amino acid geometries for a multipolar polarizable force field.

    PubMed

    Hughes, Timothy J; Cardamone, Salvatore; Popelier, Paul L A

    2015-09-15

    The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X-ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF.

  4. A contemporary decennial global Landsat sample of changing agricultural field sizes

    NASA Astrophysics Data System (ADS)

    White, Emma; Roy, David

    2014-05-01

    Agriculture has caused significant human induced Land Cover Land Use (LCLU) change, with dramatic cropland expansion in the last century and significant increases in productivity over the past few decades. Satellite data have been used for agricultural applications including cropland distribution mapping, crop condition monitoring, crop production assessment and yield prediction. Satellite based agricultural applications are less reliable when the sensor spatial resolution is small relative to the field size. However, to date, studies of agricultural field size distributions and their change have been limited, even though this information is needed to inform the design of agricultural satellite monitoring systems. Moreover, the size of agricultural fields is a fundamental description of rural landscapes and provides an insight into the drivers of rural LCLU change. In many parts of the world field sizes may have increased. Increasing field sizes cause a subsequent decrease in the number of fields and therefore decreased landscape spatial complexity with impacts on biodiversity, habitat, soil erosion, plant-pollinator interactions, and impacts on the diffusion of herbicides, pesticides, disease pathogens, and pests. The Landsat series of satellites provide the longest record of global land observations, with 30m observations available since 1982. Landsat data are used to examine contemporary field size changes in a period (1980 to 2010) when significant global agricultural changes have occurred. A multi-scale sampling approach is used to locate global hotspots of field size change by examination of a recent global agricultural yield map and literature review. Nine hotspots are selected where significant field size change is apparent and where change has been driven by technological advancements (Argentina and U.S.), abrupt societal changes (Albania and Zimbabwe), government land use and agricultural policy changes (China, Malaysia, Brazil), and/or constrained by

  5. Search for life on Mars in surface samples: Lessons from the 1999 Marsokhod rover field experiment

    USGS Publications Warehouse

    Newsom, Horton E.; Bishop, J.L.; Cockell, C.; Roush, T.L.; Johnson, J. R.

    2001-01-01

    The Marsokhod 1999 field experiment in the Mojave Desert included a simulation of a rover-based sample selection mission. As part of this mission, a test was made of strategies and analytical techniques for identifying past or present life in environments expected to be present on Mars. A combination of visual clues from high-resolution images and the detection of an important biomolecule (chlorophyll) with visible/near-infrared (NIR) spectroscopy led to the successful identification of a rock with evidence of cryptoendolithic organisms. The sample was identified in high-resolution images (3 times the resolution of the Imager for Mars Pathfinder camera) on the basis of a green tinge and textural information suggesting the presence of a thin, partially missing exfoliating layer revealing the organisms. The presence of chlorophyll bands in similar samples was observed in visible/NIR spectra of samples in the field and later confirmed in the laboratory using the same spectrometer. Raman spectroscopy in the laboratory, simulating a remote measurement technique, also detected evidence of carotenoids in samples from the same area. Laboratory analysis confirmed that the subsurface layer of the rock is inhabited by a community of coccoid Chroococcidioposis cyanobacteria. The identification of minerals in the field, including carbonates and serpentine, that are associated with aqueous processes was also demonstrated using the visible/NIR spectrometer. Other lessons learned that are applicable to future rover missions include the benefits of web-based programs for target selection and for daily mission planning and the need for involvement of the science team in optimizing image compression schemes based on the retention of visual signature characteristics. Copyright 2000 by the American Geophysical Union.

  6. Highly sampled tetranucleotide and tetraloop motifs enable evaluation of common RNA force fields.

    PubMed

    Bergonzo, Christina; Henriksen, Niel M; Roe, Daniel R; Cheatham, Thomas E

    2015-09-01

    Recent modifications and improvements to standard nucleic acid force fields have attempted to fix problems and issues that have been observed as longer timescale simulations have become routine. Although previous work has shown the ability to fold the UUCG stem-loop structure, until now no group has attempted to quantify the performance of current force fields using highly converged structural populations of the tetraloop conformational ensemble. In this study, we report the use of multiple independent sets of multidimensional replica exchange molecular dynamics (M-REMD) simulations with different initial conditions to generate well-converged conformational ensembles for the tetranucleotides r(GACC) and r(CCCC), as well as the larger UUCG tetraloop motif. By generating what is to our knowledge the most complete RNA structure ensembles reported to date for these systems, we remove the coupling between force field errors and errors due to incomplete sampling, providing a comprehensive comparison between current top-performing MD force fields for RNA. Of the RNA force fields tested in this study, none demonstrate the ability to correctly identify the most thermodynamically stable structure for all three systems. We discuss the deficiencies present in each potential function and suggest areas where improvements can be made. The results imply that although "short" (nsec-μsec timescale) simulations may stay close to their respective experimental structures and may well reproduce experimental observables, inevitably the current force fields will populate alternative incorrect structures that are more stable than those observed via experiment.

  7. Sensitivity maximized near-field scanning optical microscope with dithering sample stage

    NASA Astrophysics Data System (ADS)

    Park, Kyoung-Duck; Lee, Seung Gol; Heo, Chaejeong; Lee, Young Hee; Jeong, Mun Seok

    2012-09-01

    We developed a new scheme for a higher sensitivity near-field scanning optical microscope (NSOM) by using a dithering sample stage rather than a dithering probe for the constant gap control between probe and sample. In a conventional NSOM, which use tip dithering feedback mechanism, the Q factor drastically decreases from 7783 to 1000 (13%) or even to 100 (1%) because harmonic oscillating characteristic is deteriorated owing to the large change of stiffness and mass of one prong of tuning fork when a probe is attached to it. In our proposed scheme, on the other hand, we use sample dithering feedback mechanism, where the probe is not attached to the tuning fork and the sample is loaded directly onto the surface of dithering tuning fork. Thus, the Q factor does not decrease significantly, from only 7783 to 7480 (96%), because the loaded sample hardly changes the stiffness and mass of tuning fork. Accordingly, gap control between the immobile fiber probe and the dithering sample is performed precisely by detecting the shear force with high sensitivity. Consequently, the extremely high Q factor enables clear observation of graphene sheets with sub-nanometer vertical resolution, which is not possible with a conventional NSOM setup.

  8. Rapid analysis of non-uniformly sampled pulsed field gradient data for velocity estimation.

    PubMed

    Raghavan, K; Park, J C; Pavlovskaya, G E; Gibbs, S J

    2001-06-01

    Bretthorst's recent generalization of the Lomb-Scargle periodogram shows that a sufficient statistic for frequency estimation from non-uniformly, but simultaneously sampled quadrature data is equivalent to the FFT of those data with the missing samples replaced by zeros. We have applied this concept to the rapid analysis of pulsed field gradient MRI data which have been non-uniformly sampled in the velocity encoding wave vector q. For a small number of q samples, it is more computationally efficient to calculate the periodogram directly rather than using the FFT algorithm with a large number of zeros. The algorithm we have implemented for finding the peak of the generalized periodogram is simple and robust; it involves repeated apodization and grid searching of the periodogram until the desired velocity resolution is achieved. The final estimate is refined by quadratic interpolation. We have tested the method for fully developed Poiseuille flow of a Newtonian fluid and have demonstrated substantial improvement in the precision of velocity measurement achievable in a fixed acquisition time with non-uniform sampling. The method is readily extendible to multidimensional data. Analysis of a 256 by 256 pixel image with 8 q samples and an effective velocity resolution of better than 1/680 of the Nyquist range requires approximately 1 minute computation time on a 400 MHz SUN Ultrasparc II processor. PMID:11672628

  9. Sensitivity maximized near-field scanning optical microscope with dithering sample stage.

    PubMed

    Park, Kyoung-Duck; Lee, Seung Gol; Heo, Chaejeong; Lee, Young Hee; Jeong, Mun Seok

    2012-09-01

    We developed a new scheme for a higher sensitivity near-field scanning optical microscope (NSOM) by using a dithering sample stage rather than a dithering probe for the constant gap control between probe and sample. In a conventional NSOM, which use tip dithering feedback mechanism, the Q factor drastically decreases from 7783 to 1000 (13%) or even to 100 (1%) because harmonic oscillating characteristic is deteriorated owing to the large change of stiffness and mass of one prong of tuning fork when a probe is attached to it. In our proposed scheme, on the other hand, we use sample dithering feedback mechanism, where the probe is not attached to the tuning fork and the sample is loaded directly onto the surface of dithering tuning fork. Thus, the Q factor does not decrease significantly, from only 7783 to 7480 (96%), because the loaded sample hardly changes the stiffness and mass of tuning fork. Accordingly, gap control between the immobile fiber probe and the dithering sample is performed precisely by detecting the shear force with high sensitivity. Consequently, the extremely high Q factor enables clear observation of graphene sheets with sub-nanometer vertical resolution, which is not possible with a conventional NSOM setup. PMID:23020386

  10. Magnetic field microscopy of rock samples using a giant magnetoresistance-based scanning magnetometer

    NASA Astrophysics Data System (ADS)

    Hankard, Fatim; Gattacceca, JéRôMe; Fermon, Claude; Pannetier-Lecoeur, Myriam; Langlais, Benoit; Quesnel, Yoann; Rochette, Pierre; McEnroe, Suzanne A.

    2009-10-01

    We have developed a new scanning magnetic microscope to image with micrometric resolution magnetic fields originating from room temperature polished samples. This microscope is based on a giant magnetoresistance (GMR) sensor working at room temperature. These magnetic sensors are sensitive to the in-plane components of the magnetic field. The size of the sensing element is 9 μm × 36 μm. The noise of the GMR sensor is dominated by a low-frequency 1/f noise. The field equivalent noise of the sensors is 10 nT? at 1Hz and decreases to 0.3 nT? above 1 kHz for a 1 mA sensing current. The spatial resolution of the system is ˜20 μm, and its peak-to-peak noise during operation is ˜250 nT. Its high spatial resolution and a minimum sensor-to-sample distance of 30 μm compensate for its rather moderate field sensitivity. This room temperature small-sized and rugged magnetic microscope appears as a powerful instrument for small-scale rock magnetic investigations.

  11. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  12. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  13. How Does Sampling Methodology Influence Molecular Detection and Isolation Success in Influenza A Virus Field Studies?

    PubMed

    Latorre-Margalef, Neus; Avril, Alexis; Tolf, Conny; Olsen, Björn; Waldenström, Jonas

    2016-02-01

    Wild waterfowl are important reservoir hosts for influenza A virus (IAV) and a potential source of spillover infections in other hosts, including poultry and swine. The emergence of highly pathogenic avian influenza (HPAI) viruses, such as H5N1 and H5N8, and subsequent spread along migratory flyways prompted the initiation of several programs in Europe, North America, and Africa to monitor circulation of HPAI and low-pathogenicity precursor viruses (low-pathogenicity avian influenza [LPAI] viruses). Given the costs of maintaining such programs, it is essential to establish best practice for field methodologies to provide robust data for epidemiological interpretation. Here, we use long-term surveillance data from a single site to evaluate the influence of a number of parameters on virus detection and isolation of LPAI viruses. A total of 26,586 samples (oropharyngeal, fecal, and cloacal) collected from wild mallards were screened by real-time PCR, and positive samples were subjected to isolation in embryonated chicken eggs. The LPAI virus detection rate was influenced by the sample type: cloacal/fecal samples showed a consistently higher detection rate and lower cycle threshold (Ct) value than oropharyngeal samples. Molecular detection was more sensitive than isolation, and virus isolation success was proportional to the number of RNA copies in the sample. Interestingly, for a given Ct value, the isolation success was lower in samples from adult birds than in those from juveniles. Comparing the results of specific real-time reverse transcriptase (RRT)-PCRs and of isolation, it was clear that coinfections were common in the investigated birds. The effects of sample type and detection methods warrant some caution in interpretation of the surveillance data. PMID:26655759

  14. How Does Sampling Methodology Influence Molecular Detection and Isolation Success in Influenza A Virus Field Studies?

    PubMed Central

    Avril, Alexis; Tolf, Conny; Olsen, Björn

    2015-01-01

    Wild waterfowl are important reservoir hosts for influenza A virus (IAV) and a potential source of spillover infections in other hosts, including poultry and swine. The emergence of highly pathogenic avian influenza (HPAI) viruses, such as H5N1 and H5N8, and subsequent spread along migratory flyways prompted the initiation of several programs in Europe, North America, and Africa to monitor circulation of HPAI and low-pathogenicity precursor viruses (low-pathogenicity avian influenza [LPAI] viruses). Given the costs of maintaining such programs, it is essential to establish best practice for field methodologies to provide robust data for epidemiological interpretation. Here, we use long-term surveillance data from a single site to evaluate the influence of a number of parameters on virus detection and isolation of LPAI viruses. A total of 26,586 samples (oropharyngeal, fecal, and cloacal) collected from wild mallards were screened by real-time PCR, and positive samples were subjected to isolation in embryonated chicken eggs. The LPAI virus detection rate was influenced by the sample type: cloacal/fecal samples showed a consistently higher detection rate and lower cycle threshold (Ct) value than oropharyngeal samples. Molecular detection was more sensitive than isolation, and virus isolation success was proportional to the number of RNA copies in the sample. Interestingly, for a given Ct value, the isolation success was lower in samples from adult birds than in those from juveniles. Comparing the results of specific real-time reverse transcriptase (RRT)-PCRs and of isolation, it was clear that coinfections were common in the investigated birds. The effects of sample type and detection methods warrant some caution in interpretation of the surveillance data. PMID:26655759

  15. DNA from Dust: Comparative Genomics of Large DNA Viruses in Field Surveillance Samples

    PubMed Central

    Pandey, Utsav; Bell, Andrew S.; Renner, Daniel W.; Kennedy, David A.; Shreve, Jacob T.; Cairns, Chris L.; Jones, Matthew J.; Dunn, Patricia A.; Read, Andrew F.

    2016-01-01

    ABSTRACT The intensification of the poultry industry over the last 60 years facilitated the evolution of increased virulence and vaccine breaks in Marek’s disease virus (MDV-1). Full-genome sequences are essential for understanding why and how this evolution occurred, but what is known about genome-wide variation in MDV comes from laboratory culture. To rectify this, we developed methods for obtaining high-quality genome sequences directly from field samples without the need for sequence-based enrichment strategies prior to sequencing. We applied this to the first characterization of MDV-1 genomes from the field, without prior culture. These viruses were collected from vaccinated hosts that acquired naturally circulating field strains of MDV-1, in the absence of a disease outbreak. This reflects the current issue afflicting the poultry industry, where virulent field strains continue to circulate despite vaccination and can remain undetected due to the lack of overt disease symptoms. We found that viral genomes from adjacent field sites had high levels of overall DNA identity, and despite strong evidence of purifying selection, had coding variations in proteins associated with virulence and manipulation of host immunity. Our methods empower ecological field surveillance, make it possible to determine the basis of viral virulence and vaccine breaks, and can be used to obtain full genomes from clinical samples of other large DNA viruses, known and unknown. IMPORTANCE Despite both clinical and laboratory data that show increased virulence in field isolates of MDV-1 over the last half century, we do not yet understand the genetic basis of its pathogenicity. Our knowledge of genome-wide variation between strains of this virus comes exclusively from isolates that have been cultured in the laboratory. MDV-1 isolates tend to lose virulence during repeated cycles of replication in the laboratory, raising concerns about the ability of cultured isolates to accurately

  16. Detection of Campylobacter in human and animal field samples in Cambodia.

    PubMed

    Osbjer, Kristina; Tano, Eva; Chhayheng, Leang; Mac-Kwashie, Akofa Olivia; Fernström, Lise-Lotte; Ellström, Patrik; Sokerya, Seng; Sokheng, Choup; Mom, Veng; Chheng, Kannarath; San, Sorn; Davun, Holl; Boqvist, Sofia; Rautelin, Hilpi; Magnusson, Ulf

    2016-06-01

    Campylobacter are zoonotic bacteria and a leading cause of human gastroenteritis worldwide with Campylobacter jejuni and C. coli being the most commonly detected species. The aim of this study was to detect Campylobacter in humans and livestock (chickens, ducks, pigs, cattle, water buffalo, quail, pigeons and geese) in rural households by routine culturing and multiplex PCR in faecal samples frozen before analysis. Of 681 human samples, 82 (12%) tested positive by PCR (C. jejuni in 66 samples and C. coli in 16), but none by routine culture. Children were more commonly Campylobacter positive (19%) than adult males (8%) and females (7%). Of 853 livestock samples, 106 (12%) tested positive by routine culture and 352 (41%) by PCR. Campylobacter jejuni was more frequent in chickens and ducks and C. coli in pigs. In conclusion, Campylobacter proved to be highly prevalent by PCR in children (19%), ducks (24%), chickens (56%) and pigs (72%). Routine culturing was insufficiently sensitive in detecting Campylobacter in field samples frozen before analysis. These findings suggest that PCR should be the preferred diagnostic method for detection of Campylobacter in humans and livestock where timely culture is not feasible.

  17. Detection of Campylobacter in human and animal field samples in Cambodia.

    PubMed

    Osbjer, Kristina; Tano, Eva; Chhayheng, Leang; Mac-Kwashie, Akofa Olivia; Fernström, Lise-Lotte; Ellström, Patrik; Sokerya, Seng; Sokheng, Choup; Mom, Veng; Chheng, Kannarath; San, Sorn; Davun, Holl; Boqvist, Sofia; Rautelin, Hilpi; Magnusson, Ulf

    2016-06-01

    Campylobacter are zoonotic bacteria and a leading cause of human gastroenteritis worldwide with Campylobacter jejuni and C. coli being the most commonly detected species. The aim of this study was to detect Campylobacter in humans and livestock (chickens, ducks, pigs, cattle, water buffalo, quail, pigeons and geese) in rural households by routine culturing and multiplex PCR in faecal samples frozen before analysis. Of 681 human samples, 82 (12%) tested positive by PCR (C. jejuni in 66 samples and C. coli in 16), but none by routine culture. Children were more commonly Campylobacter positive (19%) than adult males (8%) and females (7%). Of 853 livestock samples, 106 (12%) tested positive by routine culture and 352 (41%) by PCR. Campylobacter jejuni was more frequent in chickens and ducks and C. coli in pigs. In conclusion, Campylobacter proved to be highly prevalent by PCR in children (19%), ducks (24%), chickens (56%) and pigs (72%). Routine culturing was insufficiently sensitive in detecting Campylobacter in field samples frozen before analysis. These findings suggest that PCR should be the preferred diagnostic method for detection of Campylobacter in humans and livestock where timely culture is not feasible. PMID:26991032

  18. Confirmatory analysis of field-presumptive GSR test sample using SEM/EDS

    NASA Astrophysics Data System (ADS)

    Toal, Sarah J.; Niemeyer, Wayne D.; Conte, Sean; Montgomery, Daniel D.; Erikson, Gregory S.

    2014-09-01

    RedXDefense has developed an automated red-light/green-light field presumptive lead test using a sampling pad which can be subsequently processed in a Scanning Electron Microscope for GSR confirmation. The XCAT's sampling card is used to acquire a sample from a suspect's hands on the scene and give investigators an immediate presumptive as to the presence of lead possibly from primer residue. Positive results can be obtained after firing as little as one shot. The same sampling card can then be sent to a crime lab and processed on the SEM for GSR following ASTM E-1588-10 Standard Guide for Gunshot Residue Analysis by Scanning Electron Microscopy/Energy Dispersive X-Ray Spectrometry, in the same manner as the existing tape lifts currently used in the field. Detection of GSR-characteristic particles (fused lead, barium, and antimony) as small as 0.8 microns (0.5 micron resolution) has been achieved using a JEOL JSM-6480LV SEM equipped with an Oxford Instruments INCA EDS system with a 50mm2 SDD detector, 350X magnification, in low-vacuum mode and in high vacuum mode after coating with carbon in a sputter coater. GSR particles remain stable on the sampling pad for a minimum of two months after chemical exposure (long term stability tests are in progress). The presumptive result provided by the XCAT yields immediate actionable intelligence to law enforcement to facilitate their investigation, without compromising the confirmatory test necessary to further support the investigation and legal case.

  19. Deoxynivalenol, zearalenone, and Fusarium graminearum contamination of cereal straw; field distribution; and sampling of big bales.

    PubMed

    Häggblom, P; Nordkvist, E

    2015-05-01

    Sampling of straw bales from wheat, barley, and oats was carried out after harvest showing large variations in deoxynivalenol (DON) and zearalenone (ZEN) levels. In the wheat field, DON was detected in all straw samples with an average DON concentration of 976 μg/kg and a median of 525 μg/kg, while in four bales, the concentrations were above 3000 μg/kg. For ZEN, the concentrations were more uniform with an average concentration of 11 μg/kg. The barley straw bales were all positive for DON with an average concentration of 449 μg/kg and three bales above 800 μg/kg. In oat straw, the average DON concentration was 6719 μg/kg with the lowest concentration at 2614 μg/kg and eight samples above 8000 μg/kg. ZEN contamination was detected in all bales with an average concentration of 53 μg/kg with the highest concentration at 219 μg/kg. Oat bales from another field showed an average concentration of 16,382 μg/kg. ZEN concentrations in the oat bales were on average 153 μg/kg with a maximum at 284 μg/kg. Levels of Fusarium graminearum DNA were higher in oat straw (max 6444 pg DNA/mg straw) compared to straw from wheat or barley. The significance of mycotoxin exposure from straw should not be neglected particularly in years when high levels of DON and ZEN are also detected in the feed grain. With a limited number of samples preferably using a sampling probe, it is possible to distinguish lots of straw that should not be used as bedding material for pigs.

  20. Field methods for sampling and storing nectar from flowers with low nectar volumes

    PubMed Central

    Morrant, D. S.; Schumann, R.; Petit, S.

    2009-01-01

    Background and Aims Although several methods of sampling and storing floral nectar are available, little information exists on sampling and storing nectar from flowers with low nectar volumes. Methods for sampling and storing nectar from the flowers of species with low floral nectar volumes (<1 µL) were investigated using the flowers of Eucalyptus species. Methods Sampling with microcapillary tubes, blotting up with filter paper, washing and rinsing were compared to determine masses of sugars recovered and differences in sugar ratios. Storage methods included room temperature, refrigeration and freezing treatments; the addition of antimicrobial agents benzyl alcohol or methanol to some of these treatments was also evaluated. Nectar samples were analysed using high-performance liquid chromatography and the masses of sucrose, glucose and fructose in each sample were determined. Key Results Masses of sugars varied significantly among sampling treatments, but the highest yielding methods, rinsing and washing, were not significantly different. A washing time of 1 min was as effective as one of 20 min. Storage trials showed that the sugar concentration measurements of nectar solutions changed rapidly, with the best results achieved for refrigeration with no additive (sucrose and fructose were stable for at least 2 weeks). Sugar ratios, however, remained relatively stable in most treatments and did not change significantly across 4 weeks for the methanol plus refrigerator and freezing treatments, and 2 weeks for the refrigeration treatment with no additive. Conclusions Washing is recommended for nectar collection from flowers with low nectar volumes in the field (with the understanding that one wash underestimates the amounts of sugars present in a flower), as is immediate analysis of sugar mass. In view of the great variation in results depending on nectar collection and storage methods, caution should be exercised in their choice, and their accuracy should be evaluated

  1. Design of Field Experiments for Adaptive Sampling of the Ocean with Autonomous Vehicles

    NASA Astrophysics Data System (ADS)

    Zheng, H.; Ooi, B. H.; Cho, W.; Dao, M. H.; Tkalich, P.; Patrikalakis, N. M.

    2010-05-01

    Due to the highly non-linear and dynamical nature of oceanic phenomena, the predictive capability of various ocean models depends on the availability of operational data. A practical method to improve the accuracy of the ocean forecast is to use a data assimilation methodology to combine in-situ measured and remotely acquired data with numerical forecast models of the physical environment. Autonomous surface and underwater vehicles with various sensors are economic and efficient tools for exploring and sampling the ocean for data assimilation; however there is an energy limitation to such vehicles, and thus effective resource allocation for adaptive sampling is required to optimize the efficiency of exploration. In this paper, we use physical oceanography forecasts of the coastal zone of Singapore for the design of a set of field experiments to acquire useful data for model calibration and data assimilation. The design process of our experiments relied on the oceanography forecast including the current speed, its gradient, and vorticity in a given region of interest for which permits for field experiments could be obtained and for time intervals that correspond to strong tidal currents. Based on these maps, resources available to our experimental team, including Autonomous Surface Craft (ASC) are allocated so as to capture the oceanic features that result from jets and vortices behind bluff bodies (e.g., islands) in the tidal current. Results are summarized from this resource allocation process and field experiments conducted in January 2009.

  2. Geographical variation in inorganic arsenic in paddy field samples and commercial rice from the Iberian Peninsula.

    PubMed

    Signes-Pastor, Antonio J; Carey, Manus; Carbonell-Barrachina, Angel A; Moreno-Jiménez, Eduardo; Green, Andy J; Meharg, Andrew A

    2016-07-01

    This study investigated total arsenic and arsenic speciation in rice using ion chromatography with mass spectrometric detection (IC-ICP-MS), covering the main rice-growing regions of the Iberian Peninsula in Europe. The main arsenic species found were inorganic and dimethylarsinic acid. Samples surveyed were soil, shoots and field-collected rice grain. From this information soil to plant arsenic transfer was investigated plus the distribution of arsenic in rice across the geographical regions of Spain and Portugal. Commercial polished rice was also obtained from each region and tested for arsenic speciation, showing a positive correlation with field-obtained rice grain. Commercial polished rice had the lowest i-As content in Andalucia, Murcia and Valencia while Extremadura had the highest concentrations. About 26% of commercial rice samples exceeded the permissible concentration for infant food production as governed by the European Commission. Some cadmium data is also presented, available with ICP-MS analyses, and show low concentration in rice samples. PMID:26920305

  3. Field portable low temperature porous layer open tubular cryoadsorption headspace sampling and analysis part II: Applications.

    PubMed

    Harries, Megan; Bukovsky-Reyes, Santiago; Bruno, Thomas J

    2016-01-15

    This paper details the sampling methods used with the field portable porous layer open tubular cryoadsorption (PLOT-cryo) approach, described in Part I of this two-part series, applied to several analytes of interest. We conducted tests with coumarin and 2,4,6-trinitrotoluene (two solutes that were used in initial development of PLOT-cryo technology), naphthalene, aviation turbine kerosene, and diesel fuel, on a variety of matrices and test beds. We demonstrated that these analytes can be easily detected and reliably identified using the portable unit for analyte collection. By leveraging efficiency-boosting temperature control and the high flow rate multiple capillary wafer, very short collection times (as low as 3s) yielded accurate detection. For diesel fuel spiked on glass beads, we determined a method detection limit below 1 ppm. We observed greater variability among separate samples analyzed with the portable unit than previously documented in work using the laboratory-based PLOT-cryo technology. We identify three likely sources that may help explain the additional variation: the use of a compressed air source to generate suction, matrix geometry, and variability in the local vapor concentration around the sampling probe as solute depletion occurs both locally around the probe and in the test bed as a whole. This field-portable adaptation of the PLOT-cryo approach has numerous and diverse potential applications.

  4. Geographical variation in inorganic arsenic in paddy field samples and commercial rice from the Iberian Peninsula.

    PubMed

    Signes-Pastor, Antonio J; Carey, Manus; Carbonell-Barrachina, Angel A; Moreno-Jiménez, Eduardo; Green, Andy J; Meharg, Andrew A

    2016-07-01

    This study investigated total arsenic and arsenic speciation in rice using ion chromatography with mass spectrometric detection (IC-ICP-MS), covering the main rice-growing regions of the Iberian Peninsula in Europe. The main arsenic species found were inorganic and dimethylarsinic acid. Samples surveyed were soil, shoots and field-collected rice grain. From this information soil to plant arsenic transfer was investigated plus the distribution of arsenic in rice across the geographical regions of Spain and Portugal. Commercial polished rice was also obtained from each region and tested for arsenic speciation, showing a positive correlation with field-obtained rice grain. Commercial polished rice had the lowest i-As content in Andalucia, Murcia and Valencia while Extremadura had the highest concentrations. About 26% of commercial rice samples exceeded the permissible concentration for infant food production as governed by the European Commission. Some cadmium data is also presented, available with ICP-MS analyses, and show low concentration in rice samples.

  5. Field portable low temperature porous layer open tubular cryoadsorption headspace sampling and analysis part II: Applications.

    PubMed

    Harries, Megan; Bukovsky-Reyes, Santiago; Bruno, Thomas J

    2016-01-15

    This paper details the sampling methods used with the field portable porous layer open tubular cryoadsorption (PLOT-cryo) approach, described in Part I of this two-part series, applied to several analytes of interest. We conducted tests with coumarin and 2,4,6-trinitrotoluene (two solutes that were used in initial development of PLOT-cryo technology), naphthalene, aviation turbine kerosene, and diesel fuel, on a variety of matrices and test beds. We demonstrated that these analytes can be easily detected and reliably identified using the portable unit for analyte collection. By leveraging efficiency-boosting temperature control and the high flow rate multiple capillary wafer, very short collection times (as low as 3s) yielded accurate detection. For diesel fuel spiked on glass beads, we determined a method detection limit below 1 ppm. We observed greater variability among separate samples analyzed with the portable unit than previously documented in work using the laboratory-based PLOT-cryo technology. We identify three likely sources that may help explain the additional variation: the use of a compressed air source to generate suction, matrix geometry, and variability in the local vapor concentration around the sampling probe as solute depletion occurs both locally around the probe and in the test bed as a whole. This field-portable adaptation of the PLOT-cryo approach has numerous and diverse potential applications. PMID:26726934

  6. Lensless coherent imaging by sampling of the optical field with digital micromirror device

    NASA Astrophysics Data System (ADS)

    Vdovin, G.; Gong, H.; Soloviev, O.; Pozzi, P.; Verhaegen, M.

    2015-12-01

    We have experimentally demonstrated a lensless coherent microscope based on direct registration of the complex optical field by sampling the pupil with a sequence of two-point interferometers formed by a digital micromirror device. Complete registration of the complex amplitude in the pupil of the imaging system, without any reference beam, provides a convenient link between the experimental and computational optics. Unlike other approaches to digital holography, our method does not require any external reference beam, resulting in a simple and robust registration setup. Computer analysis of the experimentally registered field allows for focusing the image in the whole range from zero to infinity, and for virtual correction of the aberrations present in the real optical system, by applying the adaptive wavefront corrections to its virtual model.

  7. Quantitative reverse sample genome probing of microbial communities and its application to oil field production waters

    SciTech Connect

    Voordouw, G.; Shen, Y.; Harrington, C.S.; Teland, A.J. ); Jack, T.R. ); Westlake, W.S. )

    1993-12-01

    This paper presents a protocol for quantitative analysis of microbial communities by reverse sample genome probing is presented in which (i) whole community DNA is isolated and labeled in the presence of a known amount of an added internal standard and (ii) the resulting spiked reverse genome probe is hybridized with a master filter on which denatured genomic DNAs from bacterial standards isolated from the target environment were spotted in large amounts (up to 1,500 ng) in order to improve detection sensitivity. This protocol allowed reproducible fingerprinting of the microbial community in oil field production waters at 19 sites from which water and biofilm samples were collected. It appeared that selected sulfate-reducing bacteria were significantly enhanced in biofilms covering the metal surfaces in contact with the production waters.

  8. GeoLab's First Field Trials, 2010 Desert RATS: Evaluating Tools for Early Sample Characterization

    NASA Technical Reports Server (NTRS)

    Evans, Cindy A.; Bell, M. S.; Calaway, M. J.; Graff, Trevor; Young, Kelsey

    2011-01-01

    As part of an accelerated prototyping project to support science operations tests for future exploration missions, we designed and built a geological laboratory, GeoLab, that was integrated into NASA's first generation Habitat Demonstration Unit-1/Pressurized Excursion Module (HDU1-PEM). GeoLab includes a pressurized glovebox for transferring and handling samples collected on geological traverses, and a suite of instruments for collecting preliminary data to help characterize those samples. The GeoLab and the HDU1-PEM were tested for the first time as part of the 2010 Desert Research and Technology Studies (DRATS), NASA's analog field exercise for testing mission technologies. The HDU1- PEM and GeoLab participated in two weeks of joint operations in northern Arizona with two crewed rovers and the DRATS science team.

  9. Highly efficient sample stacking by enhanced field amplification on a simple paper device.

    PubMed

    Ma, Biao; Song, Yi-Zhen; Niu, Ji-Cheng; Wu, Zhi-Yong

    2016-09-21

    We present a novel electrokinetic stacking (ES) method based on field amplification on a simple paper device for sample preconcentration. With voltage application, charged probe ions in a solution of lower conductivity stack and form a narrow band at the boundary between the sample and the background electrolyte of higher conductivity. The stacking band appears quickly and stabilizes in a few minutes. With this ES method, three orders of magnitude signal improvement was successfully achieved for both a fluorescein probe and a double-stranded DNA within 300 s. This enhanced stacking efficiency is attributed to a focusing effect due to the balance between electromigration and counter electroosmotic flow. We also applied this ES method to other low-cost fiber substrates such as cloth and thread. Such a simple and highly efficient ES method will find wide applications in the development of sensitive paper-based analytical devices (PADs), especially for low-cost point-of-care testing (POCT).

  10. Review of concepts useful for maintaining quality of male reproductive field samples for laboratory study

    USGS Publications Warehouse

    Jenkins, Jill A.

    2011-01-01

    Investigations into cellular and molecular characteristics of male gametes obtained from fish in natural ecosystems require careful sample handling and shipping in order to minimize artifacts. Maintaining sample integrity engenders confident assessments of ecosystem health, whereby animal condition is often reflected by gamete biomarkers - indicators that respond in measurable ways to changes. A number of our investigations have addressed the hypothesis that biomarkers from fish along a pollution gradient are reflective of site location. Species biology and the selected biological endpoints direct choice of parameters such as: temperature, buffer osmolality, time in transit, fixation, cryoprotectants, protease inhibition, and antibiotic inclusion in extender. This paper will highlight case studies, and outline parameters and thoughts on approaches for use by field and laboratory researchers.

  11. Investigation of Particle Sampling Bias in the Shear Flow Field Downstream of a Backward Facing Step

    NASA Technical Reports Server (NTRS)

    Meyers, James F.; Kjelgaard, Scott O.; Hepner, Timothy E.

    1990-01-01

    The flow field about a backward facing step was investigated to determine the characteristics of particle sampling bias in the various flow phenomena. The investigation used the calculation of the velocity:data rate correlation coefficient as a measure of statistical dependence and thus the degree of velocity bias. While the investigation found negligible dependence within the free stream region, increased dependence was found within the boundary and shear layers. Full classic correction techniques over-compensated the data since the dependence was weak, even in the boundary layer and shear regions. The paper emphasizes the necessity to determine the degree of particle sampling bias for each measurement ensemble and not use generalized assumptions to correct the data. Further, it recommends the calculation of the velocity:data rate correlation coefficient become a standard statistical calculation in the analysis of all laser velocimeter data.

  12. Membrane solid-phase extraction: Field application for isolation of polycyclic aromatic hydrocarbons from water samples

    SciTech Connect

    Furlong, E.T.; Koleis, J.C.; Gates, P.M.

    1995-12-31

    Solid-phase extraction (SPE) membranes (M-SPE) were used to isolate microgram-per-liter to nanogram-per-liter quantities of polycyclic aromatic hydrocarbons (PAH) in 4- to 8-liter ground-water samples from a crude-oil-contaminated ground-water site near Bemidji, Minnesota. The M-SPE method was evaluated (1) under laboratory conditions using reagent water fortified with individual PAH at 1.23 micrograms per liter, and (2) at the Bemidji site. At the site, ground-water samples were processed and PAH isolated using a M-SPE system connected directly to the well pump. Following sample isolation, all M-SPE samples were extracted using dichloromethane and analyzed by gas chromatography-mass spectrometry with selected-ion monitoring. Operationally, the M-SPE method provided a simple means to isolate PAH on site at the wellhead, particularly for anoxic water samples. Acceptable recoveries, ranging from 56 to over 100 percent, were observed for lower molecular weight PAH (naphthalene to pyrene) using the M-SPE method. Recoveries using M-SPE were somewhat lower, but reproducible, for higher molecular weight PAH (chrysene to benzo[ghi]perylene), ranging from 18 to 56 percent. M-SPE provides the capability to collect and field isolate PAH from a sufficiently large number of samples to identify environmental chemical processes occurring at individual compound concentrations of 50 to 1,200 nanograms per liter. Using M-SPE, the potential for facilitated transport of PAH by in situ-derived dissolved organic carbon (DOC) was evaluated at the site. Plots comparing DOC and PAH concentrations indicate that PAH concentrations increase exponentially with linear increases in DOC concentrations.

  13. Four p67 alleles identified in South African Theileria parva field samples.

    PubMed

    Sibeko, Kgomotso P; Geysen, Dirk; Oosthuizen, Marinda C; Matthee, Conrad A; Troskie, Milana; Potgieter, Frederick T; Coetzer, Jacobus A W; Collins, Nicola E

    2010-02-10

    Previous studies characterizing the Theileria parva p67 gene in East Africa revealed two alleles. Cattle-derived isolates associated with East Coast fever (ECF) have a 129bp deletion in the central region of the p67 gene (allele 1), compared to buffalo-derived isolates with no deletion (allele 2). In South Africa, Corridor disease outbreaks occur if there is contact between infected buffalo and susceptible cattle in the presence of vector ticks. Although ECF was introduced into South Africa in the early 20th century, it has been eradicated and it is thought that there has been no cattle to cattle transmission of T. parva since. The variable region of the p67 gene was amplified and the gene sequences analyzed to characterize South African T. parva parasites that occur in buffalo, in cattle from farms where Corridor disease outbreaks were diagnosed and in experimentally infected cattle. Four p67 alleles were identified, including alleles 1 and 2 previously detected in East African cattle and buffalo, respectively, as well as two novel alleles, one with a different 174bp deletion (allele 3), the other with a similar sequence to allele 3 but with no deletion (allele 4). Sequence variants of allele 1 were obtained from field samples originating from both cattle and buffalo. Allele 1 was also obtained from a bovine that tested T. parva positive from a farm near Ladysmith in the KwaZulu-Natal Province. East Coast fever was not diagnosed on this farm, but the p67 sequence was identical to that of T. parva Muguga, an isolate that causes ECF in Kenya. Variants of allele 2 were obtained from all T. parva samples from both buffalo and cattle, except Lad 10 and Zam 5. Phylogenetic analysis revealed that alleles 3 and 4 are monophyletic and diverged early from the other alleles. These novel alleles were not identified from South African field samples collected from cattle; however allele 3, with a p67 sequence identical to those obtained in South African field samples from

  14. Wood Dust Sampling: Field Evaluation of Personal Samplers When Large Particles Are Present

    PubMed Central

    Lee, Taekhee; Harper, Martin; Slaven, James E.; Lee, Kiyoung; Rando, Roy J.; Maples, Elizabeth H.

    2011-01-01

    Recent recommendations for wood dust sampling include sampling according to the inhalable convention of International Organization for Standardization (ISO) 7708 (1995) Air quality—particle size fraction definitions for health-related sampling. However, a specific sampling device is not mandated, and while several samplers have laboratory performance approaching theoretical for an ‘inhalable’ sampler, the best choice of sampler for wood dust is not clear. A side-by-side field study was considered the most practical test of samplers as laboratory performance tests consider overall performance based on a wider range of particle sizes than are commonly encountered in the wood products industry. Seven companies in the wood products industry of the Southeast USA (MS, KY, AL, and WV) participated in this study. The products included hardwood flooring, engineered hardwood flooring, door skins, shutter blinds, kitchen cabinets, plywood, and veneer. The samplers selected were 37-mm closed-face cassette with ACCU-CAP™, Button, CIP10-I, GSP, and Institute of Occupational Medicine. Approximately 30 of each possible pairwise combination of samplers were collected as personal sample sets. Paired samplers of the same type were used to calculate environmental variance that was then used to determine the number of pairs of samples necessary to detect any difference at a specified level of confidence. Total valid sample number was 888 (444 valid pairs). The mass concentration of wood dust ranged from 0.02 to 195 mg m−3. Geometric mean (geometric standard deviation) and arithmetic mean (standard deviation) of wood dust were 0.98 mg m−3 (3.06) and 2.12 mg m−3 (7.74), respectively. One percent of the samples exceeded 15 mg m−3, 6% exceeded 5 mg m−3, and 48% exceeded 1 mg m−3. The number of collected pairs is generally appropriate to detect a 35% difference when outliers (negative mass loadings) are removed. Statistical evaluation of the nonsimilar sampler pair

  15. Chemical analysis of post explosion samples obtained as a result of model field experiments.

    PubMed

    Borusiewicz, Rafal; Zadora, Grzegorz; Zieba-Palus, Janina

    2013-11-15

    Five different explosives were detonated in a series of field experiments. Each experiment (detonation of the charge of each specific explosive) was repeated three times. The experiments were conducted under controlled conditions, exceeding those of research published so far. Detonated charges were uniform in size and, as far as possible, in shape. The explosives used originated from the same batch. Additionally, the same kind of electric detonators were used. Witness plates (sheets of galvanised steel 100 cm × 90 cm × 0.5 mm) were used to collect post-blast residues in a reproducible way. They were placed relatively close to the charge to minimise the influence of the wind. Samples were collected by systematic swabbing of the surface of the plate by acetone moistened cotton swabs. Samples were packed tight, transferred to the laboratory, and extracted with methanol. Extracts were concentrated by solvent evaporation, cleaned by centrifugation, and analysed using HPLC-DAD. Each extract was analysed three times and the mean value of the amount of the given explosive within the extract was calculated. For each of the explosive materials used the results of the repetition of the experiments proved them to be irreproducible. After each detonation of a specific charge different amounts of given explosives were found in post-blast samples. Also, the intuitively expected relationship between the distance from the charge and amount of post-blast residues were not observed. These results are consistent with previously published results of field experiments. The lack of reproducibility may be explained by differences in efficiency of detonation. The efficiency of a detonation may be influenced even by small differences in the shape of the charge as well as by the position and properties of the detonator. The lack of dependency between the amount of the explosive in the post-blast samples and the distance from the charge may be explained by the fact that during detonation

  16. Sample Characterization of FIDO-2000 and FIDO-2002 Blind Field Test Sites by an APXS Instrument

    NASA Astrophysics Data System (ADS)

    Economou, T. E.

    2002-12-01

    The Mars Rover Explorer (MER) Project conducted in the past few years two major blind field test that involved the Field Integrated Design and Operations (FIDO) rover, with a payload not quite, but close to the real MER mission flight payload. Since the APXS and the MB spectrometer cannot operate properly in the Earth's atmosphere, a representative variety of rocks and soil samples from designated "landing" sites were collected and sent to the respective laboratories for analyses with these two instruments. During the field tests, the data from FIDO instruments, together with the appropriate data from the APXS and MB spectrometers, which, according to the site operators opinion, most closely resembled the real analyzed samples, were transmitted to the control room at JPL for target evaluation. The APXS analyzed both, the natural side and the fresh cut side, of most of the rocks that were made available. By comparing the analytical results from both sides, it was possible to clearly detect and evaluate alteration rinds and coatings on the analyzed rocks. Desert varnish, thin iron and carbon coatings were found on natural side of some rocks, but not others. The elemental composition results by the APXS contributed synergistically with the other FIDO instruments to derive the mineralogical and geological characterization of the sites by imposing limits on the amounts and the variety of specific minerals. Most of the analyzed samples from both FIDO field test sites were very high in silica and alumina. In a few cases, the analyses were compatible with pure quartz. The alpha mode of the APXS is especially valuable for detecting even small amounts of carbonates. In many instances, it was possible to show that the carbon was only on the surface of some rocks. Examples of the APXS results from both blind field tests will be presented and discussed at the meeting The APXS results will be compared to the Pathfinder APXS rock analyses and conclusions will be made about rinds

  17. Passive sampling reversed: coupling passive field sampling with passive lab dosing to assess the ecotoxicity of mixtures present in the marine environment.

    PubMed

    Claessens, Michiel; Monteyne, Els; Wille, Klaas; Vanhaecke, Lynn; Roose, Patrick; Janssen, Colin R

    2015-04-15

    This study presents a new approach in aquatic toxicity testing combining passive sampling and passive dosing. Polydimethylsiloxane sheets were used to sample contaminant mixtures in the marine environment. These sheets were subsequently transferred to ecotoxicological test medium in which the sampled contaminant mixtures were released through passive dosing. 4 out of 17 of these mixtures caused severe effects in a growth inhibition assay with a marine diatom. These effects could not be explained by the presence of compounds detected in the sampling area and were most likely attributable to unmeasured compounds absorbed to the passive samplers during field deployment. The findings of this study indicate that linking passive sampling in the field to passive dosing in laboratory ecotoxicity tests provides a practical and complimentary approach for assessing the toxicity of hydrophobic contaminant mixtures that mimics realistic environmental exposures. Limitations and opportunities for future improvements are presented.

  18. Exposure history of the Mocs (L6) chondrite: A study of strewn field samples

    NASA Astrophysics Data System (ADS)

    Ferko, T. E.; Schultz, L.; Franke, L.; Bogard, D. D.; Garrison, D. H.; Hutchison, R.; Lipschutz, M. E.

    2000-11-01

    We measured cosmogenic radionuclides (10Be, 26Al, 36Cl) and noble gases (He, Ne and Ar) in 10 specimens of the L6 chondrite Mocs to determine the exposure history and pre-atmospheric relationship among fragments from known locations in the strewn field. Cosmogenic noble gas contents alone are consistent with a simple irradiation exposure of 15.2 Ma. However, Mocs has very low 22Ne/21Ne ratios indicative of deep burial in a large meteoroid, but radionuclide levels at saturation values typical for much smaller meteoroids: this paradox suggests a possible complex exposure. For the latter case, we propose a two-stage exposure history in which Mocs initially was buried deeply in a large object for 110 Ma followed by exposure in a 65 cm object for 10.5 Ma. Relative shielding was inferred from the measured 22Ne/21Ne ratios assuming constant 22Ne/21Ne production for all samples during the first stage. These shielding levels, which are supported by estimates based on 36Cl production by neutron capture, indicate a possible relationship between depth of samples in the Mocs meteoroid and fall location in the strewn field.

  19. Integrated Field Lysimetry and Porewater Sampling for Evaluation of Chemical Mobility in Soils and Established Vegetation

    PubMed Central

    Gannon, Travis W.; Polizzotto, Matthew L.

    2014-01-01

    Potentially toxic chemicals are routinely applied to land to meet growing demands on waste management and food production, but the fate of these chemicals is often not well understood. Here we demonstrate an integrated field lysimetry and porewater sampling method for evaluating the mobility of chemicals applied to soils and established vegetation. Lysimeters, open columns made of metal or plastic, are driven into bareground or vegetated soils. Porewater samplers, which are commercially available and use vacuum to collect percolating soil water, are installed at predetermined depths within the lysimeters. At prearranged times following chemical application to experimental plots, porewater is collected, and lysimeters, containing soil and vegetation, are exhumed. By analyzing chemical concentrations in the lysimeter soil, vegetation, and porewater, downward leaching rates, soil retention capacities, and plant uptake for the chemical of interest may be quantified. Because field lysimetry and porewater sampling are conducted under natural environmental conditions and with minimal soil disturbance, derived results project real-case scenarios and provide valuable information for chemical management. As chemicals are increasingly applied to land worldwide, the described techniques may be utilized to determine whether applied chemicals pose adverse effects to human health or the environment. PMID:25045915

  20. Classification of underwater targets from autonomous underwater vehicle sampled bistatic acoustic scattered fields.

    PubMed

    Fischell, Erin M; Schmidt, Henrik

    2015-12-01

    One of the long term goals of autonomous underwater vehicle (AUV) minehunting is to have multiple inexpensive AUVs in a harbor autonomously classify hazards. Existing acoustic methods for target classification using AUV-based sensing, such as sidescan and synthetic aperture sonar, require an expensive payload on each outfitted vehicle and post-processing and/or image interpretation. A vehicle payload and machine learning classification methodology using bistatic angle dependence of target scattering amplitudes between a fixed acoustic source and target has been developed for onboard, fully autonomous classification with lower cost-per-vehicle. To achieve the high-quality, densely sampled three-dimensional (3D) bistatic scattering data required by this research, vehicle sampling behaviors and an acoustic payload for precision timed data acquisition with a 16 element nose array were demonstrated. 3D bistatic scattered field data were collected by an AUV around spherical and cylindrical targets insonified by a 7-9 kHz fixed source. The collected data were compared to simulated scattering models. Classification and confidence estimation were shown for the sphere versus cylinder case on the resulting real and simulated bistatic amplitude data. The final models were used for classification of simulated targets in real time in the LAMSS MOOS-IvP simulation package [M. Benjamin, H. Schmidt, P. Newman, and J. Leonard, J. Field Rob. 27, 834-875 (2010)].

  1. 9 T high magnetic field annealing effects on FeN bulk sample

    SciTech Connect

    Jiang, Yanfeng; Wang, Jian-Ping; Dabade, Vivekanand; James, Richard D.; Brady, Michael P.; Rios, Orlando

    2014-05-07

    α″-Fe{sub 16}N{sub 2} has been suggested as a promising candidate for future rare-earth-free magnets. In this paper, we report to use high magnetic field (9 T) assisted post-annealing process to enhance the Fe{sub 16}N{sub 2} phase formation in FeN bulk rod samples during the α′ → α″ phase transformation and thus improve its magnetic properties. It was found by X-ray Diffraction measurement that the volume ratio of Fe{sub 16}N{sub 2} phase was increased up to 22%, which corresponds to an increase in the amount of transformation from α′ → α″ up to 78%. Also, the saturation magnetization (M{sub s}) of the prepared FeN rod sample was increased to 227 emu/g with its coercivity up to 376 Oe at room temperature. A working mechanism for the high field assisted post-annealing process was presented.

  2. Classification of underwater targets from autonomous underwater vehicle sampled bistatic acoustic scattered fields.

    PubMed

    Fischell, Erin M; Schmidt, Henrik

    2015-12-01

    One of the long term goals of autonomous underwater vehicle (AUV) minehunting is to have multiple inexpensive AUVs in a harbor autonomously classify hazards. Existing acoustic methods for target classification using AUV-based sensing, such as sidescan and synthetic aperture sonar, require an expensive payload on each outfitted vehicle and post-processing and/or image interpretation. A vehicle payload and machine learning classification methodology using bistatic angle dependence of target scattering amplitudes between a fixed acoustic source and target has been developed for onboard, fully autonomous classification with lower cost-per-vehicle. To achieve the high-quality, densely sampled three-dimensional (3D) bistatic scattering data required by this research, vehicle sampling behaviors and an acoustic payload for precision timed data acquisition with a 16 element nose array were demonstrated. 3D bistatic scattered field data were collected by an AUV around spherical and cylindrical targets insonified by a 7-9 kHz fixed source. The collected data were compared to simulated scattering models. Classification and confidence estimation were shown for the sphere versus cylinder case on the resulting real and simulated bistatic amplitude data. The final models were used for classification of simulated targets in real time in the LAMSS MOOS-IvP simulation package [M. Benjamin, H. Schmidt, P. Newman, and J. Leonard, J. Field Rob. 27, 834-875 (2010)]. PMID:26723332

  3. Near-field acoustic holography using sparse regularization and compressive sampling principles.

    PubMed

    Chardon, Gilles; Daudet, Laurent; Peillot, Antoine; Ollivier, François; Bertin, Nancy; Gribonval, Rémi

    2012-09-01

    Regularization of the inverse problem is a complex issue when using near-field acoustic holography (NAH) techniques to identify the vibrating sources. This paper shows that, for convex homogeneous plates with arbitrary boundary conditions, alternative regularization schemes can be developed based on the sparsity of the normal velocity of the plate in a well-designed basis, i.e., the possibility to approximate it as a weighted sum of few elementary basis functions. In particular, these techniques can handle discontinuities of the velocity field at the boundaries, which can be problematic with standard techniques. This comes at the cost of a higher computational complexity to solve the associated optimization problem, though it remains easily tractable with out-of-the-box software. Furthermore, this sparsity framework allows us to take advantage of the concept of compressive sampling; under some conditions on the sampling process (here, the design of a random array, which can be numerically and experimentally validated), it is possible to reconstruct the sparse signals with significantly less measurements (i.e., microphones) than classically required. After introducing the different concepts, this paper presents numerical and experimental results of NAH with two plate geometries, and compares the advantages and limitations of these sparsity-based techniques over standard Tikhonov regularization. PMID:22978881

  4. Effect of temporal sampling and timing for soil moisture measurements at field scale

    NASA Astrophysics Data System (ADS)

    Snapir, B.; Hobbs, S.

    2012-04-01

    Estimating soil moisture at field scale is valuable for various applications such as irrigation scheduling in cultivated watersheds, flood and drought prediction, waterborne disease spread assessment, or even determination of mobility with lightweight vehicles. Synthetic aperture radar on satellites in low Earth orbit can provide fine resolution images with a repeat time of a few days. For an Earth observing satellite, the choice of the orbit is driven in particular by the frequency of measurements required to meet a certain accuracy in retrieving the parameters of interest. For a given target, having only one image every week may not enable to capture the full dynamic range of soil moisture - soil moisture can change significantly within a day when rainfall occurs. Hence this study focuses on the effect of temporal sampling and timing of measurements in terms of error on the retrieved signal. All the analyses are based on in situ measurements of soil moisture (acquired every 30 min) from the OzNet Hydrological Monitoring Network in Australia for different fields over several years. The first study concerns sampling frequency. Measurements at different frequencies were simulated by sub-sampling the original data. Linear interpolation was used to estimate the missing intermediate values, and then this time series was compared to the original. The difference between these two signals is computed for different levels of sub-sampling. Results show that the error increases linearly when the interval is less than 1 day. For intervals longer than a day, a sinusoidal component appears on top of the linear growth due to the diurnal variation of surface soil moisture. Thus, for example, the error with measurements every 4.5 days can be slightly less than the error with measurements every 2 days. Next, for a given sampling interval, this study evaluated the effect of the time during the day at which measurements are made. Of course when measurements are very frequent the time

  5. Size-dependent Turbidimatric Quantification of Mobile Colloids in Field Samples

    NASA Astrophysics Data System (ADS)

    Yan, J.; Meng, X.; Jin, Y.

    2015-12-01

    Natural colloids, often defined as entities with sizes < 1.0 μm, have attracted much research attention because of their ability to facilitate the transport of contaminants in the subsurface environment. However, due to their small size and generally low concentrations in field samples, quantification of mobile colloids, especially the smaller fractions (< 0.45 µm), which are operationally defined as dissolved, is largely impeded and hence the natural colloidal pool is greatly overlooked and underestimated. The main objectives of this study are to: (1) develop an experimentally and economically efficient methodology to quantify natural colloids in different size fractions (0.1-0.45 and 0.45-1 µm); (2) quantify mobile colloids including small colloids, < 0.45 µm particularly, in different natural aquatic samples. We measured and generated correlations between mass concentration and turbidity of colloid suspensions, made by extracting and fractionating water dispersible colloids in 37 soils from different areas in the U.S. and Denmark, for colloid size fractions 0.1-0.45 and 0.45-1 µm. Results show that the correlation between turbidity and colloid mass concentration is largely affected by colloid size and iron content, indicating the need to generate different correlations for colloids with constrained size range and iron content. This method enabled quick quantification of colloid concentrations in a large number of field samples collected from freshwater, wetland and estuaries in different size fractions. As a general trend, we observed high concentrations of colloids in the < 0.45 µm fraction, which constitutes a significant percentage of the total mobile colloidal pool (< 1 µm). This observation suggests that the operationally defined cut-off size for "dissolved" phase can greatly underestimate colloid concentration therefore the role that colloids play in the transport of associated contaminants or other elements.

  6. Spatiotemporal reconstruction of gaps in multivariate fields using the direct sampling approach

    NASA Astrophysics Data System (ADS)

    Mariethoz, Gregoire; McCabe, Matthew F.; Renard, Philippe

    2012-10-01

    The development of spatially continuous fields from sparse observing networks is an outstanding problem in the environmental and Earth sciences. Here we explore an approach to produce spatially continuous fields from discontinuous data that focuses on reconstructing gaps routinely present in satellite-based Earth observations. To assess the utility of the approach, we use synthetic imagery derived from a regional climate model of southeastern Australia. Orbital tracks, scan geometry influences, and atmospheric artifacts are artificially imposed upon these model simulations to examine the techniques' capacity to reproduce realistic and representative retrievals. The imposed discontinuities are reconstructed using a direct sampling technique and are compared against the original continuous model data: a synthetic simulation experiment. Results indicate that the multipoint geostatistical gap-filling approach produces texturally realistic spatially continuous fields from otherwise discontinuous data sets. Reconstruction results are assessed through comparison of spatial distributions, as well as through visual assessment of fine-scale features. Complex spatial patterns and fine-scale structure can be resolved within the reconstructions, illustrating that the often nonlinear dependencies between variables can be maintained. The stochastic nature of the methodology makes it possible to expand the approach within a Monte Carlo framework in order to estimate the uncertainty related to subsequent reconstructions. From a practical perspective, the reconstruction method is straightforward and requires minimum user intervention for parameter adjustment. As such, it can be automated to systematically process real time remote sensing measurements.

  7. [Analysis of nine narcotics in urine by microemulsion electrokinetic chromatography-field samplified sample injection].

    PubMed

    Zhang, Yu; Li, Qin; Lu, Minghua; Zhang, Lan; Chen, Guonan; Cai, Zongwei

    2011-08-01

    A simple, sensitive and reproducible method using microemulsion electrokinetic chromatography (MEEKC)-field amplified sample injection (FASI) was developed for the analysis of nine narcotics (morphine, codeine, naloxone, heroin, thebaine, cocaine, pethidine, fentanyl and methadone) in urine. In the MEEKC method, sodium dodecyl sulfate (SDS), 1-butanol and ethyl acetate were used as surfactant, co-surfactant and organic solvent, respectively. The effects of the acidity and concentration of borate buffer, SDS, 1-butanol and ethyl acetate contents were investigated. The optimum concentrations (by mass fraction) of microemulsion system were 0.6% SDS, 1.2% 1-butanol, 0.6% ethyl acetate and 97.6% 10 mmol/L Na2B4O7 buffer (pH 9.5). The applied voltage was 25 kV. FASI was coupled with the MEEKC method to increase the sensitivity. Under the optimum conditions, the nine narcotics were baseline separated within 15 min and the detection limits (S/N = 3) were in the range of 0.3 - 8.0 microg/L. The spiked recoveries in urine samples were between 79.4% and 119.9% with the intraday relative standard deviations (RSDs) less than 5.5%. The developed method has been successfully applied to the analysis of methadone in the samples from in vitro metabolism study.

  8. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  9. Using analog field and sample data to understand remote data of Mars

    NASA Astrophysics Data System (ADS)

    Wright, Shawn

    2015-04-01

    The primary geologic processes on Mars are basaltic volcanism, sedimentation, impact cratering, and alteration. All potentially create amorphous materials and complex mineralogies, and these must be measured by rovers sent to Mars to characterize the geology. This paper addresses the field measurements and sample analyses of a terrestrial analog impact crater to interpret rover and perhaps orbital data of Mars. Motivation: OMEGA and CRISM have shown alteration minerals in Martian ejecta blankets. These phyllosilicates may represent altered crust that was excavated, and only exposed, by the impact, or could represent ejecta that was altered in part during impact or fractured/fragmented material that was altered at higher rate than surrounding terrain after ejecta emplacement. Study Site and Geologic History: Lonar Crater, India is a young (~570 ka), ~1.8 km impact site emplaced in ~65 Ma Deccan basalt, which is an excellent analog material for Mars with ~45-50% labradorite and ~35% augite/pigeonite before lower flows were altered and then excavated and/or shocked. Pre-impact stratigraphy was not complex: 3 flows of fresh basalt overlying 3 flows of aqueously-altered basalt, and both are found as impact breccia clasts in a ~8 m thick lithic (unshocked, "throw out") and ~1 m suevite (all ranges of shock pressure, "fall out") breccia units in the ejecta. Two geologic histories for shocked clasts in the Lonar suevite breccia are compared: 1.) the alteration of impactites (impact glasses and melts) of a range of shock pressures ("post-impact alteration"), which likely increase the rate of alteration and affects the order of alteration where compared to pristine, igneous minerals, and 2.) the existence of altered basalt protoliths ("pre-impact alteration") now vitrified as in-situ breccia clasts or float. Both of these geologic histories and their alteration pathways are compared to those of unshocked fresh and unshocked altered basalts found in the lithic breccia and

  10. Comparison of aerosol backscatter and wind field estimates from the REAL and the SAMPLE

    NASA Astrophysics Data System (ADS)

    Mayor, Shane D.; Dérian, Pierre; Mauzey, Christopher F.; Spuler, Scott M.; Ponsardin, Patrick; Pruitt, Jeff; Ramsey, Darrell; Higdon, Noah S.

    2015-09-01

    Although operating at the same near-infrared 1.5- m wavelength, the Raman-shifted Eye-safe Aerosol Lidar (REAL) and the Scanning Aerosol Micro-Pulse Lidar-Eye-safe (SAMPLE) are very different in how they generate and detect laser radiation. We present results from an experiment where the REAL and the SAMPLE were operated side-by-side in Chico, California, in March of 2015. During the non-continuous, eleven day test period, the SAMPLE instrument was operated at maximum pulse repetition frequency (15 kHz) and integrated over the interpulse period of the REAL (0.1 s). Operation at the high pulse repetition frequency resulted in second trip echoes which contaminated portions of the data. The performance of the SAMPLE instrument varied with background brightness--as expected with a photon counting receiver|--yet showed equal or larger backscatter intensity signal to noise ratio throughout the intercomparison experiment. We show that a modest low-pass filter or smooth applied to the REAL raw waveforms (that have 5x higher range resolution) results in significant increases in raw signal-to-noise ratio and image signal-to-noise ratio--a measure of coherent aerosol feature content in the images resulting from the scans. Examples of wind fields and time series of wind estimates from both systems are presented. We conclude by reviewing the advantages and disadvantages of each system and sketch a plan for future research and development activities to optimize the design of future systems.

  11. Quality assurance guidance for field sampling and measurement assessment plates in support of EM environmental sampling and analysis activities

    SciTech Connect

    Not Available

    1994-05-01

    This document is one of several guidance documents developed by the US Department of Energy (DOE) Office of Environmental Restoration and Waste Management (EM). These documents support the EM Analytical Services Program (ASP) and are based on applicable regulatory requirements and DOE Orders. They address requirements in DOE Orders by providing guidance that pertains specifically to environmental restoration and waste management sampling and analysis activities. DOE 5700.6C Quality Assurance (QA) defines policy and requirements to establish QA programs ensuring that risks and environmental impacts are minimized and that safety, reliability, and performance are maximized. This is accomplished through the application of effective management systems commensurate with the risks imposed by the facility and the project. Every organization supporting EM`s environmental sampling and analysis activities must develop and document a QA program. Management of each organization is responsible for appropriate QA program implementation, assessment, and improvement. The collection of credible and cost-effective environmental data is critical to the long-term success of remedial and waste management actions performed at DOE facilities. Only well established and management supported assessment programs within each EM-support organization will enable DOE to demonstrate data quality. The purpose of this series of documents is to offer specific guidance for establishing an effective assessment program for EM`s environmental sampling and analysis (ESA) activities.

  12. Field Comparison of the Sampling Efficacy of Two Smear Media: Cotton Fiber and Kraft Paper

    SciTech Connect

    Hogue, M.G.

    2002-02-07

    Two materials were compared in field tests at the Defense Waste Processing Facility: kraft paper (a strong, brown paper made from wood pulp prepared with a sodium sulfate solution) and cotton fiber. Based on a sampling of forty-six pairs of smears, the cotton fiber smears provide a greater sensitivity. The cotton fiber smears collected an average of forty-four percent more beta activity than the kraft paper smears and twenty-nine percent more alpha activity. Results show a greater sensitivity with cotton fiber over kraft paper at the 95 percent confidence level. Regulatory requirements for smear materials are vague. The data demonstrate that the difference in sensitivity of smear materials could lead to a large difference in reported results that are subsequently used for meeting shipping regulations or evaluating workplace contamination levels.

  13. In-Field Diffuse Ultraviolet Spectroscopy and Imaging of the Stardust Sample Return Capsule

    NASA Technical Reports Server (NTRS)

    Pugel, D. Elizabeth; Stackpoole, Mairead; McNamara, Karen; Schwartz, C.; Warren, J.; Kontinos, Dean

    2008-01-01

    In-field diffuse Ultraviolet (UV) spectroscopy and imaging systems were developed for the purposes of evaluating the surface chemical composition of spacecraft thermal control coatings and materials. The investigation of these systems and the compilation of an associated UV reflectance and luminescence database were conducted using the Stardust Sample Return Capsule (SRC), located at the Johnson Space Center. Spectral responses of the surfaces of the Stardust forebody and aftbody in both reflectance and fluorescence modes were examined post-flight. In this paper, we report on two primary findings of in-field diffuse UV spectroscopy and imaging: (1) deduction of the thermal history of thermal control coatings of the forebody and (2) bond line variations in the aftbody. In the forebody, the thermal history of thermal control coatings may be deduced from the presence of particular semiconducting defect states associated with ZnO, a common emissivity constituent in thermal control coatings. A spatial dependence of this history was mapped for these regions. In the aftbody, luminescing defect states, associated with Si and SiO2 color centers were found along regions of bond variability.

  14. FIELD-DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-09-12

    Methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of aqueous spent fuel storage basins and determine the oxide thickness on the spent fuel basin materials were developed to assess the corrosion potential of a basin. this assessment can then be used to determine the amount of time fuel has spent in a storage basin to ascertain if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations and assist in evaluating general storage basin operations. The test kit was developed based on the identification of key physical, chemical and microbiological parameters identified using a review of the scientific and basin operations literature. The parameters were used to design bench scale test cells for additional corrosion analyses, and then tools were purchased to analyze the key parameters. The tools were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The sampling kit consisted of a total organic carbon analyzer, an YSI multiprobe, and a thickness probe. The tools were field tested to determine their ease of use, reliability, and determine the quality of data that each tool could provide. Characterization confirmed that the L Area basin is a well operated facility with low corrosion potential.

  15. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal field, California, was measured at 150, 200, and 250 C as a function of steam pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption and desorption runs were made in order to investigate the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were made on the same rock samples. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there was no direct correlation between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The hysteresis decreased significantly at 250 C. The results indicate that multilayer adsorption, rather than capillary condensation, is the dominant water storage mechanism at high temperatures.

  16. Determination of ephedrine and pseudoephedrine by field-amplified sample injection capillary electrophoresis.

    PubMed

    Deng, Dongli; Deng, Hao; Zhang, Lichun; Su, Yingying

    2014-04-01

    A simple and rapid capillary electrophoresis method was developed for the separation and determination of ephedrine (E) and pseudoephedrine (PE) in a buffer solution containing 80 mM of NaH2PO4 (pH 3.0), 15 mM of β-cyclodextrin and 0.3% of hydroxypropyl methylcellulose. The field-amplified sample injection (FASI) technique was applied to the online concentration of the alkaloids. With FASI in the presence of a low conductivity solvent plug (water), an approximately 1,000-fold improvement in sensitivity was achieved without any loss of separation efficiency when compared to conventional sample injection. Under these optimized conditions, a baseline separation of the two analytes was achieved within 16 min and the detection limits for E and PE were 0.7 and 0.6 µg/L, respectively. Without expensive instruments or labeling of the compounds, the limits of detection for E and PE obtained by the proposed method are comparable with (or even lower than) those obtained by capillary electrophoresis laser-induced fluorescence, liquid chromatography-tandem mass spectrometry and gas chromatography-mass spectrometry. The method was validated in terms of precision, linearity and accuracy, and successfully applied for the determination of the two alkaloids in Ephedra herbs.

  17. Acquisition of a High Resolution Field Emission Scanning Electron Microscope for the Analysis of Returned Samples

    NASA Technical Reports Server (NTRS)

    Nittler, Larry R.

    2003-01-01

    This grant furnished funds to purchase a state-of-the-art scanning electron microscope (SEM) to support our analytical facilities for extraterrestrial samples. After evaluating several instruments, we purchased a JEOL 6500F thermal field emission SEM with the following analytical accessories: EDAX energy-dispersive x-ray analysis system with fully automated control of instrument and sample stage; EDAX LEXS wavelength-dispersive x-ray spectrometer for high sensitivity light-element analysis; EDAX/TSL electron backscatter diffraction (EBSD) system with software for phase identification and crystal orientation mapping; Robinson backscatter electron detector; and an in situ micro-manipulator (Kleindiek). The total price was $550,000 (with $150,000 of the purchase supported by Carnegie institution matching funds). The microscope was delivered in October 2002, and most of the analytical accessories were installed by January 2003. With the exception of the wavelength spectrometer (which has been undergoing design changes) everything is working well and the SEM is in routine use in our laboratory.

  18. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling.

    PubMed

    Aerts, Sam; Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-01

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information-inside hotspots or in search of them-based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km2. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96.

  19. ELISA test for rabies antibody titration in orally vaccinated foxes sampled in the fields.

    PubMed

    Cliquet, F; Sagné, L; Schereffer, J L; Aubert, M F

    2000-08-01

    The assessment of the efficacy of rabies oral vaccination campaigns requires the titration of specific antibodies in the target species. Unfortunately, in Continental Europe, most fox serum samples are in fact "body fluids" taken from cadavers and the lack of a validated titration method for these poor quality sera made it impossible to survey and compare the efficacy of various oral vaccination protocols used by the different European teams. By using ready to use microplates sensitised with rabies virus glycoprotein purchased from a manufacturer and applying a simple and rapid ELISA technique on field fox sera, we obtained antibody quantitation highly correlated with seroneutralising antibody titres measured with a seroneutralisation test on cell culture. We obtained, with fox sera sampled in the same area, the same distribution of high, medium and low titres within all categories of serum quality (from high to very poor quality) and therefore conclude that this ELISA test allows a reliable titration even with highly contaminated body fluids. This test was shown to be equally capable of detecting rabies antibodies in serum samples taken from foxes vaccinated with an highly attenuated rabies virus (the SAG2 double mutant of the Street Alabama Dufferin strain) or with the VRG, the Vaccinia recombinant glycoprotein. Additionally, a strong correlation was demonstrated between titres given by this ELISA (or by the seroneutralisation test) and protection against challenge of foxes orally vaccinated with SAG2 vaccine baits. In view of this validation, this simple and reliable test is proposed for sero-surveying foxes following rabies oral vaccination campaigns.

  20. Moving your laboratories to the field – Advantages and limitations of the use of field portable instruments in environmental sample analysis

    SciTech Connect

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M.; Namieśnik, Jacek

    2015-07-15

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet–visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. - Highlights: • Field portable instruments are widely used in environmental sample analysis. • Field portable instruments are indispensable for analysis in emergency response. • Miniaturization of field portable instruments reduces resource consumption. • In situ analysis is in agreement with green analytical chemistry

  1. Development of sampling approaches for the determination of the presence of genetically modified organisms at the field level.

    PubMed

    Sustar-Vozlic, Jelka; Rostohar, Katja; Blejec, Andrej; Kozjak, Petra; Cergan, Zoran; Meglic, Vladimir

    2010-03-01

    In order to comply with the European Union regulatory threshold for the adventitious presence of genetically modified organisms (GMOs) in food and feed, it is important to trace GMOs from the field. Appropriate sampling methods are needed to accurately predict the presence of GMOs at the field level. A 2-year field experiment with two maize varieties differing in kernel colour was conducted in Slovenia. Based on the results of data mining analyses and modelling, it was concluded that spatial relations between the donor and receptor field were the most important factors influencing the distribution of outcrossing rate (OCR) in the field. The approach for estimation fitting function parameters in the receptor (non-GM) field at two distances from the donor (GM) field (10 and 25 m) for estimation of the OCR (GMO content) in the whole receptor field was developed. Different sampling schemes were tested; a systematic random scheme in rows was proposed to be applied for sampling at the two distances for the estimation of fitting function parameters for determination of OCR. The sampling approach had already been validated with some other OCR data and was practically applied in the 2009 harvest in Poland. The developed approach can be used for determination of the GMO presence at the field level and for making appropriate labelling decisions. The importance of this approach lies in its possibility to also address other threshold levels beside the currently prescribed labelling threshold of 0.9% for food and feed. PMID:20069281

  2. Development of sampling approaches for the determination of the presence of genetically modified organisms at the field level.

    PubMed

    Sustar-Vozlic, Jelka; Rostohar, Katja; Blejec, Andrej; Kozjak, Petra; Cergan, Zoran; Meglic, Vladimir

    2010-03-01

    In order to comply with the European Union regulatory threshold for the adventitious presence of genetically modified organisms (GMOs) in food and feed, it is important to trace GMOs from the field. Appropriate sampling methods are needed to accurately predict the presence of GMOs at the field level. A 2-year field experiment with two maize varieties differing in kernel colour was conducted in Slovenia. Based on the results of data mining analyses and modelling, it was concluded that spatial relations between the donor and receptor field were the most important factors influencing the distribution of outcrossing rate (OCR) in the field. The approach for estimation fitting function parameters in the receptor (non-GM) field at two distances from the donor (GM) field (10 and 25 m) for estimation of the OCR (GMO content) in the whole receptor field was developed. Different sampling schemes were tested; a systematic random scheme in rows was proposed to be applied for sampling at the two distances for the estimation of fitting function parameters for determination of OCR. The sampling approach had already been validated with some other OCR data and was practically applied in the 2009 harvest in Poland. The developed approach can be used for determination of the GMO presence at the field level and for making appropriate labelling decisions. The importance of this approach lies in its possibility to also address other threshold levels beside the currently prescribed labelling threshold of 0.9% for food and feed.

  3. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  4. Use of field-applied quality control samples to monitor performance of a Goulden large-sample extractor/GC-MS method for pesticides in water

    USGS Publications Warehouse

    Foreman, W.T.; Gates, Paul M.; Foster, G.D.; Rinella, F.A.; McKenzie, S.W.

    2000-01-01

    Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4'-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50-ng/L each. Recoveries ranged from not detected to greater than 100%. Variability in pesticide recoveries from triplicate 10-L water samples collected at one site averaged 5.7% relative standard deviation and did not exceed 19%.Since 1985, the Goulden large-sample extractor (GLSE) has been used to isolate a broad array of trace-organic contaminants from large volumes of water. In this study, field-applied quality control measures, including matrix and surrogate spikes and blanks, were used to monitor method performance from GLSE extraction through GC-MS analysis. The method was applied to the determination of multiple classes of pesticides isolated from 4- to 112-L filtered surface-water samples. Average recoveries of six surrogate compounds ranged from 84 ?? 18% for [2H10]diazinon to 15 ?? 13% for 4,4???-[2H8]DDT, the low recoveries for which were largely a result of unmonitored breakdown of this surrogate by the GC injection system. Field-matrix-spike samples were prepared by fortifying 10-L, 35-L, and 110-L filtered surface-water samples with 68 pesticides to amended concentrations of 11- to 50

  5. Characterisation of radiation field for irradiation of biological samples at nuclear reactor-comparison of twin detector and recombination methods.

    PubMed

    Golnik, N; Gryziński, M A; Kowalska, M; Meronka, K; Tulik, P

    2014-10-01

    Central Laboratory for Radiological Protection is involved in achieving scientific project on biological dosimetry. The project includes irradiation of blood samples in radiation fields of nuclear reactor. A simple facility for irradiation of biological samples has been prepared at horizontal channel of the nuclear reactor MARIA in NCBJ in Poland. The radiation field, composed mainly of gamma radiation and thermal neutrons, has been characterised in terms of tissue kerma using twin-detector technique and recombination chambers.

  6. Field Study of Filter Sampling Artifacts for Inorganic and Organic Aerosol Species

    NASA Astrophysics Data System (ADS)

    Maenhaut, W.; Wang, W.; Chi, X.

    2009-12-01

    It is well-known that the collection of carbonaceous aerosols on quartz fibre filters is prone to both positive and negative artifacts (e.g., Turpin et al., 2000). In studies on these artifacts, one normally concentrates on organic carbon (OC) as a whole or occasionally on water-soluble OC (WSOC). It is rare that studies are carried on individual organic species. Examples of the latter type of study are those by Limbeck et al. (2001; 2005), who used a low-volume tandem filter set-up at a rural background site in South Africa and at the urban site Vienna in Austria, and measured dicarboxylic acids (DCAs) on the front and back filters. We conducted a similar study as those of Limbeck et al. (2001; 2005). For our study we collected high-volume PM2.5 samples during summer field campaigns at three European forested sites, i.e., in Hungary, Belgium, and Finland. The front and back filters of our samples were analysed for OC with a thermal-optical transmission technique (Birch & Cary, 1996), for WSOC as described by Viana et al. (2006), and for water-soluble inorganic cationic and anionic species and organic anionic species by suppressed ion chromatography with conductometric detection. The organic species measured included methanesulphonic acid (MSA) and the four major DCAs, i.e., oxalic, malonic, succinic, and glutaric. The median back/front percentage ratios for ammonium and sulphate were low, below 5% and 1%, respectively, but for nitrate they were around 25-30%. That undenuded filter samplings for nitrate are prone to artifacts is well-documented (e.g., Schaap et al., 2004). For OC the median back/front percentage ratios were around 15% and for WSOC around 20%. For MSA and the four DCAs, they increased in the following order: oxalic (1.5%), succinic (3%), MSA (4%), malonic (2-9%), glutaric (7-26%). Our back/front ratios for three of the four DCAs are lower to much lower than these found by Limbeck et al. (2001; 2005); for malonic, however, we found higher back

  7. Spatially-Optimized Sequential Sampling Plan for Cabbage Aphids Brevicoryne brassicae L. (Hemiptera: Aphididae) in Canola Fields.

    PubMed

    Severtson, Dustin; Flower, Ken; Nansen, Christian

    2016-08-01

    The cabbage aphid is a significant pest worldwide in brassica crops, including canola. This pest has shown considerable ability to develop resistance to insecticides, so these should only be applied on a "when and where needed" basis. Thus, optimized sampling plans to accurately assess cabbage aphid densities are critically important to determine the potential need for pesticide applications. In this study, we developed a spatially optimized binomial sequential sampling plan for cabbage aphids in canola fields. Based on five sampled canola fields, sampling plans were developed using 0.1, 0.2, and 0.3 proportions of plants infested as action thresholds. Average sample numbers required to make a decision ranged from 10 to 25 plants. Decreasing acceptable error from 10 to 5% was not considered practically feasible, as it substantially increased the number of samples required to reach a decision. We determined the relationship between the proportions of canola plants infested and cabbage aphid densities per plant, and proposed a spatially optimized sequential sampling plan for cabbage aphids in canola fields, in which spatial features (i.e., edge effects) and optimization of sampling effort (i.e., sequential sampling) are combined. Two forms of stratification were performed to reduce spatial variability caused by edge effects and large field sizes. Spatially optimized sampling, starting at the edge of fields, reduced spatial variability and therefore increased the accuracy of infested plant density estimates. The proposed spatially optimized sampling plan may be used to spatially target insecticide applications, resulting in cost savings, insecticide resistance mitigation, conservation of natural enemies, and reduced environmental impact.

  8. Spatially-Optimized Sequential Sampling Plan for Cabbage Aphids Brevicoryne brassicae L. (Hemiptera: Aphididae) in Canola Fields.

    PubMed

    Severtson, Dustin; Flower, Ken; Nansen, Christian

    2016-08-01

    The cabbage aphid is a significant pest worldwide in brassica crops, including canola. This pest has shown considerable ability to develop resistance to insecticides, so these should only be applied on a "when and where needed" basis. Thus, optimized sampling plans to accurately assess cabbage aphid densities are critically important to determine the potential need for pesticide applications. In this study, we developed a spatially optimized binomial sequential sampling plan for cabbage aphids in canola fields. Based on five sampled canola fields, sampling plans were developed using 0.1, 0.2, and 0.3 proportions of plants infested as action thresholds. Average sample numbers required to make a decision ranged from 10 to 25 plants. Decreasing acceptable error from 10 to 5% was not considered practically feasible, as it substantially increased the number of samples required to reach a decision. We determined the relationship between the proportions of canola plants infested and cabbage aphid densities per plant, and proposed a spatially optimized sequential sampling plan for cabbage aphids in canola fields, in which spatial features (i.e., edge effects) and optimization of sampling effort (i.e., sequential sampling) are combined. Two forms of stratification were performed to reduce spatial variability caused by edge effects and large field sizes. Spatially optimized sampling, starting at the edge of fields, reduced spatial variability and therefore increased the accuracy of infested plant density estimates. The proposed spatially optimized sampling plan may be used to spatially target insecticide applications, resulting in cost savings, insecticide resistance mitigation, conservation of natural enemies, and reduced environmental impact. PMID:27371709

  9. High volume electrostatic field-sampler for collection of fine particle bulk samples

    NASA Astrophysics Data System (ADS)

    Kumar Sharma, Anoop; Wallin, Håkan; Alstrup Jensen, Keld

    A high volume electrostatic field-sampler was developed for collection of fine particles, which easily can be recovered for subsequent sample characterisation and bioassays. The sampler was based on a commercial office air cleaner and consisted of a prefilter followed by electrostatic collection plates operating at 2.7 kV. The sampler performance was characterised for 26 nm to 5.4 μm-size particles in urban street air. The collection efficiency reached a maximum (60-70%) between 0.2 and 0.8 μm and dropped to ˜25% at 30 nm and 2.5 μm, respectively. After extraction in water, the particle loss was<2%. The extraction efficiency for dry lyophilised particulate matter was above 80%, allowing retrievement of ˜12 mg day -1 in urban street air at PM 10 levels of ˜24 μg m -3. The ozone generating capacity of the corona discharge during operation was on the order of 10 ppb. A polycyclic aromatic hydrocarbons (PAH) degradation test using benzo[a]pyrene as a model showed that ˜85% was degraded after 24 h. However, similar results were observed when the corona discharge was switched off. Hence, the ozone and other corona discharge reactants do not appear to contribute considerably to PAH-degradation. The overall results show that the sampler type is a promising alternative to traditional sampling of fine particles for bulk analysis and bioassays. The main advantages are simple operation, high stability, high quantifiable particle recovery rates and low cost.

  10. Pre-Mission Input Requirements to Enable Successful Sample Collection by A Remote Field/EVA Team

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Lim, D. S. S.; Young, K. E.; Brunner, A.; Elphic, R. E.; Horne, A.; Kerrigan, M. C.; Osinski, G. R.; Skok, J. R.; Squyres, S. W.; Saint-Jacques, D.; Heldmann, J. L.

    2016-01-01

    The FINESSE (Field Investigations to Enable Solar System Science and Exploration) team, part of the Solar System Exploration Virtual Institute (SSERVI), is a field-based research program aimed at generating strategic knowledge in preparation for human and robotic exploration of the Moon, near-Earth asteroids, Phobos and Deimos, and beyond. In contract to other technology-driven NASA analog studies, The FINESSE WCIS activity is science-focused and, moreover, is sampling-focused with the explicit intent to return the best samples for geochronology studies in the laboratory. We used the FINESSE field excursion to the West Clearwater Lake Impact structure (WCIS) as an opportunity to test factors related to sampling decisions. We examined the in situ sample characterization and real-time decision-making process of the astronauts, with a guiding hypothesis that pre-mission training that included detailed background information on the analytical fate of a sample would better enable future astronauts to select samples that would best meet science requirements. We conducted three tests of this hypothesis over several days in the field. Our investigation was designed to document processes, tools and procedures for crew sampling of planetary targets. This was not meant to be a blind, controlled test of crew efficacy, but rather an effort to explicitly recognize the relevant variables that enter into sampling protocol and to be able to develop recommendations for crew and backroom training in future endeavors.

  11. Assessment of outdoor radiofrequency electromagnetic field exposure through hotspot localization using kriging-based sequential sampling

    SciTech Connect

    Aerts, Sam Deschrijver, Dirk; Verloock, Leen; Dhaene, Tom; Martens, Luc; Joseph, Wout

    2013-10-15

    In this study, a novel methodology is proposed to create heat maps that accurately pinpoint the outdoor locations with elevated exposure to radiofrequency electromagnetic fields (RF-EMF) in an extensive urban region (or, hotspots), and that would allow local authorities and epidemiologists to efficiently assess the locations and spectral composition of these hotspots, while at the same time developing a global picture of the exposure in the area. Moreover, no prior knowledge about the presence of radiofrequency radiation sources (e.g., base station parameters) is required. After building a surrogate model from the available data using kriging, the proposed method makes use of an iterative sampling strategy that selects new measurement locations at spots which are deemed to contain the most valuable information—inside hotspots or in search of them—based on the prediction uncertainty of the model. The method was tested and validated in an urban subarea of Ghent, Belgium with a size of approximately 1 km{sup 2}. In total, 600 input and 50 validation measurements were performed using a broadband probe. Five hotspots were discovered and assessed, with maximum total electric-field strengths ranging from 1.3 to 3.1 V/m, satisfying the reference levels issued by the International Commission on Non-Ionizing Radiation Protection for exposure of the general public to RF-EMF. Spectrum analyzer measurements in these hotspots revealed five radiofrequency signals with a relevant contribution to the exposure. The radiofrequency radiation emitted by 900 MHz Global System for Mobile Communications (GSM) base stations was always dominant, with contributions ranging from 45% to 100%. Finally, validation of the subsequent surrogate models shows high prediction accuracy, with the final model featuring an average relative error of less than 2 dB (factor 1.26 in electric-field strength), a correlation coefficient of 0.7, and a specificity of 0.96. -- Highlights: • We present an

  12. DEVELOPMENT OF METHODOLOGY AND FIELD DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-06-04

    This project developed methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of the fuel storage medium and determine the oxide thickness on the spent fuel basin materials. The overall objective of this project was to determine the amount of time fuel has spent in a storage basin to determine if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations. This project developed and validated forensic tools that can be used to predict the age and condition of spent nuclear fuels stored in liquid basins based on key physical, chemical and microbiological basin characteristics. Key parameters were identified based on a literature review, the parameters were used to design test cells for corrosion analyses, tools were purchased to analyze the key parameters, and these were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The key parameters identified in the literature review included chloride concentration, conductivity, and total organic carbon level. Focus was also placed on aluminum based cladding because of their application to weapons production. The literature review was helpful in identifying important parameters, but relationships between these parameters and corrosion rates were not available. Bench scale test systems were designed, operated, harvested, and analyzed to determine corrosion relationships between water parameters and water conditions, chemistry and microbiological conditions. The data from the bench scale system indicated that corrosion rates were dependent on total organic carbon levels and chloride concentrations. The highest corrosion rates were observed in test cells amended with sediment, a large microbial inoculum and an organic carbon source. A complete characterization test kit was field tested to characterize the SRS L-Area spent fuel basin. The sampling kit consisted of a TOC analyzer, a YSI

  13. Experiments with central-limit properties of spatial samples from locally covariant random fields

    USGS Publications Warehouse

    Barringer, T.H.; Smith, T.E.

    1992-01-01

    When spatial samples are statistically dependent, the classical estimator of sample-mean standard deviation is well known to be inconsistent. For locally dependent samples, however, consistent estimators of sample-mean standard deviation can be constructed. The present paper investigates the sampling properties of one such estimator, designated as the tau estimator of sample-mean standard deviation. In particular, the asymptotic normality properties of standardized sample means based on tau estimators are studied in terms of computer experiments with simulated sample-mean distributions. The effects of both sample size and dependency levels among samples are examined for various value of tau (denoting the size of the spatial kernel for the estimator). The results suggest that even for small degrees of spatial dependency, the tau estimator exhibits significantly stronger normality properties than does the classical estimator of standardized sample means. ?? 1992.

  14. Ca II Triplet Spectroscopy of Small Magellanic Cloud Red Giants. IV. Abundances for a Large Sample of Field Stars and Comparison with the Cluster Sample

    NASA Astrophysics Data System (ADS)

    Parisi, M. C.; Geisler, D.; Carraro, G.; Clariá, J. J.; Villanova, S.; Gramajo, L. V.; Sarajedini, A.; Grocholski, A. J.

    2016-09-01

    This paper represents a major step forward in the systematic and homogeneous study of Small Magellanic Cloud (SMC) star clusters and field stars carried out by applying the calcium triplet technique. We present in this work the radial velocity and metallicity of approximately 400 red giant stars in 15 SMC fields, with typical errors of about 7 km s-1 and 0.16 dex, respectively. We added to this information our previously determined metallicity values for 29 clusters and approximately 350 field stars using the identical techniques. Using this enlarged sample, we analyze the metallicity distribution and gradient in this galaxy. We also compare the chemical properties of the clusters and of their surrounding fields. We find a number of surprising results. While the clusters, taken as a whole, show no strong evidence for a metallicity gradient (MG), the field stars exhibit a clear negative gradient in the inner region of the SMC, consistent with the recent results of Dobbie et al. For distances to the center of the galaxy less than 4°, field stars show a considerably smaller metallicity dispersion than that of the clusters. However, in the external SMC regions, clusters and field stars exhibit similar metallicity dispersions. Moreover, in the inner region of the SMC, clusters appear to be concentrated in two groups: one more metal-poor and another more metal-rich than field stars. Individually considered, neither cluster group presents an MG. Most surprisingly, the MG for both stellar populations (clusters and field stars) appears to reverse sign in the outer regions of the SMC. The difference between the cluster metallicity and the mean metallicity of the surrounding field stars turns out to be a strong function of the cluster metallicity. These results could be indicating different chemical evolution histories for these two SMC stellar populations. They could also indicate variations in the chemical behavior of the SMC in its internal and external regions.

  15. Ca II Triplet Spectroscopy of Small Magellanic Cloud Red Giants. IV. Abundances for a Large Sample of Field Stars and Comparison with the Cluster Sample

    NASA Astrophysics Data System (ADS)

    Parisi, M. C.; Geisler, D.; Carraro, G.; Clariá, J. J.; Villanova, S.; Gramajo, L. V.; Sarajedini, A.; Grocholski, A. J.

    2016-09-01

    This paper represents a major step forward in the systematic and homogeneous study of Small Magellanic Cloud (SMC) star clusters and field stars carried out by applying the calcium triplet technique. We present in this work the radial velocity and metallicity of approximately 400 red giant stars in 15 SMC fields, with typical errors of about 7 km s‑1 and 0.16 dex, respectively. We added to this information our previously determined metallicity values for 29 clusters and approximately 350 field stars using the identical techniques. Using this enlarged sample, we analyze the metallicity distribution and gradient in this galaxy. We also compare the chemical properties of the clusters and of their surrounding fields. We find a number of surprising results. While the clusters, taken as a whole, show no strong evidence for a metallicity gradient (MG), the field stars exhibit a clear negative gradient in the inner region of the SMC, consistent with the recent results of Dobbie et al. For distances to the center of the galaxy less than 4°, field stars show a considerably smaller metallicity dispersion than that of the clusters. However, in the external SMC regions, clusters and field stars exhibit similar metallicity dispersions. Moreover, in the inner region of the SMC, clusters appear to be concentrated in two groups: one more metal-poor and another more metal-rich than field stars. Individually considered, neither cluster group presents an MG. Most surprisingly, the MG for both stellar populations (clusters and field stars) appears to reverse sign in the outer regions of the SMC. The difference between the cluster metallicity and the mean metallicity of the surrounding field stars turns out to be a strong function of the cluster metallicity. These results could be indicating different chemical evolution histories for these two SMC stellar populations. They could also indicate variations in the chemical behavior of the SMC in its internal and external regions.

  16. The actual goals of geoethics

    NASA Astrophysics Data System (ADS)

    Nemec, Vaclav

    2014-05-01

    The most actual goals of geoethics have been formulated as results of the International Conference on Geoethics (October 2013) held at the geoethics birth-place Pribram (Czech Republic): In the sphere of education and public enlightenment an appropriate needed minimum know how of Earth sciences should be intensively promoted together with cultivating ethical way of thinking and acting for the sustainable well-being of the society. The actual activities of the Intergovernmental Panel of Climate Changes are not sustainable with the existing knowledge of the Earth sciences (as presented in the results of the 33rd and 34th International Geological Congresses). This knowledge should be incorporated into any further work of the IPCC. In the sphere of legislation in a large international co-operation following steps are needed: - to re-formulate the term of a "false alarm" and its legal consequences, - to demand very consequently the needed evaluation of existing risks, - to solve problems of rights of individuals and minorities in cases of the optimum use of mineral resources and of the optimum protection of the local population against emergency dangers and disasters; common good (well-being) must be considered as the priority when solving ethical dilemmas. The precaution principle should be applied in any decision making process. Earth scientists presenting their expert opinions are not exempted from civil, administrative or even criminal liabilities. Details must be established by national law and jurisprudence. The well known case of the L'Aquila earthquake (2009) should serve as a serious warning because of the proven misuse of geoethics for protecting top Italian seismologists responsible and sentenced for their inadequate superficial behaviour causing lot of human victims. Another recent scandal with the Himalayan fossil fraud will be also documented. A support is needed for any effort to analyze and to disclose the problems of the deformation of the contemporary

  17. Microcystin-Bound Protein Patterns in Different Cultures of Microcystis aeruginosa and Field Samples

    PubMed Central

    Wei, Nian; Hu, Lili; Song, Lirong; Gan, Nanqin

    2016-01-01

    Micocystin (MC) exists in Microcystis cells in two different forms, free and protein-bound. We examined the dynamic change in extracellular free MCs, intracellular free MCs and protein-bound MCs in both batch cultures and semi-continuous cultures, using high performance liquid chromatography and Western blot. The results showed that the free MC per cell remained constant, while the quantity of protein-bound MCs increased with the growth of Microcystis cells in both kinds of culture. Significant changes in the dominant MC-bound proteins occurred in the late exponential growth phase of batch cultures, while the dominant MC-bound proteins in semi-continuous cultures remained the same. In field samples collected at different months in Lake Taihu, the dominant MC-bound proteins were shown to be similar, but the amount of protein-bound MC varied and correlated with the intracellular MC content. We identified MC-bound proteins by two-dimensional electrophoresis immunoblots and mass spectrometry. The 60 kDa chaperonin GroEL was a prominent MC-bound protein. Three essential glycolytic enzymes and ATP synthase alpha subunit were also major targets of MC-binding, which might contribute to sustained growth in semi-continuous culture. Our results indicate that protein-bound MC may be important for sustaining growth and adaptation of Microcystis sp. PMID:27754336

  18. Microwave emission from smooth bare fields and soil moisture sampling depth

    NASA Technical Reports Server (NTRS)

    Wang, James R.

    1987-01-01

    This paper studies the depth to which soil moisture can be directly estimated with microwave measurements over smooth bare fields. The analyses are based on both theoretical and experimental considerations at the frequencies of 1.4, 5.0, and 10.7 GHz. Radiative transfer calculations of microwave emissivities at these frequencies are performed with a number of moisture profiles measured for two soils. The calculated emissivities are compared with those derived from the Fresnel equation to deduce the microwave sampling depth in soils. The data acquired from the ground-level radiometric measurements during the summers of 1979-1981 are examined and compared with the theoretical analysis. Both theoretical and experimental analyses lead to the conclusion that the microwave samplinhg depth in soils is about one tenth of the wavelength of observation. It is shown that the moisture content at any depth near the surface of a smooth soil can be estimated, in principle, by a combination of a radiometric measurement and a curve generated by the Fresnel equation at an appropriate frequency, provided that the texture of the soil is known.

  19. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    PubMed

    Armas-Pérez, Julio C; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P; de Pablo, Juan J

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  20. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    SciTech Connect

    Armas-Perez, Julio C.; Londono-Hurtado, Alejandro; Guzman, Orlando; Hernandez-Ortiz, Juan P.; de Pablo, Juan J.

    2015-07-27

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  1. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields

    SciTech Connect

    Armas-Pérez, Julio C.; Londono-Hurtado, Alejandro; Guzmán, Orlando; Hernández-Ortiz, Juan P.; Pablo, Juan J. de

    2015-07-28

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  2. Field guide for collecting and processing stream-water samples for the National Water-Quality Assessment Program

    USGS Publications Warehouse

    Shelton, Larry R.

    1994-01-01

    The U.S. Geological Survey's National Water-Quality Assessment program includes extensive data- collection efforts to assess the quality of the Nations's streams. These studies require analyses of stream samples for major ions, nutrients, sediments, and organic contaminants. For the information to be comparable among studies in different parts of the Nation, consistent procedures specifically designed to produce uncontaminated samples for trace analysis in the laboratory are critical. This field guide describes the standard procedures for collecting and processing samples for major ions, nutrients, organic contaminants, sediment, and field analyses of conductivity, pH, alkalinity, and dissolved oxygen. Samples are collected and processed using modified and newly designed equipment made of Teflon to avoid contamination, including nonmetallic samplers (D-77 and DH-81) and a Teflon sample splitter. Field solid-phase extraction procedures developed to process samples for organic constituent analyses produce an extracted sample with stabilized compounds for more accurate results. Improvements to standard operational procedures include the use of processing chambers and capsule filtering systems. A modified collecting and processing procedure for organic carbon is designed to avoid contamination from equipment cleaned with methanol. Quality assurance is maintained by strict collecting and processing procedures, replicate sampling, equipment blank samples, and a rigid cleaning procedure using detergent, hydrochloric acid, and methanol.

  3. Moving your laboratories to the field--Advantages and limitations of the use of field portable instruments in environmental sample analysis.

    PubMed

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M; Namieśnik, Jacek

    2015-07-01

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet-visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities.

  4. Moving your laboratories to the field--Advantages and limitations of the use of field portable instruments in environmental sample analysis.

    PubMed

    Gałuszka, Agnieszka; Migaszewski, Zdzisław M; Namieśnik, Jacek

    2015-07-01

    The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector), ultraviolet-visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. PMID:26051907

  5. Laboratory development and field evaluation of a generic method for sampling and analysis of isocyanates. Revised final report

    SciTech Connect

    McGaughey, J.F.; Foster, S.C.; Merrill, R.G.

    1995-09-01

    The U.S. Environmental Protection Agency (EPA), under the authority of Title III of the Clean Air Act Amendments (CAAA) of 1990, requires the identification and validation of sampling and analytical methods for the isocyanate compounds which are listed among the 189 hazardous air pollutants identified in Title III. In all, three field tests were performed to accomplish the isocyanate field evaluation. The objective of this work was to develop and evaluate the isocyanate sampling and analytical test method through field testing at operating stationary sources. The method was evaluated by collecting flue gas samples for the analysis of the individual isocyanate and evaluating the data for bias and precision. EPA Method 301, Field Validation of Pollutant Measurement Methods from Various Waste Media, was used as the model for the experimental design of this method evaluation project.

  6. Field geologic observation and sample collection strategies for planetary surface exploration: Insights from the 2010 Desert RATS geologist crewmembers

    NASA Astrophysics Data System (ADS)

    Hurtado, José M.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W.

    2013-10-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic fieldwork, the Desert RATS (Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crewmembers who participated in the 2010 field test. We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies related to duplication of samples and observations; logistical constraints on the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to "flexibly execute" their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  7. Field Geologic Observation and Sample Collection Strategies for Planetary Surface Exploration: Insights from the 2010 Desert RATS Geologist Crewmembers

    NASA Technical Reports Server (NTRS)

    Hurtado, Jose M., Jr.; Young, Kelsey; Bleacher, Jacob E.; Garry, W. Brent; Rice, James W., Jr.

    2012-01-01

    Observation is the primary role of all field geologists, and geologic observations put into an evolving conceptual context will be the most important data stream that will be relayed to Earth during a planetary exploration mission. Sample collection is also an important planetary field activity, and its success is closely tied to the quality of contextual observations. To test protocols for doing effective planetary geologic field- work, the Desert RATS(Research and Technology Studies) project deployed two prototype rovers for two weeks of simulated exploratory traverses in the San Francisco volcanic field of northern Arizona. The authors of this paper represent the geologist crew members who participated in the 2010 field test.We document the procedures adopted for Desert RATS 2010 and report on our experiences regarding these protocols. Careful consideration must be made of various issues that impact the interplay between field geologic observations and sample collection, including time management; strategies relatedtoduplicationofsamplesandobservations;logisticalconstraintson the volume and mass of samples and the volume/transfer of data collected; and paradigms for evaluation of mission success. We find that the 2010 field protocols brought to light important aspects of each of these issues, and we recommend best practices and modifications to training and operational protocols to address them. Underlying our recommendations is the recognition that the capacity of the crew to flexibly execute their activities is paramount. Careful design of mission parameters, especially field geologic protocols, is critical for enabling the crews to successfully meet their science objectives.

  8. THE IMPORTANCE OF THE MAGNETIC FIELD FROM AN SMA-CSO-COMBINED SAMPLE OF STAR-FORMING REGIONS

    SciTech Connect

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Chen, Huei-Ru Vivien; Liu, Hau-Yu Baobab; Yen, Hsi-Wei; Lai, Shih-Ping; Zhang, Qizhou; Chen, How-Huan; Ching, Tao-Chung; Girart, Josep M.; Frau, Pau; Li, Hua-Bai; Li, Zhi-Yun; Padovani, Marco; Qiu, Keping; Rao, Ramprasad

    2014-12-20

    Submillimeter dust polarization measurements of a sample of 50 star-forming regions, observed with the Submillimeter Array (SMA) and the Caltech Submillimeter Observatory (CSO) covering parsec-scale clouds to milliparsec-scale cores, are analyzed in order to quantify the magnetic field importance. The magnetic field misalignment δ—the local angle between magnetic field and dust emission gradient—is found to be a prime observable, revealing distinct distributions for sources where the magnetic field is preferentially aligned with or perpendicular to the source minor axis. Source-averaged misalignment angles (|δ|) fall into systematically different ranges, reflecting the different source-magnetic field configurations. Possible bimodal (|δ|) distributions are found for the separate SMA and CSO samples. Combining both samples broadens the distribution with a wide maximum peak at small (|δ|) values. Assuming the 50 sources to be representative, the prevailing source-magnetic field configuration is one that statistically prefers small magnetic field misalignments |δ|. When interpreting |δ| together with a magnetohydrodynamics force equation, as developed in the framework of the polarization-intensity gradient method, a sample-based log-linear scaling fits the magnetic field tension-to-gravity force ratio (Σ {sub B}) versus (|δ|) with (Σ {sub B}) = 0.116 · exp (0.047 · (|δ|)) ± 0.20 (mean error), providing a way to estimate the relative importance of the magnetic field, only based on measurable field misalignments |δ|. The force ratio Σ {sub B} discriminates systems that are collapsible on average ((Σ {sub B}) < 1) from other molecular clouds where the magnetic field still provides enough resistance against gravitational collapse ((Σ {sub B}) > 1). The sample-wide trend shows a transition around (|δ|) ≈ 45°. Defining an effective gravitational force ∼1 – (Σ {sub B}), the average magnetic-field-reduced star formation efficiency is at least a

  9. Integrating field sampling, spatial statistics and remote sensing to map wetland vegetation in the Pantanal, Brazil

    NASA Astrophysics Data System (ADS)

    Arieira, J.; Karssenberg, D.; de Jong, S. M.; Addink, E. A.; Couto, E. G.; Nunes da Cunha, C.; Skøien, J. O.

    2010-09-01

    To improve the protection of wetlands, it is imperative to have a thorough understanding of their structuring elements and of the identification of efficient methods to describe and monitor them. This article uses sophisticated statistical classification, interpolation and error propagation techniques, in order to describe vegetation spatial patterns, map plant community distribution and evaluate the capability of statistical approaches to produce high-quality vegetation maps. The approach results in seven vegetation communities with a known floral composition that can be mapped over large areas using remotely sensed data. The relations between remotely sensing data and vegetation patterns, captured in four factorial axes, were formalized mathematically in multiple linear regression models and used in a universal kriging procedure to reduce the uncertainty in mapped communities. Universal kriging has shown to be a valuable interpolation technique because parts of vegetation variability not explained by the images could be modeled as spatially correlated residuals, increasing prediction accuracy. Differences in spatial dependence of the vegetation gradients evidenced the multi-scale nature of vegetation communities. Cross validation procedures and Monte Carlo simulations were used to quantify the uncertainty in the resulting map. Cross-validation showed that accuracy in classification varies according with the community type, as a result of sampling density and configuration. A map of uncertainty resulted from Monte Carlo simulations displayed the spatial variation in classification accuracy, showing that the quality of classification varies spatially, even though the proportion and arrangement of communities observed in the original map is preserved to a great extent. These results suggested that mapping improvement could be achieved by increasing the number of field observations of those communities with a scattered and small patch size distribution; or by

  10. Sampling and Analysis of Impact Crater Residues found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R. P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years on orbit, the Wide Field Planetary Camera-2 (WFPC-2) was recovered from the Hubble Space Telescope in May 2009 during the 12 day shuttle mission designated STS-125. During that exposure to the low Earth orbit environment, the WFPC-2 radiator was struck by approximately 700 impactors producing crater features 300 micrometers and larger in size. Following an optical inspection of these features in 2009, an agreement was reached for the joint NASA-ESA examination and characterization of crater residues, the remnants of the projectile, in 2011. Active examination began in 2012, with 486 of the impact features being cored at NASA Johnson Space Center fs (JSC) Space Exposed Hardware cleanroom and curation facility. The core samples were subsequently divided between NASA and ESA. NASA's analysis was conducted at JSC fs Astromaterials Research and Exploration Science (ARES) Division, using scanning electron microscopy (SEM)/ energy dispersive X-ray spectrometry (EDS) methods, and ESA's analysis was conducted at the Natural History Museum (NHM) again using SEM/EDS, and at the University of Surrey Ion Beam Centre (IBC) using ion beam analysis (IBA) with a scanned proton microbeam. As detailed discussion of the joint findings remains premature at this point, this paper reports on the coring technique developed; the practical taxonomy developed to classify residues as belonging either to anthropogenic "orbital debris" or micrometeoroids; and the protocols for examination of crater residues. Challenges addressed in coring were the relative thickness of the surface to be cut, protection of the impact feature from contamination while coring, and the need to preserve the cleanroom environment so as to preclude or minimize cross-contamination. Classification criteria are summarized, including the assessment of surface contamination and surface cleaning. Finally, we discuss the analytical techniques used to examine the crater residues. We employed EDS from

  11. Optimized Field Sampling and Monitoring of Airborne Hazardous Transport Plumes; A Geostatistical Simulation Approach

    SciTech Connect

    Chen, DI-WEN

    2001-11-21

    Airborne hazardous plumes inadvertently released during nuclear/chemical/biological incidents are mostly of unknown composition and concentration until measurements are taken of post-accident ground concentrations from plume-ground deposition of constituents. Unfortunately, measurements often are days post-incident and rely on hazardous manned air-vehicle measurements. Before this happens, computational plume migration models are the only source of information on the plume characteristics, constituents, concentrations, directions of travel, ground deposition, etc. A mobile ''lighter than air'' (LTA) system is being developed at Oak Ridge National Laboratory that will be part of the first response in emergency conditions. These interactive and remote unmanned air vehicles will carry light-weight detectors and weather instrumentation to measure the conditions during and after plume release. This requires a cooperative computationally organized, GPS-controlled set of LTA's that self-coordinate around the objectives in an emergency situation in restricted time frames. A critical step before an optimum and cost-effective field sampling and monitoring program proceeds is the collection of data that provides statistically significant information, collected in a reliable and expeditious manner. Efficient aerial arrangements of the detectors taking the data (for active airborne release conditions) are necessary for plume identification, computational 3-dimensional reconstruction, and source distribution functions. This report describes the application of stochastic or geostatistical simulations to delineate the plume for guiding subsequent sampling and monitoring designs. A case study is presented of building digital plume images, based on existing ''hard'' experimental data and ''soft'' preliminary transport modeling results of Prairie Grass Trials Site. Markov Bayes Simulation, a coupled Bayesian/geostatistical methodology, quantitatively combines soft information

  12. 2003 Mars Exploration Rover Mission: Robotic Field Geologists for a Mars Sample Return Mission

    NASA Technical Reports Server (NTRS)

    Ming, Douglas W.

    2008-01-01

    The Mars Exploration Rover (MER) Spirit landed in Gusev crater on Jan. 4, 2004 and the rover Opportunity arrived on the plains of Meridiani Planum on Jan. 25, 2004. The rovers continue to return new discoveries after 4 continuous Earth years of operations on the surface of the red planet. Spirit has successfully traversed 7.5 km over the Gusev crater plains, ascended to the top of Husband Hill, and entered into the Inner Basin of the Columbia Hills. Opportunity has traveled nearly 12 km over flat plains of Meridiani and descended into several impact craters. Spirit and Opportunity carry an integrated suite of scientific instruments and tools called the Athena science payload. The Athena science payload consists of the 1) Panoramic Camera (Pancam) that provides high-resolution, color stereo imaging, 2) Miniature Thermal Emission Spectrometer (Mini-TES) that provides spectral cubes at mid-infrared wavelengths, 3) Microscopic Imager (MI) for close-up imaging, 4) Alpha Particle X-Ray Spectrometer (APXS) for elemental chemistry, 5) Moessbauer Spectrometer (MB) for the mineralogy of Fe-bearing materials, 6) Rock Abrasion Tool (RAT) for removing dusty and weathered surfaces and exposing fresh rock underneath, and 7) Magnetic Properties Experiment that allow the instruments to study the composition of magnetic martian materials [1]. The primary objective of the Athena science investigation is to explore two sites on the martian surface where water may once have been present, and to assess past environmental conditions at those sites and their suitability for life. The Athena science instruments have made numerous scientific discoveries over the 4 plus years of operations. The objectives of this paper are to 1) describe the major scientific discoveries of the MER robotic field geologists and 2) briefly summarize what major outstanding questions were not answered by MER that might be addressed by returning samples to our laboratories on Earth.

  13. Computational ligand-based rational design: Role of conformational sampling and force fields in model development

    PubMed Central

    Shim, Jihyun; MacKerell, Alexander D.

    2011-01-01

    A significant number of drug discovery efforts are based on natural products or high throughput screens from which compounds showing potential therapeutic effects are identified without knowledge of the target molecule or its 3D structure. In such cases computational ligand-based drug design (LBDD) can accelerate the drug discovery processes. LBDD is a general approach to elucidate the relationship of a compound's structure and physicochemical attributes to its biological activity. The resulting structure-activity relationship (SAR) may then act as the basis for the prediction of compounds with improved biological attributes. LBDD methods range from pharmacophore models identifying essential features of ligands responsible for their activity, quantitative structure-activity relationships (QSAR) yielding quantitative estimates of activities based on physiochemical properties, and to similarity searching, which explores compounds with similar properties as well as various combinations of the above. A number of recent LBDD approaches involve the use of multiple conformations of the ligands being studied. One of the basic components to generate multiple conformations in LBDD is molecular mechanics (MM), which apply an empirical energy function to relate conformation to energies and forces. The collection of conformations for ligands is then combined with functional data using methods ranging from regression analysis to neural networks, from which the SAR is determined. Accordingly, for effective application of LBDD for SAR determinations it is important that the compounds be accurately modelled such that the appropriate range of conformations accessible to the ligands is identified. Such accurate modelling is largely based on use of the appropriate empirical force field for the molecules being investigated and the approaches used to generate the conformations. The present chapter includes a brief overview of currently used SAR methods in LBDD followed by a more

  14. A Field Comparison of Sampling Protocols for Measuring Lead in Drinking Water

    EPA Science Inventory

    US EPA Region 5 conducted a sampling study that demonstrates existing sampling protocols used for the Lead and Copper Rule (LCR) underestimate peak and probable mass of lead released in a system with lead service lines (LSLs). This comparative stagnation sampling was conducted i...

  15. Stressing biological samples with pulsed magnetic fields: physical aspects and experimental results

    NASA Astrophysics Data System (ADS)

    Delle Side, D.; Specchia, V.; D'Attis, S.; Giuffreda, E.; Quarta, G.; Calcagnile, L.; Bozzetti, M. P.; Nassisi, V.

    2016-05-01

    Magnetic field effects are diffused among living organisms. They are mainly studied with static or extremely low frequency fields, while scarce information is available for pulsed fields. This work is devoted to the study of the interaction between Drosophila melanogaster, both adults and larvae, and pulsed magnetic fields. We exposed the organisms to a peak field of 0.4 T, lasting for about 2 μ s, within an ad hoc designed copper coil. Adult individuals didn't present any deregulation of repetitive sequences in the germ line of Drosophila. Instead, we noticed a marked magnetic field effect in larvae. Polytene chromosomes coming from treated individuals showed the presence of heat shock puffs; the same organisms revealed also an upregulation of the genes encoding for the Hsp70 protein. These observations suggest that the larvae underwent an oxidative stress caused by the modulation of free radicals' yield induced by the magnetic field through a radical pair mechanism.

  16. DEVELOPMENT AND FIELD IMPLEMENTATION OF AN IMPROVED METHOD FOR HEADSPACE GAS SAMPLING OF TRANSURANIC WASTE DRUMS

    SciTech Connect

    Polley, M.; Ankrom, J.; Wickland, T.; Warren, J.

    2003-02-27

    A fast, safe, and cost-effective method for obtaining headspace gas samples has been developed and implemented at Los Alamos National Laboratory (LANL). A sample port is installed directly into a drum lid using a pneumatic driver, allowing sampling with a side-port needle. Testing has shown that the sample port can be installed with no release of radioactive material. Use of this system at LANL has significantly reduced the time required for sampling, and eliminates the need for many safety precautions previously used. The system has significantly improved productivity and lowered radiation exposure and cost.

  17. Linguistic Theory and Actual Language.

    ERIC Educational Resources Information Center

    Segerdahl, Par

    1995-01-01

    Examines Noam Chomsky's (1957) discussion of "grammaticalness" and the role of linguistics in the "correct" way of speaking and writing. It is argued that the concern of linguistics with the tools of grammar has resulted in confusion, with the tools becoming mixed up with the actual language, thereby becoming the central element in a metaphysical…

  18. El Observatorio Gemini - Status actual

    NASA Astrophysics Data System (ADS)

    Levato, H.

    Se hace una breve descripción de la situación actual del Observatorio Gemini y de las últimas decisiones del Board para incrementar la eficiencia operativa. Se hace también una breve referencia al uso argentino del observatorio.

  19. Underground storage tanks 200W-FS-34 and 200W-FS-35 excavated soil field sample plan

    SciTech Connect

    Lucas, J.G.

    1994-09-07

    This plan outlines the process that will be used to collect samples from soil excavated during removal of underground storage tanks 200W-FS-34 and 200W-FS-35. The samples will be analyzed to determine if gasoline and diesel fuel are present in the soil at levels above action levels specified by the Washington State Department of Ecology. On April 15, 1992, the underground storage tanks were removed and soil samples were collected at each former tank location and from around the associated piping. Soil was excavated from the site until field instrumentation indicated that the former tank sites were clean in the judgment of the field team leader. Field monitoring consisted of using an organic vapor monitor to survey soil shaken in a plastic bag. Monitoring indicated that petroleum contamination ranged from 40 to 800 ppm.

  20. Adsorptive Films in Support of In-field UF6 Destructive Assay Sample Collection and Analysis

    SciTech Connect

    Barrett, Christopher A.; Martinez, Alonzo; McNamara, Bruce K.; Cannon, Bret D.; Anheier, Norman C.

    2014-07-20

    International Atom Energy Agency (IAEA) safeguard verification measures in gaseous centrifuge enrichment plants (GCEPs) rely on environmental sampling, non-destructive assay (NDA), and destructive assay (DA) sampling and analysis to determine uranium enrichment. UF6 bias defect measurements are made by DA sampling and analysis to assure that enrichment is consistent with declarations. DA samples are collected from a limited number of cylinders for high precision, offsite mass spectrometer analysis. Samples are typically drawn from a sampling tap into a UF6 sample bottle, then packaged, sealed, and shipped under IAEA chain of custody to an offsite analytical laboratory. Future DA safeguard measures may require improvements in efficiency and effectiveness as GCEP capacities increase and UF6 shipping regulations become increasingly more restrictive. The Pacific Northwest National Laboratory (PNNL) DA sampler concept and Laser Ablation Absorption Ratio Spectrometry (LAARS) assay method are under development to potentially provide DA safeguard tools that increase inspection effectiveness and reduce sample shipping constraints. The PNNL DA sampler concept uses a handheld sampler to collect DA samples for either onsite LAARS assay or offsite laboratory analysis. The DA sampler design will use a small sampling planchet that is coated with an adsorptive film to collect controlled quantities of UF6 gas directly from a cylinder or process sampling tap. Development efforts are currently underway at PNNL to enhance LAARS assay performance to allow high-precision onsite bias defect measurements. In this paper, we report on the experimental investigation to develop adsorptive films for the PNNL DA sampler concept. These films are intended to efficiently capture UF6 and then stabilize the collected DA sample prior to onsite LAARS or offsite laboratory analysis. Several porous material composite films were investigated, including a film designed to maximize the chemical adsorption

  1. Field and laboratory evaluation of a wood-stove dilution-sampling system. June 1986-June 1987

    SciTech Connect

    Merrill, R.G.; Harris, D.B.

    1987-07-01

    This paper discusses field and laboratory evaluation of a wood-stove dilution sampling system. Two sampling methods were developed and used by EPA to test emissions from wood stoves: both remove flue gas directly from the appliance chimney. The two methods were developed to meet two goals of EPA-sponsored research and development: (1) the wood stove dilution-sampling system (WSDSS) addresses the need to simulate or model the atmosphere/stack interface and to provide emissions samples as they are distributed between vapor-phase and particle-bound material; and (2) the modified method 5 (MM5) system addresses the need to perform direct-source sampling without dilution or condensation. Comparison of the WSDSS and MM5 sampling systems in laboratory tests is presented.

  2. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  3. Integral field spectroscopy of a sample of nearby galaxies. II. Properties of the H ii regions

    NASA Astrophysics Data System (ADS)

    Sánchez, S. F.; Rosales-Ortega, F. F.; Marino, R. A.; Iglesias-Páramo, J.; Vílchez, J. M.; Kennicutt, R. C.; Díaz, A. I.; Mast, D.; Monreal-Ibero, A.; García-Benito, R.; Bland-Hawthorn, J.; Pérez, E.; González Delgado, R.; Husemann, B.; López-Sánchez, Á. R.; Cid Fernandes, R.; Kehrig, C.; Walcher, C. J.; Gil de Paz, A.; Ellis, S.

    2012-10-01

    We analyse the spectroscopic properties of thousands of H ii regions identified in 38 face-on spiral galaxies. All galaxies were observed out to 2.4 effective radii using integral field spectroscopy (IFS) over the wavelength range ~3700 to ~6900 Å. The near uniform sample has been assembled from the PPAK IFS Nearby Galaxy (PINGS) survey and a sample described in Paper I. We develop a new automatic procedure to detect H ii regions, based on the contrast of the Hα intensity maps extracted from the datacubes. Once detected, the algorithm provides us with the integrated spectra of each individual segmented region. In total, we derive good quality spectroscopic information for ~2600 independent H ii regions/complexes. This is by far the largest H ii region survey of its kind. Our selection criteria and the use of 3D spectroscopy guarantee that we cover the regions in an unbiased way. A well-tested automatic decoupling procedure has been applied to remove the underlying stellar population, deriving the main properties (intensity, dispersion and velocity) of the strongest emission lines in the considered wavelength range (covering from [O ii] λ3727 to [S ii] λ6731). A final catalogue of the spectroscopic properties of H ii regions has been created for each galaxy, which includes information on morphology, spiral structure, gaskinematics, and surface brightness of the underlying stellar population. In the current study, we focus on the understanding of the average properties of the H ii regions and their radial distributions. We find a significant change in the ionisation characteristics of H ii regions within r < 0.25 re due to contamination from sources with different ionising characteristics, as we discuss. We find that the gas-phase oxygen abundance and the Hα equivalent width present a negative and positive gradient, respectively. The distribution of slopes is statistically compatible with a random Gaussian distribution around the mean value, if the radial

  4. High-frequency isotopic analysis of liquid water samples in the field - initial results from continuous water sampling and cavity ring-down spectroscopy

    NASA Astrophysics Data System (ADS)

    von Freyberg, Jana; Studer, Bjørn; Kirchner, James

    2016-04-01

    Studying rapidly changing hydrochemical signals in catchments can help to improve our mechanistic understanding of their water flow pathways and travel times. For these purposes, stable water isotopes (18O and 2H) are commonly used as natural tracers. However, high-frequency isotopic analyses of liquid water samples are challenging. One must capture highly dynamic behavior with high precision and accuracy, but the lab workload (and sample storage artifacts) involved in collecting and analyzing thousands of bottled samples should also be avoided. Therefore, we have tested Picarro, Inc.'s newly developed Continuous Water Sampler Module (CoWS), which is coupled to their L2130-i Cavity Ring-Down Spectrometer to enable real-time on-line measurements of 18O and 2H in liquid water samples. We coupled this isotope analysis system to a dual-channel ion chomatograph (Metrohm AG, Herisau, Switzerland) for analysis of major cations and anions, as well as a UV-Vis spectroscopy system (s::can Messtechnik GmbH, Vienna, Austria) and electrochemical probes for characterization of basic water quality parameters. The system was run unattended for up to a week at a time in the laboratory and at a small catchment. At the field site, stream-water and precipitation samples were analyzed, alternating at sub-hourly intervals. We observed that measured isotope ratios were highly sensitive to the liquid water flow rate in the CoWS, and thus to the hydraulic head difference between the CoWS and the samples from which water was drawn. We used a programmable high-precision dosing pump to control the injection flow rate and eliminate this flow-rate artifact. Our experiments showed that the precision of the CoWS-L2130-i-system for 2-minute average values was typically better than 0.06‰ for δ18O and 0.16‰ for δ2H. Carryover effects were 1% or less between isotopically contrasting water samples for 30-minute sampling intervals. Instrument drift could be minimized through periodic analysis of

  5. Estimating population size for Capercaillie (Tetrao urogallus L.) with spatial capture-recapture models based on genotypes from one field sample

    USGS Publications Warehouse

    Mollet, Pierre; Kery, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, Andy

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species.

  6. Estimating Population Size for Capercaillie (Tetrao urogallus L.) with Spatial Capture-Recapture Models Based on Genotypes from One Field Sample

    PubMed Central

    Mollet, Pierre; Kéry, Marc; Gardner, Beth; Pasinelli, Gilberto; Royle, J. Andrew

    2015-01-01

    We conducted a survey of an endangered and cryptic forest grouse, the capercaillie Tetrao urogallus, based on droppings collected on two sampling occasions in eight forest fragments in central Switzerland in early spring 2009. We used genetic analyses to sex and individually identify birds. We estimated sex-dependent detection probabilities and population size using a modern spatial capture-recapture (SCR) model for the data from pooled surveys. A total of 127 capercaillie genotypes were identified (77 males, 46 females, and 4 of unknown sex). The SCR model yielded atotal population size estimate (posterior mean) of 137.3 capercaillies (posterior sd 4.2, 95% CRI 130–147). The observed sex ratio was skewed towards males (0.63). The posterior mean of the sex ratio under the SCR model was 0.58 (posterior sd 0.02, 95% CRI 0.54–0.61), suggesting a male-biased sex ratio in our study area. A subsampling simulation study indicated that a reduced sampling effort representing 75% of the actual detections would still yield practically acceptable estimates of total size and sex ratio in our population. Hence, field work and financial effort could be reduced without compromising accuracy when the SCR model is used to estimate key population parameters of cryptic species. PMID:26087321

  7. Integrating Field-Based Research into the Classroom: An Environmental Sampling Exercise

    ERIC Educational Resources Information Center

    DeSutter, T.; Viall, E.; Rijal, I.; Murdoff, M.; Guy, A.; Pang, X.; Koltes, S.; Luciano, R.; Bai, X.; Zitnick, K.; Wang, S.; Podrebarac, F.; Casey, F.; Hopkins, D.

    2010-01-01

    A field-based, soil methods, and instrumentation course was developed to expose graduate students to numerous strategies for measuring soil parameters. Given the northern latitude of North Dakota State University and the rapid onset of winter, this course met once per week for the first 8 weeks of the fall semester and centered on the field as a…

  8. CTEPP-OH DATA SUPPLEMENTAL INFORMATION ON FIELD AND LABORATORY SAMPLES

    EPA Science Inventory

    This data set contains supplemental data related to the final core analytical results table for CTEPP-OH. This includes sample collection data for example sample weight, air volume, creatinine, specific gravity etc.

    The Children’s Total Exposure to Persistent Pesticides and Oth...

  9. Sampling of Riverine or Marine Bacterial Communities in Remote Locations: From Field to Publication.

    PubMed

    Lehmann, Katja

    2016-01-01

    This protocol describes how to sample and preserve microbial water column samples from rivers that can be used for 16S or 18S metabarcoding studies or shotgun sequencing. It further describes how to extract the DNA for sequencing and how to prepare raw Illumina MiSeq amplicon data and analyze it in the R environment. PMID:27460367

  10. Design and development of low cost, simple, rapid and safe, modified field kits for the visual detection and determination of arsenic in drinking water samples.

    PubMed

    Cherukurii, Jyotsna; Anjaneyulu, Y

    2005-08-01

    Arsenic is naturally found in surface and ground waters and the inorganic forms of arsenic are the most toxic forms. The adverse health effects of arsenic may involve the respiratory, gastrointestinal, cardiovascular, nervous, and haematopoietic systems. Arsenic contamination in drinking water is a global problem widely seen in Bangladesh and West Bengal of the Indian sub continent. As there is a great demand for field test kits due to the anticipated reduction of the US EPA arsenic standard from 50ppb to 10ppb a field kit which offers rapid, simple and safe method for precise estimation of arsenic at 10ppb in drinking water samples is developed. Field methods, based on the mercuric-bromide-stain, consist of three different major parts, which are carried out stepwise. The first part of the procedure is to remove serious interference caused by hydrogen sulphide. In commercially available kits either the sulphide is oxidized to sulphate and the excess oxidizing reagent removed prior to the hydride generation step or, the hydrogen sulphide is filtered out by passing the gas stream through a filter impregnated with lead acetate during the hydride generation step. The present method employs cupric chloride in combination with ferric chloride or Fentonis reagent for the removal of hydrogen sulphide, which is rapid, simple and more efficient. Other interferences at this step of the analyses are normally not expected for drinking water analysis. In the second step, the generation of the arsine gas involves the classical way of using zinc metal and hydrochloric acid, which produce the enascenti hydrogen, which is the actual reducing agent. Hydrochloric acid can be replaced by sulfamic acid, which is solid and avoids a major disadvantage of having to handle a corrosive liquid in the field. The arsine gas produces a yellowish spot on the reagent paper. Depending on the arsenic content, either, Yellow n H (HgBr)2 As (10-50ppb), Brown n (HgBr)3 As (50-100ppb) or Black n Hg3 As2

  11. Field-amplified sample stacking and nonaqueous capillary electrophoresis determination of complex mixtures of polar aromatic sulfonates.

    PubMed

    Morales, Sergio; Cela, Rafael

    2002-02-01

    Nonaqueous CE and field-amplified sample stacking have been used in the determination of complex mixtures of polar aromatic sulfonates (AS; mainly benzene- and naphthalenesulfonates) of environmental concern. The analytical procedure consists of an on-column aqueous sample enrichment, followed by the nonaqueous electrophoretic determination of stacked aromatic sulfonates. Various organic solvents were used as separation medium, acetonitrile and N-methylformamide gave the best results. Optimum capillary electrophoresis separation is obtained with ammonium acetate (25 mM) dissolved in N-methylformamide-methanol (90:10) as background electrolyte. This combined method was applied to the analysis of surface water samples spiked with selected aromatic sulfonates derivatives.

  12. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies

    PubMed Central

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A.

    2014-01-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg-1 pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern. PMID:25580031

  13. Occurrence of Ditylenchus weischeri and Not D. dipsaci in Field Pea Harvest Samples and Cirsium arvense in the Canadian Prairies.

    PubMed

    Tenuta, Mario; Madani, Mehrdad; Briar, Shabeg; Molina, Oscar; Gulden, Robert; Subbotin, Sergei A

    2014-12-01

    The stem nematode, a parasite of the herbaceous perennial weed, Cirsium arvense (L.) Scop. and identified as Ditylenchus dipsaci (Kühn) Filipjev, was reported in the Canadian prairies in 1979. Recently, D. weischeri Chizhov parasitizing Cirsium arvense was described in Russia, and it has been shown that this species is not an agricultural pest. In this study, we examined Ditylenchus species found in field pea (Pisum sativum L.) grain harvest samples in 2009 and 2010 and from C. arvense shoots in pea fields in the Saskatchewan, Alberta, and Manitoba provinces. Samples from 538 fields (mainly yellow pea) were provided by 151 growers throughout the main pea-growing area of the Canadian prairies. Of the samples collected, 2% were positive for Ditylenchus. The population density of the nematode ranged between 4 and 1,500 nematodes kg(-1) pea harvest sample and related to presence of C. arvense seeds. Positive samples occurred in 2009 but not in 2010 and were from throughout the pea-growing area of the Canadian prairies and not related to cropping history. C. arvense collected from yellow pea fields in Saskatchewan and Manitoba, but not Alberta, were infested with Ditylenchus. Morphological and molecular (ITS-PCR-RFLP) traits indicated that this species belongs to D. weischeri. The results indicated the stem nematode found in yellow pea grain is D. weischeri which resided with C. arvense seeds and debris to pea samples. Unlike D. dipsaci, D. weischeri is not a nematode pest of economic importance; therefore, its presence in the pea harvest samples was not a concern. PMID:25580031

  14. Calibration and field application of passive sampling for episodic exposure to polar organic pesticides in streams.

    PubMed

    Fernández, Diego; Vermeirssen, Etiënne L M; Bandow, Nicole; Muñoz, Katherine; Schäfer, Ralf B

    2014-11-01

    Rainfall-triggered runoff is a major driver of pesticide input in streams. Only few studies have examined the suitability of passive sampling to quantify such episodic exposures. In this study, we used Empore™ styrene-divinylbenzene reverse phase sulfonated disks (SDB disks) and event-driven water samples (EDS) to assess exposure to 15 fungicides and 4 insecticides in 17 streams in a German vineyard area during 4 rainfall events. We also conducted a microcosm experiment to determine the SDB-disk sampling rates and provide a free-software solution to derive sampling rates under time-variable exposure. Sampling rates ranged from 0.26 to 0.77 L d(-1) and time-weighted average (TWA) concentrations from 0.05 to 2.11 μg/L. The 2 sampling systems were in good agreement and EDS exceeded TWA concentrations on average by a factor of 3. Our study demonstrates that passive sampling is suitable to quantify episodic exposures from polar organic pesticides.

  15. Basic properties of transition remanent magnetizations of magnetite in relation to the ambient field using granite samples

    NASA Astrophysics Data System (ADS)

    Sato, Masahiko; Seita, Kazuhiro; Miyagawa, Takeshi; Mochizuki, Nobutatsu; Kogiso, Tetsu; Tsunakawa, Hideo

    2015-01-01

    We have investigated basic properties of transition remanent magnetization of natural magnetite in granite samples collected from the Minnesota River Valley, North America. Transition remanence was imparted during cooling and/or warming through the Verwey transition around 120 K. Depending on magnetic field conditions during cooling and warming, three types of transition remanences have been categorized: (1) TrRM, acquired during a cycle of field cooling and field warming; (2) TrWRM, acquired during zero-field cooling and field warming and (3) TrCRM, imparted during field cooling and zero-field warming. These remanences fulfil basic laws of remanent magnetization: (1) directions of the transition remanences are parallel to direction of the applied field (the law of parallelism), (2) intensities of the transition remanences are proportional to the applied field intensity (the law of proportionality) and (3) sum of the partial transition remanences is equal to the total transitional remanence, that is, TrRM = TrWRM + TrCRM. In addition, the ratio of TrRM to TRMLTD (the demagnetized component of thermoremanent magnetization by low-temperature demagnetization) shows a nearly constant value of ˜0.34. This relationship might reflect differences in equilibrium magnetic domain state at low and high temperature.

  16. Investigating temporal field sampling strategies for site-specific calibration of three soil moisture-neutron intensity parameterisation methods

    NASA Astrophysics Data System (ADS)

    Iwema, J.; Rosolem, R.; Baatz, R.; Wagener, T.; Bogena, H. R.

    2015-07-01

    The Cosmic-Ray Neutron Sensor (CRNS) can provide soil moisture information at scales relevant to hydrometeorological modelling applications. Site-specific calibration is needed to translate CRNS neutron intensities into sensor footprint average soil moisture contents. We investigated temporal sampling strategies for calibration of three CRNS parameterisations (modified N0, HMF, and COSMIC) by assessing the effects of the number of sampling days and soil wetness conditions on the performance of the calibration results while investigating actual neutron intensity measurements, for three sites with distinct climate and land use: a semi-arid site, a temperate grassland, and a temperate forest. When calibrated with 1 year of data, both COSMIC and the modified N0 method performed better than HMF. The performance of COSMIC was remarkably good at the semi-arid site in the USA, while the N0mod performed best at the two temperate sites in Germany. The successful performance of COSMIC at all three sites can be attributed to the benefits of explicitly resolving individual soil layers (which is not accounted for in the other two parameterisations). To better calibrate these parameterisations, we recommend in situ soil sampled to be collected on more than a single day. However, little improvement is observed for sampling on more than 6 days. At the semi-arid site, the N0mod method was calibrated better under site-specific average wetness conditions, whereas HMF and COSMIC were calibrated better under drier conditions. Average soil wetness condition gave better calibration results at the two humid sites. The calibration results for the HMF method were better when calibrated with combinations of days with similar soil wetness conditions, opposed to N0mod and COSMIC, which profited from using days with distinct wetness conditions. Errors in actual neutron intensities were translated to average errors specifically to each site. At the semi-arid site, these errors were below the

  17. Genetic variability of spined soldier bugs (Hemiptera: Pentatomidae) sampled from distinct field sites and laboratory colonies in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The spined soldier bug, Podisus maculiventris (Say), is an important biological control agent for agricultural and forest pests that preys on eggs and larvae of lepidopteran and coleopteran species. Genetic variability among field collected samples from Michigan, Mississippi, Missouri, and Florida, ...

  18. Guidelines for collection and field analysis of water-quality samples from streams in Texas

    USGS Publications Warehouse

    Wells, F.C.; Gibbons, W.J.; Dorsey, M.E.

    1990-01-01

    Analyses for unstable constituents or properties are by necessity performed in the field. This manual addresses analytical techniques and quality assurance for: (1) Water temperature; (2) specific conductance; (3) pH; (4) alkalinity; (5) dissolved oxygen; and (6) bacteria.

  19. FIELD EVALUATION OF A SAMPLING APPROACH FOR PM-COARSE AEROSOLS

    EPA Science Inventory

    Subsequent to a 1997 revision of the national ambient air quality standards (NAAQS) for particulate matter (PM), the US Environmental Protection Agency is investigating the development of sampling methodology for a possible new coarse particle standard. When developed, this me...

  20. Student Participation in Mars Sample Return Rover Field Tests, Silver Lake, California

    NASA Technical Reports Server (NTRS)

    Anderson, R. C.; Arvidson, R. E.; Bowman, J. D.; Dunham, C. D.; Backes, P.; Baumgartner, E. T.; Bell, J.; Dworetzky, S. C.; Klug, S.; Peck, N.

    2000-01-01

    An integrated team of students and teachers from four high schools across the country developed and implemented their own mission of exploration and discovery using the Mars Sample Return prototype rover, FIDO, at Silver Lake in the Mojave Desert.

  1. A simplified electrospray ionization source based on electrostatic field induction for mass spectrometric analysis of droplet samples.

    PubMed

    Lu, Xiaohui; Chen, Hong; Li, Xiang; Chen, Jianmin; Yang, Xin

    2012-12-21

    A simplified electrospray ionization source based on electrostatic field induction is introduced in this paper. The electrostatic field induced spray ionization, termed EFISI, is easily performed using a needle electrode and a capillary, and it does not require heat, gas, a syringe pump or any other equipment. A high voltage is applied to a needle electrode which does not contact the sample. The capillary is used as a sample spray emitter without any electrical contact or tip modification. As only a 1 μL sample droplet is needed for analysis with no or little pretreatment, the EFISI source is particularly suitable for the mass spectrometric analysis of microlitre volume samples. The change of charge distribution in the droplet solution, by the induction of an external electrostatic field from the needle electrode, is proposed to be the main cause of ion formation. We demonstrate its feasibility for the characterization of a wide range of organic compounds and biomolecules in pure solutions or complex matrices. The influence of sample capillary length and droplet solvent composition on the ionization process are also discussed. PMID:23095821

  2. Field Methods and Sample Collection Techniques for the Surveillance of West Nile Virus in Avian Hosts.

    PubMed

    Wheeler, Sarah S; Boyce, Walter M; Reisen, William K

    2016-01-01

    Avian hosts play an important role in the spread, maintenance, and amplification of West Nile virus (WNV). Avian susceptibility to WNV varies from species to species thus surveillance efforts can focus both on birds that survive infection and those that succumb. Here we describe methods for the collection and sampling of live birds for WNV antibodies or viremia, and methods for the sampling of dead birds. Target species and study design considerations are discussed. PMID:27188560

  3. Non-Cartesian sampled centric scan SPRITE imaging with magnetic field gradient and B0(t) field measurements for MRI in the vicinity of metal structures.

    PubMed

    Han, Hui; Green, Derrick; Ouellette, Matthew; MacGregor, Rodney; Balcom, Bruce J

    2010-09-01

    This paper proposes the possibility of spatially resolved MRI measurements undertaken inside metallic cells. MRI has been rarely usable inside conducting vessels due to the eddy currents in the walls caused by switching magnetic field gradients, which render most advanced MRI pulse sequences impossible. We propose magnetic field gradient waveform monitoring (MFGM) for MRI of samples inside metallic cells. In this work the MFGM method was extended to measure the B(0) field temporal evolution associated with gradient waveforms. MFGM was used to observe and correct eddy current effects associated with a metallic cell. High quality centric scan SPRITE images result from such corrections. MRI of samples held under pressure, most notably rock core samples, traditionally employs cells that are non-magnetic and fabricated from polymeric materials. The natural material for high-pressure MRI is however non-ferromagnetic metal given their high tensile strengths and high thermal conductivity. MRI measurement of macroscopic samples at high pressure would be generally possible if metallic pressure vessels could be employed. This study will form the basis of new MRI compatible metallic pressure vessels, which will permit MRI of macroscopic systems at high pressure. PMID:20650669

  4. Selectivity and limitations of carbon sorption tubes for capturing siloxanes in biogas during field sampling.

    PubMed

    Tansel, Berrin; Surita, Sharon C

    2016-06-01

    Siloxane levels in biogas can jeopardize the warranties of the engines used at the biogas to energy facilities. The chemical structure of siloxanes consists of silicon and oxygen atoms, alternating in position, with hydrocarbon groups attached to the silicon side chain. Siloxanes can be either in cyclic (D) or linear (L) configuration and referred with a letter corresponding to their structure followed by a number corresponding to the number of silicon atoms present. When siloxanes are burned, the hydrocarbon fraction is lost and silicon is converted to silicates. The purpose of this study was to evaluate the adequacy of activated carbon gas samplers for quantitative analysis of siloxanes in biogas samples. Biogas samples were collected from a landfill and an anaerobic digester using multiple carbon sorbent tubes assembled in series. One set of samples was collected for 30min (sampling 6-L gas), and the second set was collected for 60min (sampling 12-L gas). Carbon particles were thermally desorbed and analyzed by Gas Chromatography Mass Spectrometry (GC/MS). The results showed that biogas sampling using a single tube would not adequately capture octamethyltrisiloxane (L3), hexamethylcyclotrisiloxane (D3), octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5) and dodecamethylcyclohexasiloxane (D6). Even with 4 tubes were used in series, D5 was not captured effectively. The single sorbent tube sampling method was adequate only for capturing trimethylsilanol (TMS) and hexamethyldisiloxane (L2). Affinity of siloxanes for activated carbon decreased with increasing molecular weight. Using multiple carbon sorbent tubes in series can be an appropriate method for developing a standard procedure for determining siloxane levels for low molecular weight siloxanes (up to D3). Appropriate quality assurance and quality control procedures should be developed for adequately quantifying the levels of the higher molecular weight siloxanes in biogas with sorbent tubes.

  5. Tissue sampling from live blue mussels, Mytilus edulis. A field study from the Swedish west coast

    NASA Astrophysics Data System (ADS)

    Svärdh, Lillemor

    2003-05-01

    Histological techniques are often used to study environmental effects on mussels, but since these techniques include killing of the individuals, rare or endangered populations cannot be studied using conventional tissue sampling. This study is an attempt to find a method that can be used repeatedly with the same mussel individual and which does not affect growth and survival. From 200 mussels, Mytilus edulis, tissue was sampled in different ways, such as drilling a hole in the shell or prising apart the shell valves. Two kind of instruments were used, an injection needle and surgery forceps. Some of the drilled mussels had their holes sealed again with cement. Drilling a hole in the shell, removing tissue sample with surgical forceps and then leaving the holes open did not seriously harm the mussels during the two months the experiment lasted. But if the holes were sealed with cement, both length and weight growth were negatively affected (35% lower length growth and 36% lower weight growth compared to the control mussels). Mortality was highest among the drilled and sealed mussels (80% higher than among the other treatments). The vulnerability of the population, the aim of the study and the duration of the experiment should decide what method to use for tissue sampling. For long-term experiments and repeated sampling, opening the mussels by prizing apart the valves is a better alternative than drilling holes in the shells, but depending on the morphology of the species it could be difficult to sample the anterior part of the mussel body. For a short experiment and to sample anterior parts, drilling the shells, leaving the holes open and using surgical forceps, seems to be an acceptable compromise between the different treatments used.

  6. Selectivity and limitations of carbon sorption tubes for capturing siloxanes in biogas during field sampling.

    PubMed

    Tansel, Berrin; Surita, Sharon C

    2016-06-01

    Siloxane levels in biogas can jeopardize the warranties of the engines used at the biogas to energy facilities. The chemical structure of siloxanes consists of silicon and oxygen atoms, alternating in position, with hydrocarbon groups attached to the silicon side chain. Siloxanes can be either in cyclic (D) or linear (L) configuration and referred with a letter corresponding to their structure followed by a number corresponding to the number of silicon atoms present. When siloxanes are burned, the hydrocarbon fraction is lost and silicon is converted to silicates. The purpose of this study was to evaluate the adequacy of activated carbon gas samplers for quantitative analysis of siloxanes in biogas samples. Biogas samples were collected from a landfill and an anaerobic digester using multiple carbon sorbent tubes assembled in series. One set of samples was collected for 30min (sampling 6-L gas), and the second set was collected for 60min (sampling 12-L gas). Carbon particles were thermally desorbed and analyzed by Gas Chromatography Mass Spectrometry (GC/MS). The results showed that biogas sampling using a single tube would not adequately capture octamethyltrisiloxane (L3), hexamethylcyclotrisiloxane (D3), octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5) and dodecamethylcyclohexasiloxane (D6). Even with 4 tubes were used in series, D5 was not captured effectively. The single sorbent tube sampling method was adequate only for capturing trimethylsilanol (TMS) and hexamethyldisiloxane (L2). Affinity of siloxanes for activated carbon decreased with increasing molecular weight. Using multiple carbon sorbent tubes in series can be an appropriate method for developing a standard procedure for determining siloxane levels for low molecular weight siloxanes (up to D3). Appropriate quality assurance and quality control procedures should be developed for adequately quantifying the levels of the higher molecular weight siloxanes in biogas with sorbent tubes

  7. Study of Low Temperature Baking Effect on Field Emission on Nb Samples Treated by BEP, EP, and BCP

    SciTech Connect

    Andy Wu, Song Jin, Robert Rimmer, Xiang Yang Lu, K. Zhao, Laura MacIntyre, Robert Ike

    2010-05-01

    Field emission is still one of the major obstacles facing Nb superconducting radio frequency (SRF) community for allowing Nb SRF cavities to reach routinely accelerating gradient of 35 MV/m that is required for the international linear collider. Nowadays, the well know low temperature backing at 120 oC for 48 hours is a common procedure used in the SRF community to improve the high field Q slope. However, some cavity production data have showed that the low temperature baking may induce field emission for cavities treated by EP. On the other hand, an earlier study of field emission on Nb flat samples treated by BCP showed an opposite conclusion. In this presentation, the preliminary measurements of Nb flat samples treated by BEP, EP, and BCP via our unique home-made scanning field emission microscope before and after the low temperature baking are reported. Some correlations between surface smoothness and the number of the observed field emitters were found. The observed experimental results can be understood, at least partially, by a simple model that involves the change of the thickness of the pent-oxide layer on Nb surfaces.

  8. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data.

    PubMed

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Kohn, Jordan; Yuan, Michael L; Gesquiere, Laurence; Grieneisen, Laura E; Tung, Jenny

    2016-01-01

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples-unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  9. Test and Analysis of China's First Short Conductor Sample for ITER Toroidal Field Coils

    NASA Astrophysics Data System (ADS)

    Liu, Bo; Wu, Yu

    2011-02-01

    In the framework of the ITER qualification tests, the first China TF conductor sample (CNTF1) was tested at the SULTAN facility. The sample was made of two TF conductor sections manufactured from identical internal stannum strands provided by the Oxford Superconducting technology company (OST). In order to evaluate the conductor performance, the current sharing temperature (Tcs) was measured at specified electromagnetic load cycling steps. Both conductor sections of the CNTF1 sample showed identical performance. Tcs was 7.2 K before cycling loading, and 6.9 K even after 950 cycles, without significant degradation, which substantially exceeds the ITER requirement of 5.7 K. The tests of the CNTF1 conductor sample showed that the electromagnetic cyclic load exhibited a negligible effect on the conductor performance. The coupling time constant θ for AC loss was 214 ms and 71.52 ms before and after the cycling load, respectively. The test results of the sample are compared with the strand performance and parameter model analysis.

  10. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-12-01

    This study is a contribution to development of a heterogeneity characterization facility for "next-generation" soil sampling aimed, for example, at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity in quantification of a set of exemplar parameters is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The theory of sampling (TOS) and variographic analysis has been applied to develop a more general fit-for-purpose soil heterogeneity characterization approach. All parameters were assessed in large-scale transect (1-100 m) vs. small-scale (0.1-0.5 m) replication sampling point variability. Variographic profiles of experimental analytical results from a specific well-mixed soil type show that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among other soils types. This study has a significant carrying-over potential for related research areas, e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  11. Local versus field scale soil heterogeneity characterization - a challenge for representative sampling in pollution studies

    NASA Astrophysics Data System (ADS)

    Kardanpour, Z.; Jacobsen, O. S.; Esbensen, K. H.

    2015-06-01

    This study is a contribution to development of a heterogeneity characterisation facility for "next generation" sampling aimed at more realistic and controllable pesticide variability in laboratory pots in experimental environmental contaminant assessment. The role of soil heterogeneity on quantification of a set of exemplar parameters, organic matter, loss on ignition (LOI), biomass, soil microbiology, MCPA sorption and mineralization is described, including a brief background on how heterogeneity affects sampling/monitoring procedures in environmental pollutant studies. The Theory of Sampling (TOS) and variographic analysis has been applied to develop a fit-for-purpose heterogeneity characterization approach. All parameters were assessed in large-scale profile (1-100 m) vs. small-scale (0.1-1 m) replication sampling pattern. Variographic profiles of experimental analytical results concludes that it is essential to sample at locations with less than a 2.5 m distance interval to benefit from spatial auto-correlation and thereby avoid unnecessary, inflated compositional variation in experimental pots; this range is an inherent characteristic of the soil heterogeneity and will differ among soils types. This study has a significant carrying-over potential for related research areas e.g. soil science, contamination studies, and environmental monitoring and environmental chemistry.

  12. Comparison and Field Validation of Binomial Sampling Plans for Oligonychus perseae (Acari: Tetranychidae) on Hass Avocado in Southern California.

    PubMed

    Lara, Jesus R; Hoddle, Mark S

    2015-08-01

    Oligonychus perseae Tuttle, Baker, & Abatiello is a foliar pest of 'Hass' avocados [Persea americana Miller (Lauraceae)]. The recommended action threshold is 50-100 motile mites per leaf, but this count range and other ecological factors associated with O. perseae infestations limit the application of enumerative sampling plans in the field. Consequently, a comprehensive modeling approach was implemented to compare the practical application of various binomial sampling models for decision-making of O. perseae in California. An initial set of sequential binomial sampling models were developed using three mean-proportion modeling techniques (i.e., Taylor's power law, maximum likelihood, and an empirical model) in combination with two-leaf infestation tally thresholds of either one or two mites. Model performance was evaluated using a robust mite count database consisting of >20,000 Hass avocado leaves infested with varying densities of O. perseae and collected from multiple locations. Operating characteristic and average sample number results for sequential binomial models were used as the basis to develop and validate a standardized fixed-size binomial sampling model with guidelines on sample tree and leaf selection within blocks of avocado trees. This final validated model requires a leaf sampling cost of 30 leaves and takes into account the spatial dynamics of O. perseae to make reliable mite density classifications for a 50-mite action threshold. Recommendations for implementing this fixed-size binomial sampling plan to assess densities of O. perseae in commercial California avocado orchards are discussed. PMID:26470355

  13. Sediment and radionuclide transport in rivers. Summary report, field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-11-01

    A three-phase field sampling program was conducted on the Buttermilk-Cattaraugus Creek system to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Phase 1 of the sampling program was conducted during November and December 1977; Phase 2 during September 1978; and Phase 3 during April 1979. Bed sediment, suspended sediment, and water samples were collected over a 45-mile reach of the creek system. Bed sediment samples were also collected at the mouth of Cattaraugus Creek in Lake Erie. A fourth sampling trip was conducted during May 1980 to obtain supplementary channel geometry data and flood plain sediment samples. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239,240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, CS-134, Co-60, Pu-238, Pu-239,240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks.

  14. Comparison and Field Validation of Binomial Sampling Plans for Oligonychus perseae (Acari: Tetranychidae) on Hass Avocado in Southern California.

    PubMed

    Lara, Jesus R; Hoddle, Mark S

    2015-08-01

    Oligonychus perseae Tuttle, Baker, & Abatiello is a foliar pest of 'Hass' avocados [Persea americana Miller (Lauraceae)]. The recommended action threshold is 50-100 motile mites per leaf, but this count range and other ecological factors associated with O. perseae infestations limit the application of enumerative sampling plans in the field. Consequently, a comprehensive modeling approach was implemented to compare the practical application of various binomial sampling models for decision-making of O. perseae in California. An initial set of sequential binomial sampling models were developed using three mean-proportion modeling techniques (i.e., Taylor's power law, maximum likelihood, and an empirical model) in combination with two-leaf infestation tally thresholds of either one or two mites. Model performance was evaluated using a robust mite count database consisting of >20,000 Hass avocado leaves infested with varying densities of O. perseae and collected from multiple locations. Operating characteristic and average sample number results for sequential binomial models were used as the basis to develop and validate a standardized fixed-size binomial sampling model with guidelines on sample tree and leaf selection within blocks of avocado trees. This final validated model requires a leaf sampling cost of 30 leaves and takes into account the spatial dynamics of O. perseae to make reliable mite density classifications for a 50-mite action threshold. Recommendations for implementing this fixed-size binomial sampling plan to assess densities of O. perseae in commercial California avocado orchards are discussed.

  15. Groundwater Monitoring and Field Sampling Plan for Operable Unit 10-08

    SciTech Connect

    M. S. Roddy

    2007-05-01

    This plan describes the groundwater sampling and water level monitoring that will be conducted to evaluate contaminations in the Snake River Plain Aquifer entering and leaving the Idaho National Laboratory. The sampling and monitoring locations were selected to meet the data quality objectives detailed in this plan. Data for the Snake River Plain Aquifer obtained under this plan will be evaluated in the Operable Unit 10-08 Remedial Investigation/Feasibility Study report and will be used to support the Operable Unit 10-08 Sitewide groundwater model.

  16. Field Reliability of Comprehensive System Scoring in an Adolescent Inpatient Sample

    ERIC Educational Resources Information Center

    McGrath, Robert E.; Pogge, David L.; Stokes, John M.; Cragnolino, Ana; Zaccario, Michele; Hayman, Judy; Piacentini, Teresa; Wayland-Smith, Douglas

    2005-01-01

    The extent to which the Comprehensive System for the Rorschach is reliably scored has been a topic of some controversy. Although several studies have concluded it can be scored reliably in research settings, little is known about its reliability in field settings. This study evaluated the reliability of both response-level codes and protocol-level…

  17. Validation of in situ networks via field sampling: case study in the South Fork Experimental Watershed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The calibration and validation of soil moisture remote sensing products is complicated by the logistics of installing a soil moisture network for a long term period in an active landscape. Therefore, these stations are located along field boundaries or in non-representative sites with regards to so...

  18. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    PubMed Central

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-01-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases. PMID:27357449

  19. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample.

    PubMed

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-01-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases. PMID:27357449

  20. Time resolved X-ray Dark-Field Tomography Revealing Water Transport in a Fresh Cement Sample

    NASA Astrophysics Data System (ADS)

    Prade, Friedrich; Fischer, Kai; Heinz, Detlef; Meyer, Pascal; Mohr, Jürgen; Pfeiffer, Franz

    2016-06-01

    Grating-based X-ray dark-field tomography is a promising technique for biomedical and materials research. Even if the resolution of conventional X-ray tomography does not suffice to resolve relevant structures, the dark-field signal provides valuable information about the sub-pixel microstructural properties of the sample. Here, we report on the potential of X-ray dark-field imaging to be used for time-resolved three-dimensional studies. By repeating consecutive tomography scans on a fresh cement sample, we were able to study the hardening dynamics of the cement paste in three dimensions over time. The hardening of the cement was accompanied by a strong decrease in the dark-field signal pointing to microstructural changes within the cement paste. Furthermore our results hint at the transport of water from certain limestone grains, which were embedded in the sample, to the cement paste during the process of hardening. This is indicated by an increasing scattering signal which was observed for two of the six tested limestone grains. Electron microscopy images revealed a distinct porous structure only for those two grains which supports the following interpretation of our results. When the water filled pores of the limestone grains empty during the experiment the scattering signal of the grains increases.

  1. How People Actually Use Thermostats

    SciTech Connect

    Meier, Alan; Aragon, Cecilia; Hurwitz, Becky; Mujumdar, Dhawal; Peffer, Therese; Perry, Daniel; Pritoni, Marco

    2010-08-15

    Residential thermostats have been a key element in controlling heating and cooling systems for over sixty years. However, today's modern programmable thermostats (PTs) are complicated and difficult for users to understand, leading to errors in operation and wasted energy. Four separate tests of usability were conducted in preparation for a larger study. These tests included personal interviews, an on-line survey, photographing actual thermostat settings, and measurements of ability to accomplish four tasks related to effective use of a PT. The interviews revealed that many occupants used the PT as an on-off switch and most demonstrated little knowledge of how to operate it. The on-line survey found that 89% of the respondents rarely or never used the PT to set a weekday or weekend program. The photographic survey (in low income homes) found that only 30% of the PTs were actually programmed. In the usability test, we found that we could quantify the difference in usability of two PTs as measured in time to accomplish tasks. Users accomplished the tasks in consistently shorter times with the touchscreen unit than with buttons. None of these studies are representative of the entire population of users but, together, they illustrate the importance of improving user interfaces in PTs.

  2. Field evaluation of sampling and analysis for organic pollutants in indoor air. Project summary

    SciTech Connect

    Chuang, J.C.; Mack, G.A.; Stockrahm, J.W.; Hannan, S.W.; Bridges, C.

    1988-09-01

    The objectives of the study were to determine the feasibility of the use of newly developed indoor air samplers in residential indoor air sampling and to evaluate methodology for characterization of the concentrations of polynuclear aromatic hydrocarbons (PAH), PAH derivatives, and nicotine in residential air.

  3. Geologic Field Notes, Geochemical Analyses, and Field Photographs of Outcrops and Rock Samples from the Big Delta B-1 Quadrangle, East-Central Alaska

    USGS Publications Warehouse

    Day, Warren C.; O'Neill, J. Michael

    2008-01-01

    The U.S. Geological Survey, in cooperation with the Alaska Department of Natural Resources Division of Mining, Land, and Water, has released a geologic map of the Big Delta B-1 quadrangle of east-central Alaska (Day and others, 2007). This companion report presents the major element oxide and trace element geochemical analyses, including those for gold, silver, and base metals, for representative rock units and for grab samples from quartz veins and mineralized zones within the quadrangle. Also included are field station locations, field notes, structural data, and field photographs based primarily on observations by W.C. Day with additions by J.M. O'Neill and B.M. Gamble, all of the U.S. Geological Survey. The data are provided in both Microsoft Excel spread sheet format and as a Microsoft Access database.

  4. Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data

    PubMed Central

    Blekhman, Ran; Tang, Karen; Archie, Elizabeth A.; Barreiro, Luis B.; Johnson, Zachary P.; Wilson, Mark E.; Kohn, Jordan; Yuan, Michael L.; Gesquiere, Laurence; Grieneisen, Laura E.; Tung, Jenny

    2016-01-01

    Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples—unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts. PMID:27528013

  5. Sediment and radionuclide transport in rivers. Phase 3. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Ecker, R.M.; Walters, W.H.; Onishi, Y.

    1982-08-01

    A field sampling program was conducted on Cattaraugus and Buttermilk Creeks, New York during April 1979 to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Bed sediment, suspended sediment and water samples were collected during unsteady flow conditions over a 45 mile reach of stream channel. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239, 240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, Cs-134, Co-60, Pu-238, Pu-239, 240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks. This field sampling effort was the last of a three phase program to collect hydrologic and radiologic data at different flow conditions.

  6. Maximizing the chances of detecting pathogenic leptospires in mammals: the evaluation of field samples and a multi-sample-per-mammal, multi-test approach.

    PubMed

    Tulsiani, S M; Graham, G C; Dohnt, M F; Burns, M-A; Craig, S B

    2011-03-01

    Identification of wild animals that harbour the causative leptospires, and the identification of the most important of these 'wild reservoirs' (in terms of threat to human health), are key factors in the epidemiology of human leptospirosis. In an epidemiological investigation in the Australian state of Queensland, in 2007-2008, samples were collected from fruit bats (Pteropus conspicillatus) and rodents (to investigate the potential role of fruit bats in the maintenance and transmission of leptospires to ground-dwelling rodents) and checked for pathogenic leptospires. The results of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire-positive, culture only yielded four isolates, probably because many cultures were contaminated. The main aims of the present study were to quantify the performance of the individual diagnostic tests and examine the reasons behind the high incidence of culture contamination. The results of sensitivity and specificity analyses for the different diagnostic tests indicated that isolation by culture (the definitive diagnostic test for leptospiral shedding) had perfect (100%) sensitivity when compared with the results of the PCR but a low specificity (40%). The MAT performed poorly, with a sensitivity of 50% when compared against the results of culture. The prevalence of leptospiral carriage revealed by the PCR-based investigation of kidney and urine samples (59.2%) was higher than

  7. Maximizing the chances of detecting pathogenic leptospires in mammals: the evaluation of field samples and a multi-sample-per-mammal, multi-test approach

    PubMed Central

    Tulsiani, S M; Graham, G C; Dohnt, M F; Burns, M-A; Craig, S B

    2011-01-01

    Identification of wild animals that harbour the causative leptospires, and the identification of the most important of these ‘wild reservoirs’ (in terms of threat to human health), are key factors in the epidemiology of human leptospirosis. In an epidemiological investigation in the Australian state of Queensland, in 2007–2008, samples were collected from fruit bats (Pteropus conspicillatus) and rodents (to investigate the potential role of fruit bats in the maintenance and transmission of leptospires to ground-dwelling rodents) and checked for pathogenic leptospires. The results of these studies have now been carefully analysed in attempts to see which method of detection and type of test sample were best. The effects of pentobarbitone sodium used to euthanize wild mammals before collection of necropsy samples, on the survival and detection of leptospires in vitro, were also explored. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27·6% of the rodents investigated were found leptospire-positive, culture only yielded four isolates, probably because many cultures were contaminated. The main aims of the present study were to quantify the performance of the individual diagnostic tests and examine the reasons behind the high incidence of culture contamination. The results of sensitivity and specificity analyses for the different diagnostic tests indicated that isolation by culture (the definitive diagnostic test for leptospiral shedding) had perfect (100%) sensitivity when compared with the results of the PCR but a low specificity (40%). The MAT performed poorly, with a sensitivity of 50% when compared against the results of culture. The prevalence of leptospiral carriage revealed by the PCR-based investigation of kidney and urine samples (59·2%) was

  8. A large depth of field LIBS measuring system for elemental analysis of moving samples of raw coal

    NASA Astrophysics Data System (ADS)

    Redoglio, D.; Golinelli, E.; Musazzi, S.; Perini, U.; Barberis, F.

    2016-02-01

    We present preliminary results of laboratory tests carried out on moving samples of coal by means of an innovative LIBS system with a large depth of field. The measuring system has been conceived to operate on line in a coal fired power plant. To duplicate at laboratory level the real situation, the coal samples are sequentially positioned under the measuring head by means of a translation/rotation unit that allows reproducing the behavior of the raw coal transported by a conveyor belt. Experimental results show that both carbon and hydrogen concentration as well as the content of some inorganic components (Al, Ca, Fe, Si) can be evaluated with good accuracy.

  9. Spatial sampling of the thermospheric vertical wind field at auroral latitudes

    NASA Astrophysics Data System (ADS)

    Anderson, C.; Davies, T.; Conde, M.; Dyson, P.; Kosch, M. J.

    2011-06-01

    Results are presented from two nights of bistatic Doppler measurements of neutral thermospheric winds using Fabry-Perot spectrometers at Mawson and Davis stations in Antarctica. A scanning Doppler imager (SDI) at Mawson and a narrow-field Fabry-Perot spectrometer (FPS) at Davis have been used to estimate the vertical wind at three locations along the great circle joining the two stations, in addition to the vertical wind routinely observed above each station. These data were obtained from observations of the 630.0 nm airglow line of atomic oxygen, at a nominal altitude of 240 km. Low-resolution all-sky images produced by the Mawson SDI have been used to relate disturbances in the measured vertical wind field to auroral activity and divergence in the horizontal wind field. Correlated vertical wind responses were observed on a range of horizontal scales from ˜150 to 480 km. In general, the behavior of the vertical wind was in agreement with earlier studies, with strong upward winds observed poleward of the optical aurora and sustained, though weak, downward winds observed early in the night. The relation between vertical wind and horizontal divergence was seen to follow the general trend predicted by Burnside et al. (1981), whereby upward vertical winds were associated with positive divergence and vice versa; however, a scale height approximately 3-4 times greater than that modeled by NRLMSISE-00 was required to best fit the data using this relation.

  10. Quantitative Field Testing Rotylenchulus reniformis DNA from Metagenomic Samples Isolated Directly from Soil

    PubMed Central

    Showmaker, Kurt; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2011-01-01

    A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil. PMID:22194958

  11. Laboratory and field testing of bednet traps for mosquito (Diptera: Culicidae) sampling in West Java, Indonesia.

    PubMed

    Stoops, Craig A; Gionar, Yoyo R; Rusmiarto, Saptoro; Susapto, Dwiko; Andris, Heri; Elyazar, Iqbal R F; Barbara, Kathryn A; Munif, Amrul

    2010-06-01

    Surveillance of medically important mosquitoes is critical to determine the risk of mosquito-borne disease transmission. The purpose of this research was to test self-supporting, exposure-free bednet traps to survey mosquitoes. In the laboratory we tested human-baited and unbaited CDC light trap/cot bednet (CDCBN) combinations against three types of traps: the Mbita Trap (MIBITA), a Tent Trap (TENT), and a modified Townes style Malaise trap (TSM). In the laboratory, 16 runs comparing MBITA, TSM, and TENT to the CDCBN were conducted for a total of 48 runs of the experiment using 13,600 mosquitoes. The TENT trap collected significantly more mosquitoes than the CDCBN. The CDCBN collected significantly more than the MBITA and there was no difference between the TSM and the CDCBN. Two field trials were conducted in Cibuntu, Sukabumi, West Java, Indonesia. The first test compared human-baited and unbaited CDCBN, TENT, and TSM traps during six nights over two consecutive weeks per month from January, 2007 to September, 2007 for a total of 54 trapnights. A total of 8,474 mosquitoes representing 33 species were collected using the six trapping methods. The TENT-baited trap collected significantly more mosquitoes than both the CDCBN and the TSM. The second field trial was a comparison of the baited and unbaited TENT and CDCBN traps and Human Landing Collections (HLCs). The trial was carried out from January, 2008 to May, 2008 for a total of 30 trap nights. A total of 11,923 mosquitoes were collected representing 24 species. Human Landing Collections captured significantly more mosquitoes than either the TENT or the CDCBN. The baited and unbaited TENT collected significantly more mosquitoes than the CDCBN. The TENT trap was found to be an effective, light-weight substitute for the CDC light-trap, bednet combination in the field and should be considered for use in surveys of mosquito-borne diseases such as malaria, arboviruses, and filariasis.

  12. Methods for growing and titrating African swine fever virus: field and laboratory samples.

    PubMed

    Carrascosa, Angel L; Bustos, M Jose; de Leon, Patricia

    2011-12-01

    Growing African swine fever virus (ASFV) isolates obtained mainly from the field, but also engineered in the laboratory, is a critical step for diagnosis, titration, or virus infection studies. This unit describes a set of methods and protocols to produce and titrate any ASFV strain in cell cultures. The procedures include (1) basic techniques to prepare virus-sensitive target cells; (2) strategies for growth, concentration, and purification of virus stocks; and (3) the semi-quantitative (end dilution) and quantitative (plaque) assays for the determination of viral titers, and the use of different ASFV-sensitive cells as targets for virus production and titration.

  13. Drilling, Sampling, and Well-Installation Plan for the IFC Well Field, 300 Area

    SciTech Connect

    Bjornstad, Bruce N.; Horner, Jacob A.

    2008-05-05

    The 300 Area was selected as a location for an IFC because it offers excellent opportunities for field research on the influence of mass-transfer processes on uranium in the vadose zone and groundwater. The 300 Area was the location of nuclear fuel fabrication facilities and has more than 100 waste sites. Two of these waste sites, the North and South Process Ponds received large volumes of process waste from 1943 to 1975 and are thought to represent a significant source of the groundwater uranium plume in the 300 Area. Geophysical surveys and other characterization efforts have led to selection of the South Process Pond for the IFC.

  14. Sparse temporal sampling for fast time-domain wide-field fluorescence molecular tomography

    NASA Astrophysics Data System (ADS)

    Yao, Ruoyang; Zhao, Lingling; Intes, Xavier

    2016-03-01

    Fluorescence Molecular Tomography (FMT) is a powerful optical imaging tool for preclinical research. Especially, its implementation with time-domain (TD) techniques allows lifetime multiplexing for simultaneously imaging multiple biomarkers and provides enhanced data sets for improved resolution and quantification compared to continuous wave (CW) and frequency domain (FD) methodologies. When performing time-domain reconstructions, one important aspect is the selection of a temporal sub-data set. Typically, such selection is performed a posteriori after dense temporal sampling during the acquisition. In this work, we investigate the potential to collect a priori sparse data sets for fast experimental acquisition without compromising FMT performances.

  15. Estimating wildfire risk on a Mojave Desert landscape using remote sensing and field sampling

    USGS Publications Warehouse

    Van Linn, Peter F.; Nussear, Kenneth E.; Esque, Todd C.; DeFalco, Lesley A.; Inman, Richard D.; Abella, Scott R.

    2013-01-01

    Predicting wildfires that affect broad landscapes is important for allocating suppression resources and guiding land management. Wildfire prediction in the south-western United States is of specific concern because of the increasing prevalence and severe effects of fire on desert shrublands and the current lack of accurate fire prediction tools. We developed a fire risk model to predict fire occurrence in a north-eastern Mojave Desert landscape. First we developed a spatial model using remote sensing data to predict fuel loads based on field estimates of fuels. We then modelled fire risk (interactions of fuel characteristics and environmental conditions conducive to wildfire) using satellite imagery, our model of fuel loads, and spatial data on ignition potential (lightning strikes and distance to roads), topography (elevation and aspect) and climate (maximum and minimum temperatures). The risk model was developed during a fire year at our study landscape and validated at a nearby landscape; model performance was accurate and similar at both sites. This study demonstrates that remote sensing techniques used in combination with field surveys can accurately predict wildfire risk in the Mojave Desert and may be applicable to other arid and semiarid lands where wildfires are prevalent.

  16. Water adsorption at high temperature on core samples from The Geysers geothermal field

    SciTech Connect

    Gruszkiewicz, M.S.; Horita, J.; Simonson, J.M.; Mesmer, R.E.

    1998-06-01

    The quantity of water retained by rock samples taken from three wells located in The Geysers geothermal reservoir, California, was measured at 150, 200, and 250 C as a function of pressure in the range 0.00 {le} p/p{sub 0} {le} 0.98, where p{sub 0} is the saturated water vapor pressure. Both adsorption (increasing pressure) and desorption (decreasing pressure) runs were made in order to investigate the nature and the extent of the hysteresis. Additionally, low temperature gas adsorption analyses were performed on the same rock samples. Nitrogen or krypton adsorption and desorption isotherms at 77 K were used to obtain BET specific surface areas, pore volumes and their distributions with respect to pore sizes. Mercury intrusion porosimetry was also used to obtain similar information extending to very large pores (macropores). A qualitative correlation was found between the surface properties obtained from nitrogen adsorption and the mineralogical and petrological characteristics of the solids. However, there is in general no proportionality between BET specific surface areas and the capacity of the rocks for water adsorption at high temperatures. The results indicate that multilayer adsorption rather than capillary condensation is the dominant water storage mechanism at high temperatures.

  17. Performance evaluation of currently used portable X ray fluorescence instruments for measuring the lead content of paint in field samples.

    PubMed

    Muller, Yan; Favreau, Philippe; Kohler, Marcel

    2014-01-01

    Field-portable X-ray fluorescence (FP-XRF) instruments are important for non-destructive, rapid and convenient measurements of lead in paint, in view of potential remediation. Using real-life paint samples, we compared measurements from three FP-XRF instruments currently used in Switzerland with laboratory measurements using inductively coupled plasma mass spectrometry after complete sample dissolution. Two FP-XRF devices that functioned by lead L shell excitation frequently underestimated the lead concentration of samples. Lack of accuracy correlated with lead depth and/or the presence of additional metal elements (Zn, Ba or Ti). A radioactive source emitter XRF that enabled the additional K shell excitation showed higher accuracy and precision, regardless of the depth of the lead layer in the sample or the presence of other elements. Inspection of samples by light and electron microscopy revealed the diversity of real-life samples, with multi-layered paints showing various depths of lead and other metals. We conclude that the most accurate measurements of lead in paint are currently obtained with instruments that provide at least sufficient energy for lead K shell excitation.

  18. Field Sampling Plan for the Operable Units 6-05 and 10-04 Remedial Action, Phase IV

    SciTech Connect

    R. Wells

    2006-11-14

    This Field Sampling Plan outlines the collection and analysis of samples in support of Phase IV of the Waste Area Group 10, Operable Units 6-05 and 10-04 remedial action. Phase IV addresses the remedial actions to areas with the potential for unexploded ordnance at the Idaho National Laboratory Site. These areas include portions of the Naval Proving Ground, the Arco High-Altitude Bombing Range, and the Twin Buttes Bombing Range. The remedial action consists of removal and disposal of ordnance by high-order detonation, followed by sampling to determine the extent, if any, of soil that might have been contaminated by the detonation activities associated with the disposal of ordnance during the Phase IV activities and explosives during the Phase II activities.

  19. The structure and transformation of the nanomineral schwertmannite: a synthetic analog representative of field samples

    NASA Astrophysics Data System (ADS)

    French, Rebecca A.; Monsegue, Niven; Murayama, Mitsuhiro; Hochella, Michael F.

    2014-04-01

    The phase transformation of schwertmannite, an iron oxyhydroxide sulfate nanomineral synthesized at room temperature and at 75 °C using H2O2 to drive the precipitation of schwertmannite from ferrous sulfate (Regenspurg et al. in Geochim Cosmochim Acta 68:1185-1197, 2004), was studied using high-resolution transmission electron microscopy. The results of this study suggest that schwertmannite synthesized using this method should not be described as a single phase with a repeating unit cell, but as a polyphasic nanomineral with crystalline areas spanning less than a few nanometers in diameter, within a characteristic `pin-cushion'-like amorphous matrix. The difference in synthesis temperature affected the density of the needles on the schwertmannite surface. The needles on the higher-temperature schwertmannite displayed a dendritic morphology, whereas the needles on the room-temperature schwertmannite were more closely packed. Visible lattice fringes in the schwertmannite samples are consistent with the powder X-ray diffraction (XRD) pattern taken on the bulk schwertmannite and also matched d-spacings for goethite, indicating a close structural relationship between schwertmannite and goethite. The incomplete transformation from schwertmannite to goethite over 24 h at 75 °C was tracked using XRD and TEM. TEM images suggest that the sample collected after 24 h consists of aggregates of goethite nanocrystals. Comparing the synthetic schwertmannite in this study to a study on schwertmannite produced at 85 °C, which used ferric sulfate, reveals that synthesis conditions can result in significant differences in needle crystal structure. The bulk powder XRD patterns for the schwertmannite produced using these two samples were indistinguishable from one another. Future studies using synthetic schwertmannite should account for these differences when determining schwertmannite's structure, reactivity, and capacity to take up elements like arsenic. The schwertmannite

  20. Field Sampling and Modeling of Creosote-Derived Contamination in a Tdally Forced Aquifer

    NASA Astrophysics Data System (ADS)

    Bishop, C.

    2003-12-01

    We are investigating the fate and transport of a creosote-derived groundwater contaminant plume found in an aquifer adjacent to and beneath a large, tidally forced river. The site, located in Coquitlam, BC, is adjacent to the Fraser River, and has been an active wood preserving facility since the 1920's. In the on-shore source zone, creosote has penetrated into the aquifer and a dissolved-phase plume, composed primarily of naphthalene, flows in the site aquifer from the source zone towards and below the river, eventually discharging from the river bottom. A capture well has been operated since 1996 to contain and capture the contaminant source. Previous research at this site has documented that biodegradation of naphthalene takes place in the plume fringe in the region of the aquifer that is beneath the river, but not onshore. Abundant methane and ferrous iron in the aquifer suggests that iron reduction and methanogenesis are the dominant terminal electron accepting processes. High offshore naphthalene concentrations sampled in 1999 despite three years of source containment and degradation led to the hypothesis that the plume may be at steady state due to buffering of contaminant concentrations by desorption from aquifer sediments. Naphthalene concentrations sampled in this study show that the contaminant plume is not at steady state. Results of groundwater flow modelling and sorption data show that the continued presence of high concentrations of naphthalene offshore are likely due to incomplete source containment or to slow migration of contaminants from upgradient regions of the aqueous plume. Although naphthalene has been the focus of all previous investigations of the offshore plume at this site, recent sampling shows that two other components of creosote, indane and benzothiophene, become the dominant components of the aqueous phase plume as it approaches the discharge point. Significant concentrations of these contaminants are likely discharging to the river

  1. Prediction of SAMPL3 host-guest binding affinities: evaluating the accuracy of generalized force-fields.

    PubMed

    Muddana, Hari S; Gilson, Michael K

    2012-05-01

    We used the second-generation mining minima method (M2) to compute the binding affinities of the novel host-guest complexes in the SAMPL3 blind prediction challenge. The predictions were in poor agreement with experiment, and we conjectured that much of the error might derive from the force field, CHARMm with Vcharge charges. Repeating the calculations with other generalized force-fields led to no significant improvement, and we observed that the predicted affinities were highly sensitive to the choice of force-field. We therefore embarked on a systematic evaluation of a set of generalized force fields, based upon comparisons with PM6-DH2, a fast yet accurate semi-empirical quantum mechanics method. In particular, we compared gas-phase interaction energies and entropies for the host-guest complexes themselves, as well as for smaller chemical fragments derived from the same molecules. The mean deviations of the force field interaction energies from the quantum results were greater than 3 kcal/mol and 9 kcal/mol, for the fragments and host-guest systems respectively. We further evaluated the accuracy of force-fields for computing the vibrational entropies and found the mean errors to be greater than 4 kcal/mol. Given these errors in energy and entropy, it is not surprising in retrospect that the predicted binding affinities deviated from the experiment by several kcal/mol. These results emphasize the need for improvements in generalized force-fields and also highlight the importance of systematic evaluation of force-field parameters prior to evaluating different free-energy methods.

  2. It's about time; Repeated field sampling and flexible UAV platforms for a changing globe

    NASA Astrophysics Data System (ADS)

    Crutsinger, G.

    2015-12-01

    Unmanned Aerial Vehicles (UAVs) are quickly being adopted across the field sciences and will revolutionizing the speed and spatial scale of data collection. As a result, UAVs will alleviate much of the burden placed on boots-on-the-ground researchers as they seek to address fundamental scientific questionsa ssociated with global change. Concurrently, UAVs will initiate a rapid rise in time-series data, whether from monitoring weather patterns, measuring shifts in phenology due to a warming temperatures, or tracking range expansion and contraction of species. The challenges within the scientific community will be in the standardization of data collection, protocol sharing, and data management. The emergence of flexible aerial platforms within the commercial UAV space with multiple sensor configurations, open software application development, and cloud-based services should do much to address these challenges, but only if there is close collaboration between the industry and academic research partners.

  3. Field sampling of soil pore water to evaluate trace element mobility and associated environmental risk.

    PubMed

    Moreno-Jiménez, Eduardo; Beesley, Luke; Lepp, Nicholas W; Dickinson, Nicholas M; Hartley, William; Clemente, Rafael

    2011-10-01

    Monitoring soil pollution is a key aspect in sustainable management of contaminated land but there is often debate over what should be monitored to assess ecological risk. Soil pore water, containing the most labile pollutant fraction in soils, can be easily collected in situ offering a routine way to monitor this risk. We present a compilation of data on concentration of trace elements (As, Cd, Cu, Pb, and Zn) in soil pore water collected in field conditions from a range of polluted and non-polluted soils in Spain and the UK during single and repeated monitoring, and propose a simple eco-toxicity test using this media. Sufficient pore water could be extracted for analysis both under semi-arid and temperate conditions, and eco-toxicity comparisons could be effectively made between polluted and non-polluted soils. We propose that in-situ pore water extraction could enhance the realism of risk assessment at some contaminated sites.

  4. Sampling and Analysis of Impact Crater Residues Found on the Wide Field Planetary Camera-2 Radiator

    NASA Technical Reports Server (NTRS)

    Kearsley, A. T.; Grime, G. W.; Colaux, J. L.; Jeynes, C.; Palitsin, V. V.; Webb, R, P.; Griffin, T. J.; Reed, B. B.; Anz-Meador, P. D.; Kou, J.-C.; Robinson, G. A.; Opiela, J. N.; Gerlach, L.

    2013-01-01

    After nearly 16 years in low Earth orbit (LEO), the Wide Field Planetary Camera-2 (WFPC2) was recovered from the Hubble Space Telescope (HST) in May 2009, during the 12 day shuttle mission designated STS-125. The WFPC-2 radiator had been struck by approximately 700 impactors producing crater features 300 microns and larger in size. Following optical inspection in 2009, agreement was reached for joint NASA-ESA study of crater residues, in 2011. Over 480 impact features were extracted at NASA Johnson Space Center's (JSC) Space Exposed Hardware clean-room and curation facility during 2012, and were shared between NASA and ESA. We describe analyses conducted using scanning electron microscopy (SEM) - energy dispersive X-ray spectrometry (EDX): by NASA at JSC's Astromaterials Research and Exploration Science (ARES) Division; and for ESA at the Natural History Museum (NHM), with Ion beam analysis (IBA) using a scanned proton microbeam at the University of Surrey Ion Beam Centre (IBC).

  5. Statistical techniques for detecting the intergalactic magnetic field from large samples of extragalactic Faraday rotation data

    SciTech Connect

    Akahori, Takuya; Gaensler, B. M.; Ryu, Dongsu E-mail: bryan.gaensler@sydney.edu.au

    2014-08-01

    Rotation measure (RM) grids of extragalactic radio sources have been widely used for studying cosmic magnetism. However, their potential for exploring the intergalactic magnetic field (IGMF) in filaments of galaxies is unclear, since other Faraday-rotation media such as the radio source itself, intervening galaxies, and the interstellar medium of our Galaxy are all significant contributors. We study statistical techniques for discriminating the Faraday rotation of filaments from other sources of Faraday rotation in future large-scale surveys of radio polarization. We consider a 30° × 30° field of view toward the south Galactic pole, while varying the number of sources detected in both present and future observations. We select sources located at high redshifts and toward which depolarization and optical absorption systems are not observed so as to reduce the RM contributions from the sources and intervening galaxies. It is found that a high-pass filter can satisfactorily reduce the RM contribution from the Galaxy since the angular scale of this component toward high Galactic latitudes would be much larger than that expected for the IGMF. Present observations do not yet provide a sufficient source density to be able to estimate the RM of filaments. However, from the proposed approach with forthcoming surveys, we predict significant residuals of RM that should be ascribable to filaments. The predicted structure of the IGMF down to scales of 0.°1 should be observable with data from the Square Kilometre Array, if we achieve selections of sources toward which sightlines do not contain intervening galaxies and RM errors are less than a few rad m{sup –2}.

  6. Using adaptive sampling and triangular meshes for the processing and inversion of potential field data

    NASA Astrophysics Data System (ADS)

    Foks, Nathan Leon

    The interpretation of geophysical data plays an important role in the analysis of potential field data in resource exploration industries. Two categories of interpretation techniques are discussed in this thesis; boundary detection and geophysical inversion. Fault or boundary detection is a method to interpret the locations of subsurface boundaries from measured data, while inversion is a computationally intensive method that provides 3D information about subsurface structure. My research focuses on these two aspects of interpretation techniques. First, I develop a method to aid in the interpretation of faults and boundaries from magnetic data. These processes are traditionally carried out using raster grid and image processing techniques. Instead, I use unstructured meshes of triangular facets that can extract inferred boundaries using mesh edges. Next, to address the computational issues of geophysical inversion, I develop an approach to reduce the number of data in a data set. The approach selects the data points according to a user specified proxy for its signal content. The approach is performed in the data domain and requires no modification to existing inversion codes. This technique adds to the existing suite of compressive inversion algorithms. Finally, I develop an algorithm to invert gravity data for an interfacing surface using an unstructured mesh of triangular facets. A pertinent property of unstructured meshes is their flexibility at representing oblique, or arbitrarily oriented structures. This flexibility makes unstructured meshes an ideal candidate for geometry based interface inversions. The approaches I have developed provide a suite of algorithms geared towards large-scale interpretation of potential field data, by using an unstructured representation of both the data and model parameters.

  7. Applying high resolution SyXRD analysis on sulfate attacked concrete field samples

    SciTech Connect

    Stroh, J.; Schlegel, M.-C.; Irassar, E.F.; Meng, B.; Emmerling, F.

    2014-12-15

    High resolution synchrotron X-ray diffraction (SyXRD) was applied for a microstructural profile analysis of concrete deterioration after sulfate attack. The cement matrices consist of ordinary Portland cement and different amounts of supplementary cementitious materials, such as fly ash, natural pozzolana and granulated blast furnace slag. The changes of the phase composition were determined along the direction of sulfate ingress. This approach allows the identification of reaction fronts and zones of different phase compositions and conclusions about the mechanisms of sulfate attack. Two reaction fronts were localized in the initial 4 mm from the sample surface. The mechanism of deterioration caused by the exposition in the sulfate-bearing soil is discussed. SyXRD is shown to be a reliable method for investigation of cementitious materials with aggregates embedded in natural environments.

  8. NGSI FY15 Final Report. Innovative Sample Preparation for in-Field Uranium Isotopic Determinations

    SciTech Connect

    Yoshida, Thomas M.; Meyers, Lisa

    2015-11-10

    Our FY14 Final Report included an introduction to the project, background, literature search of uranium dissolution methods, assessment of commercial off the shelf (COTS) automated sample preparation systems, as well as data and results for dissolution of bulk quantities of uranium oxides, and dissolution of uranium oxides from swipe filter materials using ammonium bifluoride (ABF). Also, discussed were reaction studies of solid ABF with uranium oxide that provided a basis for determining the ABF/uranium oxide dissolution mechanism. This report details the final experiments for optimizing dissolution of U3O8 and UO2 using ABF and steps leading to development of a Standard Operating Procedure (SOP) for dissolution of uranium oxides on swipe filters.

  9. Field Evaluations of Sampling Methods for Long-Term Monitoring of Upland Ecosystems on the Colorado Plateau

    USGS Publications Warehouse

    Miller, Mark E.; Witwicki, Dana L.; Mann, Rebecca K.; Tancreto, Nicole J.

    2007-01-01

    . There also were no differences among methods with respect to mean and median measures of among-plot variability in total live understory canopy cover. But among-plot variability was least for the line-point technique at seven of 11 ecological sites. Sampling activities had greatest impacts on plot conditions at macroplots where there was a high degree of cover by biological and physical soil crusts. Of all sampling procedures, 10-m2 quadrat sampling, line-point sampling, and gap-intercept sampling had the most impacts on soil conditions due to trampling of soil crusts by the field team.

  10. Megacrystic Clinopyroxene Basalts Sample A Deep Crustal Underplate To The Mount Taylor Volcanic Field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, M. E.; Schrader, C. M.; Crumpler, L. S.; Wolff, J. A.

    2012-12-01

    The alkaline and compositionally diverse (basanite to high-Si rhyolite) Mount Taylor Volcanic Field (MTVF), New Mexico comprises 4 regions that cover ~75 x 40 km2: (1) Mount Taylor, a large composite volcano and a surrounding field of basaltic vents; (2) Grants Ridge, constructed of topaz rhyolitic ignimbrite and coulees; (3) Mesa Chivato, a plateau of alkali basalts and mugearitic to trachytic domes; and (4) the Rio Puero basaltic necks. Distributed throughout its history (~3.6 to 1.26 Ma; Crumpler and Goff, 2012) and area (excepting Rio Puerco Necks) is a texturally distinct family of differentiated basalts (Mg# 43.2-53.4). These basalts contain resorbed and moth-eaten megacrysts (up to 2 cm) of plagioclase, clinopyroxene, and olivine ±Ti-magnetite ±ilmenite ±rare orthopyroxene. Some megacrystic lava flows have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. For instance, gabbroic and megacrystic clinopyroxenes form linear positive arrays in TiO2 (0.2-2.3 wt%) with respect to Al2O3 (0.7-9.3 wt%). The lowest Al clinopyroxenes are found in a gabbroic inclusion and are associated with partially melted intercumulus orthopyroxene. Megacrystic and gabbroic plagioclase (An 41-80) in 4 representative thin sections were analyzed for 87Sr/86Sr by Laser Ablation ICP-MS. 87Sr/86Sr values for the suite range from 0.7036 to 0.7047. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, these megacrysts track the differentiation of an intrusive body (or related bodies) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. The intrusive body likely underplates portions of the MTVF that have generated silicic magmas (Mount Taylor, Grants Ridge, Mesa Chivato). Although disequilibrium is implied by resorbed

  11. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland: Volume 2, Quality Assurance Project Plan

    SciTech Connect

    Prasad, S.; Martino, L.; Patton, T.

    1995-03-01

    J-Field encompasses about 460 acres at the southern end of the Gunpowder Neck Peninsula in the Edgewood Area of APG (Figure 2.1). Since World War II, the Edgewood Area of APG has been used to develop, manufacture, test, and destroy chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). For the purposes of this project, J-Field has been divided into eight geographic areas or facilities that are designated as areas of concern (AOCs): the Toxic Burning Pits (TBP), the White Phosphorus Burning Pits (WPP), the Riot Control Burning Pit (RCP), the Robins Point Demolition Ground (RPDG), the Robins Point Tower Site (RPTS), the South Beach Demolition Ground (SBDG), the South Beach Trench (SBT), and the Prototype Building (PB). The scope of this project is to conduct a remedial investigation/feasibility study (RI/FS) and ecological risk assessment to evaluate the impacts of past disposal activities at the J-Field site. Sampling for the RI will be carried out in three stages (I, II, and III) as detailed in the FSP. A phased approach will be used for the J-Field ecological risk assessment (ERA).

  12. You wouldn't go into the field with dirty sampling gear, would you?

    NASA Astrophysics Data System (ADS)

    Rummel, J. D.; Voytek, M. A.; Hipkin, V.

    2014-12-01

    Planetary protection is a precautionary principle that brought together Western and Soviet interests at the height of the Cold War. Scientists on both sides lobbied for a guiding principle in the design of planetary missions that included how to prevent biological contamination of target planetary bodies to preserve their pristine nature until they could be studied in detail. Planetary protection policies today remain as relevant because the pace of exploration has been far slower than their expectation, which was to have completed the search for life in our solar system within 50 years. Today Planetary Protection Policy rides on our definitions of terran life and what we know of its limits on Earth and our limited knowledge of extraterrestrial environments. A brief history of planetary protection is presented with a reminder that the harmful contamination it protects against for Mars is the inability to detect biosignatures should they exist. For illustration, an imaginary life detection mission without planetary protection requirements is discussed. Finally, a brief review is given of current planetary protection implementation methods and new areas of research in this field.

  13. Locating and quantifying PCB sources in Chicago: receptor modeling and field sampling.

    PubMed

    Hsu, Ying-Kuang; Holsen, Thomas M; Hopke, Philip K

    2003-02-15

    Potential source contribution function (PSCF) modeling using polychlorinated biphenyl (PCB) concentrations measured in the Chicago area resolved three PCB source sectors. They were (i) the direction northwest of Chicago, (ii) the direction southwest of Chicago, and (iii) the south side of Chicago in the neighborhood of Lake Calumet. The area south of Chicago was further examined by taking upwind/ downwind samples near a landfill and sludge drying beds. Results identified the sludge drying beds and a large landfill as PCB sources to the atmosphere. Another PCB source identified in Chicago was a transformer storage yard. This site had the highest upwind/downwind concentration increments in this study (downwind PCB concentrations were more than 5 times those in the upwind air). These PCB sources were characterized in terms of inventories, emission rates, contributions, and PCB congener profiles (fingerprints). Preliminarily results indicate that the sludge may emit up to 90 kg/yr of PCBs to the air. This amount is probably not a significant contribution of PCBs to the Chicago atmosphere on the basis of dispersion modeling results and a simple box model.

  14. Methods for preparing comparative standards and field samples for neutron activation analysis of soil

    SciTech Connect

    Glasgow, D.C.; Dyer, F.F.; Robinson, L.

    1994-06-01

    One of the more difficult problems associated with comparative neutron activation analysis (CNAA) is the preparation of standards which are tailor-made to the desired irradiation and counting conditions. Frequently, there simply is not a suitable standard available commercially, or the resulting gamma spectrum is convoluted with interferences. In a recent soil analysis project, the need arose for standards which contained about 35 elements. In response, a computer spreadsheet was developed to calculate the appropriate amount of each element so that the resulting gamma spectrum is relatively free of interferences. Incorporated in the program are options for calculating all of the irradiation and counting parameters including activity produced, necessary flux/bombardment time, counting time, and appropriate source-to-detector distance. The result is multi-element standards for CNAA which have optimal concentrations. The program retains ease of use without sacrificing capability. In addition to optimized standard production, a novel soil homogenization technique was developed which is a low cost, highly efficient alternative to commercially available homogenization systems. Comparative neutron activation analysis for large scale projects has been made easier through these advancements. This paper contains details of the design and function of the NAA spreadsheet and innovative sample handling techniques.

  15. Partitioning of alcohol ethoxylates and polyethylene glycols in the marine environment: field samplings vs laboratory experiments.

    PubMed

    Traverso-Soto, Juan M; Brownawell, Bruce J; González-Mazo, Eduardo; Lara-Martín, Pablo A

    2014-08-15

    Nowadays, alcohol ethoxylates (AEOs) constitute the most important group of non-ionic surfactants, used in a wide range of applications such as household cleaners and detergents. Significant amounts of these compounds and their degradation products (polyethylene glycols, PEGs, which are also used for many other applications) reach aquatic environments, and are eliminated from the water column by degradation and sorption processes. This work deals with the environmental distribution of AEOs and PEGs in the Long Island Sound Estuary, a setting impacted by sewage discharges from New York City (NYC). The distribution of target compounds in seawater was influenced by tides, consistent with salinity differences, and concentrations in suspended solid samples ranged from 1.5 to 20.5 μg/g. The more hydrophobic AEOs were mostly attached to the particulate matter whereas the more polar PEGs were predominant in the dissolved form. Later, the sorption of these chemicals was characterized in the laboratory. Experimental and environmental sorption coefficients for AEOs and PEGs showed average values from 3607 to 164,994 L/kg and from 74 to 32,862 L/kg, respectively. The sorption data were fitted to a Freundlich isotherm model with parameters n and log KF between 0.8-1.2 and 1.46-4.39 L/kg, respectively. AEO and PEG sorptions on marine sediment were also found to be mostly not affected by changes in salinity. PMID:24887194

  16. Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

    USGS Publications Warehouse

    Cecil, L.D.; Knobel, L.L.; Wegner, S.J.; Moore, L.L.

    1989-01-01

    Water from four wells completed in the Snake River Plain aquifer was sampled as part of the U.S. Geological Survey 's quality assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in groundwater at the Idaho National Engineering Laboratory. Water from each well was filtered through either a 0.45-micrometer membrane or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered samples was preserved in the field with reagent-grade hydrochloric acid and the other set of samples was not acidified. For water from wells with strontium-90 concentrations at or above the reporting level, 94% or more of the strontium-90 is in true solution or in colloidal particles smaller than 0.1 micrometer. These results suggest that within-laboratory reproducibility for strontium-90 in groundwater at the INEL is not significantly affected by changes in filtration and preservation methods used for sample collections. (USGS)

  17. Field Research and Laboratory Sample Analysis of Dust-Water-Organics-Life from Mars Analogue Extreme Environments

    NASA Astrophysics Data System (ADS)

    Foing, Bernard H.; Ehrenfreund, Pascale; ILEWG EuroMoonMars Team

    2015-08-01

    We describe results from the data analysis from a series of field research campaigns (ILEWG EuroMoonMars campaigns 2009* to 2013) in the extreme environment of the Utah desert relevant to habitability and astrobiology in Mars environments, and in order to help in the interpretation of Mars missions measurements from orbit (MEX, MRO) or from the surface (MER, MSL). We discuss results relevant to the scientific study of the habitability factors influenced by the properties of dust, organics, water history and the diagnostics and characterisation of microbial life. We also discuss perspectives for the preparation of future lander and sample return missions. We deployed at Mars Desert Research station, Utah, a suite of instruments and techniques including sample collection, context imaging from remote to local and microscale, drilling, spectrometers and life sensors. We analyzed how geological and geochemical evolution a ected local parameters (mineralogy, organics content, environment variations) and the habitability and signature of organics and biota. We find high diversity in the composition of soil samples even when collected in close proximity, the low abundances of detectable PAHs and amino acids and the presence of biota of all three domains of life with signi cant heterogeneity. An extraordinary variety of putative extremophiles was observed. A dominant factor seems to be soil porosity and lower clay-sized particle content. A protocol was developed for sterile sampling, contamination issues, and the diagnostics of biodiversity via PCR and DGGE analysis in soils and rocks samples. We compare 2009 campaign results to new measurements from 2010-2013 campaigns: comparison between remote sensing and in-situ measurements; the study of minerals; the detection of organics and signs of life.References * in Foing, Stoker Ehrenfreund (Editors, 2011) Astrobiology field Research in Moon/Mars Analogue Environments", Special Issue of International Journal of Astrobiology

  18. Megacrystic pyroxene basalts sample deep crustal gabbroic cumulates beneath the Mount Taylor volcanic field, New Mexico

    NASA Astrophysics Data System (ADS)

    Schmidt, Mariek E.; Schrader, Christian M.; Crumpler, Larry S.; Rowe, Michael C.; Wolff, John A.; Boroughs, Scott P.

    2016-04-01

    Distributed over the ~ 2.3 m.y. history of the alkaline and compositionally diverse Mount Taylor Volcanic Field (MTVF), New Mexico is a widespread texturally distinct family of differentiated basalts that contain resorbed megacrysts (up to 3 cm) of plagioclase, clinopyroxene, and olivine ± Ti-magnetite ± ilmenite ± orthopyroxene. These lavas have gabbroic cumulate inclusions with mineral compositions similar to the megacrysts, suggesting a common origin. Gabbroic and megacrystic clinopyroxenes form positive linear arrays in TiO2 (0.2-2.3 wt.%) with respect to Al2O3 (0.7-9.3 wt.%). Plagioclase (An41-80) from representative thin sections analyzed for 87Sr/86Sr by laser ablation ICP-MS range from 0.7036 to 0.7048. The low 87Sr/86Sr plagioclases (0.7036 to 0.7037) are associated with high Ti-Al clinopyroxenes. Likewise, the higher 87Sr/86Sr plagioclases (0.7043 to 0.7047) are associated with the low-Al clinopyroxenes. Taken together, the pyroxene and plagioclase megacrysts appear to track the differentiation of a gabbroic pluton (or related plutons) from alkaline to Si-saturated conditions by fractional crystallization and crustal assimilation. Clinopyroxene-liquid geobarometry calculations suggest that crystallization occurred near the crust-mantle transition at an average of ~ 1200 °C and 12-13 kbar. The distribution of the megacrystic pyroxene basalts suggests that a gabbroic intrusive body underlies subregions of the MTVF that have generated silicic magmas. The gabbro is interpreted to be a significant heat and mass input into the lower crust that is capable of driving the petrogenesis of diverse silicic compositions (through fractionation and crustal assimilation), including mugearites, trachytes, trachy-andesites and dacites, high-Si rhyolites, and topaz rhyolites of the MTVF.

  19. The connection between supernova remnants and the Galactic magnetic field: A global radio study of the axisymmetric sample

    NASA Astrophysics Data System (ADS)

    West, J. L.; Safi-Harb, S.; Jaffe, T.; Kothes, R.; Landecker, T. L.; Foster, T.

    2016-03-01

    The study of supernova remnants (SNRs) is fundamental to understanding the chemical enrichment and magnetism in galaxies, including our own Milky Way. In an effort to understand the connection between the morphology of SNRs and the Galactic magnetic field (GMF), we have examined the radio images of all known SNRs in our Galaxy and compiled a large sample that have an axisymmetric morphology, which we define to mean SNRs with a bilateral or barrel-shaped morphology, in addition to one-sided shells. We selected the cleanest examples and model each of these at their appropriate Galactic position using two GMF models, one of which includes a vertical halo component, and another that is oriented entirely parallel to the plane. Since the magnitude and relative orientation of the magnetic field changes with distance from the sun, we analyze a range of distances, from 0.5 to 10 kpc in each case. Using a physically motivated model of an SNR expanding into an ambient GMF that includes a vertical halo component, we find it is able to reproduce observed morphologies of many SNRs in our sample. These results strongly support the presence of an off-plane, vertical component to the GMF, and the importance of the Galactic field on SNR morphology. Our approach also provides a potentially new method for determining distances to SNRs, or conversely, distances to features in the large-scale GMF if SNR distances are known.

  20. Preservation of Field Samples for Enzymatic and Proteomic Characterization: Analysis of Proteins from the Trophallactic Fluid of Hornets and Yellowjackets

    PubMed Central

    Roskens, Violet A.; Carpenter, James M.; Pickett, Kurt M.; Ballif, Bryan A.

    2010-01-01

    Proteomics is fast becoming one of the most interdisciplinary fields, bridging many chemical and biological disciplines. Major challenges, however, can limit the reach of proteomics to studies of model organisms. Challenges include the adequate preservation of field samples, and the reliance of in-depth proteomics on sequenced genomes. Seeking to better establish the evolutionary relationships of hornets and yellowjackets comprising the subfamily Vespinae, we are combining classical morphological and genomic information with a functional genomics trait using proteomics. Vespine species form highly social colonies and exhibit division of labor in almost all aspects of colony life. An extreme digestive division of labor has been reported in Vespa orientalis, in which larvae but not adult workers exhibit the capacity to digest proteins fully. This makes the colony dependent upon the amino acid-rich trophallactic fluid released to adults by larvae, and implies that the V. orientalis superorganism possesses larval-specific proteases. Identifying the proteases and the species exhibiting such extreme partitioning of digestive labor will allow for tracing the phylogenetic origins and elaboration of that digestive partitioning in the Vespinae. Herein we describe methods, generally applicable to field samples, showing the preservation of proteins and proteolytic activity from adult and larval vespine trophallactic fluid. PMID:20718491

  1. Sensitivity of the central visual field in 70- to 81-year-old male athletes and in a population sample.

    PubMed

    Era, P; Pärssinen, O; Pykälä, P; Jokela, J; Suominen, H

    1994-10-01

    The sensitivity of the central visual field (0 degree-30 degrees) was studied using an automatic Octopus 500E perimeter in elderly male athletes and in a population sample of men of corresponding age. The athletes (N = 96) were endurance and power athletes, who were still active in competitive sports with training histories spanning tens of years. The athletes' results were compared with those of a sample of men of the same age (70-81 years, N = 41) randomly selected from the local population register. The sensitivity values of the athletes, and the endurance athletes in particular, were significantly better than those of the controls, with differences varying from 1 to 2.5 dB in the different areas of the central visual field. Multivariate analyses of the background factors of visual field sensitivity showed that the most important were age, amount of annual training, number of chronic diseases, HDL-cholesterol level, and vital capacity. The results suggest that a long training history, especially of the aerobic type, may be beneficial with respect to the sensitivity of the visual system.

  2. Effect of Nitrate Injection on the Microbial Community in an Oil Field as Monitored by Reverse Sample Genome Probing

    PubMed Central

    Telang, A. J.; Ebert, S.; Foght, J. M.; Westlake, D.; Jenneman, G. E.; Gevertz, D.; Voordouw, G.

    1997-01-01

    The reverse sample genome probe (RSGP) method, developed for monitoring the microbial community in oil fields with a moderate subsurface temperature, has been improved by (i) isolation of a variety of heterotrophic bacteria and inclusion of their genomes on the oil field master filter and (ii) use of phosphorimaging technology for the rapid quantitation of hybridization signals. The new master filter contains the genomes of 30 sulfate-reducing, 1 sulfide-oxidizing, and 16 heterotrophic bacteria. Most have been identified by partial 16S rRNA sequencing. Use of improved RSGP in monitoring the effect of nitrate injection in an oil field indicated that the sulfide-oxidizing, nitrate-reducing isolate CVO (a Campylobacter sp.) becomes the dominant community component immediately after injection. No significant enhancement of other community members, including the sulfate-reducing bacteria, was observed. The elevated level of CVO decayed at most sampling sites within 30 days after nitrate injection was terminated. Chemical analyses indicated a corresponding decrease and subsequent increase in sulfide concentrations. Thus, transient injection of a higher potential electron acceptor into an anaerobic subsurface system can have desirable effects (i.e., reduction of sulfide levels) without a permanent adverse influence on the resident microbial community. PMID:16535595

  3. Woodbridge Army Research Facility RI/FS; volume 1. Field sampling plan. Report for 1995-1996

    SciTech Connect

    Choynowski, J.; Ehlers, M.; Elias, M.; Garcia, M.; Henry, C.

    1996-02-01

    U.S. Army Woodbridge Research Facility (WRF) was used in the past as a major military communications center and a research and development laboratory where electromagnetic pulse energy was tested on military and other equipment. WRF is presently an inactive facility pursuant to the 1991 Base Realignment and Closure list. Past investigation activities indicate that polychlorinated biphenyl compounds (PCBs) are primary chemicals of concern. The WRF is presently in the process of being turned over to the United States Fish and Wildlife Service (USFWS) to be used as a wildlife refuge and training facility. This task calls for provision of the necessary staff and equipment to provide remedial investigation/feasibility support for the USAEC BRAC Program investigation at WRF. The scope of work includes Focused Feasibility Studies, Remedial Investigations, Feasibility Studies, ecological assessments, risk assessments, proposed plans, RODs, and community relations support. This Field Sampling Plan contains a description of the site, sample location rationale, technical approach to field operations, site safety procedures, and methods for ecological assessments, analyses of samples, data management, and disposal of investigation-derived wastes. Information contained in other plans which accompany this submittal is identified.

  4. Iodine-129 Analysis of NTS Near-Field Groundwater Samples on the Multi-Collector ICP-MS

    SciTech Connect

    Williams, R; Ramon, E; Moran, J E; Rose, T P

    2005-02-01

    Iodine was chemically separated from NTS near-field groundwater samples and analyzed for its {sup 129}I/{sup 129}I ratio on a Multi-Collector Inductively Coupled Plasma Mass Spectrometer (MC-ICPMS). The measured ratios were then compared to {sup 129}I/{sup 129}I ratios for identical samples run on the Accelerator Mass Spectrometer (AMS). The MC-ICPMS results in some cases differed from the AMS values by more than an order of magnitude. The disparity in the results is due to isobaric interferences at mass 129 from polyatomic species and {sup 129}Xe in the MC-ICPMS plasma gas. It is anticipated that the interferences can be largely eliminated by (1) improving the molybdenum separation chemistry using a {sup 92}Mo-spike precipitation method, and (2) introducing O{sub 2} to the plasma gas to reduce the {sup 129}Xe interference. The MC-ICPMS detection limit for {sup 129}I/{sup 127}I (measured on reference standards) is on the order of 1E-6 or slightly lower. Most near-field groundwater samples have {sup 129}I/{sup 127}I ratios >1E-6, and should be measurable on the MC-ICPMS once the isobaric interference issues are resolved.

  5. Quantifying Marine Emissions of Biogenic Volatile Organic Compounds Using Laboratory Measurements of Plankton Monocultures and Field Samples

    NASA Astrophysics Data System (ADS)

    Sabolis, A. W.; Meskhidze, N.; Kamykowski, D.; Reed, R. E.

    2010-12-01

    Marine biogenic volatile organic compounds (BVOCs) have been suggested to contribute significant portion of the organic carbon present in ocean atmosphere. In this study emission rates of 40 different hydrocarbons are quantified for lab-grown non-axenic phytoplankton monocultures and ambient samples from the Pamlico-Neuse Estuary, NC. The outcome of environmental conditions on production of BVOCs was examined for different light and temperature conditions. These different regimes are considered proxies for physiological stress-induced effects observed in natural ecosystems. The samples were incubated in a climate controlled room; they were then transferred to smaller volumes (200 ml) for analysis. BVOCs accumulated in the water and headspace above the water were measured by bubbling hydrocarbon-free gas mixture through the sample and passing the gas stream through a gas chromatography/mass spectrometry system equipped with a sample pre-concentrator. Inside the pre-concentrator, the compounds were trapped on a sorbent material, heated, and flushed into the GC-MS column. The pre-concentrator/GC-MS system gave at least 1000 times magnification of the sample concentrations, allowing detection of low ppt levels of hydrocarbons. Here we report results for lab-grown diatoms Thalassiosira weissflogii and Thalassiosira pseudonana, prymnesiophyte Pleurochrysis carterae, and dinoflagellates Karina brevis and Procentrum minimum, as well as field samples. To make results widely usable, all the emissions are normalized to Chlorophyll-a (Chl-a) concentration and cell counts. Our results show that diatoms had the highest isoprene production rate of 2.8 μmol (g Chl-a)-1 h-1 with ranges between 1.4 and 3.6 μmol (g Chl-a)-1 h-1 at light levels between 90 and 900 μE m-2 s-1, respectively. The prymnesiophyte and dinoflagellate species had isoprene production rates of 1.3±0.4 μmol (g Chl-a)-1 h-1 with a similar light dependency as diatoms. Field samples had comparable isoprene

  6. Gas and Isotope Geochemistry of 81 Steam Samples from Wells in The Geysers Geothermal Field, Sonoma and Lake Counties, California

    USGS Publications Warehouse

    Lowenstern, Jacob B.; Janik, Cathy J.; Fahlquist, Lynne; Johnson, Linda S.

    1999-01-01

    The Geysers geothermal field in northern California, with about 2000-MW electrical capacity, is the largest geothermal field in the world. Despite its importance as a resource and as an example of a vapor-dominated reservoir, very few complete geochemical analyses of the steam have been published (Allen and Day, 1927; Truesdell and others, 1987). This report presents data from 90 steam, gas, and condensate samples from wells in The Geysers geothermal field in northern California. Samples were collected between 1978 and 1991. Well attributes include sampling date, well name, location, total depth, and the wellhead temperature and pressure at which the sample was collected. Geochemical characteristics include the steam/gas ratio, composition of noncondensable gas (relative proportions of CO2, H2S, He, H2, O2, Ar, N2, CH4, and NH3), and isotopic values for deltaD and delta18O of H2O, delta13C of CO2, and delta34S of H2S. The compilation includes 81 analyses from 74 different production wells, 9 isotopic analyses of steam condensate pumped into injection wells, and 5 complete geochemical analyses on gases from surface fumaroles and bubbling pools. Most samples were collected as saturated steam and plot along the liquid-water/steam boiling curve. Steam-togas ratios are highest in the southeastern part of the geothermal field and lowest in the northwest, consistent with other studies. Wells in the Northwest Geysers are also enriched in N2/Ar, CO2 and CH4, deltaD, and delta18O. Well discharges from the Southeast Geysers are high in steam/gas and have isotopic compositions and N2/Ar ratios consistent with recharge by local meteoric waters. Samples from the Central Geysers show characteristics found in both the Southeast and Northwest Geysers. Gas and steam characteristics of well discharges from the Northwest Geysers are consistent with input of components from a high-temperature reservoir containing carbonrich gases derived from the host Franciscan rocks. Throughout the

  7. Actualities and Perspectives in Neurosurgery

    PubMed Central

    Iencean, SM; Brehar, FM

    2008-01-01

    In the field of neurosurgery, like in other surgical specialties, the last decades have brought major achievements. The series of revolutionary discoveries has started during the last century in the fifties, with stereotactic radiosurgery, then continued with the implementation of operative microscope (during the seventies), the endovascular embolisation in the nineties and finally with the major improvement in robotic neurosurgery and molecular neurosurgery at the beginning of this century. The major innovation has been brought not only in the field of therapeutical measures but also in the field of neuro– imaging. Thus, the modern MRI with more than 3 Tesla, can reveal to the neurosurgeon the most intimate structures of the nervous system. Several important areas in neurosurgery like: vascular neurosurgery, functional neurosurgery and brain tumors pathology, benefit from the modern technology and from the latest discoveries from genetic and molecular biology. In conclusion, summarizing the discoveries of the last decade, we emphasize that the related areas like genetics, molecular biology, computer technology become more and more important in the future progress of the neurosurgery. PMID:20108475

  8. Multiscale modeling of polycrystalline graphene: A comparison of structure and defect energies of realistic samples from phase field crystal models

    NASA Astrophysics Data System (ADS)

    Hirvonen, Petri; Ervasti, Mikko M.; Fan, Zheyong; Jalalvand, Morteza; Seymour, Matthew; Vaez Allaei, S. Mehdi; Provatas, Nikolas; Harju, Ari; Elder, Ken R.; Ala-Nissila, Tapio

    2016-07-01

    We extend the phase field crystal (PFC) framework to quantitative modeling of polycrystalline graphene. PFC modeling is a powerful multiscale method for finding the ground state configurations of large realistic samples that can be further used to study their mechanical, thermal, or electronic properties. By fitting to quantum-mechanical density functional theory (DFT) calculations, we show that the PFC approach is able to predict realistic formation energies and defect structures of grain boundaries. We provide an in-depth comparison of the formation energies between PFC, DFT, and molecular dynamics (MD) calculations. The DFT and MD calculations are initialized using atomic configurations extracted from PFC ground states. Finally, we use the PFC approach to explicitly construct large realistic polycrystalline samples and characterize their properties using MD relaxation to demonstrate their quality.

  9. Dynamic field sampling of airborne organophosphate triesters using solid-phase microextraction under equilibrium and non-equilibrium conditions.

    PubMed

    Isetun, Sindra; Nilsson, Ulrika

    2005-01-01

    A simple setup for dynamic air sampling using a solid-phase microextraction (SPME) device designed for use in the field was evaluated for organophosphate triester vapour under both equilibrium and non-equilibrium conditions. The effects of varying the applied airflows in the sampling device were evaluated in order to optimise the system with respect to the Reynolds number and magnitude of the boundary layer that developed near the surface. Further, the storage stability of the analytes was studied for both capped and uncapped 100-microm PDMS fibres. Organophosphate triesters are utilized on large scales as flame-retardants and/or plasticizers, for instance in upholstered furniture. In indoor working environments these compounds have become common components in the surrounding air. Measurements were performed in a recently furnished working environment and the concentration of tris(2-choropropyl) phosphate was found to be 7 microg m(-3).

  10. SubPatch: random kd-tree on a sub-sampled patch set for nearest neighbor field estimation

    NASA Astrophysics Data System (ADS)

    Pedersoli, Fabrizio; Benini, Sergio; Adami, Nicola; Okuda, Masahiro; Leonardi, Riccardo

    2015-02-01

    We propose a new method to compute the approximate nearest-neighbors field (ANNF) between image pairs using random kd-tree and patch set sub-sampling. By exploiting image coherence we demonstrate that it is possible to reduce the number of patches on which we compute the ANNF, while maintaining high overall accuracy on the final result. Information on missing patches is then recovered by interpolation and propagation of good matches. The introduction of the sub-sampling factor on patch sets also allows for setting the desired trade off between accuracy and speed, providing a flexibility that lacks in state-of-the-art methods. Tests conducted on a public database prove that our algorithm achieves superior performance with respect to PatchMatch (PM) and Coherence Sensitivity Hashing (CSH) algorithms in a comparable computational time.

  11. The Mass of the Galaxy from Large Samples of Field Horizontal-Branch Stars in the SDSS Early Data Release

    NASA Astrophysics Data System (ADS)

    Beers, T. C.; Chiba, M.; Sakamoto, T.; Wilhelm, R.; Allende Prieto, C.; Sommer-Larsen, J.; Newberg, H. J.; Yanny, B.; Marsteller, B.; Pier, J. R.

    2004-07-01

    We present a new estimate of the mass of the Milky Way, making use of a large sample of 955 field horizontal-branch (FHB) stars from the Early Data Release of the Sloan Digital Sky Survey. This sample of stars has been classified on the basis of an automated analysis approach, in combination with other methods, in order to obtain estimates of the physical parameters of the stars, i.e., T_eff, log g, [Fe/H], and should be relatively free of contamination from halo blue stragglers. The stars all have measured radial velocities and photometric distance estimates, and the sample includes objects as distant as ˜ 75 kpc from the Galactic center. Application of a Bayesian likelihood method, for a specific model of the Galaxy, indicates that the total mass of the Galaxy lies in the range 1.5-4.0 x 1012 M⊙. Our sample appears to reveal a clear signature of a dual halo population of FHB stars, with the boundary between the inner and outer halo around 20 kpc, and the possibility of rather striking differences in the rotational properties of the Galaxy at low metallicity.

  12. Influence of high-conductivity buffer composition on field-enhanced sample injection coupled to sweeping in CE.

    PubMed

    Anres, Philippe; Delaunay, Nathalie; Vial, Jérôme; Thormann, Wolfgang; Gareil, Pierre

    2013-02-01

    The aim of this work was to clarify the mechanism taking place in field-enhanced sample injection coupled to sweeping and micellar EKC (FESI-Sweep-MEKC), with the utilization of two acidic high-conductivity buffers (HCBs), phosphoric acid or sodium phosphate buffer, in view of maximizing sensitivity enhancements. Using cationic model compounds in acidic media, a chemometric approach and simulations with SIMUL5 were implemented. Experimental design first enabled to identify the significant factors and their potential interactions. Simulation demonstrates the formation of moving boundaries during sample injection, which originate at the initial sample/HCB and HCB/buffer discontinuities and gradually change the compositions of HCB and BGE. With sodium phosphate buffer, the HCB conductivity increased during the injection, leading to a more efficient preconcentration by staking (about 1.6 times) than with phosphoric acid alone, for which conductivity decreased during injection. For the same injection time at constant voltage, however, a lower amount of analytes was injected with sodium phosphate buffer than with phosphoric acid. Consequently sensitivity enhancements were lower for the whole FESI-Sweep-MEKC process. This is why, in order to maximize sensitivity enhancements, it is proposed to work with sodium phosphate buffer as HCB and to use constant current during sample injection.

  13. Statistical properties of the surface velocity field in the northern Gulf of Mexico sampled by GLAD drifters

    NASA Astrophysics Data System (ADS)

    Mariano, A. J.; Ryan, E. H.; Huntley, H. S.; Laurindo, L. C.; Coelho, E.; Griffa, A.; Özgökmen, T. M.; Berta, M.; Bogucki, D.; Chen, S. S.; Curcic, M.; Drouin, K. L.; Gough, M.; Haus, B. K.; Haza, A. C.; Hogan, P.; Iskandarani, M.; Jacobs, G.; Kirwan, A. D.; Laxague, N.; Lipphardt, B.; Magaldi, M. G.; Novelli, G.; Reniers, A.; Restrepo, J. M.; Smith, C.; Valle-Levinson, A.; Wei, M.

    2016-07-01

    The Grand LAgrangian Deployment (GLAD) used multiscale sampling and GPS technology to observe time series of drifter positions with initial drifter separation of O(100 m) to O(10 km), and nominal 5 min sampling, during the summer and fall of 2012 in the northern Gulf of Mexico. Histograms of the velocity field and its statistical parameters are non-Gaussian; most are multimodal. The dominant periods for the surface velocity field are 1-2 days due to inertial oscillations, tides, and the sea breeze; 5-6 days due to wind forcing and submesoscale eddies; 9-10 days and two weeks or longer periods due to wind forcing and mesoscale variability, including the period of eddy rotation. The temporal e-folding scales of a fitted drifter velocity autocorrelation function are bimodal with time scales, 0.25-0.50 days and 0.9-1.4 days, and are the same order as the temporal e-folding scales of observed winds from nearby moored National Data Buoy Center stations. The Lagrangian integral time scales increase from coastal values of 8 h to offshore values of approximately 2 days with peak values of 3-4 days. The velocity variance is large, O>(1>) m2/s2, the surface velocity statistics are more anisotropic, and increased dispersion is observed at flow bifurcations. Horizontal diffusivity estimates are O>(103>) m2/s in coastal regions with weaker flow to O>(105>) m2/s in flow bifurcations, a strong jet, and during the passage of Hurricane Isaac. The Gulf of Mexico surface velocity statistics sampled by the GLAD drifters are a strong function of the feature sampled, topography, and wind forcing.

  14. CIP10 optimization for 4,4-methylene diphenyl diisocyanate aerosol sampling and field comparison with impinger method.

    PubMed

    Puscasu, Silvia; Aubin, Simon; Cloutier, Yves; Sarazin, Philippe; Tra, Huu V; Gagné, Sébastien

    2015-04-01

    4,4-methylene diphenyl diisocyanate (MDI) aerosol exposure evaluation in spray foam insulation application is known as being a challenge because the spray foam application actually involves a fast-curing process. Available techniques are either not user-friendly or are inaccurate or not validated for this application. To address these issues, a new approach using a CIP10M was developed to appropriately collect MDI aerosol in spray foam insulation while being suitable for personal sampling. The CIP10M is a commercially available personal aerosol sampler that has been validated for the collection of microbial spores into a liquid medium. Tributylphosphate with 1-(2-methoxyphenyl)piperazine (MOPIP) was introduced into the CIP10M to collect and stabilize the MDI aerosols. The limit of detection and limit of quantification of the method were 0.007 and 0.024 μg ml(-1), respectively. The dynamic range was from 0.024 to 0.787 μg ml(-1) (with R (2) ≥ 0.990), which corresponds to concentrations in the air from 0.04 to 1.3 µg m(-3), assuming 60 min of sampling at 10 l min(-1). The intraday and interday analytical precisions were <2% for all of the concentration levels tested, and the accuracy was within an appropriate range of 98 ± 1%. No matrix effect was observed, and a total recovery of 99% was obtained. Parallel sampling was performed in a real MDI foam spraying environment with a CIP10M and impingers containing toluene/MOPIP (reference method). The results obtained show that the CIP10M provides levels of MDI monomer in the same range as the impingers, and higher levels of MDI oligomers. The negative bias observed for MDI monomer was between 2 and 26%, whereas the positive bias observed for MDI oligomers was between 76 and 113%, with both biases calculated with a confidence level of 95%. The CIP10M seems to be a promising approach for MDI aerosol exposure evaluation in spray foam applications.

  15. Implications of the field sampling procedure of the LUCAS Topsoil Survey for uncertainty in soil organic carbon concentrations.

    NASA Astrophysics Data System (ADS)

    Lark, R. M.; Rawlins, B. G.; Lark, T. A.

    2014-05-01

    The LUCAS Topsoil survey is a pan-European Union initiative in which soil data were collected according to standard protocols from 19 967 sites. Any inference about soil variables is subject to uncertainty due to different sources of variability in the data. In this study we examine the likely magnitude of uncertainty due to the field-sampling protocol. The published sampling protocol (LUCAS, 2009) describes a procedure to form a composite soil sample from aliquots collected to a depth of between approximately 15-20. A v-shaped hole to the target depth is cut with a spade, then a slice is cut from one of the exposed surfaces. This methodology gives rather less control of the sampling depth than protocols used in other soil and geochemical surveys, this may be a substantial source of variation in uncultivated soils with strong contrasts between an organic-rich A-horizon and an underlying B-horizon. We extracted all representative profile descriptions from soil series recorded in the memoir of the 1:250 000-scale map of Northern England (Soil Survey of England and Wales, 1984) where the base of the A-horizon is less than 20 cm below the surface. The Soil Associations in which these 14 series are significant members cover approximately 17% of the area of Northern England, and are expected to be the mineral soils with the largest organic content. Soil Organic Carbon content and bulk density were extracted for the A- and B-horizons, along with the thickness of the horizons. Recorded bulk density, or prediction by a pedotransfer function, were also recorded. For any proposed angle of the v-shaped hole, the proportions of A- and B-horizon in the resulting sample may be computed by trigonometry. From the bulk density and SOC concentration of the horizons, the SOC concentration of the sample can be computed. For each Soil Series we drew 1000 random samples from a trapezoidal distribution of angles, with uniform density over the range corresponding to depths 15-20 cm and

  16. Evaluating the roles of biotransformation, spatial concentration differences, organism home range, and field sampling design on trophic magnification factors.

    PubMed

    Kim, Jaeshin; Gobas, Frank A P C; Arnot, Jon A; Powell, David E; Seston, Rita M; Woodburn, Kent B

    2016-05-01

    Trophic magnification factors (TMFs) are field-based measurements of the bioaccumulation behavior of chemicals in food-webs. TMFs can provide valuable insights into the bioaccumulation behavior of chemicals. However, bioaccumulation metrics such as TMF may be subject to considerable uncertainty as a consequence of systematic bias and the influence of confounding variables. This study seeks to investigate the role of systematic bias resulting from spatially-variable concentrations in water and sediments and biotransformation rates on the determination of TMF. For this purpose, a multibox food-web bioaccumulation model was developed to account for spatial concentration differences and movement of organisms on chemical concentrations in aquatic biota and TMFs. Model calculated and reported field TMFs showed good agreement for persistent polychlorinated biphenyl (PCB) congeners and biotransformable phthalate esters (PEs) in a marine aquatic food-web. Model testing showed no systematic bias and good precision in the estimation of the TMF for PCB congeners but an apparent underestimation of model calculated TMFs, relative to reported field TMFs, for PEs. A model sensitivity analysis showed that sampling designs that ignore the presence of concentration gradients may cause systematically biased and misleading TMF values. The model demonstrates that field TMFs are most sensitive to concentration gradients and species migration patterns for substances that are subject to a low degree of biomagnification or trophic dilution. The model is useful in anticipating the effect of spatial concentration gradients on the determination of the TMF; guiding species collection strategies in TMF studies; and interpretation of the results of field bioaccumulation studies in study locations where spatial differences in chemical concentration exist.

  17. Sampling field heterogeneity at the heme of c-type cytochromes by spectral hole burning spectroscopy and electrostatic calculations.

    PubMed Central

    Laberge, M; Köhler, M; Vanderkooi, J M; Friedrich, J

    1999-01-01

    We report on a comparative investigation of the heme pocket fields of two Zn-substituted c-type cytochromes-namely yeast and horse heart cytochromes c-using a combination of hole burning Stark spectroscopy and electrostatic calculations. The spectral hole burning experiments are consistent with different pocket fields experienced at the hemes of the respective cytochromes. In the case of horse heart Zn-cytochrome c, two distinguishable electronic origins with different electrostatic properties are observed. The yeast species, on the other hand, displays a single electronic origin. Electrostatic calculations and graphics modeling using the linearized finite-difference Poisson-Boltzmann equation performed at selected time intervals on nanosecond-molecular dynamics trajectories show that the hemes of the respective cytochromes sample different potentials as they explore conformational space. The electrostatic potentials generated by the protein matrix at the heme show different patterns in both cytochromes, and we suggest that the cytochromes differ by the number of "electrostatic substates" that they can sample, thus accounting for the different spectral populations observed in the two cytochromes. PMID:10585951

  18. Laboratory and Field Testing of an Automated Atmospheric Particle-Bound Reactive Oxygen Species Sampling-Analysis System

    PubMed Central

    Wang, Yungang; Hopke, Philip K.; Sun, Liping; Chalupa, David C.; Utell, Mark J.

    2011-01-01

    In this study, various laboratory and field tests were performed to develop an effective automated particle-bound ROS sampling-analysis system. The system uses 2′ 7′-dichlorofluorescin (DCFH) fluorescence method as a nonspecific, general indicator of the particle-bound ROS. A sharp-cut cyclone and a particle-into-liquid sampler (PILS) were used to collect PM2.5 atmospheric particles into slurry produced by a DCFH-HRP solution. The laboratory results show that the DCFH and H2O2 standard solutions could be kept at room temperature for at least three and eight days, respectively. The field test in Rochester, NY, shows that the average ROS concentration was 8.3 ± 2.2 nmol of equivalent H2O2 m−3 of air. The ROS concentrations were observed to be greater after foggy conditions. This study demonstrates the first practical automated sampling-analysis system to measure this ambient particle component. PMID:21577270

  19. A novel capillary electrophoresis method with pressure assisted field amplified sample injection in determination of thiol collectors in flotation process waters.

    PubMed

    Sihvonen, T; Aaltonen, A; Leppinen, J; Hiltunen, S; Sirén, H

    2014-01-17

    A new capillary electrophoresis method was developed for the quantification of diisobutyldithiophosphate (DTP), diisobutyldithiophosphinate (DTPI) and ethyl and isobutyl xanthates (EX, IBX) all of which are used as thiol collectors in froth flotation. This method uses pressure assisted field amplified sample injection (PA-FASI) to concentrate the analytes at the capillary inlet. The background electrolyte in electrophoretic separation was 60millimolar (mM) from 3-(cyclohexylamino)propane-1-sulfonic acid (CAPS) in 40mM NaOH solution. The similar CAPS electrolyte solution has earlier been used for screening for diuretics that contained sulphonamide and/or carboxylic groups. In this study, the functional groups are xanthate, phosphate and phosphinate. The method was developed using actual flotation process waters. The results showed that the water delivered from the plant did not contain significant amount of collectors; therefore, method development was accomplished by spiking analytes in these waters. Separation of analytes was achieved in 15min. The range of quantification was 0.27-66.6mg/L (R(2) 0.9991-0.9999) for all analytes other than ethyl xanthate, for which the range was 0.09-66.6mg/L (R(2) 0.9999). LOD (S/N=3) and LOQ (S/N=10) values for DTP, DTPI, IBX and EX were 0.05, 0.07, 0.06 and 0.01mg/L and 0.16, 0.25, 0.21 and 0.04mg/L, respectively. No interference from the matrices was observed, when the method was tested at a gold concentrator plant.

  20. Sampling in the Snow: High School Winter Field Experiences Provide Relevant, Real World Connections Between Scientific Practices and Disciplinary Core Ideas

    NASA Astrophysics Data System (ADS)

    Hanson, E. W.; Burakowski, E. A.

    2014-12-01

    For much of the northern United States, the months surrounding the winter solstice are times of increased darkness, low temperatures, and frozen landscapes. It's a time when many high school science educators, who otherwise would venture outside with their classes, hunker down and are wary of the outdoors. However, a plethora of learning opportunities lies just beyond the classroom. Working collaboratively, a high school science teacher and a snow scientist have developed multiple activities to engage students in the scientific process of collecting, analyzing and interpreting the winter world using snow data to (1) learn about the insulative properties of snow, and (2) to learn about the role of snow cover on winter climate through its reflective properties while participating in a volunteer network that collects snow depth, albedo (reflectivity), and density data. These outdoor field-based snow investigations incorporate Next Generation Science Standards (NGSS) and disciplinary core ideas, including ESS2.C: The roles of water in Earth's surface processes and ESS2.D: Weather and Climate. Additionally, the lesson plans presented address Common Core State Standards (CCSS) in Mathematics, including the creation and analysis of bar graphs and time series plots (CCSS.Math.HSS-ID.A.1) and xy scatter plots (CCSS.Math.HSS-ID.B.6). High school students participating in the 2013/2014 snow sampling season described their outdoor learning experience as "authentic" and "hands-on" as compared to traditional class indoors. They emphasized that learning outdoors was essential to their understanding of underlying content and concepts because they "learn through actual experience."

  1. A FLUX-LIMITED SAMPLE OF z {approx} 1 Ly{alpha} EMITTING GALAXIES IN THE CHANDRA DEEP FIELD SOUTH ,

    SciTech Connect

    Barger, A. J.; Wold, I. G. B.; Cowie, L. L.

    2012-04-20

    We describe a method for obtaining a flux-limited sample of Ly{alpha} emitters from Galaxy Evolution Explorer (GALEX) grism data. We show that the multiple GALEX grism images can be converted into a three-dimensional (two spatial axes and one wavelength axis) data cube. The wavelength slices may then be treated as narrowband images and searched for emission-line galaxies. For the GALEX NUV grism data, the method provides a Ly{alpha} flux-limited sample over the redshift range z = 0.67-1.16. We test the method on the Chandra Deep Field South field, where we find 28 Ly{alpha} emitters with faint continuum magnitudes (NUV > 22) that are not present in the GALEX pipeline sample. We measure the completeness by adding artificial emitters and measuring the fraction recovered. We find that we have an 80% completeness above a Ly{alpha} flux of 10{sup -15} erg cm{sup -2} s{sup -1}. We use the UV spectra and the available X-ray data and optical spectra to estimate the fraction of active galactic nuclei in the selection. We report the first detection of a giant Ly{alpha} blob at z < 1, though we find that these objects are much less common at z = 1 than at z = 3. Finally, we compute limits on the z {approx} 1 Ly{alpha} luminosity function and confirm that there is a dramatic evolution in the luminosity function over the redshift range z = 0-1.

  2. Sediment and radionuclide transport in rivers. Phase 2. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-04-01

    As part of a study on sediment and radionuclide transport in rivers, Pacific Northwest Laboratory (PNL) is investigating the effect of sediment on the transport of radionuclides in Cattaraugus and Buttermilk Creeks, New York. A source of radioactivity in these creeks is the Western New York Nuclear Service Center which consists of a low-level waste disposal site and a nuclear fuel reprocessing plant. Other sources of radioactivity include fallout from worldwide weapons testing and natural background radioactivity. The major objective of the PNL Field Sampling Program is to provide data on sediment and radionuclide characteristics in Cattaraugus and Buttermilk Creeks to verify the use of the Sediment and Radionuclide Transport model, SERATRA, for nontidal rivers. This report covers the results of field data collection conducted during September 1978. Radiological analysis of sand, silt, and clay size fractions of suspended and bed sediment, and water were performed. Results of these analyses indicate that the principal radionuclides occurring in these two water courses, with levels significantly higher than background levels, during the Phase 2 sampling program were Cesium-137 and Strontium-90. These radionuclides had significantly higher activity levels above background in the bed sediment, suspended sediment, and water samples. Other radionuclides that are possibly being released into the surface water environment by the Nuclear Fuel Services facilities are Plutonium-238, 239, and 240, Americium-241, Curium-244, and Tritium. More radionuclides were consistently found in the bed sediment as compared to suspended sediment. The fewest radionuclides were found in the water of Buttermilk and Cattaraugus Creeks. The higher levels were found in the bed sediments for the gamma-emitters and in the suspended sediment for the alpha and beta-emitters (not including Tritium).

  3. Reduction of magnetic field fluctuations in powered magnets for NMR using inductive measurements and sampled-data feedback control.

    PubMed

    Li, Mingzhou; Schiano, Jeffrey L; Samra, Jenna E; Shetty, Kiran K; Brey, William W

    2011-10-01

    Resistive and hybrid (resistive/superconducting) magnets provide substantially higher magnetic fields than those available in low-temperature superconducting magnets, but their relatively low spatial homogeneity and temporal field fluctuations are unacceptable for high resolution NMR. While several techniques for reducing temporal fluctuations have demonstrated varying degrees of success, this paper restricts attention to methods that utilize inductive measurements and feedback control to actively cancel the temporal fluctuations. In comparison to earlier studies using analog proportional control, this paper shows that shaping the controller frequency response results in significantly higher reductions in temporal fluctuations. Measurements of temporal fluctuation spectra and the frequency response of the instrumentation that cancels the temporal fluctuations guide the controller design. In particular, we describe a sampled-data phase-lead-lag controller that utilizes the internal model principle to selectively attenuate magnetic field fluctuations caused by the power supply ripple. We present a quantitative comparison of the attenuation in temporal fluctuations afforded by the new design and a proportional control design. Metrics for comparison include measurements of the temporal fluctuations using Faraday induction and observations of the effect that the fluctuations have on nuclear resonance measurements.

  4. The psychometric properties of the personality inventory for DSM-5 in an APA DSM-5 field trial sample.

    PubMed

    Quilty, Lena C; Ayearst, Lindsay; Chmielewski, Michael; Pollock, Bruce G; Bagby, R Michael

    2013-06-01

    Section 3 of the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) includes a hybrid model of personality pathology, in which dimensional personality traits are used to derive one of seven categorical personality disorder diagnoses. The Personality Inventory for DSM-5 (PID-5) was developed by the DSM-5 Personality and Personality Disorders workgroup and their consultants to produce a freely available instrument to assess the personality traits within this new system. To date, the psychometric properties of the PID-5 have been evaluated primarily in undergraduate student and community adult samples. In the current investigation, we extend this line of research to a psychiatric patient sample who participated in the APA DSM-5 Field Trial (Centre for Addiction and Mental Health site). A total of 201 psychiatric patients (102 men, 99 women) completed the PID-5 and the Revised NEO Personality Inventory (NEO PI-R). The internal consistencies of the PID-5 domain and facet trait scales were acceptable. Results supported the unidimensional structure of all trait scales but one, and the convergence between the PID-5 and analogous NEO PI-R scales. Evidence for discriminant validity was mixed. Overall, the current investigation provides support for the psychometric properties of this diagnostic instrument in psychiatric samples.

  5. Preliminary Evaluation of the Field and Laboratory Emission Cell (FLEC) for Sampling Attribution Signatures from Building Materials

    SciTech Connect

    Harvey, Scott D.; He, Lijian; Wahl, Jon H.

    2012-08-30

    This study provides a preliminary evaluation of the Field and Laboratory Emission Cell (FLEC) for its suitability for sampling building materials for toxic compounds and their associated impurities and residues that might remain after a terrorist chemical attack. Chemical warfare (CW) agents and toxic industrial chemicals were represented by a range of test probes that included CW surrogates. The test probes encompassed the acid-base properties, volatilities, and polarities of the expected chemical agents and residual compounds. Results indicated that dissipation of the test probes depended heavily on the underlying material. Near complete dissipation of almost all test probes occurred from galvanized stainless steel within 3.0 hrs, whereas far stronger retention with concomitant slower release was observed for vinyl composition floor tiles. The test probes displayed immediated permanence on Teflon. FLEC sampling was further evaluated by profiling residues remaining after the evaporation of 2-chloroethyl ethyl sulfide, a sulfur mustard simulant. This study lays the groundwork for the eventual goal of applying this sampling approach for collection of forensic attribution signatures that remain after a terrorist chemical attack.

  6. Physical properties of two core samples from Well 34-9RD2 at the Coso geothermal field, California

    USGS Publications Warehouse

    Morrow, C.A.; Lockner, D.A.

    2006-01-01

    The Coso geothermal field, located along the Eastern California Shear Zone, is composed of fractured granitic rocks above a shallow heat source. Temperatures exceed 640 ?F (~338 ?C) at a depth of less than 10000 feet (3 km). Permeability varies throughout the geothermal field due to the competing processes of alteration and mineral precipitation, acting to reduce the interconnectivity of faults and fractures, and the generation of new fractures through faulting and brecciation. Currently, several hot regions display very low permeability, not conducive to the efficient extraction of heat. Because high rates of seismicity in the field indicate that the area is highly stressed, enhanced permeability can be stimulated by increasing the fluid pressure at depth to induce faulting along the existing network of fractures. Such an Enhanced Geothermal System (EGS), planned for well 46A-19RD, would greatly facilitate the extraction of geothermal fluids from depth by increasing the extent and depth of the fracture network. In order to prepare for and interpret data from such a stimulation experiment, the physical properties and failure behavior of the target rocks must be fully understood. Various diorites and granodiorites are the predominant rock types in the target area of the well, which will be pressurized from 10000 feet measured depth (MD) (3048m MD) to the bottom of the well at 13,000 feet MD (3962 m MD). Because there are no core rocks currently available from well 46A-19RD, we report here on the results of compressive strength, frictional sliding behavior, and elastic measurements of a granodiorite and diorite from another well, 34-9RD2, at the Coso site. Rocks cored from well 34-9RD2 are the deepest samples to date available for testing, and are representative of rocks from the field in general.

  7. Isolation of Legionella species from Noyu (unattended natural hot springs in mountains and fields) samples in Japan.

    PubMed

    Furuhata, Katsunori; Edagawa, Akiko; Ishizaki, Naoto; Fukuyama, Masafumi

    2013-01-01

    In order to understand the habitation conditions of the bacteria of the genus Legionella in Noyu (unattended natural hot springs in mountains and fields) in Japan, isolation of Legionella spp. was attempted in the Noyu samples from 11 prefectures nationwide between May and September 2012, and the following results were obtained. Overall, Legionella spp. was isolated from 16 of 43 samples (37.2%). The species was isolated from the Hokkaido region to the Chugoku region but not from the Shikoku region to the Kyushu region. The number of bacteria detected was usually small, less than 5.0 × 10(1) CFU/100 ml, as found in 11 samples (68.8%), while counts of 10(2) or more to 10(3) or less CFU/100 ml were found in two samples (12.5%). Legionella pneumophila was the most commonly found strain, with 19 strains (90.5%) found, and was the dominant species. Regarding the serogrouping, four strains (21.1%) fell under group 1, the most common grouping, followed by three strains (15.8%) in group 3, two strains (10.5%) in group 5, etc. Moreover, the detected bacterial strains other than L. pneumophila included two strains (9.5%) of L. londiniensis. The temperature of the Noyu from which Legionella spp. was isolated was between 33.1°C and 41.5°C with a pH ranging from 5.2 to 8.1. The present report is the first report to clarify the habitation conditions of strains of Legionella spp. isolated from Noyu in Japan.

  8. A Sample of Very Young Field L Dwarfs and Implications for the Brown Dwarf "Lithium Test" at Early Ages

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, J. Davy; Cruz, Kelle L.; Barman, Travis S.; Burgasser, Adam J.; Looper, Dagny L.; Tinney, C. G.; Gelino, Christopher R.; Lowrance, Patrick J.; Liebert, James; Carpenter, John M.; Hillenbrand, Lynne A.; Stauffer, John R.

    2008-12-01

    Using a large sample of optical spectra of late-type dwarfs, we identify a subset of late-M through L field dwarfs that, because of the presence of low-gravity features in their spectra, are believed to be unusually young. From a combined sample of 303 field L dwarfs, we find observationally that 7.6% +/- 1.6% are younger than 100 Myr. This percentage is in agreement with theoretical predictions once observing biases are taken into account. We find that these young L dwarfs tend to fall in the southern hemisphere (decl . < 0°) and may be previously unrecognized, low-mass members of nearby, young associations like Tucana-Horologium, TW Hydrae, β Pictoris, and AB Doradus. We use a homogeneously observed sample of ~150 optical spectra to examine lithium strength as a function of L/T spectral type and further corroborate the trends noted by Kirkpatrick and coworkers. We use our low-gravity spectra to investigate lithium strength as a function of age. The data weakly suggest that for early- to mid-L dwarfs the line strength reaches a maximum for a few × 100 Myr, whereas for much older (few Gyr) and much younger (<100 Myr) L dwarfs the line is weaker or undetectable. We show that a weakening of lithium at lower gravities is predicted by model atmosphere calculations, an effect partially corroborated by existing observational data. Larger samples containing L dwarfs of well-determined ages are needed to further test this empirically. If verified, this result would reinforce the caveat first cited by Kirkpatrick and coworkers that the lithium test should be used with caution when attempting to confirm the substellar nature of the youngest brown dwarfs. Most of the spectroscopic data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous

  9. Persistent Organic Pollutant Determination in Killer Whale Scat Samples: Optimization of a Gas Chromatography/Mass Spectrometry Method and Application to Field Samples.

    PubMed

    Lundin, Jessica I; Dills, Russell L; Ylitalo, Gina M; Hanson, M Bradley; Emmons, Candice K; Schorr, Gregory S; Ahmad, Jacqui; Hempelmann, Jennifer A; Parsons, Kim M; Wasser, Samuel K

    2016-01-01

    Biologic sample collection in wild cetacean populations is challenging. Most information on toxicant levels is obtained from blubber biopsy samples; however, sample collection is invasive and strictly regulated under permit, thus limiting sample numbers. Methods are needed to monitor toxicant levels that increase temporal and repeat sampling of individuals for population health and recovery models. The objective of this study was to optimize measuring trace levels (parts per billion) of persistent organic pollutants (POPs), namely polychlorinated-biphenyls (PCBs), polybrominated-diphenyl-ethers (PBDEs), dichlorodiphenyltrichloroethanes (DDTs), and hexachlorocyclobenzene, in killer whale scat (fecal) samples. Archival scat samples, initially collected, lyophilized, and extracted with 70 % ethanol for hormone analyses, were used to analyze POP concentrations. The residual pellet was extracted and analyzed using gas chromatography coupled with mass spectrometry. Method detection limits ranged from 11 to 125 ng/g dry weight. The described method is suitable for p,p'-DDE, PCBs-138, 153, 180, and 187, and PBDEs-47 and 100; other POPs were below the limit of detection. We applied this method to 126 scat samples collected from Southern Resident killer whales. Scat samples from 22 adult whales also had known POP concentrations in blubber and demonstrated significant correlations (p < 0.01) between matrices across target analytes. Overall, the scat toxicant measures matched previously reported patterns from blubber samples of decreased levels in reproductive-age females and a decreased p,p'-DDE/∑PCB ratio in J-pod. Measuring toxicants in scat samples provides an unprecedented opportunity to noninvasively evaluate contaminant levels in wild cetacean populations; these data have the prospect to provide meaningful information for vital management decisions. PMID:26298464

  10. Persistent Organic Pollutant Determination in Killer Whale Scat Samples: Optimization of a Gas Chromatography/Mass Spectrometry Method and Application to Field Samples.

    PubMed

    Lundin, Jessica I; Dills, Russell L; Ylitalo, Gina M; Hanson, M Bradley; Emmons, Candice K; Schorr, Gregory S; Ahmad, Jacqui; Hempelmann, Jennifer A; Parsons, Kim M; Wasser, Samuel K

    2016-01-01

    Biologic sample collection in wild cetacean populations is challenging. Most information on toxicant levels is obtained from blubber biopsy samples; however, sample collection is invasive and strictly regulated under permit, thus limiting sample numbers. Methods are needed to monitor toxicant levels that increase temporal and repeat sampling of individuals for population health and recovery models. The objective of this study was to optimize measuring trace levels (parts per billion) of persistent organic pollutants (POPs), namely polychlorinated-biphenyls (PCBs), polybrominated-diphenyl-ethers (PBDEs), dichlorodiphenyltrichloroethanes (DDTs), and hexachlorocyclobenzene, in killer whale scat (fecal) samples. Archival scat samples, initially collected, lyophilized, and extracted with 70 % ethanol for hormone analyses, were used to analyze POP concentrations. The residual pellet was extracted and analyzed using gas chromatography coupled with mass spectrometry. Method detection limits ranged from 11 to 125 ng/g dry weight. The described method is suitable for p,p'-DDE, PCBs-138, 153, 180, and 187, and PBDEs-47 and 100; other POPs were below the limit of detection. We applied this method to 126 scat samples collected from Southern Resident killer whales. Scat samples from 22 adult whales also had known POP concentrations in blubber and demonstrated significant correlations (p < 0.01) between matrices across target analytes. Overall, the scat toxicant measures matched previously reported patterns from blubber samples of decreased levels in reproductive-age females and a decreased p,p'-DDE/∑PCB ratio in J-pod. Measuring toxicants in scat samples provides an unprecedented opportunity to noninvasively evaluate contaminant levels in wild cetacean populations; these data have the prospect to provide meaningful information for vital management decisions.

  11. Residue levels of captan and trichlorfon in field-treated kaki fruits, individual versus composite samples, and after household processing.

    PubMed

    Fernández-Cruz, M L; Grimalt, S; Villarroya, M; López, F J; Llanos, S; García-Baudín, J M

    2006-06-01

    The dissipation of residue levels of captan and trichlorfon in field-treated kaki crops was studied according to good laboratory practices to propose maximum residue limits (MRLs). Residue levels of captan and trichlorfon were analysed by GC/MS and LC-MS/MS, respectively. Residue levels of captan and trichlorfon permitted one to propose MRLs in kaki of 3 and 5 mg kg(-1), respectively. The behaviour of these residues was also studied after peeling and cooking, and in individual fruits versus composite samples. Residue levels of these compounds for individual fruits suggested that a variability factor up to three could be set for the acute risk assessment. Levels of captan decreased by more than 90% after peeling and completely after cooking. Trichlorfon penetrates into the flesh in a proportion of 70% of the residue at the pre-harvest interval. Cooking resulted in a decrease of 27% of residue levels of trichlorfon.

  12. Final field-sampling plan for surface and ground-water investigation at the Milwaukee Army Reserve Center (MIARC)

    SciTech Connect

    Not Available

    1992-02-24

    This Field Sampling Plan has been prepared by OHM Remediation Services Corp. (OHM), a wholly owned subsidiary of OHM Corporation, to support Task order No. 004 of Contract No. DAAA15-90-D-0019 for the Surface and Ground Water Investigation at the Milwaukee Army Reserve Center (MIARC). MIARC is located in eastern Wisconsin, approximately 5 miles from the western shore of Lake Michigan between North 48th and North 55th streets in the City of Milwaukee as shown in Figure 1-1. This property lies adjacent to, and directly north of, West Silver Spring Drive. The reserve center is comprised of several administrative/maintenance buildings located on approximately 60 acres with additional Adjacent training areas. The complex includes military reserve buildings, a motor repair shop, paved roadways, parking areas, and sidewalks. The entire facility is fenced, however, public access is unrestricted in the northwest corner of the site.

  13. Advantages of a Synchrotron Bending Magnet as the Sample Illuminator for a Wide-field X-ray Microscope

    SciTech Connect

    Feser, M.; Howells, M. R.; Kirz, J.; Rudati, J.; Yun, W.

    2012-09-01

    In our paper the choice between bending magnets and insertion devices as sample illuminators for a hard X-ray full-field microscope is investigated. An optimized bending-magnet beamline design is presented. Its imaging speed is very competitive with the performance of similar microscopes installed currently at insertion-device beamlines. The fact that imaging X-ray microscopes can accept a large phase space makes them very well suited to the output characteristics of bending magnets which are often a plentiful and paid-for resource. There exist opportunities at all synchrotron light sources to take advantage of this finding to build bending-magnet beamlines that are dedicated to transmission X-ray microscope facilities. We expect that demand for such facilities will increase as three-dimensional tomography becomes routine and advanced techniques such as mosaic tomography and XANES tomography (taking three-dimensional tomograms at different energies to highlight elemental and chemical differences) become more widespread.

  14. Actual Leisure Participation of Norwegian Adolescents with Down Syndrome

    ERIC Educational Resources Information Center

    Dolva, Anne-Stine; Kleiven, Jo; Kollstad, Marit

    2014-01-01

    This article reports the actual participation in leisure activities by a sample of Norwegian adolescents with Down syndrome aged 14. Representing a first generation to grow up in a relatively inclusive context, they live with their families, attend mainstream schools, and are part of common community life. Leisure information was obtained in…

  15. Stability Tests with Actual Savannah River Site Radioactive Waste

    SciTech Connect

    Walker, D.D.

    2002-09-09

    solutions in two laboratory experiments. The first experiment tested four waste solutions for supersaturation of aluminum by monitoring the aluminum concentration after seeding with gibbsite. The second experiment tested two waste samples for precipitation of aluminosilicates by heating the solutions to accelerate solids formation. The results of the experiments with actual waste solutions are supported in this report.

  16. Effect of an absorbent overlay on the residual stress field induced by laser shock processing on aluminum samples

    NASA Astrophysics Data System (ADS)

    Rubio-González, C.; Gomez-Rosas, G.; Ocaña, J. L.; Molpeceres, C.; Banderas, A.; Porro, J.; Morales, M.

    2006-07-01

    Laser shock processing (LSP) or laser shock peening is a new technique for strengthening metals. This process induces a compressive residual stress field, which increases fatigue crack initiation life and reduces fatigue crack growth rate. Specimens of 6061-T6 aluminum alloy are used in this investigation. A convergent lens is used to deliver 2.5 J, 8 ns laser pulses by a Q-switch Nd:YAG laser, operating at 10 Hz. The pulses are focused to a diameter of 1.5 mm onto aluminum samples. Density of 2500 pulses/cm 2 with infrared (1064 nm) radiation was used. The effect of an absorbent overlay on the residual stress field using this LSP setup and this energy level is evaluated. Residual stress distribution as a function of depth is assessed by the hole drilling method. It is observed that the overlay makes the compressive residual stress profile move to the surface. This effect is explained on the basis of the vaporization of the coat layer suppressing thermal effects on the metallic substrate. The effect of coating the specimen surface before LSP treatment may have advantages on improving wear and contact fatigue properties of this aluminum alloy.

  17. The effects of composition, temperature and sample size on the sintering of chem-prep high field varistors.

    SciTech Connect

    Garino, Terry J.

    2007-09-01

    The sintering behavior of Sandia chem-prep high field varistor materials was studied using techniques including in situ shrinkage measurements, optical and scanning electron microscopy and x-ray diffraction. A thorough literature review of phase behavior, sintering and microstructure in Bi{sub 2}O{sub 3}-ZnO varistor systems is included. The effects of Bi{sub 2}O{sub 3} content (from 0.25 to 0.56 mol%) and of sodium doping level (0 to 600 ppm) on the isothermal densification kinetics was determined between 650 and 825 C. At {ge} 750 C samples with {ge}0.41 mol% Bi{sub 2}O{sub 3} have very similar densification kinetics, whereas samples with {le}0.33 mol% begin to densify only after a period of hours at low temperatures. The effect of the sodium content was greatest at {approx}700 C for standard 0.56 mol% Bi{sub 2}O{sub 3} and was greater in samples with 0.30 mol% Bi{sub 2}O{sub 3} than for those with 0.56 mol%. Sintering experiments on samples of differing size and shape found that densification decreases and mass loss increases with increasing surface area to volume ratio. However, these two effects have different causes: the enhancement in densification as samples increase in size appears to be caused by a low oxygen internal atmosphere that develops whereas the mass loss is due to the evaporation of bismuth oxide. In situ XRD experiments showed that the bismuth is initially present as an oxycarbonate that transforms to metastable {beta}-Bi{sub 2}O{sub 3} by 400 C. At {approx}650 C, coincident with the onset of densification, the cubic binary phase, Bi{sub 38}ZnO{sub 58} forms and remains stable to >800 C, indicating that a eutectic liquid does not form during normal varistor sintering ({approx}730 C). Finally, the formation and morphology of bismuth oxide phase regions that form on the varistors surfaces during slow cooling were studied.

  18. H I CONTENT AND OPTICAL PROPERTIES OF FIELD GALAXIES FROM THE ALFALFA SURVEY. I. SELECTION OF A CONTROL SAMPLE

    SciTech Connect

    Toribio, M. Carmen; Solanes, Jose M.; Giovanelli, Riccardo; Haynes, Martha P.; Masters, Karen L. E-mail: jm.solanes@ub.edu E-mail: haynes@astro.cornell.edu

    2011-05-10

    We report results from a study of the H I content and stellar properties of nearby galaxies detected by the Arecibo Legacy Fast ALFA blind 21 cm line survey and the Sloan Digital Sky Survey. We consider two declination strips covering a total area of 9 hr x 16 deg in the general direction of the Virgo Cluster. The present analysis focuses on gas-rich galaxies expected to show little or no evidence of interaction with their surroundings. We seek to assemble a control sample suitable for providing absolute measures of the H I content of gaseous objects, as well as to study the relationship between H I emission and widely used optical measures of morphology. From a database which includes more than 15,000 H I detections, we have assembled three samples that could provide adequate H I standards. The most reliable results are obtained with a sample of 5647 sources found in low-density environments, as defined by a nearest neighbor approach. The other two samples contain several hundred relatively isolated galaxies each, as determined from standard isolation algorithms based either on a combination of spectroscopic and photometric information or solely on photometric data. We find that isolated objects are not particularly gas-rich compared to their low-density-environment counterparts, while they suffer from selection bias and span a smaller dynamic range. All this makes them less suitable for defining a reference for H I content. We have explored the optical morphology of gaseous galaxies in quiet environments, finding that, within the volume surveyed, the vast majority of them display unequivocal late-type galaxy features. In contrast, bona fide gas-rich early-type systems account only for a negligible fraction of the 21 cm detections. We argue that H I emission provides the most reliable way to determine the morphological population to which a galaxy belongs. We have also observed that the color distribution of flux-limited samples of optically selected field H I

  19. Field Air Sampling and Simultaneous Chemical and Sensory Analysis of Livestock Odorants with Sorbent Tube GC-MS/Olfactometry

    SciTech Connect

    Zhang Shicheng; Cai Lingshuang; Koziel, Jacek A.; Hoff, Steven; Clanton, Charles; Schmidt, David; Jacobson, Larry; Parker, David; Heber, Albert

    2009-05-23

    Characterization and quantification of livestock odorants is one of the most challenging analytical tasks because odor-causing gases are very reactive, polar and often present at very low concentrations in a complex matrix of less important or irrelevant gases. The objective of this research was to develop a novel analytical method for characterization of the livestock odorants including their odor character, odor intensity, and hedonic tone and to apply this method for quantitative analysis of the key odorants responsible for livestock odor. Sorbent tubes packed with Tenax TA were used for field sampling. The automated one-step thermal desorption module coupled with multidimensional gas chromatography-mass spectrometry/olfactometry system was used for simultaneous chemical and odor analysis. Fifteen odorous VOCs and semi-VOCs identified from different livestock species operations were quantified. Method detection limits ranges from 40 pg for skatole to 3590 pg for acetic acid. In addition, odor character, odor intensity and hedonic tone associated with each of the target odorants are also analyzed simultaneously. We found that the mass of each VOCs in the sample correlates well with the log stimulus intensity. All of the correlation coefficients (R{sup 2}) are greater than 0.74, and the top 10 correlation coefficients were greater than 0.90.

  20. Field Air Sampling and Simultaneous Chemical and Sensory Analysis of Livestock Odorants with Sorbent Tube GC-MS/Olfactometry

    NASA Astrophysics Data System (ADS)

    Zhang, Shicheng; Cai, Lingshuang; Koziel, Jacek A.; Hoff, Steven; Clanton, Charles; Schmidt, David; Jacobson, Larry; Parker, David; Heber, Albert

    2009-05-01

    Characterization and quantification of livestock odorants is one of the most challenging analytical tasks because odor-causing gases are very reactive, polar and often present at very low concentrations in a complex matrix of less important or irrelevant gases. The objective of this research was to develop a novel analytical method for characterization of the livestock odorants including their odor character, odor intensity, and hedonic tone and to apply this method for quantitative analysis of the key odorants responsible for livestock odor. Sorbent tubes packed with Tenax TA were used for field sampling. The automated one-step thermal desorption module coupled with multidimensional gas chromatography-mass spectrometry/olfactometry system was used for simultaneous chemical and odor analysis. Fifteen odorous VOCs and semi-VOCs identified from different livestock species operations were quantified. Method detection limits ranges from 40 pg for skatole to 3590 pg for acetic acid. In addition, odor character, odor intensity and hedonic tone associated with each of the target odorants are also analyzed simultaneously. We found that the mass of each VOCs in the sample correlates well with the log stimulus intensity. All of the correlation coefficients (R2) are greater than 0.74, and the top 10 correlation coefficients were greater than 0.90.

  1. Field-amplified sample stacking β-cyclodextrin modified capillary electrophoresis for quantitative determination of diastereomeric saponins.

    PubMed

    Emara, Samy; Masujima, Tsutomu; Zarad, Walaa; Mohamed, Khaled; Kamal, Maha; Fouad, Marwa; EL-Bagary, Ramzia

    2014-01-01

    Successful simultaneous diastereomeric separation and sensitive determination of two pairs of triterpenoidal saponins have been achieved by capillary electrophoresis (CE) using β-cyclodextrin (β-CD) as a stereoselective agent to cooperate with borate complexation. A usual technique for isolation and group separation of saponins was developed as an appropriate purification step prior to the determination of individual saponins by CE. Soyasaponin I ( S1: ), azukisaponin V ( S2: ), bersimoside I ( S3: ) and bersimoside II ( S4: ) could be well separated within 14 min in a fused-silica capillary (60 cm long to the detector with an additional 10 cm to the cathode; 75 µm i.d.). The background electrolyte was borate buffer (80 mM, pH 10), containing 24 mM β-CD. The separation voltage was 14 kV with a detection wavelength of 195 nm. The sample was electrokinetically injected using a voltage of 16 kV for 12 s. Methanol (70%) was used as the diluent for field-amplified sample stacking after hydrodynamic injection of short water plug (5 cm, 4 s). The method was partially validated for linearity, repeatability, reproducibility, limits of detection and limits of quantification. The correlation coefficients of the calibration curves were all >0.998, and the recoveries were from 98.23 to 96.21%.

  2. Field-amplified sample injection in capillary electrophoresis with amperometric detection for the ultratrace analysis of diastereomeric ephedrine alkaloids.

    PubMed

    Chen, Xiaoyan; Tang, Yanxia; Wang, Shaoyun; Song, Yunping; Tang, Fengxiang; Wu, Xiaoping

    2015-08-01

    A coupling method of field-amplified sample injection (FASI) CE with amperometric detection is developed for ultratrace analysis of ephedrine alkaloids stereoisomers. FASI was introduced by injecting electrokinetically the sample solution for 10 s into the capillary filled with highly conductive background electrolyte (BGE). The diastereomeric selectivity and the detection sensitivity were improved by using borate buffer of high ionic strength as BGE. Parameters affecting FASI and CE separation were investigated to achieve the optimal conditions. Four analytes were separated within 15 min using 200 mmol/L borate buffer (pH 9.5) and separation voltage of +18 kV, with detection potential at +1.0 V (vs. Ag/AgCl) and carbon disc electrode as working electrode. Excellent linearity was observed between peak current and concentration of analytes in the range of 0.1-100 ng/mL. The LODs (S/N = 3) for (-)-ephedrine, (+)-pseudoephedrine, (-)-N-methylephedrine and (+)-N-methylpseudoephedrine were 39.3, 54.9, 30.8, and 44.1 pg/mL, respectively. The proposed method was successfully applied to the determination of alkaloids in Ephedra sinica, with results agreed well with HPLC method. Mean recoveries of 102.1-109.7% and RSDs less than 6% were found. And the merits of high sensitivity and selectivity, as well as a simple and stable operation, have been demonstrated.

  3. Versatile pulsed laser setup for depth profiling analysis of multilayered samples in the field of cultural heritage

    NASA Astrophysics Data System (ADS)

    Mendes, N. F. C.; Osticioli, I.; Striova, J.; Sansonetti, A.; Becucci, M.; Castellucci, E.

    2009-04-01

    The present study considers the use of a nanosecond pulsed laser setup capable of performing laser induced breakdown spectroscopy (LIBS) and pulsed Raman spectroscopy for the study of multilayered objects in the field of cultural heritage. Controlled etching using the 4th harmonic 266 nm emission of a Nd:YAG laser source with a 8 ns pulse duration was performed on organic films and mineral strata meant to simulate different sequence of layers usually found in art objects such as in easel and mural paintings. The process of micro ablation coupled with powerful spectroscopic techniques operating with the same laser source, constitutes an interesting alternative to mechanical sampling especially when dealing with artworks such as ceramics and metal works which are problematic due to their hardness and brittleness. Another case is that of valuable pieces where sampling is not an option and the materials to analyse lie behind the surface. The capabilities and limitations of such instrumentation were assessed through several tests in order to characterize the trend of the laser ablation on different materials. Monitored ablation was performed on commercial sheets of polyethylene terephthalate (PET), a standard material of known thickness and mechanical stability, and rabbit glue, an adhesive often used in works of art. Measurements were finally carried out on a specimen with a stratigraphy similar to those found in real mural paintings.

  4. Vent 7504 of the San Francisco Volcanic Field (SFVF), Arizona: Sample Geochemistry and Implications for Cone Formation

    NASA Astrophysics Data System (ADS)

    Needham, D. H.; Eppler, D. B.; Bleacher, J. E.; Skinner, J. A.; Evans, C. A.; Feng, W.; Gruener, J. E.; Whitson, P. A.; Janoiko, B. A.; Mertzman, S. A.

    2015-12-01

    Vent 7504 is a complex structure in the SFVF that has 3 unit classes: a central cone with exposed dikes and cinder-covered rheomorphic facies; a SE/NW-trending ridge north of the cone with cinder-covered rheomorphic facies; and three discrete lava flows that emanate to the N from the ridge and to the SW and NW from the cone. Field observations suggest the ridge was the northern crest of an initial, larger cone. The NW portion of this cone was most likely disrupted during a catastrophic breach of lava that had accumulated within the cone; this third of three lava flows carried rafted packages of the rheomorphic cone facies to the NW, forming the linear N ridge. The final phase of pyroclastic activity was concentrated in the SW portion of the original cone, covering the top of the cone with cinders and forming the more traditional conic-shaped construct observed today. This study describes the geochemistry of 9 samples collected from the mapped units (2 from the cone, 1 from the N ridge, 1 from the N lava flow, 2 from the SW lava flow, and 3 from the NW lava flow) to further constrain the formation of Vent 7504. Geochemical analyses including back-scatter electron scanning electron microscopy and laboratory X-ray fluorescence spectroscopy were conducted on the 9 collected samples to measure bulk rock and olivine phenocryst compositions. Major element concentrations in the bulk rock and olivine compositions are strongly clustered in all samples, indicating they likely originated from a single magmatic source. Bulk rock SiO2 (~47.5 wt%) and alkali (Na2O + K2O, ~2.7 wt% + 0.71 wt%) concentrations are consistent with a basaltic classification for these samples. Trends in major elements relative to MgO are observed for the olivine phenocrysts: SiO2, Al2O3, Na2O, and TiO2 remain constant relative to MgO, but strong linear trends are observed in MnO, FeO, and NiO relative to MgO. These linear trends are expected given the potential for bivalent cation exchanges in the

  5. Investigation of differences between field and laboratory pH measurements of national atmospheric deposition program/national trends network precipitation samples

    USGS Publications Warehouse

    Latysh, N.; Gordon, J.

    2004-01-01

    A study was undertaken to investigate differences between laboratory and field pH measurements for precipitation samples collected from 135 weekly precipitation-monitoring sites in the National Trends Network from 12/30/1986 to 12/28/1999. Differences in pH between field and laboratory measurements occurred for 96% of samples collected during this time period. Differences between the two measurements were evaluated for precipitation samples collected before and after January 1994, when modifications to sample-handling protocol and elimination of the contaminating bucket o-ring used in sample shipment occurred. Median hydrogen-ion and pH differences between field and laboratory measurements declined from 3.9 ??eq L-1 or 0.10 pH units before the 1994 protocol change to 1.4 ??eq L-1 or 0.04 pH units after the 1994 protocol change. Hydrogen-ion differences between field and laboratory measurements had a high correlation with the sample pH determined in the field. The largest pH differences between the two measurements occurred for high-pH samples (>5.6), typical of precipitation collected in Western United States; however low- pH samples (<5.0) displayed the highest variability in hydrogen-ion differences between field and laboratory analyses. Properly screened field pH measurements are a useful alternative to laboratory pH values for trend analysis, particularly before 1994 when laboratory pH values were influenced by sample-collection equipment.

  6. Isolating the actual signal of paleointensity?

    NASA Astrophysics Data System (ADS)

    Valet, J. M.; Moreno, E.; Bassinot, F.; Herrero-Bervera, E.

    2011-12-01

    of the field determinations. It can be argued that studies of long-term field behaviour do not require the same accuracy as for knowledge of the field variations that prevailed during the past millenia. We have followed another track after noticing that samples containing exclusively monodomain magnetite provide almost systematically the right field determination. Thus, we prefer to select appropriate samples for standard Thellier experiments from thermal demagnetization diagrams of twin specimens. This preliminary thermal treatment also has the advantage of providing suitable directions so that there is no time waste and no loss of information.

  7. Dependence of B1+ and B1− Field Patterns of Surface Coils on the Electrical Properties of the Sample and the MR Operating Frequency

    PubMed Central

    Vaidya, Manushka V.; Collins, Christopher M.; Sodickson, Daniel K.; Brown, Ryan; Wiggins, Graham C.; Lattanzi, Riccardo

    2016-01-01

    In high field MRI, the spatial distribution of the radiofrequency magnetic (B1) field is usually affected by the presence of the sample. For hardware design and to aid interpretation of experimental results, it is important both to anticipate and to accurately simulate the behavior of these fields. Fields generated by a radiofrequency surface coil were simulated using dyadic Green’s functions, or experimentally measured over a range of frequencies inside an object whose electrical properties were varied to illustrate a variety of transmit (B1+) and receive (B1−) field patterns. In this work, we examine how changes in polarization of the field and interference of propagating waves in an object can affect the B1 spatial distribution. Results are explained conceptually using Maxwell’s equations and intuitive illustrations. We demonstrate that the electrical conductivity alters the spatial distribution of distinct polarized components of the field, causing “twisted” transmit and receive field patterns, and asymmetries between |B1+| and |B1−|. Additionally, interference patterns due to wavelength effects are observed at high field in samples with high relative permittivity and near-zero conductivity, but are not present in lossy samples due to the attenuation of propagating EM fields. This work provides a conceptual framework for understanding B1 spatial distributions for surface coils and can provide guidance for RF engineers.

  8. Elevating sampling

    PubMed Central

    Labuz, Joseph M.; Takayama, Shuichi

    2014-01-01

    Sampling – the process of collecting, preparing, and introducing an appropriate volume element (voxel) into a system – is often under appreciated and pushed behind the scenes in lab-on-a-chip research. What often stands in the way between proof-of-principle demonstrations of potentially exciting technology and its broader dissemination and actual use, however, is the effectiveness of sample collection and preparation. The power of micro- and nanofluidics to improve reactions, sensing, separation, and cell culture cannot be accessed if sampling is not equally efficient and reliable. This perspective will highlight recent successes as well as assess current challenges and opportunities in this area. PMID:24781100

  9. Nonuniform sampling techniques for antenna applications

    NASA Technical Reports Server (NTRS)

    Rahmat-Samii, Yahya; Cheung, Rudolf Lap-Tung

    1987-01-01

    A two-dimensional sampling technique, which can employ irregularly spaced samples (amplitude and phase) in order to generate the complete far-field patterns is presented. The technique implements a matrix inversion algorithm, which depends only on the nonuniform sampled data point locations and with no dependence on the actual field values at these points. A powerful simulation algorithm is presented to allow a real-life simulation of many reflector/feed configurations and to determine the usefulness of the nonuniform sampling technique for the copolar and cross-polar patterns. Additionally, an overlapped window concept and a generalized error simulation model are discussed to identify the stability of the technique for recovering the field data among the nonuniform sampled data. Numerical results are tailored for the pattern reconstruction of a 20-m offset reflector antenna operating at L-band. This reflector is planned to be used in a proposed measurement concept of large antenna aboard the Space Shuttle, whereby it would be almost impractical to accurately control the movement of the Shuttle with respect to the RF source in prescribed directions in order to generate uniform sampled points. Also, application of the nonuniform sampling technique to patterns obtained using near-field measured data is demonstrated. Finally, results of an actual far-field measurement are presented for the construction of patterns of a reflector antenna from a set of nonuniformly distributed measured amplitude and phase data.

  10. Meteorological field measurements at potential and actual wind turbine sites

    SciTech Connect

    Renne, D.S.; Sandusky, W.F.; Hadley, D.L.

    1982-09-01

    An overview of experiences gained in a meteorological measurement program conducted at a number of locations around the United States for the purpose of site evaluation for wind energy utilization is provided. The evolution of the measurement program from its inception in 1976 to the present day is discussed. Some of the major accomplishments and areas for improvement are outlined. Some conclusions on research using data from this program are presented.

  11. Novel Virus Discovery and Genome Reconstruction from Field RNA Samples Reveals Highly Divergent Viruses in Dipteran Hosts

    PubMed Central

    Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.

    2013-01-01

    We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463

  12. Advantages of a synchrotron bending magnet as the sample illuminator for a wide-field X-ray microscope.

    PubMed

    Feser, M; Howells, M R; Kirz, J; Rudati, J; Yun, W

    2012-09-01

    In this paper the choice between bending magnets and insertion devices as sample illuminators for a hard X-ray full-field microscope is investigated. An optimized bending-magnet beamline design is presented. Its imaging speed is very competitive with the performance of similar microscopes installed currently at insertion-device beamlines. The fact that imaging X-ray microscopes can accept a large phase space makes them very well suited to the output characteristics of bending magnets which are often a plentiful and paid-for resource. There exist opportunities at all synchrotron light sources to take advantage of this finding to build bending-magnet beamlines that are dedicated to transmission X-ray microscope facilities. It is expected that demand for such facilities will increase as three-dimensional tomography becomes routine and advanced techniques such as mosaic tomography and XANES tomography (taking three-dimensional tomograms at different energies to highlight elemental and chemical differences) become more widespread.

  13. Near-field reflection backscattering apertureless optical microscopy: application to spectroscopy experiments on opaque samples, comparison between lock-in and digital photon counting detection techniques.

    PubMed

    Diziain, S; Bijeon, J-L; Adam, P-M; Lamy de la Chapelle, M; Thomas, B; Déturche, R; Royer, P

    2007-01-01

    An apertureless scanning near-field optical microscope (ASNOM) in reflection backscattering configuration is designed to conduct spectroscopic experiments on opaque samples constituted of latex beads. The ASNOM proposed takes advantage of the depth-discrimination properties of confocal microscopes to efficiently extract the near-field optical signal. Given their importance in a spectroscopic experiment, we systematically compare the lock-in and synchronous photon counting detection methods. Some results of Rayleigh's scattering in the near field of the test samples are used to illustrate the possibilities of this technique for reflection backscattering spectroscopy.

  14. Planned versus actual outcomes as a result of animal feeding operation decisions for managing phosphorus.

    PubMed

    Cabot, Perry E; Nowak, Pete

    2005-01-01

    The paper explores how decisions made on animal feeding operations (AFOs) influence the management of manure and phosphorus. Variability among these decisions from operation to operation and from field to field can influence the validity of nutrient loss risk assessments. These assessments are based on assumptions that the decision outcomes regarding manure distribution will occur as they are planned. The discrepancy between planned versus actual outcomes in phosphorus management was explored on nine AFOs managing a contiguous set of 210 fields in south-central Wisconsin. A total of 2611 soil samples were collected and multiple interviews conducted to assign phosphorus index (PI) ratings to the fields. Spearman's rank correlation coefficients (r(S)) indicated that PI ratings were less sensitive to soil test phosphorus (STP) levels (r(S) = 0.378), universal soil loss equation (USLE) (r(S) = 0.261), ratings for chemical fertilizer application (r(S) = 0.185), and runoff class (r(S) = -0.089), and more sensitive to ratings for manure application (r(S) = 0.854). One-way ANOVA indicated that mean field STP levels were more homogenous than field PI ratings between AFOs. Kolmogorov-Smirnov (K-S) tests displayed several nonsignificant comparisons for cumulative distribution functions, S(x), of mean STP levels on AFO fields. On the other hand, the K-S tests of S(x) for PI ratings indicated that the majority of these S(x) functions were significantly different between AFOs at or greater than the 0.05 significance level. Interviews suggested multiple reasons for divergence between planned and actual outcomes in managing phosphorus, and that this divergence arises at the strategic, tactical, and operational levels of decision-making.

  15. How to Conduct a Research Field Trip

    ERIC Educational Resources Information Center

    Wacker, David G.

    1974-01-01

    Discusses the three phases of a three-day intensive research study field trip: planning and pre-trip training; actual trip; and post-trip report, research and data organization, and final trip evaluation. Included is a sample program of the limnology field trip taken by the Grafton High School, Wisconsin. (CC)

  16. Self-Actualization, Liberalism, and Humanistic Education.

    ERIC Educational Resources Information Center

    Porter, Charles Mack

    1979-01-01

    The relationship between personality factors and political orientation has long been of interest to psychologists. This study tests the hypothesis that there is no significant relationship between self-actualization and liberalism-conservatism. The hypothesis is supported. (Author)

  17. Detailed Observations and Sampling of the Sea Cliff Hydrothermal Field (GR-14) on the Northern Gorda Ridge

    NASA Astrophysics Data System (ADS)

    McClain, J. S.; Zierenberg, R.; Clague, D. A.; Von Damm, K. L.; Davis, A.; Goffredi, S.; Mayer, N.; Orphan, V.; Olsen, E.; Ross, S. L.

    2001-12-01

    During the summer of 2000, on a research cruise of the MBARI research ship, Western Flyer, we deployed the ROV Tiburon for a series of dives at the Sea Cliff Hydrothermal site on the northern Gorda Ridge. The Sea Cliff site is near the top of a terrace on the west facing rift valley wall (fault), about 300 meters above, and 3 km east of the ridge axis. The 1996 Gorda Ridge eruption occurred on axis in the region west and south of the vent site. The vents were first predicted on the basis of water column anomalies and seafloor structure, and the field was discovered in 1988 during dives of the Sea Cliff submersible. In 2000, we made 4 dives at the site and collected a suite of rock and vent fluid samples. The high temperature water vents from as many as 10 individual chimneys. Measured vent temperatures at several of the chimneys fall in a narrow range of around 304\\deg C. The chimneys are arrayed along two low ridges that are oriented roughly perpendicular to the strike of the rift valley. Venting fluids have low salinity indicating subsurface phase separation. The waters are isotopically enriched (\\delta 18O = 1.9%), suggesting extensive water-rock interaction. The chimneys themselves are primarily anhydrite and a pale green Mg-rich clay with minor amounts of amorphous silica, pyrrhotite, wurtzite, and isocubanite. The chimneys are delicate and are surrounded by aprons (5 -10 m) of collapsed chimney material. As a result, no macro fauna were observed colonizing the high temperature vents. Silica-rich hydrothermal crust and talus cover the fault slope. A broad region of diffuse venting surrounds the active chimneys and locally supports a rich biological community that includes blue ciliate mats near the vents, that give way to tube worm fields and low tube worm mounds formed on massive barite. The Sea Cliff Hydrothermal site is unusual in that it lies off axis and above the rift valley floor. Faulting must play a role in its location and perhaps geometry, and the

  18. Linear models for airborne-laser-scanning-based operational forest inventory with small field sample size and highly correlated LiDAR data

    USGS Publications Warehouse

    Junttila, Virpi; Kauranne, Tuomo; Finley, Andrew O.; Bradford, John B.

    2015-01-01

    Modern operational forest inventory often uses remotely sensed data that cover the whole inventory area to produce spatially explicit estimates of forest properties through statistical models. The data obtained by airborne light detection and ranging (LiDAR) correlate well with many forest inventory variables, such as the tree height, the timber volume, and the biomass. To construct an accurate model over thousands of hectares, LiDAR data must be supplemented with several hundred field sample measurements of forest inventory variables. This can be costly and time consuming. Different LiDAR-data-based and spatial-data-based sampling designs can reduce the number of field sample plots needed. However, problems arising from the features of the LiDAR data, such as a large number of predictors compared with the sample size (overfitting) or a strong correlation among predictors (multicollinearity), may decrease the accuracy and precision of the estimates and predictions. To overcome these problems, a Bayesian linear model with the singular value decomposition of predictors, combined with regularization, is proposed. The model performance in predicting different forest inventory variables is verified in ten inventory areas from two continents, where the number of field sample plots is reduced using different sampling designs. The results show that, with an appropriate field plot selection strategy and the proposed linear model, the total relative error of the predicted forest inventory variables is only 5%–15% larger using 50 field sample plots than the error of a linear model estimated with several hundred field sample plots when we sum up the error due to both the model noise variance and the model’s lack of fit.

  19. Microfabricated Devices for Sample Extraction, Concentrations, and Related Sample Processing Technologies

    SciTech Connect

    Chen, Gang; Lin, Yuehe

    2006-12-01

    This is an invited book chapter. As with other analytical techniques, sample pretreatments, sample extraction, sample introduction, and related techniques are of extreme importance for micro-electro-mechanical systems (MEMS). Bio-MEMS devices and systems start with a sampling step. The biological sample then usually undergoes some kinds of sample preparation steps before the actual analysis. These steps may involve extracting the target sample from its matrix, removing interferences from the sample, derivatizing the sample to detectable species, or performing a sample preconcentration step. The integration of the components for sample pretreatment into microfluidic devices represents one of the remaining the bottle-neck towards achieving true miniaturized total analysis systems (?TAS). This chapter provides a thorough state-of-art of the developments in this field to date.

  20. Sampling and Studying Permafrost in Alaska and on Mars: Mars Arctic Regions Science Field Experience for Secondary Teachers (MARSFEST)

    NASA Astrophysics Data System (ADS)

    Keller, J. M.; Buxner, S. R.; Douglas, T. A.; Lombardi, D. A.; Shaner, A. J.

    2006-12-01

    Both neutron and gamma ray data from the Gamma Ray Spectrometer (GRS) instrument suite aboard the 2001 Mars Odyssey spacecraft provide compelling evidence for the presence of water ice buried within the upper few tens of centimeters of Mars at high latitudes.^{1-3} In May 2008, the Phoenix Mars Lander mission will arrive at the northern high latitudes of Mars to ground-truth the presence of this water ice. The mission will use a robotic arm to deliver samples of permafrost to several instruments on the deck of the spacecraft for detailed chemical and microscopic analyses. Two primary science objectives at the landing site are to study the history of water in all its phases and to characterize soil habitability.4 As part of the Education and Public Outreach efforts for both the Phoenix and Odyssey missions, 20 secondary science teachers from across the U.S. and Canada were selected to spend a week in Summer 2006 immersed in arctic region science around Fairbanks, Alaska. The focal point of the experience involved investigations conducted at the Cold Regions Research and Engineering Laboratory (CRREL) Permafrost Tunnel.5 Teacher participants combined remote sensing and in situ observations of permafrost regions, conducted sample collection and analyses to investigate research questions generated by participants at the Permafrost Tunnel, explored comparisons between the terrestrial and Martian arctic, and completed inquiry- based classroom curriculum activities related to Mars and arctic science. A video documentary of the field experience is being produced by the NASA Mars Public Engagement program for education and public outreach purposes. The ten teacher teams involved in the workshop will now serve as educational ambassadors for the Phoenix Mars Lander mission over the next two years through to the completion of surface operations for the mission. They will be supported through monthly teleconferences updating them on mission status and continued research

  1. Characterizing forest structure variations across an intact tropical peat dome using field samplings and airborne LiDAR.

    PubMed

    Nguyen, Ha T; Hutyra, Lucy R; Hardiman, Brady S; Raciti, Steve M

    2016-03-01

    Tropical peat swamp forests (PSF) are one of the most carbon dense ecosystems on the globe and are experiencing substantial natural and anthropogenic disturbances. In this study, we combined direct field sampling and airborne LiDAR to empirically quantify forest structure and aboveground live biomass (AGB) across a large, intact tropical peat dome in Northwestern Borneo. Moving up a 4 m elevational gradient, we observed increasing stem density but decreasing canopy height, crown area, and crown roughness. These findings were consistent with hypotheses that nutrient and hydrological dynamics co-influence forest structure and stature of the canopy individuals, leading to reduced productivity towards the dome interior. Gap frequency as a function of gap size followed a power law distribution with a shape factor (λ) of 1.76 ± 0.06. Ground-based and dome-wide estimates of AGB were 217.7 ± 28.3 Mg C/ha and 222.4 ± 24.4 Mg C/ha, respectively, which were higher than previously reported AGB for PSF and tropical forests in general. However, dome-wide AGB estimates were based on height statistics, and we found the coefficient of variation on canopy height was only 0.08, three times less than stem diameter measurements, suggesting LiDAR height metrics may not be a robust predictor of AGB in tall tropical forests with dense canopies. Our structural characterization of this ecosystem advances the understanding of the ecology of intact tropical peat domes and factors that influence biomass density and landscape-scale spatial variation. This ecological understanding is essential to improve estimates of forest carbon density and its spatial distribution in PSF and to effectively model the effects of disturbance and deforestation in these carbon dense ecosystems.

  2. Characterizing forest structure variations across an intact tropical peat dome using field samplings and airborne LiDAR.

    PubMed

    Nguyen, Ha T; Hutyra, Lucy R; Hardiman, Brady S; Raciti, Steve M

    2016-03-01

    Tropical peat swamp forests (PSF) are one of the most carbon dense ecosystems on the globe and are experiencing substantial natural and anthropogenic disturbances. In this study, we combined direct field sampling and airborne LiDAR to empirically quantify forest structure and aboveground live biomass (AGB) across a large, intact tropical peat dome in Northwestern Borneo. Moving up a 4 m elevational gradient, we observed increasing stem density but decreasing canopy height, crown area, and crown roughness. These findings were consistent with hypotheses that nutrient and hydrological dynamics co-influence forest structure and stature of the canopy individuals, leading to reduced productivity towards the dome interior. Gap frequency as a function of gap size followed a power law distribution with a shape factor (λ) of 1.76 ± 0.06. Ground-based and dome-wide estimates of AGB were 217.7 ± 28.3 Mg C/ha and 222.4 ± 24.4 Mg C/ha, respectively, which were higher than previously reported AGB for PSF and tropical forests in general. However, dome-wide AGB estimates were based on height statistics, and we found the coefficient of variation on canopy height was only 0.08, three times less than stem diameter measurements, suggesting LiDAR height metrics may not be a robust predictor of AGB in tall tropical forests with dense canopies. Our structural characterization of this ecosystem advances the understanding of the ecology of intact tropical peat domes and factors that influence biomass density and landscape-scale spatial variation. This ecological understanding is essential to improve estimates of forest carbon density and its spatial distribution in PSF and to effectively model the effects of disturbance and deforestation in these carbon dense ecosystems. PMID:27209797

  3. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect

    Evans, Susan Kay; Orchard, B. J.

    2002-01-01

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  4. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect

    Evans, S.K.

    2002-01-31

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  5. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2006-10-18

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 222-S Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cs-137 sulfate, and sodium) were exceeded in all three of the flowsheet tests that were performed.

  6. FRACTIONAL CRYSTALLIZATION FLOWSHEET TESTS WITH ACTUAL TANK WASTE

    SciTech Connect

    HERTING, D.L.

    2007-04-13

    Laboratory-scale flowsheet tests of the fractional crystallization process were conducted with actual tank waste samples in a hot cell at the 2224 Laboratory. The process is designed to separate medium-curie liquid waste into a low-curie stream for feeding to supplemental treatment and a high-curie stream for double-shell tank storage. Separations criteria (for Cesium-137 sulfate and sodium) were exceeded in all three of the flowsheet tests that were performed.

  7. The actual citation impact of European oncological research.

    PubMed

    López-Illescas, Carmen; de Moya-Anegón, Félix; Moed, Henk F

    2008-01-01

    This study provides an overview of the research performance of major European countries in the field Oncology, the most important journals in which they published their research articles, and the most important academic institutions publishing them. The analysis was based on Thomson Scientific's Web of Science (WoS) and calculated bibliometric indicators of publication activity and actual citation impact. Studying the time period 2000-2006, it gives an update of earlier studies, but at the same time it expands their methodologies, using a broader definition of the field, calculating indicators of actual citation impact, and analysing new and policy relevant aspects. Findings suggest that the emergence of Asian countries in the field Oncology has displaced European articles more strongly than articles from the USA; that oncologists who have published their articles in important, more general journals or in journals covering other specialties, rather than in their own specialist journals, have generated a relatively high actual citation impact; and that universities from Germany, and--to a lesser extent--those from Italy, the Netherlands, UK, and Sweden, dominate a ranking of European universities based on number of articles in oncology. The outcomes illustrate that different bibliometric methodologies may lead to different outcomes, and that outcomes should be interpreted with care.

  8. Effect of variable rates of daily sampling of fly larvae on decomposition and carrion insect community assembly: implications for forensic entomology field study protocols.

    PubMed

    Michaud, Jean-Philippe; Moreau, Gaétan

    2013-07-01

    Experimental protocols in forensic entomology successional field studies generally involve daily sampling of insects to document temporal changes in species composition on animal carcasses. One challenge with that method has been to adjust the sampling intensity to obtain the best representation of the community present without affecting the said community. To this date, little is known about how such investigator perturbations affect decomposition-related processes. Here, we investigated how different levels of daily sampling of fly eggs and fly larvae affected, over time, carcass decomposition rate and the carrion insect community. Results indicated that a daily sampling of <5% of the egg and larvae volumes present on a carcass, a sampling intensity believed to be consistent with current accepted practices in successional field studies, had little effect overall. Higher sampling intensities, however, slowed down carcass decomposition, affected the abundance of certain carrion insects, and caused an increase in the volume of eggs laid by dipterans. This study suggests that the carrion insect community not only has a limited resilience to recurrent perturbations but that a daily sampling intensity equal to or <5% of the egg and larvae volumes appears adequate to ensure that the system is representative of unsampled conditions. Hence we propose that this threshold be accepted as best practice in future forensic entomology successional field studies.

  9. Temperature dependent low-field measurements of the magnetocaloric ΔT with sub-mK resolution in small volume and thin film samples

    NASA Astrophysics Data System (ADS)

    Döntgen, J.; Rudolph, J.; Gottschall, T.; Gutfleisch, O.; Salomon, S.; Ludwig, A.; Hägele, D.

    2015-01-01

    We present temperature dependent ΔT measurements of the magnetocaloric effect in a thin film sample of Gd, employing magnetomodulation and detection of thermal radiation. A bulk sample of the metamagnetic material LaFe11.05Co0.91Si1.04 shows a strong broadening of the ΔT peak for increasing field amplitudes between 4 and 45 mT. Bulk Gd in comparison shows only a weak broadening. All investigated samples exhibit a clear quadratic dependence of ΔT on the external field Hext at the ΔT peak maximum, contrary to earlier predictions. An analytic expression is derived that interpolates between the Hext2 -behavior at low and the well-known Hext2 /3 -behavior at high fields.

  10. Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize.

    PubMed

    Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

    2015-01-01

    Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers' freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

  11. Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize

    PubMed Central

    Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

    2015-01-01

    Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers’ freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

  12. Towards high concentration enhancement of microfluidic temperature gradient focusing of sample solutes using combined AC and DC field induced Joule heating.

    PubMed

    Ge, Zhengwei; Wang, Wei; Yang, Chun

    2011-04-01

    It is challenging to continuously concentrate sample solutes in microfluidic channels. We present an improved electrokinetic technique for enhancing microfluidic temperature gradient focusing (TGF) of sample solutes using combined AC and DC field induced Joule heating effects. The introduction of an AC electric field component services dual functions: one is to produce Joule heat for generating temperature gradient; the other is to suppress electroosmotic flow. Consequently the required DC voltages for achieving sample concentration by Joule heating induced TGF are reduced, thereby leading to smaller electroosmotic flow (EOF) and thus backpressure effects. As a demonstration, the proposed technique can lead to concentration enhancement of sample solutes of more than 2500-fold, which is much higher than the existing literature reported microfluidic concentration enhancement by utilizing the Joule heating induced TGF technique. PMID:21331425

  13. A field method to store samples from temperate mountain grassland soils for analysis of phospholipid fatty acids.

    PubMed

    Schnecker, Jörg; Wild, Birgit; Fuchslueger, Lucia; Richter, Andreas

    2012-08-01

    The storage of soil samples for PLFA analysis can lead to shifts in the microbial community composition. We show here that conserving samples in RNAlater, which is already widely used to store samples for DNA and RNA analysis, proved to be as sufficient as freezing at -20 °C and preferable over storage at 4 °C for temperate mountain grassland soil. The total amount of extracted PLFAs was not changed by any storage treatment. Storage at 4 °C led to an alteration of seven out of thirty individual biomarkers, while freezing and storage in RNAlater caused changes in the amount of fungal biomarkers but had no effect on any other microbial group. We therefore suggest that RNAlater could be used to preserve soil samples for PLFA analysis when immediate extraction or freezing of samples is not possible, for example during sampling campaigns in remote areas or during transport and shipping.

  14. Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples.

    PubMed

    Voordouw, Gerrit; Menon, Priyesh; Pinnock, Tijan; Sharma, Mohita; Shen, Yin; Venturelli, Amanda; Voordouw, Johanna; Sexton, Aoife

    2016-01-01

    Microbially-influenced corrosion (MIC) contributes to the general corrosion rate (CR), which is typically measured with carbon steel coupons. Here we explore the use of carbon steel ball bearings, referred to as beads (55.0 ± 0.3 mg; Ø = 0.238 cm), for determining CRs. CRs for samples from an oil field in Oceania incubated with beads were determined by the weight loss method, using acid treatment to remove corrosion products. The release of ferrous and ferric iron was also measured and CRs based on weight loss and iron determination were in good agreement. Average CRs were 0.022 mm/yr for eight produced waters with high numbers (10(5)/ml) of acid-producing bacteria (APB), but no sulfate-reducing bacteria (SRB). Average CRs were 0.009 mm/yr for five central processing facility (CPF) waters, which had no APB or SRB due to weekly biocide treatment and 0.036 mm/yr for 2 CPF tank bottom sludges, which had high numbers of APB (10(6)/ml) and SRB (10(8)/ml). Hence, corrosion monitoring with carbon steel beads indicated that biocide treatment of CPF waters decreased the CR, except where biocide did not penetrate. The CR for incubations with 20 ml of a produced water decreased from 0.061 to 0.007 mm/yr when increasing the number of beads from 1 to 40. CRs determined with beads were higher than those with coupons, possibly also due to a higher weight of iron per unit volume used in incubations with coupons. Use of 1 ml syringe columns, containing carbon steel beads, and injected with 10 ml/day of SRB-containing medium for 256 days gave a CR of 0.11 mm/yr under flow conditions. The standard deviation of the distribution of residual bead weights, a measure for the unevenness of the corrosion, increased with increasing CR. The most heavily corroded beads showed significant pitting. Hence the use of uniformly sized carbon steel beads offers new opportunities for screening and monitoring of corrosion including determination of the distribution of corrosion rates, which allows

  15. Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples

    PubMed Central

    Voordouw, Gerrit; Menon, Priyesh; Pinnock, Tijan; Sharma, Mohita; Shen, Yin; Venturelli, Amanda; Voordouw, Johanna; Sexton, Aoife

    2016-01-01

    Microbially-influenced corrosion (MIC) contributes to the general corrosion rate (CR), which is typically measured with carbon steel coupons. Here we explore the use of carbon steel ball bearings, referred to as beads (55.0 ± 0.3 mg; Ø = 0.238 cm), for determining CRs. CRs for samples from an oil field in Oceania incubated with beads were determined by the weight loss method, using acid treatment to remove corrosion products. The release of ferrous and ferric iron was also measured and CRs based on weight loss and iron determination were in good agreement. Average CRs were 0.022 mm/yr for eight produced waters with high numbers (105/ml) of acid-producing bacteria (APB), but no sulfate-reducing bacteria (SRB). Average CRs were 0.009 mm/yr for five central processing facility (CPF) waters, which had no APB or SRB due to weekly biocide treatment and 0.036 mm/yr for 2 CPF tank bottom sludges, which had high numbers of APB (106/ml) and SRB (108/ml). Hence, corrosion monitoring with carbon steel beads indicated that biocide treatment of CPF waters decreased the CR, except where biocide did not penetrate. The CR for incubations with 20 ml of a produced water decreased from 0.061 to 0.007 mm/yr when increasing the number of beads from 1 to 40. CRs determined with beads were higher than those with coupons, possibly also due to a higher weight of iron per unit volume used in incubations with coupons. Use of 1 ml syringe columns, containing carbon steel beads, and injected with 10 ml/day of SRB-containing medium for 256 days gave a CR of 0.11 mm/yr under flow conditions. The standard deviation of the distribution of residual bead weights, a measure for the unevenness of the corrosion, increased with increasing CR. The most heavily corroded beads showed significant pitting. Hence the use of uniformly sized carbon steel beads offers new opportunities for screening and monitoring of corrosion including determination of the distribution of corrosion rates, which allows

  16. Petrographic description of calcite/opal samples collected on field trip of December 5-9, 1992. Special report No. 7

    SciTech Connect

    Hill, C.A.; Schluter, C.M.

    1993-06-01

    This study is part of the research program of the Yucca Mountain Project intended to provide the State of Nevada with a detailed analysis and assessment of the water-deposited minerals of Yucca Mountain and adjacent regions. Forty-three separate stops were made and 203 samples were collected during the five days of the field trip. This report describes petrographic observations made on the calcite/opal samples.

  17. Realizing actual feedback control of complex network

    NASA Astrophysics Data System (ADS)

    Tu, Chengyi; Cheng, Yuhua

    2014-06-01

    In this paper, we present the concept of feedbackability and how to identify the Minimum Feedbackability Set of an arbitrary complex directed network. Furthermore, we design an estimator and a feedback controller accessing one MFS to realize actual feedback control, i.e. control the system to our desired state according to the estimated system internal state from the output of estimator. Last but not least, we perform numerical simulations of a small linear time-invariant dynamics network and a real simple food network to verify the theoretical results. The framework presented here could make an arbitrary complex directed network realize actual feedback control and deepen our understanding of complex systems.

  18. Comparison of geochemical data obtained using four brine sampling methods at the SECARB Phase III Anthropogenic Test CO2 injection site, Citronelle Oil Field, Alabama

    USGS Publications Warehouse

    Conaway, Christopher; Thordsen, James J.; Manning, Michael A.; Cook, Paul J.; Trautz, Robert C.; Thomas, Burt; Kharaka, Yousif K.

    2016-01-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a characterization well in the Citronelle Oil Field, Alabama, as part of the Southeast Regional Carbon Sequestration Partnership (SECARB) Phase III Anthropogenic Test, which is an integrated carbon capture and storage project. In this study, formation water and gas samples were obtained from well D-9-8 #2 at Citronelle using gas lift, electric submersible pump, U-tube, and a downhole vacuum sampler (VS) and subjected to both field and laboratory analyses. Field chemical analyses included electrical conductivity, dissolved sulfide concentration, alkalinity, and pH; laboratory analyses included major, minor and trace elements, dissolved carbon, volatile fatty acids, free and dissolved gas species. The formation water obtained from this well is a Na–Ca–Cl-type brine with a salinity of about 200,000 mg/L total dissolved solids. Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity. There was little gas in samples, and gas composition results were strongly influenced by sampling methods. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the VS and U-tube system performing most favorably in this aspect.

  19. Geospatial compilation of results from field sample collection in support of mineral resource investigations, Western Alaska Range, Alaska, July 2013

    USGS Publications Warehouse

    Johnson, Michaela R.; Graham, Garth E.; Hubbard, Bernard E.; Benzel, William M.

    2015-07-16

    This Data Series summarizes results from July 2013 sampling in the western Alaska Range near Mount Estelle, Alaska. The fieldwork combined in situ and camp-based spectral measurements of talus/soil and rock samples. Five rock and 48 soil samples were submitted for quantitative geochemi­cal analysis (for 55 major and trace elements), and the 48 soils samples were also analyzed by x-ray diffraction to establish mineralogy and geochemistry. The results and sample photo­graphs are presented in a geodatabase that accompanies this report. The spectral, mineralogical, and geochemical charac­terization of these samples and the sites that they represent can be used to validate existing remote-sensing datasets (for example, ASTER) and future hyperspectral studies. Empiri­cal evidence of jarosite (as identified by x-ray diffraction and spectral analysis) corresponding with gold concentrations in excess of 50 parts per billion in soil samples suggests that surficial mapping of jarosite in regional surveys may be use­ful for targeting areas of prospective gold occurrences in this sampling area.

  20. Geospatial compilation of results from field sample collection in support of mineral resource investigations, Western Alaska Range, Alaska, July 2013

    USGS Publications Warehouse

    Johnson, Michaela R.; Graham, Garth E.; Hubbard, Bernard E.; Benzel, William M.

    2015-01-01

    This Data Series summarizes results from July 2013 sampling in the western Alaska Range near Mount Estelle, Alaska. The fieldwork combined in situ and camp-based spectral measurements of talus/soil and rock samples. Five rock and 48 soil samples were submitted for quantitative geochemi­cal analysis (for 55 major and trace elements), and the 48 soils samples were also analyzed by x-ray diffraction to establish mineralogy and geochemistry. The results and sample photo­graphs are presented in a geodatabase that accompanies this report. The spectral, mineralogical, and geochemical charac­terization of these samples and the sites that they represent can be used to validate existing remote-sensing datasets (for example, ASTER) and future hyperspectral studies. Empiri­cal evidence of jarosite (as identified by x-ray diffraction and spectral analysis) corresponding with gold concentrations in excess of 50 parts per billion in soil samples suggests that surficial mapping of jarosite in regional surveys may be use­ful for targeting areas of prospective gold occurrences in this sampling area.

  1. Developing Human Resources through Actualizing Human Potential

    ERIC Educational Resources Information Center

    Clarken, Rodney H.

    2012-01-01

    The key to human resource development is in actualizing individual and collective thinking, feeling and choosing potentials related to our minds, hearts and wills respectively. These capacities and faculties must be balanced and regulated according to the standards of truth, love and justice for individual, community and institutional development,…

  2. [Actual diet of patients with gastrointestinal diseases].

    PubMed

    Loranskaia, T I; Shakhovskaia, A K; Pavliuchkova, M S

    2000-01-01

    The study of actual nutrition of patients with erosive-ulcerative lesions in the gastroduodenal zone and of patients with operated ulcer has revealed defects in intake of essential nutrients by these patients: overeating of animal fat and refined carbohydrates, deficiency of oil, vitamins A, B2, C, D and food fibers.

  3. Humanistic Education and Self-Actualization Theory.

    ERIC Educational Resources Information Center

    Farmer, Rod

    1984-01-01

    Stresses the need for theoretical justification for the development of humanistic education programs in today's schools. Explores Abraham Maslow's hierarchy of needs and theory of self-actualization. Argues that Maslow's theory may be the best available for educators concerned with educating the whole child. (JHZ)

  4. Group Counseling for Self-Actualization.

    ERIC Educational Resources Information Center

    Streich, William H.; Keeler, Douglas J.

    Self-concept, creativity, growth orientation, an integrated value system, and receptiveness to new experiences are considered to be crucial variables to the self-actualization process. A regular, year-long group counseling program was conducted with 85 randomly selected gifted secondary students in the Farmington, Connecticut Public Schools. A…

  5. Teenagers' Perceived and Actual Probabilities of Pregnancy.

    ERIC Educational Resources Information Center

    Namerow, Pearila Brickner; And Others

    1987-01-01

    Explored adolescent females' (N=425) actual and perceived probabilities of pregnancy. Subjects estimated their likelihood of becoming pregnant the last time they had intercourse, and indicated the dates of last intercourse and last menstrual period. Found that the distributions of perceived probability of pregnancy were nearly identical for both…

  6. Use of a field portable X-Ray fluorescence analyzer to determine the concentration of lead and other metals in soil samples.

    PubMed

    Clark, S; Menrath, W; Chen, M; Roda, S; Succop, P

    1999-01-01

    Field portable methods are often needed in risk characterization, assessment and management to rapidly determine metal concentrations in environmental samples. Examples are for determining: "hot spots" of soil contamination, whether dust wipe lead levels meet housing occupancy standards, and worker respiratory protection levels. For over 30 years portable X-Ray Fluorescence (XRF) analyzers have been available for the in situ, non-destructive, measurement of lead in paint. Recent advances made possible their use for analysis of airborne dust filter samples, soil, and dust wipes. Research at the University of Cincinnati with the NITON 700 Series XRF instrument (40 millicurie Cadmium 109 source, L X-Rays) demonstrated its proficiency on air sample filters (NIOSH Method No. 7702, "Lead by Field Portable XRF; limit of detection 6 microg per sample; working range 17-1,500 microg/m3 air). Research with lead dust wipe samples from housing has also shown promising results. This XRF instrument was used in 1997 in Poland on copper smelter area soil samples with the cooperation of the Wroclaw Medical Academy and the Foundation for the Children from the Copper Basin (Legnica). Geometric mean soil lead concentrations were 200 ppm with the portable XRF, 201 ppm with laboratory-based XRF (Kevex) and 190 ppm using atomic absorption (AA). Correlations of field portable XRF and AA results were excellent for samples sieved to less than 125 micrometers with R-squared values of 0.997, 0.957, and 0.976 for lead, copper and zinc respectively. Similarly, correlations were excellent for soil sieved to less than 250 micrometers, where R-squared values were 0. 924, 0.973, and 0.937 for lead, copper and zinc, respectively. The field portable XRF instrument appears to be useful for the determination of soil pollution by these metals in industrial regions.

  7. Endotoxin deposits on the inner surfaces of closed-face cassettes during bioaerosol sampling: a field investigation at composting facilities.

    PubMed

    Duquenne, Philippe; Simon, Xavier; Demange, Valérie; Harper, Martin; Wild, Pascal

    2015-05-01

    A set of 270 bioaerosol samples was taken from 15 composting facilities using polystyrene closed-face filter cassettes (CFCs). The objective was to measure the quantity of endotoxin deposits on the inner surfaces of the cassettes (sometimes referred to as 'wall deposits'). The results show that endotoxins are deposited on the inner surfaces of the CFCs through sampling and/or handling of samples. The quantity of endotoxins measured on inner surfaces range between 0.05 (the limit of detection of the method) and 3100 endotoxin units per cassette. The deposits can represent a large and variable percentage of the endotoxins sampled. More than a third of the samples presented a percentage of inner surface deposits >40% of the total quantity of endotoxins collected (filter + inner surfaces). Omitting these inner surface deposits in the analytical process lead to measurement errors relative to sampling all particles entering the CFC sampler, corresponding to a developing consensus on matching the inhalable particulate sampling convention. The result would be underestimated exposures and could affect the decision as to whether or not a result is acceptable in comparison to airborne concentration limits defined in terms of the inhalability convention. The results of this study suggest including the endotoxins deposited on the inner surfaces of CFCs during analysis. Further researches are necessary to investigate endotoxin deposits on the inner cassette surfaces in other working sectors.

  8. Cropland Field Monitoring: MMV Page 1 Montana Cropland Enrolled Farm Fields Carbon Sequestration Field Sampling, Measurement, Monitoring, and Verification: Application of Visible-Near Infrared Diffuse Reflectance Spectroscopy (VNIR) and Laser-induced Breakdown Spectroscopy (LIBS)

    SciTech Connect

    Lee Spangler; Ross Bricklemyer; David Brown

    2012-03-15

    There is growing need for rapid, accurate, and inexpensive methods to measure, and verify soil organic carbon (SOC) change for national greenhouse gas accounting and the development of a soil carbon trading market. Laboratory based soil characterization typically requires significant soil processing, which is time and resource intensive. This severely limits application for large-region soil characterization. Thus, development of rapid and accurate methods for characterizing soils are needed to map soil properties for precision agriculture applications, improve regional and global soil carbon (C) stock and flux estimates and efficiently map sub-surface metal contamination, among others. The greatest gains for efficient soil characterization will come from collecting soil data in situ, thus minimizing soil sample transportation, processing, and lab-based measurement costs. Visible and near-infrared diffuse reflectance spectroscopy (VisNIR) and laser-induced breakdown spectroscopy (LIBS) are two complementary, yet fundamentally different spectroscopic techniques that have the potential to meet this need. These sensors have the potential to be mounted on a soil penetrometer and deployed for rapid soil profile characterization at field and landscape scales. Details of sensor interaction, efficient data management, and appropriate statistical analysis techniques for model calibrations are first needed. In situ or on-the-go VisNIR spectroscopy has been proposed as a rapid and inexpensive tool for intensively mapping soil texture and organic carbon (SOC). While lab-based VisNIR has been established as a viable technique for estimating various soil properties, few experiments have compared the predictive accuracy of on-the-go and lab-based VisNIR. Eight north central Montana wheat fields were intensively interrogated using on-the-go and lab-based VisNIR. Lab-based spectral data consistently provided more accurate predictions than on-the-go data. However, neither in situ

  9. Description of a computer program to calculate reacting supersonic internal flow fields with shock waves using viscous characteristics: Program manual and sample calculations

    NASA Technical Reports Server (NTRS)

    Cavalleri, R. J.; Agnone, A. M.

    1972-01-01

    A computer program for calculating internal supersonic flow fields with chemical reactions and shock waves typical of supersonic combustion chambers with either wall or mid-stream injectors is described. The usefulness and limitations of the program are indicated. The program manual and listing are presented along with a sample calculation.

  10. Assessment of the Worldwide Antimalarial Resistance Network Standardized Procedure for In Vitro Malaria Drug Sensitivity Testing Using SYBR Green Assay for Field Samples with Various Initial Parasitemia Levels.

    PubMed

    Cheruiyot, Agnes C; Auschwitz, Jennifer M; Lee, Patricia J; Yeda, Redemptah A; Okello, Charles O; Leed, Susan E; Talwar, Mayank; Murthy, Tushar; Gaona, Heather W; Hickman, Mark R; Akala, Hoseah M; Kamau, Edwin; Johnson, Jacob D

    2016-04-01

    The malaria SYBR green assay, which is used to profilein vitrodrug susceptibility ofPlasmodium falciparum, is a reliable drug screening and surveillance tool. Malaria field surveillance efforts provide isolates with various low levels of parasitemia. To be advantageous, malaria drug sensitivity assays should perform reproducibly among various starting parasitemia levels rather than at one fixed initial value. We examined the SYBR green assay standardized procedure developed by the Worldwide Antimalarial Resistance Network (WWARN) for its sensitivity and ability to accurately determine the drug concentration that inhibits parasite growth by 50% (IC50) in samples with a range of initial parasitemia levels. The initial sensitivity determination of the WWARN procedure yielded a detection limit of 0.019% parasitemia.P. falciparumlaboratory strains and field isolates with various levels of initial parasitemia were then subjected to a range of doses of common antimalarials. The IC50s were comparable for laboratory strains with between 0.0375% and 0.6% parasitemia and for field isolates with between 0.075% and 0.6% parasitemia for all drugs tested. Furthermore, assay quality (Z') analysis indicated that the WWARN procedure displays high robustness, allowing for drug testing of malaria field samples within the derived range of initial parasitemia. The use of the WWARN procedure should allow for the inclusion of more malaria field samples in malaria drug sensitivity screens that would have otherwise been excluded due to low initial parasitemia levels.

  11. Assessment of the Worldwide Antimalarial Resistance Network Standardized Procedure for In Vitro Malaria Drug Sensitivity Testing Using SYBR Green Assay for Field Samples with Various Initial Parasitemia Levels

    PubMed Central

    Cheruiyot, Agnes C.; Auschwitz, Jennifer M.; Lee, Patricia J.; Yeda, Redemptah A.; Okello, Charles O.; Leed, Susan E.; Talwar, Mayank; Murthy, Tushar; Gaona, Heather W.; Hickman, Mark R.; Akala, Hoseah M.; Kamau, Edwin

    2016-01-01

    The malaria SYBR green assay, which is used to profile in vitro drug susceptibility of Plasmodium falciparum, is a reliable drug screening and surveillance tool. Malaria field surveillance efforts provide isolates with various low levels of parasitemia. To be advantageous, malaria drug sensitivity assays should perform reproducibly among various starting parasitemia levels rather than at one fixed initial value. We examined the SYBR green assay standardized procedure developed by the Worldwide Antimalarial Resistance Network (WWARN) for its sensitivity and ability to accurately determine the drug concentration that inhibits parasite growth by 50% (IC50) in samples with a range of initial parasitemia levels. The initial sensitivity determination of the WWARN procedure yielded a detection limit of 0.019% parasitemia. P. falciparum laboratory strains and field isolates with various levels of initial parasitemia were then subjected to a range of doses of common antimalarials. The IC50s were comparable for laboratory strains with between 0.0375% and 0.6% parasitemia and for field isolates with between 0.075% and 0.6% parasitemia for all drugs tested. Furthermore, assay quality (Z′) analysis indicated that the WWARN procedure displays high robustness, allowing for drug testing of malaria field samples within the derived range of initial parasitemia. The use of the WWARN procedure should allow for the inclusion of more malaria field samples in malaria drug sensitivity screens that would have otherwise been excluded due to low initial parasitemia levels. PMID:26856829

  12. Chronically indwelling venous cannula and automatic blood sampling system for use with nonhuman primates exposed to 60 Hz electric and magnetic fields

    SciTech Connect

    Rogers, W.R.; Lucas, J.H.; Smith, H.D.; Orr, J.L.; Mikiten, B.C.

    1995-12-31

    An automated blood sampling system was developed for use with tethered baboons (Papio cynocephalus) during concurrent exposure to 60 Hz 30 kV/m electric fields and 0.1 mT (1.0 G) magnetic fields. The system was controlled by a FORTH-based microcomputer, which operated a pump, a fraction collector, and two pinch valves. A swivel mechanism at the end of the tether allowed the baboons to move freely in their cages. The hardware and software were designed for fail-safe operation. Heparinized saline was infused at a rate of 0.5 ml/min until a sample cycle was initiated. Then, blood was drawn from the animal into a storage tube at a rate of 12.5 ml/min, a sample of undiluted blood was taken from the end of the storage tube near the baboon, and the blood remaining in the storage tube was then flushed back into the animal. Use of the storage tube prevented the peristaltic pump rollers from pressing on tubing containing blood, and return of the blood diluted with saline limited the blood wasted per sample to less than 0.5 ml. The system functioned reliably in three experiments, collecting samples as scheduled 97% of the time. Although it was initially designed for and used successfully with primates in an electric and magnetic field environment, this type of system could be employed in many areas of biomedical research or medical treatment.

  13. Highly sensitive detection of five typical fluoroquinolones in low-fat milk by field-enhanced sample injection-based CE in bubble cell capillary.

    PubMed

    Deng, Yan; Gasilova, Natalia; Qiao, Liang; Zhou, Ying-Lin; Zhang, Xin-Xiang; Girault, Hubert H

    2014-12-01

    Fluoroquinolones are a group of synthetic antibiotics with a broad activity spectrum against mycoplasma, Gram-positive, and Gram-negative bacteria. Due to the extensive use of fluoroquinolones in farming and veterinary science, there is a constant need in the analytical methods able to efficiently monitor their residues in food products of animal origin, regulated by Commission Regulation (European Union) no. 37/2010. Herein, field-enhanced sample injection for sample stacking prior the CZE separation was developed inside a bubble cell capillary for highly sensitive detection of five typical fluoroquinolones in bovine milk. Ethylenediamine was proposed as the main component of BGE for the antibiotics separation. The effect of BGE composition, injection parameters, and water plug length on the field-enhanced sample injection-based CE with UV detection was investigated. Under the optimized conditions, described field-enhanced sample injection-based CE-UV analysis of fluoroquinolones provides LODs varying from 0.4 to 1.3 ng/mL. These LOD values are much lower (from 460 to 1500 times) than those obtained by a conventional CE in a standard capillary without bubble cell. The developed method was finally applied for the analysis of fluoroquinolones in low-fat milk from a Swiss supermarket. Sample recovery values from 93.6 to 106.0% for different fluoroquinolones, and LODs from 0.7 to 2.5 μg/kg, were achieved. Moreover, the proposed ethylenediamine-based BGE as volatile and compatible with MS system, enabled the coupling of the field-enhanced sample injection-based CE with a recently introduced electrostatic spray ionization MS via an iontophoretic fraction collection interface for qualitative fluoroquinolones identification.

  14. Investigating temporal field sampling strategies for site-specific calibration of three soil moisture - neutron flux interaction models

    NASA Astrophysics Data System (ADS)

    Iwema, Joost; Rosolem, Rafael; Baatz, Roland; Wagener, Thorsten; Bogena, Heye

    2015-04-01

    Soil moisture is an important state variable in land-atmosphere interaction and hydrological processes. The novel Cosmic-Ray Neutron Sensor (CRNS) can be used to determine soil moisture at the sub-kilometre scale, which is relevant to these processes. The CRNS is usually calibrated with soil moisture samples taken on a single day. We investigated whether using data from only one day can be sufficient and, if not, how many days would be needed to obtain a reliable calibration. Therefore temporal sampling strategies for calibration of three widely used soil moisture - cosmic-ray neutron interaction models were investigated for three distinct sites: an arid site in Arizona (USA), a temperate humid grassland and a temperate humid spruce forest, both located in Germany. First, the effects of the number of sampling days on the calibration results were analysed and the effects of different soil wetness conditions of the sampling days on the quality of the calibration results were then investigated. Independent point-scale (TDT) soil moisture measurements from a sensor network were used as input to all three models. Simulated neutron intensity was then compared against measurements from cosmic-ray sensors at all sites. It was found that, if wetness conditions were not taken into account, collecting soil moisture samples on more than one day is needed to obtain a reliable calibration result, regardless of which model is used. We typically find that two to four days are normally sufficient. Sampling on days or combinations of days with appropriate wetness conditions for specific sites can reduce the needed number of sampling days. What appropriate wetness conditions are, differs between sites and different soil moisture - cosmic-ray neutron interaction models.

  15. Denser Sampling of the Rosette Nebula with Faraday Rotation Measurements: Improved Estimates of Magnetic Fields in H II Regions

    NASA Astrophysics Data System (ADS)

    Costa, Allison H.; Spangler, Steven R.; Sink, Joseph R.; Brown, Shea; Mao, Sui Ann

    2016-04-01

    We report Faraday rotation measurements of 11 extragalactic radio sources with lines of sight through the Rosette Nebula, a prominent H ii region associated with the star cluster NGC 2244. The goal of these measurements is to better determine the strength and structure of the magnetic field in the nebula. We calculate the rotation measure (RM) through two methods, a least-squares fit to χ ({λ }2) and Rotation Measure Synthesis. In conjunction with our results from Savage et al., we find an excess RM due to the shell of the nebula of +40 to +1200 rad m‑2 above a background RM of +147 rad m‑2. We discuss two forms of a simple shell model intended to reproduce the magnitude of the observed RM as a function of distance from the center of the Rosette Nebula. The models represent different physical situations for the magnetic field within the shell of the nebula. The first assumes that there is an increase in the magnetic field strength and plasma density at the outer radius of the H ii region, such as would be produced by a strong magnetohydrodynamic shock wave. The second model assumes that any increase in the RM is due solely to an increase in the density, and the Galactic magnetic field is unaffected in the shell. We employ a Bayesian analysis to compare the two forms of the model. The results of this analysis were inconclusive, although the model without amplification of the interstellar magnetic field is weakly favored.

  16. From the field: Efficacy of detecting Chronic Wasting Disease via sampling hunter-killed white-tailed deer

    USGS Publications Warehouse

    Diefenbach, D.R.; Rosenberry, C.S.; Boyd, Robert C.

    2004-01-01

    Surveillance programs for Chronic Wasting Disease (CWD) in free-ranging cervids often use a standard of being able to detect 1% prevalence when determining minimum sample sizes. However, 1% prevalence may represent >10,000 infected animals in a population of 1 million, and most wildlife managers would prefer to detect the presence of CWD when far fewer infected animals exist. We wanted to detect the presence of CWD in white-tailed deer (Odocoileus virginianus) in Pennsylvania when the disease was present in only 1 of 21 wildlife management units (WMUs) statewide. We used computer simulation to estimate the probability of detecting CWD based on a sampling design to detect the presence of CWD at 0.1% and 1.0% prevalence (23-76 and 225-762 infected deer, respectively) using tissue samples collected from hunter-killed deer. The probability of detection at 0.1% prevalence was <30% with sample sizes of ???6,000 deer, and the probability of detection at 1.0% prevalence was 46-72% with statewide sample sizes of 2,000-6,000 deer. We believe that testing of hunter-killed deer is an essential part of any surveillance program for CWD, but our results demonstrated the importance of a multifaceted surveillance approach for CWD detection rather than sole reliance on testing hunter-killed deer.

  17. Assessment of the Minimum Sampling Frequency to Avoid Measurement Redundancy in Microclimate Field Surveys in Museum Buildings.

    PubMed

    García-Diego, Fernando-Juan; Verticchio, Elena; Beltrán, Pedro; Siani, Anna Maria

    2016-01-01

    Monitoring temperature and relative humidity of the environment to which artefacts are exposed is fundamental in preventive conservation studies. The common approach in setting measuring instruments is the choice of a high sampling rate to detect short fluctuations and increase the accuracy of statistical analysis. However, in recent cultural heritage standards the evaluation of variability is based on moving average and short fluctuations and therefore massive acquisition of data in slowly-changing indoor environments could end up being redundant. In this research, the sampling frequency to set a datalogger in a museum room and inside a microclimate frame is investigated by comparing the outcomes obtained from datasheets associated with different sampling conditions. Thermo-hygrometric data collected in the Sorolla room of the Pio V Museum of Valencia (Spain) were used and the widely consulted recommendations issued in UNI 10829:1999 and EN 15757:2010 standards and in the American Society of Heating, Air-Conditioning and Refrigerating Engineers (ASHRAE) guidelines were applied. Hourly sampling proved effective in obtaining highly reliable results. Furthermore, it was found that in some instances daily means of data sampled every hour can lead to the same conclusions as those of high frequency. This allows us to improve data logging design and manageability of the resulting datasheets. PMID:27537886

  18. Assessment of the Minimum Sampling Frequency to Avoid Measurement Redundancy in Microclimate Field Surveys in Museum Buildings

    PubMed Central

    García-Diego, Fernando-Juan; Verticchio, Elena; Beltrán, Pedro; Siani, Anna Maria

    2016-01-01

    Monitoring temperature and relative humidity of the environment to which artefacts are exposed is fundamental in preventive conservation studies. The common approach in setting measuring instruments is the choice of a high sampling rate to detect short fluctuations and increase the accuracy of statistical analysis. However, in recent cultural heritage standards the evaluation of variability is based on moving average and short fluctuations and therefore massive acquisition of data in slowly-changing indoor environments could end up being redundant. In this research, the sampling frequency to set a datalogger in a museum room and inside a microclimate frame is investigated by comparing the outcomes obtained from datasheets associated with different sampling conditions. Thermo-hygrometric data collected in the Sorolla room of the Pio V Museum of Valencia (Spain) were used and the widely consulted recommendations issued in UNI 10829:1999 and EN 15757:2010 standards and in the American Society of Heating, Air-Conditioning and Refrigerating Engineers (ASHRAE) guidelines were applied. Hourly sampling proved effective in obtaining highly reliable results. Furthermore, it was found that in some instances daily means of data sampled every hour can lead to the same conclusions as those of high frequency. This allows us to improve data logging design and manageability of the resulting datasheets. PMID:27537886

  19. Sampling blood from big brown bats (Eptesicus fuscus) in the field with and without anesthesia: Impacts on survival

    USGS Publications Warehouse

    Ellison, L.E.; O'Shea, T.J.; Wimsatt, J.; Pearce, R.D.; Neubaum, D.J.; Neubaum, M.A.; Bowen, R.A.

    2006-01-01

    Blood was collected from wild big brown bats (Eptesicus fuscus) with and without anesthesia in Fort Collins, Colorado in 2004 to assess the impacts of these procedures on short-term survival and 1-yr return rates. Short-term survival and 1-yr return rates after release were passively monitored using PIT tag detection hoops placed at selected buildings. Comparison of 14-day maximum likelihood survival estimates from bats not bled (142 adult females, 62 volant juveniles), and bats sampled for blood with anesthesia (96 adult females, 23 volant juveniles) and without anesthesia (112 adult females, 22 volant juveniles) indicated no adverse effects of either treatment (juveniles: X2=53.38, df=41, P=0.09; adults: X2=39.09, df=44, P=0.68). Return rates of bats one year after sampling were similar among adult female controls (75.4%, n=142, 95% CI=67.4-82.2%), females sampled for blood with anesthesia (83.0%, n=112, 95% CI=74.8-89.5%), and females sampled without anesthesia (87.5%, n=96, 95% CI=79.2-93.4%). Lack of an effect was also noted in 1-yr return rates of juvenile females. These data suggest that the use of anesthesia during sampling of blood has no advantages in terms of enhancement of survival in big brown bats. ?? Wildlife Disease Association 2006.

  20. In situ chemistry and microbial community compositions in five deep-sea hydrothermal fluid samples from Irina II in the Logatchev field.

    PubMed

    Perner, Mirjam; Gonnella, Giorgio; Hourdez, Stephane; Böhnke, Stefanie; Kurtz, Stefan; Girguis, Peter

    2013-05-01

    We present data on the co-registered geochemistry (in situ mass spectrometry) and microbiology (pyrosequencing of 16S rRNA genes; V1, V2, V3 regions) in five fluid samples from Irina II in the Logatchev hydrothermal field. Two samples were collected over 24 min from the same spot and further three samples were from spatially distinct locations (20 cm, 3 m and the overlaying plume). Four low-temperature hydrothermal fluids from the Irina II are composed of the same core bacterial community, namely specific Gammaproteobacteria and Epsilonproteobacteria, which, however, differs in the relative abundance. The microbial composition of the fifth sample (plume) is considerably different. Although a significant correlation between sulfide enrichment and proportions of Sulfurovum (Epsilonproteobacteria) was found, no other significant linkages between abiotic factors, i.e. temperature, hydrogen, methane, sulfide and oxygen, and bacterial lineages were evident. Intriguingly, bacterial community compositions of some time series samples from the same spot were significantly more similar to a sample collected 20 cm away than to each other. Although this finding is based on three single samples only, it provides first hints that single hydrothermal fluid samples collected on a small spatial scale may also reflect unrecognized temporal variability. However, further studies are required to support this hypothesis.

  1. Reproducing Actual Morphology of Planetary Lava Flows

    NASA Astrophysics Data System (ADS)

    Miyamoto, H.; Sasaki, S.

    1996-03-01

    Assuming that lava flows behave as non-isothermal laminar Bingham fluids, we developed a numerical code of lava flows. We take the self gravity effects and cooling mechanisms into account. The calculation method is a kind of cellular automata using a reduced random space method, which can eliminate the mesh shape dependence. We can calculate large scale lava flows precisely without numerical instability and reproduce morphology of actual lava flows.

  2. The Actual Apollo 13 Prime Crew

    NASA Technical Reports Server (NTRS)

    1970-01-01

    The actual Apollo 13 lunar landing mission prime crew from left to right are: Commander, James A. Lovell Jr., Command Module pilot, John L. Swigert Jr.and Lunar Module pilot, Fred W. Haise Jr. The original Command Module pilot for this mission was Thomas 'Ken' Mattingly Jr. but due to exposure to German measles he was replaced by his backup, Command Module pilot, John L. 'Jack' Swigert Jr.

  3. Quantifying actual and theoretical ethanol yields for switchgrass strains using NIRS analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantifying actual and theoretical ethanol yields from biomass conversion processes such as simultanteous saccharification and fermentation (SSF) requires expensive, complex fermentation assays and extensive compositional analyses of the biomass sample. Near infrared reflectance spectroscopy (NIRS...

  4. A COMPARISON OF LIQUID AND GAS-PHASE PHOTOOXIDATION TREATMENT OF METHYL TERTIARY BUTYL ETHER: SYNTHETIC AND FIELD SAMPLES

    EPA Science Inventory

    The feasibility of photo-oxidation treatment of metyl tert-butyl either (MTBE) in water was investigated using two systems, 1) a slurry falling film photo-reactor, and 2) an integrated air-stripping with gas phase photooxidation system. MTBE-contaminated synthetic water and field...

  5. Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

    PubMed

    Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

    2013-06-01

    Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

  6. A strip-shield improves the efficiency of a solenoid coil in probes for high field solid-state NMR of lossy biological samples

    PubMed Central

    Wu, Chin H.; Grant, Christopher V.; Cook, Gabriel A.; Park, Sang Ho; Opella, Stanley J.

    2009-01-01

    A strip-shield inserted between a high inductance double-tuned solenoid coil and the glass tube containing the sample improves the efficiency of probes used for high-field solid-state NMR experiments on lossy aqueous samples of proteins and other biopolymers. A strip-shield is a coil liner consisting of thin copper strips layered on a PTFE (polytetrafluoroethylene) insulator. With lossy samples, the shift in tuning frequency is smaller, the reduction in Q, and RF-induced heating are all significantly reduced when the strip-shield is present. The performance of 800 MHz 1H/15N and 1H/13C double-resonance probes is demonstrated on aqueous samples of membrane proteins in phospholipid bilayers. PMID:19559634

  7. Comparison of Precision of Biomass Estimates in Regional Field Sample Surveys and Airborne LiDAR-Assisted Surveys in Hedmark County, Norway

    NASA Technical Reports Server (NTRS)

    Naesset, Erik; Gobakken, Terje; Bollandsas, Ole Martin; Gregoire, Timothy G.; Nelson, Ross; Stahl, Goeran

    2013-01-01

    Airborne scanning LiDAR (Light Detection and Ranging) has emerged as a promising tool to provide auxiliary data for sample surveys aiming at estimation of above-ground tree biomass (AGB), with potential applications in REDD forest monitoring. For larger geographical regions such as counties, states or nations, it is not feasible to collect airborne LiDAR data continuously ("wall-to-wall") over the entire area of interest. Two-stage cluster survey designs have therefore been demonstrated by which LiDAR data are collected along selected individual flight-lines treated as clusters and with ground plots sampled along these LiDAR swaths. Recently, analytical AGB estimators and associated variance estimators that quantify the sampling variability have been proposed. Empirical studies employing these estimators have shown a seemingly equal or even larger uncertainty of the AGB estimates obtained with extensive use of LiDAR data to support the estimation as compared to pure field-based estimates employing estimators appropriate under simple random sampling (SRS). However, comparison of uncertainty estimates under SRS and sophisticated two-stage designs is complicated by large differences in the designs and assumptions. In this study, probability-based principles to estimation and inference were followed. We assumed designs of a field sample and a LiDAR-assisted survey of Hedmark County (HC) (27,390 km2), Norway, considered to be more comparable than those assumed in previous studies. The field sample consisted of 659 systematically distributed National Forest Inventory (NFI) plots and the airborne scanning LiDAR data were collected along 53 parallel flight-lines flown over the NFI plots. We compared AGB estimates based on the field survey only assuming SRS against corresponding estimates assuming two-phase (double) sampling with LiDAR and employing model-assisted estimators. We also compared AGB estimates based on the field survey only assuming two-stage sampling (the NFI

  8. Testing the application of Teflon/quartz soil solution samplers for DOM sampling in the Critical Zone: Field and laboratory approaches

    NASA Astrophysics Data System (ADS)

    Dolan, E. M.; Perdrial, J. N.; Vazquez, A.; Hernández, S.; Chorover, J.

    2010-12-01

    Elizabeth Dolan1,2, Julia Perdrial3, Angélica Vázquez-Ortega3, Selene Hernández-Ruiz3, Jon Chorover3 1Deptartment of Soil, Environmental, and Atmospheric Science, University of Missouri. 2Biosphere 2, University of Arizona. 3Deptartment of Soil, Water, and Environmental Science, University of Arizona. Abstract: The behavior of dissolved organic matter (DOM) in soil is important to many biogeochemical processes. Extraction methods to obtain DOM from the unsaturated zone remain a current focus of research as different methods can influence the type and concentration of DOM obtained. Thus, the present comparison study involves three methods for soil solution sampling to assess their impact on DOM quantity and quality: 1) aqueous soil extracts, 2) solution yielded from laboratory installed suction cup samplers and 3) solutions from field installed suction cup samplers. All samples were analyzed for dissolved organic carbon and total nitrogen concentrations. Moreover, DOM quality was analyzed using fluorescence, UV-Vis and FTIR spectroscopies. Results indicate higher DOC values for laboratory extracted DOM: 20 mg/L for aqueous soil extracts and 31 mg/L for lab installed samplers compared to 12 mg/L for field installed samplers. Large variations in C/N ratios were also observed ranging from 1.5 in laboratory extracted DOM to 11 in field samples. Fluorescence excitation-emission matrices of DOM solutions obtained for the laboratory extraction methods showed higher intensities in regions typical for fulvic and humic acid-like materials relative to those extracted in the field. Similarly, the molar absorptivity calculated from DOC concentration normalization of UV-Vis absorbance of the laboratory-derived solutions was significantly higher as well, indicating greater aromaticity. The observed differences can be attributed to soil disturbance associated with obtaining laboratory derived solution samples. Our results indicate that laboratory extraction methods are not

  9. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    PubMed

    Knüsel, R; Bergmann, S M; Einer-Jensen, K; Casey, J; Segner, H; Wahli, T

    2007-09-01

    This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and/or demonstrated positive anti-VHSV-antibody titres (83 sites, 121 positive blood samples) in a serum plaque neutralization test (SPNT). The RT-PCR technique confirmed the four VHSV-positive tissue sample pools detected by virus isolation and additionally identified one VHSV-positive sample that showed positive anti-VHSV-AB titres, but was negative in virus isolation. With IHNV, RT-PCR detected two positive samples not identified by virus isolation while in these fish the SPNT result had been questionable. One of the IHNV-positive samples represents the first detection of IHNV-RNA in wild brown trout in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus isolation. However, in a titration experiment under laboratory conditions, the sensitivity of RT-PCR was not significantly higher when compared with virus isolation.

  10. Geomapping generalized eigenvalue frequency distributions for predicting prolific Aedes albopictus and Culex quinquefasciatus habitats based on spatiotemporal field-sampled count data.

    PubMed

    Jacob, Benjamin G; Morris, Joel A; Caamano, Erick X; Griffith, Daniel A; Novak, Robert J

    2011-02-01

    Marked spatiotemporal variabilities in mosquito infection of arboviruses require adaptive strategies for determining optimal field-sampling timeframes, pool screening, and data analyses. In particular, the error distribution and aggregation patterns of adult arboviral mosquitoes can vary significantly by species, which can statistically bias analyses of spatiotemporal-sampled predictor variables generating misinterpretation of prolific habitat surveillance locations. Currently, there is a lack of reliable and consistent measures of risk exposure based on field-sampled georeferenced explanatory covariates which can compromise quantitative predictions generated from arboviral mosquito surveillance models for implementing larval control strategies targeting productive habitats. In this research we used spatial statistics and QuickBird visible and near-infra-red data for determining trapping sites that were related to Culex quinquefasciatus and Aedes albopictus species abundance and distribution in Birmingham, Alabama. Initially, a Land Use Land Cover (LULC) model was constructed from multiple spatiotemporal-sampled georeferenced predictors and the QuickBird data. A Poisson regression model with a non-homogenous, gamma-distributed mean then decomposed the data into positive and negative spatial filter eigenvectors. An autoregressive process in the error term then was used to derive the sample distribution of the Moran's I statistic for determining latent autocorrelation components in the model. Spatial filter algorithms established means, variances, distributional functions, and pairwise correlations for the predictor variables. In doing so, the eigenfunction spatial filter quantified the residual autocorrelation error in the mean response term of the model as a linear combination of various distinct Cx. quinquefasciatus and Ae. albopictus habitat map patterns. The analyses revealed 18-27% redundant information in the data. Prolific habitats of Cx. quinquefasciatus and

  11. Design and evaluation of a field study on the contamination of selected volatile organic compounds and wastewater-indicator compounds in blanks and groundwater samples

    USGS Publications Warehouse

    Thiros, Susan A.; Bender, David A.; Mueller, David K.; Rose, Donna L.; Olsen, Lisa D.; Martin, Jeffrey D.; Bernard, Bruce; Zogorski, John S.

    2011-01-01

    The Field Contamination Study (FCS) was designed to determine the field processes that tend to result in clean field blanks and to identify potential sources of contamination to blanks collected in the field from selected volatile organic compounds (VOCs) and wastewater-indicator compounds (WICs). The VOCs and WICs analyzed in the FCS were detected in blanks collected by the U.S. Geological Survey (USGS) National Water-Quality Assessment (NAWQA) Program during 1996-2008 and 2002-08, respectively. To minimize the number of variables, the study required ordering of supplies just before sampling, storage of supplies and equipment in clean areas, and use of adequate amounts of purge-and-trap volatile-grade methanol and volatile pesticide-grade blank water (VPBW) to clean sampling equipment and to collect field blanks. Blanks and groundwater samples were collected during 2008-09 at 16 sites, which were a mix of water-supply and monitoring wells, located in 9 States. Five different sample types were collected for the FCS at each site: (1) a source-solution blank collected at the USGS National Water Quality Laboratory (NWQL) using laboratory-purged VPBW, (2) source-solution blanks collected in the field using laboratory-purged VPBW, (3) source-solution blanks collected in the field using field-purged VPBW, (4) a field blank collected using field-purged VPBW, and (5) a groundwater sample collected from a well. The source-solution blank and field-blank analyses were used to identify, quantify, and document extrinsic contamination and to help determine the sources and causes of data-quality problems that can affect groundwater samples. Concentrations of compounds detected in FCS analyses were quantified and results were stored in the USGS National Water Information System database after meeting rigorous identification and quantification criteria. The study also utilized information provided by laboratory analysts about evidence indicating the presence of selected compounds

  12. Comparison of Two Techniques to Calculate Methane Oxidation rates in Samples Obtained From the Hudson Canyon Seep Field in the North Atlantic

    NASA Astrophysics Data System (ADS)

    Leonte, M.; Kessler, J. D.; Chepigin, A.; Kellermann, M. Y.; Arrington, E.; Valentine, D. L.; Sylva, S.

    2014-12-01

    Aerobic methane oxidation, or methanotrophy, is the dominant process by which methane is removed from the water column in oceanic environments. Therefore, accurately quantifying methane oxidation rates is crucial when constructing methane budgets on a local or global scale. Here we present a comparison of two techniques used to determine methane oxidation rates based on samples obtained over the Hudson Canyon seep field in the North Atlantic. Traditional methane oxidation rate measurements require inoculation of water samples with isotopically labeled methane and tracking the changes to methane concentrations and isotopes as the samples are incubated. However, the addition of methane above background levels is thought to increase the potential for methane oxidation in the sample. A new technique to calculate methane oxidation rates is based on kinetic isotope models and incorporates direct measurements of methane concentrations, methane 13C isotopes, and water current velocity. Acoustic instrumentation (ADCP) aboard the R/V Endeavor was used to obtain water current velocity data while water samples were collected for methane concentration and isotopic ratio analysis. Methane δ13C measurements allow us to attribute changes in methane concentration to either water dispersion or bacterial methane oxidation. The data obtained from this cruise will tell us a comprehensive story of methane removal processes from this active seep field. The kinetic isotope models will allow us to estimate the total flux of methane from the seep site and calculate methane oxidation rates at different depths and locations away from seafloor plumes.

  13. Development of a Multiplexed, Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples. Final Report

    SciTech Connect

    Lowe, M.; Halden, R.

    2002-10-09

    This was the final report for DOE NABIR grant DE-FG02-01ER63264 (PI Mary Lowe). The grant was entitled ''Development of a Multiplexed Bead-Based Assessment Tool for Rapid Identification and Quantitation of Microorganisms in Field Samples.'' The grant duration was one year. The purpose was to develop a bead-based assay for measuring analyte DNAs in environmental PCR products and to apply the method to a field experiment. The primary experiment was located at the UMTRA Old Rifle site.

  14. VMAT vs. 7-field-IMRT: assessing the dosimetric parameters of prostate cancer treatment with a 292-patient sample.

    PubMed

    Kopp, Robert W; Duff, Michael; Catalfamo, Frank; Shah, Dhiren; Rajecki, Michael; Ahmad, Kehkashan

    2011-01-01

    We compared normal tissue radiation dose for the treatment of prostate cancer using 2 different radiation therapy delivery methods: volumetric modulated arc therapy (VMAT) vs. fixed-field intensity-modulated radiation therapy (IMRT). Radiotherapy plans for 292 prostate cancer patients treated with VMAT to a total dose of 7740 cGy were analyzed retrospectively. Fixed-angle, 7-field IMRT plans were created using the same computed tomography datasets and contours. Radiation doses to the planning target volume (PTV) and organs at risk (bladder, rectum, penile bulb, and femoral heads) were measured, means were calculated for both treatment methods, and dose-volume comparisons were made with 2-tailed, paired t-tests. The mean dose to the bladder was lower with VMAT at all measured volumes: 5, 10, 15, 25, 35, and 50% (p < 0.05). The mean doses to 5 and 10% of the rectum, the high-dose regions, were lower with VMAT (p < 0.05). The mean dose to 15% of the rectal volume was not significantly different (p = 0.95). VMAT exposed larger rectal volumes (25, 35, and 50%) to more radiation than fixed-field IMRT (p < 0.05). Average mean dose to the penile bulb (p < 0.05) and mean dose to 10% of the femoral heads (p < 0.05) were lower with VMAT. VMAT therapy for prostate cancer has dosimetric advantages for critical structures, notably for high-dose regions compared with fixed-field IMRT, without compromising PTV coverage. This may translate into reduced acute and chronic toxicity.

  15. VMAT vs. 7-Field-IMRT: Assessing the Dosimetric Parameters of Prostate Cancer Treatment with a 292-Patient Sample

    SciTech Connect

    Kopp, Robert W.; Duff, Michael; Catalfamo, Frank; Shah, Dhiren; Rajecki, Michael; Ahmad, Kehkashan

    2011-01-01

    We compared normal tissue radiation dose for the treatment of prostate cancer using 2 different radiation therapy delivery methods: volumetric modulated arc therapy (VMAT) vs. fixed-field intensity-modulated radiation therapy (IMRT). Radiotherapy plans for 292 prostate cancer patients treated with VMAT to a total dose of 7740 cGy were analyzed retrospectively. Fixed-angle, 7-field IMRT plans were created using the same computed tomography datasets and contours. Radiation doses to the planning target volume (PTV) and organs at risk (bladder, rectum, penile bulb, and femoral heads) were measured, means were calculated for both treatment methods, and dose-volume comparisons were made with 2-tailed, paired t-tests. The mean dose to the bladder was lower with VMAT at all measured volumes: 5, 10, 15, 25, 35, and 50% (p < 0.05). The mean doses to 5 and 10% of the rectum, the high-dose regions, were lower with VMAT (p < 0.05). The mean dose to 15% of the rectal volume was not significantly different (p = 0.95). VMAT exposed larger rectal volumes (25, 35, and 50%) to more radiation than fixed-field IMRT (p < 0.05). Average mean dose to the penile bulb (p < 0.05) and mean dose to 10% of the femoral heads (p < 0.05) were lower with VMAT. VMAT therapy for prostate cancer has dosimetric advantages for critical structures, notably for high-dose regions compared with fixed-field IMRT, without compromising PTV coverage. This may translate into reduced acute and chronic toxicity.

  16. Development of novel enzyme potentiometric biosensor based on pH-sensitive field-effect transistors for aflatoxin B1 analysis in real samples.

    PubMed

    Stepurska, K V; Soldatkin, O O; Arkhypova, V M; Soldatkin, A P; Lagarde, F; Jaffrezic-Renault, N; Dzyadevych, S V

    2015-11-01

    This study aimed at the development and optimization of a potentiometric biosensor based on pH-sensitive field-effect transistors and acetylcholinesterase for aflatoxin B1 determination in real samples. Optimal conditions for bioselective elements operation were defined and analytical characteristics of the proposed biosensor were studied. The proposed biosensor characterized high operational stability and reproducibility of signal. Selectivity of acetylcholinesterase-biosensor to aflatoxins in relation to other groups of toxic substances was analyzed. The developed biosensor was applied to the determination of aflatoxin B1 in real samples (sesame, walnut and pea).

  17. Field-enhanced sample injection micelle-to-solvent stacking capillary zone electrophoresis-electrospray ionization mass spectrometry of antibiotics in seawater after solid-phase extraction.

    PubMed

    Wuethrich, Alain; Haddad, Paul R; Quirino, Joselito P

    2016-05-01

    The synergistic stacking approach of field-enhanced sample injection-micelle-to-solvent stacking was used for high sensitivity CZE-ESI-MS of eight penicillins and sulfonamides. Sensitivity enhancement factors (peak height) were 1629-3328 compared to typical injection, with LODs from 0.11 to 0.55 ng/mL. The analytical figures of merit were acceptable. SPE on a fortified seawater sample resulted in 50-fold enrichment with recoveries of 85-110%. The overall method LODs were 0.002-0.011 ng/mL. PMID:27135307

  18. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  19. Field sampling rate of BG-sentinel traps for Aedes aegypti (Diptera: Culicidae) in suburban Cairns, Australia.

    PubMed

    Johnson, P H; Spitzauer, V; Ritchie, S A

    2012-01-01

    Mini-mark-release-recapture experiments were conducted in suburban Cairns, Australia to establish the sampling rate of the Biogents-Sentinel (BGS) trap for adult Aedes aegypti (L.). Small cohorts of marked mosquitoes (30 females and 15 males) were released at typical Cairns residences, and the number of marked mosquitoes recaptured in the BGS trap after 24 h was recorded. The sampling rate was compared between two seasons and two common housing styles (high-set 'Queenslander-style' timber and low-set brick houses), between old gravid and young nulliparous females, and between mosquitoes released in different areas of a house. Overall, the BGS traps recaptured a mean (+/- SEM) of 24.6% (+/- 1.9) of the released marked female mosquitoes in 24 h. The mean recapture rate for females was significantly higher in the dry season (30.4% +/- 2.8) compared with the wet (18.8% +/- 2.2). The overall recapture rates did not differ significantly between the two house types, but variability between the individual premises was high. An overall mean of 18.2% (+/- 1.7) of males was collected. Recapture rates of young nullipars and older gravid females were similar. These recapture rates can be used to estimate the population density of Ae. aegypti females in north Queensland, although it will provide an underestimate as trap sample was largely representative of mosquitoes present in the same area as the trap, and not from other areas of the house. PMID:22308768

  20. Frequency distribution of mineral elements in samples of alfalfa and sugar beet leaves obtained from a common field in Imperial Valley, California

    SciTech Connect

    Wallace, A.; Romney, E.M.; Kinnear, J.

    1982-07-01

    Baseline measurements were made of mineral composition of alfalfa (Medicago sativa L.) and sugar beets (Beta vulgaris L.) from one field each in the Imperial Valley of California. The fields are in a geothermal area being developed for energy production, and the purpose of the investigation was to ascertain variablility within a relatively large number of samples from a common area, so that subsequent samplings could be made to satisfactorily detect whether there were changes resulting from the geothermal activity. Means, standard deviations, frequency distribution, correlations, cluster trees, and other statistics were examined for over 20 elements at each site.Most elements were normally distributed, but there was three- to fourfold range in the concentration for each.

  1. Air resistance measurements on actual airplane parts

    NASA Technical Reports Server (NTRS)

    Weiselsberger, C

    1923-01-01

    For the calculation of the parasite resistance of an airplane, a knowledge of the resistance of the individual structural and accessory parts is necessary. The most reliable basis for this is given by tests with actual airplane parts at airspeeds which occur in practice. The data given here relate to the landing gear of a Siemanms-Schuckert DI airplane; the landing gear of a 'Luftfahrzeug-Gesellschaft' airplane (type Roland Dlla); landing gear of a 'Flugzeugbau Friedrichshafen' G airplane; a machine gun, and the exhaust manifold of a 269 HP engine.

  2. Explosive Percolation Transition is Actually Continuous

    NASA Astrophysics Data System (ADS)

    da Costa, R. A.; Dorogovtsev, S. N.; Goltsev, A. V.; Mendes, J. F. F.

    2010-12-01

    Recently a discontinuous percolation transition was reported in a new “explosive percolation” problem for irreversible systems [D. Achlioptas, R. M. D’Souza, and J. Spencer, Science 323, 1453 (2009)SCIEAS0036-807510.1126/science.1167782] in striking contrast to ordinary percolation. We consider a representative model which shows that the explosive percolation transition is actually a continuous, second order phase transition though with a uniquely small critical exponent of the percolation cluster size. We describe the unusual scaling properties of this transition and find its critical exponents and dimensions.

  3. Field confirmation of modified pressurized solvent extraction vessels for the analysis of polychlorinated biphenyl congeners in blood samples from Great Lakes Mallards (Anas platyrhynchos).

    PubMed

    Haskins, Stacey D; Kelly, David G; Weir, Ron D

    2013-06-01

    Miniaturized pressurized solvent extraction vessels were used to examine polychlorinated biphenyl congener (PCB) concentrations in 0.2 g sample sizes of whole blood, liver, heart and breast tissue sampled from twelve Great Lakes Mallard ducks (Anas platyrhynchos). This study successfully supported the blood extraction method, previously validated only using laboratory prepared blood samples, using field samples. In situ clean-up offered excellent sample throughput without degradation of GC-MS performance; using this method, extraction, instrument analysis and data interpretation for 100 samples could be accomplished within a one to two week time period. Results indicated contamination in the blood (∑PCB = 1.9-13 ng g(-1) ww), liver (∑PCB = 0.8-11 ng g(-1) ww), breast (∑PCB = <0.1-9 ng g(-1) ww) and heart tissue (∑PCB = <0.1-6 ng g(-1) ww). Quality control included the analysis of blank samples, NIST SRM 1589a and a duplicate of each sample type (blood or tissue). All blank samples were below the method detection limit, SRM values were within 70% of their certified values and duplicates were within 70% of each other. Correlations were examined for the suite of analysed congeners between blood and various tissues; within select individuals a strong and significant correlation was observed. TEQs were calculated and compared against known toxicity data for bird species. Based on the PCB levels found in this study, no adverse health effects are expected in the birds themselves. ∑PCB concentrations in the breast tissue were also compared against both the Canadian and American guidelines for the consumption of edible poultry and based on these values, the Mallards used in this research would be safe for human consumption.

  4. The use of COS-1 cells for studies of field and laboratory African swine fever virus samples.

    PubMed

    Hurtado, Carolina; Bustos, María José; Carrascosa, Angel L

    2010-03-01

    Different naturally occurring, cell adapted or genetically manipulated stocks of African swine fever virus were able to infect directly cultures of COS-1 cells, producing extensive cytopathic effects and amounts from 10(6) to 10(7) of infective progeny virus per ml. The induction of late virus-specific proteins, demonstrated by RT-PCR and immunoblotting, and the development of lysis plaques by all the virus samples tested so far, allowed the optimization of both titration and diagnostic assays, as well as the proposal of a method for selection of virus clones during the generation of virus mutants with specific gene deletions.

  5. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples.

    PubMed

    Parada, Alma E; Needham, David M; Fuhrman, Jed A

    2016-05-01

    Microbial community analysis via high-throughput sequencing of amplified 16S rRNA genes is an essential microbiology tool. We found the popular primer pair 515F (515F-C) and 806R greatly underestimated (e.g. SAR11) or overestimated (e.g. Gammaproteobacteria) common marine taxa. We evaluated marine samples and mock communities (containing 11 or 27 marine 16S clones), showing alternative primers 515F-Y (5'-GTGYCAGCMGCCGCGGTAA) and 926R (5'-CCGYCAATTYMTTTRAGTTT) yield more accurate estimates of mock community abundances, produce longer amplicons that can differentiate taxa unresolvable with 515F-C/806R, and amplify eukaryotic 18S rRNA. Mock communities amplified with 515F-Y/926R yielded closer observed community composition versus expected (r(2)  = 0.95) compared with 515F-Y/806R (r(2)  ∼ 0.5). Unexpectedly, biases with 515F-Y/806R against SAR11 in field samples (∼4-10-fold) were stronger than in mock communities (∼2-fold). Correcting a mismatch to Thaumarchaea in the 515F-C increased their apparent abundance in field samples, but not as much as using 926R rather than 806R. With plankton samples rich in eukaryotic DNA (> 1 μm size fraction), 18S sequences averaged ∼17% of all sequences. A single mismatch can strongly bias amplification, but even perfectly matched primers can exhibit preferential amplification. We show that beyond in silico predictions, testing with mock communities and field samples is important in primer selection.

  6. The Photometric and Kinematic Structure of Face-on Disk Galaxies. I. Sample Definition, Hα Integral Field Spectroscopy, and H I Line Widths

    NASA Astrophysics Data System (ADS)

    Andersen, David R.; Bershady, Matthew A.; Sparke, Linda S.; Gallagher, John S., III; Wilcots, Eric M.; van Driel, Wim; Monnier-Ragaigne, Delphine

    2006-10-01

    We present a survey of the photometric and kinematic properties of 39 nearby, nearly face-on disk galaxies. Our approach exploits echelle-resolution integral-field spectroscopy of the Hα regions, obtained with DensePak on the WIYN 3.5 m telescope Bench Spectrograph. These data are complemented by H I line profiles observed with the Nançay radio telescope for 25 of these sample galaxies. Twelve additional line widths are available for sample galaxies from the literature. In this paper, we introduce the goals of this survey, define the sample selection algorithm, and amass the integral field spectroscopic data and H I line widths. We establish spatially integrated Hα line widths for the sample. We test the veracity of these spatially integrated line profiles by convolving narrowband imaging data with velocity field information for one of the sample galaxies, PGC 38268, and also by comparing to H I line profiles. We find H I and Hα line profiles to be similar in width but different in shape, indicating that we are observing different spatial distributions of ionized and neutral gas in largely axisymmetric systems with flat outer rotation curves. We also find vertical velocity dispersions of the ionized disk gas within several disk scale lengths have a median value of 18 km s-1 and an 80% range of 12-26 km s-1. This is only a factor of ~2 larger than what is observed for neutral atomic and molecular gas. With standard assumptions for intrinsic and thermal broadening for Hα, this translates into a factor of 3 range in turbulent velocities, between 8 and 25 km s-1.

  7. Continuous analysis of δ¹⁸O and δD values of water by diffusion sampling cavity ring-down spectrometry: a novel sampling device for unattended field monitoring of precipitation, ground and surface waters.

    PubMed

    Munksgaard, Niels C; Wurster, Chris M; Bird, Michael I

    2011-12-30

    A novel sampling device suitable for continuous, unattended field monitoring of rapid isotopic changes in environmental waters is described. The device utilises diffusion through porous PTFE tubing to deliver water vapour continuously from a liquid water source for analysis of δ¹⁸O and δD values by Cavity Ring-Down Spectrometry (CRDS). Separation of the analysed water vapour from non-volatile dissolved and particulate contaminants in the liquid sample minimises spectral interferences associated with CRDS analyses of many aqueous samples. Comparison of isotopic data for a range of water samples analysed by Diffusion Sampling-CRDS (DS-CRDS) and Isotope Ratio Mass Spectrometry (IRMS) shows significant linear correlations between the two methods allowing for accurate standardisation of DS-CRDS data. The internal precision for an integration period of 3 min (standard deviation (SD) = 0.1‰ and 0.3‰ for δ¹⁸O and δD values, respectively) is similar to analysis of water by CRDS using an autosampler to inject and evaporate discrete water samples. The isotopic effects of variable air temperature, water vapour concentration, water pumping rate and dissolved organic content were found to be either negligible or correctable by analysis of water standards. The DS-CRDS system was used to analyse the O and H isotope composition in short-lived rain events. Other applications where finely time resolved water isotope data may be of benefit include recharge/discharge in groundwater/river systems and infiltration-related changes in cave drip water.

  8. Field use of semipermeable membrane devices (SPMDs) for passive air sampling of polycyclic aromatic hydrocarbons: Opportunities and limitations

    NASA Astrophysics Data System (ADS)

    Piccardo, M. T.; Stella, A.; Pala, M.; Balducci, D.; Valerio, F.

    2010-05-01

    Semipermeable membrane devices (SPMDs) were used for measurements in air of twelve polycyclic aromatic hydrocarbons (PAHs) in two Genoa locations, both on building roofs, distant 300 m from each other. The first, site A, was in front a dismissing steel complex and the second, site B, was in an urban area overlooking a busy thoroughfare. SPMDs were deployed contemporary at the two sites, in nine monthly samplings, from April 2007 to May 2008. The amount of sequestered PAHs, in sites A and B, ranged between 61-267 ng SPMD -1 d -1 and 50-535 ng SPMD -1 d -1, respectively. PAHs profiles highlighted seasonal differences and suggested the possible role of different PAHs sources in the two areas. In particular, the contribution of remediation works of the steel complex was observed in site A. Moreover, a naphthalene leak from a tank, into the former industrial area, and a fire broke out near site A, were registered by time-integrated measurements of SPMDs. However, the strong dependence between amount of sequestered PAHs and air temperature needs further studies to distinguish between uptake rate variability and seasonal contribution of different sources. Finally, to measure air concentrations with reasonable accuracy, it should be very important to have certified sampling rates for all individual PAHs.

  9. Development of a spatially targeted field sampling technique for the southern cattle tick, Rhipicephalus microplus, by mapping white-tailed deer, Odocoileus virginianus, habitat in South Texas.

    PubMed

    Phillips, Pamela L; Welch, John B; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field. PMID:25368044

  10. Development of a Spatially Targeted Field Sampling Technique for the Southern Cattle Tick, Rhipicephalus microplus, by Mapping Whitetailed Deer, Odocoileus virginianus, Habitat in South Texas

    PubMed Central

    Phillips, Pamela L.; Welch, John B.; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field. PMID:25368044

  11. Development of a spatially targeted field sampling technique for the southern cattle tick, Rhipicephalus microplus, by mapping white-tailed deer, Odocoileus virginianus, habitat in South Texas.

    PubMed

    Phillips, Pamela L; Welch, John B; Kramer, Matthew

    2014-01-01

    The objective of our study was to determine whether satellite remote sensed data could be used to identify white-tailed deer, Odocoileus virginianus (Zimmerman) (Artiodactyla: Cervidae), habitat and target locations for sampling free-living larvae of the southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Ixodida: Ixodidae) in South Texas. Two methods for mapping white-tailed deer habitat were used, an object-oriented method to identify closed canopies and waterways for deer movement and two vegetation indices: the Normalized Difference Vegetation Index and the Modified Soil Adjusted Vegetation Index to identify forage for deer. These two data sets of favorable white-tailed deer habitat were combined within a geographic information system to identify locations for sampling ticks. Larvae of R. (B.) microplus, were sampled in Zapata County, Texas, by walking transects with attached flannel panels to jeans. Although the data set and sampling period were limited, data analysis demonstrated that sampling of free-living larvae of R. (B.) microplus can be conducted in South Texas, and larvae were most abundant in areas that harbored O. virginianus. Spatial analysis of satellite imagery to classify white-tailed deer/southern cattle tick habitat proved efficacious and may be useful in directing sampling activities in the field.

  12. Possibilities and limitations of the ART-Sample algorithm for reconstruction of 3D temperature fields and the influence of opaque obstacles

    PubMed Central

    Li, Yuanyang; Herman, Cila

    2013-01-01

    The need for the measurement of complex, unsteady, three-dimensional (3D) temperature distributions arises in a variety of engineering applications, and tomographic techniques are applied to accomplish this goal. Holographic interferometry (HI), one of the optical methods used for visualizing temperature fields, combined with tomographic reconstruction techniques requires multi-directional interferometric data to recover the 3D information. However, the presence of opaque obstacles (such as solid objects in the flow field and heaters) in the measurement volume, prevents the probing light beams from traversing the entire measurement volume. As a consequence, information on the average value of the field variable will be lost in regions located in the shade of the obstacle. The capability of the ART-Sample tomographic reconstruction method to recover 3D temperature distributions both in unobstructed temperature fields and in the presence of opaque obstacles is discussed in this paper. A computer code for tomographic reconstruction of 3D temperature fields from 2D projections was developed. In the paper, the reconstruction accuracy is discussed quantitatively both without and with obstacles in the measurement volume for a set of phantom functions mimicking realistic temperature distributions. The reconstruction performance is optimized while minimizing the number of irradiation directions (experimental hardware requirements) and computational effort. For the smooth temperature field both with and without obstacles, the reconstructions produced by this algorithm are good, both visually and using quantitative criteria. The results suggest that the location and the size of the obstacle and the number of viewing directions will affect the reconstruction of the temperature field. When the best performance parameters of the ART-Sample algorithm identified in this paper are used to reconstruct the 3D temperature field, the 3D reconstructions with and without obstacle are

  13. A Modified Alderman-Grant Coil makes possible an efficient cross-coil probe for high field solid-state NMR of lossy biological samples

    NASA Astrophysics Data System (ADS)

    Grant, Christopher V.; Yang, Yuan; Glibowicka, Mira; Wu, Chin H.; Park, Sang Ho; Deber, Charles M.; Opella, Stanley J.

    2009-11-01

    The design, construction, and performance of a cross-coil double-resonance probe for solid-state NMR experiments on lossy biological samples at high magnetic fields are described. The outer coil is a Modified Alderman-Grant Coil (MAGC) tuned to the 1H frequency. The inner coil consists of a multi-turn solenoid coil that produces a B 1 field orthogonal to that of the outer coil. This results in a compact nested cross-coil pair with the inner solenoid coil tuned to the low frequency detection channel. This design has several advantages over multiple-tuned solenoid coil probes, since RF heating from the 1H channel is substantially reduced, it can be tuned for samples with a wide range of dielectric constants, and the simplified circuit design and high inductance inner coil provides excellent sensitivity. The utility of this probe is demonstrated on two electrically lossy samples of membrane proteins in phospholipid bilayers (bicelles) that are particularly difficult for conventional NMR probes. The 72-residue polypeptide embedding the transmembrane helices 3 and 4 of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (residues 194-241) requires a high salt concentration in order to be successfully reconstituted in phospholipid bicelles. A second application is to paramagnetic relaxation enhancement applied to the membrane-bound form of Pf1 coat protein in phospholipid bicelles where the resistance to sample heating enables high duty cycle solid-state NMR experiments to be performed.

  14. Monoclonal antibody-based dipstick assay: a reliable field applicable technique for diagnosis of Schistosoma mansoni infection using human serum and urine samples.

    PubMed

    Demerdash, Zeinab; Mohamed, Salwa; Hendawy, Mohamed; Rabia, Ibrahim; Attia, Mohy; Shaker, Zeinab; Diab, Tarek M

    2013-02-01

    A field applicable diagnostic technique, the dipstick assay, was evaluated for its sensitivity and specificity in diagnosing human Schistosoma mansoni infection. A monoclonal antibody (mAb) against S. mansoni adult worm tegumental antigen (AWTA) was employed in dipstick and sandwich ELISA for detection of circulating schistosome antigen (CSA) in both serum and urine samples. Based on clinical and parasitological examinations, 60 S. mansoni-infected patients, 30 patients infected with parasites other than schistosomiasis, and 30 uninfected healthy individuals were selected. The sensitivity and specificity of dipstick assay in urine samples were 86.7% and 90.0%, respectively, compared to 90.0% sensitivity and 91.7% specificity of sandwich ELISA. In serum samples, the sensitivity and specificity were 88.3% and 91.7% for dipstick assay vs. 91.7% and 95.0% for sandwich ELISA, respectively. The diagnostic efficacy of dipstick assay in urine and serum samples was 88.3% and 90.0%, while it was 90.8% and 93.3% for sandwich ELISA, respectively. The diagnostic indices of dipstick assay and ELISA either in serum or in urine were statistically comparable (P>0.05). In conclusion, the dipstick assay offers an alternative simple, rapid, non-invasive technique in detecting CSA or complement to stool examinations especially in field studies. PMID:23467705

  15. Linking community tolerance and structure with low metallic contamination: a field study on 13 biofilms sampled across the Seine river basin.

    PubMed

    Fechner, Lise C; Gourlay-Francé, Catherine; Tusseau-Vuillemin, Marie-Hélène

    2014-03-15

    It is difficult to assess the biological consequences of diffuse water contamination by micropollutants which are present in rivers at low, even sublethal levels. River biofilms, which respond quickly to changes of environmental parameters, are good candidates to acquire knowledge on the response of aquatic organisms to diffuse chemical contamination in the field. The study was designed as an attempt to link biofilm metal tolerance and metallic contamination in a field survey covering 13 different sampling sites in the Seine river basin (north of France) with low contamination levels. Cd and Zn tolerance of heterotrophic communities was assessed using a short-term toxicity test based on β-glucosidase activity. Metal tolerance levels varied between sites but there was no obvious correlation between tolerance and corresponding water contamination levels for Cd and Zn. Indeed, metallic contamination at the sampling sites remained subtle when compared to water quality standards (only two sampling sites had either Zn or both Cu and Zn concentrations exceeding the Environmental Quality Standards set by the EU Water Framework Directive). Yet, multivariate analysis of the data using Partial Least Squares Regression revealed that both metallic and environmental parameters were important variables explaining the variability of metal tolerance levels. Automated Ribosomal Intergenic Spacer Analysis (ARISA) was also performed on both bacterial and eukaryotic biofilm communities from the 13 sampling sites. Multivariate analysis of ARISA fingerprints revealed that biofilms with similar tolerance levels have similar ARISA profiles. Those results confirm that river biofilms are potential indicators of low, diffuse contamination levels of aquatic systems.

  16. Pre-injection Comparison of Methods for Sampling Formation Water and Associated Gas from a Monitoring Well at a Carbon Dioxide Injection Site, Citronelle Oil Field, Alabama

    NASA Astrophysics Data System (ADS)

    Conaway, C.; Thordsen, J. J.; Manning, M. A.; Cook, P. J.; Abedini, A. A.; Trautz, R. C.; Thomas, B.; Kharaka, Y. K.

    2012-12-01

    The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a well in the Citronelle Oil Field, Alabama, a site that will be used for a carbon dioxide injection experiment. Prior to each of the two sampling periods, the well was cleaned from the drilling fluids and KCl solutions by producing at least three pore volumes of formation water. Accurate measurements of the chemical composition of groundwater or formation water, including dissolved gasses, and gas samples is essential in understanding subsurface geochemical processes occurring as a result of geologic carbon dioxide injection, which is used for enhanced oil recovery (EOR) and has been proposed as a means of carbon sequestration. In this study, formation water and gas samples for geochemical analyses were obtained from well D-9-8 #2 at Citronelle using nitrogen lift, submersible pump, U-Tube, and a downhole (Kuster) sampler. Field chemical analyses included electrical conductivity, hydrogen sulfide, alkalinity, and pH, and laboratory analyses included major, minor and trace elements by mass spectrometry and ion chromatography, dissolved carbon, organic acid anions, free and dissolved gas species. The formation water obtained from this well is a Na-Ca-Cl brine with a salinity of 160,000 and 200,000 mg/L total dissolved solids (TDS). Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity measurements. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the downhole sampler and U-Tube system performing most favorably in this aspect.

  17. Geochemistry of stream-sediment samples from the Santa Renia Fields and Beaver Peak quadrangles, northern Carlin Trend, Nevada

    USGS Publications Warehouse

    Theodore, Ted G.; Kotlyar, Boris B.; Berger, Vladimir I.; Moring, Barry C.; Singer, Donald A.; Edstrom, Sven A.

    1999-01-01

    A broad west-to-east increase of many metal concentrations has been found in stream sediments during a reconnaissance investigation conducted in conjunction with geologic studies in the Santa Renia Fields and Beaver Peak 7–1/2 minute quadrangles near the northern end of the Carlin trend of gold deposits in the Tuscarora Mountains. This regional increase in metal concentrations coincides with a dramatic change in landform wherein high concentrations of metals in stream sediments appear to correlate directly with areas of high elevations and steep slopes in the Beaver Peak quadrangle. Robust erosion combined with high flow rates in streams from these higher elevations are envisaged to have contributed significantly to increased metal concentrations in the stream sediments by an enhanced presence of minerals with high specific gravities and a correspondingly diminished presence of minerals with low specific gravities. Minerals with low specific gravities probably have been preferentially flushed down stream because of high transporting capacities for sediment by streams in the Beaver Peak quadrangle. In addition, the Carlin trend, a generally northwest-alignment of gold deposits in the Santa Renia Fields quadrangle, is well outlined by arsenic concentrations that include a maximum of approximately 54 parts per million. Further, a weakly developed distal-to-proximal metal zonation towards these gold deposits appears to be defined respectively in plots showing distributions of thallium, arsenic, antimony, and zinc. A broad area of high metal concentrations—including sharply elevated abundances of Ag, As, Au, Cd, Co, Cu, Mn, Ni, P, Sb, Sc, Te, V, and especially Zn—near the southeast corner of the Beaver Peak quadrangle primarily could be the result of stratiform mineralized rocks in the Ordovician Vinini Formation or Devonian Slaven Chert, or the result of a subsequent Mesozoic or Tertiary epigenetic overprint.

  18. Iodide sorption and partitioning in solid, liquid and gas phases in soil samples collected from Japanese paddy fields.

    PubMed

    Ishikawa, Nao K; Uchida, Shigeo; Tagami, Keiko

    2011-07-01

    Sorption kinetics of iodide (I(-)), which is one of the major inorganic chemical forms of iodine in soil environments, were studied under four sets of experimental conditions characterised by temperature or biological activity. We compared partitioning ratios in solid, liquid and gas phases in soils as well as soil-soil solution distribution coefficients (K(d)s) at two different temperatures 4 and 23 °C, for 63 paddy soil samples collected throughout Japan. Interestingly, (125)I emission from soil was observed; the partitioning ratios in gas phase ranged from 0 to 27 % at 4 °C and from 0 to 42 % at 23 °C. In addition, the authors found that K(d) values at 23 °C had good correlation with pH though there was no correlation between K(d) values at 4 °C and pH because of the difference in biological activity.

  19. Actual leisure participation of Norwegian adolescents with Down syndrome.

    PubMed

    Dolva, Anne-Stine; Kleiven, Jo; Kollstad, Marit

    2014-02-01

    This article reports the actual participation in leisure activities by a sample of Norwegian adolescents with Down syndrome aged 14. Representing a first generation to grow up in a relatively inclusive context, they live with their families, attend mainstream schools, and are part of common community life. Leisure information was obtained in individual, structured parent interviews, and added to existing longitudinal data from a project following the sample. Generally, the leisure activity may be viewed as varying along a continuum-reaching from formal, organized, and assisted activity participation outside home, to informal, self-organized, and independent participation at home. Formal leisure activities were either organized "for all" or "adapted for disabled." The adolescents' leisure appears as active and social. However, social participation largely involved parents and family, while socializing with other adolescents mainly took place within formal activities adapted for disabled. Clearly, formal and informal activities provide rather different opportunities for social encounters and assistance. PMID:24515503

  20. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; arsenic speciation in natural-water samples using laboratory and field methods

    USGS Publications Warehouse

    Garbarino, John R.; Bednar, Anthony J.; Burkhardt, Mark R.

    2002-01-01

    Analytical methods for the determination of arsenite [As(III)], arsenate [As(V)], dimethylarsinate (DMA), monomethylarsonate (MMA), and roxarsone in filtered natural-water samples are described. Various analytical methods can be used for the determination, depending on the arsenic species being determined. Arsenic concentration is determined by using inductively coupled plasma-mass spectrometry (ICP-MS) as an arsenic-specific detector for all methods. Laboratory-speciation methods are described that use an ion chromatographic column to separate the arsenic species; the column length, column packing, and mobile phase are dependent on the species of interest. Regardless of the separation technique, the arsenic species are introduced into plasma by eithe rpneumatic nebulization or arsine generation. Analysis times range from 2 to 8 minutes and method detection limits range from 0.1 to 0.6 microgram-arsenic per liter (ug-As/L), 10 to 60 picograms absolute (for a 100-microliter injection), depending on the arsenic species determined and the analytical method used. A field-generation specciation method also is described that uses a strong anion exchange cartridge to separate As(III) from As(V) in the field. As(III) in the eluate and the As(V) in the cartridge extract are determined by direct nebulization ICP-MS. Methylated arsenic species that also are retained on the cartridge will positively bias As(V) results without further laboratory separations. The method detection limit for field speciation is 0.3 ug-As/L. The distribution of arsenic species must be preserved in the field to eliminate changes caused by photochemical oxidation or metal oxyhydroxide precipitation. Preservation techniques, such as refrigeration, the addition of acides, or the additoin of ethylene-diaminetetraacetic acid (EDTA) and the effects of ambient light were tested. Of the preservatives evaluated, EDTA was found to work best with the laboratory- and field-speciation methods for all sample

  1. The actual status of Astronomy in Moldova

    NASA Astrophysics Data System (ADS)

    Gaina, A.

    The astronomical research in the Republic of Moldova after Nicolae Donitch (Donici)(1874-1956(?)) were renewed in 1957, when a satellites observations station was open in Chisinau. Fotometric observations and rotations of first Soviet artificial satellites were investigated under a program SPIN put in action by the Academy of Sciences of former Socialist Countries. The works were conducted by Assoc. prof. Dr. V. Grigorevskij, which conducted also research in variable stars. Later, at the beginning of 60-th, an astronomical Observatory at the Chisinau State University named after Lenin (actually: the State University of Moldova), placed in Lozovo-Ciuciuleni villages was open, which were coordinated by Odessa State University (Prof. V.P. Tsesevich) and the Astrosovet of the USSR. Two main groups worked in this area: first conducted by V. Grigorevskij (till 1971) and second conducted by L.I. Shakun (till 1988), both graduated from Odessa State University. Besides this research areas another astronomical observations were made: Comets observations, astroclimate and atmospheric optics in collaboration with the Institute of the Atmospheric optics of the Siberian branch of the USSR (V. Chernobai, I. Nacu, C. Usov and A.F. Poiata). Comets observations were also made since 1988 by D. I. Gorodetskij which came to Chisinau from Alma-Ata and collaborated with Ukrainean astronomers conducted by K.I. Churyumov. Another part of space research was made at the State University of Tiraspol since the beggining of 70-th by a group of teaching staff of the Tiraspol State Pedagogical University: M.D. Polanuer, V.S. Sholokhov. No a collaboration between Moldovan astronomers and Transdniestrian ones actually exist due to War in Transdniestria in 1992. An important area of research concerned the Radiophysics of the Ionosphere, which was conducted in Beltsy at the Beltsy State Pedagogical Institute by a group of teaching staff of the University since the beginning of 70-th: N. D. Filip, E

  2. MODIS Solar Diffuser: Modelled and Actual Performance

    NASA Technical Reports Server (NTRS)

    Waluschka, Eugene; Xiong, Xiao-Xiong; Esposito, Joe; Wang, Xin-Dong; Krebs, Carolyn (Technical Monitor)

    2001-01-01

    The Moderate Resolution Imaging Spectroradiometer (MODIS) instrument's solar diffuser is used in its radiometric calibration for the reflective solar bands (VIS, NTR, and SWIR) ranging from 0.41 to 2.1 micron. The sun illuminates the solar diffuser either directly or through a attenuation screen. The attenuation screen consists of a regular array of pin holes. The attenuated illumination pattern on the solar diffuser is not uniform, but consists of a multitude of pin-hole images of the sun. This non-uniform illumination produces small, but noticeable radiometric effects. A description of the computer model used to simulate the effects of the attenuation screen is given and the predictions of the model are compared with actual, on-orbit, calibration measurements.

  3. Novel sample preparation methods and field testing procedures used to determine the chemical basis of cocaine detection by canines

    NASA Astrophysics Data System (ADS)

    Furton, Kenneth G.; Hsu, Ya-Li; Luo, Tien-Ying; Alvarez, Nayiby; Lagos, Pedro

    1997-02-01

    The use of canines to signal money associated with drug trafficking is a major point of contention among dog handlers, forensic scientists, and the legal community particularly in light of recent reports that a significant amount of money in circulation is contaminated with detectable amounts of cocaine. The questions raised include: What exactly are the dogs alerting to? How selective are the dogs? How sensitive are the dogs? How reliable are the dogs? Tests with various volatile cocaine by-products confirm that the dominant chemical in cocaine odor is methyl benzoate. Field tests on fifteen different drug detector dogs with varying breeds, ages and training regimes show a consistent threshold level of 1 (mu) g of methyl benzoate spiked along with cocaine on U.S. currency required to initiate an alert. The majority of the canines did not alert to pharmaceutical grade cocaine even at levels as high as 1 g. Methyl benzoate is shown to evaporate rapidly from individual bills and is a function of the available surface area for wrapped currency. The canines tested were remarkably selective and reliable even under varying test conditions and using different delivery devices.

  4. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  5. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  6. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  7. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  8. 7 CFR 1437.101 - Actual production history.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Actual production history. 1437.101 Section 1437.101... Determining Yield Coverage Using Actual Production History § 1437.101 Actual production history. Actual production history (APH) is the unit's record of crop yield by crop year for the APH base period. The...

  9. Near-field commercial aircraft contribution to nitrogen oxides by engine, aircraft type, and airline by individual plume sampling.

    PubMed

    Carslaw, David C; Ropkins, Karl; Laxen, Duncan; Moorcroft, Stephen; Marner, Ben; Williams, Martin L

    2008-03-15

    Nitrogen oxides (NOx) concentrations were measured in individual plumes from aircraft departing on the northern runway at Heathrow Airport in west London. Over a period of four weeks 5618 individual plumes were sampled by a chemiluminescence monitor located 180 m from the runway. Results were processed and matched with detailed aircraft movement and aircraft engine data using chromatographic techniques. Peak concentrations associated with 29 commonly used engines were calculated and found to have a good relationship with N0x emissions taken from the International Civil Aviation Organization (ICAO) databank. However, it is found that engines with higher reported NOx emissions result in proportionately lower NOx concentrations than engines with lower emissions. We show that it is likely that aircraft operational factors such as takeoff weight and aircraftthrust setting have a measurable and important effect on concentrations of N0x. For example, NOx concentrations can differ by up to 41% for aircraft using the same airframe and engine type, while those due to the same engine type in different airframes can differ by 28%. These differences are as great as, if not greater than, the reported differences in NOx emissions between different engine manufacturers for engines used on the same airframe.

  10. Microscopic and Spectroscopic Characterization of Calcified Microorganisms at the Nanometer-Scale in Experimental and Field Samples.

    NASA Astrophysics Data System (ADS)

    Benzerara, K.; Yoon, T.; Menguy, N.; Tyliszczak, T.; Brown, G. E.

    2004-12-01

    Calcium phosphates and calcium carbonates are the most prevalent minerals involved in microbial fossilization. Structural characterization of both the organic and mineral components in such samples is, however, usually difficult at the appropriate spatial resolution, i.e., at the submicrometer scale. We have used a combination of Scanning Transmission X-ray microscopy (STXM), a synchrotron-based technique, and High-Resolution Transmission Electron Microscopy (HRTEM) to characterize both the Ca-containing biominerals and the functional groups present in the organic components associated with them (STXM). These data, in turn, provide a better understanding of the mechanisms, products, and biomolecules involved in microbial calcification. We have studied the experimental biomineralization of the model strain Caulobacter crescentus by calcium phosphates, and the calcification of natural biofilms by aragonite in an alkaline lake in Turkey. The precipitation of calcium phosphate and calcium carbonate by microorganisms likely involves different mechanisms. The resulting biominerals were found to have unique features with dimensions in the nanometer-range, preferential crystallographic orientations or unusual morphologies, which provide potential biosignatures. By using C K-edge NEXAFS spectroscopy at a submicrometer scale, we were also able to document the evolution of the organic molecules during the fossilization process and to characterize those involved as templates in the formation of calcium phosphate and carbonate minerals.

  11. Near-field commercial aircraft contribution to nitrogen oxides by engine, aircraft type, and airline by individual plume sampling.

    PubMed

    Carslaw, David C; Ropkins, Karl; Laxen, Duncan; Moorcroft, Stephen; Marner, Ben; Williams, Martin L

    2008-03-15

    Nitrogen oxides (NOx) concentrations were measured in individual plumes from aircraft departing on the northern runway at Heathrow Airport in west London. Over a period of four weeks 5618 individual plumes were sampled by a chemiluminescence monitor located 180 m from the runway. Results were processed and matched with detailed aircraft movement and aircraft engine data using chromatographic techniques. Peak concentrations associated with 29 commonly used engines were calculated and found to have a good relationship with N0x emissions taken from the International Civil Aviation Organization (ICAO) databank. However, it is found that engines with higher reported NOx emissions result in proportionately lower NOx concentrations than engines with lower emissions. We show that it is likely that aircraft operational factors such as takeoff weight and aircraftthrust setting have a measurable and important effect on concentrations of N0x. For example, NOx concentrations can differ by up to 41% for aircraft using the same airframe and engine type, while those due to the same engine type in different airframes can differ by 28%. These differences are as great as, if not greater than, the reported differences in NOx emissions between different engine manufacturers for engines used on the same airframe. PMID:18409606

  12. Characterization of the geochemical and physical properties of wetland soils on the Savannah River Site: Field sampling activities. Final report

    SciTech Connect

    Dixon, K.L.

    1992-11-01

    There are 36,000 acres of wetlands on the Savannah River Site (SRS) and an additional 5,000 acres of floodplain. Recent studies of wetland soils near various waste sites at SRS have shown that some wetlands have been contaminated with pollutants resulting from SRS operations. In general, releases of contaminants to wetland areas have been indirect. These releases may have originated at disposal lagoons or waste facilities located in the vicinity of the wetland areas. Transport mechanisms such as surface runoff, soil erosion, sediment transport, and groundwater seepage into downgradient wetland areas are responsible for the indirect discharges to the wetland areas. The SRS determined that a database of background geochemical and physical properties for wetland soils on the SRS was needed to facilitate future remedial investigations, human health and ecological risk assessments, treatability studies, and feasibility studies for the wetland areas. These data are needed for comparison to contaminant data collected from wetland soils that have been affected by contamination from SRS operations. This report describes the efforts associated with the collection of soil cores, preparation of a lithologic log for each core, and the processing and packaging of individual soil samples for shipment to analytical laboratory facilities.

  13. Characterization of the geochemical and physical properties of wetland soils on the Savannah River Site: Field sampling activities

    SciTech Connect

    Dixon, K.L. )

    1992-11-01

    There are 36,000 acres of wetlands on the Savannah River Site (SRS) and an additional 5,000 acres of floodplain. Recent studies of wetland soils near various waste sites at SRS have shown that some wetlands have been contaminated with pollutants resulting from SRS operations. In general, releases of contaminants to wetland areas have been indirect. These releases may have originated at disposal lagoons or waste facilities located in the vicinity of the wetland areas. Transport mechanisms such as surface runoff, soil erosion, sediment transport, and groundwater seepage into downgradient wetland areas are responsible for the indirect discharges to the wetland areas. The SRS determined that a database of background geochemical and physical properties for wetland soils on the SRS was needed to facilitate future remedial investigations, human health and ecological risk assessments, treatability studies, and feasibility studies for the wetland areas. These data are needed for comparison to contaminant data collected from wetland soils that have been affected by contamination from SRS operations. This report describes the efforts associated with the collection of soil cores, preparation of a lithologic log for each core, and the processing and packaging of individual soil samples for shipment to analytical laboratory facilities.

  14. Field application of a planted fixed bed reactor (PFR) for support media and rhizosphere investigation using undisturbed samples from full-scale constructed wetlands.

    PubMed

    Barreto, A B; Vasconcellos, G R; von Sperling, M; Kuschk, P; Kappelmeyer, U; Vasel, J L

    2015-01-01

    This study presents a novel method for investigations on undisturbed samples from full-scale horizontal subsurface-flow constructed wetlands (HSSFCW). The planted fixed bed reactor (PFR), developed at the Helmholtz Center for Environmental Research (UFZ), is a universal test unit for planted soil filters that reproduces the operational conditions of a constructed wetland (CW) system in laboratory scale. The present research proposes modifications on the PFR original configuration in order to allow its operation in field conditions. A mobile device to obtain undisturbed samples from real-scale HSSFCW was also developed. The experimental setting is presented with two possible operational configurations. The first allows the removal and replacement of undisturbed samples in the CW bed for laboratory investigations, guaranteeing sample integrity with a mobile device. The second allows the continuous operation of the PFR and undisturbed samples as a fraction of the support media, reproducing the same environmental conditions outside the real-scale system. Investigations on the hydrodynamics of the adapted PFR were carried out with saline tracer tests, validating the proposed adaptation. Six adapted PFR units were installed next to full-scale HSSFCW beds and fed with interstitial liquid pumped from two regions of planted and unplanted support media. Fourteen points were monitored along the system, covering carbon fractions, nitrogen and sulfate. The results indicate the method as a promising tool for investigations on CW support media, rhizosphere and open space for studies on CW modeling, respirometry, kinetic parameters, microbial communities, redox potential and plant influence on HSSFCW. PMID:26247753

  15. Quantification and interpretation of total petroleum hydrocarbons in sediment samples by a GC/MS method and comparison with EPA 418.1 and a rapid field method.

    PubMed

    Xie, G; Barcelona, M J; Fang, J

    1999-05-01

    Total petroleum hydrocarbons (TPH) as a lumped parameter can be easily and rapidly measured or monitored. Despite interpretational problems, it has become an accepted regulatory benchmark used widely to evaluate the extent of petroleum product contamination. Three currently used methods (GC/MS, conventional EPA 418.1, and a rapid field method PetroFLAG) were performed to quantify the TPH content in samples collected from a site contaminated by transformer oil. To standardize the method and improve the comparability of TPH data, crucial GC-based quantification issues were examined, e.g., quantification based on internal standards (ISTD) vs external standards (ESTD), single vs multiple ISTD, and various area integration approaches. The interpretation of hydrocarbon chromatographic results was examined in the context of field samples. The performance of the GC/MS method was compared with those of EPA 418.1 and PetroFLAG. As a result, it was observed that the ISTD quantification method was preferred to the ESTD method, multiple ISTD might be better than single ISTD, and three different area integration approaches did not have a significant effect on TPH results. Evaluation of the chromatograms between a reference sample and three unknown samples showed that the extent of contamination varied appreciably with sample depth. It was also found that there existed a good positive correlation between GC/MS and both EPA 418.1 and PetroFLAG, and that EPA 418.1 produced the higher overall estimate while GC/MS and PetroFLAG resulted in lower, more statistically comparable TPH values.

  16. Nanometer-sized alumina packed microcolumn solid-phase extraction combined with field-amplified sample stacking-capillary electrophoresis for the speciation analysis of inorganic selenium in environmental water samples.

    PubMed

    Duan, Jiankuan; Hu, Bin; He, Man

    2012-10-01

    In this paper, a new method of nanometer-sized alumina packed microcolumn SPE combined with field-amplified sample stacking (FASS)-CE-UV detection was developed for the speciation analysis of inorganic selenium in environmental water samples. Self-synthesized nanometer-sized alumina was packed in a microcolumn as the SPE adsorbent to retain Se(IV) and Se(VI) simultaneously at pH 6 and the retained inorganic selenium was eluted by concentrated ammonia. The eluent was used for FASS-CE-UV analysis after NH₃ evaporation. The factors affecting the preconcentration of both Se(IV) and Se(VI) by SPE and FASS were studied and the optimal CE separation conditions for Se(IV) and Se(VI) were obtained. Under the optimal conditions, the LODs of 57 ng L⁻¹ (Se(IV)) and 71 ng L⁻¹ (Se(VI)) were obtained, respectively. The developed method was validated by the analysis of a certified reference material of GBW(E)080395 environmental water and the determined value was in a good agreement with the certified value. It was also successfully applied to the speciation analysis of inorganic selenium in environmental water samples, including Yangtze River water, spring water, and tap water.

  17. Nanometer-sized alumina packed microcolumn solid-phase extraction combined with field-amplified sample stacking-capillary electrophoresis for the speciation analysis of inorganic selenium in environmental water samples.

    PubMed

    Duan, Jiankuan; Hu, Bin; He, Man

    2012-10-01

    In this paper, a new method of nanometer-sized alumina packed microcolumn SPE combined with field-amplified sample stacking (FASS)-CE-UV detection was developed for the speciation analysis of inorganic selenium in environmental water samples. Self-synthesized nanometer-sized alumina was packed in a microcolumn as the SPE adsorbent to retain Se(IV) and Se(VI) simultaneously at pH 6 and the retained inorganic selenium was eluted by concentrated ammonia. The eluent was used for FASS-CE-UV analysis after NH₃ evaporation. The factors affecting the preconcentration of both Se(IV) and Se(VI) by SPE and FASS were studied and the optimal CE separation conditions for Se(IV) and Se(VI) were obtained. Under the optimal conditions, the LODs of 57 ng L⁻¹ (Se(IV)) and 71 ng L⁻¹ (Se(VI)) were obtained, respectively. The developed method was validated by the analysis of a certified reference material of GBW(E)080395 environmental water and the determined value was in a good agreement with the certified value. It was also successfully applied to the speciation analysis of inorganic selenium in environmental water samples, including Yangtze River water, spring water, and tap water. PMID:22996935

  18. A simulation-based approach for designing effective field-sampling programs to evaluate contamination risk of groundwater supplies

    USGS Publications Warehouse

    Nordqvist, R.; Voss, C.I.

    1996-01-01

    An approach to model discrimination and network design for evaluation of groundwater contamination risk is proposed and demonstrated by application to a site in a glaciofluvial aquifer in Sweden. The approach consists of first hypothesizing alternative conceptual models of hydrogeology at the site on the basis of both quantitative data and qualitative information. The conceptual models are then expressed as two-dimensional numerical models of groundwater flow and solute transport, and model attributes controlling risk to the water supply are determined by simulation. Model predictions of response to a specific field test are made with each model that affects risk. Regions for effective measurement networks are then identified. Effective networks are those that capture sufficient information to determine which of the hypothesized models best describes the system with a minimum of measurement points. For the example site in Sweden, the network is designed such that important system parameters may be accurately estimated at the same time as model discrimination is carried out. The site in Vansbro, Sweden, consists of a water-supply well in an esker separated (by 300m) from a wood preservation and treatment area on the esker flank by only a narrow inlet of a bordering stream. Application of the above-described risk analysis shows that, of all the hydrologic controls and parameters in the groundwater system, the only factor that controls the potential migration of wood-treatment contaminants to the well is whether the inlet's bed is pervious, creating a hydraulic barrier to lateral contaminant transport. Furthermore, the analysis localizes an area near the end of the inlet wherein the most effective measurements of drawdown would be made to discriminate between a permeable and impermeable bed. The location of this optimal area is not obvious prior to application of the above methodology.

  19. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    SciTech Connect

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-04-15

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomen–pelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  20. Application of portable gas chromatography-photo ionization detector combined with headspace sampling for field analysis of benzene, toluene, ethylbenzene, and xylene in soils.

    PubMed

    Zhou, You-Ya; Yu, Ji-Fang; Yan, Zeng-Guang; Zhang, Chao-Yan; Xie, Ya-Bo; Ma, Li-Qiang; Gu, Qing-Bao; Li, Fa-Sheng

    2013-04-01

    A method based on headspace (HS) sampling coupling with portable gas chromatography (GC) with photo ionization detector (PID) was developed for rapid determination of benzene, toluene, ethylbenzene, and xylenes (BTEX) in soils. Optimal conditions for HS gas sampling procedure were determined, and the influence of soil organic matter on the recovery of BTEX from soil was investigated using five representative Chinese soils. The results showed that the HS-portable-GC-PID method could be effectively operated at ambient temperature, and the addition of 15 ml of saturated NaCl solution in a 40-ml sampling vial and 60 s of shaking time for sample solution were optimum for the HS gas sampling procedure. The recoveries of each BTEX in soils ranged from 87.2 to 105.1 %, with relative standard deviations varying from 5.3 to 7.8 %. Good linearity was obtained for all BTEX compounds, and the detection limits were in the 0.1 to 0.8 μg kg(-1) range. Soil organic matter was identified as one of the principal elements that affect the HS gas sampling of BTEX in soils. The HS-portable-GC-PID method was successfully applied for field determination of benzene and toluene in soils of a former chemical plant in Jilin City, northeast China. Considering its satisfactory repeatability and reproducibility and particular suitability to be operated in ambient environment, HS sampling coupling with portable GC-PID is, therefore, recommended to be a suitable screening tool for rapid on-site determination of BTEX in soils.

  1. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    PubMed Central

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-01-01

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomen–pelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  2. Determination of polyphenols in Mentha longifolia and M. piperita field-grown and in vitro plant samples using UPLC-TQ-MS.

    PubMed

    Krzyzanowska, Justyna; Janda, Bogdan; Pecio, Lukasz; Stochmal, Anna; Oleszek, Wieslaw; Czubacka, Anna; Przybys, Marcin; Doroszewska, Teresa

    2011-01-01

    Nine polyphenols in the aerial parts of Mentha longifolia have been separated by chromatographic techniques. Their structures have been confirmed by HPLC/electrospray ionization-MS/MS. The compounds identified included rosmarinic acid, salvianolic acid L, dedihydro-salvianolic acid, luteolin-glucuronide, luteolin-diglucuronide, luteolin-glucopyranosyl-rhamnopyranoside, and eriodictyol-glucopyranosyl-rhamnopyranoside. The extracts of M. longifolia and M. piperita field plants, in vitro plants, callus tissues, and cell suspension cultures were profiled, and their polyphenol composition was compared in different tissues and quantified using ultra-performance column liquid chromatography (UPLC)/triple-quadrupole-MS in the selected-ion recording detection mode. Determination of desired compounds was based on calibration curves obtained for standards, which were previously isolated from M. longifolia aerial parts. The UPLC profiles revealed considerable differences in the synthesis of secondary metabolites among samples coming from field plants, in vitro plants, callus tissues, and cell suspension cultures. Plant tissues coming from field cultivation (for both M. piperita and M. longifolia) contained several phenolic compounds (flavonoids and phenolic acids), whereas plants from in vitro conditions, callus tissues, and suspension cultures contained only a few of them. Rosmarinic acid dominated in all of these samples. These results show that under in vitro conditions, the metabolism of phenolics undergoes a fundamental change.

  3. A convenient and sensitive method for haloacetic acid analysis in tap water by on-line field-amplified sample-stacking CE-ESI-MS.

    PubMed

    Hung, Sih-Hua; Her, Guor-Rong

    2013-11-01

    In this study, we propose a simple strategy based on flow injection and field-amplified sample-stacking CE-ESI-MS/MS to analyze haloacetic acids (HAAs) in tap water. Tap water was passed through a desalination cartridge before field-amplified sample-stacking CE-ESI-MS/MS analysis to reduce sample salinity. With this treatment, the signals of the HAAs increased 300- to 1400-fold. The LODs for tap water analysis were in the range of 10 to 100 ng/L, except for the LOD of monochloroacetic acid (1 μg/L in selected-ion monitoring mode detection). The proposed method is fast, convenient, and sensitive enough to perform on-line analysis of five HAAs in the tap water of Taipei City. Four HAAs, including trichloroacetic acid, dichloroacetic acid, dibromoacetic acid, and monobromoacetic acid, were detected at concentrations of approximately 1.74, 1.15, 0.16, and 0.15 ppb, respectively.

  4. Giving Students Control over Their Learning; from Self-guided Museum Visits and Field Trips to Using Scanning Technology to Link Content to Earth Samples

    NASA Astrophysics Data System (ADS)

    Kirkby, K. C.; Phipps, M.

    2011-12-01

    While it may seem counterintuitive, sometimes stepping back is one of the more effective pedagogical approaches instructors can make. On museum visits, an instructor's presence fundamentally alters students' experiences and can curtail student learning by limiting questions or discouraging students from exploring their own interests. Students often rely on the instructor and become passive observers, rather than engaged learners. As an alternative to instructor-led visits, self-guided student explorations of museum exhibits proved to be both popular and pedagogically effective. On pre-instruction and post-instruction surveys, these ungraded, self-guided explorations match or exceed the efficacy of traditional graded lab instruction and completely eclipse gains normally achieved by traditional lecture instruction. In addition, these explorations achieve the remarkable goal of integrating undergraduate earth science instruction into students' social lives. Based on the success of the self-guided museum explorations, this fall saw the debut of an attempt to expand this concept to field experiences. A self-guided student field exploration of Saint Anthony Falls focuses on the intersections of geological processes with human history. Students explore the waterfalls' evolution, its early interpretation by 18th and 19th century Dakota and Euro-America societies, and its subsequent social and economic impacts on Upper Midwest societies. Self-guided explorations allow students to explore field settings on their own or with friends and family in a more relaxed manner. At the same time, these explorations give students control over, and responsibility for, their own learning - a powerful pedagogical approach. Student control over their learning is also the goal of an initiative to use scanning technologies, such as linear bar codes, 2D barcodes and radio-frequency identification (RFID), to revolutionize sample identification and study. Scanning technology allows students to

  5. Membrane supported liquid-liquid-liquid microextraction combined with field-amplified sample injection CE-UV for high-sensitivity analysis of six cardiovascular drugs in human urine sample.

    PubMed

    Zhou, Xiaoqing; He, Man; Chen, Beibei; Yang, Qing; Hu, Bin

    2016-05-01

    An effective dual preconcentration method involving off-line membrane supported liquid-liquid-liquid microextraction (MS-LLLME) and on-line field-amplified sample injection (FASI) was proposed for the extraction of six cardiovascular drugs, including mexiletine, xylocaine, propafenone, propranolol, metoprolol, and carvedilol from aqueous solution prior to CE-UV. In MS-LLLME, the analytes were extracted from 9 mL sample solution into toluene, and then back extracted into a drop of acceptor phase of 10 μL 20 mmol/L acetic acid. After that, the acceptor phase was directly introduced into CE for FASI without any modification. In FASI process, water plug was hydro