Science.gov

Sample records for acuros xb axb

  1. From AAA to Acuros XB-clinical implications of selecting either Acuros XB dose-to-water or dose-to-medium.

    PubMed

    Zifodya, Jackson M; Challens, Cameron H C; Hsieh, Wen-Long

    2016-06-01

    When implementing Acuros XB (AXB) as a substitute for anisotropic analytic algorithm (AAA) in the Eclipse Treatment Planning System, one is faced with a dilemma of reporting either dose to medium, AXB-Dm or dose to water, AXB-Dw. To assist with decision making on selecting either AXB-Dm or AXB-Dw for dose reporting, a retrospective study of treated patients for head & neck (H&N), prostate, breast and lung is presented. Ten patients, previously treated using AAA plans, were selected for each site and re-planned with AXB-Dm and AXB-Dw. Re-planning was done with fixed monitor units (MU) as well as non-fixed MUs. Dose volume histograms (DVH) of targets and organs at risk (OAR), were analyzed in conjunction with ICRU-83 recommended dose reporting metrics. Additionally, comparisons of plan homogeneity indices (HI) and MUs were done to further highlight the differences between the algorithms. Results showed that, on average AAA overestimated dose to the target volume and OARs by less than 2.0 %. Comparisons between AXB-Dw and AXB-Dm, for all sites, also showed overall dose differences to be small (<1.5 %). However, in non-water biological media, dose differences between AXB-Dw and AXB-Dm, as large as 4.6 % were observed. AXB-Dw also tended to have unexpectedly high 3D maximum dose values (>135 % of prescription dose) for target volumes with high density materials. Homogeneity indices showed that AAA planning and optimization templates would need to be adjusted only for the H&N and Lung sites. MU comparison showed insignificant differences between AXB-Dw relative to AAA and between AXB-Dw relative to AXB-Dm. However AXB-Dm MUs relative to AAA, showed an average difference of about 1.3 % signifying an underdosage by AAA. In conclusion, when dose is reported as AXB-Dw, the effect that high density structures in the PTV has on the dose distribution should be carefully considered. As the results show overall small dose differences between the algorithms, when

  2. From AAA to Acuros XB-clinical implications of selecting either Acuros XB dose-to-water or dose-to-medium.

    PubMed

    Zifodya, Jackson M; Challens, Cameron H C; Hsieh, Wen-Long

    2016-06-01

    When implementing Acuros XB (AXB) as a substitute for anisotropic analytic algorithm (AAA) in the Eclipse Treatment Planning System, one is faced with a dilemma of reporting either dose to medium, AXB-Dm or dose to water, AXB-Dw. To assist with decision making on selecting either AXB-Dm or AXB-Dw for dose reporting, a retrospective study of treated patients for head & neck (H&N), prostate, breast and lung is presented. Ten patients, previously treated using AAA plans, were selected for each site and re-planned with AXB-Dm and AXB-Dw. Re-planning was done with fixed monitor units (MU) as well as non-fixed MUs. Dose volume histograms (DVH) of targets and organs at risk (OAR), were analyzed in conjunction with ICRU-83 recommended dose reporting metrics. Additionally, comparisons of plan homogeneity indices (HI) and MUs were done to further highlight the differences between the algorithms. Results showed that, on average AAA overestimated dose to the target volume and OARs by less than 2.0 %. Comparisons between AXB-Dw and AXB-Dm, for all sites, also showed overall dose differences to be small (<1.5 %). However, in non-water biological media, dose differences between AXB-Dw and AXB-Dm, as large as 4.6 % were observed. AXB-Dw also tended to have unexpectedly high 3D maximum dose values (>135 % of prescription dose) for target volumes with high density materials. Homogeneity indices showed that AAA planning and optimization templates would need to be adjusted only for the H&N and Lung sites. MU comparison showed insignificant differences between AXB-Dw relative to AAA and between AXB-Dw relative to AXB-Dm. However AXB-Dm MUs relative to AAA, showed an average difference of about 1.3 % signifying an underdosage by AAA. In conclusion, when dose is reported as AXB-Dw, the effect that high density structures in the PTV has on the dose distribution should be carefully considered. As the results show overall small dose differences between the algorithms, when

  3. Dosimetric impact of Acuros XB deterministic radiation transport algorithm for heterogeneous dose calculation in lung cancer

    SciTech Connect

    Han Tao; Followill, David; Repchak, Roman; Molineu, Andrea; Howell, Rebecca; Salehpour, Mohammad; Mikell, Justin; Mourtada, Firas

    2013-05-15

    Purpose: The novel deterministic radiation transport algorithm, Acuros XB (AXB), has shown great potential for accurate heterogeneous dose calculation. However, the clinical impact between AXB and other currently used algorithms still needs to be elucidated for translation between these algorithms. The purpose of this study was to investigate the impact of AXB for heterogeneous dose calculation in lung cancer for intensity-modulated radiation therapy (IMRT) and volumetric-modulated arc therapy (VMAT). Methods: The thorax phantom from the Radiological Physics Center (RPC) was used for this study. IMRT and VMAT plans were created for the phantom in the Eclipse 11.0 treatment planning system. Each plan was delivered to the phantom three times using a Varian Clinac iX linear accelerator to ensure reproducibility. Thermoluminescent dosimeters (TLDs) and Gafchromic EBT2 film were placed inside the phantom to measure delivered doses. The measurements were compared with dose calculations from AXB 11.0.21 and the anisotropic analytical algorithm (AAA) 11.0.21. Two dose reporting modes of AXB, dose-to-medium in medium (D{sub m,m}) and dose-to-water in medium (D{sub w,m}), were studied. Point doses, dose profiles, and gamma analysis were used to quantify the agreement between measurements and calculations from both AXB and AAA. The computation times for AAA and AXB were also evaluated. Results: For the RPC lung phantom, AAA and AXB dose predictions were found in good agreement to TLD and film measurements for both IMRT and VMAT plans. TLD dose predictions were within 0.4%-4.4% to AXB doses (both D{sub m,m} and D{sub w,m}); and within 2.5%-6.4% to AAA doses, respectively. For the film comparisons, the gamma indexes ({+-}3%/3 mm criteria) were 94%, 97%, and 98% for AAA, AXB{sub Dm,m}, and AXB{sub Dw,m}, respectively. The differences between AXB and AAA in dose-volume histogram mean doses were within 2% in the planning target volume, lung, heart, and within 5% in the spinal cord

  4. Dosimetric impact of Acuros XB deterministic radiation transport algorithm for heterogeneous dose calculation in lung cancer

    PubMed Central

    Han, Tao; Followill, David; Mikell, Justin; Repchak, Roman; Molineu, Andrea; Howell, Rebecca; Salehpour, Mohammad; Mourtada, Firas

    2013-01-01

    Purpose: The novel deterministic radiation transport algorithm, Acuros XB (AXB), has shown great potential for accurate heterogeneous dose calculation. However, the clinical impact between AXB and other currently used algorithms still needs to be elucidated for translation between these algorithms. The purpose of this study was to investigate the impact of AXB for heterogeneous dose calculation in lung cancer for intensity-modulated radiation therapy (IMRT) and volumetric-modulated arc therapy (VMAT). Methods: The thorax phantom from the Radiological Physics Center (RPC) was used for this study. IMRT and VMAT plans were created for the phantom in the Eclipse 11.0 treatment planning system. Each plan was delivered to the phantom three times using a Varian Clinac iX linear accelerator to ensure reproducibility. Thermoluminescent dosimeters (TLDs) and Gafchromic EBT2 film were placed inside the phantom to measure delivered doses. The measurements were compared with dose calculations from AXB 11.0.21 and the anisotropic analytical algorithm (AAA) 11.0.21. Two dose reporting modes of AXB, dose-to-medium in medium (Dm,m) and dose-to-water in medium (Dw,m), were studied. Point doses, dose profiles, and gamma analysis were used to quantify the agreement between measurements and calculations from both AXB and AAA. The computation times for AAA and AXB were also evaluated. Results: For the RPC lung phantom, AAA and AXB dose predictions were found in good agreement to TLD and film measurements for both IMRT and VMAT plans. TLD dose predictions were within 0.4%–4.4% to AXB doses (both Dm,m and Dw,m); and within 2.5%–6.4% to AAA doses, respectively. For the film comparisons, the gamma indexes (±3%/3 mm criteria) were 94%, 97%, and 98% for AAA, AXB_Dm,m, and AXB_Dw,m, respectively. The differences between AXB and AAA in dose–volume histogram mean doses were within 2% in the planning target volume, lung, heart, and within 5% in the spinal cord. However, differences up to 8

  5. SU-E-T-313: The Accuracy of the Acuros XB Advanced Dose Calculation Algorithm for IMRT Dose Distributions in Head and Neck

    SciTech Connect

    Araki, F; Onizuka, R; Ohno, T; Tomiyama, Y; Hioki, K

    2014-06-01

    Purpose: To investigate the accuracy of the Acuros XB version 11 (AXB11) advanced dose calculation algorithm by comparing with Monte Caro (MC) calculations. The comparisons were performed with dose distributions for a virtual inhomogeneity phantom and intensity-modulated radiotherapy (IMRT) in head and neck. Methods: Recently, AXB based on Linear Boltzmann Transport Equation has been installed in the Eclipse treatment planning system (Varian Medical Oncology System, USA). The dose calculation accuracy of AXB11 was tested by the EGSnrc-MC calculations. In additions, AXB version 10 (AXB10) and Analytical Anisotropic Algorithm (AAA) were also used. First the accuracy of an inhomogeneity correction for AXB and AAA algorithms was evaluated by comparing with MC-calculated dose distributions for a virtual inhomogeneity phantom that includes water, bone, air, adipose, muscle, and aluminum. Next the IMRT dose distributions for head and neck were compared with the AXB and AAA algorithms and MC by means of dose volume histograms and three dimensional gamma analysis for each structure (CTV, OAR, etc.). Results: For dose distributions with the virtual inhomogeneity phantom, AXB was in good agreement with those of MC, except the dose in air region. The dose in air region decreased in order of MC<AXB11<AXB10. This may be caused by the difference of the electron cut-off energy for algorithms, ie: 0.700 MeV for MC, 0.711 MeV for AXB11, and 1.011 MeV for AXB 10. Since the AAA algorithm is based on the dose kernel of water, the doses in regions for air, bone, and aluminum considerably became higher than those of AXB and MC. The pass rates of the gamma analysis for IMRT dose distributions in head and neck were similar to those of MC in order of AXB11<AXB10AXB11 was almost equivalent to the MC dose calculation.

  6. Dosimetric comparison of Acuros XB, AAA, and XVMC in stereotactic body radiotherapy for lung cancer

    SciTech Connect

    Tsuruta, Yusuke; Nakata, Manabu; Higashimura, Kyoji; Nakamura, Mitsuhiro Matsuo, Yukinori; Monzen, Hajime; Mizowaki, Takashi; Hiraoka, Masahiro

    2014-08-15

    Purpose: To compare the dosimetric performance of Acuros XB (AXB), anisotropic analytical algorithm (AAA), and x-ray voxel Monte Carlo (XVMC) in heterogeneous phantoms and lung stereotactic body radiotherapy (SBRT) plans. Methods: Water- and lung-equivalent phantoms were combined to evaluate the percentage depth dose and dose profile. The radiation treatment machine Novalis (BrainLab AG, Feldkirchen, Germany) with an x-ray beam energy of 6 MV was used to calculate the doses in the composite phantom at a source-to-surface distance of 100 cm with a gantry angle of 0°. Subsequently, the clinical lung SBRT plans for the 26 consecutive patients were transferred from the iPlan (ver. 4.1; BrainLab AG) to the Eclipse treatment planning systems (ver. 11.0.3; Varian Medical Systems, Palo Alto, CA). The doses were then recalculated with AXB and AAA while maintaining the XVMC-calculated monitor units and beam arrangement. Then the dose-volumetric data obtained using the three different radiation dose calculation algorithms were compared. Results: The results from AXB and XVMC agreed with measurements within ±3.0% for the lung-equivalent phantom with a 6 × 6 cm{sup 2} field size, whereas AAA values were higher than measurements in the heterogeneous zone and near the boundary, with the greatest difference being 4.1%. AXB and XVMC agreed well with measurements in terms of the profile shape at the boundary of the heterogeneous zone. For the lung SBRT plans, AXB yielded lower values than XVMC in terms of the maximum doses of ITV and PTV; however, the differences were within ±3.0%. In addition to the dose-volumetric data, the dose distribution analysis showed that AXB yielded dose distribution calculations that were closer to those with XVMC than did AAA. Means ± standard deviation of the computation time was 221.6 ± 53.1 s (range, 124–358 s), 66.1 ± 16.0 s (range, 42–94 s), and 6.7 ± 1.1 s (range, 5–9 s) for XVMC, AXB, and AAA, respectively. Conclusions: In the

  7. Effect of Acuros XB algorithm on monitor units for stereotactic body radiotherapy planning of lung cancer

    SciTech Connect

    Khan, Rao F. Villarreal-Barajas, Eduardo; Lau, Harold; Liu, Hong-Wei

    2014-04-01

    Stereotactic body radiotherapy (SBRT) is a curative regimen that uses hypofractionated radiation-absorbed dose to achieve a high degree of local control in early stage non–small cell lung cancer (NSCLC). In the presence of heterogeneities, the dose calculation for the lungs becomes challenging. We have evaluated the dosimetric effect of the recently introduced advanced dose-calculation algorithm, Acuros XB (AXB), for SBRT of NSCLC. A total of 97 patients with early-stage lung cancer who underwent SBRT at our cancer center during last 4 years were included. Initial clinical plans were created in Aria Eclipse version 8.9 or prior, using 6 to 10 fields with 6-MV beams, and dose was calculated using the anisotropic analytic algorithm (AAA) as implemented in Eclipse treatment planning system. The clinical plans were recalculated in Aria Eclipse 11.0.21 using both AAA and AXB algorithms. Both sets of plans were normalized to the same prescription point at the center of mass of the target. A secondary monitor unit (MU) calculation was performed using commercial program RadCalc for all of the fields. For the planning target volumes ranging from 19 to 375 cm{sup 3}, a comparison of MUs was performed for both set of algorithms on field and plan basis. In total, variation of MUs for 677 treatment fields was investigated in terms of equivalent depth and the equivalent square of the field. Overall, MUs required by AXB to deliver the prescribed dose are on an average 2% higher than AAA. Using a 2-tailed paired t-test, the MUs from the 2 algorithms were found to be significantly different (p < 0.001). The secondary independent MU calculator RadCalc underestimates the required MUs (on an average by 4% to 5%) in the lung relative to either of the 2 dose algorithms.

  8. Experimental validation of deterministic Acuros XB algorithm for IMRT and VMAT dose calculations with the Radiological Physics Center's head and neck phantom

    SciTech Connect

    Han Tao; Mourtada, Firas; Kisling, Kelly; Mikell, Justin; Followill, David; Howell, Rebecca

    2012-04-15

    Purpose: The purpose of this study was to verify the dosimetric performance of Acuros XB (AXB), a grid-based Boltzmann solver, in intensity-modulated radiation therapy (IMRT) and volumetric-modulated arc therapy (VMAT). Methods: The Radiological Physics Center (RPC) head and neck (H and N) phantom was used for all calculations and measurements in this study. Clinically equivalent IMRT and VMAT plans were created on the RPC H and N phantom in the Eclipse treatment planning system (version 10.0) by using RPC dose prescription specifications. The dose distributions were calculated with two different algorithms, AXB 11.0.03 and anisotropic analytical algorithm (AAA) 10.0.24. Two dose report modes of AXB were recorded: dose-to-medium in medium (D{sub m,m}) and dose-to-water in medium (D{sub w,m}). Each treatment plan was delivered to the RPC phantom three times for reproducibility by using a Varian Clinac iX linear accelerator. Absolute point dose and planar dose were measured with thermoluminescent dosimeters (TLDs) and GafChromic registered EBT2 film, respectively. Profile comparison and 2D gamma analysis were used to quantify the agreement between the film measurements and the calculated dose distributions from both AXB and AAA. The computation times for AAA and AXB were also evaluated. Results: Good agreement was observed between measured doses and those calculated with AAA or AXB. Both AAA and AXB calculated doses within 5% of TLD measurements in both the IMRT and VMAT plans. Results of AXB{sub Dm,m} (0.1% to 3.6%) were slightly better than AAA (0.2% to 4.6%) or AXB{sub Dw,m} (0.3% to 5.1%). The gamma analysis for both AAA and AXB met the RPC 7%/4 mm criteria (over 90% passed), whereas AXB{sub Dm,m} met 5%/3 mm criteria in most cases. AAA was 2 to 3 times faster than AXB for IMRT, whereas AXB was 4-6 times faster than AAA for VMAT. Conclusions: AXB was found to be satisfactorily accurate when compared to measurements in the RPC H and N phantom. Compared with AAA

  9. Experimental validation of deterministic Acuros XB algorithm for IMRT and VMAT dose calculations with the Radiological Physics Center’s head and neck phantom

    PubMed Central

    Han, Tao; Mourtada, Firas; Kisling, Kelly; Mikell, Justin; Followill, David; Howell, Rebecca

    2012-01-01

    Purpose: The purpose of this study was to verify the dosimetric performance of Acuros XB (AXB), a grid-based Boltzmann solver, in intensity-modulated radiation therapy (IMRT) and volumetric-modulated arc therapy (VMAT). Methods: The Radiological Physics Center (RPC) head and neck (H&N) phantom was used for all calculations and measurements in this study. Clinically equivalent IMRT and VMAT plans were created on the RPC H&N phantom in the Eclipse treatment planning system (version 10.0) by using RPC dose prescription specifications. The dose distributions were calculated with two different algorithms, AXB 11.0.03 and anisotropic analytical algorithm (AAA) 10.0.24. Two dose report modes of AXB were recorded: dose-to-medium in medium (Dm,m) and dose-to-water in medium (Dw,m). Each treatment plan was delivered to the RPC phantom three times for reproducibility by using a Varian Clinac iX linear accelerator. Absolute point dose and planar dose were measured with thermoluminescent dosimeters (TLDs) and GafChromic® EBT2 film, respectively. Profile comparison and 2D gamma analysis were used to quantify the agreement between the film measurements and the calculated dose distributions from both AXB and AAA. The computation times for AAA and AXB were also evaluated. Results: Good agreement was observed between measured doses and those calculated with AAA or AXB. Both AAA and AXB calculated doses within 5% of TLD measurements in both the IMRT and VMAT plans. Results of AXB_Dm,m (0.1% to 3.6%) were slightly better than AAA (0.2% to 4.6%) or AXB_Dw,m (0.3% to 5.1%). The gamma analysis for both AAA and AXB met the RPC 7%/4 mm criteria (over 90% passed), whereas AXB_Dm,m met 5%/3 mm criteria in most cases. AAA was 2 to 3 times faster than AXB for IMRT, whereas AXB was 4–6 times faster than AAA for VMAT. Conclusions: AXB was found to be satisfactorily accurate when compared to measurements in the RPC H&N phantom. Compared with AAA, AXB results were equal to or better than those

  10. The accuracy of Acuros XB algorithm for radiation beams traversing a metallic hip implant - comparison with measurements and Monte Carlo calculations.

    PubMed

    Ojala, Jarkko; Kapanen, Mika; Sipilä, Petri; Hyödynmaa, Simo; Pitkänen, Maunu

    2014-01-01

    In this study, the clinical benefit of the improved accuracy of the Acuros XB (AXB) algorithm, implemented in a commercial radiotherapy treatment planning system (TPS), Varian Eclipse, was demonstrated with beams traversing a high-Z material. This is also the first study assessing the accuracy of the AXB algorithm applying volumetric modulated arc therapy (VMAT) technique compared to full Monte Carlo (MC) simulations. In the first phase the AXB algorithm was benchmarked against point dosimetry, film dosimetry, and full MC calculation in a water-filled anthropometric phantom with a unilateral hip implant. Also the validity of the full MC calculation used as reference method was demonstrated. The dose calculations were performed both in original computed tomography (CT) dataset, which included artifacts, and in corrected CT dataset, where constant Hounsfield unit (HU) value assignment for all the materials was made. In the second phase, a clinical treatment plan was prepared for a prostate cancer patient with a unilateral hip implant. The plan applied a hybrid VMAT technique that included partial arcs that avoided passing through the implant and static beams traversing the implant. Ultimately, the AXB-calculated dose distribution was compared to the recalculation by the full MC simulation to assess the accuracy of the AXB algorithm in clinical setting. A recalculation with the anisotropic analytical algorithm (AAA) was also performed to quantify the benefit of the improved dose calculation accuracy of type 'c' algorithm (AXB) over type 'b' algorithm (AAA). The agreement between the AXB algorithm and the full MC model was very good inside and in the vicinity of the implant and elsewhere, which verifies the accuracy of the AXB algorithm for patient plans with beams traversing through high-Z material, whereas the AAA produced larger discrepancies. PMID:25207577

  11. Difference in dose-volumetric data between the analytical anisotropic algorithm, the dose-to-medium, and the dose-to-water reporting modes of the Acuros XB for lung stereotactic body radiation therapy.

    PubMed

    Mampuya, Wambaka A; Nakamura, Mitsuhiro; Hirose, Yoshinori; Kitsuda, Kenji; Ishigaki, Takashi; Mizowaki, Takashi; Hiraoka, Masahiro

    2016-01-01

    The purpose of this study was to evaluate the difference in dose-volumetric data between the analytical anisotropic algorithms (AAA) and the two dose reporting modes of the Acuros XB, namely, the dose to water (AXB_Dw) and dose to medium (AXB_Dm) in lung stereotactic body radiotherapy (SBRT). Thirty-eight plans were generated using the AXB_Dm in Eclipse Treatment Planning System (TPS) and then recalculated with the AXB_Dw and AAA, using identical beam setup. A dose of 50 Gy in 4 fractions was prescribed to the isocenter and the planning target volume (PTV) D95%. The isocenter was always inside the PTV. The following dose-volumetric parameters were evaluated; D2%, D50%, D95%, and D98% for the internal target volume (ITV) and the PTV. Two-tailed paired Student's t-tests determined the statistical significance. Although for most of the parameters evaluated, the mean differences observed between the AAA, AXB_Dm, and AXB_Dw were statistically significant (p < 0.05), absolute differences were rather small, in general less than 5% points. The maximum mean difference was observed in the ITV D50% between the AXB_Dm and the AAA and was 1.7% points under the isocenter prescription and 3.3% points under the D95 prescription. AXB_Dm produced higher values than AXB_Dw with differences ranging from 0.4 to 1.1% points under isocenter prescription and 0.0 to 0.7% points under the PTV D95% prescription. The differences observed under the PTV D95% prescription were larger compared to those observed for the isocenter prescription between AXB_Dm and AAA, AXB_Dm and AXB_Dw, and AXB_Dw and AAA. Although statistically significant, the mean differences between the three algorithms are within 3.3% points. PMID:27685138

  12. Difference in dose-volumetric data between the analytical anisotropic algorithm, the dose-to-medium, and the dose-to-water reporting modes of the Acuros XB for lung stereotactic body radiation therapy.

    PubMed

    Mampuya, Wambaka A; Nakamura, Mitsuhiro; Hirose, Yoshinori; Kitsuda, Kenji; Ishigaki, Takashi; Mizowaki, Takashi; Hiraoka, Masahiro

    2016-01-01

    The purpose of this study was to evaluate the difference in dose-volumetric data between the analytical anisotropic algorithms (AAA) and the two dose reporting modes of the Acuros XB, namely, the dose to water (AXB_Dw) and dose to medium (AXB_Dm) in lung stereotactic body radiotherapy (SBRT). Thirty-eight plans were generated using the AXB_Dm in Eclipse Treatment Planning System (TPS) and then recalculated with the AXB_Dw and AAA, using identical beam setup. A dose of 50 Gy in 4 fractions was prescribed to the isocenter and the planning target volume (PTV) D95%. The isocenter was always inside the PTV. The following dose-volumetric parameters were evaluated; D2%, D50%, D95%, and D98% for the internal target volume (ITV) and the PTV. Two-tailed paired Student's t-tests determined the statistical significance. Although for most of the parameters evaluated, the mean differences observed between the AAA, AXB_Dm, and AXB_Dw were statistically significant (p < 0.05), absolute differences were rather small, in general less than 5% points. The maximum mean difference was observed in the ITV D50% between the AXB_Dm and the AAA and was 1.7% points under the isocenter prescription and 3.3% points under the D95 prescription. AXB_Dm produced higher values than AXB_Dw with differences ranging from 0.4 to 1.1% points under isocenter prescription and 0.0 to 0.7% points under the PTV D95% prescription. The differences observed under the PTV D95% prescription were larger compared to those observed for the isocenter prescription between AXB_Dm and AAA, AXB_Dm and AXB_Dw, and AXB_Dw and AAA. Although statistically significant, the mean differences between the three algorithms are within 3.3% points.

  13. Experimental verification of the Acuros XB and AAA dose calculation adjacent to heterogeneous media for IMRT and RapidArc of nasopharygeal carcinoma

    SciTech Connect

    Kan, Monica W. K.; Leung, Lucullus H. T.; So, Ronald W. K.; Yu, Peter K. N.

    2013-03-15

    Purpose: To compare the doses calculated by the Acuros XB (AXB) algorithm and analytical anisotropic algorithm (AAA) with experimentally measured data adjacent to and within heterogeneous medium using intensity modulated radiation therapy (IMRT) and RapidArc{sup Registered-Sign} (RA) volumetric arc therapy plans for nasopharygeal carcinoma (NPC). Methods: Two-dimensional dose distribution immediately adjacent to both air and bone inserts of a rectangular tissue equivalent phantom irradiated using IMRT and RA plans for NPC cases were measured with GafChromic{sup Registered-Sign} EBT3 films. Doses near and within the nasopharygeal (NP) region of an anthropomorphic phantom containing heterogeneous medium were also measured with thermoluminescent dosimeters (TLD) and EBT3 films. The measured data were then compared with the data calculated by AAA and AXB. For AXB, dose calculations were performed using both dose-to-medium (AXB{sub Dm}) and dose-to-water (AXB{sub Dw}) options. Furthermore, target dose differences between AAA and AXB were analyzed for the corresponding real patients. The comparison of real patient plans was performed by stratifying the targets into components of different densities, including tissue, bone, and air. Results: For the verification of planar dose distribution adjacent to air and bone using the rectangular phantom, the percentages of pixels that passed the gamma analysis with the {+-} 3%/3mm criteria were 98.7%, 99.5%, and 97.7% on the axial plane for AAA, AXB{sub Dm}, and AXB{sub Dw}, respectively, averaged over all IMRT and RA plans, while they were 97.6%, 98.2%, and 97.7%, respectively, on the coronal plane. For the verification of planar dose distribution within the NP region of the anthropomorphic phantom, the percentages of pixels that passed the gamma analysis with the {+-} 3%/3mm criteria were 95.1%, 91.3%, and 99.0% for AAA, AXB{sub Dm}, and AXB{sub Dw}, respectively, averaged over all IMRT and RA plans. Within the NP region where

  14. SU-E-T-101: Determination and Comparison of Correction Factors Obtained for TLDs in Small Field Lung Heterogenous Phantom Using Acuros XB and EGSnrc

    SciTech Connect

    Soh, R; Lee, J; Harianto, F

    2014-06-01

    Purpose: To determine and compare the correction factors obtained for TLDs in 2 × 2cm{sup 2} small field in lung heterogenous phantom using Acuros XB (AXB) and EGSnrc. Methods: This study will simulate the correction factors due to the perturbation of TLD-100 chips (Harshaw/Thermoscientific, 3 × 3 × 0.9mm{sup 3}, 2.64g/cm{sup 3}) in small field lung medium for Stereotactic Body Radiation Therapy (SBRT). A physical lung phantom was simulated by a 14cm thick composite cork phantom (0.27g/cm{sup 3}, HU:-743 ± 11) sandwiched between 4cm thick Plastic Water (CIRS,Norfolk). Composite cork has been shown to be a good lung substitute material for dosimetric studies. 6MV photon beam from Varian Clinac iX (Varian Medical Systems, Palo Alto, CA) with field size 2 × 2cm{sup 2} was simulated. Depth dose profiles were obtained from the Eclipse treatment planning system Acuros XB (AXB) and independently from DOSxyznrc, EGSnrc. Correction factors was calculated by the ratio of unperturbed to perturbed dose. Since AXB has limitations in simulating actual material compositions, EGSnrc will also simulate the AXB-based material composition for comparison to the actual lung phantom. Results: TLD-100, with its finite size and relatively high density, causes significant perturbation in 2 × 2cm{sup 2} small field in a low lung density phantom. Correction factors calculated by both EGSnrc and AXB was found to be as low as 0.9. It is expected that the correction factor obtained by EGSnrc wlll be more accurate as it is able to simulate the actual phantom material compositions. AXB have a limited material library, therefore it only approximates the composition of TLD, Composite cork and Plastic water, contributing to uncertainties in TLD correction factors. Conclusion: It is expected that the correction factors obtained by EGSnrc will be more accurate. Studies will be done to investigate the correction factors for higher energies where perturbation may be more pronounced.

  15. Dosimetric Impact of Using the Acuros XB Algorithm for Intensity Modulated Radiation Therapy and RapidArc Planning in Nasopharyngeal Carcinomas

    SciTech Connect

    Kan, Monica W.K.; Leung, Lucullus H.T.; Yu, Peter K.N.

    2013-01-01

    Purpose: To assess the dosimetric implications for the intensity modulated radiation therapy (IMRT) and volumetric modulated arc therapy with RapidArc (RA) of nasopharyngeal carcinomas (NPC) due to the use of the Acuros XB (AXB) algorithm versus the anisotropic analytical algorithm (AAA). Methods and Materials: Nine-field sliding window IMRT and triple-arc RA plans produced for 12 patients with NPC using AAA were recalculated using AXB. The dose distributions to multiple planning target volumes (PTVs) with different prescribed doses and critical organs were compared. The PTVs were separated into components in bone, air, and tissue. The change of doses by AXB due to air and bone, and the variation of the amount of dose changes with number of fields was also studied using simple geometric phantoms. Results: Using AXB instead of AAA, the averaged mean dose to PTV{sub 70} (70 Gy was prescribed to PTV{sub 70}) was found to be 0.9% and 1.2% lower for IMRT and RA, respectively. It was approximately 1% lower in tissue, 2% lower in bone, and 1% higher in air. The averaged minimum dose to PTV{sub 70} in bone was approximately 4% lower for both IMRT and RA, whereas it was approximately 1.5% lower for PTV{sub 70} in tissue. The decrease in target doses estimated by AXB was mostly contributed from the presence of bone, less from tissue, and none from air. A similar trend was observed for PTV{sub 60} (60 Gy was prescribed to PTV{sub 60}). The doses to most serial organs were found to be 1% to 3% lower and to other organs 4% to 10% lower for both techniques. Conclusions: The use of the AXB algorithm is highly recommended for IMRT and RapidArc planning for NPC cases.

  16. Dosimetric comparison of Acuros XB deterministic radiation transport method with Monte Carlo and model-based convolution methods in heterogeneous media

    PubMed Central

    Han, Tao; Mikell, Justin K.; Salehpour, Mohammad; Mourtada, Firas

    2011-01-01

    Purpose: The deterministic Acuros XB (AXB) algorithm was recently implemented in the Eclipse treatment planning system. The goal of this study was to compare AXB performance to Monte Carlo (MC) and two standard clinical convolution methods: the anisotropic analytical algorithm (AAA) and the collapsed-cone convolution (CCC) method. Methods: Homogeneous water and multilayer slab virtual phantoms were used for this study. The multilayer slab phantom had three different materials, representing soft tissue, bone, and lung. Depth dose and lateral dose profiles from AXB v10 in Eclipse were compared to AAA v10 in Eclipse, CCC in Pinnacle3, and EGSnrc MC simulations for 6 and 18 MV photon beams with open fields for both phantoms. In order to further reveal the dosimetric differences between AXB and AAA or CCC, three-dimensional (3D) gamma index analyses were conducted in slab regions and subregions defined by AAPM Task Group 53. Results: The AXB calculations were found to be closer to MC than both AAA and CCC for all the investigated plans, especially in bone and lung regions. The average differences of depth dose profiles between MC and AXB, AAA, or CCC was within 1.1, 4.4, and 2.2%, respectively, for all fields and energies. More specifically, those differences in bone region were up to 1.1, 6.4, and 1.6%; in lung region were up to 0.9, 11.6, and 4.5% for AXB, AAA, and CCC, respectively. AXB was also found to have better dose predictions than AAA and CCC at the tissue interfaces where backscatter occurs. 3D gamma index analyses (percent of dose voxels passing a 2%∕2 mm criterion) showed that the dose differences between AAA and AXB are significant (under 60% passed) in the bone region for all field sizes of 6 MV and in the lung region for most of field sizes of both energies. The difference between AXB and CCC was generally small (over 90% passed) except in the lung region for 18 MV 10 × 10 cm2 fields (over 26% passed) and in the bone region for 5 × 5 and 10

  17. Dosimetric accuracy and clinical quality of Acuros XB and AAA dose calculation algorithm for stereotactic and conventional lung volumetric modulated arc therapy plans

    PubMed Central

    2013-01-01

    Introduction The main aim of the current study was to assess the dosimetric accuracy and clinical quality of volumetric modulated arc therapy (VMAT) plans for stereotactic (stage I) and conventional (stage III) lung cancer treatments planned with Eclipse version 10.0 Anisotropic Analytical Algorithm (AAA) and Acuros XB (AXB) algorithm. Methods The dosimetric impact of using AAA instead of AXB, and grid size 2.5 mm instead of 1.0 mm for VMAT treatment plans was evaluated. The clinical plan quality of AXB VMAT was assessed using 45 stage I and 73 stage III patients, and was compared with published results, planned with VMAT and hybrid-VMAT techniques. Results The dosimetric impact on near-minimum PTV dose (D98%) using AAA instead of AXB was large (underdose up to 12.3%) for stage I and very small (underdose up to 0.8%) for stage III lung treatments. There were no significant differences for dose volume histogram (DVH) values between grid sizes. The calculation time was significantly higher for AXB grid size 1.0 than 2.5 mm (p < 0.01). The clinical quality of the VMAT plans was at least comparable with clinical qualities given in literature of lung treatment plans with VMAT and hybrid-VMAT techniques. The average mean lung dose (MLD), lung V20Gy and V5Gy in this study were respectively 3.6 Gy, 4.1% and 15.7% for 45 stage I patients and 12.4 Gy, 19.3% and 46.6% for 73 stage III lung patients. The average contra-lateral lung dose V5Gy-cont was 35.6% for stage III patients. Conclusions For stereotactic and conventional lung treatments, VMAT calculated with AXB grid size 2.5 mm resulted in accurate dose calculations. No hybrid technique was needed to obtain the dose constraints. AXB is recommended instead of AAA for avoiding serious overestimation of the minimum target doses compared to the actual delivered dose. PMID:23800024

  18. Dosimetric validation of the Acuros XB Advanced Dose Calculation algorithm: fundamental characterization in water

    NASA Astrophysics Data System (ADS)

    Fogliata, Antonella; Nicolini, Giorgia; Clivio, Alessandro; Vanetti, Eugenio; Mancosu, Pietro; Cozzi, Luca

    2011-05-01

    This corrigendum intends to clarify some important points that were not clearly or properly addressed in the original paper, and for which the authors apologize. The original description of the first Acuros algorithm is from the developers, published in Physics in Medicine and Biology by Vassiliev et al (2010) in the paper entitled 'Validation of a new grid-based Boltzmann equation solver for dose calculation in radiotherapy with photon beams'. The main equations describing the algorithm reported in our paper, implemented as the 'Acuros XB Advanced Dose Calculation Algorithm' in the Varian Eclipse treatment planning system, were originally described (for the original Acuros algorithm) in the above mentioned paper by Vassiliev et al. The intention of our description in our paper was to give readers an overview of the algorithm, not pretending to have authorship of the algorithm itself (used as implemented in the planning system). Unfortunately our paper was not clear, particularly in not allocating full credit to the work published by Vassiliev et al on the original Acuros algorithm. Moreover, it is important to clarify that we have not adapted any existing algorithm, but have used the Acuros XB implementation in the Eclipse planning system from Varian. In particular, the original text of our paper should have been as follows: On page 1880 the sentence 'A prototype LBTE solver, called Attila (Wareing et al 2001), was also applied to external photon beam dose calculations (Gifford et al 2006, Vassiliev et al 2008, 2010). Acuros XB builds upon many of the methods in Attila, but represents a ground-up rewrite of the solver where the methods were adapted especially for external photon beam dose calculations' should be corrected to 'A prototype LBTE solver, called Attila (Wareing et al 2001), was also applied to external photon beam dose calculations (Gifford et al 2006, Vassiliev et al 2008). A new algorithm called Acuros, developed by the Transpire Inc. group, was

  19. SU-E-T-481: Dosimetric Comparison of Acuros XB and Anisotropic Analytic Algorithm with Commercial Monte Carlo Based Dose Calculation Algorithm for Stereotactic Body Radiation Therapy of Lung Cancer

    SciTech Connect

    Cao, M; Tenn, S; Lee, C; Yang, Y; Lamb, J; Agazaryan, N; Lee, P; Low, D

    2014-06-01

    Purpose: To evaluate performance of three commercially available treatment planning systems for stereotactic body radiation therapy (SBRT) of lung cancer using the following algorithms: Boltzmann transport equation based algorithm (AcurosXB AXB), convolution based algorithm Anisotropic Analytic Algorithm (AAA); and Monte Carlo based algorithm (XVMC). Methods: A total of 10 patients with early stage non-small cell peripheral lung cancer were included. The initial clinical plans were generated using the XVMC based treatment planning system with a prescription of 54Gy in 3 fractions following RTOG0613 protocol. The plans were recalculated with the same beam parameters and monitor units using AAA and AXB algorithms. A calculation grid size of 2mm was used for all algorithms. The dose distribution, conformity, and dosimetric parameters for the targets and organs at risk (OAR) are compared between the algorithms. Results: The average PTV volume was 19.6mL (range 4.2–47.2mL). The volume of PTV covered by the prescribed dose (PTV-V100) were 93.97±2.00%, 95.07±2.07% and 95.10±2.97% for XVMC, AXB and AAA algorithms, respectively. There was no significant difference in high dose conformity index; however, XVMC predicted slightly higher values (p=0.04) for the ratio of 50% prescription isodose volume to PTV (R50%). The percentage volume of total lungs receiving dose >20Gy (LungV20Gy) were 4.03±2.26%, 3.86±2.22% and 3.85±2.21% for XVMC, AXB and AAA algorithms. Examination of dose volume histograms (DVH) revealed small differences in targets and OARs for most patients. However, the AAA algorithm was found to predict considerable higher PTV coverage compared with AXB and XVMC algorithms in two cases. The dose difference was found to be primarily located at the periphery region of the target. Conclusion: For clinical SBRT lung treatment planning, the dosimetric differences between three commercially available algorithms are generally small except at target periphery. XVMC

  20. SU-E-T-67: Clinical Implementation and Evaluation of the Acuros Dose Calculation Algorithm

    SciTech Connect

    Yan, C; Combine, T; Dickens, K; Wynn, R; Pavord, D; Huq, M

    2014-06-01

    Purpose: The main aim of the current study is to present a detailed description of the implementation of the Acuros XB Dose Calculation Algorithm, and subsequently evaluate its clinical impacts by comparing it with AAA algorithm. Methods: The source models for both Acuros XB and AAA were configured by importing the same measured beam data into Eclipse treatment planning system. Both algorithms were evaluated by comparing calculated dose with measured dose on a homogeneous water phantom for field sizes ranging from 6cm × 6cm to 40cm × 40cm. Central axis and off-axis points with different depths were chosen for the comparison. Similarly, wedge fields with wedge angles from 15 to 60 degree were used. In addition, variable field sizes for a heterogeneous phantom were used to evaluate the Acuros algorithm. Finally, both Acuros and AAA were tested on VMAT patient plans for various sites. Does distributions and calculation time were compared. Results: On average, computation time is reduced by at least 50% by Acuros XB compared with AAA on single fields and VMAT plans. When used for open 6MV photon beams on homogeneous water phantom, both Acuros XB and AAA calculated doses were within 1% of measurement. For 23 MV photon beams, the calculated doses were within 1.5% of measured doses for Acuros XB and 2% for AAA. When heterogeneous phantom was used, Acuros XB also improved on accuracy. Conclusion: Compared with AAA, Acuros XB can improve accuracy while significantly reduce computation time for VMAT plans.

  1. XB-70A_flight

    NASA Video Gallery

    During the 1960s, XB-70 was the world's largest experimental aircraft. Capable of flight at speeds of three times the speed of sound (2,000 miles per hour) at altitudes of 70,000 feet, the XB-70 wa...

  2. XB-70A_takeoff

    NASA Video Gallery

    During the 1960s, XB-70 was the world's largest experimental aircraft. Capable of flight at speeds of three times the speed of sound (2,000 miles per hour) at altitudes of 70,000 feet, the XB-70 wa...

  3. SU-E-T-137: Dosimetric Validation for Pinnacle, Acuros, AAA, and Brainlab Algorithms with Induced Inhomogenieties

    SciTech Connect

    Lopez, P; Tambasco, M; LaFontaine, R; Burns, L

    2014-06-01

    Purpose: To compare the dosimetric accuracy of the Eclipse 11.0 Acuros XB and Anisotropic Analytical Algorithm (AAA), Pinnacle-3 9.2 Collapsed Cone Convolution, and the iPlan 4.1 Monte Carlo (MC) and Pencil Beam (PB) algorithms using measurement as the gold standard. Methods: Ion chamber and diode measurements were taken for 6, 10, and 18 MV beams in a phantom made up of slab densities corresponding to solid water, lung, and bone. The phantom was setup at source-to-surface distance of 100 cm, and the field sizes were 3.0 × 3.0, 5.0 × 5.0, and 10.0 × 10.0 cm2. Data from the planning systems were computed along the central axis of the beam. The measurements were taken using a pinpoint chamber and edge diode for interface regions. Results: The best agreement between data from the algorithms and our measurements occurs away from the slab interfaces. For the 6 MV beam, iPlan 4.1 MC software performs the best with 1.7% absolute average percent difference from measurement. For the 10 MV beam, iPlan 4.1 PB performs the best with 2.7% absolute average percent difference from measurement. For the 18 MV beam, Acuros performs the best with 2.0% absolute average percent difference from measurement. It is interesting to note that the steepest drop in dose occurred the at lung heterogeneity-solid water interface of the18 MV, 3.0 × 3.0 cm2 field size setup. In this situation, Acuros and AAA performed best with an average percent difference within −1.1% of measurement, followed by iPlan 4.1 MC, which was within 4.9%. Conclusion: This study shows that all of the algorithms perform reasonably well in computing dose in a heterogeneous slab phantom. Moreover, Acuros and AAA perform particularly well at the lung-solid water interfaces for higher energy beams and small field sizes.

  4. XB-70A #1 cockpit

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Photo of the XB-70 #1 cockpit, which shows the complexity of this mid-1960s research aircraft. On the left and right sides of the picture are the pilot's and co-pilot's control yokes. Forward of these, on the cockpit floor, are the rudder pedals with the NAA (North American Aviation) trademark. Between them is the center console. Visible are the six throttles for the XB-70's jet engines. Above this is the center instrument panel. The bottom panel has the wing tip fold, landing gear, and flap controls, as well as the hydraulic pressure gages. In the center are three rows of engine gages. The top row are tachometers, the second are exhaust temperature gages, and the bottom row are exhaust nozzle position indicators. Above these are the engine fire and engine brake switches. The instrument panels for the pilot (left) and co-pilot (right) differ somewhat. Both crewmen have an airspeed/Mach indicator, and altitude/vertical velocity indicator, an artificial horizon, and a heading indicator/compass directly in front of them. The pilot's flight instruments, from top to bottom, are total heat gage and crew warning lights; stand-by flight instruments (side-slip, artificial horizon, and altitude); the engine vibration indicators; cabin altitude, ammonia, and water quantity gages, the electronic compartment air temperature gage, and the liquid oxygen quantity gage. At the bottom are the switches for the flight displays and environmental controls. On the co-pilot's panel, the top three rows are for the engine inlet controls. Below this is the fuel tank sequence indicator, which shows the amount of fuel in each tank. The bottom row consists of the fuel pump switches, which were used to shift fuel to maintain the proper center of gravity. Just to the right are the indicators for the total fuel (top) and the individual tanks (bottom). Visible on the right edge of the photo are the refueling valves, while above these are switches for the flight data recording instruments. The XB-70

  5. An edited linkage map for the AXB and BXA recombinant inbred mouse strains.

    PubMed

    Sampson, S B; Higgins, D C; Elliot, R W; Taylor, B A; Lueders, K K; Koza, R A; Paigen, B

    1998-09-01

    We have updated the history of the AXB and BXA recombinant inbred (RI) strains, typed additional loci, and edited the AXB, BXA RI database. Thirteen of the original 51 AXB and BXA RI strains are either extinct or genetically contaminated, leaving 33 living strains available from The Jackson Laboratory. However, we found a high degree of similarity among three sets of strains, indicating that these strains are not independent, which leaves 27 independent RI strains in the set. Accordingly, we modified the database by combining the AXB and BXA RI sets and eliminating strains that were genetically contaminated or extinct with no available DNA. We added 92 newly typed loci, retyped some questionable genotypings, and removed loci with excessive double crossovers or an insufficient number of typed strains. The edited strain distribution pattern (SDP) is available on the World Wide Web (WWW) (http://www. informatics.jax.org/riset.html) and now includes over 700 loci. Each locus is linked to adjacent loci with a LOD score of at least 3.0 with a few described exceptions. We also carried out a second editing designed for the analysis of quantitative trait loci by deleting extinct strains and loci with identical SDPs; this edited database is also available on the WWW.

  6. XB130: A novel adaptor protein in cancer signal transduction

    PubMed Central

    ZHANG, RUIYAO; ZHANG, JINGYAO; WU, QIFEI; MENG, FANDI; LIU, CHANG

    2016-01-01

    Adaptor proteins are functional proteins that contain two or more protein-binding modules to link signaling proteins together, which affect cell growth and shape and have no enzymatic activity. The actin filament-associated protein (AFAP) family is an important member of the adaptor proteins, including AFAP1, AFAP1L1 and AFAP1L2/XB130. AFAP1 and AFAP1L1 share certain common characteristics and function as an actin-binding protein and a cSrc-activating protein. XB130 exhibits certain unique features in structure and function. The mRNA of XB130 is expressed in human spleen, thyroid, kidney, brain, lung, pancreas, liver, colon and stomach, and the most prominent disease associated with XB130 is cancer. XB130 has a controversial effect on cancer. Studies have shown that XB130 can promote cancer progression and downregulation of XB130-reduced growth of tumors derived from certain cell lines. A higher mRNA level of XB130 was shown to be associated with a better survival in non-small cell lung cancer. Previous studies have shown that XB130 can regulate cell growth, migration and invasion and possibly has the effect through the cAMP-cSrc-phosphoinositide 3-kinase/Akt pathway. Except for cancer, XB130 is also associated with other pathological or physiological procedures, such as airway repair and regeneration. PMID:26998266

  7. Iterative methods for solving Ax=b, GMRES/FOM versus QMR/BiCG

    SciTech Connect

    Cullum, J.

    1996-12-31

    We study the convergence of GMRES/FOM and QMR/BiCG methods for solving nonsymmetric Ax=b. We prove that given the results of a BiCG computation on Ax=b, we can obtain a matrix B with the same eigenvalues as A and a vector c such that the residual norms generated by a FOM computation on Bx=c are identical to those generated by the BiCG computations. Using a unitary equivalence for each of these methods, we obtain test problems where we can easily vary certain spectral properties of the matrices. We use these test problems to study the effects of nonnormality on the convergence of GMRES and QMR, to study the effects of eigenvalue outliers on the convergence of QMR, and to compare the convergence of restarted GMRES, QMR, and BiCGSTAB across a family of normal and nonnormal problems. Our GMRES tests on nonnormal test matrices indicate that nonnormality can have unexpected effects upon the residual norm convergence, giving misleading indications of superior convergence over QMR when the error norms for GMRES are not significantly different from those for QMR. Our QMR tests indicate that the convergence of the QMR residual and error norms is influenced predominantly by small and large eigenvalue outliers and by the character, real, complex, or nearly real, of the outliers and the other eigenvalues. In our comparison tests QMR outperformed GMRES(10) and GMRES(20) on both the normal and nonnormal test matrices.

  8. XB-70A landing with drag chutes deployed

    NASA Technical Reports Server (NTRS)

    1960-01-01

    This photo shows the XB-70A #1 rolling out after landing, employing drag chutes to slow down. In the photo, the outer wing panels are slightly raised. When the XB-70 was flying at high speed, the panels were lowered to improve stability. The XB-70 was the world's largest experimental aircraft. It was capable of flight at speeds of three times the speed of sound (roughly 2,000 miles per hour) at altitudes of 70,000 feet. It was used to collect in-flight information for use in the design of future supersonic aircraft, military and civilian. The major objectives of the XB-70 flight research program were to study the airplane's stability and handling characteristics, to evaluate its response to atmospheric turbulence, and to determine the aerodynamic and propulsion performance. In addition there were secondary objectives to measure the noise and friction associated with airflow over the airplane and to determine the levels and extent of the engine noise during takeoff, landing, and ground operations. The XB-70 was about 186 feet long, 33 feet high, with a wingspan of 105 feet. Originally conceived as an advanced bomber for the United States Air Force, the XB-70 was limited to production of two aircraft when it was decided to limit the aircraft's mission to flight research. The first flight of the XB-70 was made on Sept. 21, 1964. The number two XB-70 was destroyed in a mid-air collision on June 8, 1966. Program management of the NASA-USAF research effort was assigned to NASA in March 1967. The final flight was flown on Feb. 4, 1969. Designed by North American Aviation (later North American Rockwell and still later, a division of Boeing) the XB-70 had a long fuselage with a canard or horizontal stabilizer mounted just behind the crew compartment. It had a sharply swept 65.6-percent delta wing. The outer portion of the wing could be folded down in flight to provide greater lateral-directional stability. The airplane had two windshields. A moveable outer windshield was

  9. Going the distance: validation of Acuros and AAA at an extended SSD of 400 cm.

    PubMed

    Lamichhane, Narottam; Patel, Vivek N; Studenski, Matthew T

    2016-01-01

    Accurate dose calculation and treatment delivery is essential for total body irradiation (TBI). In an effort to verify the accuracy of TBI dose calculation at our institution, we evaluated both the Varian Eclipse AAA and Acuros algorithms to predict dose distributions at an extended source-to-surface distance (SSD) of 400 cm. Measurements were compared to calculated values for a 6 MV beam in physical and virtual phantoms at 400 cm SSD using open beams for both 5 × 5 and 40 × 40cm2 field sizes. Inline and crossline profiles were acquired at equivalent depths of 5 cm, 10 cm, and 20 cm. Depth-dose curves were acquired using EBT2 film and an ion chamber for both field sizes. Finally, a RANDO phantom was used to simulate an actual TBI treatment. At this extended SSD, care must be taken using the planning system as there is good relative agreement between measured and calculated profiles for both algorithms, but there are deviations in terms of the absolute dose. Acuros has better agreement than AAA in the penumbra region. PMID:27074473

  10. XB130 expression in human osteosarcoma: a clinical and experimental study.

    PubMed

    Wang, Xiaohui; Wang, Ruiguo; Liu, Zhaolong; Hao, Fengyun; Huang, Hai; Guo, Wenchen

    2015-01-01

    Identifying prognostic factors for osteosarcoma (OS) aids in the selection of patients who require more aggressive management. XB130 is a newly characterized adaptor protein that was reported to be a prognostic factor of certain tumor types. However, the association between XB130 expression and the prognosis of OS remains unknown. In the present study, we investigated the association between XB130 expression and clinicopathologic features and prognosis in patients suffering OS, and further investigated its potential role on OS cells in vitro and vivo. A retrospective immunohistochemical study of XB130 was performed on archival formalin-fixed paraffin-embedded specimens from 60 pairs of osteosarcoma and noncancerous bone tissues, and compared the expression of XB130 with clinicopathological parameters. We then investigate the effect of XB130 sliencing on invasion in vitro and lung metastasis in vivo of the human OS cell line. Immunohistochemical assays revealed that XB130 expression in OS tissues was significantly higher than that in corresponding noncancerous bone tissues (P=0.001). In addition, high XB130 expression more frequently occurred in OS tissues with advanced clinical stage (P=0.002) and positive distant metastasis (P=0.001). Moreover, OS patients with high XB130 expression had significantly shorter overall survival and disease-free survival (both P<0.001) when compared with patients with the low expression of XB130. The univariate analysis and multivariate analysis shown that high XB130 expression and distant metastasis were the independent poor prognostic factor.We showed that XB130 depletion by RNA interference inhibited invasion of XB130-rich U2OS cells in vitro and lung metastasis in vivo. This is the first study to reveal that XB130 overexpression may be related to the prediction of metastasis potency and poor prognosis for OS patients, suggesting that XB130 may serve as a prognostic marker for the optimization of clinical treatments. Furthermore

  11. Dosimetric Verification around High-density Materials for External Beam Radiotherapy.

    PubMed

    Sasaki, Makoto; Nakata, Manabu; Nakamura, Mitsuhiro; Ishihara, Yoshitomo; Fujimoto, Takahiro; Tsuruta, Yusuke; Yano, Shinsuke; Higashimura, Kyouji

    2016-09-01

    It is generally known that the dose distribution around the high-density materials is not accurate with commercially available radiation treatment planning systems (RTPS). Recently, Acuros XB (AXB) has been clinically available for dose calculation algorithm. The AXB is based on the linear Boltzmann transport equation - the governing equation - that describes the distribution of radiation particles resulting from their interactions with matter. The purpose of this study was to evaluate the dose calculation accuracy around high-density materials for AXB under three X-rays energy on the basis of measured values with EBT3 and compare AXB with various dose calculation algorithms (AAA, XVMC) in RTPS and Monte Carlo. First, two different metals, including titanium and stainless steel, were inserted at the center of a water-equivalent phantom, and the depth dose was measured with EBT3. Next, after a phantom which reproduced the geometry of measurement was virtually created in RTPS, dose distributions were calculated with three commercially available algorithms (AXB, AAA, and XVMC) and MC. The calculated doses were then compared with the measured ones. As a result, compared to other algorithms, it was found that the dose calculation accuracy of AXB at the exit side of high-density materials was comparable to that of MC and measured value with EBT3. However, note that AXB underestimated the dose up to approximately 30% at the plane of incidence because it cannot exactly estimate the impact of the backscatter. PMID:27647596

  12. A summary of XB-70 sonic boom signature data

    NASA Technical Reports Server (NTRS)

    Maglieri, Domenic J.; Sothcott, Victor E.; Keefer, Thomas N., Jr.

    1992-01-01

    A compilation is provided of measured sonic boom signature data derived from 39 supersonic flights (43 passes) of the XB-70 airplane over the Mach number range of 1.11 to 2.92 and an altitude range of 30500 to 70300 ft. These tables represent a convenient hard copy version of available electronic files which include over 300 digitized sonic boom signatures with their corresponding spectra. Also included in the electronic files is information regarding ground track position, aircraft operating conditions, and surface and upper air weather observations for each of the 43 supersonic passes. In addition to the sonic boom signature data, a description is also provided of the XB-70 data base that was placed on electronic files along with a description of the method used to scan and digitize the analog/oscillograph sonic boom signature time histories. Such information is intended to enhance the value and utilization of the electronic files.

  13. Application of the QCD light cone sum rule to tetraquarks: The strong vertices XbXbρ and XcXcρ

    NASA Astrophysics Data System (ADS)

    Agaev, S. S.; Azizi, K.; Sundu, H.

    2016-06-01

    The full version of the QCD light-cone sum rule method is applied to tetraquarks containing a single heavy b or c quark. To this end, investigations of the strong vertices XbXbρ and XcXcρ are performed, where Xb=[s u ][b ¯ d ¯ ] and Xc=[s u ][c ¯d ¯] are the exotic states built of four quarks of different flavors. The strong coupling constants GXbXbρ and GXcXcρ corresponding to these vertices are found using the ρ -meson leading- and higher-twist distribution amplitudes. In the calculations, Xb and Xc are treated as scalar bound states of a diquark and antidiquark.

  14. XB130 expression in human osteosarcoma: a clinical and experimental study.

    PubMed

    Wang, Xiaohui; Wang, Ruiguo; Liu, Zhaolong; Hao, Fengyun; Huang, Hai; Guo, Wenchen

    2015-01-01

    Identifying prognostic factors for osteosarcoma (OS) aids in the selection of patients who require more aggressive management. XB130 is a newly characterized adaptor protein that was reported to be a prognostic factor of certain tumor types. However, the association between XB130 expression and the prognosis of OS remains unknown. In the present study, we investigated the association between XB130 expression and clinicopathologic features and prognosis in patients suffering OS, and further investigated its potential role on OS cells in vitro and vivo. A retrospective immunohistochemical study of XB130 was performed on archival formalin-fixed paraffin-embedded specimens from 60 pairs of osteosarcoma and noncancerous bone tissues, and compared the expression of XB130 with clinicopathological parameters. We then investigate the effect of XB130 sliencing on invasion in vitro and lung metastasis in vivo of the human OS cell line. Immunohistochemical assays revealed that XB130 expression in OS tissues was significantly higher than that in corresponding noncancerous bone tissues (P=0.001). In addition, high XB130 expression more frequently occurred in OS tissues with advanced clinical stage (P=0.002) and positive distant metastasis (P=0.001). Moreover, OS patients with high XB130 expression had significantly shorter overall survival and disease-free survival (both P<0.001) when compared with patients with the low expression of XB130. The univariate analysis and multivariate analysis shown that high XB130 expression and distant metastasis were the independent poor prognostic factor.We showed that XB130 depletion by RNA interference inhibited invasion of XB130-rich U2OS cells in vitro and lung metastasis in vivo. This is the first study to reveal that XB130 overexpression may be related to the prediction of metastasis potency and poor prognosis for OS patients, suggesting that XB130 may serve as a prognostic marker for the optimization of clinical treatments. Furthermore

  15. SU-E-T-131: Dosimetric Impact and Evaluation of Different Heterogenity Algorithm in Volumetric Modulated Arc Therapy Plan for Stereotactic Ablative Radiotherapy Lung Treatment with the Flattening Filter Free Beam

    SciTech Connect

    Chung, J; Kim, J; Lee, J; Kim, Y

    2014-06-01

    Purpose: The present study aimed to investigate the dosimetric impacts of the anisotropic analytic algorithm (AAA) and the Acuros XB (AXB) plan for lung stereotactic ablative radiation therapy using flattening filter-free (FFF) beam. We retrospectively analyzed 10 patients. Methods: We retrospectively analyzed 10 patients. The dosimetric parameters for the target and organs at risk (OARs) from the treatment plans calculated with these dose calculation algorithms were compared. The technical parameters, such as the computation times and the total monitor units (MUs), were also evaluated. Results: A comparison of DVHs from AXB and AAA showed that the AXB plan produced a high maximum PTV dose by average 4.40% with a statistical significance but slightly lower mean PTV dose by average 5.20% compared to the AAA plans. The maximum dose to the lung was slightly higher in the AXB compared to the AAA. For both algorithms, the values of V5, V10 and V20 for ipsilateral lung were higher in the AXB plan more than those of AAA. However, these parameters for contralateral lung were comparable. The differences of maximum dose for the spinal cord and heart were also small. The computation time of AXB was found fast with the relative difference of 13.7% than those of AAA. The average of monitor units (MUs) for all patients was higher in AXB plans than in the AAA plans. These results indicated that the difference between AXB and AAA are large in heterogeneous region with low density. Conclusion: The AXB provided the advantages such as the accuracy of calculations and the reduction of the computation time in lung stereotactic ablative radiotherapy (SABR) with using FFF beam, especially for VMAT planning. In dose calculation with the media of different density, therefore, the careful attention should be taken regarding the impacts of different heterogeneity correction algorithms. The authors report no conflicts of interest.

  16. [Comparison of dose calculation algorithms in stereotactic radiation therapy in lung].

    PubMed

    Tomiyama, Yuki; Araki, Fujio; Kanetake, Nagisa; Shimohigashi, Yoshinobu; Tominaga, Hirofumi; Sakata, Jyunichi; Oono, Takeshi; Kouno, Tomohiro; Hioki, Kazunari

    2013-06-01

    Dose calculation algorithms in radiation treatment planning systems (RTPSs) play a crucial role in stereotactic body radiation therapy (SBRT) in the lung with heterogeneous media. This study investigated the performance and accuracy of dose calculation for three algorithms: analytical anisotropic algorithm (AAA), pencil beam convolution (PBC) and Acuros XB (AXB) in Eclipse (Varian Medical Systems), by comparison against the Voxel Monte Carlo algorithm (VMC) in iPlan (BrainLab). The dose calculations were performed with clinical lung treatments under identical planning conditions, and the dose distributions and the dose volume histogram (DVH) were compared among algorithms. AAA underestimated the dose in the planning target volume (PTV) compared to VMC and AXB in most clinical plans. In contrast, PBC overestimated the PTV dose. AXB tended to slightly overestimate the PTV dose compared to VMC but the discrepancy was within 3%. The discrepancy in the PTV dose between VMC and AXB appears to be due to differences in physical material assignments, material voxelization methods, and an energy cut-off for electron interactions. The dose distributions in lung treatments varied significantly according to the calculation accuracy of the algorithms. VMC and AXB are better algorithms than AAA for SBRT. PMID:23782779

  17. Kinetic simulations of X-B and O-X-B mode conversion

    SciTech Connect

    Arefiev, A. V.; Du Toit, E. J.; Vann, R. G. L.; Köhn, A.; Holzhauer, E.; Shevchenko, V. F.

    2015-12-10

    We have performed fully-kinetic simulations of X-B and O-X-B mode conversion in one and two dimensional setups using the PIC code EPOCH. We have recovered the linear dispersion relation for electron Bernstein waves by employing relatively low amplitude incoming waves. The setups presented here can be used to study non-linear regimes of X-B and O-X-B mode conversion.

  18. XB130 deficiency enhances lipopolysaccharide-induced septic response and acute lung injury

    PubMed Central

    Toba, Hiroaki; Tomankova, Tereza; Wang, Yingchun; Bai, Xiaohui; Cho, Hae-Ra; Guan, Zhehong; Adeyi, Oyedele A.; Tian, Feng; Keshavjee, Shaf; Liu, Mingyao

    2016-01-01

    XB130 is a novel oncoprotein that promotes cancer cell survival, proliferation and migration. Its physiological function in vivo is largely unknown. The objective of this study was to determine the role of XB130 in lipopolysaccharide (LPS)-induced septic responses and acute lung injury. LPS was intraperitoneally administrated to Xb130 knockout (KO) and wild type (WT) mice. There was a significant weight loss in KO mice at Day 2 and significantly higher disease scores during the 7 days of observation. The levels of tumor necrosis factor-alpha, monocyte chemoattractant protein-1, interleukin-6 and interleukin-10 in the serum were significantly higher in KO mice at Day 2. In KO mice there were a significantly higher lung injury score, higher wet/dry lung weight ratio, more apoptotic cells and less proliferative cells in the lung. Macrophage infiltration was significantly elevated in the lung of KO mice. There was significantly increased number of p-GSK-3β positive cells in KO mice, which were mainly neutrophils and macrophages. XB130 is expressed in alveolar type I and type II cells in the lung. The expression in these cells was significantly reduced after LPS challenge. XB130 deficiency delayed the recovery from systemic septic responses, and the presence of XB130 in the alveolar epithelial cells may provide protective mechanisms by reducing cell death and promoting cell proliferation, and reducing pulmonary permeability. PMID:27029000

  19. X-15 and XB-70 parked on NASA ramp

    NASA Technical Reports Server (NTRS)

    1967-01-01

    The X-15A-2 with drop tanks and ablative coating is shown parked on the NASA ramp in front of the XB-70. These aircraft represent two different approaches to flight research. The X-15 was a research airplane in the purest sense, whereas the XB-70 was an experimental bomber intended for production but diverted to research when production was cancelled by changes in the Department of Defense's offensive doctrine. The X-15A-2 had been modified from its original configuration with a longer fuselage and drop tanks. To protect it against aerodynamic heating, researchers had coated it with an ablative coating covered by a layer of white paint. These changes allowed the X-15A-2 to reach a maximum speed of Mach 6.7, although it could be sustained for only a brief period. The XB-70, by contrast, was designed for prolonged high-altitude cruise flight at Mach 3. The aircraft's striking shape--with a long forward fuselage, canards, a large delta wing, twin fins, and a box-like engine bay--allowed it to ride its own Mach 3 shockwave, so to speak. A joint NASA-Air Force program used the aircraft to collect data in support of the U.S supersonic transport (SST) program, which never came to fruition because of environmental concerns. X-15: The X-15 was a rocket-powered aircraft. The original three aircraft were about 50 ft long with a wingspan of 22 ft. The modified #2 aircraft (X-15A-2 was longer.) They were a missile-shaped vehicles with unusual wedge-shaped vertical tails, thin stubby wings, and unique side fairings that extended along the side of the fuselage. The X-15 weighed about 14,000 lb empty and approximately 34,000 lb at launch. The XLR-99 rocket engine, manufactured by Thiokol Chemical Corp., was pilot controlled and was rated at 57,000 lb of thrust, although there are indications that it actually achieved up to 60,000 lb. North American Aviation built three X-15 aircraft for the program. The X-15 research aircraft was developed to provide in-flight information and data

  20. XB130 promotes bronchioalveolar stem cell and Club cell proliferation in airway epithelial repair and regeneration

    PubMed Central

    Toba, Hiroaki; Wang, Yingchun; Bai, Xiaohui; Zamel, Ricardo; Cho, Hae-Ra; Liu, Hongmei; Lira, Alonso; Keshavjee, Shaf; Liu, Mingyao

    2015-01-01

    Proliferation of bronchioalveolar stem cells (BASCs) is essential for epithelial repair. XB130 is a novel adaptor protein involved in the regulation of epithelial cell survival, proliferation and migration through the PI3K/Akt pathway. To determine the role of XB130 in airway epithelial injury repair and regeneration, a naphthalene-induced airway epithelial injury model was used with XB130 knockout (KO) mice and their wild type (WT) littermates. In XB130 KO mice, at days 7 and 14, small airway epithelium repair was significantly delayed with fewer number of Club cells (previously called Clara cells). CCSP (Club cell secreted protein) mRNA expression was also significantly lower in KO mice at day 7. At day 5, there were significantly fewer proliferative epithelial cells in the KO group, and the number of BASCs significantly increased in WT mice but not in KO mice. At day 7, phosphorylation of Akt, GSK-3β, and the p85α subunit of PI3K was observed in airway epithelial cells in WT mice, but to a much lesser extent in KO mice. Microarray data also suggest that PI3K/Akt-related signals were regulated differently in KO and WT mice. An inhibitory mechanism for cell proliferation and cell cycle progression was suggested in KO mice. XB130 is involved in bronchioalveolar stem cell and Club cell proliferation, likely through the PI3K/Akt/GSK-3β pathway. PMID:26360608

  1. X (3872 ) , Xb , and the χb 1(3 P ) state

    NASA Astrophysics Data System (ADS)

    Karliner, Marek; Rosner, Jonathan L.

    2015-01-01

    We discuss the possible production and discovery channels in e+e- and p p machines of the Xb, the bottomonium counterpart of X (3872 ) and the putative isoscalar analogue of the charged bottomoniumlike states Zb discovered by Belle. We suggest that the Xb may be close in mass to the bottomonium state χb 1(3 P ), mixing with it and sharing its decay channels, just as X (3872 ) is likely a mixture of a D ¯D* molecule and χc 1(2 P ) . Consequently, the experiments which reported observing χb 1(3 P ) might have actually discovered the Xb, or a mixture of the two states.

  2. XB-70A #1 liftoff with TB-58A chase aircraft

    NASA Technical Reports Server (NTRS)

    1960-01-01

    This photo shows XB-70A #1 taking off on a research flight, escorted by a TB-58 chase plane. The TB-58 (a prototype B-58 modified as a trainer) had a dash speed of Mach 2. This allowed it to stay close to the XB-70 as it conducted its research maneuvers. When the XB-70 was flying at or near Mach 3, the slower TB-58 could often keep up with it by flying lower and cutting inside the turns in the XB-70's flight path when these occurred. The XB-70 was the world's largest experimental aircraft. It was capable of flight at speeds of three times the speed of sound (roughly 2,000 miles per hour) at altitudes of 70,000 feet. It was used to collect in-flight information for use in the design of future supersonic aircraft, military and civilian. The major objectives of the XB-70 flight research program were to study the airplane's stability and handling characteristics, to evaluate its response to atmospheric turbulence, and to determine the aerodynamic and propulsion performance. In addition there were secondary objectives to measure the noise and friction associated with airflow over the airplane and to determine the levels and extent of the engine noise during takeoff, landing, and ground operations. The XB-70 was about 186 feet long, 33 feet high, with a wingspan of 105 feet. Originally conceived as an advanced bomber for the United States Air Force, the XB-70 was limited to production of two aircraft when it was decided to limit the aircraft's mission to flight research. The first flight of the XB-70 was made on Sept. 21, 1964. The number two XB-70 was destroyed in a mid-air collision on June 8, 1966. Program management of the NASA-USAF research effort was assigned to NASA in March 1967. The final flight was flown on Feb. 4, 1969. Designed by North American Aviation (later North American Rockwell and still later, a division of Boeing) the XB-70 had a long fuselage with a canard or horizontal stabilizer mounted just behind the crew compartment. It had a sharply swept 65

  3. SU-D-BRB-07: Lipiodol Impact On Dose Distribution in Liver SBRT After TACE

    SciTech Connect

    Kawahara, D; Ozawa, S; Hioki, K; Suzuki, T; Lin, Y; Okumura, T; Ochi, Y; Nakashima, T; Ohno, Y; Kimura, T; Murakami, Y; Nagata, Y

    2015-06-15

    Purpose: Stereotactic body radiotherapy (SBRT) combining transarterial chemoembolization (TACE) with Lipiodol is expected to improve local control. This study aims to evaluate the impact of Lipiodol on dose distribution by comparing the dosimetric performance of the Acuros XB (AXB) algorithm, anisotropic analytical algorithm (AAA), and Monte Carlo (MC) method using a virtual heterogeneous phantom and a treatment plan for liver SBRT after TACE. Methods: The dose distributions calculated using AAA and AXB algorithm, both in Eclipse (ver. 11; Varian Medical Systems, Palo Alto, CA), and EGSnrc-MC were compared. First, the inhomogeneity correction accuracy of the AXB algorithm and AAA was evaluated by comparing the percent depth dose (PDD) obtained from the algorithms with that from the MC calculations using a virtual inhomogeneity phantom, which included water and Lipiodol. Second, the dose distribution of a liver SBRT patient treatment plan was compared between the calculation algorithms. Results In the virtual phantom, compared with the MC calculations, AAA underestimated the doses just before and in the Lipiodol region by 5.1% and 9.5%, respectively, and overestimated the doses behind the region by 6.0%. Furthermore, compared with the MC calculations, the AXB algorithm underestimated the doses just before and in the Lipiodol region by 4.5% and 10.5%, respectively, and overestimated the doses behind the region by 4.2%. In the SBRT plan, the AAA and AXB algorithm underestimated the maximum doses in the Lipiodol region by 9.0% in comparison with the MC calculations. In clinical cases, the dose enhancement in the Lipiodol region can approximately 10% increases in tumor dose without increase of dose to normal tissue. Conclusion: The MC method demonstrated a larger increase in the dose in the Lipiodol region than the AAA and AXB algorithm. Notably, dose enhancement were observed in the tumor area; this may lead to a clinical benefit.

  4. Comparison of selected dose calculation algorithms in radiotherapy treatment planning for tissues with inhomogeneities

    NASA Astrophysics Data System (ADS)

    Woon, Y. L.; Heng, S. P.; Wong, J. H. D.; Ung, N. M.

    2016-03-01

    Inhomogeneity correction is recommended for accurate dose calculation in radiotherapy treatment planning since human body are highly inhomogeneous with the presence of bones and air cavities. However, each dose calculation algorithm has its own limitations. This study is to assess the accuracy of five algorithms that are currently implemented for treatment planning, including pencil beam convolution (PBC), superposition (SP), anisotropic analytical algorithm (AAA), Monte Carlo (MC) and Acuros XB (AXB). The calculated dose was compared with the measured dose using radiochromic film (Gafchromic EBT2) in inhomogeneous phantoms. In addition, the dosimetric impact of different algorithms on intensity modulated radiotherapy (IMRT) was studied for head and neck region. MC had the best agreement with the measured percentage depth dose (PDD) within the inhomogeneous region. This was followed by AXB, AAA, SP and PBC. For IMRT planning, MC algorithm is recommended for treatment planning in preference to PBC and SP. The MC and AXB algorithms were found to have better accuracy in terms of inhomogeneity correction and should be used for tumour volume within the proximity of inhomogeneous structures.

  5. The high coercivity mechanism for Nd 16Fe 77-xAl x>B 7 magnets

    NASA Astrophysics Data System (ADS)

    Hu, Jifan; Wang, Yizhong; Feng, Minying; Dai, Daoyang; Wang, Zhenxi; Cao, Yongjing

    1989-10-01

    Nd 16Fe 77- xAl xB 7 ( x = 0-7) sintered magnets with the maximum coercivity iHc = 20.5 kOe at x = 5 were obtained. The magnetic anisotropy fields of these magnets decrease with the addition of Al. The initial magnetizing field dependence of the coercivity for Nd 16Fe 77- xAl xB 7 sintered magnets in the thermally demagnetized state was determined. The result clearly indicates that the Nd 16Fe 77- xAl xB 7 sintered magnets are nucleation-hardened. The result of SEM shows that the grain boundary of the main phase in the Nd 16Fe 77B 7 magnet is clear, but not in the Nd 16Fe 77- xAl xB 7 ( x = 5) magnet with a high coercivity of 20.5 kOe. The results of SEM for Nd 16Fe 77- xAl xB 7 ( x = 5) magnet also show that there a new floss shaped phase is precipitated within the Nd-rich phase. With energy dispersive X-ray spectra, we determined the composition of this precipitation: Nd: Fe: Al = 76: 3.4: 20.6. The increase of coercivity iHc with Al can be attributed to better magnetic decoupling of the grains.

  6. Performance of dose calculation algorithms from three generations in lung SBRT: comparison with full Monte Carlo-based dose distributions.

    PubMed

    Ojala, Jarkko J; Kapanen, Mika K; Hyödynmaa, Simo J; Wigren, Tuija K; Pitkänen, Maunu A

    2014-01-01

    The accuracy of dose calculation is a key challenge in stereotactic body radiotherapy (SBRT) of the lung. We have benchmarked three photon beam dose calculation algorithms--pencil beam convolution (PBC), anisotropic analytical algorithm (AAA), and Acuros XB (AXB)--implemented in a commercial treatment planning system (TPS), Varian Eclipse. Dose distributions from full Monte Carlo (MC) simulations were regarded as a reference. In the first stage, for four patients with central lung tumors, treatment plans using 3D conformal radiotherapy (CRT) technique applying 6 MV photon beams were made using the AXB algorithm, with planning criteria according to the Nordic SBRT study group. The plans were recalculated (with same number of monitor units (MUs) and identical field settings) using BEAMnrc and DOSXYZnrc MC codes. The MC-calculated dose distributions were compared to corresponding AXB-calculated dose distributions to assess the accuracy of the AXB algorithm, to which then other TPS algorithms were compared. In the second stage, treatment plans were made for ten patients with 3D CRT technique using both the PBC algorithm and the AAA. The plans were recalculated (with same number of MUs and identical field settings) with the AXB algorithm, then compared to original plans. Throughout the study, the comparisons were made as a function of the size of the planning target volume (PTV), using various dose-volume histogram (DVH) and other parameters to quantitatively assess the plan quality. In the first stage also, 3D gamma analyses with threshold criteria 3%/3mm and 2%/2 mm were applied. The AXB-calculated dose distributions showed relatively high level of agreement in the light of 3D gamma analysis and DVH comparison against the full MC simulation, especially with large PTVs, but, with smaller PTVs, larger discrepancies were found. Gamma agreement index (GAI) values between 95.5% and 99.6% for all the plans with the threshold criteria 3%/3 mm were achieved, but 2%/2 mm

  7. Mediators-assisted reductive biotransformation of tetrabromobisphenol-A by Shewanella sp. XB.

    PubMed

    Wang, Jing; Fu, Zhenzhen; Liu, Guangfei; Guo, Ning; Lu, Hong; Zhan, Yaoyao

    2013-08-01

    The anaerobic biotransformation of tetrabromobisphenol A (TBBPA) was mainly observed in the consortia so far. The role of redox mediators in anaerobic TBBPA biotransformation by Shewanella sp. distributed widely in environments was investigated for the first time. The results showed the flavins secretion of Shewanella sp. XB was highly dependent on initial TBBPA concentration. The corresponding first-order rate constants (k) of TBBPA transformation decreased to 0.007 d(-1) when TBBPA concentration increased up to 80 mg/L. Moreover, the removal rate of TBBPA (80 mg/L) was significantly enhanced in treatments amended with cyanocobalamin, riboflavin, 2-hydroxy-1,4-naphthoquinone and Aldrich humic acid with k values of 0.42, 0.19, 0.16, and 0.07 d(-1), respectively. In addition, some redox proteins were secreted and played a role in flavins-mediated extracellular biotransformation of TBBPA by Shewanella sp. XB. These findings are beneficial to better understand TBBPA fate in natural environments and to develop efficient biotreatment strategies of TBBPA pollutions.

  8. Measured Sonic Boom Signatures Above and Below the XB-70 Airplane Flying at Mach 1.5 and 37,000 Feet

    NASA Technical Reports Server (NTRS)

    Maglieri, Domenic J.; Henderson, Herbert R.; Tinetti, Ana F.

    2011-01-01

    During the 1966-67 Edwards Air Force Base (EAFB) National Sonic Boom Evaluation Program, a series of in-flight flow-field measurements were made above and below the USAF XB-70 using an instrumented NASA F-104 aircraft with a specially designed nose probe. These were accomplished in the three XB-70 flights at about Mach 1.5 at about 37,000 ft. and gross weights of about 350,000 lbs. Six supersonic passes with the F-104 probe aircraft were made through the XB-70 shock flow-field; one above and five below the XB-70. Separation distances ranged from about 3000 ft. above and 7000 ft. to the side of the XB-70 and about 2000 ft. and 5000 ft. below the XB-70. Complex near-field "sawtooth-type" signatures were observed in all cases. At ground level, the XB-70 shock waves had not coalesced into the two-shock classical sonic boom N-wave signature, but contained three shocks. Included in this report is a description of the generating and probe airplanes, the in-flight and ground pressure measuring instrumentation, the flight test procedure and aircraft positioning, surface and upper air weather observations, and the six in-flight pressure signatures from the three flights.

  9. Valence fluctuations of europium in the boride Eu4Pd(29+x)B8.

    PubMed

    Gumeniuk, Roman; Schnelle, Walter; Ahmida, Mahmoud A; Abd-Elmeguid, Mohsen M; Kvashnina, Kristina O; Tsirlin, Alexander A; Leithe-Jasper, Andreas; Geibel, Christoph

    2016-03-23

    We synthesized a high-quality sample of the boride Eu4Pd(29+x)B8 (x  =  0.76) and studied its structural and physical properties. Its tetragonal structure was solved by direct methods and confirmed to belong to the Eu4Pd29B8 type. All studied physical properties indicate a valence fluctuating Eu state, with a valence decreasing continuously from about 2.9 at 5 K to 2.7 at 300 K. Maxima in the T dependence of the susceptibility and thermopower at around 135 K and 120 K, respectively, indicate a valence fluctuation energy scale on the order of 300 K. Analysis of the magnetic susceptibility evidences some inconsistencies when using the ionic interconfigurational fluctuation (ICF) model, thus suggesting a stronger relevance of hybridization between 4f and valence electrons compared to standard valence-fluctuating Eu systems.

  10. Vibration Survey of Blades in 19XB Axial-Flow Compressor. 2; Dynamic Investigation

    NASA Technical Reports Server (NTRS)

    Meyer, Andre J., Jr.; Calvert, Howard F.

    1947-01-01

    Strain-gage measurements were taken under operating conditions from blades of various stages of the 19XB axial-flow compressor in an effort to determine the reason for failures in the seventh and tenth stages. First bending-mode vibrations were detected in the first five stages of the compressor caused by each integral multiple of rotor speed from three through ten. Lead-wire failures in the last five stages resulted in incomplete data. The dynamic-vibration frequencies at various rotor speeds were compared with statically measured frequencies analytically corrected for the influence of centrifugal force. Large increases in vibration anilitude with increased pressure ratio were observed. During surging operation, blade vibrations were not present. The effects of pressure ratio and surge indicate the existence of aerodynamic excitation as the cause of the blade vibrations.

  11. Valence fluctuations of europium in the boride Eu4Pd(29+x)B8.

    PubMed

    Gumeniuk, Roman; Schnelle, Walter; Ahmida, Mahmoud A; Abd-Elmeguid, Mohsen M; Kvashnina, Kristina O; Tsirlin, Alexander A; Leithe-Jasper, Andreas; Geibel, Christoph

    2016-03-23

    We synthesized a high-quality sample of the boride Eu4Pd(29+x)B8 (x  =  0.76) and studied its structural and physical properties. Its tetragonal structure was solved by direct methods and confirmed to belong to the Eu4Pd29B8 type. All studied physical properties indicate a valence fluctuating Eu state, with a valence decreasing continuously from about 2.9 at 5 K to 2.7 at 300 K. Maxima in the T dependence of the susceptibility and thermopower at around 135 K and 120 K, respectively, indicate a valence fluctuation energy scale on the order of 300 K. Analysis of the magnetic susceptibility evidences some inconsistencies when using the ionic interconfigurational fluctuation (ICF) model, thus suggesting a stronger relevance of hybridization between 4f and valence electrons compared to standard valence-fluctuating Eu systems. PMID:26895077

  12. Delta-f particle-in-cell simulation of X-B mode conversion

    NASA Astrophysics Data System (ADS)

    Xiang, N.; Cary, J. R.; Barnes, D. C.; Carlsson, J.

    2006-04-01

    Low-noise, delta-f particle-in-cell algorithm has been implemented in VORPAL, a massive parallel, hybrid plasma modeling code (Chet Nieter and John. R. Cary, J. Comp. Physics 196, 448 (2004)). This computation method allows us to simulate the mode conversion between the extraordinary wave (X) and electron Bernstein wave (EBW) in both linear and nonlinear regimes. In the linear regime, it is found that a full X-B mode conversion can be obtained for optimized parameters as φ/φce<2 (φ is the driving frequency and φce is the electron cyclotron frequency). No 100% conversion is found for φ/φce moderately larger than 2. The simulation results agree with the predictions of Ram's theory (Ram & Schultz, Phys. Plasma 4084 (2000)). The agreement indicates that X-B mode conversion can be well described by the quadratic wave equation based on cold plasma approximation, and this is consistent with the phase-space picture of mode conversion. It is also shown that the conversion efficiency is significantly affected by the gradient of magnetic fields. When the amplitude of the incident X wave increases, it is shown that the nonlinear self-interaction of the electron converted EBW gives rise to the second harmonic generation at a pump power as low as three orders smaller than the electron thermal energy. If the fundamental EBW is sufficiently large, the non-propagating third and fourth harmonic modes are also generated. *The work was supported by DOE Contract No.DE-FG02-04ER54735.

  13. SU-E-T-351: Verification of Monitor Unit Calculation for Lung Stereotactic Body Radiation Therapy Using a Secondary Independent Planning System

    SciTech Connect

    Tsuruta, Y; Nakata, M; Higashimura, K; Nakamura, M; Miyabe, Y; Akimoto, M; Ono, T; Mukumoto, N; Ishihara, Y; Matsuo, Y; Mizowaki, T; Hiraoka, M

    2014-06-01

    Purpose: To compare isocenter (IC) dose between X-ray Voxel Monte Carlo (XVMC) and Acuros XB (AXB) as part of an independent verification of monitor unit (MU) calculation for lung stereotactic body radiation therapy (SBRT) using a secondary independent treatment planning system (TPS). Methods: Treatment plans of 110 lesions from 101 patients who underwent lung SBRT with Vero4DRT (Mitsubishi Heavy Industries, Ltd., Japan, and BrainLAB, Feldkirchen, Germany) were evaluated retrospectively. Dose distribution was calculated with X-ray Voxel Monte Carlo (XVMC) in iPlan 4.5.1 (BrainLAB, Feldkirchen, Germany) on averaged intensity projection images. A spatial resolution and mean variance were 2 mm and 2%, respectively. The clinical treatment plans were transferred from iPlan to Eclipse (Varian Medical Systems, Palo Alto, CA, USA), and doses were recalculated with well commissioned AXB ver. 11.0.31 while maintaining the XVMC-calculated MUs and beam arrangement. Dose calculations were made in the dose-to-medium dose reporting mode with the calculation grid size of 2.5 mm. The mean and standard deviation (SD) of the IC dose difference between XVMC and AXB were calculated. The tolerance level was defined as |mean|+2SD. Additionally, the relationship between IC dose difference and the size of planning target volume (PTV) or computed tomography (CT) value of internal target volume (ITV) was evaluated. Results: The mean±SD of the IC dose difference between XVMC and AXB was −0.32±0.73%. The tolerance level was 1.8%. Absolute IC dose differences exceeding the tolerance level were observed in 3 patients (2.8%). There were no strong correlations between IC dose difference and PTV size (R=−0.14) or CT value of ITV (R=−0.33). Conclusion: The present study suggested that independent verification of MU calculation for lung SBRT using a secondary TPS is useful.

  14. SU-E-J-58: Dosimetric Verification of Metal Artifact Effects: Comparison of Dose Distributions Affected by Patient Teeth and Implants

    SciTech Connect

    Lee, M; Kang, S; Lee, S; Suh, T; Lee, J; Park, J; Park, H; Lee, B

    2014-06-01

    Purpose: Implant-supported dentures seem particularly appropriate for the predicament of becoming edentulous and cancer patients are no exceptions. As the number of people having dental implants increased in different ages, critical dosimetric verification of metal artifact effects are required for the more accurate head and neck radiation therapy. The purpose of this study is to verify the theoretical analysis of the metal(streak and dark) artifact, and to evaluate dosimetric effect which cause by dental implants in CT images of patients with the patient teeth and implants inserted humanoid phantom. Methods: The phantom comprises cylinder which is shaped to simulate the anatomical structures of a human head and neck. Through applying various clinical cases, made phantom which is closely allied to human. Developed phantom can verify two classes: (i)closed mouth (ii)opened mouth. RapidArc plans of 4 cases were created in the Eclipse planning system. Total dose of 2000 cGy in 10 fractions is prescribed to the whole planning target volume (PTV) using 6MV photon beams. Acuros XB (AXB) advanced dose calculation algorithm, Analytical Anisotropic Algorithm (AAA) and progressive resolution optimizer were used in dose optimization and calculation. Results: In closed and opened mouth phantom, because dark artifacts formed extensively around the metal implants, dose variation was relatively higher than that of streak artifacts. As the PTV was delineated on the dark regions or large streak artifact regions, maximum 7.8% dose error and average 3.2% difference was observed. The averaged minimum dose to the PTV predicted by AAA was about 5.6% higher and OARs doses are also 5.2% higher compared to AXB. Conclusion: The results of this study showed that AXB dose calculation involving high-density materials is more accurate than AAA calculation, and AXB was superior to AAA in dose predictions beyond dark artifact/air cavity portion when compared against the measurements.

  15. 2,3,7,8-tetrachlorodibenzo-p-dioxin: examination of biochemical effects involved in the proliferation and differentiation of XB cells

    SciTech Connect

    Knutson, J.C.; Poland, A.

    1984-10-01

    XB, a cell line derived form a mouse teratoma, differentiates into stratified squamous epithelium when incubated with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). To examine the mediators of this response the effects produced by TCDD and those elicited by other compounds which stimulated epidermal proliferation and/or differentiation in mice were compared, XB/3T3 cultures keratinize when incubated with cholera toxin, epidermal growth factor (EGF), or TCDD , but not 12-0-tetradecanoylphorbol-13-acetate (TPA). Incubation of XB cells with TCDD for 48 hours produces an increase in thymidine incorporation, a response which is neither as large nor as rapid as that produced by cholera toxin, TPA, or EGF. Although both cholera toxin and TCDD stimulate differentiation and thymidine incorporation in XB/3T3 cultures, cholera toxin increases cAMP 30-fold in these cells, while TCDD does not affect cAMP accumulation. Inhibitors of arachidonic acid metabolism, which block epidermal proliferative responses to TPA in vivo, do not prevent the differentiation of XB cells in response to TCDD. In XB/3T3 cultures, TPA stimulates arachidonic acid release at all times tested (1,6, and 24 hours) and increases the incorporation of /sup 32/P/sub i/ into total phospholipids and phosphatidyl-choline after 3 hours. In contrast, D affects neither arachidonic acid release nor the turnover of phosphatidylinositol, or phosphatidylcholine at any of the times tested. Although biochemical effects which have been suggested as part of the mechanism of TCDD and produced by other epidermal proliferative compounds in XB cells were examined, no mediator of the TCDD-produced differentiation of XB/3T3 cultures was observed.

  16. The origin of the n-type behavior in rare earth borocarbide Y1-xB28.5C4.

    PubMed

    Mori, Takao; Nishimura, Toshiyuki; Schnelle, Walter; Burkhardt, Ulrich; Grin, Yuri

    2014-10-28

    Synthesis conditions, morphology, and thermoelectric properties of Y1-xB28.5C4 were investigated. Y1-xB28.5C4 is the compound with the lowest metal content in a series of homologous rare earth borocarbonitrides, which have been attracting interest as high temperature thermoelectric materials because they can embody the long-awaited counterpart to boron carbide, one of the few thermoelectric materials with a history of commercialization. It was revealed that the presence of boron carbide inclusions was the origin of the p-type behavior previously observed for Y1-xB28.5C4 in contrast to Y1-xB15.5CN and Y1-xB22C2N. In comparison with that of previous small flux-grown single crystals, a metal-poor composition of YB40C6 (Y0.71B28.5C4) in the synthesis successfully yielded sintered bulk Y1-xB28.5C4 samples apparently free of boron carbide inclusions. "Pure" Y1-xB28.5C4 was found to exhibit the same attractive n-type behavior as the other rare earth borocarbonitrides even though it is the most metal-poor compound among the series. Calculations of the electronic structure were carried out for Y1-xB28.5C4 as a representative of the series of homologous compounds and reveal a pseudo gap-like electronic density of states near the Fermi level mainly originating from the covalent borocarbonitride network.

  17. Induction of truncated form of tenascin-X (XB-S) through dissociation of HDAC1 from SP-1/HDAC1 complex in response to hypoxic conditions

    SciTech Connect

    Kato, Akari; Endo, Toshiya; Abiko, Shun; Ariga, Hiroyoshi; Matsumoto, Ken-ichi

    2008-08-15

    ABSTRACT: XB-S is an amino-terminal truncated protein of tenascin-X (TNX) in humans. The levels of the XB-S transcript, but not those of TNX transcripts, were increased upon hypoxia. We identified a critical hypoxia-responsive element (HRE) localized to a GT-rich element positioned from - 1410 to - 1368 in the XB-S promoter. Using an electrophoretic mobility shift assay (EMSA), we found that the HRE forms a DNA-protein complex with Sp1 and that GG positioned in - 1379 and - 1378 is essential for the binding of the nuclear complex. Transfection experiments in SL2 cells, an Sp1-deficient model system, with an Sp1 expression vector demonstrated that the region from - 1380 to - 1371, an HRE, is sufficient for efficient activation of the XB-S promoter upon hypoxia. The EMSA and a chromatin immunoprecipitation (ChIP) assay showed that Sp1 together with the transcriptional repressor histone deacetylase 1 (HDAC1) binds to the HRE of the XB-S promoter under normoxia and that hypoxia causes dissociation of HDAC1 from the Sp1/HDAC1 complex. The HRE promoter activity was induced in the presence of a histone deacetylase inhibitor, trichostatin A, even under normoxia. Our results indicate that the hypoxia-induced activation of the XB-S promoter is regulated through dissociation of HDAC1 from an Sp1-binding HRE site.

  18. A Theoretical Investigation of the Dynamic Lateral Stability Characteristics of the MX-838 (XB-51) Airplane

    NASA Technical Reports Server (NTRS)

    Paulson, Jon W.

    1948-01-01

    At the request of the Air Material Command, U. S. Air Force, a theoretical study has been made of the dynamic lateral stability characteristics of the MX-838 (XB-51) airplane. The calculations included the determination of the neutral-oscillatory-stability boundary (R = 0), the period and time to damp to one-half amplitude of the lateral oscillation, end the time to damp to one-half amplitude for the spiral mode. Factors varied in the investigation were lift coefficient, wing incidence, wing loading, and altitude. The results of the investigation showed that the lateral oscillation of the airplane is unstable below a lift coefficient of 1.2 with flaps . deflected 40deg but is stable over the entire speed range with flaps deflected 20deg or 0deg. The results showed that satisfactory oscillatory stability can probably be obtained for all lift coefficients with the proper variation of flap deflection and wing incidence with airspeed. Reducing the positive wing incidence improved the oscillatory stability characteristics. The airplane is spirally unstable for most conditions but the instability is mild and the Air Force requirements are easily met.

  19. Dip Spectroscopy of the Low Mass X-Ray Binary XB 1254-690

    NASA Technical Reports Server (NTRS)

    Smale, Alan P.; Church, M. J.; BalucinskaChurch, M.; White, Nicholas E. (Technical Monitor)

    2002-01-01

    We observed the low mass X-ray binary XB 1254-690 with the Rossi X-ray Timing Explorer in 2001 May and December. During the first observation strong dipping on the 3.9-hr orbital period and a high degree of variability were observed, along with "shoulders" approx. 15% deep during extended intervals on each side of the main dips. The first observation also included pronounced flaring activity. The non-dip spectrum obtained using the PCA instrument was well-described by a two-component model consisting of a blackbody with kT = 1.30 +/- 0.10 keV plus a cut-off power law representation of Comptonized emission with power law photon index 1.10 +/- 0.46 and a cut-off energy of 5.9(sup +3.0, sub -1.4) keV. The intensity decrease in the shoulders of dipping is energy-independent, consistent with electron scattering in the outer ionized regions of the absorber. In deep dipping the depth of dipping reached 100%, in the energy band below 5 keV, indicating that all emitting regions were covered by absorber. Intensity-selected dip spectra were well-fit by a model in which the point-like blackbody is rapidly covered, while the extended Comptonized emission is progressively overlapped by the absorber, with the, covering fraction rising to 95% in the deepest portion of the dip. The intensity of this component in the dip spectra could be modeled by a combination of electron scattering and photoelectric absorption. Dipping did not occur during the 2001 December observation, but remarkably, both bursting and flaring were observed contemporaneously.

  20. Altitude-Wind-Tunnel investigation of Westinghouse 19B-2, 19B-8, and 19XB-1 Jet-Propulsion Engines IV : analysis of compressor performance

    NASA Technical Reports Server (NTRS)

    Dietz, Robert O; Kuenzig, John K

    1948-01-01

    Investigations were conducted in the NACA Cleveland altitude wind tunnel to determine the performance and operational characteristics of the 19B-2, 19B-6, and 19XB-1 Turbojet Engines. One objective of the investigations was to determine the effect of altitude, flight Mach number, and tail-pipe-nozzle area on the performance characteristics of the six-stage and ten-stage axial-flow compressors of the 19B-8 and 19XB-1 engines, respectively. The data were obtained over a range of simulated altitudes and flight Mach numbers. At each simulated flight condition the engine was run over its full operable range of speeds. Performance characteristics of the 19B-8 and 19XB-1 compressors for the range of operation obtainable in the turbojet-engine installation are presented. Compressor characteristics are presented as functions of air flow corrected to sea-level conditions, compressor Mach number, and compressor load coefficient.

  1. Direct X-B mode conversion for high-β national spherical torus experiment in nonlinear regime

    SciTech Connect

    Ali Asgarian, M. E-mail: maa@msu.edu; Parvazian, A.; Abbasi, M.; Verboncoeur, J. P.

    2014-09-15

    Electron Bernstein wave (EBW) can be effective for heating and driving currents in spherical tokamak plasmas. Power can be coupled to EBW via mode conversion of the extraordinary (X) mode wave. The most common and successful approach to study the conditions for optimized mode conversion to EBW was evaluated analytically and numerically using a cold plasma model and an approximate kinetic model. The major drawback in using radio frequency waves was the lack of continuous wave sources at very high frequencies (above the electron plasma frequency), which has been addressed. A future milestone is to approach high power regime, where the nonlinear effects become significant, exceeding the limits of validity for present linear theory. Therefore, one appropriate tool would be particle in cell (PIC) simulation. The PIC method retains most of the nonlinear physics without approximations. In this work, we study the direct X-B mode conversion process stages using PIC method for incident wave frequency f{sub 0} = 15 GHz, and maximum amplitude E{sub 0} = 10{sup 5 }V/m in the national spherical torus experiment (NSTX). The modelling shows a considerable reduction in X-B mode conversion efficiency, C{sub modelling} = 0.43, due to the presence of nonlinearities. Comparison of system properties to the linear state reveals predominant nonlinear effects; EBW wavelength and group velocity in comparison with linear regime exhibit an increment around ∼36% and 17%, respectively.

  2. Hyperactivation of the Human Plasma Membrane Ca2+ Pump PMCA h4xb by Mutation of Glu99 to Lys*

    PubMed Central

    Mazzitelli, Luciana R.; Adamo, Hugo P.

    2014-01-01

    The transport of calcium to the extracellular space carried out by plasma membrane Ca2+ pumps (PMCAs) is essential for maintaining low Ca2+ concentrations in the cytosol of eukaryotic cells. The activity of PMCAs is controlled by autoinhibition. Autoinhibition is relieved by the binding of Ca2+-calmodulin to the calmodulin-binding autoinhibitory sequence, which in the human PMCA is located in the C-terminal segment and results in a PMCA of high maximal velocity of transport and high affinity for Ca2+. Autoinhibition involves the intramolecular interaction between the autoinhibitory domain and a not well defined region of the molecule near the catalytic site. Here we show that the fusion of GFP to the C terminus of the h4xb PMCA causes partial loss of autoinhibition by specifically increasing the Vmax. Mutation of residue Glu99 to Lys in the cytosolic portion of the M1 transmembrane helix at the other end of the molecule brought the Vmax of the h4xb PMCA to near that of the calmodulin-activated enzyme without increasing the apparent affinity for Ca2+. Altogether, the results suggest that the autoinhibitory interaction of the extreme C-terminal segment of the h4 PMCA is disturbed by changes of negatively charged residues of the N-terminal region. This would be consistent with a recently proposed model of an autoinhibited form of the plant ACA8 pump, although some differences are noted. PMID:24584935

  3. Direct X-B mode conversion for high-β national spherical torus experiment in nonlinear regime

    NASA Astrophysics Data System (ADS)

    Ali Asgarian, M.; Parvazian, A.; Abbasi, M.; Verboncoeur, J. P.

    2014-09-01

    Electron Bernstein wave (EBW) can be effective for heating and driving currents in spherical tokamak plasmas. Power can be coupled to EBW via mode conversion of the extraordinary (X) mode wave. The most common and successful approach to study the conditions for optimized mode conversion to EBW was evaluated analytically and numerically using a cold plasma model and an approximate kinetic model. The major drawback in using radio frequency waves was the lack of continuous wave sources at very high frequencies (above the electron plasma frequency), which has been addressed. A future milestone is to approach high power regime, where the nonlinear effects become significant, exceeding the limits of validity for present linear theory. Therefore, one appropriate tool would be particle in cell (PIC) simulation. The PIC method retains most of the nonlinear physics without approximations. In this work, we study the direct X-B mode conversion process stages using PIC method for incident wave frequency f0 = 15 GHz, and maximum amplitude E0 = 105 V/m in the national spherical torus experiment (NSTX). The modelling shows a considerable reduction in X-B mode conversion efficiency, Cmodelling = 0.43, due to the presence of nonlinearities. Comparison of system properties to the linear state reveals predominant nonlinear effects; EBW wavelength and group velocity in comparison with linear regime exhibit an increment around ˜36% and 17%, respectively.

  4. Stereotactic Ablative Radiation Therapy for Subcentimeter Lung Tumors: Clinical, Dosimetric, and Image Guidance Considerations

    SciTech Connect

    Louie, Alexander V.; Senan, Suresh; Dahele, Max; Slotman, Ben J.; Verbakel, Wilko F.A.R.

    2014-11-15

    Purpose: Use of stereotactic ablative radiation therapy (SABR) for subcentimeter lung tumors is controversial. We report our outcomes for tumors with diameter ≤1 cm and their visibility on cone beam computed tomography (CBCT) scans and retrospectively evaluate the planned dose using a deterministic dose calculation algorithm (Acuros XB [AXB]). Methods and Materials: We identified subcentimeter tumors from our institutional SABR database. Tumor size was remeasured on an artifact-free phase of the planning 4-dimensional (4D)-CT. Clinical plan doses were generated using either a pencil beam convolution or an anisotropic analytic algorithm (AAA). All AAA plans were recalculated using AXB, and differences among D95 and mean dose for internal target volume (ITV) and planning target volume (PTV) on the average intensity CT dataset, as well as for gross tumor volume (GTV) on the end respiratory phases were reported. For all AAA patients, CBCT scans acquired during each treatment fraction were evaluated for target visibility. Progression-free and overall survival rates were calculated using the Kaplan-Meier method. Results: Thirty-five patients with 37 subcentimeter tumors were eligible for analysis. For the 22 AAA plans recalculated using AXB, Mean D95 ± SD values were 2.2 ± 4.4% (ITV) and 2.5 ± 4.8% (PTV) lower using AXB; whereas mean doses were 2.9 ± 4.9% (ITV) and 3.7 ± 5.1% (PTV) lower. Calculated AXB doses were significantly lower in one patient (difference in mean ITV and PTV doses, as well as in mean ITV and PTV D95 ranged from 22%-24%). However, the end respiratory phase GTV received at least 95% of the prescription dose. Review of 92 CBCT scans from all AAA patients revealed that the tumor was visualized in 82 images, and its position could be inferred in other images. The 2-year local progression-free survival was 100%. Conclusions: Patients with subcentimeter lung tumors are good candidates for SABR, given the dosimetry, ability to localize

  5. On unusual temperature dependence of the upper critical field in YNi 2- xFe xB 2C

    NASA Astrophysics Data System (ADS)

    Kumary, T. Geetha; Kalavathi, S.; Valsakumar, M. C.; Hariharan, Y.; Radhakrishnan, T. S.

    1997-02-01

    Measurement of upper critica field in YNi 2- xFe xB 2C is reported for x = 0, 0.05, 0.10, and 0.15. An anomalous positive curvature is observed for a range of temperatures close to Tc, for all x. As x is increased, the temperature interval over which the curvature in Hc2( T) is positive, is reduced and the system shows a tendency to go to the usual behaviour exhibited by conventional low temperature superconductors. Most of the theories based on a Fermi liquid normal state seem to be inadequate to understand this anomalous behaviour. It is speculated that this anomalous behaviour of Hc2( T) signifies the presence of strong correlations in the pristine YNi 2B 2C and that strong correlation effects become less and less important upon substitution of Ni with Fe.

  6. Dosimetric comparison of a 6-MV flattening-filter and a flattening-filter-free beam for lung stereotactic ablative radiotherapy treatment

    NASA Astrophysics Data System (ADS)

    Kim, Yon-Lae; Chung, Jin-Beom; Kim, Jae-Sung; Lee, Jeong-Woo; Kim, Jin-Young; Kang, Sang-Won; Suh, Tae-Suk

    2015-11-01

    The purpose of this study was to test the feasibility of clinical usage of a flattening-filter-free (FFF) beam for treatment with lung stereotactic ablative radiotherapy (SABR). Ten patients were treated with SABR and a 6-MV FFF beam for this study. All plans using volumetric modulated arc therapy (VMAT) were optimized in the Eclipse treatment planning system (TPS) by using the Acuros XB (AXB) dose calculation algorithm and were delivered by using a Varian TrueBeam ™ linear accelerator equipped with a high-definition (HD) multi-leaf collimator. The prescription dose used was 48 Gy in 4 fractions. In order to compare the plan using a conventional 6-MV flattening-filter (FF) beam, the SABR plan was recalculated under the condition of the same beam settings used in the plan employing the 6-MV FFF beam. All dose distributions were calculated by using Acuros XB (AXB, version 11) and a 2.5-mm isotropic dose grid. The cumulative dosevolume histograms (DVH) for the planning target volume (PTV) and all organs at risk (OARs) were analyzed. Technical parameters, such as total monitor units (MUs) and the delivery time, were also recorded and assessed. All plans for target volumes met the planning objectives for the PTV ( i.e., V95% > 95%) and the maximum dose ( i.e., Dmax < 110%) revealing adequate target coverage for the 6-MV FF and FFF beams. Differences in DVH for target volumes (PTV and clinical target volume (CTV)) and OARs on the lung SABR plans from the interchange of the treatment beams were small, but showed a marked reduction (52.97%) in the treatment delivery time. The SABR plan with a FFF beam required a larger number of MUs than the plan with the FF beam, and the mean difference in MUs was 4.65%. This study demonstrated that the use of the FFF beam for lung SABR plan provided better treatment efficiency relative to 6-MV FF beam. This strategy should be particularly beneficial for high dose conformity to the lung and decreased intra-fraction movements because of

  7. Phosphatidylinositol 3-Kinase-Associated Protein (PI3KAP)/XB130 Crosslinks Actin Filaments through Its Actin Binding and Multimerization Properties In Vitro and Enhances Endocytosis in HEK293 Cells.

    PubMed

    Yamanaka, Daisuke; Akama, Takeshi; Chida, Kazuhiro; Minami, Shiro; Ito, Koichi; Hakuno, Fumihiko; Takahashi, Shin-Ichiro

    2016-01-01

    Actin-crosslinking proteins control actin filament networks and bundles and contribute to various cellular functions including regulation of cell migration, cell morphology, and endocytosis. Phosphatidylinositol 3-kinase-associated protein (PI3KAP)/XB130 has been reported to be localized to actin filaments (F-actin) and required for cell migration in thyroid carcinoma cells. Here, we show a role for PI3KAP/XB130 as an actin-crosslinking protein. First, we found that the carboxyl terminal region of PI3KAP/XB130 containing amino acid residues 830-840 was required and sufficient for localization to F-actin in NIH3T3 cells, and this region is directly bound to F-actin in vitro. Moreover, actin-crosslinking assay revealed that recombinant PI3KAP/XB130 crosslinked F-actin. In general, actin-crosslinking proteins often multimerize to assemble multiple actin-binding sites. We then investigated whether PI3KAP/XB130 could form a multimer. Blue native-PAGE analysis showed that recombinant PI3KAP/XB130 was detected at 250-1200 kDa although the molecular mass was approximately 125 kDa, suggesting that PI3KAP/XB130 formed multimers. Furthermore, we found that the amino terminal 40 amino acids were required for this multimerization by co-immunoprecipitation assay in HEK293T cells. Deletion mutants of PI3KAP/XB130 lacking the actin-binding region or the multimerizing region did not crosslink actin filaments, indicating that actin binding and multimerization of PI3KAP/XB130 were necessary to crosslink F-actin. Finally, we examined roles of PI3KAP/XB130 on endocytosis, an actin-related biological process. Overexpression of PI3KAP/XB130 enhanced dextran uptake in HEK 293 cells. However, most of the cells transfected with the deletion mutant lacking the actin-binding region incorporated dextran to a similar extent as control cells. Taken together, these results demonstrate that PI3KAP/XB130 crosslinks F-actin through both its actin-binding region and multimerizing region and plays

  8. Genetic diversity of VAR2CSA ID1-DBL2Xb in worldwide Plasmodium falciparum populations: impact on vaccine design for placental malaria.

    PubMed

    Bordbar, Bita; Tuikue Ndam, Nicaise; Renard, Emmanuelle; Jafari-Guemouri, Sayeh; Tavul, Livingstone; Jennison, Charlie; Gnidehou, Sédami; Tahar, Rachida; Gamboa, Dionicia; Bendezu, Jorge; Menard, Didier; Barry, Alyssa E; Deloron, Philippe; Sabbagh, Audrey

    2014-07-01

    In placental malaria (PM), sequestration of infected erythrocytes in the placenta is mediated by an interaction between VAR2CSA, a Plasmodium falciparum protein expressed on erythrocytes, and chondroitin sulfate A (CSA) on syncytiotrophoblasts. Recent works have identified ID1-DBL2Xb as the minimal CSA-binding region within VAR2CSA able to induce strong protective immunity, making it the leading candidate for the development of a vaccine against PM. Assessing the existence of population differences in the distribution of ID1-DBL2Xb polymorphisms is of paramount importance to determine whether geographic diversity must be considered when designing a candidate vaccine based on this fragment. In this study, we examined patterns of sequence variation of ID1-DBL2Xb in a large collection of P. falciparum field isolates (n=247) from different malaria-endemic areas, including Africa (Benin, Senegal, Cameroon and Madagascar), Asia (Cambodia), Oceania (Papua New Guinea), and Latin America (Peru). Detection of variants and estimation of their allele frequencies were performed using next-generation sequencing of DNA pools. A considerable amount of variation was detected along the whole gene segment, suggesting that several allelic variants may need to be included in a candidate vaccine to achieve broad population coverage. However, most sequence variants were common and extensively shared among worldwide parasite populations, demonstrating long term persistence of those polymorphisms, probably maintained through balancing selection. Therefore, a vaccine mixture including such stable antigen variants will be putatively applicable and efficacious in all world regions where malaria occurs. Despite similarity in ID1-DBL2Xb allele repertoire across geographic areas, several peaks of strong population differentiation were observed at specific polymorphic loci, pointing out putative targets of humoral immunity subject to positive immune selection.

  9. Altitude-Wind-Tunnel Investigation of the 19B-2, 19B-8 and 19XB-1 Jet- Propulsion Engines. 4; Analysis of Compressor Performance

    NASA Technical Reports Server (NTRS)

    Dietz, Robert O.; Kuenzig, John K.

    1947-01-01

    Investigations were conducted in the Cleveland altitude wind tunnel to determine the performance and operational characteristics of the 19B-2, 19B-8, and 19XS-1 turbojet engines. One objective was to determine the effect of altitude, flight Mach number, and tail-pipe-nozzle area on the performance characteristics of the six-stage and ten-stage axial-flow compressors of the 19B-8 and 19XB-1 engines, respectively, The data were obtained over a range of simulated altitudes and flight Mach numbers. At each simulated flight condition the engine was run over its full operable range of speeds. Performance characteristics of the 19B-8 and 19XB-1 compressors for the range of operation obtainable in the turboJet-engine installation are presented. Compressor characteristics are presented as functions of air flow corrected to sea-level conditions, compressor Mach number, and compressor load coefficient. For the range of compressor operation investigated, changes in Reynolds number had no measurable effect on the relations among compressor Mach number, corrected air flow, compressor load coefficient, compressor pressure ratio, and compressor efficiency. The operating lines for the 19B-8 compressor lay on the low-air-flow side of the region of maximum compressor efficiency; the 19B-8 compressor operated at higher average pressure coefficients per stage and produced a lower over-all pressure ratio than did the 19XB-1 compressor.

  10. Evaluation of an analytic linear Boltzmann transport equation solver for high-density inhomogeneities

    SciTech Connect

    Lloyd, S. A. M.; Ansbacher, W.

    2013-01-15

    Purpose: Acuros external beam (Acuros XB) is a novel dose calculation algorithm implemented through the ECLIPSE treatment planning system. The algorithm finds a deterministic solution to the linear Boltzmann transport equation, the same equation commonly solved stochastically by Monte Carlo methods. This work is an evaluation of Acuros XB, by comparison with Monte Carlo, for dose calculation applications involving high-density materials. Existing non-Monte Carlo clinical dose calculation algorithms, such as the analytic anisotropic algorithm (AAA), do not accurately model dose perturbations due to increased electron scatter within high-density volumes. Methods: Acuros XB, AAA, and EGSnrc based Monte Carlo are used to calculate dose distributions from 18 MV and 6 MV photon beams delivered to a cubic water phantom containing a rectangular high density (4.0-8.0 g/cm{sup 3}) volume at its center. The algorithms are also used to recalculate a clinical prostate treatment plan involving a unilateral hip prosthesis, originally evaluated using AAA. These results are compared graphically and numerically using gamma-index analysis. Radio-chromic film measurements are presented to augment Monte Carlo and Acuros XB dose perturbation data. Results: Using a 2% and 1 mm gamma-analysis, between 91.3% and 96.8% of Acuros XB dose voxels containing greater than 50% the normalized dose were in agreement with Monte Carlo data for virtual phantoms involving 18 MV and 6 MV photons, stainless steel and titanium alloy implants and for on-axis and oblique field delivery. A similar gamma-analysis of AAA against Monte Carlo data showed between 80.8% and 87.3% agreement. Comparing Acuros XB and AAA evaluations of a clinical prostate patient plan involving a unilateral hip prosthesis, Acuros XB showed good overall agreement with Monte Carlo while AAA underestimated dose on the upstream medial surface of the prosthesis due to electron scatter from the high-density material. Film measurements

  11. SU-E-T-280: Reconstructed Rectal Wall Dose Map-Based Verification of Rectal Dose Sparing Effect According to Rectum Definition Methods and Dose Perturbation by Air Cavity in Endo-Rectal Balloon

    SciTech Connect

    Park, J; Park, H; Lee, J; Kang, S; Lee, M; Suh, T; Lee, B

    2014-06-01

    Purpose: Dosimetric effect and discrepancy according to the rectum definition methods and dose perturbation by air cavity in an endo-rectal balloon (ERB) were verified using rectal-wall (Rwall) dose maps considering systematic errors in dose optimization and calculation accuracy in intensity-modulated radiation treatment (IMRT) for prostate cancer patients. Methods: When the inflated ERB having average diameter of 4.5 cm and air volume of 100 cc is used for patient, Rwall doses were predicted by pencil-beam convolution (PBC), anisotropic analytic algorithm (AAA), and AcurosXB (AXB) with material assignment function. The errors of dose optimization and calculation by separating air cavity from the whole rectum (Rwhole) were verified with measured rectal doses. The Rwall doses affected by the dose perturbation of air cavity were evaluated using a featured rectal phantom allowing insert of rolled-up gafchromic films and glass rod detectors placed along the rectum perimeter. Inner and outer Rwall doses were verified with reconstructed predicted rectal wall dose maps. Dose errors and extent at dose levels were evaluated with estimated rectal toxicity. Results: While AXB showed insignificant difference of target dose coverage, Rwall doses underestimated by up to 20% in dose optimization for the Rwhole than Rwall at all dose range except for the maximum dose. As dose optimization for Rwall was applied, the Rwall doses presented dose error less than 3% between dose calculation algorithm except for overestimation of maximum rectal dose up to 5% in PBC. Dose optimization for Rwhole caused dose difference of Rwall especially at intermediate doses. Conclusion: Dose optimization for Rwall could be suggested for more accurate prediction of rectal wall dose prediction and dose perturbation effect by air cavity in IMRT for prostate cancer. This research was supported by the Leading Foreign Research Institute Recruitment Program through the National Research Foundation of Korea

  12. Search for the Xb and other hidden-beauty states in the π+π- ϒ (1 S) channel at ATLAS

    NASA Astrophysics Data System (ADS)

    Aad, G.; Abbott, B.; Abdallah, J.; Abdel Khalek, S.; Abdinov, O.; Aben, R.; Abi, B.; Abolins, M.; AbouZeid, O. S.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adamczyk, L.; Adams, D. L.; Adelman, J.; Adomeit, S.; Adye, T.; Agatonovic-Jovin, T.; Aguilar-Saavedra, J. A.; Agustoni, M.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akerstedt, H.; Åkesson, T. P. A.; Akimoto, G.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albrand, S.; Alconada Verzini, M. J.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexandre, G.; Alexopoulos, T.; Alhroob, M.; Alimonti, G.; Alio, L.; Alison, J.; Allbrooke, B. M. M.; Allison, L. J.; Allport, P. P.; Almond, J.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Altheimer, A.; Alvarez Gonzalez, B.; Alviggi, M. G.; Amako, K.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amorim, A.; Amoroso, S.; Amram, N.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, G.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Anduaga, X. S.; Angelidakis, S.; Angelozzi, I.; Anger, P.; Angerami, A.; Anghinolfi, F.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antonaki, A.; Antonelli, M.; Antonov, A.; Antos, J.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Apolle, R.; Arabidze, G.; Aracena, I.; Arai, Y.; Araque, J. P.; Arce, A. T. H.; Arguin, J.-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Arnaez, O.; Arnal, V.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Asai, S.; Asbah, N.; Ashkenazi, A.; Åsman, B.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Auerbach, B.; Augsten, K.; Aurousseau, M.; Avolio, G.; Azuelos, G.; Azuma, Y.; Baak, M. A.; Baas, A. E.; Bacci, C.; Bachacou, H.; Bachas, K.; Backes, M.; Backhaus, M.; Backus Mayes, J.; Badescu, E.; Bagiacchi, P.; Bagnaia, P.; Bai, Y.; Bain, T.; Baines, J. T.; Baker, O. K.; Balek, P.; Balli, F.; Banas, E.; Banerjee, Sw.; Bannoura, A. A. E.; Bansal, V.; Bansil, H. S.; Barak, L.; Baranov, S. P.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barisonzi, M.; Barklow, T.; Barlow, N.; Barnett, B. M.; Barnett, R. M.; Barnovska, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Bartsch, V.; Bassalat, A.; Basye, A.; Bates, R. L.; Batley, J. R.; Battaglia, M.; Battistin, M.; Bauer, F.; Bawa, H. S.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Beccherle, R.; Bechtle, P.; Beck, H. P.; Becker, K.; Becker, S.; Beckingham, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bedikian, S.; Bednyakov, V. A.; Bee, C. P.; Beemster, L. J.; Beermann, T. A.; Begel, M.; Behr, K.; Belanger-Champagne, C.; Bell, P. J.; Bell, W. H.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Benary, O.; Benchekroun, D.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez Garcia, J. A.; Benjamin, D. P.; Bensinger, J. R.; Benslama, K.; Bentvelsen, S.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Berghaus, F.; Beringer, J.; Bernard, C.; Bernat, P.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertsche, C.; Bertsche, D.; Besana, M. I.; Besjes, G. J.; Bessidskaia, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethke, S.; Bhimji, W.; Bianchi, R. M.; Bianchini, L.; Bianco, M.; Biebel, O.; Bieniek, S. P.; Bierwagen, K.; Biesiada, J.; Biglietti, M.; Bilbao De Mendizabal, J.; Bilokon, H.; Bindi, M.; Binet, S.; Bingul, A.; Bini, C.; Black, C. W.; Black, J. E.; Black, K. M.; Blackburn, D.; Blair, R. E.; Blanchard, J.-B.; Blazek, T.; Bloch, I.; Blocker, C.; Blum, W.; Blumenschein, U.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boddy, C. R.; Boehler, M.; Boek, T. T.; Bogaerts, J. A.; Bogdanchikov, A. G.; Bogouch, A.; Bohm, C.; Bohm, J.; Boisvert, V.; Bold, T.; Boldea, V.; Boldyrev, A. S.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Borri, M.; Borroni, S.; Bortfeldt, J.; Bortolotto, V.; Bos, K.; Boscherini, D.; Bosman, M.; Boterenbrood, H.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Bousson, N.; Boutouil, S.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bozic, I.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Braun, H. M.; Brazzale, S. F.; Brelier, B.; Brendlinger, K.; Brennan, A. J.; Brenner, R.; Bressler, S.; Bristow, K.; Bristow, T. M.; Britton, D.; Brochu, F. M.; Brock, I.; Brock, R.; Bromberg, C.; Bronner, J.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Brown, J.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruneliere, R.; Brunet, S.; Bruni, A.; Bruni, G.; Bruschi, M.; Bryngemark, L.; Buanes, T.; Buat, Q.; Bucci, F.; Buchholz, P.; Buckingham, R. M.; Buckley, A. G.; Buda, S. I.; Budagov, I. A.; Buehrer, F.; Bugge, L.; Bugge, M. K.; Bulekov, O.; Bundock, A. C.; Burckhart, H.; Burdin, S.; Burghgrave, B.; Burke, S.; Burmeister, I.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Buszello, C. P.; Butler, B.; Butler, J. M.; Butt, A. I.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Byszewski, M.; Cabrera Urbán, S.; Caforio, D.; Cakir, O.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Calkins, R.; Caloba, L. P.; Calvet, D.; Calvet, S.; Camacho Toro, R.; Camarda, S.; Cameron, D.; Caminada, L. M.; Caminal Armadans, R.; Campana, S.; Campanelli, M.; Campoverde, A.; Canale, V.; Canepa, A.; Cano Bret, M.; Cantero, J.; Cantrill, R.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Caputo, R.; Cardarelli, R.; Carli, T.; Carlino, G.; Carminati, L.; Caron, S.; Carquin, E.; Carrillo-Montoya, G. D.; Carter, J. R.; Carvalho, J.; Casadei, D.; Casado, M. P.; Casolino, M.; Castaneda-Miranda, E.; Castelli, A.; Castillo Gimenez, V.; Castro, N. F.; Catastini, P.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Cattani, G.; Caudron, J.; Cavaliere, V.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Ceradini, F.; Cerio, B. C.; Cerny, K.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cerv, M.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chalupkova, I.; Chang, P.; Chapleau, B.; Chapman, J. D.; Charfeddine, D.; Charlton, D. G.; Chau, C. C.; Chavez Barajas, C. A.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, K.; Chen, L.; Chen, S.; Chen, X.; Chen, Y.; Chen, Y.; Cheng, H. C.; Cheng, Y.; Cheplakov, A.; Cherkaoui El Moursli, R.; Chernyatin, V.; Cheu, E.; Chevalier, L.; Chiarella, V.; Chiefari, G.; Childers, J. T.; Chilingarov, A.; Chiodini, G.; Chisholm, A. S.; Chislett, R. T.; Chitan, A.; Chizhov, M. V.; Chouridou, S.; Chow, B. K. B.; Chromek-Burckhart, D.; Chu, M. L.; Chudoba, J.; Chwastowski, J. J.; Chytka, L.; Ciapetti, G.; Ciftci, A. K.; Ciftci, R.; Cinca, D.; Cindro, V.; Ciocio, A.; Cirkovic, P.; Citron, Z. H.; Citterio, M.; Ciubancan, M.; Clark, A.; Clark, P. J.; Clarke, R. N.; Cleland, W.; Clemens, J. C.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Coffey, L.; Cogan, J. G.; Coggeshall, J.; Cole, B.; Cole, S.; Colijn, A. P.; Collot, J.; Colombo, T.; Colon, G.; Compostella, G.; Conde Muiño, P.; Coniavitis, E.; Conidi, M. C.; Connell, S. H.; Connelly, I. A.; Consonni, S. M.; Consorti, V.; Constantinescu, S.; Conta, C.; Conti, G.; Conventi, F.; Cooke, M.; Cooper, B. D.; Cooper-Sarkar, A. M.; Cooper-Smith, N. J.; Copic, K.; Cornelissen, T.; Corradi, M.; Corriveau, F.; Corso-Radu, A.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Côté, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Crispin Ortuzar, M.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cuciuc, C.-M.; Cuhadar Donszelmann, T.; Cummings, J.; Curatolo, M.; Cuthbert, C.; Czirr, H.; Czodrowski, P.; Czyczula, Z.; D'Auria, S.; D'Onofrio, M.; Da Cunha Sargedas De Sousa, M. J.; Da Via, C.; Dabrowski, W.; Dafinca, A.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Daniells, A. C.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J.; Dattagupta, A.; Davey, W.; David, C.; Davidek, T.; Davies, E.; Davies, M.; Davignon, O.; Davison, A. R.; Davison, P.; Davygora, Y.; Dawe, E.; Dawson, I.; Daya-Ishmukhametova, R. K.; De, K.; de Asmundis, R.; De Castro, S.; De Cecco, S.; De Groot, N.; de Jong, P.; De la Torre, H.; De Lorenzi, F.; De Nooij, L.; De Pedis, D.; De Salvo, A.; De Sanctis, U.; De Santo, A.; De Vivie De Regie, J. B.; Dearnaley, W. J.; Debbe, R.; Debenedetti, C.; Dechenaux, B.; Dedovich, D. V.; Deigaard, I.; Del Peso, J.; Del Prete, T.; Deliot, F.; Delitzsch, C. M.; Deliyergiyev, M.; Dell'Acqua, A.; Dell'Asta, L.; Dell'Orso, M.; Della Pietra, M.; della Volpe, D.; Delmastro, M.; Delsart, P. A.; Deluca, C.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; Di Ciaccio, A.; Di Ciaccio, L.; Di Domenico, A.; Di Donato, C.; Di Girolamo, A.; Di Girolamo, B.; Di Mattia, A.; Di Micco, B.; Di Nardo, R.; Di Simone, A.; Di Sipio, R.; Di Valentino, D.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Dietzsch, T. A.; Diglio, S.; Dimitrievska, A.; Dingfelder, J.; Dionisi, C.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; do Vale, M. A. B.; Do Valle Wemans, A.; Dobos, D.; Doglioni, C.; Doherty, T.; Dohmae, T.; Dolejsi, J.; Dolezal, Z.; Dolgoshein, B. A.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Dris, M.; Dubbert, J.; Dube, S.; Dubreuil, E.; Duchovni, E.; Duckeck, G.; Ducu, O. A.; Duda, D.; Dudarev, A.; Dudziak, F.; Duflot, L.; Duguid, L.; Dührssen, M.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Dwuznik, M.; Dyndal, M.; Ebke, J.; Edson, W.; Edwards, N. C.; Ehrenfeld, W.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; Ellert, M.; Elles, S.; Ellinghaus, F.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Endo, M.; Engelmann, R.; Erdmann, J.; Ereditato, A.; Eriksson, D.; Ernis, G.; Ernst, J.; Ernst, M.; Ernwein, J.; Errede, D.; Errede, S.; Ertel, E.; Escalier, M.; Esch, H.; Escobar, C.; Esposito, B.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Fabbri, L.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Favareto, A.; Fayard, L.; Federic, P.; Fedin, O. L.; Fedorko, W.; Fehling-Kaschek, M.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenyuk, A. B.; Fernandez Perez, S.; Ferrag, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Ferretto Parodi, A.; Fiascaris, M.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Firan, A.; Fischer, A.; Fischer, J.; Fisher, W. C.; Fitzgerald, E. A.; Flechl, M.; Fleck, I.; Fleischmann, P.; Fleischmann, S.; Fletcher, G. T.; Fletcher, G.; Flick, T.; Floderus, A.; Flores Castillo, L. R.; Florez Bustos, A. C.; Flowerdew, M. J.; Formica, A.; Forti, A.; Fortin, D.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Franchino, S.; Francis, D.; Franconi, L.; Franklin, M.; Franz, S.; Fraternali, M.; French, S. T.; Friedrich, C.; Friedrich, F.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fullana Torregrosa, E.; Fulsom, B. G.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, P.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallo, V.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Gao, J.; Gao, Y. S.; Garay Walls, F. M.; Garberson, F.; García, C.; García Navarro, J. E.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gatti, C.; Gaudio, G.; Gaur, B.; Gauthier, L.; Gauzzi, P.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Ge, P.; Gecse, Z.; Gee, C. N. P.; Geerts, D. A. A.; Geich-Gimbel, Ch.; Gellerstedt, K.; Gemme, C.; Gemmell, A.; Genest, M. H.; Gentile, S.; George, M.; George, S.; Gerbaudo, D.; Gershon, A.; Ghazlane, H.; Ghodbane, N.; Giacobbe, B.; Giagu, S.; Giangiobbe, V.; Giannetti, P.; Gianotti, F.; Gibbard, B.; Gibson, S. M.; Gilchriese, M.; Gillam, T. P. S.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giokaris, N.; Giordani, M. P.; Giordano, R.; Giorgi, F. M.; Giorgi, F. M.; Giraud, P. F.; Giugni, D.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Glonti, G. L.; Goblirsch-Kolb, M.; Goddard, J. R.; Godlewski, J.; Goeringer, C.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gomez Fajardo, L. S.; Gonçalo, R.; Goncalves Pinto Firmino Da Costa, J.; Gonella, L.; González de la Hoz, S.; Gonzalez Parra, G.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Gornicki, E.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Gouighri, M.; Goujdami, D.; Goulette, M. P.; Goussiou, A. G.; Goy, C.; Gozpinar, S.; Grabas, H. M. X.; Graber, L.; Grabowska-Bold, I.; Grafström, P.; Grahn, K.-J.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Grassi, V.; Gratchev, V.; Gray, H. M.; Graziani, E.; Grebenyuk, O. G.; Greenwood, Z. D.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grishkevich, Y. V.; Grivaz, J.-F.; Grohs, J. P.; Grohsjean, A.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Groth-Jensen, J.; Grout, Z. J.; Guan, L.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Guicheney, C.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Gupta, S.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guttman, N.; Guyot, C.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Haefner, P.; Hageböck, S.; Hajduk, Z.; Hakobyan, H.; Haleem, M.; Hall, D.; Halladjian, G.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamer, M.; Hamilton, A.; Hamilton, S.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Hanagaki, K.; Hanawa, K.; Hance, M.; Hanke, P.; Hanna, R.; Hansen, J. B.; Hansen, J. D.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harper, D.; Harrington, R. D.; Harris, O. M.; Harrison, P. F.; Hartjes, F.; Hasegawa, M.; Hasegawa, S.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauschild, M.; Hauser, R.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hawkins, A. D.; Hayashi, T.; Hayden, D.; Hays, C. P.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, L.; Hejbal, J.; Helary, L.; Heller, C.; Heller, M.; Hellman, S.; Hellmich, D.; Helsens, C.; Henderson, J.; Henderson, R. C. W.; Heng, Y.; Hengler, C.; Henrichs, A.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Hernández Jiménez, Y.; Herrberg-Schubert, R.; Herten, G.; Hertenberger, R.; Hervas, L.; Hesketh, G. G.; Hessey, N. P.; Hickling, R.; Higón-Rodriguez, E.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillert, S.; Hillier, S. J.; Hinchliffe, I.; Hines, E.; Hirose, M.; Hirschbuehl, D.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hoffman, J.; Hoffmann, D.; Hohlfeld, M.; Holmes, T. R.; Hong, T. M.; Hooft van Huysduynen, L.; Hopkins, W. H.; Horii, Y.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howard, J.; Howarth, J.; Hrabovsky, M.; Hristova, I.; Hrivnac, J.; Hryn'ova, T.; Hsu, C.; Hsu, P. J.; Hsu, S.-C.; Hu, D.; Hu, X.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Hülsing, T. A.; Hurwitz, M.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Ideal, E.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikematsu, K.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Inamaru, Y.; Ince, T.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Irles Quiles, A.; Isaksson, C.; Ishino, M.; Ishitsuka, M.; Ishmukhametov, R.; Issever, C.; Istin, S.; Iturbe Ponce, J. M.; Iuppa, R.; Ivarsson, J.; Iwanski, W.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jackson, B.; Jackson, M.; Jackson, P.; Jaekel, M. R.; Jain, V.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jakubek, J.; Jamin, D. O.; Jana, D. K.; Jansen, E.; Jansen, H.; Janssen, J.; Janus, M.; Jarlskog, G.; Javadov, N.; Javůrek, T.; Jeanty, L.; Jejelava, J.; Jeng, G.-Y.; Jennens, D.; Jenni, P.; Jentzsch, J.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, Y.; Jimenez Belenguer, M.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Joergensen, M. D.; Johansson, K. E.; Johansson, P.; Johns, K. A.; Jon-And, K.; Jones, G.; Jones, R. W. L.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Joshi, K. D.; Jovicevic, J.; Ju, X.; Jung, C. A.; Jungst, R. M.; Jussel, P.; Juste Rozas, A.; Kaci, M.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kajomovitz, E.; Kalderon, C. W.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kaneda, M.; Kaneti, S.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kapliy, A.; Kar, D.; Karakostas, K.; Karastathis, N.; Kareem, M. J.; Karnevskiy, M.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kashif, L.; Kasieczka, G.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Katre, A.; Katzy, J.; Kaushik, V.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kazama, S.; Kazanin, V. F.; Kazarinov, M. Y.; Keeler, R.; Kehoe, R.; Keil, M.; Keller, J. S.; Kempster, J. J.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Kessoku, K.; Keung, J.; Khalil-zada, F.; Khandanyan, H.; Khanov, A.; Khodinov, A.; Khomich, A.; Khoo, T. J.; Khoriauli, G.; Khoroshilov, A.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kim, H. Y.; Kim, H.; Kim, S. H.; Kimura, N.; Kind, O.; King, B. T.; King, M.; King, R. S. B.; King, S. B.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kiss, F.; Kittelmann, T.; Kiuchi, K.; Kladiva, E.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klinger, J. A.; Klioutchnikova, T.; Klok, P. F.; Kluge, E.-E.; Kluit, P.; Kluth, S.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koevesarki, P.; Koffas, T.; Koffeman, E.; Kogan, L. A.; Kohlmann, S.; Kohout, Z.; Kohriki, T.; Koi, T.; Kolanoski, H.; Koletsou, I.; Koll, J.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; König, S.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Köpke, L.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Korotkov, V. A.; Kortner, O.; Kortner, S.; Kostyukhin, V. V.; Kotov, V. M.; Kotwal, A.; Kourkoumelis, C.; Kouskoura, V.; Koutsman, A.; Kowalewski, R.; Kowalski, T. Z.; Kozanecki, W.; Kozhin, A. S.; Kral, V.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasny, M. W.; Krasznahorkay, A.; Kraus, J. K.; Kravchenko, A.; Kreiss, S.; Kretz, M.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Kruker, T.; Krumnack, N.; Krumshteyn, Z. V.; Kruse, A.; Kruse, M. C.; Kruskal, M.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuehn, S.; Kugel, A.; Kuhl, A.; Kuhl, T.; Kukhtin, V.; Kulchitsky, Y.; Kuleshov, S.; Kuna, M.; Kunkle, J.; Kupco, A.; Kurashige, H.; Kurochkin, Y. A.; Kurumida, R.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; La Rosa, A.; La Rotonda, L.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Lacuesta, V. R.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Laier, H.; Lambourne, L.; Lammers, S.; Lampen, C. L.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lang, V. S.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Laplace, S.; Lapoire, C.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Le Dortz, O.; Le Guirriec, E.; Le Menedeu, E.; LeCompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, H.; Lee, J. S. H.; Lee, S. C.; Lee, L.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehan, A.; Lehmacher, M.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leisos, A.; Leister, A. G.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzen, G.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Leontsinis, S.; Leroy, C.; Lester, C. G.; Lester, C. M.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Lewis, A.; Lewis, G. H.; Leyko, A. M.; Leyton, M.; Li, B.; Li, B.; Li, H.; Li, H. L.; Li, L.; Li, L.; Li, S.; Li, Y.; Liang, Z.; Liao, H.; Liberti, B.; Lichard, P.; Lie, K.; Liebal, J.; Liebig, W.; Limbach, C.; Limosani, A.; Lin, S. C.; Lin, T. H.; Linde, F.; Lindquist, B. E.; Linnemann, J. T.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lissauer, D.; Lister, A.; Litke, A. M.; Liu, B.; Liu, D.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, M.; Liu, Y.; Livan, M.; Livermore, S. S. A.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo Sterzo, F.; Lobodzinska, E.; Loch, P.; Lockman, W. S.; Loebinger, F. K.; Loevschall-Jensen, A. E.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Lombardo, V. P.; Long, B. A.; Long, J. D.; Long, R. E.; Lopes, L.; Lopez Mateos, D.; Lopez Paredes, B.; Lopez Paz, I.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Loscutoff, P.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lowe, A. J.; Lu, F.; Lu, N.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Lungwitz, M.; Lynn, D.; Lysak, R.; Lytken, E.; Ma, H.; Ma, L. L.; Maccarrone, G.; Macchiolo, A.; Machado Miguens, J.; Macina, D.; Madaffari, D.; Madar, R.; Maddocks, H. J.; Mader, W. F.; Madsen, A.; Maeno, M.; Maeno, T.; Maevskiy, A.; Magradze, E.; Mahboubi, K.; Mahlstedt, J.; Mahmoud, S.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maio, A.; Majewski, S.; Makida, Y.; Makovec, N.; Mal, P.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyshev, V. M.; Malyukov, S.; Mamuzic, J.; Mandelli, B.; Mandelli, L.; Mandić, I.; Mandrysch, R.; Maneira, J.; Manfredini, A.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J. A.; Mann, A.; Manning, P. M.; Manousakis-Katsikakis, A.; Mansoulie, B.; Mantifel, R.; Mapelli, L.; March, L.; Marchand, J. F.; Marchiori, G.; Marcisovsky, M.; Marino, C. P.; Marjanovic, M.; Marques, C. N.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Marti, L. F.; Marti-Garcia, S.; Martin, B.; Martin, B.; Martin, T. A.; Martin, V. J.; Martin dit Latour, B.; Martinez, H.; Martinez, M.; Martin-Haugh, S.; Martyniuk, A. C.; Marx, M.; Marzano, F.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, I.; Massa, L.; Massol, N.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Mattmann, J.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Mazzaferro, L.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McCubbin, N. A.; McFarlane, K. W.; Mcfayden, J. A.; Mchedlidze, G.; McMahon, S. J.; McPherson, R. A.; Mechnich, J.; Medinnis, M.; Meehan, S.; Mehlhase, S.; Mehta, A.; Meier, K.; Meineck, C.; Meirose, B.; Melachrinos, C.; Mellado Garcia, B. R.; Meloni, F.; Mengarelli, A.; Menke, S.; Meoni, E.; Mercurio, K. M.; Mergelmeyer, S.; Meric, N.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Merritt, H.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, C.; Meyer, J.-P.; Meyer, J.; Middleton, R. P.; Migas, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milic, A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Milstein, D.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Ming, Y.; Mir, L. M.; Mirabelli, G.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Mitsui, S.; Miucci, A.; Miyagawa, P. S.; Mjörnmark, J. U.; Moa, T.; Mochizuki, K.; Mohapatra, S.; Mohr, W.; Molander, S.; Moles-Valls, R.; Mönig, K.; Monini, C.; Monk, J.; Monnier, E.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Morgenstern, M.; Morii, M.; Moritz, S.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Morvaj, L.; Moser, H. G.; Mosidze, M.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Mouraviev, S. V.; Moyse, E. J. W.; Muanza, S.; Mudd, R. D.; Mueller, F.; Mueller, J.; Mueller, K.; Mueller, T.; Mueller, T.; Muenstermann, D.; Munwes, Y.; Murillo Quijada, J. A.; Murray, W. J.; Musheghyan, H.; Musto, E.; Myagkov, A. G.; Myska, M.; Nackenhorst, O.; Nadal, J.; Nagai, K.; Nagai, R.; Nagai, Y.; Nagano, K.; Nagarkar, A.; Nagasaka, Y.; Nagel, M.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Namasivayam, H.; Nanava, G.; Narayan, R.; Nattermann, T.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Nef, P. D.; Negri, A.; Negri, G.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nelson, T. K.; Nemecek, S.; Nemethy, P.; Nepomuceno, A. A.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Neves, R. M.; Nevski, P.; Newman, P. R.; Nguyen, D. H.; Nickerson, R. B.; Nicolaidou, R.; Nicquevert, B.; Nielsen, J.; Nikiforou, N.; Nikiforov, A.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolics, K.; Nikolopoulos, K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nisius, R.; Nobe, T.; Nodulman, L.; Nomachi, M.; Nomidis, I.; Norberg, S.; Nordberg, M.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nunes Hanninger, G.; Nunnemann, T.; Nurse, E.; Nuti, F.; O'Brien, B. J.; O'grady, F.; O'Neil, D. C.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, M. I.; Oda, S.; Odaka, S.; Ogren, H.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Okamura, W.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Olchevski, A. G.; Olivares Pino, S. A.; Oliveira Damazio, D.; Oliver Garcia, E.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onyisi, P. U. E.; Oram, C. J.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Oropeza Barrera, C.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero y Garzon, G.; Otono, H.; Ouchrif, M.; Ouellette, E. A.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Ovcharova, A.; Owen, M.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Padilla Aranda, C.; Pagáčová, M.; Pagan Griso, S.; Paganis, E.; Pahl, C.; Paige, F.; Pais, P.; Pajchel, K.; Palacino, G.; Palestini, S.; Palka, M.; Pallin, D.; Palma, A.; Palmer, J. D.; Pan, Y. B.; Panagiotopoulou, E.; Panduro Vazquez, J. G.; Pani, P.; Panikashvili, N.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, M. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pasqualucci, E.; Passaggio, S.; Passeri, A.; Pastore, F.; Pastore, Fr.; Pásztor, G.; Pataraia, S.; Patel, N. D.; Pater, J. R.; Patricelli, S.; Pauly, T.; Pearce, J.; Pedersen, L. E.; Pedersen, M.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Pelikan, D.; Peng, H.; Penning, B.; Penwell, J.; Perepelitsa, D. V.; Perez Codina, E.; Pérez García-Estañ, M. T.; Perez Reale, V.; Perini, L.; Pernegger, H.; Perrella, S.; Perrino, R.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petrolo, E.; Petrucci, F.; Pettersson, N. E.; Pezoa, R.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Piccinini, M.; Piegaia, R.; Pignotti, D. T.; Pilcher, J. E.; Pilkington, A. D.; Pina, J.; Pinamonti, M.; Pinder, A.; Pinfold, J. L.; Pingel, A.; Pinto, B.; Pires, S.; Pitt, M.; Pizio, C.; Plazak, L.; Pleier, M.-A.; Pleskot, V.; Plotnikova, E.; Plucinski, P.; Poddar, S.; Podlyski, F.; Poettgen, R.; Poggioli, L.; Pohl, D.; Pohl, M.; Polesello, G.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Pontecorvo, L.; Pope, B. G.; Popeneciu, G. A.; Popovic, D. S.; Poppleton, A.; Portell Bueso, X.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Potter, C. T.; Poulard, G.; Poveda, J.; Pozdnyakov, V.; Pralavorio, P.; Pranko, A.; Prasad, S.; Pravahan, R.; Prell, S.; Price, D.; Price, J.; Price, L. E.; Prieur, D.; Primavera, M.; Proissl, M.; Prokofiev, K.; Prokoshin, F.; Protopapadaki, E.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Przysiezniak, H.; Ptacek, E.; Puddu, D.; Pueschel, E.; Puldon, D.; Purohit, M.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Quarrie, D. R.; Quayle, W. B.; Queitsch-Maitland, M.; Quilty, D.; Qureshi, A.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Rajagopalan, S.; Rammensee, M.; Randle-Conde, A. S.; Rangel-Smith, C.; Rao, K.; Rauscher, F.; Rave, T. C.; Ravenscroft, T.; Raymond, M.; Read, A. L.; Readioff, N. P.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reeves, K.; Rehnisch, L.; Reisin, H.; Relich, M.; Rembser, C.; Ren, H.; Ren, Z. L.; Renaud, A.; Rescigno, M.; Resconi, S.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Ridel, M.; Rieck, P.; Rieger, J.; Rijssenbeek, M.; Rimoldi, A.; Rinaldi, L.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Roda, C.; Rodrigues, L.; Roe, S.; Røhne, O.; Rolli, S.; Romaniouk, A.; Romano, M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Ros, E.; Rosati, S.; Rosbach, K.; Rose, M.; Rose, P.; Rosendahl, P. L.; Rosenthal, O.; Rossetti, V.; Rossi, E.; Rossi, L. P.; Rosten, R.; Rotaru, M.; Roth, I.; Rothberg, J.; Rousseau, D.; Royon, C. R.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rubinskiy, I.; Rud, V. I.; Rudolph, C.; Rudolph, M. S.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Ruschke, A.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryder, N. C.; Saavedra, A. F.; Sacerdoti, S.; Saddique, A.; Sadeh, I.; Sadrozinski, H. F.-W.; Sadykov, R.; Safai Tehrani, F.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salamon, A.; Saleem, M.; Salek, D.; Sales De Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sampsonidis, D.; Sanchez, A.; Sánchez, J.; Sanchez Martinez, V.; Sandaker, H.; Sandbach, R. L.; Sander, H. G.; Sanders, M. P.; Sandhoff, M.; Sandoval, T.; Sandoval, C.; Sandstroem, R.; Sankey, D. P. C.; Sansoni, A.; Santoni, C.; Santonico, R.; Santos, H.; Santoyo Castillo, I.; Sapp, K.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sartisohn, G.; Sasaki, O.; Sasaki, Y.; Sauvage, G.; Sauvan, E.; Savard, P.; Savu, D. O.; Sawyer, C.; Sawyer, L.; Saxon, D. H.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Scarcella, M.; Scarfone, V.; Schaarschmidt, J.; Schacht, P.; Schaefer, D.; Schaefer, R.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Scharf, V.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Scherzer, M. I.; Schiavi, C.; Schieck, J.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmidt, E.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schneider, B.; Schnellbach, Y. J.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schorlemmer, A. L. S.; Schott, M.; Schouten, D.; Schovancova, J.; Schramm, S.; Schreyer, M.; Schroeder, C.; Schuh, N.; Schultens, M. J.; Schultz-Coulon, H.-C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwanenberger, C.; Schwartzman, A.; Schwarz, T. A.; Schwegler, Ph.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Schwindt, T.; Schwoerer, M.; Sciacca, F. G.; Scifo, E.; Sciolla, G.; Scott, W. G.; Scuri, F.; Scutti, F.; Searcy, J.; Sedov, G.; Sedykh, E.; Seidel, S. C.; Seiden, A.; Seifert, F.; Seixas, J. M.; Sekhniaidze, G.; Sekula, S. J.; Selbach, K. E.; Seliverstov, D. M.; Sellers, G.; Semprini-Cesari, N.; Serfon, C.; Serin, L.; Serkin, L.; Serre, T.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shamim, M.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shehu, C. Y.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shiyakova, M.; Shmeleva, A.; Shochet, M. J.; Short, D.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Shushkevich, S.; Sicho, P.; Sidiropoulou, O.; Sidorov, D.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silver, Y.; Silverstein, D.; Silverstein, S. B.; Simak, V.; Simard, O.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simoniello, R.; Simonyan, M.; Sinervo, P.; Sinev, N. B.; Sipica, V.; Siragusa, G.; Sircar, A.; Sisakyan, A. N.; Sivoklokov, S. Yu.; Sjölin, J.; Sjursen, T. B.; Skottowe, H. P.; Skovpen, K. Yu.; Skubic, P.; Slater, M.; Slavicek, T.; Sliwa, K.; Smakhtin, V.; Smart, B. H.; Smestad, L.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, K. M.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snidero, G.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Soh, D. A.; Solans, C. A.; Solar, M.; Solc, J.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Song, H. Y.; Soni, N.; Sood, A.; Sopczak, A.; Sopko, B.; Sopko, V.; Sorin, V.; Sosebee, M.; Soualah, R.; Soueid, P.; Soukharev, A. M.; South, D.; Spagnolo, S.; Spanò, F.; Spearman, W. R.; Spettel, F.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; Spreitzer, T.; Spurlock, B.; St. Denis, R. D.; Staerz, S.; Stahlman, J.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanescu-Bellu, M.; Stanitzki, M. M.; Stapnes, S.; Starchenko, E. A.; Stark, J.; Staroba, P.; Starovoitov, P.; Staszewski, R.; Stavina, P.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stern, S.; Stewart, G. A.; Stillings, J. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strandlie, A.; Strauss, E.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Subramaniam, R.; Succurro, A.; Sugaya, Y.; Suhr, C.; Suk, M.; Sulin, V. V.; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Sundermann, J. E.; Suruliz, K.; Susinno, G.; Sutton, M. R.; Suzuki, Y.; Svatos, M.; Swedish, S.; Swiatlowski, M.; Sykora, I.; Sykora, T.; Ta, D.; Taccini, C.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Taiblum, N.; Takai, H.; Takashima, R.; Takeda, H.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tam, J. Y. C.; Tan, K. G.; Tanaka, J.; Tanaka, R.; Tanaka, S.; Tanaka, S.; Tanasijczuk, A. J.; Tannenwald, B. B.; Tannoury, N.; Tapprogge, S.; Tarem, S.; Tarrade, F.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, F. E.; Taylor, G. N.; Taylor, W.; Teischinger, F. A.; Teixeira Dias Castanheira, M.; Teixeira-Dias, P.; Temming, K. K.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Therhaag, J.; Theveneaux-Pelzer, T.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, E. N.; Thompson, P. D.; Thompson, P. D.; Thompson, R. J.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Thomson, M.; Thong, W. M.; Thun, R. P.; Tian, F.; Tibbetts, M. J.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tiouchichine, E.; Tipton, P.; Tisserant, S.; Todorov, T.; Todorova-Nova, S.; Toggerson, B.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tollefson, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Topilin, N. D.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Tran, H. L.; Trefzger, T.; Tremblet, L.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; True, P.; Trzebinski, M.; Trzupek, A.; Tsarouchas, C.; Tseng, J. C.-L.; Tsiareshka, P. V.; Tsionou, D.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tudorache, A.; Tudorache, V.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turecek, D.; Turk Cakir, I.; Turra, R.; Tuts, P. M.; Tykhonov, A.; Tylmad, M.; Tyndel, M.; Uchida, K.; Ueda, I.; Ueno, R.; Ughetto, M.; Ugland, M.; Uhlenbrock, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urbaniec, D.; Urquijo, P.; Usai, G.; Usanova, A.; Vacavant, L.; Vacek, V.; Vachon, B.; Valencic, N.; Valentinetti, S.; Valero, A.; Valery, L.; Valkar, S.; Valladolid Gallego, E.; Vallecorsa, S.; Valls Ferrer, J. A.; Van Den Wollenberg, W.; Van Der Deijl, P. C.; van der Geer, R.; van der Graaf, H.; Van Der Leeuw, R.; van der Ster, D.; van Eldik, N.; van Gemmeren, P.; Van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vanguri, R.; Vaniachine, A.; Vankov, P.; Vannucci, F.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veloso, F.; Velz, T.; Veneziano, S.; Ventura, A.; Ventura, D.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, J. C.; Vest, A.; Vetterli, M. C.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigne, R.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Virzi, J.; Vivarelli, I.; Vives Vaque, F.; Vlachos, S.; Vladoiu, D.; Vlasak, M.; Vogel, A.; Vogel, M.; Vokac, P.; Volpi, G.; Volpi, M.; von der Schmitt, H.; von Radziewski, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vu Anh, T.; Vuillermet, R.; Vukotic, I.; Vykydal, Z.; Wagner, P.; Wagner, W.; Wahlberg, H.; Wahrmund, S.; Wakabayashi, J.; Walder, J.; Walker, R.; Walkowiak, W.; Wall, R.; Waller, P.; Walsh, B.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, K.; Wang, R.; Wang, S. M.; Wang, T.; Wang, X.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Warsinsky, M.; Washbrook, A.; Wasicki, C.; Watkins, P. M.; Watson, A. T.; Watson, I. J.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, S.; Weber, M. S.; Weber, S. W.; Webster, J. S.; Weidberg, A. R.; Weigell, P.; Weinert, B.; Weingarten, J.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wendland, D.; Weng, Z.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M.; Werner, P.; Wessels, M.; Wetter, J.; Whalen, K.; White, A.; White, M. J.; White, R.; White, S.; Whiteson, D.; Wicke, D.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wienemann, P.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wijeratne, P. A.; Wildauer, A.; Wildt, M. A.; Wilkens, H. G.; Will, J. Z.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, A.; Wilson, J. A.; Wingerter-Seez, I.; Winklmeier, F.; Winter, B. T.; Wittgen, M.; Wittig, T.; Wittkowski, J.; Wollstadt, S. J.; Wolter, M. W.; Wolters, H.; Wosiek, B. K.; Wotschack, J.; Woudstra, M. J.; Wozniak, K. W.; Wright, M.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wulf, E.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xiao, M.; Xu, D.; Xu, L.; Yabsley, B.; Yacoob, S.; Yakabe, R.; Yamada, M.; Yamaguchi, H.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, K.; Yamamoto, S.; Yamamura, T.; Yamanaka, T.; Yamauchi, K.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, U. K.; Yang, Y.; Yanush, S.; Yao, L.; Yao, W.-M.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yen, A. L.; Yildirim, E.; Yilmaz, M.; Yoosoofmiya, R.; Yorita, K.; Yoshida, R.; Yoshihara, K.; Young, C.; Young, C. J. S.; Youssef, S.; Yu, D. R.; Yu, J.; Yu, J. M.; Yu, J.; Yuan, L.; Yurkewicz, A.; Yusuff, I.; Zabinski, B.; Zaidan, R.; Zaitsev, A. M.; Zaman, A.; Zambito, S.; Zanello, L.; Zanzi, D.; Zeitnitz, C.; Zeman, M.; Zemla, A.; Zengel, K.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zevi della Porta, G.; Zhang, D.; Zhang, F.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, X.; Zhang, Z.; Zhao, Z.; Zhemchugov, A.; Zhong, J.; Zhou, B.; Zhou, L.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, R.; Zimmermann, S.; Zimmermann, S.; Zinonos, Z.; Ziolkowski, M.; Zobernig, G.; Zoccoli, A.; zur Nedden, M.; Zurzolo, G.; Zutshi, V.; Zwalinski, L.

    2015-01-01

    This Letter presents a search for a hidden-beauty counterpart of the X (3872) in the mass ranges of 10.05-10.31 GeV and 10.40-11.00 GeV, in the channel Xb →π+π- ϒ (1 S) (→μ+μ-), using 16.2 fb-1 of √{ s} = 8 TeVpp collision data collected by the ATLAS detector at the LHC. No evidence for new narrow states is found, and upper limits are set on the product of the Xb cross section and branching fraction, relative to those of the ϒ (2S), at the 95% confidence level using the CLS approach. These limits range from 0.8% to 4.0%, depending on mass. For masses above 10.1 GeV, the expected upper limits from this analysis are the most restrictive to date. Searches for production of the ϒ (13DJ), ϒ (10 860), and ϒ (11 020) states also reveal no significant signals.

  13. Excitation of ion Bernstein waves as the dominant parametric decay channel in direct X-B mode conversion for typical spherical torus

    NASA Astrophysics Data System (ADS)

    Abbasi, Mustafa; Sadeghi, Yahya; Sobhanian, Samad; Asgarian, Mohammad Ali

    2016-03-01

    The electron Bernstein wave (EBW) is typically the only wave in the electron cyclotron (EC) range that can be applied in spherical tokamaks for heating and current drive (H&CD). Spherical tokamaks (STs) operate generally in high- β regimes, in which the usual EC ordinary (O) and extraordinary (X) modes are cut off. As it was recently investigated the existence of EBWs at nonlinear regime thus the next step would be the probable nonlinear phenomena study which are predicted to be occurred within the high levels of injected power. In this regard, parametric instabilities are considered as the major channels for losses at the X-B conversion. Hence, we have to consider their effects at the UHR region which can reduce the X-B conversion efficiency. In the case of EBW heating (EBH) at high power density, the nonlinear effects can arise. Particularly at the UHR position, the group velocity is strongly reduced, which creates a high energy density and subsequently a high amplitude electric field. Therefore, a part of the input wave can decay into daughter waves via parametric instability (PI). Thus, via the present research, the excitations of ion Bernstein waves as the dominant decay channels are investigated and also an estimate for the threshold power in terms of experimental parameters related to the fundamental mode of instability is proposed.

  14. Characterization of a Severe Parenchymal Phenotype of Experimental Autoimmune Encephalomyelitis in (C57BL6xB10.PL)F1 Mice

    PubMed Central

    Carrithers, Michael D.; Carrithers, Lisette M.; Czyzyk, Jan; Henegariu, Octavian

    2009-01-01

    We here describe a novel CD4 T cell adoptive transfer model of severe experimental autoimmune encephalomyelitis in (C57BL6xB10.PL)F1 mice. This FI cross developed severe disease characterized by extensive parenchymal spinal cord and brain periventricular white matter infiltrates. In contrast, B10.PL mice developed mild disease characterized by meningeal predominant infiltrates. As determined by cDNA microarray and quantitative real time PCR expression analysis, histologic and flow cytometry analysis of inflammatory infiltrates, and attenuation of disease in class I-deficient and CD8-depleted F1 mice; this severe disease phenotype appears to be regulated by CNS infiltration of CD8 T lymphocytes early in the disease course. PMID:17512611

  15. Photon beam dosimetry with EBT3 film in heterogeneous regions: Application to the evaluation of dose-calculation algorithms

    NASA Astrophysics Data System (ADS)

    Jung, Hyunuk; Kum, Oyeon; Han, Youngyih; Park, Byungdo; Cheong, Kwang-Ho

    2014-12-01

    For a better understanding of the accuracy of state-of-the-art-radiation therapies, 2-dimensional dosimetry in a patient-like environment will be helpful. Therefore, the dosimetry of EBT3 films in non-water-equivalent tissues was investigated, and the accuracy of commercially-used dose-calculation algorithms was evaluated with EBT3 measurement. Dose distributions were measured with EBT3 films for an in-house-designed phantom that contained a lung or a bone substitute, i.e., an air cavity (3 × 3 × 3 cm3) or teflon (2 × 2 × 2 cm3 or 3 × 3 × 3 cm3), respectively. The phantom was irradiated with 6-MV X-rays with field sizes of 2 × 2, 3 × 3, and 5 × 5 cm2. The accuracy of EBT3 dosimetry was evaluated by comparing the measured dose with the dose obtained from Monte Carlo (MC) simulations. A dose-to-bone-equivalent material was obtained by multiplying the EBT3 measurements by the stopping power ratio (SPR). The EBT3 measurements were then compared with the predictions from four algorithms: Monte Carlo (MC) in iPlan, acuros XB (AXB), analytical anisotropic algorithm (AAA) in Eclipse, and superposition-convolution (SC) in Pinnacle. For the air cavity, the EBT3 measurements agreed with the MC calculation to within 2% on average. For teflon, the EBT3 measurements differed by 9.297% (±0.9229%) on average from the Monte Carlo calculation before dose conversion, and by 0.717% (±0.6546%) after applying the SPR. The doses calculated by using the MC, AXB, AAA, and SC algorithms for the air cavity differed from the EBT3 measurements on average by 2.174, 2.863, 18.01, and 8.391%, respectively; for teflon, the average differences were 3.447, 4.113, 7.589, and 5.102%. The EBT3 measurements corrected with the SPR agreed with 2% on average both within and beyond the heterogeneities with MC results, thereby indicating that EBT3 dosimetry can be used in heterogeneous media. The MC and the AXB dose calculation algorithms exhibited clinically-acceptable accuracy (<5%) in

  16. Tunable deep ultraviolet single-longitudinal-mode laser generated with Ba(1-x)B(2-y-z)O4Si(x)Al(y)Ga(z) crystal.

    PubMed

    Wang, Rui; Teng, Hao; Wang, Nan; Han, Hainian; Wang, Zhaohua; Wei, Zhiyi; Hong, Maochun; Lin, Wenxiong

    2014-04-01

    We report a new nonlinear crystal, Ba(1-x)B(2-y-z)O4Si(x)Al(y)Ga(z), and employ it to a compact 1 kHz single-longitudinal-mode Ti:Sapphire master oscillator power amplifier system for fourth harmonic generation. A maximum output power of 130 mW is obtained in the tunable range of 195-205 nm with linewidth of less than 0.1 pm.

  17. Preparation and properties of a new ternary phase Mg3+xNi7-xB2 (0.17≤x≤0.66) and its Cu-doping effect

    NASA Astrophysics Data System (ADS)

    Liao, Chang-Zhong; Dong, Cheng; Shih, Kaimin; Zeng, Lingmin; He, Bing; Cao, Wenhuan; Yang, Lihong

    2015-03-01

    In recent years, the materials in the B-Mg-Ni system have been intensively studied due to their excellent properties of hydrogen storage and superconductivity. Solving the crystal structure of phases in this system will facilitate an understanding of the mechanism of their physical properties. In this study, we report the preparation, crystal structure and physical properties of a new ternary phase Mg3+xNi7-xB2 in the B-Mg-Ni system. The Mg3+xNi7-xB2 phase was prepared by solid-state reactions at 1073 K and its crystal structure was determined and refined using X-ray powder diffraction data. The Mg3+xNi7-xB2 phase crystallizes in the Ca3Ni7B2 structure type (space group R-3m, no. 166) with a=4.9496(3)-5.0105(6) Å, c=20.480(1)-20.581(1) Å depending on the x value, where x varies from 0.17 to 0.66. Two samples with nominal compositions Mg10Ni20B6 and Mg12Ni18B6 were characterized by magnetization and electric resistivity measurements in the temperature range from 5 K to room temperature. Both samples exhibited metallic behavior and showed spin-glass-like behavior with a spin freezing temperature (Tf) around 33 K. A study of the Cu-doping effect showed that limited Cu content can be doped into the Mg3+xNi7-xB2 compound and Tf decreases as the Cu content increases.

  18. Competing anisotropies on 3d sub-lattice of YNi{sub 4–x}Co{sub x}B compounds

    SciTech Connect

    Caraballo Vivas, R. J.; Rocco, D. L.; Reis, M. S.; Caldeira, L.; Coelho, A. A.

    2014-08-14

    The magnetic anisotropy of 3d sub-lattices has an important rule on the overall magnetic properties of hard magnets. Intermetallics alloys with boron (R-Co/Ni-B, for instance) belong to those hard magnets family and are useful objects to help to understand the magnetic behavior of 3d sub-lattice, specially when the rare earth ions R do not have magnetic nature, like YCo{sub 4}B ferromagnetic material. Interestingly, YNi{sub 4}B is a paramagnetic material and Ni ions do not contribute to the magnetic anisotropy. We focused therefore our attention to YNi{sub 4–x}Co{sub x}B series, with x = 0, 1, 2, 3, and 4. The magnetic anisotropy of these compounds is deeper described using statistical and preferential models of Co occupation among the possible Wyckoff positions into the CeCo{sub 4}B type hexagonal structure. We found that the preferential model is the most suitable to explain the magnetization experimental data.

  19. Equivalent Longitudinal Area Distributions of the B-58 and XB-70-1 Airplanes for Use in Wave Drag and Sonic Boom Calculations

    NASA Technical Reports Server (NTRS)

    Tinetti, Ana F.; Maglieri, Domenic J.; Driver, Cornelius; Bobbitt, Percy J.

    2011-01-01

    A detailed geometric description, in wave drag format, has been developed for the Convair B-58 and North American XB-70-1 delta wing airplanes. These descriptions have been placed on electronic files, the contents of which are described in this paper They are intended for use in wave drag and sonic boom calculations. Included in the electronic file and in the present paper are photographs and 3-view drawings of the two airplanes, tabulated geometric descriptions of each vehicle and its components, and comparisons of the electronic file outputs with existing data. The comparisons include a pictorial of the two airplanes based on the present geometric descriptions, and cross-sectional area distributions for both the normal Mach cuts and oblique Mach cuts above and below the vehicles. Good correlation exists between the area distributions generated in the late 1950s and 1960s and the present files. The availability of these electronic files facilitates further validation of sonic boom prediction codes through the use of two existing data bases on these airplanes, which were acquired in the 1960s and have not been fully exploited.

  20. Quantum mechanically guided design of Co43Fe20Ta(5.5)X(31.5) (X=B, Si, P, S) metallic glasses.

    PubMed

    Hostert, C; Music, D; Bednarcik, J; Keckes, J; Schneider, J M

    2012-05-01

    A systematic ab initio molecular dynamics study was carried out to identify valence electron concentration and size induced changes on structure, elastic and magnetic properties for Co(43)Fe(20)Ta(5.5)X(31.5) (X=B, Si, P, S). Short range order, charge transfer and the bonding nature are analyzed by means of density of states, Bader decomposition and pair distribution function analysis. A clear trend of a decrease in density and bulk modulus as well as a weaker cohesion was observed as the valence electron concentration is increased by replacing B with Si and further with P and S. These changes may be understood based on increased interatomic distances, variations in coordination numbers and the electronic structure changes; as the valence electron concentration of X is increased the X bonding becomes more ionic, which disrupts the overall metallic interactions, leading to lower cohesion and stiffness. The highest magnetic moments for the transition metals are identified for X=S, despite the fact that the presence of X generally reduces the magnetic moment of Co. Furthermore, this study reveals an extended diagonal relationship between B and P within these amorphous alloys. Based on quantum mechanical data we identify composition induced changes in short range order, charge transfer and bonding nature and link them to density, elasticity and magnetism. The interplay between transition metal d band filling and s-d hybridization was identified to be a key materials design criterion.

  1. A 2.15 hr ORBITAL PERIOD FOR THE LOW-MASS X-RAY BINARY XB 1832-330 IN THE GLOBULAR CLUSTER NGC 6652

    SciTech Connect

    Engel, M. C.; Heinke, C. O.; Sivakoff, G. R.; Elshamouty, K. G.; Edmonds, P. D. E-mail: heinke@ualberta.ca

    2012-03-10

    We present a candidate orbital period for the low-mass X-ray binary (LMXB) XB 1832-330 in the globular cluster NGC 6652 using a 6.5 hr Gemini South observation of the optical counterpart of the system. Light curves in g' and r' for two LMXBs in the cluster, sources A and B in previous literature, were extracted and analyzed for periodicity using the ISIS image subtraction package. A clear sinusoidal modulation is evident in both of A's curves, of amplitude {approx}0.11 mag in g' and {approx}0.065 mag in r', while B's curves exhibit rapid flickering, of amplitude {approx}1 mag in g' and {approx}0.5 mag in r'. A Lomb-Scargle test revealed a 2.15 hr periodic variation in the magnitude of A with a false alarm probability less than 10{sup -11}, and no significant periodicity in the light curve for B. Though it is possible that saturated stars in the vicinity of our sources partially contaminated our signal, the identification of A's binary period is nonetheless robust.

  2. Performance of 19XB-2A Gas Turbine. 1; Effect of Pressure Ratio and Inlet Pressure on Turbine Performance for an Inlet Temperature of 800 degree R

    NASA Technical Reports Server (NTRS)

    Kohl, Robert C.; Larkin, Robert G.

    1946-01-01

    An investigation of the 19XB-2A gas turbine is being conducted at the Cleveland laboratory to determine the effect on turbine performance of various inlet pressures, inlet temperatures, pressure ratios, and wheel speeds. The engine of which this turbine is a component is designed to operate at an air flow of 30 pounds per second at a compressor rotor speed of 17,000 rpm at sea-level conditions. At these conditions the total-pressure ratio is 2.08 across the turbine and the turbine inlet total temperature is 2000 degrees R. Runs have been made with turbine inlet total pressures of 20, 30, 40, and 45 inches of mercury absolute for a constant total pressure ratio across the turbine of 2.40, the maximum value that could be obtained. Additional runs have been made with total pressure ratios of 1.50 and 2.00 at an inlet total pressure of 45 inches of mercury absolute. All runs were made with an inlet total temperature of 800 degrees R over a range of corrected turbine wheel speeds from 40 to 150 percent of the corrected speed at the design point. The turbine efficiencies at these conditions are presented.

  3. SWIFT REVEALS A ∼5.7 DAY SUPER-ORBITAL PERIOD IN THE M31 GLOBULAR CLUSTER X-RAY BINARY XB158

    SciTech Connect

    Barnard, R.; Garcia, M. R.; Murray, S. S.

    2015-03-01

    The M31 globular cluster X-ray binary XB158 (a.k.a. Bo 158) exhibits intensity dips on a 2.78 hr period in some observations, but not others. The short period suggests a low mass ratio, and an asymmetric, precessing disk due to additional tidal torques from the donor star since the disk crosses the 3:1 resonance. Previous theoretical three-dimensional smoothed particle hydrodynamical modeling suggested a super-orbital disk precession period 29 ± 1 times the orbital period, i.e., ∼81 ± 3 hr. We conducted a Swift monitoring campaign of 30 observations over ∼1 month in order to search for evidence of such a super-orbital period. Fitting the 0.3-10 keV Swift X-Ray Telescope luminosity light curve with a sinusoid yielded a period of 5.65 ± 0.05 days, and a >5σ improvement in χ{sup 2} over the best fit constant intensity model. A Lomb-Scargle periodogram revealed that periods of 5.4-5.8 days were detected at a >3σ level, with a peak at 5.6 days. We consider this strong evidence for a 5.65 day super-orbital period, ∼70% longer than the predicted period. The 0.3-10 keV luminosity varied by a factor of ∼5, consistent with variations seen in long-term monitoring from Chandra. We conclude that other X-ray binaries exhibiting similar long-term behavior are likely to also be X-ray binaries with low mass ratios and super-orbital periods.

  4. The electronic structure, mechanical and thermodynamic properties of Mo{sub 2}XB{sub 2} and MoX{sub 2}B{sub 4} (X = Fe, Co, Ni) ternary borides

    SciTech Connect

    He, TianWei; Jiang, YeHua E-mail: jfeng@seas.harvard.edu; Zhou, Rong; Feng, Jing E-mail: jfeng@seas.harvard.edu

    2015-08-21

    The mechanical properties, electronic structure and thermodynamic properties of the Mo{sub 2}XB{sub 2} and MoX{sub 2}B{sub 4} (X = Fe, Co, Ni) ternary borides were calculated by first-principles methods. The elastic constants show that these ternary borides are mechanically stable. Formation enthalpy of Mo{sub 2}XB{sub 2} and MoX{sub 2}B{sub 4} (X = Fe, Co, Ni) ternary borides are at the range of −118.09 kJ/mol to −40.14 kJ/mol. The electronic structures and chemical bonding characteristics are analyzed by the density of states. Mo{sub 2}FeB{sub 2} has the largest shear and Young's modulus because of its strong chemical bonding, and the values are 204.3 GPa and 500.3 GPa, respectively. MoCo{sub 2}B{sub 4} shows the lowest degree of anisotropy due to the lack of strong direction in the bonding. The Debye temperature of MoFe{sub 2}B{sub 4} is the largest among the six phases, which means that MoFe{sub 2}B{sub 4} possesses the best thermal conductivity. Enthalpy shows an approximately linear function of the temperature above 300 K. The entropy of these compounds increase rapidly when the temperature is below 450 K. The Gibbs free energy decreases with the increase in temperature. MoCo{sub 2}B{sub 4} has the lowest Gibbs free energy, which indicates the strongest formation ability in Mo{sub 2}XB{sub 2} and MoX{sub 2}B{sub 4} (X = Fe, Co, Ni) ternary borides.

  5. The performance of the progressive resolution optimizer (PRO) for RapidArc planning in targets with low-density media.

    PubMed

    Kan, Monica W K; Leung, Lucullus H T; Yu, Peter K N

    2013-01-01

    A new version of progressive resolution optimizer (PRO) with an option of air cavity correction has been implemented for RapidArc volumetric-modulated arc therapy (RA). The purpose of this study was to compare the performance of this new PRO with the use of air cavity correction option (PRO10_air) against the one without the use of the air cavity correction option (PRO10_no-air) for RapidArc planning in targets with low-density media of different sizes and complexities. The performance of PRO10_no-air and PRO10_air was initially compared using single-arc plans created for four different simple heterogeneous phantoms with virtual targets and organs at risk. Multiple-arc planning of 12 real patients having nasopharyngeal carcinomas (NPC) and ten patients having non-small cell lung cancer (NSCLC) were then performed using the above two options for further comparison. Dose calculations were performed using both the Acuros XB (AXB) algorithm with the dose to medium option and the analytical anisotropic algorithm (AAA). The effect of using intermediate dose option after the first optimization cycle in PRO10_air and PRO10_no-air was also investigated and compared. Plans were evaluated and compared using target dose coverage, critical organ sparing, conformity index, and dose homogeneity index. For NSCLC cases or cases for which large volumes of low-density media were present in or adjacent to the target volume, the use of the air cavity correction option in PRO10 was shown to be beneficial. For NPC cases or cases for which small volumes of both low- and high-density media existed in the target volume, the use of air cavity correction in PRO10 did not improve the plan quality. Based on the AXB dose calculation results, the use of PRO10_air could produce up to 18% less coverage to the bony structures of the planning target volumes for NPC cases. When the intermediate dose option in PRO10 was used, there was negligible difference observed in plan quality between

  6. Wind-tunnel/flight correlation study of aerodynamic characteristics of a large flexible supersonic cruise airplane (XB-70-1). 3: A comparison between characteristics predicted from wind-tunnel measurements and those measured in flight

    NASA Technical Reports Server (NTRS)

    Arnaiz, H. H.; Peterson, J. B., Jr.; Daugherty, J. C.

    1980-01-01

    A program was undertaken by NASA to evaluate the accuracy of a method for predicting the aerodynamic characteristics of large supersonic cruise airplanes. This program compared predicted and flight-measured lift, drag, angle of attack, and control surface deflection for the XB-70-1 airplane for 14 flight conditions with a Mach number range from 0.76 to 2.56. The predictions were derived from the wind-tunnel test data of a 0.03-scale model of the XB-70-1 airplane fabricated to represent the aeroelastically deformed shape at a 2.5 Mach number cruise condition. Corrections for shape variations at the other Mach numbers were included in the prediction. For most cases, differences between predicted and measured values were within the accuracy of the comparison. However, there were significant differences at transonic Mach numbers. At a Mach number of 1.06 differences were as large as 27 percent in the drag coefficients and 20 deg in the elevator deflections. A brief analysis indicated that a significant part of the difference between drag coefficients was due to the incorrect prediction of the control surface deflection required to trim the airplane.

  7. Synthesis and characterizations of water-based ferrofluids of substituted ferrites [Fe 1-xB xFe 2O 4, B=Mn, Co ( x=0-1)] for biomedical applications

    NASA Astrophysics Data System (ADS)

    Giri, Jyotsnendu; Pradhan, Pallab; Somani, Vaibhav; Chelawat, Hitesh; Chhatre, Shreerang; Banerjee, Rinti; Bahadur, Dhirendra

    Nanomagnetic particles have great potential in the biomedical applications like MRI contrast enhancement, magnetic separation, targeting delivery and hyperthermia. In this paper, we have explored the possibility of biomedical applications of [Fe 1-xB xFe 2O 4, B=Mn, Co] ferrite. Superparamagnetic particles of substituted ferrites [Fe 1-xB xFe 2O 4, B=Mn, Co ( x=0-1)] and their fatty acid coated water base ferrofluids have been successfully prepared by co-precipitation technique using NH4OH/TMAH (Tetramethylammonium hydroxide) as base. In vitro cytocompatibility study of different magnetic fluids was done using HeLa (human cervical carcinoma) cell lines. Co 2+-substituted ferrite systems (e.g. CoFe 2O 4) is more toxic than Mn 2+-substituted ferrite systems (e.g. MnFe 2O 4, Fe 0.6Mn 0.4Fe 2O 4). The later is as cytocompatible as Fe 3O 4. Thus, Fe 1-xMn xFe 2O 4 could be useful in biomedical applications like MRI contrast agent and hyperthermia treatment of cancer.

  8. Sol-gel preparation of boron-containing cordierite Mg{sub 2}(Al{sub 4-x}B {sub x})Si{sub 5}O{sub 18} and its crystallization

    SciTech Connect

    Hamzawy, Esmat M.A. . E-mail: ehamzawy@lycos.com; Ali, Ashraf F.

    2006-12-15

    Five cordierite-based powders were investigated regarding their thermal and crystallization behaviors. The powders were obtained from amorphous gels having nominal compositions of 2Mg : xAl : (4 - x)B : 5Si where x = 4 down to 0. Thermal gravimetry analysis of the dry gels showed some absorbed water and decomposition of organic ligands in addition to network condensation. Gradual substitution of B for Al in the dried gel powders showed a new band in their infrared spectra corresponding to triangular BO{sub 3}, whereas the bands corresponding to Al vanished. This also showed a noticeable effect on the crystallization trends, type and stability of cordierite. Cordierite crystallized in samples of B/Al ratio up to 1 while protoenstatite predominated in samples of higher B/Al ratios. In addition, some silica minerals, with little amorphous phase, were formed. Incorporation of boron and increase in temperature enhanced the transformation of {gamma} cordierite to its {alpha} form.

  9. A theoretical investigation of mixing thermodynamics, age-hardening potential, and electronic structure of ternary M11-xM2xB2 alloys with AlB2 type structure

    NASA Astrophysics Data System (ADS)

    Alling, B.; Högberg, H.; Armiento, R.; Rosen, J.; Hultman, L.

    2015-05-01

    Transition metal diborides are ceramic materials with potential applications as hard protective thin films and electrical contact materials. We investigate the possibility to obtain age hardening through isostructural clustering, including spinodal decomposition, or ordering-induced precipitation in ternary diboride alloys. By means of first-principles mixing thermodynamics calculations, 45 ternary M11-xM2xB2 alloys comprising MiB2 (Mi = Mg, Al, Sc, Y, Ti, Zr, Hf, V, Nb, Ta) with AlB2 type structure are studied. In particular Al1-xTixB2 is found to be of interest for coherent isostructural decomposition with a strong driving force for phase separation, while having almost concentration independent a and c lattice parameters. The results are explained by revealing the nature of the electronic structure in these alloys, and in particular, the origin of the pseudogap at EF in TiB2, ZrB2, and HfB2.

  10. Effects of the substitution of P2O5 by B2O3 on the structure and dielectric properties in (90-x) P2O5-xB2O3-10Fe2O3 glasses.

    PubMed

    Sdiri, N; Elhouichet, H; Dhaou, H; Mokhtar, F

    2014-01-01

    90%[xB2O3 (1-x) P2O5] 10%Fe2O3, glass systems where (x=0 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%) was prepared via a melt quenching technique. The structure of glass is investigated at room temperature by, Raman and EPR spectroscopy. Raman studies have been performed on these glasses to examine the distribution of different borate and phosphate structural groups. We have noted an increase from 3 to 4 in the coordination number of the boron atoms from 3 to 4, i.e., the conversion of the BO3 triangular structural units into BO4 tetrahedra. The samples have been investigated by means of electron paramagnetic resonance (EPR). The results obtained from the gef=4.28 EPR line are typical of the occurrence of iron (III) occupying substitutional sites. Moreover, the dielectric sizes such as ε'(ω), ε″(ω), imaginary parts of the electrical modulus, M(*)(ω) and the loss tanδ, their variation with frequency at room temperature show a decrease in relaxation intensity with an increase in the concentration of (B2O3). On the present work, we have found a weak extinction index with our new glass.

  11. A theoretical investigation of mixing thermodynamics, age-hardening potential, and electronic structure of ternary M11–xM2xB2 alloys with AlB2 type structure

    PubMed Central

    Alling, B.; Högberg, H.; Armiento, R.; Rosen, J.; Hultman, L.

    2015-01-01

    Transition metal diborides are ceramic materials with potential applications as hard protective thin films and electrical contact materials. We investigate the possibility to obtain age hardening through isostructural clustering, including spinodal decomposition, or ordering-induced precipitation in ternary diboride alloys. By means of first-principles mixing thermodynamics calculations, 45 ternary M11–xM2xB2 alloys comprising MiB2 (Mi = Mg, Al, Sc, Y, Ti, Zr, Hf, V, Nb, Ta) with AlB2 type structure are studied. In particular Al1–xTixB2 is found to be of interest for coherent isostructural decomposition with a strong driving force for phase separation, while having almost concentration independent a and c lattice parameters. The results are explained by revealing the nature of the electronic structure in these alloys, and in particular, the origin of the pseudogap at EF in TiB2, ZrB2, and HfB2. PMID:25970763

  12. Observation of e+e- → π+π-π(0)(χbJ) and Search for X(b) → ωϒ(1S) at sqrt[s] = 10.867 GeV.

    PubMed

    He, X H; Shen, C P; Yuan, C Z; Ban, Y; Abdesselam, A; Adachi, I; Aihara, H; Asner, D M; Aulchenko, V; Aushev, T; Ayad, R; Bahinipati, S; Bakich, A M; Bansal, V; Bhuyan, B; Bondar, A; Bonvicini, G; Bozek, A; Bračko, M; Browder, T E; Cervenkov, D; Chang, P; Chekelian, V; Chen, A; Cheon, B G; Chilikin, K; Chistov, R; Cho, K; Chobanova, V; Choi, S-K; Choi, Y; Cinabro, D; Dalseno, J; Danilov, M; Doležal, Z; Drásal, Z; Drutskoy, A; Eidelman, S; Farhat, H; Fast, J E; Ferber, T; Gaur, V; Gabyshev, N; Ganguly, S; Garmash, A; Gillard, R; Glattauer, R; Goh, Y M; Grzymkowska, O; Haba, J; Hayasaka, K; Hayashii, H; Hou, W-S; Iijima, T; Ishikawa, A; Itoh, R; Iwasaki, Y; Jaegle, I; Joo, K K; Julius, T; Kato, E; Kawasaki, T; Kim, D Y; Kim, M J; Kim, Y J; Kinoshita, K; Ko, B R; Kodyš, P; Korpar, S; Križan, P; Krokovny, P; Kumita, T; Kuzmin, A; Kwon, Y-J; Lange, J S; Li, Y; Libby, J; Liventsev, D; Matvienko, D; Miyabayashi, K; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Mussa, R; Nakano, E; Nakao, M; Nakazawa, H; Nanut, T; Natkaniec, Z; Nedelkovska, E; Nisar, N K; Nishida, S; Ogawa, S; Okuno, S; Pakhlov, P; Pakhlova, G; Park, H; Pedlar, T K; Pestotnik, R; Petrič, M; Piilonen, L E; Ritter, M; Rostomyan, A; Sakai, Y; Sandilya, S; Santelj, L; Sanuki, T; Sato, Y; Savinov, V; Schneider, O; Schnell, G; Schwanda, C; Semmler, D; Senyo, K; Sevior, M E; Shebalin, V; Shibata, T-A; Shiu, J-G; Shwartz, B; Sibidanov, A; Simon, F; Sohn, Y-S; Sokolov, A; Solovieva, E; Starič, M; Steder, M; Sumisawa, K; Sumiyoshi, T; Tamponi, U; Tanida, K; Tatishvili, G; Teramoto, Y; Thorne, F; Trabelsi, K; Uchida, M; Uehara, S; Uglov, T; Unno, Y; Uno, S; Urquijo, P; Vahsen, S E; Van Hulse, C; Vanhoefer, P; Varner, G; Vinokurova, A; Vorobyev, V; Wagner, M N; Wang, C H; Wang, M-Z; Wang, P; Wang, X L; Watanabe, M; Watanabe, Y; Wehle, S; Williams, K M; Won, E; Yamaoka, J; Yashchenko, S; Yook, Y; Yusa, Y; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A

    2014-10-01

    The e(+)e(-) → π(+)π(-)π(0)χ(bJ) (J = 0,1,2) processes are studied using a 118 fb(-1) data sample acquired with the Belle detector at a center-of-mass energy of 10.867 GeV. Unambiguous π(+)π(-)π(0)χ(bJ) (J = 1,2), ωχ(b1) signals are observed, and indication for ωχ(b2) is seen, both for the first time, and the corresponding cross section measurements are presented. No significant π(+)π(-)π(0)χ(b0) or ωχ(b0) signals are observed, and 90% confidence level upper limits on the cross sections for these two processes are obtained. In the π(+)π(-)π(0) invariant mass spectrum, significant non-ω signals are also observed. We search for the X(3872)-like state (named X(b)) decaying into ωϒ(1S); no significant signal is observed with a mass between 10.55 and 10.65 GeV/c(2). PMID:25325633

  13. A theoretical investigation of mixing thermodynamics, age-hardening potential, and electronic structure of ternary M(1)1-x M(2)xB2 alloys with AlB2 type structure.

    PubMed

    Alling, B; Högberg, H; Armiento, R; Rosen, J; Hultman, L

    2015-05-13

    Transition metal diborides are ceramic materials with potential applications as hard protective thin films and electrical contact materials. We investigate the possibility to obtain age hardening through isostructural clustering, including spinodal decomposition, or ordering-induced precipitation in ternary diboride alloys. By means of first-principles mixing thermodynamics calculations, 45 ternary M(1)1-x M(2)xB2 alloys comprising M(i)B2 (M(i) = Mg, Al, Sc, Y, Ti, Zr, Hf, V, Nb, Ta) with AlB2 type structure are studied. In particular Al1-xTixB2 is found to be of interest for coherent isostructural decomposition with a strong driving force for phase separation, while having almost concentration independent a and c lattice parameters. The results are explained by revealing the nature of the electronic structure in these alloys, and in particular, the origin of the pseudogap at EF in TiB2, ZrB2, and HfB2.

  14. Comparative evaluation of modern dosimetry techniques near low- and high-density heterogeneities.

    PubMed

    Alhakeem, Eyad A; AlShaikh, Sami; Rosenfeld, Anatoly B; Zavgorodni, Sergei F

    2015-01-01

    The purpose of this study is to compare performance of several dosimetric meth-ods in heterogeneous phantoms irradiated by 6 and 18 MV beams. Monte Carlo (MC) calculations were used, along with two versions of Acuros XB, anisotropic analytical algorithm (AAA), EBT2 film, and MOSkin dosimeters. Percent depth doses (PDD) were calculated and measured in three heterogeneous phantoms. The first two phantoms were a 30 × 30 × 30 cm3 solid-water slab that had an air-gap of 20× 2.5 × 2.35 cm3. The third phantom consisted of 30 × 30 × 5 cm3 solid water slabs, two 30 × 30 × 5 cm3 slabs of lung, and one 30 × 30 × 1 cm3 solid water slab. Acuros XB, AAA, and MC calculations were within 1% in the regions with particle equilibrium. At media interfaces and buildup regions, differences between Acuros XB and MC were in the range of +4.4% to -12.8%. MOSkin and EBT2 measurements agreed to MC calculations within ~ 2.5%, except for the first cen-timeter of buildup where differences of 4.5% were observed. AAA did not predict the backscatter dose from the high-density heterogeneity. For the third, multilayer lung phantom, 6 MV beam PDDs calculated by all TPS algorithms were within 2% of MC. 18 MV PDDs calculated by two versions of Acuros XB and AAA differed from MC by up to 2.8%, 3.2%, and 6.8%, respectively. MOSkin and EBT2 each differed from MC by up to 2.9% and 2.5% for the 6 MV, and by -3.1% and ~2% for the 18 MV beams. All dosimetric techniques, except AAA, agreed within 3% in the regions with particle equilibrium. Differences between the dosimetric techniques were larger for the 18 MV than the 6 MV beam. MOSkin and EBT2 measurements were in a better agreement with MC than Acuros XB calculations at the interfaces, and they were in a better agreement to each other than to MC. The latter is due to their thinner detection layers compared to MC voxel sizes. PMID:26699322

  15. In vivo verification of radiation dose delivered to healthy tissue during radiotherapy for breast cancer

    NASA Astrophysics Data System (ADS)

    Lonski, P.; Taylor, M. L.; Hackworth, W.; Phipps, A.; Franich, R. D.; Kron, T.

    2014-03-01

    Different treatment planning system (TPS) algorithms calculate radiation dose in different ways. This work compares measurements made in vivo to the dose calculated at out-of-field locations using three different commercially available algorithms in the Eclipse treatment planning system. LiF: Mg, Cu, P thermoluminescent dosimeter (TLD) chips were placed with 1 cm build-up at six locations on the contralateral side of 5 patients undergoing radiotherapy for breast cancer. TLD readings were compared to calculations of Pencil Beam Convolution (PBC), Anisotropic Analytical Algorithm (AAA) and Acuros XB (XB). AAA predicted zero dose at points beyond 16 cm from the field edge. In the same region PBC returned an unrealistically constant result independent of distance and XB showed good agreement to measured data although consistently underestimated by ~0.1 % of the prescription dose. At points closer to the field edge XB was the superior algorithm, exhibiting agreement with TLD results to within 15 % of measured dose. Both AAA and PBC showed mixed agreement, with overall discrepancies considerably greater than XB. While XB is certainly the preferable algorithm, it should be noted that TPS algorithms in general are not designed to calculate dose at peripheral locations and calculation results in such regions should be treated with caution.

  16. SU-F-BRD-15: The Impact of Dose Calculation Algorithm and Hounsfield Units Conversion Tables On Plan Dosimetry for Lung SBRT

    SciTech Connect

    Kuo, L; Yorke, E; Lim, S; Mechalakos, J; Rimner, A

    2014-06-15

    Purpose: To assess dosimetric differences in IMRT lung stereotactic body radiotherapy (SBRT) plans calculated with Varian AAA and Acuros (AXB) and with vendor-supplied (V) versus in-house (IH) measured Hounsfield units (HU) to mass and HU to electron density conversion tables. Methods: In-house conversion tables were measured using Gammex 472 density-plug phantom. IMRT plans (6 MV, Varian TrueBeam, 6–9 coplanar fields) meeting departmental coverage and normal tissue constraints were retrospectively generated for 10 lung SBRT cases using Eclipse Vn 10.0.28 AAA with in-house tables (AAA/IH). Using these monitor units and MLC sequences, plans were recalculated with AAA and vendor tables (AAA/V) and with AXB with both tables (AXB/IH and AXB/V). Ratios to corresponding AAA/IH values were calculated for PTV D95, D01, D99, mean-dose, total and ipsilateral lung V20 and chestwall V30. Statistical significance of differences was judged by Wilcoxon Signed Rank Test (p<0.05). Results: For HU<−400 the vendor HU-mass density table was notably below the IH table. PTV D95 ratios to AAA/IH, averaged over all patients, are 0.963±0.073 (p=0.508), 0.914±0.126 (p=0.011), and 0.998±0.001 (p=0.005) for AXB/IH, AXB/V and AAA/V respectively. Total lung V20 ratios are 1.006±0.046 (p=0.386), 0.975±0.080 (p=0.514) and 0.998±0.002 (p=0.007); ipsilateral lung V20 ratios are 1.008±0.041(p=0.284), 0.977±0.076 (p=0.443), and 0.998±0.018 (p=0.005) for AXB/IH, AXB/V and AAA/V respectively. In 7 cases, ratios to AAA/IH were within ± 5% for all indices studied. For 3 cases characterized by very low lung density and small PTV (19.99±8.09 c.c.), PTV D95 ratio for AXB/V ranged from 67.4% to 85.9%, AXB/IH D95 ratio ranged from 81.6% to 93.4%; there were large differences in other studied indices. Conclusion: For AXB users, careful attention to HU conversion tables is important, as they can significantly impact AXB (but not AAA) lung SBRT plans. Algorithm selection is also important for

  17. Synthesis, crystal structure investigation and magnetism of the complex metal-rich boride series Crx(Rh1-yRuy)7-xB3 (x=0.88-1; y=0-1) with Th7Fe3-type structure

    NASA Astrophysics Data System (ADS)

    Misse, Patrick R. N.; Mbarki, Mohammed; Fokwa, Boniface P. T.

    2012-08-01

    Powder samples and single crystals of the new complex boride series Crx(Rh1-yRuy)7-xB3 (x=0.88-1; y=0-1) have been synthesized by arc-melting the elements under purified argon atmosphere on a water-cooled copper crucible. The products, which have metallic luster, were structurally characterized by single-crystal and powder X-ray diffraction as well as EDX measurements. Within the whole solid solution range the hexagonal Th7Fe3 structure type (space group P63mc, no. 186, Z=2) was identified. Single-crystal structure refinement results indicate the presence of chromium at two sites (6c and 2b) of the available three metal Wyckoff sites, with a pronounced preference for the 6c site. An unexpected Rh/Ru site preference was found in the Ru-rich region only, leading to two different magnetic behaviors in the solid solution: The Rh-rich region shows a temperature-independent (Pauli) paramagnetism whereas an additional temperature-dependent paramagnetic component is found in the Ru-rich region.

  18. Small field segments surrounded by large areas only shielded by a multileaf collimator: Comparison of experiments and dose calculation

    SciTech Connect

    Kron, T.; Clivio, A.; Vanetti, E.; Nicolini, G.; Cramb, J.; Lonski, P.; Cozzi, L.; Fogliata, A.

    2012-12-15

    Purpose: Complex radiotherapy fields delivered using a tertiary multileaf collimator (MLC) often feature small open segments surrounded by large areas of the beam only shielded by the MLC. The aim of this study was to test the ability of two modern dose calculation algorithms to accurately calculate the dose in these fields which would be common, for example, in volumetric modulated arc treatment (VMAT) and study the impact of variations in dosimetric leaf gap (DLG), focal spot size, and MLC transmission in the beam models. Methods: Nine test fields with small fields (0.6-3 cm side length) surrounded by large MLC shielded areas (secondary collimator 12 Multiplication-Sign 12 cm{sup 2}) were created using a 6 MV beam from a Varian Clinac iX linear accelerator with 120 leaf MLC. Measurements of output factors and profiles were performed using a diamond detector (PTW) and compared to two dose calculations algorithms anisotropic analytical algorithm [(AAA) and Acuros XB] implemented on a commercial radiotherapy treatment planning system (Varian Eclipse 10). Results: Both calculation algorithms predicted output factors within 1% for field sizes larger than 1 Multiplication-Sign 1 cm{sup 2}. For smaller fields AAA tended to underestimate the dose. Profiles were predicted well for all fields except for problems of Acuros XB to model the secondary penumbra between MLC shielded fields and the secondary collimator. A focal spot size of 1 mm or less, DLG 1.4 mm and MLC transmission of 1.4% provided a generally good model for our experimental setup. Conclusions: AAA and Acuros XB were found to predict the dose under small MLC defined field segments well. While DLG and focal spot affect mostly the penumbra, the choice of correct MLC transmission will be essential to model treatments such as VMAT accurately.

  19. 77 FR 70147 - Fish and Wildlife Service 0648-XB088

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-23

    ... following locations: 1. Social Sciences Resource Center, Green Library, Room 121, Stanford, CA 94305. 2. Palo Alto Main Library, 1213 Newell Road, Palo Alto, CA 94303. Individuals wishing to obtain copies of... categories of activities: Water management; creek maintenance; academic activities; utility installation...

  20. Peaks, plateaus, numerical instabilities, and achievable accuracy in Galerkin and norm minimizing procedures for solving Ax=b

    SciTech Connect

    Cullum, J.

    1994-12-31

    Plots of the residual norms generated by Galerkin procedures for solving Ax = b often exhibit strings of irregular peaks. At seemingly erratic stages in the iterations, peaks appear in the residual norm plot, intervals of iterations over which the norms initially increase and then decrease. Plots of the residual norms generated by related norm minimizing procedures often exhibit long plateaus, sequences of iterations over which reductions in the size of the residual norm are unacceptably small. In an earlier paper the author discussed and derived relationships between such peaks and plateaus within corresponding Galerkin/Norm Minimizing pairs of such methods. In this paper, through a set of numerical experiments, the author examines connections between peaks, plateaus, numerical instabilities, and the achievable accuracy for such pairs of iterative methods. Three pairs of methods, GMRES/Arnoldi, QMR/BCG, and two bidiagonalization methods are studied.

  1. Sci—Thur AM: YIS - 05: 10X-FFF VMAT for Lung SABR: an Investigation of Peripheral Dose

    SciTech Connect

    Mader, J; Mestrovic, A

    2014-08-15

    Flattening Filter Free (FFF) beams exhibit high dose rates, reduced head scatter, leaf transmission and leakage radiation. For VMAT lung SABR, treatment time can be significantly reduced using high dose rate FFF beams while maintaining plan quality and accuracy. Another possible advantage offered by FFF beams for VMAT lung SABR is the reduction in peripheral dose. The focus of this study was to investigate and quantify the reduction of peripheral dose offered by FFF beams for VMAT lung SABR. The peripheral doses delivered by VMAT Lung SABR treatments using FFF and flattened beams were investigated for the Varian Truebeam linac. This study was conducted in three stages, (1): ion chamber measurement of peripheral dose for various plans, (2): validation of AAA, Acuros XB and Monte Carlo for peripheral dose using measured data, and (3): using the validated Monte Carlo model to evaluate peripheral doses for 6 VMAT lung SABR treatments. Three energies, 6X, 10X, and 10X-FFF were used for all stages. Measured data indicates that 10X-FFF delivers the lowest peripheral dose of the three energies studied. AAA and Acuros XB dose calculation algorithms were identified as inadequate, and Monte Carlo was validated for accurate peripheral dose prediction. The Monte Carlo-calculated VMAT lung SABR plans show a significant reduction in peripheral dose for 10X-FFF plans compared to the standard 6X plans, while no significant reduction was showed when compared to 10X. This reduction combined with shorter treatment time makes 10X-FFF beams the optimal choice for superior VMAT lung SABR treatments.

  2. Project W-314 specific test and evaluation plan for transfer line SN-633 (241-AX-B to 241-AY-02A)

    SciTech Connect

    Hays, W.H.

    1998-03-20

    The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system`s performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation.

  3. Kinetic simulations of X-B and O-X-B mode conversion

    NASA Astrophysics Data System (ADS)

    Arefiev, A.; Du Toit, E. J.; Kohn, A.; Holzhauer, E.; Shevchenko, V. F.; Vann, R. G. L.

    2015-11-01

    High-performance spherical tokamaks are usually overdense (typically ωpe /ωce 4 in the core) and so regular electron cyclotron emission is blocked. However, electron Bernstein waves, generated at the local cyclotron frequency (and its harmonics) in the core may be observed outside the plasma via a mode conversion process that takes place typically in the plasma edge between an electromagnetic mode and the (electrostatic) electron Bernstein wave. Understanding the details of this mode conversion process is important in tokamaks with over-dense plasmas both for the interpretation of microwave diagnostic data and to assess the feasibility of EBW heating and/or current drive. To this end, we have performed the first ever 2-D fully-kinetic simulations of O-X-B mode conversion using the particle-in-cell code EPOCH. In addition to benchmarking these numerical results against the linear dispersion relation, we have also investigated nonlinearities associated with a larger incident intensity and the effect of a steeper (and more realistic) density gradient at the mode conversion layer. Simulations were performed on the HELIOS supercomputer at the IFERC-CSC, Rokkasho, Japan and on TACC supercomputers at the University of Texas at Austin.

  4. Exclusive xB5+Np topologies with ArgoNeuT

    NASA Astrophysics Data System (ADS)

    Partyka, Kinga

    2015-05-01

    The Argon Neutrino Test, ArgoNeuT, is a small scale Liquid Argon Time Projection Chamber (LAr TPC) that is one step towards the construction of large scale LAr TPCs for long-baseline neutrino physics. LArTPCs provide bubble-chamber-like quality images for excellent particle ID and background rejection. Due to its superb capabilities it is well suited for topological analysis by reporting what it sees in a final state. Preliminary analysis of ArgoNeuT's 0.1 to 10 GeV neutrino µ+Np topologies together with first ever study of proton multiplicities in neutrino-argon interactions was presented and compared with GENIE Monte Carlo generator.

  5. Comparison of Dosimetric Performance among Commercial Quality Assurance Systems for Verifying Pretreatment Plans of Stereotactic Body Radiotherapy Using Flattening-Filter-Free Beams

    PubMed Central

    2016-01-01

    The purpose of this study was to compare the performance of different commercial quality assurance (QA) systems for the pretreatment verification plan of stereotactic body radiotherapy (SBRT) with volumetric arc therapy (VMAT) technique using a flattening-filter-free beam. The verification for 20 pretreatment cancer patients (seven lung, six spine, and seven prostate cancers) were tested using three QA systems (EBT3 film, I’mRT MatriXX array, and MapCHECK). All the SBRT-VMAT plans were optimized in the Eclipse (version 11.0.34) treatment planning system (TPS) using the Acuros XB dose calculation algorithm and were delivered to the Varian TrueBeam® accelerator equipped with a high-definition multileaf collimator. Gamma agreement evaluation was analyzed with the criteria of 2% dose difference and 2 mm distance to agreement (2%/2 mm) or 3%/3 mm. The highest passing rate (99.1% for 3%/3 mm) was observed on the MapCHECK system while the lowest passing rate was obtained on the film. The pretreatment verification results depend on the QA systems, treatment sites, and delivery beam energies. However, the delivery QA results for all QA systems based on the TPS calculation showed a good agreement of more than 90% for both the criteria. It is concluded that the three 2D QA systems have sufficient potential for pretreatment verification of the SBRT-VMAT plan. PMID:27709851

  6. A Review on the Use of Grid-Based Boltzmann Equation Solvers for Dose Calculation in External Photon Beam Treatment Planning

    PubMed Central

    Kan, Monica W. K.; Yu, Peter K. N.; Leung, Lucullus H. T.

    2013-01-01

    Deterministic linear Boltzmann transport equation (D-LBTE) solvers have recently been developed, and one of the latest available software codes, Acuros XB, has been implemented in a commercial treatment planning system for radiotherapy photon beam dose calculation. One of the major limitations of most commercially available model-based algorithms for photon dose calculation is the ability to account for the effect of electron transport. This induces some errors in patient dose calculations, especially near heterogeneous interfaces between low and high density media such as tissue/lung interfaces. D-LBTE solvers have a high potential of producing accurate dose distributions in and near heterogeneous media in the human body. Extensive previous investigations have proved that D-LBTE solvers were able to produce comparable dose calculation accuracy as Monte Carlo methods with a reasonable speed good enough for clinical use. The current paper reviews the dosimetric evaluations of D-LBTE solvers for external beam photon radiotherapy. This content summarizes and discusses dosimetric validations for D-LBTE solvers in both homogeneous and heterogeneous media under different circumstances and also the clinical impact on various diseases due to the conversion of dose calculation from a conventional convolution/superposition algorithm to a recently released D-LBTE solver. PMID:24066294

  7. National dosimetric audit network finds discrepancies in AAA lung inhomogeneity corrections.

    PubMed

    Dunn, Leon; Lehmann, Joerg; Lye, Jessica; Kenny, John; Kron, Tomas; Alves, Andrew; Cole, Andrew; Zifodya, Jackson; Williams, Ivan

    2015-07-01

    This work presents the Australian Clinical Dosimetry Service's (ACDS) findings of an investigation of systematic discrepancies between treatment planning system (TPS) calculated and measured audit doses. Specifically, a comparison between the Anisotropic Analytic Algorithm (AAA) and other common dose-calculation algorithms in regions downstream (≥2cm) from low-density material in anthropomorphic and slab phantom geometries is presented. Two measurement setups involving rectilinear slab-phantoms (ACDS Level II audit) and anthropomorphic geometries (ACDS Level III audit) were used in conjunction with ion chamber (planar 2D array and Farmer-type) measurements. Measured doses were compared to calculated doses for a variety of cases, with and without the presence of inhomogeneities and beam-modifiers in 71 audits. Results demonstrate a systematic AAA underdose with an average discrepancy of 2.9 ± 1.2% when the AAA algorithm is implemented in regions distal from lung-tissue interfaces, when lateral beams are used with anthropomorphic phantoms. This systemic discrepancy was found for all Level III audits of facilities using the AAA algorithm. This discrepancy is not seen when identical measurements are compared for other common dose-calculation algorithms (average discrepancy -0.4 ± 1.7%), including the Acuros XB algorithm also available with the Eclipse TPS. For slab phantom geometries (Level II audits), with similar measurement points downstream from inhomogeneities this discrepancy is also not seen. PMID:25921329

  8. Generalized Pseudo-Unit-Cell model for long-wavelength optical phonons of multinary mixed crystals: application to A(x)B(1-x)C(y)D(1-y) type mixed crystals.

    PubMed

    Liao, Zhenfeng; Li, Jingzhen; Zheng, Ruisheng; Lu, Xiaowei; Chen, Hongyi

    2013-05-20

    Long-wavelength optical phonons in multinary mixed crystals are studied based on the Pseudo-Unit-Cell model. A unitary matrix method is developed to calculate the eigenfrequencies of optical phonons in multinary mixed crystals. The analytical expressions of oscillator strengths and dielectric constants of the multinary mixed crystals are obtained as a function of the phonon frequencies. The results indicate that the composition dependence of oscillator strengths shows clearly the phonon-mode behaviors of the mixed crystals. The theory and calculation method can be applied to any type of multinary mixed crystals. It is found that there is a composition independent point for the dielectric constant of quaternary mixed crystals.

  9. The pre-Mesozoic tectonic unit division of the Xing-Meng orogenic belt (XMOB)

    NASA Astrophysics Data System (ADS)

    Xu, Bei; Zhao, Pan

    2014-05-01

    According to the viewpoint that the paleo-Asian ocean closed by the end of early Paleozoic and extended during the late Paleozoic, a pre-Mesozoic tectonic unit division has been suggested. Five blocks and four sutures have been recognized in the pre-Devonia stage, the five blocks are called Erguna (EB), Xing'an (XB), Airgin Sum-Xilinhot (AXB), Songliao-Hunshandak (SHB) and Jiamusi (JB) blocks and four sutures, Xinlin-Xiguitu (XXS), Airgin Sum-Xilinhot-Heihe (AXHS), Ondor Sum-Jizhong-Yanji (OJYS) and Mudanjiang (MS) sutures. The EB contains the Precambrian base with the ages of 720-850Ma and ɛHf(T)=+2.5to +8.1. The XB is characterized by the Paleoproterozoic granitic gneiss with ɛHf(T)=-3.9 to -8.9. Several ages from 1150 to 1500 Ma bave been acquired in the AXB, proving presence of old block that links with Hutag Uul block in Mongolia to the west. The Paleoproterozoic (1.8-1.9Ga) and Neoproterozoic (750-850Ma) ages have been reported from southern and eastern parts of the SHB, respectively. As a small block in east margin of the XMOB, the JB outcrops magmatite and granitic gneiss bases with ages of 800-1000Ma. The XXS is marked by blueschists with zircon ages of 490-500Ma in Toudaoqiao village, ophiolites in Xiguitu County and granite with ages of about 500Ma along the northern segment of XXS. The AXHS is characterized by the early Paleozoic arc magmatic rocks with ages from 430Ma to 490Ma, mélange and the late Devonia molass basins, which indicates a northward subduction of the SHB beneath the AXB during the early-middle Paleozoic. The OJYS is composed of the early Paleozoic volcanic rocks, diorites and granites with ages of 425-475Ma, blueschists, ophiolitic mélange, the late Silurian flysch and Early-Middle Devonian molasses in western segment, granites (420-450Ma) in middle segment, and plagiogranites (443Ma) and the late Silurian molasses in eastern segment. This suture was caused by a southward subduction of the SHB beneath the North China block. The MS

  10. The clinical impact of detector choice for beam scanning.

    PubMed

    Gersh, Jacob A; Best, Ryan C M; Watts, Ronald J

    2014-07-08

    Recently, the developers of Eclipse have recommended the use of ionization chambers for all profile scanning, including for the modeling of VMAT and stereotactic applications. The purpose of this study is to show the clinical impact caused by the choice of detector with respect to its ability to accurately measure dose in the penumbra and tail regions of a scanned profile. Using scan data acquired with several detectors, including an IBA CC13, a PTW 60012, and a Sun Nuclear EDGE Detector, three complete beam models are created, one for each respective detector. Next, using each beam model, dose volumes are retrospectively recalculated from actual anonymous patient plans. These plans include three full-arc VMAT prostate plans, three left chest wall plans delivered using irregular compensators, two half-arc VMAT lung plans, three MLC-collimated static-field pairs, and two SBRT liver plans. Finally, plans are reweighted to deliver the same number of monitor units, and mean dose-to-target volumes and organs at risk are calculated and compared. Penumbra width did not play a role. Dose in the tail region of the profile made the largest difference. By overresponding in the tail region of the profile, the 60012 diode detector scan data affected the beam model in such a way that target doses were reduced by as much as 0.4% (in comparison to CC13 and EDGE data). This overresponse also resulted in an overestimation of dose to peripheral critical structure, whose dose consisted mainly of scatter. This study shows that, for modeling the 6 MV beam of Acuros XB in Eclipse Version 11, the choice to use a CC13 scanning ion chamber or an EDGE Detector was an unimportant choice, providing nearly identical models in the treatment planning system.

  11. Supplementary Free-Spinning-Tunnel Tests of a 1/16-Scale Model of the McDonnell XB-85 Airplane Equipped with a Conventional-Tail Arrangement

    NASA Technical Reports Server (NTRS)

    Klinar, Walter J.

    1947-01-01

    Spin tests have been conducted in the Langley free-spinning tunnel on a 1/16-scale model of the McDonnell XP-85 airplane with the normal X-tail replaced with a short-coupled conventional tail arrangement. The effect of the conventional tail arrangement and the effects of various modifications upon the spin and recovery characteristics of the model were determined. The results of the tests indicated that installation of the conventional tail arrangement wil not provide satisfactory recoveries from spins of the airplane. Satisfactory recoveries will be obtainable, however, either by installing in addition a very large ventral fin (17.94 sq ft, full-scale) below the tail or by decreasing the width of the fuselage and making it flat sided rearward of the wing trailing edge.

  12. Spectroscopic properties of Er3+/Yb3+ Co-doped zinc boro-tellurite glasses for 1.5 xB5m broadband optical amplifiers

    NASA Astrophysics Data System (ADS)

    Suthanthirakumar, P.; Karthikeyan, P.; Vijayakumar, R.; Marimuthu, K.

    2015-06-01

    A new series of Er3+/Yb3+ co-doped Zinc boro-tellurite glasses with the chemical composition (40-x-y)B2O3+ 25TeO2+20ZnO+15BaO+xYb2O3+yEr2O3 (where x = 0.1, 0.5, 1 and 3; y =1 in wt %) were prepared by melt quenching technique and their spectroscopic behavior were studied through UV-Vis-NIR absorption and NIR luminescence measurements. The bonding parameters (β ¯ and δ) and Judd-Ofelt (JO) intensity parameters Ωλ (λ=2, 4 and 6) have been calculated from the band positions of the absorption spectra. A broad near-infrared emission band at 1540 nm with a full width at half maximum around 80 nm was observed from the NIR luminescence spectra by monitoring an excitation at 980 nm. The absorption cross-section and emission cross-section for the4I13/2→4I15/2 transition of the Er3+ ions were also determined using McCumber theory and the results were discussed and reported.

  13. Low-temperature and high-pressure xB5SR study of the strongly correlated CeNiSn Hx compounds

    NASA Astrophysics Data System (ADS)

    Isnard, O.; Rusu, C.; Dudric, R.; Andreica, D.; Amato, A.; Chevalier, B.

    2016-06-01

    Hydrogen insertion in the CeNiSn Kondo semiconductor induces antiferromagnetic ordering for CeNiSnH below TN=4.5 K whereas CeNiSn H1.8 orders ferromagnetically below TC=7.0 K . We present a detailed investigation of these CeNiSn Hx compounds by means of muon spin spectroscopy performed at both ambient and high pressure (up to 23 kbar). It is shown that both magnetic ordering temperatures are sensitive to the applied pressure but in opposite directions, i.e., d/TC d p =-0.17 K kba r-1 for CeNiSn H1.8 and d/TN d p =0.016 K kba r-1 for CeNiSnH, respectively. This difference is discussed in terms of hydrogen-induced modification of the balance between the Ruderman-Kittel-Kasuya-Yosida (RKKY) and the Kondo interactions. The µSR study demonstrates that the CeNiSnH and CeNiSn H1.8 are on different sides of Doniach's dome. The behavior of the CeNiSn H1.8 is interpreted as resulting from an increase of the hybridization between 4 f and 5 d states and a concomitant steep increase of the Kondo temperature upon applying pressure. In the quest for a quantum critical point, an estimated pressure of about 35 kbar is expected to suppress the magnetism in CeNiSn H1.8 .

  14. Influence of upper hybrid resonance localized oscillation on X-B mode conversion efficiency for high-β National Spherical Torus Experiment in nonlinear regime

    NASA Astrophysics Data System (ADS)

    Abbasi, M.; Ali Asgarian, M.; Sobhanian, S.; Sadeghi, Y.

    2015-06-01

    Ever increasing needs and capabilities in high power radio frequency waves heating and current drive scenarios of present and future magnetic confined fusion plasmas motivate expansion of understanding for vast variety of ever upcoming nonlinearities in such levels of power. Among many motivating experiments, one of the most relevant and actively studied in the regime for electron Bernstein wave (EBW) heating is high-β National Spherical Torus Experiment. A very special type of large amplitude electron plasma oscillations known as localized upper hybrid (UH) mode is demonstrated. It is shown that the mutual synergetic interaction of EBW and the localized UH mode can significantly shift the resonance layer about △ x ˜ 0.9 mm compared to the prediction of linear theory and consequently can explain the considerable reduction of conversion value around 35% observed in our modelling. This reduction is due to scale up of density scale length, L n , at the new UH resonance (UHR) location followed by the increase of Budden parameter, η, which varies from 0.18 predicted by linear aspect to 0.40 in new position of UHR layer obtained by our modelling. Moreover, the parametric instabilities in the form of ion decays and dispersion of localized UH mode, approximately 7 mm due to the finite electron temperature account, are also observed which have an important contribution in reduction of conversion efficiency.

  15. Body and carcass composition of Angus and Charolais steers as affected by age and nutrition.

    PubMed

    Coleman, S W; Evans, B C; Guenther, J J

    1993-01-01

    The objectives of this study were to examine the effects of a low vs moderate rate of gain during the growing phase on empty body and carcass composition during finishing of Angus and Charolais steers of two ages. Forty-eight Angus and 48 Charolais steers that were either spring-born (OLDER) or fall-born (YOUNGER) were fed two diets (alfalfa pellets [CON] or cubed grass-alfalfa hay, wheat straw, cottonseed hulls, and soybean meal [RES]) for a growing period followed by a conventional feedlot period. The feedlot period started when the YOUNGER-CON steers weighed the same as the OLDER-RES steers. At that time, an interaction of age x diet occurred in empty body fat content (P < .10), whereas breed and age x diet affected carcass fat content (P < .01). OLDER-CON steers were larger (average 378 kg empty BW) and fatter than the other, smaller groups (average 222 kg). Angus carcasses were fatter than Charolais carcasses (P < .01). At the end of the finishing phase, compensating steers (OLDER-RES) had fatter carcasses than OLDER-CON steers. Empty body fat content was affected by a breed x age x diet interaction (P < .10). Allometric regressions (Y = aXb) of fat on empty BW indicated that empty body fat accretion was greater in Angus than in Charolais and in YOUNGER than in OLDER steers. A breed x age x diet interaction (P < .10) indicated that OLDER-Angus had higher fat accretive rates than YOUNGER-Angus, whereas OLDER-CON-Charolais steers deposited fat more slowly than the remaining groups. These data suggest that steers receiving feedlot diets at light weights, whether young in age or previously restricted, accumulate fat more rapidly than do larger steers. This feeding strategy may be an advantage in late-maturing types, but moderate growth through approximately 75% of slaughter weight is recommended for early-maturing types.

  16. A regression approach for estimation of anthropogenic heat flux based on a bottom-up air pollutant emission database

    NASA Astrophysics Data System (ADS)

    Lee, Sang-Hyun; McKeen, Stuart A.; Sailor, David J.

    2014-10-01

    A statistical regression method is presented for estimating hourly anthropogenic heat flux (AHF) using an anthropogenic pollutant emission inventory for use in mesoscale meteorological and air-quality modeling. Based on bottom-up AHF estimated from detailed energy consumption data and anthropogenic pollutant emissions of carbon monoxide (CO) and nitrogen oxides (NOx) in the US National Emission Inventory year 2005 (NEI-2005), a robust regression relation between the AHF and the pollutant emissions is obtained for Houston. This relation is a combination of two power functions (Y = aXb) relating CO and NOx emissions to AHF, giving a determinant coefficient (R2) of 0.72. The AHF for Houston derived from the regression relation has high temporal (R = 0.91) and spatial (R = 0.83) correlations with the bottom-up AHF. Hourly AHF for the whole US in summer is estimated by applying the regression relation to the NEI-2005 summer pollutant emissions with a high spatial resolution of 4-km. The summer daily mean AHF range 10-40 W m-2 on a 4 × 4 km2 grid scale with maximum heat fluxes of 50-140 W m-2 for major US cities. The AHFs derived from the regression relations between the bottom-up AHF and either CO or NOx emissions show a small difference of less than 5% (4.7 W m-2) in city-scale daily mean AHF, and similar R2 statistics, compared to results from their combination. Thus, emissions of either species can be used to estimate AHF in the US cities. An hourly AHF inventory at 4 × 4 km2 resolution over the entire US based on the combined regression is derived and made publicly available for use in mesoscale numerical modeling.

  17. Differences in absolute and relative growth between two shell forms of Pinna nobilis (Mollusca: Bivalvia) along the Tunisian coastline

    NASA Astrophysics Data System (ADS)

    Rabaoui, Lotfi; Tlig-Zouari, Sabiha; Katsanevakis, Stelios; Belgacem, Walid; Hassine, Oum Kalthoum Ben

    2011-08-01

    This study investigated the absolute and relative growth patterns of the fan mussel Pinna nobilis along the Tunisian coastline, taking into consideration both the variability among different areas and between the two shell forms "combed" and "straight and wide". Five subpopulations of the species were sampled, one from northern, two from eastern and two from southern Tunisia. Various assumptions on the growth patterns were tested based on an information theory approach and multi-model inference. For absolute growth, the assumption of different growth patterns between the two shell forms of P. nobilis and no difference among subpopulations was the most supported by the data. For the same age, "straight and wide" individuals gained on average greater lengths than the "combed" individuals. The absolute growth of the species was found to be asymptotic and the logistic model was the one most supported by the data. As for the relative growth, apart from the classical allometric model Y = aXb, more complicated models of the form ln Y = f(ln X) that either assumed non-linearities or breakpoints were tested in combination with assumptions for possible differences between the two forms and among subpopulations. Among the eight studied relationships between morphometric characters, the classical allometric model was supported in only two cases, while in all other cases more complicated models were supported. Moreover, the assumption of different growth patterns between the two forms was supported in three cases and the assumption of different growth patterns among subpopulations in four cases. Although precise relationships between the morphometric plasticity of the fan mussel and environmental factors have not been proven in this paper, local small scale constraints might be responsible of the different growth patterns observed in the same locality. A possible co-action of genetic factors should be evaluated in the future.

  18. Long and short photoperiod buds in hybrid aspen share structural development and expression patterns of marker genes

    PubMed Central

    Rinne, Päivi L.H.; Paul, Laju K.; Vahala, Jorma; Ruonala, Raili; Kangasjärvi, Jaakko; van der Schoot, Christiaan

    2015-01-01

    Tree architecture develops over time through the collective activity of apical and axillary meristems. Although the capacity of both meristems to form buds is crucial for perennial life, a comparative analysis is lacking. As shown here for hybrid aspen, axillary meristems engage in an elaborate process of axillary bud (AXB) formation, while apical dominance prevents outgrowth of branches. Development ceased when AXBs had formed an embryonic shoot (ES) with a predictable number of embryonic leaves at the bud maturation point (BMP). Under short days, terminal buds (TBs) formed an ES similar to that of AXBs, and both the TB and young AXBs above the BMP established dormancy. Quantitative PCR and in situ hybridizations showed that this shared ability and structural similarity was reflected at the molecular level. TBs and AXBs similarly regulated expression of meristem-specific and bud/branching-related genes, including CENTRORADIALIS-LIKE1 (CENL1), BRANCHED1 (BRC1), BRC2, and the strigolactone biosynthesis gene MORE AXILLARY BRANCHES1 (MAX1). Below the BMP, AXBs maintained high CENL1 expression at the rib meristem, suggesting that it serves to maintain poise for growth. In support of this, decapitation initiated outgrowth of CENL1-expressing AXBs, but not of dormant AXBs that had switched CENL1 off. This singles out CENL1 as a rib meristem marker for para-dormancy. BRC1 and MAX1 genes, which may counterbalance CENL1, were down-regulated in decapitation-activated AXBs. The results showed that removal of apical dominance shifted AXB gene expression toward that of apices, while developing TBs adopted the expression pattern of para-dormant AXBs. Bud development thus follows a shared developmental pattern at terminal and axillary positions, despite being triggered by short days and apical dominance, respectively. PMID:26248666

  19. Long and short photoperiod buds in hybrid aspen share structural development and expression patterns of marker genes.

    PubMed

    Rinne, Päivi L H; Paul, Laju K; Vahala, Jorma; Ruonala, Raili; Kangasjärvi, Jaakko; van der Schoot, Christiaan

    2015-11-01

    Tree architecture develops over time through the collective activity of apical and axillary meristems. Although the capacity of both meristems to form buds is crucial for perennial life, a comparative analysis is lacking. As shown here for hybrid aspen, axillary meristems engage in an elaborate process of axillary bud (AXB) formation, while apical dominance prevents outgrowth of branches. Development ceased when AXBs had formed an embryonic shoot (ES) with a predictable number of embryonic leaves at the bud maturation point (BMP). Under short days, terminal buds (TBs) formed an ES similar to that of AXBs, and both the TB and young AXBs above the BMP established dormancy. Quantitative PCR and in situ hybridizations showed that this shared ability and structural similarity was reflected at the molecular level. TBs and AXBs similarly regulated expression of meristem-specific and bud/branching-related genes, including CENTRORADIALIS-LIKE1 (CENL1), BRANCHED1 (BRC1), BRC2, and the strigolactone biosynthesis gene MORE AXILLARY BRANCHES1 (MAX1). Below the BMP, AXBs maintained high CENL1 expression at the rib meristem, suggesting that it serves to maintain poise for growth. In support of this, decapitation initiated outgrowth of CENL1-expressing AXBs, but not of dormant AXBs that had switched CENL1 off. This singles out CENL1 as a rib meristem marker for para-dormancy. BRC1 and MAX1 genes, which may counterbalance CENL1, were down-regulated in decapitation-activated AXBs. The results showed that removal of apical dominance shifted AXB gene expression toward that of apices, while developing TBs adopted the expression pattern of para-dormant AXBs. Bud development thus follows a shared developmental pattern at terminal and axillary positions, despite being triggered by short days and apical dominance, respectively.

  20. Study of Protein Haptenation by Amoxicillin Through the Use of a Biotinylated Antibiotic

    PubMed Central

    Ariza, Adriana; Collado, Daniel; Vida, Yolanda; Montañez, María I.; Pérez-Inestrosa, Ezequiel; Blanca, Miguel; Torres, María José; Cañada, F. Javier; Pérez-Sala, Dolores

    2014-01-01

    Allergic reactions towards β-lactam antibiotics pose an important clinical problem. The ability of small molecules, such as a β-lactams, to bind covalently to proteins, in a process known as haptenation, is considered necessary for induction of a specific immunological response. Identification of the proteins modified by β-lactams and elucidation of the relevance of this process in allergic reactions requires sensitive tools. Here we describe the preparation and characterization of a biotinylated amoxicillin analog (AX-B) as a tool for the study of protein haptenation by amoxicillin (AX). AX-B, obtained by the inclusion of a biotin moiety at the lateral chain of AX, showed a chemical reactivity identical to AX. Covalent modification of proteins by AX-B was reduced by excess AX and vice versa, suggesting competition for binding to the same targets. From an immunological point of view, AX and AX-B behaved similarly in RAST inhibition studies with sera of patients with non-selective allergy towards β-lactams, whereas, as expected, competition by AX-B was poorer with sera of AX-selective patients, which recognize AX lateral chain. Use of AX-B followed by biotin detection allowed the observation of human serum albumin (HSA) modification by concentrations 100-fold lower that when using AX followed by immunological detection. Incubation of human serum with AX-B led to the haptenation of all of the previously identified major AX targets. In addition, some new targets could be detected. Interestingly, AX-B allowed the detection of intracellular protein adducts, which showed a cell type-specific pattern. This opens the possibility of following the formation and fate of AX-B adducts in cells. Thus, AX-B may constitute a valuable tool for the identification of AX targets with high sensitivity as well as for the elucidation of the mechanisms involved in allergy towards β-lactams. PMID:24595455

  1. Comprehensive dosimetric planning comparison for early-stage, non-small cell lung cancer with SABR: fixed-beam IMRT versus VMAT versus TomoTherapy.

    PubMed

    Xhaferllari, Ilma; El-Sherif, Omar; Gaede, Stewart

    2016-09-08

    Volumetric-modulated arc therapy (VMAT) is emerging as a leading technology in treating early-stage, non-small cell lung cancer (NSCLC) with stereotactic ablative radiotherapy (SABR). However, two other modalities capable of deliver-ing intensity-modulated radiation therapy (IMRT) include fixed-beam and helical TomoTherapy (HT). This study aims to provide an extensive dosimetric compari-son among these various IMRT techniques for treating early-stage NSCLC with SABR. Ten early-stage NSCLC patients were retrospectively optimized using three fixed-beam techniques via nine to eleven beams (high and low modulation step-and-shoot (SS), and sliding window (SW)), two VMAT techniques via two partial arcs (SmartArc (SA) and RapidArc (RA)), and three HT techniques via three different fan beam widths (1 cm, 2.5 cm, and 5 cm) for 80 plans total. Fixed-beam and VMAT plans were generated using flattening filter-free beams. SS and SA, HT treatment plans, and SW and RA were optimized using Pinnacle v9.1, Tomoplan v.3.1.1, and Eclipse (Acuros XB v11.3 algorithm), respectively. Dose-volume histogram statistics, dose conformality, and treatment delivery efficiency were analyzed. VMAT treatment plans achieved significantly lower values for contralat-eral lung V5Gy (p ≤ 0.05) compared to the HT plans, and significantly lower mean lung dose (p < 0.006) compared to HT 5 cm treatment plans. In the comparison between the VMAT techniques, a significant reduction in the total monitor units (p = 0.05) was found in the SA plans, while a significant decrease was observed in the dose falloff parameter, D2cm, (p = 0.05), for the RA treatments. The maximum cord dose was significantly reduced (p = 0.017) in grouped RA&SA plans com-pared to SS. Estimated treatment time was significantly higher for HT and fixed-beam plans compared to RA&SA (p < 0.001). Although, a significant difference was not observed in the RA vs. SA (p = 0.393). RA&SA outperformed HT in all parameters measured. Despite an

  2. Comprehensive dosimetric planning comparison for early-stage, non-small cell lung cancer with SABR: fixed-beam IMRT versus VMAT versus TomoTherapy.

    PubMed

    Xhaferllari, Ilma; El-Sherif, Omar; Gaede, Stewart

    2016-01-01

    Volumetric-modulated arc therapy (VMAT) is emerging as a leading technology in treating early-stage, non-small cell lung cancer (NSCLC) with stereotactic ablative radiotherapy (SABR). However, two other modalities capable of deliver-ing intensity-modulated radiation therapy (IMRT) include fixed-beam and helical TomoTherapy (HT). This study aims to provide an extensive dosimetric compari-son among these various IMRT techniques for treating early-stage NSCLC with SABR. Ten early-stage NSCLC patients were retrospectively optimized using three fixed-beam techniques via nine to eleven beams (high and low modulation step-and-shoot (SS), and sliding window (SW)), two VMAT techniques via two partial arcs (SmartArc (SA) and RapidArc (RA)), and three HT techniques via three different fan beam widths (1 cm, 2.5 cm, and 5 cm) for 80 plans total. Fixed-beam and VMAT plans were generated using flattening filter-free beams. SS and SA, HT treatment plans, and SW and RA were optimized using Pinnacle v9.1, Tomoplan v.3.1.1, and Eclipse (Acuros XB v11.3 algorithm), respectively. Dose-volume histogram statistics, dose conformality, and treatment delivery efficiency were analyzed. VMAT treatment plans achieved significantly lower values for contralat-eral lung V5Gy (p ≤ 0.05) compared to the HT plans, and significantly lower mean lung dose (p < 0.006) compared to HT 5 cm treatment plans. In the comparison between the VMAT techniques, a significant reduction in the total monitor units (p = 0.05) was found in the SA plans, while a significant decrease was observed in the dose falloff parameter, D2cm, (p = 0.05), for the RA treatments. The maximum cord dose was significantly reduced (p = 0.017) in grouped RA&SA plans com-pared to SS. Estimated treatment time was significantly higher for HT and fixed-beam plans compared to RA&SA (p < 0.001). Although, a significant difference was not observed in the RA vs. SA (p = 0.393). RA&SA outperformed HT in all parameters measured. Despite an

  3. SU-E-J-113: The Influence of Optimizing Pediatric CT Simulator Protocols On the Treatment Dose Calculation in Radiotherapy

    SciTech Connect

    Zhang, Y; Zhang, J; Hu, Q; Tie, J; Wu, H; Deng, J

    2014-06-01

    Purpose: To investigate the possibility of applying optimized scanning protocols for pediatric CT simulation by quantifying the dosimetric inaccuracy introduced by using a fixed HU to density conversion. Methods: The images of a CIRS electron density reference phantom (Model 062) were acquired by a Siemens CT simulator (Sensation Open) using the following settings of tube voltage and beam current: 120 kV/190mA (the reference protocol used to calibrate CT for our treatment planning system (TPS)); Fixed 190mA combined with all available kV: 80, 100, and 140; fixed 120 kV and various current from 37 to 444 mA (scanner extremes) with interval of 30 mA. To avoid the HU uncertainty of point sampling in the various inserts of known electron densities, the mean CT numbers of the central cylindrical volume were calculated using DICOMan software. The doses per 100 MU to the reference point (SAD=100cm, Depth=10cm, Field=10X10cm, 6MV photon beam) in a virtual cubic phantom (30X30X30cm) were calculated using Eclipse TPS (calculation model: AcurosXB-11031) by assigning the CT numbers to HU of typical materials acquired by various protocols. Results: For the inserts of densities less than muscle, CT number fluctuations of all protocols were within the tolerance of 10 HU as accepted by AAPM-TG66. For more condensed materials, fixed kV yielded stable HU with any mA combination where largest disparities were found in 1750mg/cc insert: HU{sub reference}=1801(106.6cGy), HU{sub minimum}=1799 (106.6cGy, error{sub dose}=0.00%), HU{sub maximum}=1815 (106.8cGy, error{sub dose}=0.19%). Yet greater disagreements were observed with increasing density when kV was modified: HU{sub minimum}=1646 (104.5cGy, error{sub dose}=- 1.97%), HU{sub maximum}=2487 (116.4cGy, error{sub dose}=9.19%) in 1750mg/cc insert. Conclusion: Without affecting treatment dose calculation, personalized mA optimization of CT simulator can be conducted by fixing kV for a better cost-effectiveness of imaging dose and quality

  4. Comparative Genomics between Two Xenorhabdus bovienii Strains Highlights Differential Evolutionary Scenarios within an Entomopathogenic Bacterial Species

    PubMed Central

    Bisch, Gaëlle; Ogier, Jean-Claude; Médigue, Claudine; Rouy, Zoé; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2016-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Within Xenorhabdus bovienii species, the X. bovienii CS03 strain (Xb CS03) is nonvirulent when directly injected into lepidopteran insects, and displays a low virulence when associated with its Steinernema symbiont. The genome of Xb CS03 was sequenced and compared with the genome of a virulent strain, X. bovienii SS-2004 (Xb SS-2004). The genome size and content widely differed between the two strains. Indeed, Xb CS03 had a large genome containing several specific loci involved in the inhibition of competitors, including a few NRPS-PKS loci (nonribosomal peptide synthetases and polyketide synthases) producing antimicrobial molecules. Consistently, Xb CS03 had a greater antimicrobial activity than Xb SS-2004. The Xb CS03 strain contained more pseudogenes than Xb SS-2004. Decay of genes involved in the host invasion and exploitation (toxins, invasins, or extracellular enzymes) was particularly important in Xb CS03. This may provide an explanation for the nonvirulence of the strain when injected into an insect host. We suggest that Xb CS03 and Xb SS-2004 followed divergent evolutionary scenarios to cope with their peculiar life cycle. The fitness strategy of Xb CS03 would involve competitor inhibition, whereas Xb SS-2004 would quickly and efficiently kill the insect host. Hence, Xenorhabdus strains would have widely divergent host exploitation strategies, which impact their genome structure. PMID:26769959

  5. Scandium carbides/cyanides in the boron cage: computational prediction of X@B80 (X = Sc2C2, Sc3C2, Sc3CN and Sc3C2CN).

    PubMed

    Jin, Peng; Liu, Chang; Hou, Qinghua; Li, Lanlan; Tang, Chengchun; Chen, Zhongfang

    2016-08-01

    As the first study on metal carbide/cyanide boron clusterfullerenes, the geometries, energies, stabilities and electronic properties of four novel scandium cluster-containing B80 buckyball derivatives, namely Sc2C2@B80, Sc3C2@B80, Sc3CN@B80 and Sc3C2CN@B80, were investigated by means of density functional theory computations. The rather favorable binding energies, which are very close to those of the experimentally abundant carbon fullerene analogues, suggest a considerable possibility to realize these doped boron clusterfullerenes. Their intracluster and cluster-cage bonding natures were thoroughly revealed by various theoretical approaches. In contrast to carbon clusterfullerenes, in which the encaged non-metal atoms mainly play a stabilizing role in the metal clusters, the encapsulated carbon and nitrogen atoms inside the B80 cage covalently bond to the boron framework, resulting in strong cluster-cage interactions. Furthermore, infrared spectra and (11)B nuclear magnetic resonance spectra were simulated and fingerprint peaks were proposed to assist future experimental characterization.

  6. Scandium carbides/cyanides in the boron cage: computational prediction of X@B80 (X = Sc2C2, Sc3C2, Sc3CN and Sc3C2CN).

    PubMed

    Jin, Peng; Liu, Chang; Hou, Qinghua; Li, Lanlan; Tang, Chengchun; Chen, Zhongfang

    2016-08-01

    As the first study on metal carbide/cyanide boron clusterfullerenes, the geometries, energies, stabilities and electronic properties of four novel scandium cluster-containing B80 buckyball derivatives, namely Sc2C2@B80, Sc3C2@B80, Sc3CN@B80 and Sc3C2CN@B80, were investigated by means of density functional theory computations. The rather favorable binding energies, which are very close to those of the experimentally abundant carbon fullerene analogues, suggest a considerable possibility to realize these doped boron clusterfullerenes. Their intracluster and cluster-cage bonding natures were thoroughly revealed by various theoretical approaches. In contrast to carbon clusterfullerenes, in which the encaged non-metal atoms mainly play a stabilizing role in the metal clusters, the encapsulated carbon and nitrogen atoms inside the B80 cage covalently bond to the boron framework, resulting in strong cluster-cage interactions. Furthermore, infrared spectra and (11)B nuclear magnetic resonance spectra were simulated and fingerprint peaks were proposed to assist future experimental characterization. PMID:27424658

  7. Altitude-Wind-Tunnel Investigation of the 19B-2, 19B-8, and 19XB-1 Jet-Propulsion Engines. II - Analysis of Turbine Performance of the 19B-8 Engine

    NASA Technical Reports Server (NTRS)

    Krebs, Richard P.; Suozzi, Frank L.

    1947-01-01

    Performance characteristics of the turbine in the 19B-8 jet propulsion engine were determined from an investigation of the complete engine in the Cleveland altitude wind tunnel. The investigation covered a range of simulated altitudes from 5000 to 30,000 feet and flight Mach numbers from 0.05 to 0.46 for various tail-cone positions over the entire operable range of engine speeds. The characteristics of the turbine are presented as functions of the total-pressure ratio across the turbine and the turbine speed and the gas flow corrected to NACA standard atmospheric conditions at sea level. The effect of changes in altitude, flight Mach number, and tail-cone position on turbine performance is discussed. The turbine efficiency with the tail cone in varied from a maximum of 80.5 percent to minimum of 75 percent over a range of engine speeds from 7500 to 17,500 rpm at a flight Mach number of 0.055. Turbine efficiency was unaffected by changes in altitude up to 15,000 feet but was a function of tail-cone position and flight Mach number. Decreasing the tail-pipe-nozzle outlet area 21 percent reduced the turbine efficiency between 2 and 4.5 percent. The turbine efficiency increased between 1.5 and 3 percent as the flight Mach number changed from 0.055 to 0.297.

  8. Magnetic properties of the pseudo-binaries Np 1-xPu xB 2, extension of the Curie-Weiss model for di-magnetic solid solutions

    NASA Astrophysics Data System (ADS)

    Chipaux, R.; Blaise, A.; Fournier, J. M.

    1990-02-01

    Magnetic susceptibility measurements on NpB 2, PuB 2 and their solid-solutions are reported, and confirm the previously published Mössbauer spectroscopy investigations. Results on NpB 2 and PuB 2 are tentatively interpreted within a crystal field scheme. An extension of the Curie-Weiss model is proposed for the interpretation of results in the solid-solutions. A strong dependence of magnetic exchange interactions with interactinide smallest distances is observed, in good agreement with the general results on neptunium or plutonium compounds.

  9. Varian HDR surface applicators - commissioning and clinical implementation.

    PubMed

    Iftimia, Ileana; McKee, Andrea B; Halvorsen, Per H

    2016-01-01

    The purpose of this study was to validate the dosimetric performance of Varian surface applicators with the source vertically positioned and develop procedures for clinical implementation. The Varian surface applicators with the source vertically positioned provide a wide range of apertures making them clinically advantageous, though the steep dose gradient in the region of 3-4 mm prescription depth presents multiple challenges. The following commissioning tests were performed: 1) verification of functional integrity and physical dimensions; and 2) dosimetric measurements to validate data provided by Varian as well as data obtained using the Acuros algorithm for heterogeneity corrected dose calculation. A solid water (SW) phantom was scanned and the Acuros algorithm was used to compute the dose at 5 mm depth and at surface for all applicators. Two sets of reference dose measurements were performed, with the source positioned at (i) -10 mm and (ii) -15 mm from the center of the first nominal dwell position. Measurements were taken at 5 mm depth in a SW phantom and in air at the applicator surface. The results were then compared to the vendor's data and to the Acuros calculated dose. Relative dose measurements using Gafchromic films were taken at a depth of 4 mm in SW. Percent depth ionization (PDI) measurements using ion chamber were performed in SW. The profiles generated from film measurements and the PDI plots were compared with those computed using the Acuros algorithm and vendor's data, when available. Preliminary leakage tests were performed using optically stimulated luminescence dosimeters (OSLDs) and the results were compared with Acuros predictions. All applicators were found to be functional with physical dimensions within 1 mm of specifications. For scenario (ii) measurements taken in SW at 5 mm depth and in air at the surface of each applicator were within 10% and 4% agreement with vendor's data, respectively. Compared with Acuros predictions, these

  10. Electrochemical controlling and monitoring of halogen bond formation in solution.

    PubMed

    Groni, Sihem; Maby-Raud, Tanguy; Fave, Claire; Branca, Mathieu; Schöllhorn, Bernd

    2014-12-01

    Cyclic voltammetry has been used for the first time to probe and to control the formation of non-covalent halogen bonding (XB) via redox switching. These results strongly encourage the use of electrochemistry as an economical and precisely controllable tool for the investigation of XB in solution. PMID:25313384

  11. Electrochemical controlling and monitoring of halogen bond formation in solution.

    PubMed

    Groni, Sihem; Maby-Raud, Tanguy; Fave, Claire; Branca, Mathieu; Schöllhorn, Bernd

    2014-12-01

    Cyclic voltammetry has been used for the first time to probe and to control the formation of non-covalent halogen bonding (XB) via redox switching. These results strongly encourage the use of electrochemistry as an economical and precisely controllable tool for the investigation of XB in solution.

  12. Noise on, Voicing off: Speech Perception Deficits in Children with Specific Language Impairment

    ERIC Educational Resources Information Center

    Ziegler, Johannes C.; Pech-Georgel, Catherine; George, Florence; Lorenzi, Christian

    2011-01-01

    Speech perception of four phonetic categories (voicing, place, manner, and nasality) was investigated in children with specific language impairment (SLI) (n=20) and age-matched controls (n=19) in quiet and various noise conditions using an AXB two-alternative forced-choice paradigm. Children with SLI exhibited robust speech perception deficits in…

  13. N···I halogen bonding interactions: influence of Lewis bases on their strength and characters.

    PubMed

    Han, Na; Zeng, Yanli; Sun, Cuihong; Li, Xiaoyan; Sun, Zheng; Meng, Lingpeng

    2014-08-28

    Halogen bonding (XB) as an emerging noncovalent interaction, due to its highly directional and devisable properties, has given rise to considerable interest for constructing supramolecular assemblies. In this work, the newly developed density functional M06-2X calculations and the quantum theory of "atoms in molecules" (QTAIM) studies were carried out on a series of N···I halogen bonding to investigate the influence of Lewis bases (XB acceptors) on the XB. For the Lewis base C6-nH6-nNn (n = 1, 2, 3), with the increasing number of nitrogen atom in the aromatic ring, the most negative electrostatic potentials (VS, min) outside the nitrogen atom becomes less negative and the XB becomes weaker. The positive cooperativity exists in the Y(-)-C6H5N···C6F5I, Y(-)-C4H4N2···C6F5I, and Y(-)-C3H3N3···C6F5I (Y(-) = Cl(-), Br(-), I(-)) termolecular complexes: the H bond or anion-π interactions have the ability to enhance the N···I halogen bond and vice versa. With the addition of halogen anions to the XB acceptor, the XB become more covalent, more electronic charge transfer from the XB acceptors to donors, the XB acceptors become more energetically stabilized and XB donors become more destabilized, and the atomic volume attraction of both the nitrogen and iodine atoms become more obvious. From the view of the Laplacian of electron density function, for the XB acceptor, the reactivity zone is the region of valence shell charge concentration (VSCC), where it is a (3, -3) critical point (CP) and referred to as a lump, thus the XB interaction can be classified as a lump-hole interaction. The more negative VS,min outside the nitrogen atom, the stronger the XB, resulting in the greater distance between the (3, -3) CP and the nitrogen nucleus. PMID:25102351

  14. Spacetime-constrained oblivious transfer

    NASA Astrophysics Data System (ADS)

    Pitalúa-García, Damián

    2016-06-01

    In 1-out-of-2 oblivious transfer (OT), Alice inputs numbers x0,x1 , Bob inputs a bit b and outputs xb. Secure OT requires that Alice and Bob learn nothing about b and xb ¯, respectively. We define spacetime-constrained oblivious transfer (SCOT) as OT in Minkowski spacetime in which Bob must output xb within Rb, where R0 and R1 are fixed spacelike separated spacetime regions. We show that unconditionally secure SCOT is impossible with classical protocols in Minkowski (or Galilean) spacetime, or with quantum protocols in Galilean spacetime. We describe a quantum SCOT protocol in Minkowski spacetime, and we show it unconditionally secure.

  15. Rapid scatter estimation for CBCT using the Boltzmann transport equation

    NASA Astrophysics Data System (ADS)

    Sun, Mingshan; Maslowski, Alex; Davis, Ian; Wareing, Todd; Failla, Gregory; Star-Lack, Josh

    2014-03-01

    Scatter in cone-beam computed tomography (CBCT) is a significant problem that degrades image contrast, uniformity and CT number accuracy. One means of estimating and correcting for detected scatter is through an iterative deconvolution process known as scatter kernel superposition (SKS). While the SKS approach is efficient, clinically significant errors on the order 2-4% (20-40 HU) still remain. We have previously shown that the kernel method can be improved by perturbing the kernel parameters based on reference data provided by limited Monte Carlo simulations of a first-pass reconstruction. In this work, we replace the Monte Carlo modeling with a deterministic Boltzmann solver (AcurosCTS) to generate the reference scatter data in a dramatically reduced time. In addition, the algorithm is improved so that instead of adjusting kernel parameters, we directly perturb the SKS scatter estimates. Studies were conducted on simulated data and on a large pelvis phantom scanned on a tabletop system. The new method reduced average reconstruction errors (relative to a reference scan) from 2.5% to 1.8%, and significantly improved visualization of low contrast objects. In total, 24 projections were simulated with an AcurosCTS execution time of 22 sec/projection using an 8-core computer. We have ported AcurosCTS to the GPU, and current run-times are approximately 4 sec/projection using two GPU's running in parallel.

  16. Heterogeneity-corrected vs -uncorrected critical structure maximum point doses in breast balloon brachytherapy

    SciTech Connect

    Kim, Leonard; Narra, Venkat; Yue, Ning

    2013-07-01

    Recent studies have reported potentially clinically meaningful dose differences when heterogeneity correction is used in breast balloon brachytherapy. In this study, we report on the relationship between heterogeneity-corrected and -uncorrected doses for 2 commonly used plan evaluation metrics: maximum point dose to skin surface and maximum point dose to ribs. Maximum point doses to skin surface and ribs were calculated using TG-43 and Varian Acuros for 20 patients treated with breast balloon brachytherapy. The results were plotted against each other and fit with a zero-intercept line. Max skin dose (Acuros) = max skin dose (TG-43) ⁎ 0.930 (R{sup 2} = 0.995). The average magnitude of difference from this relationship was 1.1% (max 2.8%). Max rib dose (Acuros) = max rib dose (TG-43) ⁎ 0.955 (R{sup 2} = 0.9995). The average magnitude of difference from this relationship was 0.7% (max 1.6%). Heterogeneity-corrected maximum point doses to the skin surface and ribs were proportional to TG-43-calculated doses. The average deviation from proportionality was 1%. The proportional relationship suggests that a different metric other than maximum point dose may be needed to obtain a clinical advantage from heterogeneity correction. Alternatively, if maximum point dose continues to be used in recommended limits while incorporating heterogeneity correction, institutions without this capability may be able to accurately estimate these doses by use of a scaling factor.

  17. 77 FR 14351 - North Pacific Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-09

    .... Miscellaneous Issues: Bering Sea Integrated Ecosystem Research Program (BSIERP) Management Strategy Evaluation... National Oceanic and Atmospheric Administration RIN 0648-XB071 North Pacific Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice of meetings of the North Pacific Fishery Management Council...

  18. 77 FR 16810 - New England Fishery Management Council; Public Hearings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-22

    ... National Oceanic and Atmospheric Administration RIN 0648-XB104 New England Fishery Management Council... to Paul J. Howard, Executive Director, New England Fishery Management Council, 50 Water Street, Mill.... Howard, Executive Director, New England Fishery Management Council; telephone: (978)...

  19. 77 FR 14349 - Availability of Report: California Eelgrass Mitigation Policy

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-09

    ... National Oceanic and Atmospheric Administration RIN 0648-XB068 Availability of Report: California Eelgrass Mitigation Policy AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and Atmospheric.... The importance of eelgrass both ecologically and economically, coupled with ongoing human pressure...

  20. Timing of x-ray burst from X-pinch

    SciTech Connect

    Zhao, Shen; Zhang, Ran; Zhu, Xinlei; Zou, Xiaobing; Wang, Xinxin

    2015-06-15

    The x-ray burst timings of X-pinches, T{sub XB}, made using eight different wires for different current were measured. The results showed that a higher current makes a shorter T{sub XB} for a given X-pinch wire. In other words, T{sub XB} scales linearly with the line mass density for a given current. Based on the snow-plow model for Z-pinch plasma, it was derived that for a given X-pinch wire the integral of the current over time from zero to T{sub XB} is constant, i.e., ∫{sub 0}{sup T{sub X}{sub B}}i(t)⋅dt=const.. This theoretically derived relation was confirmed by our experiments.

  1. 77 FR 19647 - Western Pacific Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... Through Competing Acts/ Authorities. 15. Communities and Indigenous Issues. 16. International Fisheries... National Oceanic and Atmospheric Administration RIN 0648-XB128 Western Pacific Fishery Management Council; Public Meetings AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and...

  2. Impact of combined β-glucanase and xylanase enzymes on growth performance, nutrients utilization and gut microbiota in broiler chickens fed corn or wheat-based diets.

    PubMed

    Munyaka, P M; Nandha, N K; Kiarie, E; Nyachoti, C M; Khafipour, E

    2016-03-01

    The effects of a xylanase and β-glucanase (XB) blend (2,500 U of xylanase and 250 U of β-glucanase per kg of complete feed) on growth performance, nutrients utilization and digesta microbiota in broiler chickens were investigated. A total of 140 day-old male Ross 308 broiler chicks were randomly assigned to 7 replicate cages and fed experimental diets. Diets were based on either corn or wheat without or with supplemental XB. Performance was monitored weekly and excreta were collected from d 17 to 20 for nutrients digestibility and AMEn measurements. On d 21, jejunal contents were collected for viscosity determination whereas ileal and cecal contents were obtained for microbial analysis by Illumina sequencing. Microbial data were analyzed using QIIME and PLS-DA whilst other data were analyzed using SAS. Birds fed wheat diets had higher (P < 0.001) BWG (3.4%) than birds fed corn-based diet whilst birds fed XB had better BWG (4%) and FCR (7%) than birds fed non-XB diets. Birds fed wheat diet had higher (P < 0.001) NDF (46.5%) and less (P = 0.01) CP (-5.4%) digestibility compared to birds fed corn-based diet. XB reduced (P < 0.001) jejunal digesta viscosity to a greater extent in wheat diet (-31%) than in corn-based diet (-10%). Birds fed wheat-based diet with XB had higher (3.5%) starch digestibility than birds fed this diet without XB. Janthinobacterium was associated with non-XB corn-based diet, whereas Ruminococcus, Lachnospiraceae, Lactobacillaceae, Peptostreptococcaceae, Clostridiales, Acidovorax and Blautia were associated with XB corn-based diet in the ileum. A relatively similar microbiome clustering was observed in wheat-based treatments in the cecum. There were no significant (P ≥ 0.05) correlations between selected ileal or cecal bacterial taxa and AMEn. Diet impacted growth performance but XB was efficacious across diet types, implying that degradation of dietary fibrous components by feed enzymes may stimulate performance in young birds. Data provided

  3. Direct Dehydroxylative Coupling Reaction of Alcohols with Organosilanes through Si-X Bond Activation by Halogen Bonding.

    PubMed

    Saito, Masato; Tsuji, Nobuya; Kobayashi, Yusuke; Takemoto, Yoshiji

    2015-06-19

    The combined use of a halogen bond (XB) donor with trimethylsilyl halide was found to be an efficient cocatalytic system for the direct dehydroxylative coupling reaction of alcohol with various nucleophiles, such as allyltrimethylsilane and trimethylcyanide, to give the corresponding adduct in moderate to excellent yields. Detailed control experiments and mechanistic studies revealed that the XB interaction was crucial for the reaction. The application of this coupling reaction is also described.

  4. Investigation of dynamic ground effect

    NASA Technical Reports Server (NTRS)

    Chang, Ray Chung; Muirhead, Vincent U.

    1987-01-01

    An experimental investigation of dynamic ground effect was conducted in the Univ. of Kansas wind tunnel using delta wings of 60, 70, 75 deg sweep; the XB-70 wing; and the F-104A wing. Both static and dynamic tests were made. Test data were compared to other test data, including dynamic flight test data of the XB-70 and F-104A. Limited flow visualization test were conducted. A significant dynamic effect was found for highly swept delta wings.

  5. Molecular effects of the myosin activator omecamtiv mecarbil on contractile properties of skinned myocardium lacking cardiac myosin binding protein-C.

    PubMed

    Mamidi, Ranganath; Gresham, Kenneth S; Li, Amy; dos Remedios, Cristobal G; Stelzer, Julian E

    2015-08-01

    Decreased expression of cardiac myosin binding protein-C (cMyBP-C) in the myocardium is thought to be a contributing factor to hypertrophic cardiomyopathy in humans, and the initial molecular defect is likely abnormal cross-bridge (XB) function which leads to impaired force generation, decreased contractile performance, and hypertrophy in vivo. The myosin activator omecamtiv mecarbil (OM) is a pharmacological drug that specifically targets the myosin XB and recent evidence suggests that OM induces a significant decrease in the in vivo motility velocity and an increase in the XB duty cycle. Thus, the molecular effects of OM maybe beneficial in improving contractile function in skinned myocardium lacking cMyBP-C because absence of cMyBP-C in the sarcomere accelerates XB kinetics and enhances XB turnover rate, which presumably reduces contractile efficiency. Therefore, parameters of XB function were measured in skinned myocardium lacking cMyBP-C prior to and following OM incubation. We measured ktr, the rate of force redevelopment as an index of XB transition from both the weakly- to strongly-bound state and from the strongly- to weakly-bound states and performed stretch activation experiments to measure the rates of XB detachment (krel) and XB recruitment (kdf) in detergent-skinned ventricular preparations isolated from hearts of wild-type (WT) and cMyBP-C knockout (KO) mice. Samples from donor human hearts were also used to assess the effects of OM in cardiac muscle expressing a slow β-myosin heavy chain (β-MHC). Incubation of skinned myocardium with OM produced large enhancements in steady-state force generation which were most pronounced at low levels of [Ca(2+)] activations, suggesting that OM cooperatively recruits additional XB's into force generating states. Despite a large increase in steady-state force generation following OM incubation, parallel accelerations in XB kinetics as measured by ktr were not observed, and there was a significant OM

  6. Cooperative or Anticooperative: How Noncovalent Interactions Influence Each Other.

    PubMed

    Saha, Soumen; Sastry, G Narahari

    2015-08-27

    This computational study examines the key factors that control the structures and energetics of the coexistence of multiple noncovalent interactions. 4-Amino-2-iodophenol is taken as a model that exhibits nine different kinds of noncovalent interactions, viz., cation-π (CP), hydrogen bond (HB) through O (OHB), HB through N (NHB), halogen bond (XB), π-π (PP), metal ion-lone pair (ML) through O (OML), ML through N (NML), charge assisted hydrogen bond (CHB) through O (OCHB), and CHB through N (NCHB). Through all possible combinations of these noncovalent interactions, based on energy, geometry, charge, and atoms in molecules (AIM) analysis, we have systematically analyzed the cooperativity among 40 ternary systems and 105 quaternary systems. We have observed that CP-HB, CP-XB, CP-PP, HB-HB, HB-XB, HB-PP, HB-ML, HB-CHB, XB-PP, XB-ML, XB-CHB, PP-ML, and PP-OCHB can form cooperative ternary systems. While studying the quaternary systems, we have observed that HB, XB, and PP work together by enhancing each other's strength. The study highlights that the positively charged species enhances HB-HB and HB-PP interactions and forms cooperative HB-HB-CHB, HB-HB-ML, HB-PP-ML, and HB-PP-CHB systems. Surprisingly, OHB-OML-NML, OHB-OML-OCHB, OHB-OML-NCHB, OHB-NML-OCHB, NHB-OML-NML, NHB-OML-NCHB, and NHB-NML-OCHB are also cooperative in nature despite the electrostatic repulsion between two positive charge species. The current study shows the widespread presence of cooperativity as well as anticooperativity in supramolecular assembles.

  7. Perspectives of Halogen Bonding Description in Scoring Functions and QSAR/QSPR: Substituent Effects in Aromatic Core.

    PubMed

    Titov, Oleg I; Shulga, Dmitry A; Palyulin, Vladimir A; Zefirov, Nikolay S

    2015-06-01

    Halogen bonding (XB) is a new promising interaction pattern in medicinal chemistry. It has predominantly electrostatic nature - high electrostatic potential anisotropy. However to fully unleash the potential of XB in rational drug design fast and robust empirical methods of XB description should be developed. Current approaches rely heavily on ab initio calculation for each molecule studied. Thus fast prediction of electrostatic parameters for description of XB for arbitrary organic molecules is of paramount importance to promptly establish QSAR/QSPR, virtual screening and molecular docking pipelines suitable for today's agile development requirements. The two most promising approaches to describe anisotropic electrostatic models - the extra point (EP) charge model and the multipole expansion (ME) model - were studied on their ability (1) to describe ab initio molecular electrostatic potential (MEP) and (2) to produce parameters that can be predicted for each molecule empirically rather than estimated via ab initio calculations. The reference ab initio MEP was calculated for a set of 730 substituted halobenzenes. Parameters for anisotropic electrostatics of both empirical models (EP and ME) studied were extracted from ab initio MEP. The FreeWilson and Hansch type QSPR models relating XB parameters with aromatic substituents were built and analyzed, providing the guidelines for further development. PMID:27490386

  8. Detailed Investigation of Ion Exchange in Ball Milled LiH+MgB2 System using Ultra-High Field NMR Spectroscopy

    SciTech Connect

    Hu, Jian Z.; Kwak, Ja Hun; Yang, Zhenguo; Wan, Xiufeng; Shaw, Leonard D.

    2010-06-01

    The present study with the detailed 1H-6Li cross polarization NMR analysis confirms the formation of a ternary compound, (Mg1-xLi2x)B2, during ball milling of LiH + ½ MgB2 at room temperature. The 6Li sites in (Mg1-xLi2x)B2 exhibit spinning sidebands (SSBs), whereas the 6Li sites in LiH do not. The SSBs and the very short spin-lattice relaxation time manifested by the 6Li sites in (Mg1-xLi2x)B2 indicate that the Li ions in (Mg1-xLi2x)B2 are located between the layered boron structures and close to Mg ions. The formation of (Mg1-xLi2x)B2 explains the previous observation that the LiH + ½ MgB2 mixture ball milled effectively has a greatly enhanced hydriding kinetics at temperatures below the melting point of LiBH4.

  9. Fibroblast growth factor, but not activin, is a potent activator of mitogen-activated protein kinase in Xenopus explants.

    PubMed Central

    Graves, L M; Northrop, J L; Potts, B C; Krebs, E G; Kimelman, D

    1994-01-01

    Isolated explants from the animal hemisphere of Xenopus embryos were incubated with Xenopus basic fibroblast growth factor (XbFGF) or human activin A. XbFGF incubation resulted in the rapid activation of mitogen-activated protein kinase (MAPK) and ribosomal S6 protein kinase (pp90rsk) in a dose-dependent manner with the highest levels of activation occurring at 50 ng/ml. Maximal activation occurred within 6-10 min after the addition of growth factor, and the activity of both kinases declined to unstimulated levels after 30 min. Activin was unable to activate either MAPK or pp90rsk in the Xenopus explants to a substantial level, although it induced dorsal mesoderm better than XbFGF under the same experimental conditions. The regulatory protein Xwnt-8 did not activate MAPK, nor did it enhance the activation of MAPK by XbFGF. XbFGF was able to activate MAPK through at least the midgastrula stage, suggesting that this family of growth factors may have a role in gastrula-stage events. Images PMID:7510404

  10. On the absence of plasma wave emissions and the magnetic field orientation in the distant magnetosheath

    NASA Technical Reports Server (NTRS)

    Coroniti, F. V.; Greenstadt, E. W.; Moses, S. L.; Tsurutani, B. T.; Smith, E. J.

    1994-01-01

    In early September, 1983 ISEE-3 made a long traversal of the distant dawnside magnetosheath starting near x = -150 R(sub E) downstream. The distant magnetosheath often contains moderately intense plasma wave emissions at frequencies from several hundred Hz to 5 kHz. However, over time scales of many days, a clear correlation exists between the occurrence of the plasma waves and the cone angle (theta(sub xB)) between the magnetic field and the plasma flow velocity (x-direction). For theta(sub xB) large (small), the plasma wave amplitudes are near background (high). Sudden (less than 1 minute) changes in the local magnetic field orientation produce correspondingly sudden changes in the wave amplitudes. Statistically, the wave amplitudes decrease continuously with increasing theta(sub xB).

  11. Measurement of Two- and Three-Nucleon Short-Range Correlation Probabilities in Nuclei

    SciTech Connect

    K. S. Egiyan; N. B. Dashyan; M. M. Sargsian; M. I. Strikman; L. B. Weinstein; G. Adams; P. Ambrozewicz; M. Anghinolfi; B. Asavapibhop; G. Asryan; H. Avakian; H. Baghdasaryan; N. Baillie; J. P. Ball; N. A. Baltzell; V. Batourine; M. Battaglieri; I. Bedlinskiy; M. Bektasoglu; M. Bellis; N. Benmouna; A. S. Biselli; B. E. Bonner; S. Bouchigny; S. Boiarinov; R. Bradford; D. Branford; W. K. Brooks; S. Bültmann; V. D. Burkert; C. Bultuceanu; J. R. Calarco; S. L. Careccia; D. S. Carman; B. Carnahan; S. Chen; P. L. Cole; P. Coltharp; P. Corvisiero; D. Crabb; H. Crannell; J. P. Cummings; E. De Sanctis; R. DeVita; P. V. Degtyarenko; H. Denizli; L. Dennis; K. V. Dharmawardane; C. Djalali; G. E. Dodge; J. Donnelly; D. Doughty; P. Dragovitsch; M. Dugger; S. Dytman; O. P. Dzyubak; H. Egiyan; L. Elouadrhiri; A. Empl; P. Eugenio; R. Fatemi; G. Fedotov; R. J. Feuerbach; T. A. Forest; H. Funsten; G. Gavalian; N. G. Gevorgyan; G. P. Gilfoyle; K. L. Giovanetti; F. X. Girod; J. T. Goetz; E. Golovatch; R. W. Gothe; K. A. Griffioen; M. Guidal; M. Guillo; N. Guler; L. Guo; V. Gyurjyan; C. Hadjidakis; J. Hardie; F. W. Hersman; K. Hicks; I. Hleiqawi; M. Holtrop; J. Hu; M. Huertas; C. E. Hyde-Wright; Y. Ilieva; D. G. Ireland; B. S. Ishkhanov; M. M. Ito; D. Jenkins; H. S. Jo; K. Joo; H. G. Juengst; J. D. Kellie; M. Khandaker; K. Y. Kim; K. Kim; W. Kim; A. Klein; F. J. Klein; A. Klimenko; M. Klusman; L. H. Kramer; V. Kubarovsky; J. Kuhn; S. E. Kuhn; S. Kuleshov; J. Lachniet; J. M. Laget; J. Langheinrich; D. Lawrence; T. Lee; K. Livingston; L. C. Maximon; S. McAleer; B. McKinnon; J. W. C. McNabb; B. A. Mecking; M. D. Mestayer; C. A. Meyer; T. Mibe; K. Mikhailov; R. Minehart; M. Mirazita; R. Miskimen; V. Mokeev; S. A. Morrow; J. Mueller; G. S. Mutchler; P. Nadel-Turonski; J. Napolitano; R. Nasseripour; S. Niccolai; G. Niculescu; I. Niculescu; B. B. Niczyporuk; R. A. Niyazov; G. V. O'Rielly; M. Osipenko; A. I. Ostrovidov; K. Park; E. Pasyuk; C. Peterson; J. Pierce; N. Pivnyuk; D. Pocanic; O. Pogorelko; E. Polli; S. Pozdniakov; B. M. Preedom; J. W. Price; Y. Prok; D. Protopopescu; L. M. Qin; B. A. Raue; G. Riccardi; G. Ricco; M. Ripani; B. G. Ritchie; F. Ronchetti; G. Rosner; P. Rossi; D. Rowntree; P. D. Rubin; F. Sabatié; C. Salgado; J. P. Santoro; V. Sapunenko; R. A. Schumacher; V. S. Serov; Y. G. Sharabian; J. Shaw; E. S. Smith; L. C. Smith; D. I. Sober; A. Stavinsky; S. Stepanyan; B. E. Stokes; P. Stoler; S. Strauch; R. Suleiman; M. Taiuti; S. Taylor; D. J. Tedeschi; R. Thompson; A. Tkabladze; S. Tkachenko; L. Todor; C. Tur; M. Ungaro; M. F. Vineyard; A. V. Vlassov; D. P. Weygand; M. Williams; E. Wolin; M. H. Wood; A. Yegneswaran; J. Yun; L. Zana; and J. Zhang

    2006-03-01

    The ratios of inclusive electron scattering cross sections of 4He, 12C, and 56Fe to 3He have been measured at 1<xB<3. At Q2>1.4 GeV2, the ratios exhibit two separate plateaus, at 1.5<xB<2 and at xB>2.25. This pattern is predicted by models that include 2- and 3-nucleon short-range correlations (SRC). Relative to A=3, the per-nucleon probabilities of 3-nucleon SRC are 2.3, 3.1, and 4.4 times larger for A=4, 12, and 56. This is the first measurement of 3-nucleon SRC probabilities in nuclei.

  12. New Insights into the EMC Effect

    SciTech Connect

    Douglas Higinbotham

    2012-08-17

    Deep-inelastic scattering cross section ratios plotted as a function of the Bjorken scaling variable, xB, show an unexpected structure indicating that partonic structure in nuclei is different than in free nucleons. This phenomenon is commonly referred to as the EMC effect. Recent Jefferson Lab experimental data showed that the slope of the EMC effect in the 0.3 < xB > 0.7 region scales as the local nuclear density rather than the average nuclear density. This result lead to the comparison of xB>1 short-range correlation plateaus, also a local density effect, to the magnitude of the EMC effect slopes and a clear linear relation was found. In this talk, I will discuss the EMC effect and the short-range correlation plateaus and what this phenomenological relationship between the two implies.

  13. A live attenuated BCG vaccine overexpressing multistage antigens Ag85B and HspX provides superior protection against Mycobacterium tuberculosis infection.

    PubMed

    Yuan, Xuefeng; Teng, Xindong; Jing, Yukai; Ma, Jilei; Tian, Maopeng; Yu, Qi; Zhou, Lei; Wang, Ruibo; Wang, Weihua; Li, Li; Fan, Xionglin

    2015-12-01

    Tuberculosis (TB) remains one of the most menacing infectious diseases, although attenuated Mycobacterium bovis Bacillus Calmette-Guerin (BCG) vaccine has been widely used to protect children against primary TB. There are increasing evidences that rapid growing and dormant Mycobacterium tuberculosis (M. tuberculosis) coexist in vivo after infection. However, BCG vaccine only elicits cell-mediated immune responses to secretory antigens expressed by rapid growing pathogen. BCG vaccine is thus unable to thwart the reactivation of latent tuberculosis infection (LTBI), and its protection wanes over age after neonatal immunization. In order to extend its ability for a durable protection, a novel recombinant BCG (rBCG) strain, named rBCG::XB, was constructed by overexpressing immunodominant multistage antigens of Ag85B and HspX, which are expressed by both rapid replicating and dormant M. tuberculosis. Long-term protective effect and immunogenicity of rBCG::XB were compared with the parental BCG in vaccinated C57BL/6 mice. Our results demonstrated that rBCG::XB provided the stronger and long-lasting protection against M. tuberculosis H37Rv intranasal infection than BCG. The rBCG::XB not only elicited the more durable multistage antigen-specific CD4(+)Th1-biased immune responses and specific polyfunctional CD4(+)T cells but also augmented the CD8(+) CTL effects against Ag85B in vivo. In particular, higher levels of CD4(+) TEM and CD8(+) TCM cells, dominated by IL2(+) CD4(+) and CD8(+) TCM cells, were obtained in the spleen of rBCG::XB vaccinated mice. Therefore, our findings indicate that rBCG::XB is a promising candidate to improve the efficacy of BCG.

  14. Evidence for mass-loading of the Venus magnetosheath

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Russell, C. T.; Spreiter, J. R.; Stahara, S. S.

    1985-01-01

    The observed magnetic field configuration in the Venus magnetosheath contains information about the solar wind mass-loading processes occurring as a result of the extension of the neutral atmosphere into the magnetosheath. In this paper, magnetic field signatures of various mass-loading processes are discussed and experimental results from the Pioneer Venus Orbiter magnetometer experiment are examined for evidence of these signatures. The data suggest that the -V(bar)XB(bar) acceleration process, stochastic pickup of ionospheric ions, and J(bar)XB(bar) force 'scavenging' at the ionopause all occur at various times.

  15. Evidence for mass-loading of the Venus magnetosheath

    SciTech Connect

    Luhmann, J.G.; Russell, C.T.; Spreiter, J.R.; Stahara, S.S.

    1985-01-01

    The observed magnetic field configuration in the Venus magnetosheath contains information about the solar wind mass-loading processes occurring as a result of the extension of the neutral atmosphere into the magnetosheath. In this paper, magnetic field signatures of various mass-loading processes are discussed and experimental results from the Pioneer Venus Orbiter magnetometer experiment are examined for evidence of these signatures. The data suggest that the -V(bar)XB(bar) acceleration process, stochastic pickup of ionospheric ions, and J(bar)XB(bar) force scavenging at the ionopause all occur at various times. 16 references.

  16. Generalized Parton distributions with CLAS and CLAS12

    SciTech Connect

    S. Niccolai

    2012-04-01

    Recent promising results obtained with the Jefferson Lab CLAS detector on deeply virtual exclusive processes and their link to the Generalized Parton Distributions, along with the experimental program to study GPDs at the 12-GeV upgraded JLab using the CLAS12 detector, are discussed here. With its wide acceptance, high luminosity, good resolution and particle identification capabilities, as well as large Q2 and xB coverage (1 GeV < Q2 < 10 GeV2, 0.1 < xB < 0.8), CLAS12 will be the ideal facility to pursue the research on the 3-dimensional structure of the nucleon in the valence region.

  17. The sarcomeric control of energy conversion.

    PubMed

    Levy, Carmit; Ter Keurs, Henk E D J; Yaniv, Yael; Landesberg, Amir

    2005-06-01

    The Frank-Starling Law, Fenn Effect, and Suga's suggestions of cardiac muscle constant contractile efficiency establish the dependence of cardiac mechanics and energetics on the loading conditions. Consistent with these observations, this review suggests that the sarcomere control of contraction consists of two dominant feedbacks: (1) a cooperativity mechanism (positive feedback), whereby the number of force-generating cross-bridges (XBs) determines the affinity of calcium binding to the troponin regulatory protein; and (2) a mechanical (negative) feedback, whereby the filament shortening velocity affects the rate of XB turnover from the force to the non-force generating conformation. The study explains the roles of these feedbacks in providing the adaptive control of energy consumption by the loading conditions and validates the dependence of the cooperativity mechanism on the number of strong XBs. The cooperativity mechanism regulates XB recruitment. It explains the cardiac force-length calcium relationship, the related Frank-Starling Law of the heart, and the adaptive control of new XB recruitment and the associated adenosine triphosphate (ATP) consumption. The mechanical feedback explains the force-velocity relationship and the constant and high-contractile efficiency. These mechanisms were validated by testing the force responses to large amplitude (100 nm/sarcomere) sarcomere length (SL) oscillations, in intact tetanized trabeculae (utilizing 30 microM cyclopiazonic). The force responses to large-length oscillations lag behind the imposed oscillations at low extracellular calcium concentration ([Ca(2+)](0)) and slow frequencies (<4 Hz, 25 degrees C), yielding counterclockwise hystereses in the force-length plane. The force was higher during shortening than during lengthening. The area within these hystereses corresponds to the external work generated from new XB recruitment during each oscillation, and it is determined by the delay in the force response

  18. Non-isomorphism in efficient coding of complex sound properties

    PubMed Central

    Stilp, Christian E.; Kluender, Keith R.

    2011-01-01

    To the extent that sensorineural systems are efficient, stimulus redundancy should be captured in ways that optimize information transmission. Consistent with this principle, neural representations of sounds have been proposed to become “non-isomorphic,” increasingly abstract and decreasingly resembling the original (redundant) input. Here, non-isomorphism is tested in perceptual learning using AXB discrimination of novel sounds with two highly correlated complex acoustic properties and a randomly varying third dimension. Discrimination of sounds obeying the correlation became superior to that of sounds violating it despite widely varying physical acoustic properties, suggesting non-isomorphic representation of stimulus redundancy. PMID:22088040

  19. 77 FR 19646 - Marine Mammals; File No. 17178

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... National Oceanic and Atmospheric Administration RIN 0648-XB139 Marine Mammals; File No. 17178 AGENCY... permit to import marine mammal parts for scientific research. DATES: Written, telefaxed, or email.... SUPPLEMENTARY INFORMATION: The subject permit is requested under the authority of the Marine Mammal...

  20. 78 FR 3402 - Marine Mammals; File No. 16919

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-16

    ... was published in the Federal Register (77 FR 27717) that a request for a permit to conduct research on... National Oceanic and Atmospheric Administration RIN 0648-XB173 Marine Mammals; File No. 16919 AGENCY... the authority of the Marine Mammal Protection Act of 1972, as amended (16 U.S.C. 1361 et seq.),...

  1. 77 FR 12009 - Marine Mammals; File No. 16991

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-28

    ... National Oceanic and Atmospheric Administration RIN 0648-XB033 Marine Mammals; File No. 16991 AGENCY... under the authority of the Marine Mammal Protection Act of 1972, as amended (MMPA; 16 U.S.C. 1361 et seq.) and the regulations governing the taking and importing of marine mammals (50 CFR part 216)....

  2. Defect-Tolerant Diffusion Channels for Mg2+ Ions in Ribbon-Type Borates: Structural Insights into Potential Battery Cathodes MgVBO4 and Mgx Fe2–xB2O5

    DOE PAGES

    Bo, Shou-Hang; Grey, Clare P.; Khalifah, Peter G.

    2015-06-10

    The reversible room temperature intercalation of Mg2+ ions is difficult to achieve, but may offer substantial advantages in the design of next-generation batteries if this electrochemical process can be successfully realized. Two types of quadruple ribbon-type transition metal borates (MgxFe2-xB2O5 and MgVBO4) with high theoretical capacities (186 mAh/g and 360 mAh/g) have been synthesized and structurally characterized through the combined Rietveld refinement of synchrotron and time-of-flight neutron diffraction data. Neither MgVBO4 nor MgxFe2-xB2O5 can be chemically oxidized at room temperature, though Mg can be dynamically removed from the latter phase at elevated temperatures (approximately 200 - 500 °C). Findingsmore » show that Mg diffusion in the MgxFe2-xB2O5 structure is more facile for the inner two octahedral sites than for the two outer octahedral sites in the ribbons, a result supported by both the refined site occupancies after Mg removal and by bond valence sum difference map calculations of diffusion paths in the pristine material. Mg diffusion in this pyroborate MgxFe2-xB2O5 framework is also found to be tolerant to the presence of Mg/Fe disorder since Mg ions can diffuse through interstitial channels which bypass Fe-containing sites.« less

  3. 77 FR 16211 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-20

    ... National Oceanic and Atmospheric Administration RIN 0648-XB091 New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice; public meeting. SUMMARY: The New England Fishery Management.... Council address: New England Fishery Management Council, 50 Water Street, Mill 2, Newburyport, MA...

  4. 77 FR 19228 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-30

    ... National Oceanic and Atmospheric Administration RIN 0648-XB137 New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice; public meeting. SUMMARY: The New England Fishery Management... 04101; telephone: (207) 775-2311; fax: (207) 772-4017. Council address: New England Fishery...

  5. 77 FR 15720 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-16

    ... National Oceanic and Atmospheric Administration RIN 0648-XB092 New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice; public meeting. SUMMARY: The New England Fishery Management...-3000; fax: (401) 732-9309. Council address: New England Fishery Management Council, 50 Water...

  6. 77 FR 20613 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ... National Oceanic and Atmospheric Administration RIN 0648-XB129 New England Fishery Management Council... FURTHER INFORMATION CONTACT: Paul J. Howard, Executive Director, New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice of cancellation of a public meeting. SUMMARY: The New...

  7. 77 FR 19231 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-30

    ... National Oceanic and Atmospheric Administration RIN 0648-XB129 New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice; public meeting. SUMMARY: The New England Fishery Management...: (401) 861-8002. Council address: New England Fishery Management Council, 50 Water Street, Mill...

  8. 78 FR 2672 - Application for Final Commitment for a Long-Term Loan or Financial Guarantee in Excess of $100...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-14

    ... From the Federal Register Online via the Government Publishing Office EXPORT-IMPORT BANK OF THE UNITED STATES Application for Final Commitment for a Long-Term Loan or Financial Guarantee in Excess of $100 Million: AP078595XX, AP078595XA, AP078595XB AGENCY: Export-Import Bank of the United...

  9. Diversity, Biocontrol, and Plant Growth Promoting Abilities of Xylem Residing Bacteria from Solanaceous Crops

    PubMed Central

    Achari, Gauri A.

    2014-01-01

    Eggplant (Solanum melongena L.) is one of the solanaceous crops of economic and cultural importance and is widely cultivated in the state of Goa, India. Eggplant cultivation is severely affected by bacterial wilt caused by Ralstonia solanacearum that colonizes the xylem tissue. In this study, 167 bacteria were isolated from the xylem of healthy eggplant, chilli, and Solanum torvum Sw. by vacuum infiltration and maceration. Amplified rDNA restriction analysis (ARDRA) grouped these xylem residing bacteria (XRB) into 38 haplotypes. Twenty-eight strains inhibited growth of R. solanacearum and produced volatile and diffusible antagonistic compounds and plant growth promoting substances in vitro. Antagonistic strains XB86, XB169, XB177, and XB200 recorded a biocontrol efficacy greater than 85% against BW and exhibited 12%–22 % increase in shoot length in eggplant in the greenhouse screening. 16S rRNA based identification revealed the presence of 23 different bacterial genera. XRB with high biocontrol and plant growth promoting activities were identified as strains of Staphylococcus sp., Bacillus sp., Streptomyces sp., Enterobacter sp., and Agrobacterium sp. This study is the first report on identity of bacteria from the xylem of solanaceous crops having traits useful in cultivation of eggplant. PMID:24963298

  10. Liquid Rocket Booster (LRB) for the Space Transportation System (STS) systems study. Appendix A: Stress analysis report for the pump-fed and pressure-fed liquid rocket booster

    NASA Technical Reports Server (NTRS)

    1989-01-01

    Pressure effects on the pump-fed Liquid Rocket Booster (LRB) of the Space Transportation System are examined. Results from the buckling tests; bending moments tests; barrel, propellant tanks, frame XB1513, nose cone, and intertank tests; and finite element examination of forward and aft skirts are presented.

  11. Sonic boom signature data from cruciform microphone array experiments during the 1966-1967 EAFB national sonic boom evaluation program

    NASA Technical Reports Server (NTRS)

    Hubbard, H. H.; Maglieri, D. J.

    1990-01-01

    Tables are provided of measured sonic boom signature data derived from supersonic flyover tests of the XB-70, B-58 and F-104 aircraft for ranges of altitude and Mach number. These tables represent a convenient hard copy version of available electronic files and complement preliminary information included in a reference National Sonic Boom Evaluation Office document.

  12. 77 FR 15997 - Endangered Species; File No. 15672

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-19

    ..., notice was published in the Federal Register (76 FR 23305) that a request for a scientific research... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB083 Endangered Species; File No. 15672...

  13. 77 FR 47045 - Marine Mammals; File No. 16580

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-07

    ... published in the Federal Register (77 FR 31835) that a request for a permit to receive, import and export... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB158 Marine Mammals; File No. 16580...

  14. 77 FR 21751 - Endangered Species; File No. 16645

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB152 Endangered Species; File No. 16645 AGENCY... comments will be accepted in Microsoft Word or Excel, WordPerfect, or Adobe PDF file formats only....

  15. 77 FR 30508 - Marine Mammals; File No. 16991

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-23

    .... SUPPLEMENTARY INFORMATION: On February 28, 2012, notice was published in the Federal Register (77 FR 12009) that... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB033 Marine Mammals; File No. 16991...

  16. 78 FR 2659 - Endangered Species; File No. 16645

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-14

    ... INFORMATION: On April 11, 2012, notice was published in the Federal Register (77 FR 21751) that a request for... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB152 Endangered Species; File No. 16645...

  17. 77 FR 31835 - Marine Mammals; File No. 16580

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-30

    ... National Oceanic and Atmospheric Administration RIN 0648-XB158 Marine Mammals; File No. 16580 AGENCY....gov , and then selecting File No. 16580 from the list of available applications. These documents are... submitted by facsimile to (301)713-0376, or by email to NMFS.Pr1Comments@noaa.gov . Please include the...

  18. 78 FR 51146 - Marine Mammals; File No. 14535

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-20

    ... INFORMATION: On April 9, 2013, notice was published in the Federal Register (78 FR 21112) that a request for... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB161 Marine Mammals; File No. 14535...

  19. 78 FR 22517 - Endangered Species; File No. 16549

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-16

    .... SUPPLEMENTARY INFORMATION: On April 11, 2012, notice was published in the Federal Register (77 FR 21750) that a... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB155 Endangered Species; File No. 16549...

  20. 77 FR 34352 - Marine Mammals; File No. 17178

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-11

    ... (77 FR 19646) that a request for a permit to import marine mammal parts for scientific research had... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB139 Marine Mammals; File No. 17178...

  1. 77 FR 19563 - 2012 Accountability Measures for Gulf of Mexico Commercial Greater Amberjack and Closure of the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... final rule (73 FR 38139) to implement Amendment 30A to the FMP. Amendment 30A established commercial and... (FEIS) for Amendment 30A. A notice of availability for the FEIS was published on April 18, 2008 (73 FR... National Oceanic and Atmospheric Administration 50 CFR Part 622 RIN 0648-XB074 2012 Accountability...

  2. 77 FR 19227 - Gulf of Mexico Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-30

    ....--Outreach and Education Committee will review the Crisis Communication Plan and receive an update on the... National Oceanic and Atmospheric Administration RIN 0648-XB130 Gulf of Mexico Fishery Management Council... Management Council (Council) will convene a public meeting. DATES: The meeting will be held April 16-19,...

  3. Antecedents and analogues - Experimental aircraft

    NASA Technical Reports Server (NTRS)

    Smith, R. H.

    1978-01-01

    The paper reviews the development of experimental aircraft from 1953 to the present. Consideration is given to the X-series experimental aircraft, to X-15 (the first aerospace plane), to the transition of experimental aircraft to high-speed flight, to XB-70 research, to lifting body research aircraft, and to current high-speed flight research.

  4. FISH detection of ribosomal cistrons and assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae).

    PubMed

    Bidau, C J; Rosato, M; Martí, D A

    2004-01-01

    Assortment-distortion with respect to the X and NOR activity of a rare mitotically stable B chromosome (B(N)), was examined in 16 males of Dichroplus pratensis (Acrididae: Melanoplinae) from Argentine populations. In 1B individuals, the X and B associate preferentially during prophase I reaching a maximum level of association at zygotene. Frequency of X/B association remains relatively high up to diplotene-diakinesis and decreases steeply towards metaphase I. The percent X/B association at each stage is positively influenced by association at the previous stage, and interindividual variability in X/B association decreases as the frequency of association increases. Both chromosomes tended to preferentially orientate toward the same pole at MI (mean ratio of 16 individuals, 1.50:1) which determined an excess of XB and 00 second spermatocytes over X0 and 0B ones (1.39:1). No significant differences occurred between the MI, AI and MII assortment ratios. Fluorescent in situ hybridisation (FISH) confirmed that the B chromosome carries ribosomal genes and helped to establish that, during spermiogenesis, both the B and the normal NOR-bearing chromosome (S8) are clustered near the centriole adjunct region of spermatids. However, FISH failed to reveal the existence of inactive ribosomal cistrons in the X chromosome, as previously suggested, thus providing no support to a simple origin of the B from the X.

  5. 77 FR 55194 - Endangered Species; File No. 17095

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-07

    ... National Oceanic and Atmospheric Administration RIN 0648-XB155 Endangered Species; File No. 17095 AGENCY... issued under the authority of the Endangered Species Act of 1973, as amended (ESA; 16 U.S.C. 1531 et seq... endangered or threatened species, and (3) is consistent with the purposes and policies set forth in section...

  6. 77 FR 57559 - Endangered Species; File No. 13330

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-18

    ... National Oceanic and Atmospheric Administration RIN 0648-XB144 Endangered Species; File No. 13330 AGENCY... modification has been granted under the authority of the Endangered Species Act of 1973, as amended (ESA; 16 U... the disadvantage of such endangered or threatened species, and (3) is consistent with the purposes...

  7. 77 FR 25408 - International Whaling Commission; 64th Annual Meeting; Announcement of Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-30

    ... National Oceanic and Atmospheric Administration RIN 0648-XB150 International Whaling Commission; 64th... annual International Whaling Commission (IWC) meeting. DATES: The public meeting will be held June 5... the United States under the International Convention for the Regulation of Whaling, 1946. The U.S....

  8. 77 FR 19646 - International Whaling Commission; 64th Annual Meeting; Nominations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... National Oceanic and Atmospheric Administration RIN 0648-XB127 International Whaling Commission; 64th... a call for nominees for the U.S. Delegation to the July 2012 International Whaling Commission (IWC... International Convention for the Regulation of Whaling, 1946. The U.S. IWC Commissioner has responsibility...

  9. On the Solutions of Some Linear Complex Quaternionic Equations

    PubMed Central

    İpek, Ahmet

    2014-01-01

    Some complex quaternionic equations in the type AX − XB = C are investigated. For convenience, these equations were called generalized Sylvester-quaternion equations, which include the Sylvester equation as special cases. By the real matrix representations of complex quaternions, the necessary and sufficient conditions for the solvability and the general expressions of the solutions are obtained. PMID:25101318

  10. 77 FR 12574 - Schedules for Atlantic Shark Identification Workshops and Protected Species Safe Handling...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-01

    ... business listed under the shark dealer permit which first receives Atlantic sharks (71 FR 58057; October 2... permit (71 FR 58057; October 2, 2006). These certificate(s) are valid for three years. As such, vessel... National Oceanic and Atmospheric Administration RIN 0648-XB037 Schedules for Atlantic Shark...

  11. 77 FR 8810 - Gulf of Mexico Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-15

    ... National Oceanic and Atmospheric Administration RIN 0648-XB007 Gulf of Mexico Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice of a public meeting. SUMMARY: The Gulf of Mexico Fishery... 39501. Council address: Gulf of Mexico Fishery Management Council, 2203 North Lois Avenue, Suite...

  12. 77 FR 16539 - Gulf of Mexico Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-21

    ... National Oceanic and Atmospheric Administration RIN 0648-XB098 Gulf of Mexico Fishery Management Council... Administration (NOAA), Commerce. ACTION: Council to convene a public meeting. SUMMARY: The Gulf of Mexico Fishery... at the Gulf of Mexico Fishery Management Council, 2203 North Lois Avenue, Suite 1100, Tampa, FL...

  13. On the solutions of some linear complex quaternionic equations.

    PubMed

    Bolat, Cennet; İpek, Ahmet

    2014-01-01

    Some complex quaternionic equations in the type AX - XB = C are investigated. For convenience, these equations were called generalized Sylvester-quaternion equations, which include the Sylvester equation as special cases. By the real matrix representations of complex quaternions, the necessary and sufficient conditions for the solvability and the general expressions of the solutions are obtained. PMID:25101318

  14. 77 FR 14004 - New England Fishery Management Council; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-08

    ... National Oceanic and Atmospheric Administration RIN 0648-XB064 New England Fishery Management Council... Administration (NOAA), Commerce. ACTION: Notice; public meeting. SUMMARY: The New England Fishery Management... New England fisheries in the exclusive economic zone (EEZ). DATES: The meeting will be held...

  15. Variability of measured sonic boom signatures

    NASA Technical Reports Server (NTRS)

    Elmer, K. R.; Joshi, M. C.

    1994-01-01

    The topics discussed include the following: atmospheric turbulence; BOOMFILE Database description; BOOMFILE flight conditions; XB-70 Database descriptions; analysis progression; extended database; prediction method; overpressure variability dependence on flight conditions; loudness variability on flight conditions; sonic boom variability in repeat flights; and statistical distributions.

  16. 77 FR 9211 - South Atlantic Fishery Management Council; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-16

    ... will receive presentations on the use of social media tools. Additionally, the Committee will receive a... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB008 South Atlantic Fishery Management...

  17. 77 FR 12010 - Marine Mammals; File Nos. 1076-1789 and 14502

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-28

    ... (72 FR 13092), authorized the receipt, import and export of marine mammal specimens (cetaceans and... June 17, 2011 (72 FR 13092), authorized the importation of samples from Risso's (Grampus griseus... National Oceanic and Atmospheric Administration RIN 0648-XB040 Marine Mammals; File Nos. 1076-1789...

  18. Deeply Virtual Pseudoscalar Meson Production with CLAS

    SciTech Connect

    Valery Kubarovsky; Paul Stoler; Ivan Bedlinsky

    2007-09-03

    Deeply virtual Compton scattering, cross sections and asymmetries for the pi^0 and eta exclusive electroproduction in a very wide kinematic range of Q^2, t and x_B have been measured with CLAS (Jlab). Initial analyzes already are showing remarkable results. These data will help us to better understand the transition from soft to hard mechanisms.

  19. A prototype RF power source system for the X-band linear collider

    SciTech Connect

    Mizuno, H.

    1995-07-05

    Since 1988, R&D of the X-band klystron in KEK has been carried out, and in this R&D program the two types of the X-band klystrons has been designed and tested (REF-1,2,3). The first one is the 30MW class klystron named XB-50k. This rather moderate peak power klystron was designed as the first step to the 100MW class klystron, and in 1992, could achieve 26MW peak power successfully. This XB-50k{number_sign}1a had supplied the RF power to the first X-band accelerating structure high power test in autumn of 1992. The second klystron named XB-72k in this R&D program, was designed as the first 100MW class klystron which could fulfill the minimum power requirement for the RF power source of the X-band linac in the next generation of several hundreds GeV electron positron linear colliders. The first XB-72k{number_sign}1 was tested in 1992 and 1993, and successfully achieved the peak spring and also achieved 95MW. In order to verify the technological feasibility of the conventional klystron power system as the possible candidate of the future X-band linear collider, the prototype RF power system including the RF pulse compression scheme and the modulator is discussed. {copyright} {ital 1995} {ital American} {ital Institute} {ital of} {ital Physics}.

  20. A prototype RF power source system for the X-band linear collider

    NASA Astrophysics Data System (ADS)

    Mizuno, H.

    1995-07-01

    Since 1988, R&D of the X-band klystron in KEK has been carried out, and in this R&D program the two types of the X-band klystrons has been designed and tested (REF-1,2,3). The first one is the 30MW class klystron named XB-50k. This rather moderate peak power klystron was designed as the first step to the 100MW class klystron, and in 1992, could achieve 26MW peak power successfully. This XB-50k♯1a had supplied the RF power to the first X-band accelerating structure high power test in autumn of 1992. The second klystron named XB-72k in this R&D program, was designed as the first 100MW class klystron which could fulfill the minimum power requirement for the RF power source of the X-band linac in the next generation of several hundreds GeV electron positron linear colliders. The first XB-72k♯1 was tested in 1992 and 1993, and successfully achieved the peak spring and also achieved 95MW. In order to verify the technological feasibility of the conventional klystron power system as the possible candidate of the future X-band linear collider, the prototype RF power system including the RF pulse compression scheme and the modulator is discussed.

  1. Cardiac Myosin Binding Protein-C Phosphorylation Modulates Myofilament Length-Dependent Activation

    PubMed Central

    Mamidi, Ranganath; Gresham, Kenneth S.; Verma, Sujeet; Stelzer, Julian E.

    2016-01-01

    Cardiac myosin binding protein-C (cMyBP-C) phosphorylation is an important regulator of contractile function, however, its contributions to length-dependent changes in cross-bridge (XB) kinetics is unknown. Therefore, we performed mechanical experiments to quantify contractile function in detergent-skinned ventricular preparations isolated from wild-type (WT) hearts, and hearts expressing non-phosphorylatable cMyBP-C [Ser to Ala substitutions at residues Ser273, Ser282, and Ser302 (i.e., 3SA)], at sarcomere length (SL) 1.9 μm or 2.1μm, prior and following protein kinase A (PKA) treatment. Steady-state force generation measurements revealed a blunting in the length-dependent increase in myofilament Ca2+-sensitivity of force generation (pCa50) following an increase in SL in 3SA skinned myocardium compared to WT skinned myocardium. Dynamic XB behavior was assessed at submaximal Ca2+-activations by imposing an acute rapid stretch of 2% of initial muscle length, and measuring both the magnitudes and rates of resultant phases of force decay due to strain-induced XB detachment and delayed force rise due to recruitment of additional XBs with increased SL (i.e., stretch activation). The magnitude (P2) and rate of XB detachment (krel) following stretch was significantly reduced in 3SA skinned myocardium compared to WT skinned myocardium at short and long SL, and prior to and following PKA treatment. Furthermore, the length-dependent acceleration of krel due to decreased SL that was observed in WT skinned myocardium was abolished in 3SA skinned myocardium. PKA treatment accelerated the rate of XB recruitment (kdf) following stretch at both SL's in WT but not in 3SA skinned myocardium. The amplitude of the enhancement in force generation above initial pre-stretch steady-state levels (P3) was not different between WT and 3SA skinned myocardium at any condition measured. However, the magnitude of the entire delayed force phase which can dip below initial pre-stretch steady

  2. In vivo measurements for high dose rate brachytherapy with optically stimulated luminescent dosimeters

    SciTech Connect

    Sharma, Renu; Jursinic, Paul A.

    2013-07-15

    Purpose: To show the feasibility of clinical implementation of OSLDs for high dose-rate (HDR) in vivo dosimetry for gynecological and breast patients. To discuss how the OSLDs were characterized for an Ir-192 source, taking into account low gamma energy and high dose gradients. To describe differences caused by the dose calculation formalism of treatment planning systems.Methods: OSLD irradiations were made using the GammaMedplus iX Ir-192 HDR, Varian Medical Systems, Milpitas, CA. BrachyVision versions 8.9 and 10.0, Varian Medical Systems, Milpitas, CA, were used for calculations. Version 8.9 used the TG-43 algorithm and version 10.0 used the Acuros algorithm. The OSLDs (InLight Nanodots) were characterized for Ir-192. Various phantoms were created to assess calculated and measured doses and the angular dependence and self-absorption of the Nanodots. Following successful phantom measurements, patient measurements for gynecological patients and breast cancer patients were made and compared to calculated doses.Results: The OSLD sensitivity to Ir-192 compared to 6 MV is between 1.10 and 1.25, is unique to each detector, and changes with accumulated dose. The measured doses were compared to those predicted by the treatment planning system and found to be in agreement for the gynecological patients to within measurement uncertainty. The range of differences between the measured and Acuros calculated doses was -10%-14%. For the breast patients, there was a discrepancy of -4.4% to +6.5% between the measured and calculated doses at the skin surface when the Acuros algorithm was used. These differences were within experimental uncertainty due to (random) error in the location of the detector with respect to the treatment catheter.Conclusions: OSLDs can be successfully used for HDR in vivo dosimetry. However, for the measurements to be meaningful one must account for the angular dependence, volume-averaging, and the greater sensitivity to Ir-192 gamma rays than to 6 MV x

  3. eIF1A augments Ago2-mediated Dicer-independent miRNA biogenesis and RNA interference

    NASA Astrophysics Data System (ADS)

    Yi, Tingfang; Arthanari, Haribabu; Akabayov, Barak; Song, Huaidong; Papadopoulos, Evangelos; Qi, Hank H.; Jedrychowski, Mark; Güttler, Thomas; Guo, Cuicui; Luna, Rafael E.; Gygi, Steven P.; Huang, Stephen A.; Wagner, Gerhard

    2015-05-01

    MicroRNA (miRNA) biogenesis and miRNA-guided RNA interference (RNAi) are essential for gene expression in eukaryotes. Here we report that translation initiation factor eIF1A directly interacts with Ago2 and promotes Ago2 activities in RNAi and miR-451 biogenesis. Biochemical and NMR analyses demonstrate that eIF1A binds to the MID domain of Ago2 and this interaction does not impair translation initiation. Alanine mutation of the Ago2-facing Lys56 in eIF1A impairs RNAi activities in human cells and zebrafish. The eIF1A-Ago2 assembly facilitates Dicer-independent biogenesis of miR-451, which mediates erythrocyte maturation. Human eIF1A (heIF1A), but not heIF1A(K56A), rescues the erythrocyte maturation delay in eif1axb knockdown zebrafish. Consistently, miR-451 partly compensates erythrocyte maturation defects in zebrafish with eif1axb knockdown and eIF1A(K56A) expression, supporting a role of eIF1A in miRNA-451 biogenesis in this model. Our results suggest that eIF1A is a novel component of the Ago2-centred RNA-induced silencing complexes (RISCs) and augments Ago2-dependent RNAi and miRNA biogenesis.

  4. Early learners' discrimination of second-language vowels.

    PubMed

    Højen, Anders; Flege, James E

    2006-05-01

    It is uncertain from previous research to what extent the perceptual system retains plasticity after attunement to the native language (L1) sound system. This study evaluated second-language (L2) vowel discrimination by individuals who began learning the L2 as children ("early learners"). Experiment 1 identified procedures that lowered discrimination scores for foreign vowel contrasts in an AXB test (with three physically different stimuli per trial, where "X" was drawn from the same vowel category as "A" or "B"). Experiment 2 examined the AXB discrimination of English vowels by native Spanish early learners and monolingual speakers of Spanish and English (20 per group) at interstimulus intervals (ISIs) of 1000 and 0 ms. The Spanish monolinguals obtained near-chance scores for three difficult vowel contrasts, presumably because they did not perceive the vowels as distinct phonemes and because the experimental design hindered low-level encoding strategies. Like the English monolinguals, the early learners obtained high scores, indicating they had shown considerable perceptual learning. However, statistically significant differences between early learners and English monolinguals for two of three difficult contrasts at the 0-ms ISI suggested that their underlying perceptual systems were not identical. Implications for claims regarding perceptual plasticity following L1 attunement are discussed. PMID:16708962

  5. Nanolipoprotein Particles (NLPs) as Versatile Vaccine Platforms for Co-delivery of Multiple Adjuvants with Subunit Antigens from Burkholderia spp. and F. tularensis - Technical Report

    SciTech Connect

    Fischer, N. O.

    2015-01-13

    The goal of this proposal is to demonstrate that colocalization of protein subunit antigens and adjuvants on nanolipoprotein particles (NLPs) can increase the protective efficacy of subunit antigens from Burkholderia spp. and Francisella tularensis against an aerosol challenge. In the third quarter of the third year, F344 rats vaccinated with adjuvanted NLP formulations were challenged with F. tularensis SCHU S4 at Battelle. Preliminary data indicate that up to 65% of females vaccinated intranasally with an NLP-based formulation survived this challenge, compared to only 20% survival of naïve animals. In addition, NLPs were successfully formulated with Burkholderia protein antigens. IACUC approval for immunological assessments in BALB/c mice was received and we anticipate that these assessments will begin by March 2015, pending ACURO approval.

  6. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal-specific, truncated form of tenascin-X

    SciTech Connect

    Tee, Meng Kian; Thomson, A.A.; Bristow, J.; Miller, W.L.

    1995-07-20

    A compact region in the human class III major histocompatibility locus contains the human genes for the fourth component of human complement (C4) and steroid 21-hydroxylase (P450c21) in one transcriptional orientation, while the gene for the extracellular matrix protein tenascin-X (TN-X) overlaps the last exon of P450c21 on the opposite strand of DNA in the opposite transcriptional orientation. This complex locus is duplicated into A and B loci, so that the organization is 5{prime}-C4A-21A-XA-C4B-21B-XB-3{prime}. Although this duplication event truncated the 65-kb X(B) gene to a 4.5-kb XA gene, the XA gene is transcriptionally active in the adrenal cortex. To examine the basis of the tissue-specific expression of XA and C4B, we cloned the 1763-bp region that lies between the cap sites for XA and C4B and analyzed its promoter activity in both the XA and the C4 orientations. Powerful, liver-specific sequences lie within the first 75 to 138 bp from the C4B cap site, and weaker elements lie within 128 bp of the XA cap site that function in both liver and adrenal cells. Because these 128 bp upstream from the XA cap site are perfectly preserved in the XB gene encoding TN-X, we sought to determine whether a transcript similar to XA arises within the SB gene. RNase protection assays, cDNA cloning, and RT/PCR show that adrenal cells contain a novel transcript, termed short XB (XB-S), which has the same open reading frame as TN-X. Cell-free translation and immunoblotting show that this transcript encodes a novel 74-kDa XB-S protein that is identical to the carboxy-terminal 673 residues of TN-X. Because this protein consists solely of fibronectin type III repeats and a fibrinogen-like domain, it appears to correspond to an evolutionary precursor of the tenascin family of extracellular matrix proteins. 40 refs., 6 figs.

  7. Monte Carlo Investigation on the Effect of Heterogeneities on Strut Adjusted Volume Implant (SAVI) Dosimetry

    NASA Astrophysics Data System (ADS)

    Koontz, Craig

    Breast cancer is the most prevalent cancer for women with more than 225,000 new cases diagnosed in the United States in 2012 (ACS, 2012). With the high prevalence, comes an increased emphasis on researching new techniques to treat this disease. Accelerated partial breast irradiation (APBI) has been used as an alternative to whole breast irradiation (WBI) in order to treat occult disease after lumpectomy. Similar recurrence rates have been found using ABPI after lumpectomy as with mastectomy alone, but with the added benefit of improved cosmetic and psychological results. Intracavitary brachytherapy devices have been used to deliver the APBI prescription. However, inability to produce asymmetric dose distributions in order to avoid overdosing skin and chest wall has been an issue with these devices. Multi-lumen devices were introduced to overcome this problem. Of these, the Strut-Adjusted Volume Implant (SAVI) has demonstrated the greatest ability to produce an asymmetric dose distribution, which would have greater ability to avoid skin and chest wall dose, and thus allow more women to receive this type of treatment. However, SAVI treatments come with inherent heterogeneities including variable backscatter due to the proximity to the tissue-air and tissue-lung interfaces and variable contents within the cavity created by the SAVI. The dose calculation protocol based on TG-43 does not account for heterogeneities and thus will not produce accurate dosimetry; however Acuros, a model-based dose calculation algorithm manufactured by Varian Medical Systems, claims to accurately account for heterogeneities. Monte Carlo simulation can calculate the dosimetry with high accuracy. In this thesis, a model of the SAVI will be created for Monte Carlo, specifically using MCNP code, in order to explore the affects of heterogeneities on the dose distribution. This data will be compared to TG-43 and Acuros calculated dosimetry to explore their accuracy.

  8. Halogen bonding in water results in enhanced anion recognition in acyclic and rotaxane hosts

    NASA Astrophysics Data System (ADS)

    Langton, Matthew J.; Robinson, Sean W.; Marques, Igor; Félix, Vítor; Beer, Paul D.

    2014-12-01

    Halogen bonding (XB), the attractive interaction between an electron-deficient halogen atom and a Lewis base, has undergone a dramatic development as an intermolecular force analogous to hydrogen bonding (HB). However, its utilization in the solution phase remains underdeveloped. Furthermore, the design of receptors capable of strong and selective recognition of anions in water remains a significant challenge. Here we demonstrate the superiority of halogen bonding over hydrogen bonding for strong anion binding in water, to the extent that halide recognition by a simple acyclic mono-charged receptor is achievable. Quantification of iodide binding by rotaxane hosts reveals the strong binding by the XB-rotaxane is driven exclusively by favourable enthalpic contributions arising from the halogen-bonding interactions, whereas weaker association with the HB-rotaxanes is entropically driven. These observations demonstrate the unique nature of halogen bonding in water as a strong alternative interaction to the ubiquitous hydrogen bonding in molecular recognition and assembly.

  9. The elimination of dead center in the controls of airplanes with thick sections

    NASA Technical Reports Server (NTRS)

    Carroll, Thomas

    1922-01-01

    In several instances where control flaps are placed in the trailing edges of thick sections, it has appeared that a dead center (slackness or lack of control) exists about the neutral position. The condition was also experienced in the rudder action of the XB1A observation airplane. Examination of smoke pictures of the airflow around struts and airfoils indicates what may be the cause of the phenomenon. The streamwise airflow about the thick fin does not follow the surface of the rudder, and consequently the rudder can be moved between the boundaries of the intervening turbulent zone without developing an aerodynamic force. In order to alleviate this condition, a modification was designed and built for the XB1A. The modified rudder was intended to remedy the condition by thickening the section sufficiently to fill in the zone of turbulent flow and thus eliminate the dead center. The positive results of flight tests are given.

  10. Tumorigenic Xenopus cells express several maternal and early embryonic mRNAs

    SciTech Connect

    Picard, J.J.; Pelle, R.; Schonne, E.; Dworkin-Rastl, E.; Dworkin, M.B.

    1986-11-01

    Recombinant cDNA libraries were constructed from poly (A)/sup +/ RNA isolated from different stages of oogenesis and embryogenesis from the clawed toad Xenopus laevis. Hybridization analyses were used to describe the accumulation of specific RNAs represented by these cDNA clones in oocytes, embryos, adult liver, a cell line derived from Xenopus borealis embryos (Xb693), and a tumorigenic substrain of that cell line (Xb693T). It was found that from 550 cDNA clones analyses, six sequences accumulate to higher titers in poly(A)/sup +/ RNA isolated from the tumorigenic cell line compared with the nontumorigenic cell line. All six sequences were expressed at high levels during oogenesis. DNA sequencing of these three sequences followed by a computer search of protein data banks has identified them as coding for the glycolytic enzyme enolase, the ATP-ADP carrier protein, and a-tubulin.

  11. Hard Exclusive Reactions at Jlab

    SciTech Connect

    Kubarovsky, Valery P.

    2011-09-20

    Dedicated experiments to study Deeply Virtual Compton Scattering (DVCS) and Deeply Virtual Meson Production (DVMP) have been carried out at Jefferson Lab. DVCS helicity--dependent and helicity--independent cross sections and beam spin asymmetries have been measured, as well as cross sections and asymmetries for the $\\pi^0$, $\\eta$, $\\rho^0$, $\\rho^+$, $\\omega$ and $\\phi$ for exclusive electroproduction. The data were taken in a wide kinematic range in $Q^2$=1--4.5 GeV$^2$, $x_B$=0.1--0.5, and $|t|$ up to 2 GeV$^2$. The presented results offer a unique opportunity to study the structure of the nucleon at the parton level as one has access to Bjorken $x_B$ and momentum transfer to the nucleon $t$ at the same time.

  12. Hall MHD Equilibrium of Accelerated Compact Toroids

    NASA Astrophysics Data System (ADS)

    Howard, S. J.; Hwang, D. Q.; Horton, R. D.; Evans, R. W.; Brockington, S. J.

    2007-11-01

    We examine the structure and dynamics of the compact toroid's magnetic field. The compact toroid is dramatically accelerated by a large rail-gun Lorentz force density equal to j xB. We use magnetic data from the Compact Toroid Injection Experiment to answer the question of exactly where in the system j xB has nonzero values, and to what extent we can apply the standard model of force-free equilibrium. In particular we present a method of analysis of the magnetic field probe signals that allows direct comparison to the predictions of the Woltjer-Taylor force-free model and Turner's generalization of magnetic relaxation in the presence of a non-zero Hall term and fluid vorticity.

  13. Degree of Conversion and BisGMA, TEGDMA, UDMA Elution from Flowable Bulk Fill Composites

    PubMed Central

    Lempel, Edina; Czibulya, Zsuzsanna; Kovács, Bálint; Szalma, József; Tóth, Ákos; Kunsági-Máté, Sándor; Varga, Zoltán; Böddi, Katalin

    2016-01-01

    The degree of conversion (DC) and the released bisphenol A diglycidyl ether dimethacrylate (BisGMA), triethylene glycol dimethacrylate (TEGDMA) and urethane dimethacrylate (UDMA) monomers of bulk-fill composites compared to that of conventional flowable ones were assessed using micro-Raman spectroscopy and high performance liquid chromatography (HPLC). Four millimeter-thick samples were prepared from SureFil SDR Flow (SDR), X-tra Base (XB), Filtek Bulk Fill (FBF) and two and four millimeter samples from Filtek Ultimate Flow (FUF). They were measured with micro-Raman spectroscopy to determine the DC% of the top and the bottom surfaces. The amount of released monomers in 75% ethanol extraction media was measured with HPLC. The differences between the top and bottom DC% were significant for each material. The mean DC values were in the following order for the bottom surfaces: SDR_4mm_20s > FUF_2mm_20s > XB_4mm_20s > FBF_4mm_20s > XB_4mm_10s > FBF_4mm_10s > FUF_4mm_20s. The highest rate in the amount of released BisGMA and TEGDMA was found from the 4 mm-thick conventional flowable FUF. Among bulk-fills, FBF showed a twenty times higher amount of eluted UDMA and twice more BisGMA; meanwhile, SDR released a significantly higher amount of TEGDMA. SDR bulk-fill showed significantly higher DC%; meanwhile XB, FBF did not reach the same level DC, as that of the 2 mm-thick conventional composite at the bottom surface. Conventional flowable composites showed a higher rate of monomer elution compared to the bulk-fills, except FBF, which showed a high amount of UDMA release. PMID:27213361

  14. Mineral Separation in a CELSS by Ion-exchange Chromatography

    NASA Technical Reports Server (NTRS)

    Ballou, E. V.; Spitze, L. A.; Wong, F. W.; Wydeven, T.; Johnson, C. C.

    1982-01-01

    Operational parameters pertinent to ion exchange chromatography separation were identified. The experiments were performed with 9 mm diameter ion exchange columns and conventional column accessories. The cation separation beds were packed with AG 50W-X2 strong acid cation exchange resin in H(+) form and 200-400 dry mesh particle size. The stripper beds used in some experiments were packed with AG 1-XB strong base cation exchange resin in OH(-) form and 200-400 dry mesh particle size.

  15. Molecular control of myocardial mechanics and energetics: the chemo-mechanical conversion.

    PubMed

    Landesberg, A

    1997-01-01

    Energy consumption in the cardiac muscle is characterized by two basic phenomena: 1) The well known linear relationship between energy consumption by the sarcomere and the mechanical energy it generates, and 2) the ability to modulate the generated mechanical energy and energy consumption to the various loading conditions, as is manifested by the Frank-Starling Law and the Fenn effect. These basic phenomena are analyzed here based on coupling calcium kinetics with crossbridge (Xb) cycling. Our previous studies established the existence of two feedback mechanism: 1) a positive feedback mechanism, the cooperativity, whereby the affinity of the troponin for calcium, and hence Xb and actomyosin-ATPase recruitment, depends on the number of force generating Xbs, and 2) a mechanical feedback, whereby the filaments shortening velocity, or the Xb strain rate, determines the rate of Xb turnover from the strong to the weak conformation. The cooperativity mechanism determines the force-length relationship (FLR) and the related Frank-Starling Law. It also provides the basis for the regulation of energy consumption and the ability of the muscle to adapt its energy consumption to the loading conditions. The mechanical feedback regulates the shortening velocity and provides the analytical solution for the experimentally derived Hill's equation for the force-velocity relationship (FVR). The mechanical feedback regulates the generated power and provides the linear relationship between energy consumption and the generated mechanical energy, i.e., the external work done and the liberated heat. Thus, the two feedback mechanisms that regulate sarcomere dynamics, and determine the FLR and FVR, also regulate the energy consumption and the mechanical energy generated by the muscle.

  16. Observation of two distinct negative trions in tungsten disulfide monolayers

    NASA Astrophysics Data System (ADS)

    Boulesbaa, Abdelaziz; Huang, Bing; Wang, Kai; Lin, Ming-Wei; Mahjouri-Samani, Masoud; Rouleau, Christopher; Xiao, Kai; Yoon, Mina; Sumpter, Bobby; Puretzky, Alexander; Geohegan, David

    2015-09-01

    Ultrafast pump-probe spectroscopy of two-dimensional tungsten disulfide monolayers (2 D W S2) grown on sapphire substrates revealed two transient absorption spectral peaks that are attributed to distinct negative trions at ˜2.02 eV (T1) and ˜1.98 eV (T2) . The dynamics measurements indicate that trion formation by the probe is enabled by photodoped 2D WS2 crystals with electrons remaining after trapping of holes from excitons or free electron-hole pairs at defect sites in the crystal or on the substrate. Dynamics of the characteristic absorption bands of excitons XA and XB at ˜2.03 and ˜2.40 eV , respectively, were separately monitored and compared to the photoinduced absorption features. Selective excitation of the lowest exciton level XA using λpump<2.4 eV forms only trion T1, implying that the electron remaining from dissociation of exciton XA is involved in the creation of this trion with a binding energy ˜10 meV with respect to XA. The absorption peak corresponding to trion T2 appears when λpump<2.4 eV , which is just sufficient to excite exciton XB. The dynamics of trion T2 formation are found to correlate with the disappearance of the bleach of the XB exciton, indicating the involvement of holes participating in the bleach dynamics of exciton XB. Static electrical-doping photoabsorption measurements confirm the presence of an induced absorption peak similar to that of T2. Since the proposed trion formation process here involves exciton dissociation through hole trapping by defects in the 2D crystal or substrate, this discovery highlights the strong role of defects in defining optical and electrical properties of 2D metal chalcogenides, which is relevant to a broad spectrum of basic science and technological applications.

  17. Degree of Conversion and BisGMA, TEGDMA, UDMA Elution from Flowable Bulk Fill Composites.

    PubMed

    Lempel, Edina; Czibulya, Zsuzsanna; Kovács, Bálint; Szalma, József; Tóth, Ákos; Kunsági-Máté, Sándor; Varga, Zoltán; Böddi, Katalin

    2016-01-01

    The degree of conversion (DC) and the released bisphenol A diglycidyl ether dimethacrylate (BisGMA), triethylene glycol dimethacrylate (TEGDMA) and urethane dimethacrylate (UDMA) monomers of bulk-fill composites compared to that of conventional flowable ones were assessed using micro-Raman spectroscopy and high performance liquid chromatography (HPLC). Four millimeter-thick samples were prepared from SureFil SDR Flow (SDR), X-tra Base (XB), Filtek Bulk Fill (FBF) and two and four millimeter samples from Filtek Ultimate Flow (FUF). They were measured with micro-Raman spectroscopy to determine the DC% of the top and the bottom surfaces. The amount of released monomers in 75% ethanol extraction media was measured with HPLC. The differences between the top and bottom DC% were significant for each material. The mean DC values were in the following order for the bottom surfaces: SDR_4mm_20s > FUF_2mm_20s > XB_4mm_20s > FBF_4mm_20s > XB_4mm_10s > FBF_4mm_10s > FUF_4mm_20s. The highest rate in the amount of released BisGMA and TEGDMA was found from the 4 mm-thick conventional flowable FUF. Among bulk-fills, FBF showed a twenty times higher amount of eluted UDMA and twice more BisGMA; meanwhile, SDR released a significantly higher amount of TEGDMA. SDR bulk-fill showed significantly higher DC%; meanwhile XB, FBF did not reach the same level DC, as that of the 2 mm-thick conventional composite at the bottom surface. Conventional flowable composites showed a higher rate of monomer elution compared to the bulk-fills, except FBF, which showed a high amount of UDMA release. PMID:27213361

  18. Influence of vehicle configuration and flight profile on X-30 sonic booms

    NASA Astrophysics Data System (ADS)

    Maglieri, Domenic J.; Sothcott, Victor E.; Hicks, John

    1990-10-01

    The role of vehicle configuration and the flight profile on sonic booms produced by the experimental NASP X-30 is investigated. Sonic boom signatures, overpressure levels, and footprints for X-30 are presented and compared with sonic boom measurements for F-104, SR-71, Concorde, XB-70, and STS Orbiter. Results show that the sonic boom signatures for X-30 fall within those of previous high-speed planes.

  19. Dilated Cardiomyopathy Mutation (R134W) in Mouse Cardiac Troponin T Induces Greater Contractile Deficits against α-Myosin Heavy Chain than against β-Myosin Heavy Chain

    PubMed Central

    Gollapudi, Sampath K.; Chandra, Murali

    2016-01-01

    Many studies have demonstrated that depressed myofilament Ca2+ sensitivity is common to dilated cardiomyopathy (DCM) in humans. However, it remains unclear whether a single determinant—such as myofilament Ca2+ sensitivity—is sufficient to characterize all cases of DCM because the severity of disease varies widely with a given mutation. Because dynamic features dominate in the heart muscle, alterations in dynamic contractile parameters may offer better insight on the molecular mechanisms that underlie disparate effects of DCM mutations on cardiac phenotypes. Dynamic features are dominated by myofilament cooperativity that stem from different sources. One such source is the strong tropomyosin binding region in troponin T (TnT), which is known to modulate crossbridge (XB) recruitment dynamics in a myosin heavy chain (MHC)-dependent manner. Therefore, we hypothesized that the effects of DCM-linked mutations in TnT on contractile dynamics would be differently modulated by α- and β-MHC. After reconstitution with the mouse TnT equivalent (TnTR134W) of the human DCM mutation (R131W), we measured dynamic contractile parameters in detergent-skinned cardiac muscle fiber bundles from normal (α-MHC) and transgenic mice (β-MHC). TnTR134W significantly attenuated the rate constants of tension redevelopment, XB recruitment dynamics, XB distortion dynamics, and the magnitude of length-mediated XB recruitment only in α-MHC fiber bundles. TnTR134W decreased myofilament Ca2+ sensitivity to a greater extent in α-MHC (0.14 pCa units) than in β-MHC fiber bundles (0.08 pCa units). Thus, our data demonstrate that TnTR134W induces a more severe DCM-like contractile phenotype against α-MHC than against β-MHC background. PMID:27757084

  20. Deforestation offsets water balance changes due to climate variability in the Xingu River in eastern Amazonia

    NASA Astrophysics Data System (ADS)

    Panday, Prajjwal K.; Coe, Michael T.; Macedo, Marcia N.; Lefebvre, Paul; Castanho, Andrea D. de Almeida

    2015-04-01

    Deforestation reduced forest cover in Brazil's Xingu River Basin (XB; area: 510,000 km2) from 90% of the basin in the 1970s to 75% in the 2000s. Such large-scale land cover changes can substantially alter regional water budgets, but their influence can be difficult to isolate from that of natural climate variability. In this study, we estimate changes to the XB water balance from the 1970s to the 2000s due to climate variations and deforestation, using a combination of long-term observations of rainfall and discharge; satellite-based estimates of evapotranspiration (MODIS) and surface water storage (GRACE); and numerical modeling estimates (IBIS) of water budget components (evapotranspiration, soil moisture, and discharge). Model simulations over this period suggest that climate variations alone accounted for a -82 mm decrease (mean per unit area) in annual discharge (-14%, from 8190 m3 s-1 to 7806 m3 s-1), due to a -2% decrease in precipitation and +3% increase in evapotranspiration. Deforestation alone caused a +34 mm increase in annual discharge (+6%), as a result of a -3% decrease in evapotranspiration and +1% increase in soil moisture across the XB. Climate variability and land cover change thus had opposite effects on the XB water balance, with climate effects masking deforestation-induced changes to the water budget. Protected areas, which cover 55% of the basin, have helped to mitigate the effects of past deforestation on water recycling in the Xingu. However, our results suggest that continued deforestation outside protected areas could trigger changes of sufficient magnitude to offset climate variability.

  1. Functional analysis of a RING domain ankyrin repeat protein that is highly expressed during flower senescence.

    PubMed

    Xu, Xinjia; Jiang, Cai-Zhong; Donnelly, Linda; Reid, Michael S

    2007-01-01

    A gene encoding a RING zinc finger ankyrin repeat protein (MjXB3), a putative E3 ubiquitin ligase, is highly expressed in petals of senescing four o'clock (Mirabilis jalapa) flowers, increasing >40,000-fold during the onset of visible senescence. The gene has homologues in many other species, and the Petunia homologue is strongly up-regulated in senescing Petunia corollas. Silencing the expression of this gene in Petunia, using virus-induced gene silencing, resulted in a 2 d extension in flower life. In Mirabilis, a 2 kb promoter region, 5' upstream of the MjXB3 gene, was isolated. The promoter sequence included putative binding sites for many DNA-binding proteins, including the bZIP, Myb, homeodomain-leucine zipper (HD-Zip), MADS-box, and WRKY transcription factors. The construct containing a 1 kb promoter region immediately upstream of the MjXB3 gene drove the strongest expression of the beta-glucuronidase (GUS) reporter gene in a transient expression assay. In Petunia, GUS expression under the control of this heterologous promoter fragment was specific to senescing flowers. The Mirabilis promoter GUS construct was tested in other flower species; while GUS activity in carnation petals was high during senescence, no expression was detected in three monocotyledonous flowers--daylily (Hemerocallis 'Stella d'Oro'), daffodil (Narcissus pseudonarcissus 'King Alfred'), and orchid (Dendrobium 'Emma White'). PMID:18057040

  2. Tuning protein-protein interactions using cosolvents: specific effects of ionic and non-ionic additives on protein phase behavior.

    PubMed

    Hansen, Jan; Platten, Florian; Wagner, Dana; Egelhaaf, Stefan U

    2016-04-21

    Cosolvents are routinely used to modulate the (thermal) stability of proteins and, hence, their interactions with proteins have been studied intensely. However, less is known about their specific effects on protein-protein interactions, which we characterize in terms of the protein phase behavior. We analyze the phase behavior of lysozyme solutions in the presence of sodium chloride (NaCl), guanidine hydrochloride (GuHCl), glycerol, and dimethyl sulfoxide (DMSO). We experimentally determined the crystallization boundary (XB) and, in combination with data on the cloud-point temperatures (CPTs), the crystallization gap. In agreement with other studies, our data indicate that the additives might affect the protein phase behavior through electrostatic screening and additive-specific contributions. At high salt concentrations, where electrostatic interactions are screened, both the CPT and the XB are found to be linear functions of the additive concentration. Their slopes quantify the additive-specific changes of the phase behavior and thus of the protein-protein interactions. While the specific effect of NaCl is to induce attractions between proteins, DMSO, glycerol and GuHCl (with increasing strength) weaken attractions and/or induce repulsions. Except for DMSO, changes of the CPT are stronger than those of the XB. Furthermore, the crystallization gap widens in the case of GuHCl and glycerol and narrows in the case of NaCl. We relate these changes to colloidal interaction models, namely square-well and patchy interactions. PMID:27020538

  3. Observation of Nuclear Scaling in the A(e,e{prime}) Reaction at x{sub B} > 1

    SciTech Connect

    Kim Egiyan; Natalya Dashyan; Misak Sargsian; Stepan Stepanyan; Lawrence Weinstein; et. al.

    2003-07-01

    The ratios of inclusive electron scattering cross sections of 4He, 12C, and 56Fe to 3He have been measured for the first time. It is shown that these ratios are independent of xB at Q2 > 1.4 GeV2 for xB > 1.5, where the inclusive cross section depends primarily on the high momentum components of the nuclear wave function. The observed scaling shows that the momentum distributions at high-momenta have the same shape for all nuclei and differ only by a scale factor. The observed onset of the scaling at Q2 > 1.4 GeV2 and xB > 1.5 is consistent with the kinematical expectation that two-nucleon short range correlations (SRC) dominate the nuclear wave function at pm300 MeV/c. The values of these ratios in the scaling region can be related to the relative probabilities of SRC in nuclei with A3. Our data, combined with calculations and other measurements of the 3He/deuterium ratio, demonstrate that for nuclei with A12 these probabilities are 4.9-5.9 times larger than in deuterium, while for 4He it is larger by a factor of about 3.8.

  4. Hand/eye calibration of a robot arm with a 3D visual sensor

    NASA Astrophysics Data System (ADS)

    Kim, Min-Young; Cho, Hyungsuck; Kim, Jae H.

    2001-10-01

    Hand/eye calibration is useful in many industrial applications, for instance, grasping objects or reconstructing 3D scenes. The calibration of robot systems with a visual sensor is essentially the calibration of a robot, a sensor, and hand-to-eye relation. This paper describes a new technique for computing 3D position and orientation of a 3D visual sensor system relative to the end effector of a robot manipulator in an eye-on-hand robot configuration. When the position of feature points on a calibration target in sensor coordinates viewed at each robot movement, and the position of these points in world coordinates and the relative robot movement between two robot motions are known, a homogeneous equation of the form AX equals XB can be derived. To obtain the unique solution of X, it is necessary to make two relative robot arm movements and to form a system of two equations of the form: A1X equals XB1 and A2X equals XB2. In this paper, a closed-form solution of this calibration system is derived, and the constraints for existence of a unique solution are described in detail. Test results obtained through a series of simulation show that this technique is a simple, efficient, and accurate method for hand/eye calibration.

  5. [Effects of xinshuaikang granule on cardiac function and atrial natriuretic polypeptide levels in rabbits with experimental congestive heart failure].

    PubMed

    Jin, X C; Sun, J Z; Wang, X

    1996-07-01

    Xinshuaikang (XSK) granule mainly consisted of Radix Ginseng, Aconifum carmichaeli, Ligustici wallichii, Semen Lepidii seu Descurainiae, etc. Thirty-five white rabbits of Japanese strain with big ears were used and five groups were divided randomly. The models of chronic heart failure (CHF) was made by injection of adriamycin through the marginal vein of rabbit's ear. Only one group without adriamycin injection was taken as blank group. After the making of models, Xinbao (XB) was used to treat one group which was regarded as control group, XSK was used to treat two model groups, one used higher dose, the other one used lower dose. Fifteen days was taken as a course of treatment. The results were: the body weight of all model groups was heavier than that without adriamycin. After a course of treatment, the body weight of the groups treated by XSK or XB decreased rapidly, the general conditions of the three groups were improved; the two drugs could reduce heart rate and enhance heart function, at the same time they reduced the level of atrial natriuretic polypeptide (ANP) in plasma. The best results was obtained in XSK group with higher dose, the effect of XSK group with lower dose was equivalent to that of XB group. Hence, XSK granule could enhance the CHF rabbits' heart function, improve their heart endocrine activity, this drug had a reliable effect on CHF.

  6. Cadherin transfection of Xenopus XTC cells downregulates expression of substrate adhesion molecules.

    PubMed

    Finnemann, S; Kühl, M; Otto, G; Wedlich, D

    1995-09-01

    Cadherins are discussed not in terms of their adhesive function but rather as morphoregulatory proteins. Changes in gene expression following cadherin transfection of cells in culture or by overexpression in embryos have, until now, not been reported. We established a protocol for stable transfection of Xenopus XTC cells and generated cells bearing high levels of membrane-integrated mouse uvomorulin (E-cadherin) or Xenopus XB-cadherin. These cell lines showed drastically impaired substrate adhesion on fibronectin and laminin. In immunoblot and radioimmunoprecipitation experiments, we found that fibronectin and alpha 3/beta 1 integrin are downregulated. The reduced amounts of proteins result from a decrease of the respective mRNAs as proven by RNase protection assays. Coprecipitations revealed that transfected cadherin molecules are complexed with alpha-catenin and beta-catenin at plasma membranes. However, the alpha-catenin present in the XB-cadherin complex differs immunologically from that found in the uvomorulin complex. When a truncated form of XB-cadherin lacking 38 of the most C-terminal amino acids was expressed in XTC cells, complex formation with endogenous catenins was abolished. In these transfectants, substrate adhesion was not affected. These results prove that complex formation of transfected cadherins in XTC cells with endogenous beta-catenin correlates with altered synthesis of certain substrate adhesion molecules.

  7. Passivating boron silicate glasses for co-diffused high-efficiency n-type silicon solar cell application

    SciTech Connect

    Engelhardt, Josh Frey, Alexander; Gloger, Sebastian; Hahn, Giso; Terheiden, Barbara

    2015-07-27

    Doping layers commonly have but one function: supplying the dopants to form a doped region within a substrate. This work presents B doping layers/stacks, which at the same time supply dopant atoms, passivate the B-doped crystalline Si surface sufficiently well (j{sub 0E} < 50 fA/cm{sup 2}), and show optical properties suitable for anti-reflective coating. Furthermore, these boron silicate glasses can act as a barrier against parasitic P in-diffusion during a co-diffusion step. The boron emitters diffused from the inductively coupled plasma plasma-enhanced chemical vapor-deposited B containing SiO{sub x} layers are investigated and optimized concerning passivation quality and contact properties for high-efficiency n-type solar Si cell designs. It is shown that even 10 nm thin SiO{sub x}:B films already allow for suitable emitter sheet resistance for screen-printed contacts. Furthermore, SiO{sub x}:B layers presented here allow for iV{sub OC} values of 675 mV and contact resistivity of 1 mΩcm{sup 2} for commercial Ag instead of Ag/Al pastes on the diffused boron emitter passivated with the SiO{sub x}:B layer supporting the contact formation. All of these properties can be achieved within one single B doping layer/stack.

  8. Orthogonal hydrogen/halogen bonding in 1-(2-methoxyphenyl)-1H-imidazole-2(3H)-thione-I2 adduct: An experimental and theoretical study

    NASA Astrophysics Data System (ADS)

    El-Sheshtawy, Hamdy S.; Ibrahim, Mohamed M.; El-Mehasseb, Ibrahim; El-Kemary, Maged

    2015-05-01

    The molecular complex between 1-(2-methoxyphenyl)-1H-imidazole-2(3H)-thione (HmimOMe) and iodine (I2) was investigated. Single crystal of [(HmimOMe)radI2] adduct was grown by slow evaporation technique from chloroform at room temperature. Spectroscopic techniques such as FT-IR and Raman techniques, as well as elemental and thermal analysis were used to characterize the complex. The crystal structure shows that the formed adduct stabilized by two noncovalent interactions, namely, hydrogen bond (HB) and halogen bond (XB). Orthogonal HB/XB associated with iodine atom (I) was observed and fully characterized. The ability of iodine to behave as hydrogen bond acceptor and halogen bond donor was held responsible for the orthogonal HB/XB presence. In addition, the structure of HmimOMeradI2 was investigated theoretically using MP2/aug-cc-pVDZ level of theory. Natural bond orbital analysis (NBO) was used to investigate the molecular orbitals interactions and orbitals stabilization energies.

  9. Studies of Antimicrobial Activities of some 4-Thiazolidinone Fused Pyrimidines, [1,5]-Benzodiazepines and their Oxygen Substituted Hydroxylamine Derivatives.

    PubMed

    Singh, Bhawani; Maheshwari, A; Dak, G; Sharma, K; Talesara, G L

    2010-09-01

    Thiazolidin-4-one fused pyrimidines, [1,5]-benzodiazepines and their oxygen substituted hydroxylamine derivatives have been screened for antibacterial, antifungal and antimalarial activity. Bacillus subtilis, Escherichia coli, Proteus mirabilis and Salmonella typhi were used for antibacterial screening. Aspergillus fumigatus and Candida albicans were used for antifungal screening and Plasmodium species were used for antimalarial screening. The antibacterial and antifungal activities are expressed in terms of zone of inhibition and antimalarial activity is expressed in IC(50) value. Fifteen compounds 2Xa, 2Xb, 2Xc, 2Xs, 3IV, 3Va, 3Vc, 3VIIIa, 3VIIIh, 3IXa, 3IXb, 3IXc, 3Xa, 4IXa and 4Xa were tested for antibacterial as well as antifungal activity and seven compounds 2IXb, 2Xb, 3VIIIc, 3Xc, 4IXa, 4Xa and 4IXw were tested for antimalarial activity. Streptomycin, griseofulvin and chloroquine were taken as standard drugs in antibacterial, antifungal and antimalarial activity, respectively. The compound 2Xs was found significant antimicrobial against Bacillus subtilis, E. coli, Aspergillus fumigatus and Candida albicans as well as compound 3Xa was significant antimicrobial against Bacillus subtilis, E. coli, Salmonella typhi, Aspergillus fumigatus and Candida albicans. The compound 2Xb showed significant antimalarial activity.

  10. Deeply Virtual Exclusive Reactions with CLAS

    SciTech Connect

    Kubarovsky, Valery

    2011-03-01

    Deeply virtual exclusive reactions offer an unique opportunity to study the structure of the nucleon at the parton level as one has access to Bjorken xB and momentum transfer to the nucleon t at the same time. Such processes can reveal much more information about the structure of the nucleon than either inclusive electroproduction or elastic form factors alone. Dedicated experiments to study Deeply Virtual Compton Scattering (DVCS) and Deeply VirtualMeson Production (DVMP) have been carried out in Hall B at Jefferson Lab. DVCS helicity–dependent and helicity–independent cross sections and beam spin asymmetries have been measured with CLAS, as well as cross sections and asymmetries for the p 0, h, r 0, r+, w and f for exclusive electroproduction. The data were taken in a wide kinematic range in Q2=1–4.5 GeV2, xB=0.1–0.5, and |t| up to 2 GeV2. We will discuss the interpretation of these data in terms of traditional Regge and Generalized Parton Distributions models. We view the work presented in this report as leading into the program of the Jefferson Lab 12 GeV upgrade. The increased energy and luminosity will allow us to acquire data at much higher Q2 and xB, and perform Rosenbluth L/T separations of the cross sections.

  11. A Comparison of Epithelial Cells, Fibroblasts, and Osteoblasts in Dental Implant Titanium Topographies

    PubMed Central

    Teng, Fu-Yuan; Ko, Chia-Ling; Kuo, Hsien-Nan; Hu, Jin-Jia; Lin, Jia-Horng; Lou, Ching-Wen; Hung, Chun-Cheng; Wang, Yin-Lai; Cheng, Cheng-Yi; Chen, Wen-Cheng

    2012-01-01

    The major challenge for dental implants is achieving optimal esthetic appearance and a concept to fulfill this criterion is evaluated. The key to an esthetically pleasing appearance lies in the properly manage the soft tissue profile around dental implants. A novel implant restoration technique on the surface was proposed as a way to augment both soft- and hard-tissue profiles at potential implant sites. Different levels of roughness can be attained by sandblasting and acid etching, and a tetracalcium phosphate was used to supply the ions. In particular, the early stage attaching and repopulating abilities of bone cell osteoblasts (MC3T3-E1), fibroblasts (NIH 3T3), and epithelial cells (XB-2) were evaluated. The results showed that XB-2 cell adhesive qualities of a smooth surface were better than those of the roughened surfaces, the proliferative properties were reversed. The effects of roughness on the characteristics of 3T3 cells were opposite to the result for XB-2 cells. E1 proliferative ability did not differ with any statistical significance. These results suggest that a rougher surface which provided calcium and phosphate ions have the ability to enhance the proliferation of osteoblast and the inhibition of fibroblast growth that enhance implant success ratios. PMID:22287942

  12. Structural and physical properties in the system ZnO-B 2O 3-P 2O 5-R nO m

    NASA Astrophysics Data System (ADS)

    Li, Shengchun; Chen, Pei; Li, Yaogang

    2010-12-01

    The glass forming region in the quaternary system ZnO-B 2O 3-P 2O 5-R nO m has been determined. Glass transition temperature ( Tg), glass density ( ρ), thermal expansion coefficient ( α) and weight loss percentage ( WL) of these glasses were measured. The structure of (90- x- y)ZnO- xB 2O 3- yP 2O 5-10R nO m glass was characterized by infrared spectra (IR), Raman spectra and X-ray diffraction (XRD). Results of IR and Raman indicated that B 2O 3 participated in the glass network as a glass modifier and the IR band around 1440 cm -1 was ascribed to the v as(B-O-B) vibrations. Glass intensity increased with increase in B 2O 3 content. The disappearance of v s(P-O-P) vibration around 760 cm -1 indicated that P-O-B linkage was formed. XRD results revealed that the major crystalline phase changes with substitution of different amounts of B 2O 3: Zn 2P 2O 7 for 45ZnO- xB 2O 3-35P 2O 5-10R nO m glass, where x=0-20, and BPO 4 for 45ZnO- xB 2O 3-35P 2O 5-10R nO m glass, where x=30-40.

  13. Measurement of Exclusive $π^0$ Electroproduction Structure Functions and their Relationship to Transverse Generalized Parton Distributions

    SciTech Connect

    Bedlinskiy, Ivan; Niccolai, Silvia; Stoler, Paul; Adhikari, Krishna; Aghasyan, Mher; Amaryan, Moskov; Anghinolfi, Marco; Avagyan, Harutyun; Baghdasaryan, Hovhannes; Ball, Jacques; Baltzell, Nathan; Battaglieri, Marco; Bennett, Robert; Biselli, Angela; Bookwalter, Craig; Boyarinov, Sergey; Briscoe, William; Brooks, Williams; Burkert, Volker; Carman, Daniel; Celentano, Andrea; Chandavar, Shloka; Charles, Gabriel; Contalbrigo, Marco; Crede, Volker; D'Angelo, Annalisa; Daniel, Aji; Dashyan, Natalya; De Vita, Raffaella; De Sanctis, Enzo; Deur, Alexandre; Djalali, Chaden; Doughty, David; Dupre, Raphael; Egiyan, Hovanes; El Alaoui, Ahmed; Elfassi, Lamiaa; Elouadrhiri, Latifa; Eugenio, Paul; Fedotov, Gleb; Fegan, Stuart; Fleming, Jamie; Forest, Tony; Garcon, Michel; Gevorgyan, Nerses; Giovanetti, Kevin; Girod, Francoi-Xavier; Gohn, Wesley; Gothe, Ralf; Graham, Lewis; Griffioen, Keith; Guegan, Baptiste; Guidal, Michel; Guo, Lei; Hafidi, Kawtar; Hakobyan, Hayk; Hanretty, Charles; Heddle, David; Hicks, Kenneth; Holtrop, Maurik; Ilieva, Yordanka; Ireland, David; Ishkhanov, Boris; Isupov, Evgeny; Jo, Hyon-Suk; Joo, Kyungseon; Keller, Dustin; Khanddaker, Mahbubul; Khertarpal, Puneet; Kim, Andrey; Kim, Wooyoung; Klein, Franz; Koirala, Suman; Kubarovsky, A; Kuhn, Sebastian; Kuleshov, Sergey; Kvaltine, Nicholas; Livingston, Kenneth; Lu, Haiyun; MacGregor, Ian; Mao, Yuqing; Markov, Nikolai; Martinez, D; Mayer, Michael; McKinnon, Bryan; Meyer, Curtis; Mineeva, Taisiya; Mirazita, Marco; Mokeev, Viktor; Moutarde, Herve; Munevar Espitia, Edwin; Munoz Camacho, Carlos; Nadel-Turonski, Pawel; Niculescu, Gabriel; Niculescu, Maria-Ioana; Osipenko, Mikhail; Ostrovidov, Alexander; Pappalardo, Luciano; Permuzyan, Rafayel; Park, Kijun; Park, Sungkyun; Pasyuk, Eugene; Pereira, Sergio; Phelps, Evan; Pisano, Silvia; Pogorelko, Oleg; Pozdnyakov, Sergey; Price, John; Procureur, Sebastien; Prok, Yelena; Protopopescu, Dan; Puckett, Andrew; Raue, Brian; Ricco, Giovanni; Rimal, Dipak; Ripani, Marco; Rosner, Guenther; Rossi, Patrizia; Sabatie, Franck; Saini, Mukesh; Salgado, Carlos; Saylor, Nicholas; Schott, Diane; Schumacher, Reinhard; Seder, Erin; Seraydaryan, Heghine; Sharabian, Youri; Smith, Gregory; Sober, Daniel; Sokhan, Daria; Stepanyan, Samuel; Strauch, Steffen; Taiuti, Mauro; Tang, Wei; Taylor, Charles; Tian, Ye; Tkachenko, Svyatoslav; Ungaro, Maurizio; Vineyard, Michael; Vlasov, Alexander; Voskanyan, Hakob; Voutier, Eric; Walford, Natalie; Watts, Daniel; Weinstein, Lawrence; Weygan, Dennis; Wood, Michael; Zachariou, Nicholas; Zhang, Jixie; Zhao, Zhiwen; Zonta, Irene

    2012-09-01

    Exclusive $\\pi^0$ electroproduction at a beam energy of 5.75 GeV has been measured with the Jefferson Lab CLAS spectrometer. Differential cross sections were measured at more than 1800 kinematic values in $Q^2$, $x_B$, $t$, and $\\phi_\\pi$, in the $Q^2$ range from 1.0 to 4.6 GeV$^2$,\\ $-t$ up to 2 GeV$^2$, and $x_B$ from 0.1 to 0.58. Structure functions $\\sigma_T +\\epsilon \\sigma_L, \\sigma_{TT}$ and $\\sigma_{LT}$ were extracted as functions of $t$ for each of 17 combinations of $Q^2$ and $x_B$. The data were compared directly with two handbag-based calculations including both longitudinal and transversity GPDs. Inclusion of only longitudinal GPDs very strongly underestimates $\\sigma_T +\\epsilon \\sigma_L$ and fails to account for $\\sigma_{TT}$ and $\\sigma_{LT}$, while inclusion of transversity GPDs brings the calculations into substantially better agreement with the data. There is very strong sensitivity to the relative contributions of nucleon helicity flip and helicity non-flip processes. The results confirm that exclusive $\\pi^0$ electroproduction offers direct experimental access to the transversity GPDs.

  14. Electron Bernstein wave heating by electron cyclotron wave injection from the high-field side in LHD

    NASA Astrophysics Data System (ADS)

    Yoshimura, Y.; Igami, H.; Kubo, S.; Shimozuma, T.; Takahashi, H.; Nishiura, M.; Ohdachi, S.; Tanaka, K.; Ida, K.; Yoshinuma, M.; Suzuki, C.; Ogasawara, S.; Makino, R.; Idei, H.; Kumazawa, R.; Mutoh, T.; Yamada, H.; the LHD Experiment Group

    2013-06-01

    In the Large Helical Device (LHD), evident electron Bernstein wave (EBW) heating was successfully performed. The experiment was carried out using the electron cyclotron heating (ECH) system that was upgraded by installation of high-power, long-pulse 77 GHz gyrotrons. The EBW heating was achieved by a mode conversion from injected EC wave to EBW, by the so-called slow-XB technique where an X-mode wave is injected to the plasma from the high magnetic field side. The specific magnetic configuration of LHD provides a good opportunity to realize the slow-XB technique, which is generally difficult for tokamaks. With the slow-XB technique, increases in kinetically evaluated electron energy Wpe and electron temperature Te were observed in overdense plasmas. An electron heating in the so-called super dense core plasma in LHD, which is characterized with an internal diffusion barrier and a steep density gradient at the plasma core, was successfully demonstrated in the plasma core region where the central electron density ne0 of 17 × 1019 m-3 was about 1.2 times higher, at the beginning of the EC-wave injection, than the left-hand cut-off density of applied 77 GHz EC waves.

  15. Specific test and evaluation plan

    SciTech Connect

    Hays, W.H.

    1998-03-20

    The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AX-B Valve Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system`s performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation.

  16. How Does Word Length Evolve in Written Chinese?

    PubMed

    Chen, Heng; Liang, Junying; Liu, Haitao

    2015-01-01

    We demonstrate a substantial evidence that the word length can be an essential lexical structural feature for word evolution in written Chinese. The data used in this study are diachronic Chinese short narrative texts with a time span of over 2000-years. We show that the increase of word length is an essential regularity in word evolution. On the one hand, word frequency is found to depend on word length, and their relation is in line with the Power law function y = ax-b. On the other hand, our deeper analyses show that the increase of word length results in the simplification in characters for balance in written Chinese. Moreover, the correspondence between written and spoken Chinese is discussed. We conclude that the disyllabic trend may account for the increase of word length, and its impacts can be explained in "the principle of least effort".

  17. How Does Word Length Evolve in Written Chinese?

    PubMed Central

    Chen, Heng; Liang, Junying; Liu, Haitao

    2015-01-01

    We demonstrate a substantial evidence that the word length can be an essential lexical structural feature for word evolution in written Chinese. The data used in this study are diachronic Chinese short narrative texts with a time span of over 2000-years. We show that the increase of word length is an essential regularity in word evolution. On the one hand, word frequency is found to depend on word length, and their relation is in line with the Power law function y = ax-b. On the other hand, our deeper analyses show that the increase of word length results in the simplification in characters for balance in written Chinese. Moreover, the correspondence between written and spoken Chinese is discussed. We conclude that the disyllabic trend may account for the increase of word length, and its impacts can be explained in "the principle of least effort". PMID:26384237

  18. Algebraic Proof of the Distributive Law for Vector Multiplication

    NASA Astrophysics Data System (ADS)

    Korn, Charles

    2014-03-01

    Courses in first year mechanics generally start with an introduction to vector methods which include scalar and vector multiplication1. While the demonstration of the validity of the distributive law for scalar multiplication is straightforward, this is not so for vector multiplication. The latter requires complicated geometrical visualization, so its proof is often skipped1. Neither the commutative nor associative law holds for vector multiplication, so there is no a priori reason that the distributive law should hold. In this paper we present an algebraic approach to the proof that requires no geometric visualization. It is based on two relations: (1) the distributive law for scalar multiplication and (2) a*(bxc) =c*(axb) =b*(cxa). 1. e.g. C. Kittlel, W.D. Knight, M.A. Ruderman, Mechanics, Berkeley Physics Course Vol. 1, 2nd ed. McGraw Hill, pp34-39.

  19. Norms of certain Jordan elementary operators

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoli; Ji, Guoxing

    2008-10-01

    Let be a complex Hilbert space and let denote the algebra of all bounded linear operators on . For , the Jordan elementary operator UA,B is defined by UA,B(X)=AXB+BXA, . In this short note, we discuss the norm of UA,B. We show that if and ||UA,B||=||A||||B||, then either AB* or B*A is 0. We give some examples of Jordan elementary operators UA,B such that ||UA,B||=||A||||B|| but AB*[not equal to]0 and B*A[not equal to]0, which answer negatively a question posed by M. Boumazgour in [M. Boumazgour, Norm inequalities for sums of two basic elementary operators, J. Math. Anal. Appl. 342 (2008) 386-393].

  20. Low ambient temperature during early postnatal development fails to cause a permanent induction of brown adipocytes

    PubMed Central

    Chabowska-Kita, Agnieszka; Trabczynska, Anna; Korytko, Agnieszka; Kaczmarek, Monika M.; Kozak, Leslie P.

    2015-01-01

    The brown adipocyte phenotype (BAP) in white adipose tissue (WAT) is transiently induced in adult mammals in response to reduced ambient temperature. Since it is unknown whether a cold challenge can permanently induce brown adipocytes (BAs), we reared C57BL/6J (B6) and AxB8/PgJ (AxB8) mice at 17 or 29°C from birth to weaning, to assess the BAP in young and adult mice. Energy balance measurements showed that 17°C reduced fat mass in the preweaning mice by increasing energy expenditure and suppressed diet-induced obesity in adults. Microarray analysis of global gene expression of inguinal fat (ING) from 10-day-old (D) mice indicates that expression at 17°C vs. 29°C was not different. Between 10 and 21 days of age, the BAP was induced coincident with morphologic remodeling of ING and marked changes in expression of neural development genes (e.g., Akap 12 and Ngfr). Analyses of Ucp1 mRNA and protein showed that 17°C transiently increased the BAP in ING from 21D mice; however, BAs were unexpectedly present in mice reared at 29°C. The involution of the BAP in WAT occurred after weaning in mice reared at 23°C. Therefore, the capacity to stimulate thermogenically competent BAs in WAT is set by a temperature-independent, genetically controlled program between birth and weaning.—Chabowska-Kita, A., Trabczynska, A., Korytko, A., Kaczmarek, M. M., Kozak, L. P. Low ambient temperature during early postnatal development fails to cause a permanent induction of brown adipocytes. PMID:25896784

  1. Multiple Genes on Chromosome 7 Regulate Dopaminergic Amacrine Cell Number in the Mouse Retina

    PubMed Central

    Whitney, Irene E.; Raven, Mary A.; Ciobanu, Daniel C.; Williams, Robert W.; Reese, Benjamin E.

    2009-01-01

    Purpose The size of neuronal populations is modulated by gene variants that influence cell production and survival, in turn influencing neuronal connectivity, function, and disease risk. The size of the dopaminergic amacrine (DA) cell population is a highly heritable trait exhibiting six-fold variation among inbred strains of mice, and is used here to identify genes that modulate the number of DA cells. Methods The entire population was counted in retinal wholemounts from 37 genetically defined lines of mice, including six standard inbred strains, 25 recombinant inbred strains (AXB/BXA), reciprocal F1 hybrids, a chromosome (Chr) 7 consomic line, and three additional genetically modified lines. Results We mapped much of this variation to a broad locus on Chr 7 (Dopaminergic amacrine cell number control, Chr 7). The Dacnc7 locus is flanked by two candidate genes known to modulate the number of other types of retinal neuron—the pro-apoptotic gene, Bax, and tyrosinase. The Tyr mutation was shown to modulate DA cell number modestly, although in the direction opposite that predicted. In contrast, Bax deficiency increased the population four-fold. Bax expression was significantly greater in the A/J strain relative to C57BL/6J, an effect that may be due to an SNP in a p53 consensus binding site known to modulate transcription. Finally, we note a strong candidate situated at the peak of the Dacnc7 locus, Lrrk1, a Parkinson’s disease gene exhibiting mis-sense mutations segregating within the AXB/BXA cross. Conclusions Multiple polymorphic genes on Chr. 7 modulate the size of the population of DA cells. PMID:19168892

  2. SU-E-J-64: Evaluation of a Commercial EPID-Based in Vivo Dosimetric System in the Presence of Lung Tissue Heterogeneity

    SciTech Connect

    Gimeno-Olmos, J; Palomo-Llinares, R; Candela-Juan, C; Carmona Meseguer, V; Lliso-Valverde, F; Garcia-Martinez, T; Richart-Sancho, J; Ballester, F; Perez-Calatayud, J

    2014-06-01

    Purpose: To study the performance of Dosimetry Check (DC), an EPID-based dosimetry software, which allows performing transit dosimetry, in low density medium, by comparing calculations in-phantom, and analysing results for 15 lung patients. Methods: DC software (v.3.8, pencil beam-based algorithm) has been tested, for plans (Eclipse v.10.0 TPS) delivered in two Varian Clinac iX equipped with aS1000 EPIDs.In the CIRS lung phantom, comparisons between DC and Eclipse (Acuros) were performed for several plans: (1) four field box; (2) square field delivered in arc mode; (3) RapidArc lung patient plan medially centred; (4) RapidArc lung patient plan centred in one lung. Reference points analysed: P1 (medial point, plans 1–3) and P2 (located inside one lung, plan 4).For fifteen lung patients treated with RapidArc, the isocentre and 9 additional points inside the PTV as well as the gamma passing rate (3%/3mm) for the PTV and at the main planes were studied. Results: In-phantom:P1: Per-field differences in plan 1: good agreement for AP-PA fields; discrepancy of 7% for the lateral fields. Global differences (plans 1–3): about 4%, showing a compensating effect of the individual differences.P2: Global difference (plan 4): 15 %. This represents the worst case situation as it is a point surrounded by lung tissue, where the DC pencil beam algorithm is expected to give the greater difference against Acuros.Lung patients: Mean point difference inside the PTV:(5.4±4.2) %. Gamma passing rate inside the PTV:(45±12) %. Conclusion: The performance of DC in heterogeneous lung medium was studied with a special phantom and the results for 15 patients were analysed. The found deviations show that even though DC is a highly promising in vivo dosimetry tool, there is a need of incorporating a more accurate algorithm mainly for plans with low density regions involved.

  3. Observation of two distinct negative trions in tungsten disulfide monolayers

    DOE PAGES

    Boulesbaa, Abdelaziz; Huang, Bing; Wang, Kai; Lin, Ming-Wei; Mahjouri-Samani, Masoud; Rouleau, Christopher M.; Xiao, Kai; Yoon, Mina; Sumpter, Bobby G.; Puretzky, Alexander A.; et al

    2015-09-25

    We report on the observation of two distinct photogenerated negative trion states TA and TB in two-dimensional tungsten disulfide (2D-WS2) monolayers. These trions are postulated to emerge from their parent excitons XA and XB, which originate from spin-orbit-split (SOS) levels in the conduction band (CB) and valence band (VB). Time-resolved spectroscopy measurements suggests that Pauli blocking controls a competition process between TA and TB photoformation, following dissociation of XA and XB through hole trapping at internal or substrate defect sites. While TA arises directly from its parent XA, TB emerges through a different transition accessible only after XB dissociates throughmore » a hole trapping channel. This discovery of additional optically-active band-edge transitions in atomically-thin metal dichalcogenides may revolutionize optoelectronic applications and fundamental research opportunities for many-body interaction physics. Ultrafast pump-probe spectroscopy of two-dimensional tungsten disulfide monolayers (2D-WS2) grown on sapphire substrates revealed two transient absorption spectral peaks that are attributed to distinct negative trions at ~2.02 eV (T1) and ~1.98 eV (T2). The dynamics measurements indicate that trion formation by the probe is enabled by photodoped electrons that remain after trapping of holes from excitons or free electron-hole pairs at defect sites in the crystal or on the substrate. Dynamics of the excitons XA and XB’s characteristic absorption bands, at ~2.03 and ~2.40 eV, respectively, were separately monitored and compared with the photoinduced absorption features. Selective excitation of the lowest exciton level XA using λpump < 2.4 eV forms only trion T1, which implies that the electron that remains from the dissociation of exciton XA is involved in the creation of this trion with a binding energy ~ 10 meV with respect to XA. The absorption peak that corresponds to trion T2 appears when λpump > 2.4 eV, which is just

  4. Xenomicrobiology: a roadmap for genetic code engineering.

    PubMed

    Acevedo-Rocha, Carlos G; Budisa, Nediljko

    2016-09-01

    Biology is an analytical and informational science that is becoming increasingly dependent on chemical synthesis. One example is the high-throughput and low-cost synthesis of DNA, which is a foundation for the research field of synthetic biology (SB). The aim of SB is to provide biotechnological solutions to health, energy and environmental issues as well as unsustainable manufacturing processes in the frame of naturally existing chemical building blocks. Xenobiology (XB) goes a step further by implementing non-natural building blocks in living cells. In this context, genetic code engineering respectively enables the re-design of genes/genomes and proteins/proteomes with non-canonical nucleic (XNAs) and amino (ncAAs) acids. Besides studying information flow and evolutionary innovation in living systems, XB allows the development of new-to-nature therapeutic proteins/peptides, new biocatalysts for potential applications in synthetic organic chemistry and biocontainment strategies for enhanced biosafety. In this perspective, we provide a brief history and evolution of the genetic code in the context of XB. We then discuss the latest efforts and challenges ahead for engineering the genetic code with focus on substitutions and additions of ncAAs as well as standard amino acid reductions. Finally, we present a roadmap for the directed evolution of artificial microbes for emancipating rare sense codons that could be used to introduce novel building blocks. The development of such xenomicroorganisms endowed with a 'genetic firewall' will also allow to study and understand the relation between code evolution and horizontal gene transfer. PMID:27489097

  5. Xenomicrobiology: a roadmap for genetic code engineering.

    PubMed

    Acevedo-Rocha, Carlos G; Budisa, Nediljko

    2016-09-01

    Biology is an analytical and informational science that is becoming increasingly dependent on chemical synthesis. One example is the high-throughput and low-cost synthesis of DNA, which is a foundation for the research field of synthetic biology (SB). The aim of SB is to provide biotechnological solutions to health, energy and environmental issues as well as unsustainable manufacturing processes in the frame of naturally existing chemical building blocks. Xenobiology (XB) goes a step further by implementing non-natural building blocks in living cells. In this context, genetic code engineering respectively enables the re-design of genes/genomes and proteins/proteomes with non-canonical nucleic (XNAs) and amino (ncAAs) acids. Besides studying information flow and evolutionary innovation in living systems, XB allows the development of new-to-nature therapeutic proteins/peptides, new biocatalysts for potential applications in synthetic organic chemistry and biocontainment strategies for enhanced biosafety. In this perspective, we provide a brief history and evolution of the genetic code in the context of XB. We then discuss the latest efforts and challenges ahead for engineering the genetic code with focus on substitutions and additions of ncAAs as well as standard amino acid reductions. Finally, we present a roadmap for the directed evolution of artificial microbes for emancipating rare sense codons that could be used to introduce novel building blocks. The development of such xenomicroorganisms endowed with a 'genetic firewall' will also allow to study and understand the relation between code evolution and horizontal gene transfer.

  6. Effects of pseudo-phosphorylated rat cardiac troponin T are differently modulated by α- and β-myosin heavy chain isoforms.

    PubMed

    Michael, John Jeshurun; Gollapudi, Sampath K; Chandra, Murali

    2014-01-01

    Interplay between the protein kinase C (PKC)-mediated phosphorylation of troponin T (TnT)- and myosin heavy chain (MHC)-mediated effects on thin filaments takes on a new significance because: (1) there is significant interaction between the TnT- and MHC-mediated effects on cardiac thin filaments; (2) although the phosphorylation of TnT by PKC isoforms is common to both human and rodent hearts, human hearts predominantly express β-MHC while rodent hearts predominantly express α-MHC. Therefore, we tested how α- and β-MHC isoforms differently affected the functional effects of phosphorylated TnT. Contractile measurements were made on cardiac muscle fibers from normal rats (α-MHC) and propylthiouracil-treated rats (β-MHC), reconstituted with the recombinant phosphomimetic-TnT (T204E; threonine 204 replaced by glutamate). Ca2+ -activated maximal tension decreased differently in α-MHC + T204E (~68%) and β-MHC + T204E (~35%). However, myofilament Ca2+ sensitivity decreased similarly in α-MHC + T204E and β-MHC + T204E, demonstrating that a decrease in Ca2+ sensitivity alone cannot explain the greater attenuation of tension in α-MHC + T204E. Interestingly, dynamic contractile parameters (rates of tension redevelopment, crossbridge (XB) recruitment dynamics, XB distortion dynamics, and XB detachment kinetics) decreased only in α-MHC + T204E. Thus, the transition of thin filaments from the blocked- to closed-state was attenuated in α-MHC + T204E and β-MHC + T204E, but the closed- to open-state transition was attenuated only in α-MHC + T204E. Our study demonstrates that the effects of phosphorylated TnT and MHC isoforms interact to bring about different functional states of cardiac thin filaments. PMID:25301196

  7. Effects of deforestation and climate variability on the hydrological balance of the Xingu River Basin, Brazil

    NASA Astrophysics Data System (ADS)

    Panday, P. K.; Coe, M. T.; Macedo, M.; Castanho, A. D. D. A.; Lefebvre, P.

    2014-12-01

    High historical deforestation rates and a rapidly changing agricultural landscape are altering the energy and water balance of the eastern Amazon basin. The headwaters of Xingu River Basin (XB; Area: 510,000 km2) in the southeastern Amazon have seen some of the highest rates of deforestation, resulting in a decrease of average basin forest cover from about 90% in the 1970s to 75% in the 2000s. This study examines the water balance of the XB and attributes the influences of climate variations and deforestation using a diverse set of observational and modeling tools including; long-term observations of rainfall and discharge, satellite-based estimates of evapotranspiration (MODIS) and surface water storage (GRACE), and numerical model output (IBIS) of the set of hydrological components (evapotranspiration, soil moisture, and discharge). This water budget of the 2000s is first estimated by explicitly including deforestation over the 2001-2010 through integration of the modeled outputs with forest cover information from MODIS. Modeled outputs from the 1970s to the 2000s are then used to estimate the effects on the Xingu water budget due to climate variability, historical deforestation, or both. The decadal mean water balance components of the IBIS simulation over the 2001-2010, compares well with the satellite-derived and field-based observational estimates. Analysis of the individual components of change from the 1970s to the 2000s indicates that climate variability and land cover change have had opposite influences with climate effects masking the changes in water budget due to historical deforestation. Changes in land cover due to deforestation have decreased ET by ~3% and increased soil moisture by ~1% in XB, leading to increased discharge on average by 8% from the 1970s to the 2000s.

  8. Comparison of mechanical properties of a new fiber reinforced composite and bulk filling composites

    PubMed Central

    Pradelle, Nelly; Villat, Cyril; Attik, Nina; Colon, Pierre; Grosgogeat, Brigitte

    2015-01-01

    Objectives The aim of this study was to evaluate the mechanical and physical properties of a newly developed fiber reinforced dental composite. Materials and Methods Fiber reinforced composite EverX Posterior (EXP, GC EUROPE), and other commercially available bulk fill composites, including Filtek Bulk Fill (FB, 3M ESPE), SonicFill (SF, Kerr Corp.), SureFil (SDR, Dentsply), Venus Bulk Fill (VB, HerausKultzer), Tetric evoceram bulk fill (TECB, Ivoclar Vivadent), and Xtra Base (XB, Voco) were characterized. Composite samples light-cured with a LED device were evaluated in terms of flexural strength, flexural modulus (ISO 4049, n = 6), fracture toughness (n = 6), and Vickers hardness (0, 2, and 4 mm in depth at 24 hr, n = 5). The EXP samples and the fracture surface were observed under a scanning electron microscopy. Data were statistically analyzed using one-way ANOVA and unpaired t-test. Results EXP, FB, and VB had significantly higher fracture toughness value compared to all the other bulk composite types. SF, EXP, and XB were not statistically different, and had significantly higher flexural strength values compared to other tested composite materials. EXP had the highest flexural modulus, VB had the lowest values. Vickers hardness values revealed SF, EXP, TECB, and XB were not statistically different, and had significantly higher values compared to other tested composite materials. SEM observations show well dispersed fibers working as a reinforcing phase. Conclusions The addition of fibers to methacrylate-based matrix results in composites with either comparable or superior mechanical properties compared to the other bulk fill materials tested. PMID:26587411

  9. Measurement of single and double spin asymmetries in semi-inclusive deep-inelastic scattering on proton and deuteron

    NASA Astrophysics Data System (ADS)

    Koirala, Suman Bandhu

    The EG1-DVCS experiment with CLAS at Jefferson Lab collected semi-inclusive pion electro-production data on longitudinally polarized solid state NH3 and ND3 targets with longitudinally polarized electrons of approximately 6 GeV energy. Data on all three pion channels, pi +, pi-- and pi0, were collected simultaneously. The charged pions were identified by their time-of-flight information whereas the neutral pions were reconstructed from the invariant mass of two photons. The experiment covered a wide kinematic range: 1 GeV 2 ≤ Q2 ≤ 3.2 GeV2, 0.12 ≤ xB ≤ 0.48, 0.0 GeV ≤ Ph⊥ ≤ 1.0 GeV and 0.3 ≤ z ≤ 0.7. The beam single (ALU), target single (AUL) and beam-target double ( ALL) spin azimuthal asymmetries in semi-inclusive deep-inelastic scattering (SIDIS) off the proton and the deuteron extracted from the data are presented. The results of the azimuthal asymmetries for the proton are presented as a function of two variables: (xB, Ph⊥), (z, P h⊥) and (xB, z). Due to limited statistics, the azimuthal asymmetries for the deuteron are presented as a function of a single variable for the variables xB, z and Ph ⊥. Some theoretical and phenomenological predictions as well as earlier published results are compared with the results from this analysis. All the results are plotted and suitably tabulated for further analysis. The SIDIS azimuthal asymmetries are convolutions of fragmentation functions and transverse momentum dependent parton distribution functions (TMDs). The TMDs describe transverse momenta and spins of quarks and gluons inside nucleons. They open a window on the contribution of the orbital angular momentum of the quarks and gluons to the total spin of the nucleons. The results presented in this work are sensitive to these leading twist TMDs: f 1, g1, h⊥ 1L, and h⊥ 1. The significant precision of the results from this analysis will highly constrain the extractions of the associated TMDs which will substantially contribute towards further

  10. Studies of spin-orbit correlations at JLAB

    SciTech Connect

    Mher Aghasyan, Harut Avakian

    2011-05-01

    Studies of single spin asymmetries for pion electroproduction in semi-inclusive deep-inelastic scattering are presented using the polarized \\sim6 GeV electrons from at the Thomas Jefferson National Accelerator Facility (JLab) and the Continuous Electron Beam Accelerator Facility (CEBAF) Large Acceptance Spectrometer (CLAS) with the Inner Calorimeter. The cross section versus the azimuthal angle {\\phi}_h of the produced neutral pion has a substantial sin {\\phi}_h amplitude. The dependence of this amplitude on Bjorken x_B and on the pion transverse momentum is extracted and compared with published data.

  11. Studies of spin-orbit correlations at JLAB

    NASA Astrophysics Data System (ADS)

    Aghasyan, Mher; Avakian, Harut; CLAS Collaboration

    2011-05-01

    Studies of single spin asymmetries for pion electroproduction in semi-inclusive deep-inelastic scattering are presented using the polarized ~6 GeV electrons from at the Thomas Jefferson National Accelerator Facility (JLab) and the Continuous Electron Beam Accelerator Facility (CEBAF) Large Acceptance Spectrometer (CLAS) with the Inner Calorimeter. The cross section versus the azimuthal angle phih of the produced neutral pion has a substantial sin phih amplitude. The dependence of this amplitude on Bjorken xB and on the pion transverse momentum is extracted and compared with published data.

  12. Glass forming abilities and magnetic properties of soft magnetic Fe Co Zr W B bulk glassy alloys

    NASA Astrophysics Data System (ADS)

    Pawlik, Piotr; Pawlik, Katarzyna; Davies, Hywel A.; Wysłocki, Jerzy J.; Kaszuwara, Waldemar; Leonowicz, Marcin

    2006-09-01

    Melt-spun ribbon samples of various thicknesses up to 350 μm and suction-cast 1 and 2 mm diameter rods of Fe61Co10+xZr5W4-xB20(x=0,2,3) alloys, were produced. The results obtained for rods indicate relatively large saturation polarization Js, with high anisotropy field that lowers the permeability of the samples. X-ray diffractometry was applied to confirm the amorphous structure of the processed alloys.

  13. Deeply Virtual Compton Scattering off the neutron

    SciTech Connect

    M. Mazouz; A. Camsonne; C. Munoz Camacho; C. Ferdi; G. Gavalian; E. Kuchina; M. Amarian; K. A. Aniol; M. Beaumel; H. Benaoum; P. Bertin; M. Brossard; J.-P. Chen; E. Chudakov; B. Craver; F. Cusanno; C.W. de Jager; A. Deur; R. Feuerbach; J.-M. Fieschi; S. Frullani; M. Garcon; F. Garibaldi; O. Gayou; R. Gilman; J. Gomez; P. Gueye; P.A.M. Guichon; B. Guillon; O. Hansen; D. Hayes; D. Higinbotham; T. Holmstrom; C.E. Hyde; H. Ibrahim; R. Igarashi; X. Jiang; H.S. Jo; L.J. Kaufman; A. Kelleher; A. Kolarkar; G. Kumbartzki; G. Laveissiere; J.J. LeRose; R. Lindgren; N. Liyanage; H.-J. Lu; D.J. Margaziotis; Z.-E. Meziani; K. McCormick; R. Michaels; B. Michel; B. Moffit; P. Monaghan; S. Nanda; V. Nelyubin; M. Potokar; Y. Qiang; R.D. Ransome; J.-S. Real; B. Reitz; Y. Roblin; J. Roche; F. Sabatie; A. Saha; S. Sirca; K. Slifer; P. Solvignon; R. Subedi; V. Sulkosky; P.E. Ulmer; E. Voutier; K. Wang; L.B. Weinstein; B. Wojtsekhowski; X. Zheng; L. Zhu

    2007-12-01

    The present experiment exploits the interference between the Deeply Virtual Compton Scattering (DVCS) and the Bethe-Heitler processes to extract the imaginary part of DVCS amplitudes on the neutron and on the deuteron from the helicity-dependent D$({\\vec e},e'\\gamma)X$ cross section measured at $Q^2$=1.9 GeV$^2$ and $x_B$=0.36. We extract a linear combination of generalized parton distributions (GPDs) particularly sensitive to $E_q$, the least constrained GPD. A model dependent constraint on the contribution of the up and down quarks to the nucleon spin is deduced.

  14. 6. Credit USAF, ca. 1947. Original housed in the Photograph ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Credit USAF, ca. 1947. Original housed in the Photograph Files, AFFTC/HO, Edwards AFB, California. Interior of Building 4401 (or possibly 4402) looking east at hangar doors with a North American Aviation XB-45 Tornado jet aircraft in the foreground. This view illustrates why the series of sliding doors and wide, high interior clearances were necessary to accommodate large aircraft. Note configuration of wooden trusses supporting the roof. - Edwards Air Force Base, North Base, Hangar No. 1, First & B Streets, Boron, Kern County, CA

  15. Aircraft handling qualities data

    NASA Technical Reports Server (NTRS)

    Heffley, R. K.; Jewell, W. F.

    1972-01-01

    Available information on weight and inertia, aerodynamic derivatives, control characteristics, and stability augmentation systems is documented for 10 representative contemporary airplanes. Data sources are given for each airplane. Flight envelopes are presented and dimensional derivatives, transfer functions for control inputs, and several selected handling qualities parameters have been computed and are tabulated for 10 different flight conditions including the power approach configuration. The airplanes documented are the NT-33A, F-104A, F-4C, X-15, HL-10, Jetstar, CV-880M, B-747, C-5A, and XB-70A.

  16. Deeply Virtual Compton Scattering on the Neutron: JLab Experiment E08-025

    NASA Astrophysics Data System (ADS)

    Benali, Meriem; Mazouz, Malek; Fonvieille, Helene

    2016-03-01

    This paper gives the preliminary results of the experimental cross section for deeply virtual Compton scattering on the neutron (en → enγ). The E08-025 experiment was performed at Jefferson Lab Hall A. We measured the (D(e; eX - H(e; e'γ)X) unpolarized cross section and we extracted, for the first time, a non-zero contribution of (neutron-DVCS + coherent-deuteron-DVCS) at Q2 = 1.75 GeV2 and xB = 0.36.

  17. The biological effects of XTC-MIF: quantitative comparison with Xenopus bFGF.

    PubMed

    Green, J B; Howes, G; Symes, K; Cooke, J; Smith, J C

    1990-01-01

    Mesoderm in Xenopus and other amphibian embryos is induced by signals from the vegetal hemisphere acting on equatorial or animal hemisphere cells. These signals are diffusible and two classes of candidate signal molecule have been identified: the fibroblast growth factor (FGF) and transforming growth factor beta (TGF-beta) types. In this paper, we compare the effects of cloned Xenopus basic FGF (XbFGF) and electophoretically homogeneous XTC-MIF (a TGF-beta-like factor obtained from a Xenopus cell line) on animal pole explants. We find that they have a similar minimum active concentration (0.1-0.2 ng ml-1) but that, nonetheless, XTC-MIF is at least 40 times more active in inducing muscle. In general, we find that the two factors cause inductions of significantly different characters in terms of tissue type, morphology, gene expression and timing. At low concentrations (0.1-1.0 ng ml-1) both factors induce the differentiation of 'mesenchyme' and 'mesothelium' as well as blood-like cells. These latter cells do not, however, react with an antibody to Xenopus globin. This raised the possibility that the identification of red blood cells in other studies on mesoderm induction might have been mistaken, but combinations of animal pole regions with ventral vegetal pole regions confirmed that genuine erythrocytes are formed. The identity of the blood-like cells formed in response to the inducing factors remains unknown. At higher concentrations XTC-MIF induces neural tissue, notochord, pronephros and substantial and often segmented muscle. By contrast, XbFGF only induces significant amounts of muscle above 24 ng ml-1 and even then this is much less than that induced by XTC-MIF. For both factors an exposure of less than 30 min is effective. Competence of animal pole cells to respond to XbFGF is completely lost by the beginning of gastrulation (stage 10) while competence to XTC-MIF is detectable until somewhat later (stage 11). Since animal pole tissue is known to be able to

  18. Effects of configurational disorder on the elastic properties of icosahedral boron-rich alloys based on B6O, B13C2, and B4C, and their mixing thermodynamics

    NASA Astrophysics Data System (ADS)

    Ektarawong, A.; Simak, S. I.; Hultman, L.; Birch, J.; Tasnádi, F.; Wang, F.; Alling, B.

    2016-04-01

    The elastic properties of alloys between boron suboxide (B6O) and boron carbide (B13C2), denoted by (B6O)1-x(B13C2)x, as well as boron carbide with variable carbon content, ranging from B13C2 to B4C are calculated from first-principles. Furthermore, the mixing thermodynamics of (B6O)1-x(B13C2)x is studied. A superatom-special quasirandom structure approach is used for modeling different atomic configurations, in which effects of configurational disorder between the carbide and suboxide structural units, as well as between boron and carbon atoms within the units, are taken into account. Elastic properties calculations demonstrate that configurational disorder in B13C2, where a part of the C atoms in the CBC chains substitute for B atoms in the B12 icosahedra, drastically increase the Young's and shear modulus, as compared to an atomically ordered state, B12(CBC). These calculated elastic moduli of the disordered state are in excellent agreement with experiments. Configurational disorder between boron and carbon can also explain the experimentally observed almost constant elastic moduli of boron carbide as the carbon content is changed from B4C to B13C2. The elastic moduli of the (B6O)1-x(B13C2)x system are also practically unchanged with composition if boron-carbon disorder is taken into account. By investigating the mixing thermodynamics of the alloys, in which the Gibbs free energy is determined within the mean-field approximation for the configurational entropy, we outline the pseudo-binary phase diagram of (B6O)1-x(B13C2)x. The phase diagram reveals the existence of a miscibility gap at all temperatures up to the melting point. Also, the coexistence of B6O-rich as well as ordered or disordered B13C2-rich domains in the material prepared through equilibrium routes is predicted.

  19. Effects of configurational disorder on the elastic properties of icosahedral boron-rich alloys based on B6O, B13C2, and B4C, and their mixing thermodynamics.

    PubMed

    Ektarawong, A; Simak, S I; Hultman, L; Birch, J; Tasnádi, F; Wang, F; Alling, B

    2016-04-01

    The elastic properties of alloys between boron suboxide (B6O) and boron carbide (B13C2), denoted by (B6O)(1-x)(B13C2)(x), as well as boron carbide with variable carbon content, ranging from B13C2 to B4C are calculated from first-principles. Furthermore, the mixing thermodynamics of (B6O)(1-x)(B13C2)(x) is studied. A superatom-special quasirandom structure approach is used for modeling different atomic configurations, in which effects of configurational disorder between the carbide and suboxide structural units, as well as between boron and carbon atoms within the units, are taken into account. Elastic properties calculations demonstrate that configurational disorder in B13C2, where a part of the C atoms in the CBC chains substitute for B atoms in the B12 icosahedra, drastically increase the Young's and shear modulus, as compared to an atomically ordered state, B12(CBC). These calculated elastic moduli of the disordered state are in excellent agreement with experiments. Configurational disorder between boron and carbon can also explain the experimentally observed almost constant elastic moduli of boron carbide as the carbon content is changed from B4C to B13C2. The elastic moduli of the (B6O)(1-x)(B13C2)(x) system are also practically unchanged with composition if boron-carbon disorder is taken into account. By investigating the mixing thermodynamics of the alloys, in which the Gibbs free energy is determined within the mean-field approximation for the configurational entropy, we outline the pseudo-binary phase diagram of (B6O)(1-x)(B13C2)(x). The phase diagram reveals the existence of a miscibility gap at all temperatures up to the melting point. Also, the coexistence of B6O-rich as well as ordered or disordered B13C2-rich domains in the material prepared through equilibrium routes is predicted.

  20. Fast, kinetically self-consistent simulation of RF modulated plasma boundary sheaths

    NASA Astrophysics Data System (ADS)

    Shihab, Mohammed; Ziegler, Dennis; Brinkmann, Ralf Peter

    2012-05-01

    A mathematical model is presented which enables the efficient, kinetically self-consistent simulation of RF modulated plasma boundary sheaths in all technically relevant discharge regimes. It is defined on a one-dimensional geometry where a Cartesian x-axis points from the electrode or wall at xE ≡ 0 towards the plasma bulk. An arbitrary endpoint xB is chosen ‘deep in the bulk’. The model consists of a set of kinetic equations for the ions, Boltzmann's relation for the electrons and Poisson's equation for the electrical field. Boundary conditions specify the ion flux at xB and a periodically—not necessarily harmonically—modulated sheath voltage V(t) or sheath charge Q(t). The equations are solved in a statistical sense. However, it is not the well-known particle-in-cell (PIC) scheme that is employed, but an alternative iterative algorithm termed ensemble-in-spacetime (EST). The basis of the scheme is a discretization of the spacetime, the product of the domain [xE, xB] and the RF period [0, T]. Three modules are called in a sequence. A Monte Carlo module calculates the trajectories of a large set of ions from their start at xB until they reach the electrode at xE, utilizing the potential values on the nodes of the spatio-temporal grid. A harmonic analysis module reconstructs the Fourier modes nim(x) of the ion density ni(x, t) from the calculated trajectories. A field module finally solves the Boltzmann-Poisson equation with the calculated ion densities to generate an updated set of potential values for the spatio-temporal grid. The iteration is started with the potential values of a self-consistent fluid model and terminates when the updates become sufficiently small, i.e. when self-consistency is achieved. A subsequent post-processing determines important quantities, in particular the phase-resolved and phase-averaged values of the ion energy and angular distributions and the total energy flux at the electrode. A drastic reduction of the computational

  1. Vibration responses of two house structures during the Edwards Air Force Base phase of the national sonic boom program

    NASA Technical Reports Server (NTRS)

    Hubbard, Harvey H.

    1990-01-01

    The data are reproduced from NSBEO-1-67, which contains some preliminary results of the test program, and from NASA-Langley working papers 259 and 288 which are now out of print. Included are sample acceleration and strain recordings from F-104, B-58, and XB-70 sonic boom exposures, along with tabulations of the maximum acceleration and strain values measured for each one of about 130 flight tests. These data are compared with similar measurements for engine noise exposures of the building during simulated landing approaches and takeoffs of KC-135 aircraft.

  2. Relationships between stratospheric clear air turbulence and synoptic meteorological parameters over the western United States between 12-20 km altitude

    NASA Technical Reports Server (NTRS)

    Scoggins, J. R.; Clark, T. L.; Possiel, N. C.

    1975-01-01

    Procedures for forecasting clear air turbulence in the stratosphere over the western United States from rawinsonde data are described and results presented. Approaches taken to relate meteorological parameters to regions of turbulence and nonturbulence encountered by the XB-70 during 46 flights at altitudes between 12-20 km include: empirical probabilities, discriminant function analysis, and mountainwave theory. Results from these techniques were combined into a procedure to forecast regions of clear air turbulence with an accuracy of 70-80 percent. A computer program was developed to provide an objective forecast directly from the rawinsonde sounding data.

  3. Short-term sandbar variability based on video imagery: Comparison between Time-Average and Time-Variance techniques

    USGS Publications Warehouse

    Guedes, R.M.C.; Calliari, L.J.; Holland, K.T.; Plant, N.G.; Pereira, P.S.; Alves, F.N.A.

    2011-01-01

    Time-exposure intensity (averaged) images are commonly used to locate the nearshore sandbar position (xb), based on the cross-shore locations of maximum pixel intensity (xi) of the bright bands in the images. It is not known, however, how the breaking patterns seen in Variance images (i.e. those created through standard deviation of pixel intensity over time) are related to the sandbar locations. We investigated the suitability of both Time-exposure and Variance images for sandbar detection within a multiple bar system on the southern coast of Brazil, and verified the relation between wave breaking patterns, observed as bands of high intensity in these images and cross-shore profiles of modeled wave energy dissipation (xD). Not only is Time-exposure maximum pixel intensity location (xi-Ti) well related to xb, but also to the maximum pixel intensity location of Variance images (xi-Va), although the latter was typically located 15m offshore of the former. In addition, xi-Va was observed to be better associated with xD even though xi-Ti is commonly assumed as maximum wave energy dissipation. Significant wave height (Hs) and water level (??) were observed to affect the two types of images in a similar way, with an increase in both Hs and ?? resulting in xi shifting offshore. This ??-induced xi variability has an opposite behavior to what is described in the literature, and is likely an indirect effect of higher waves breaking farther offshore during periods of storm surges. Multiple regression models performed on xi, Hs and ?? allowed the reduction of the residual errors between xb and xi, yielding accurate estimates with most residuals less than 10m. Additionally, it was found that the sandbar position was best estimated using xi-Ti (xi-Va) when xb was located shoreward (seaward) of its mean position, for both the first and the second bar. Although it is unknown whether this is an indirect hydrodynamic effect or is indeed related to the morphology, we found that this

  4. Investigation of ionic liquids for efficient removal and reliable storage of radioactive iodine: a halogen-bonding case.

    PubMed

    Yan, Chuanyu; Mu, Tiancheng

    2014-03-21

    A series of ionic liquids (ILs) were investigated for removal and storage of radioactive iodine (I2) waste released by nuclear power plants. The I2 removal efficiency of ILs was dependent upon the anion species while cation species seemed to have little influence. Particularly, the I2 removal efficiency of [Bmim][Br] was higher than 96% in 5 hours. The nitrogen gas sweeping tests showed that [Bmim][Br] holds I2 tightly, and the leak of I2 from it was negligible under daily life conditions. Spectroscopy studies indicated that high removal efficiencies and storage reliability of ILs were attributed to halogen bonding (XB). PMID:24492960

  5. Quarterly Technical Progress Report June 2015

    SciTech Connect

    Buchholz, Bruce A.

    2015-06-08

    The project has two main goals: 1) Identify the types of adducts naphthalene (NA) forms with DNA and 2) determine whether adduct formation correlates with site selective tumor formation in defined subcompartments of the respiratory tract (respiratory and olfactory nasal epithelium and airways of mice, rats and rhesus monkeys). Five tasks are associated with the completion of the goals. Task 1: Contracting and Animal Use Approvals. IACUC and ACURO approvals are complete, The subcontract with UC Davis (UCD) was executed in December 2014. Task 2: Perform In Vitro Study for Goal 1. Rat samples exposed and in freezer while adduct standards are being made. Mouse samples need to be exposed in next quarter. Task 3: Perform In Vitro Study for Goal 2. Mouse ex vivo samples completed. Rat and monkey samples need to be completed in the next quarter. Task 4: Sample Preparation and Analysis. Mouse Goal 2 samples completed. Other samples remain to be done. Task 5: Data Interpretation and Reporting. Need rat data to write paper on adduct formation.

  6. An Efficient Simulation-Optimization Coupling for Management of Coastal Aquifers

    NASA Astrophysics Data System (ADS)

    Mantoglou, A.; Kourakos, G.

    2013-12-01

    Seawater intrusion is a major environmental problem and efficient tools are required to assist decision making. Decision tools are often comprised of simulation models which evaluate promising actions and optimization algorithms to search for optimum management solutions. In this work we present an efficient coupling between simulation models and optimization algorithms suitable for management of coastal aquifers based on the sharp interface approximation. Generally, the simulation models are described by partial differential equations (PDEs). The numerical solution of a PDE involves several steps. First the domain is discretized into a number of nodes. Next the partial differential equation is converted to a system of linear equations in the form AX=B by assembling the system matrix A and the vector B. The last step is the solution of the linear system AX=B. Typically the linear system is solved using Krylov subspace methods when the size of the problem is large or direct methods for relatively small problems. In both cases the solution of the linear system involves two distinct computations. In the case of iterative solvers a preconditioner of matrix A is first computed whereas in the case of direct methods the left hand side matrix A is first factorized (e.g. using LU factorization). The right hand side vector B is not used during this step and it is only required during the computation of the solution. Typically the most time consuming process is the preconditioning or factorization, while the solution time can be considered negligible. Therefore, for a system optimization of a linear problem, where the decision variables do not affect the system matrix A, we can transform the system matrix prior to optimization and then we can solve the system very rapidly for different right hand side vectors B, which depend on the decision variables. In this work we used the sharp interface approximation of Mantoglou (2004), which has the advantage that the non

  7. Sodium chloride reduces production of curvacin A, a bacteriocin produced by Lactobacillus curvatus strain LTH 1174, originating from fermented sausage.

    PubMed

    Verluyten, Jurgen; Messens, Winy; De Vuyst, Luc

    2004-04-01

    Lactobacillus curvatus LTH 1174, a strain originating in fermented sausage, produces the antilisterial bacteriocin curvacin A. Its biokinetics of cell growth and bacteriocin production as a function of various concentrations of salt (sodium chloride) were investigated in vitro during laboratory fermentations using modified MRS medium. A model was set up to describe the effects of different NaCl concentrations on microbial behavior. Both cell growth and bacteriocin activity were affected by changes in the salt concentration. Sodium chloride clearly slowed down the growth of L. curvatus LTH 1174, but more importantly, it had a detrimental effect on specific curvacin A production (k(B)) and hence on overall bacteriocin activity. Even a low salt concentration (2%, wt/vol) decreased bacteriocin production, while growth was unaffected at this concentration. The inhibitory effect of NaCl was mainly due to its role as an a(w)-lowering agent. Further, it was clear that salt interfered with bacteriocin induction. Additionally, when 6% (wt/vol) sodium chloride was added, the minimum biomass concentration necessary to start the production of curvacin A (X(B)) was 0.90 g (cell dry mass) per liter. Addition of the cell-free culture supernatant or a protein solution as a source of induction factor resulted in a decrease in X(B), an increase in k(B), and hence an increase in the maximum attainable bacteriocin activity. PMID:15066822

  8. Scour of Sand-Gravel Beaches in Front of Seawalls

    NASA Astrophysics Data System (ADS)

    Xharde, Regis; Frandsen, Jannette; Gauvin-Tremblay, Olivier

    2015-11-01

    Large-scale physical experiments were conducted in the 5m-wide, 5m-deep and 120m-long wave flume at the Quebec Coastal Laboratory of the national scientific research institute (INRS) to evaluate wave-induced scour depth (ds) at vertical seawalls and on natural beaches. In the initial part of the study, the equilibrium beach profile of a mixed sand-gravel beach with a mean grain size diameter of 12 mm was studied for various beach slopes using regular and irregular waves with intermediate water depths (h0 ∈ [2.3; 3.8] m) and different wave heights. In the second part of the study, a vertical seawall fronted by a 1:10 sloping mixed sand-gravel beach was tested for more than 50 wave trains using regular and irregular waves with various water depths at the seawall (hw) , wave heights and wave periods. The scour depth at the toe of the seawall is highly dependent on the form of wave breaking onto the structure. Sea states where plunging breakers occur directly onto the wall generate jets of water that may penetrate to the seabed and cause a local scour hole immediately adjacent to the seawall. Scour depth is maximum when Hb/hw>1 and Xb/Hb <1, where Hb is the breaker height and Xb the distance from the seawall of the breaking wave. Comparison with existing semi-empirically derived scour prediction equations was performed.

  9. Bc± decays into tetraquarks

    NASA Astrophysics Data System (ADS)

    Ali, A.; Maiani, L.; Polosa, A. D.; Riquer, V.

    2016-08-01

    The recent observation by the D0 collaboration of a narrow structure X (5568 ) consisting of four different quark flavors b d u s , has not been confirmed by LHCb. In the tightly bound diquark model, we estimate the lightest b d u s , 0+ tetraquark at a mass of about 5770 MeV, approximately 200 MeV above the reported X (5568 ), and just 7 MeV below the B K ¯ threshold. The charged tetraquark is accompanied by I =1 and I =0 neutral partners almost degenerate in mass. A b d u s , S -wave, 1+ quartet at 5820 MeV is implied as well. In the charm sector, c d u s , 0+ and 1+ tetraquarks are predicted at 2365 and 2501 MeV, about 40-50 MeV heavier than Ds 0(2317 ) and Ds 1(2460 ). The b d u s tetraquarks can be searched in the hadronic debris of a jet initiated by a b . However, some of them may also be produced in Bc decays, Bc→Xb 0+π with the subsequent decays Xb 0→Bs+π , giving rise to final states such as Bsπ+π0. We also emphasize the importance of Bc decays as a source of bound hidden charm tetraquarks, such as Bc→X (3872 )+π .

  10. Ecological survey of the native pinewoods of Scotland 1971

    NASA Astrophysics Data System (ADS)

    Wood, Claire M.; Bunce, Robert G. H.

    2016-05-01

    In 1971, a comprehensive ecological survey of the native pinewoods of Scotland was carried out by the Institute of Terrestrial Ecology. The survey was initiated as a consequence of growing concern about the status of the pinewood resource. Since the twentieth century, this unique habitat is widely recognised, not only by ecologists for its inherent biodiversity but also by the general public for its cultural and amenity value. The survey, utilising demonstrably repeatable methods, collected information on ground flora, soils, forest structure and also general site information from the major 27 sites of the 35 sites identified as truly native pinewoods in Scotland. The results from the survey prompted the organisation of an international symposium in 1975, which set the conservation agenda for the old Caledonian pinewoods. The data collected during the 1971 survey are now publicly available via the following DOI: xb" target="_blank">doi:10/7xb ("Habitat, vegetation, tree and soil data from Native Pinewoods in Scotland, 1971"). Although the data are now 44 years old, the repeatable methods will allow for a resurvey to take place, in order to assess changes in the vegetation, habitats and tree composition in a statistically robust manner.

  11. Employment of 16 S rDNA gene sequencing techniques to identify culturable environmental eubacteria in a tertiary referral hospital.

    PubMed

    Xu, J; Smyth, C L; Buchanan, J A; Dolan, A; Rooney, P J; Millar, B C; Goldsmith, C E; Elborn, J S; Moore, J E

    2004-05-01

    Universal or 'broad-range' eubacterial polymerase chain reaction (PCR) was performed on 53 isolates from environmental water-associated sites in a haematology unit (N = 22) and the outer surfaces of cleaning lotion containers sited throughout a tertiary referral hospital (N = 31) 16 S rDNA PCR was performed using two sets of universal primers, including the novel reverse primer, XB4, to generate a composite amplicon of 1068 bp, which was sequenced to obtain each isolate's identity. Sequence analysis was able to identify 51 isolates. Most (75% from the haematology unit and 81% from cleaner containers) were Gram-positive. Nine different genera were identified from the haematology unit and 13 from the cleaning lotion containers. This study provides the first reports of Terrabacter spp. and Brachybacterium paraconglomeratum isolated from a hospital environment. As unusual and difficult-to-identify environmental organisms are unlikely to be clinically significant, and molecular identification is costly and labour-intensive, we recommend that molecular methods are only used as an adjunct to first-line phenotypic identification schemes where a definitive identification is required. Where molecular identification methods are justified, partial 16 S rDNA PCR and sequencing employing the novel universal primer XB4, is a valuable and reliable technique.

  12. A long-term record of blended satellite and in situ sea-surface temperature for climate monitoring, modeling and environmental studies

    NASA Astrophysics Data System (ADS)

    Banzon, Viva; Smith, Thomas M.; Chin, Toshio Mike; Liu, Chunying; Hankins, William

    2016-04-01

    This paper describes a blended sea-surface temperature (SST) data set that is part of the National Oceanic and Atmospheric Administration (NOAA) Climate Data Record (CDR) program product suite. Using optimum interpolation (OI), in situ and satellite observations are combined on a daily and 0.25° spatial grid to form an SST analysis, i.e., a spatially complete field. A large-scale bias adjustment of the input infrared SSTs is made using buoy and ship observations as a reference. This is particularly important for the time periods when volcanic aerosols from the El Chichón and Mt. Pinatubo eruptions are widespread globally. The main source of SSTs is the Advanced Very High Resolution Radiometer (AVHRR), available from late 1981 to the present, which is also the temporal span of this CDR. The input and processing choices made to ensure a consistent data set that meets the CDR requirements are summarized. A brief history and an explanation of the forward production schedule for the preliminary and science-quality final product are also provided. The data set is produced and archived at the newly formed National Centers for Environmental Information (NCEI) in Network Common Data Form (netCDF) at XB5" target="_blank">doi:10.7289/V5SQ8XB5.

  13. Sodium chloride reduces production of curvacin A, a bacteriocin produced by Lactobacillus curvatus strain LTH 1174, originating from fermented sausage.

    PubMed

    Verluyten, Jurgen; Messens, Winy; De Vuyst, Luc

    2004-04-01

    Lactobacillus curvatus LTH 1174, a strain originating in fermented sausage, produces the antilisterial bacteriocin curvacin A. Its biokinetics of cell growth and bacteriocin production as a function of various concentrations of salt (sodium chloride) were investigated in vitro during laboratory fermentations using modified MRS medium. A model was set up to describe the effects of different NaCl concentrations on microbial behavior. Both cell growth and bacteriocin activity were affected by changes in the salt concentration. Sodium chloride clearly slowed down the growth of L. curvatus LTH 1174, but more importantly, it had a detrimental effect on specific curvacin A production (k(B)) and hence on overall bacteriocin activity. Even a low salt concentration (2%, wt/vol) decreased bacteriocin production, while growth was unaffected at this concentration. The inhibitory effect of NaCl was mainly due to its role as an a(w)-lowering agent. Further, it was clear that salt interfered with bacteriocin induction. Additionally, when 6% (wt/vol) sodium chloride was added, the minimum biomass concentration necessary to start the production of curvacin A (X(B)) was 0.90 g (cell dry mass) per liter. Addition of the cell-free culture supernatant or a protein solution as a source of induction factor resulted in a decrease in X(B), an increase in k(B), and hence an increase in the maximum attainable bacteriocin activity.

  14. Is the decrease of the total electron energy density a covalence indicator in hydrogen and halogen bonds?

    PubMed

    Angelina, Emilio L; Duarte, Darío J R; Peruchena, Nélida M

    2013-05-01

    In this work, halogen bonding (XB) and hydrogen bonding (HB) complexes were studied with the aim of analyzing the variation of the total electronic energy density H(r b ) with the interaction strengthening. The calculations were performed at the MP2/6-311++G(2d,2p) level of approximation. To explain the nature of such interactions, the atoms in molecules theory (AIM) in conjunction with reduced variational space self-consistent field (RVS) energy decomposition analysis were carried out. Based on the local virial theorem, an equation to decompose the total electronic energy density H(r b ) in two energy densities, (-G(r b )) and 1/4∇(2)ρ(r b ), was derived. These energy densities were linked with the RVS interaction energy components. Through the connection between both decomposition schemes, it was possible to conclude that the decrease in H(r b ) with the interaction strengthening observed in the HB as well as the XB complexes, is mainly due to the increase in the attractive electrostatic part of the interaction energy and in lesser extent to the increase in its covalent character, as is commonly considered. PMID:23187685

  15. Solid-State Hydriding Mechanism in the LiBH4 + MgH2 System

    SciTech Connect

    Shaw, Leon L.; Wan, Xuefei; Hu, Jian Z.; Kwak, Ja Hun; Yang, Zhenguo

    2010-05-06

    The LiBH4+MgH2 system has great potential in reversible hydrogen storage for fuel cell vehicles. However, it has always been dehydrogenated and re-hydrogenated in the liquid state until recently. The solid-state hydriding and dehydriding are necessary in order to achieve hydrogen uptake and release near the ambient temperature. In this study, the solid-state hydriding mechanism of 2LiH+MgB2 mixtures has been investigated for the first time. It is found that the solid-state hydriding proceeds in two elementary steps. The first step is the ion exchange between the Mg2+ and Li+ ions in the MgB2 crystal to form an intermediate compound (Mg1-xLi2x)B2. The second step is the continuous ion exchange and simultaneous hydrogenation of (Mg1-xLi2x)B2 to form LiBH4 and MgH2. This finding is consistent with the observed diffusion-controlled hydriding kinetics.*

  16. Breaking Wave Impact on a Partially Submerged Rigid Cube in Deep Water

    NASA Astrophysics Data System (ADS)

    Ikeda, C. M.; Choquette, M.; Duncan, J. H.

    2011-11-01

    The impact of a plunging breaking wave on a partially submerged cube is studied experimentally. The experiments are performed in a wave tank that is 14.8 m long, 1.15 m wide and 2.2 m high with a water depth of 0.91 m. A single repeatable plunging breaker is generated from a dispersively focused wave packet (average frequency of 1.4 Hz) that is created with a programmable wave maker. The rigid (L = 30 . 5 cm) cube is centered in the width of the tank and mounted from above with one face oriented normal to the oncoming wave. The position of the center of the front face of the cube is varied from the breaker location (xb ~ 6 . 35 m) to xb + 0 . 05 m in the streamwise direction and from - 0 . 25 L to 0 . 25 L vertically relative to the mean water level. A high-speed digital camera is used to record both white-light and laser-induced fluorescence (LIF) movies of the free surface shape in front of the cube before and after the wave impact. When the wave hits the cube just as the plunging jet is formed, a high-velocity vertical jet is created and the trajectory and maximum height of the jet are strongly influenced by the vertical position of the cube. Supported by the Office of Naval Research, Contract Monitor R. D. Joslin.

  17. B-70 Aircraft Study. Volume 2

    NASA Technical Reports Server (NTRS)

    1972-01-01

    Volume 2 of the final report on the B-70 aircraft study is presented here. The B-70 Program, at the onset, was a full weapon system capable of sustained Mach 3 flight for the major portion of its design missions. The weapon system was to enter the SAC inventory as an RS-70 with the first intercontinental resonnaissance/bomber wing scheduled to go operational in July, 1964. After several redirections, a two XB-70 air vehicle program emerged with its prime objective being to demonstrate the technical feasibility of sustained Mach 3 flight. This section describes the original Weapon System 110A concepts, the evolution of the RS-70 design, and the XB-70 air vehicles which demonstrated the design, fabrication, and technical feasibility of long range Mach 3 flights at high altitude. The data presented shows that a very large step forward in the state-of-the-art of manned aircraft design was achieved during the B-70 development program and that advances were made and incorporated in every area, including design, materials application, and manufacturing techniques.

  18. Evaluation of High-Speed Civil Transport Handling Qualities Criteria with Supersonic Flight Data

    NASA Technical Reports Server (NTRS)

    Cox, Timothy H.; Jackson, Dante W.

    1997-01-01

    Most flying qualities criteria have been developed from data in the subsonic flight regime. Unique characteristics of supersonic flight raise questions about whether these criteria successfully extend into the supersonic flight regime. Approximately 25 years ago NASA Dryden Flight Research Center addressed this issue with handling qualities evaluations of the XB-70 and YF-12. Good correlations between some of the classical handling qualities parameters, such as the control anticipation parameter as a function of damping, were discovered. More criteria have been developed since these studies. Some of these more recent criteria are being used in designing the High-Speed Civil Transport (HSCT). A second research study recently addressed this issue through flying qualities evaluations of the SR-71 at Mach 3. The research goal was to extend the high-speed flying qualities experience of large airplanes and to evaluate more recent MIL-STD-1797 criteria against pilot comments and ratings. Emphasis was placed on evaluating the criteria used for designing the HSCT. XB-70 and YF-12 data from the previous research supplemented the SR-71 data. The results indicate that the criteria used in the HSCT design are conservative and should provide good flying qualities for typical high-speed maneuvering. Additional results show correlation between the ratings and comments and criteria for gradual maneuvering with precision control. Correlation is shown between ratings and comments and an extension of the Neal/Smith criterion using normal acceleration instead of pitch rate.

  19. Interplay of threshold resummation and hadron mass corrections in deep inelastic processes

    DOE PAGES

    Accardi, Alberto; Anderle, Daniele P.; Ringer, Felix

    2015-02-01

    We discuss hadron mass corrections and threshold resummation for deep-inelastic scattering lN-->l'X and semi-inclusive annihilation e+e- → hX processes, and provide a prescription how to consistently combine these two corrections respecting all kinematic thresholds. We find an interesting interplay between threshold resummation and target mass corrections for deep-inelastic scattering at large values of Bjorken xB. In semi-inclusive annihilation, on the contrary, the two considered corrections are relevant in different kinematic regions and do not affect each other. A detailed analysis is nonetheless of interest in the light of recent high precision data from BaBar and Belle on pion and kaonmore » production, with which we compare our calculations. For both deep inelastic scattering and single inclusive annihilation, the size of the combined corrections compared to the precision of world data is shown to be large. Therefore, we conclude that these theoretical corrections are relevant for global QCD fits in order to extract precise parton distributions at large Bjorken xB, and fragmentation functions over the whole kinematic range.« less

  20. Transgenic expression of the dicotyledonous pattern recognition receptor EFR in rice leads to ligand-dependent activation of defense responses

    DOE PAGES

    Schwessinger, Benjamin; Bahar, Ofir; Thomas, Nicolas; Holton, Nicolas; Nekrasov, Vladimir; Ruan, Deling; Canlas, Patrick E.; Daudi, Arsalan; Petzold, Christopher J.; Singan, Vasanth R.; et al

    2015-03-30

    Plant plasma membrane localized pattern recognition receptors (PRRs) detect extracellular pathogen-associated molecules. PRRs such as Arabidopsis EFR and rice XA21 are taxonomically restricted and are absent from most plant genomes. Here we show that rice plants expressing EFR or the chimeric receptor EFR::XA21, containing the EFR ectodomain and the XA21 intracellular domain, sense both Escherichia coli- and Xanthomonas oryzae pv. oryzae (Xoo)-derived elf18 peptides at sub-nanomolar concentrations. Treatment of EFR and EFR::XA21 rice leaf tissue with elf18 leads to MAP kinase activation, reactive oxygen production and defense gene expression. Although expression of EFR does not lead to robust enhanced resistancemore » to fully virulent Xoo isolates, it does lead to quantitatively enhanced resistance to weakly virulent Xoo isolates. EFR interacts with OsSERK2 and the XA21 binding protein 24 (XB24), two key components of the rice XA21-mediated immune response. Rice-EFR plants silenced for OsSERK2, or overexpressing rice XB24 are compromised in elf18-induced reactive oxygen production and defense gene expression indicating that these proteins are also important for EFR-mediated signaling in transgenic rice. Taken together, our results demonstrate the potential feasibility of enhancing disease resistance in rice and possibly other monocotyledonous crop species by expression of dicotyledonous PRRs. Our results also suggest that Arabidopsis EFR utilizes at least a subset of the known endogenous rice XA21 signaling components.« less

  1. Modeling of plasma distortions by laser-induced ablation spectroscopy (LIAS) and implications for the interpretation of LIAS measurements

    NASA Astrophysics Data System (ADS)

    Tokar, M. Z.; Gierse, N.; Philipps, V.; Samm, U.

    2015-09-01

    For the interpretation of the line radiation observed from laser induced ablation spectroscopy (LIAS) such parameters as the density and temperature of electrons within very compact clouds of atoms and singly charged ions of ablated material have to be known. Compared to the local plasma conditions prior to the laser pulse, these can be strongly changed during LIAS since new electrons are generated by the ionisation of particles ejected from the irradiated target. Because of their transience and spatial inhomogeneity it is technically difficult to measure disturbances induced in the plasma by LIAS. To overcome this uncertainty a numerical model has been elaborated, providing a self-consistent description for the spreading of ablated particles and accompanying modifications in the plasma. The results of calculations for LIAS performed on carbon-containing targets in Ohmic and additionally heated discharges in the tokamak TEXTOR are presented. Due to the increase in the electron density the ‘ionisation per photon’ ratio, S/XB factor, is significantly enhanced compared to unperturbed plasma conditions. The impact of the amount of material ablated and of the plasma conditions before LIAS on the level of the S/XB-enhancement is investigated.

  2. Is the decrease of the total electron energy density a covalence indicator in hydrogen and halogen bonds?

    PubMed

    Angelina, Emilio L; Duarte, Darío J R; Peruchena, Nélida M

    2013-05-01

    In this work, halogen bonding (XB) and hydrogen bonding (HB) complexes were studied with the aim of analyzing the variation of the total electronic energy density H(r b ) with the interaction strengthening. The calculations were performed at the MP2/6-311++G(2d,2p) level of approximation. To explain the nature of such interactions, the atoms in molecules theory (AIM) in conjunction with reduced variational space self-consistent field (RVS) energy decomposition analysis were carried out. Based on the local virial theorem, an equation to decompose the total electronic energy density H(r b ) in two energy densities, (-G(r b )) and 1/4∇(2)ρ(r b ), was derived. These energy densities were linked with the RVS interaction energy components. Through the connection between both decomposition schemes, it was possible to conclude that the decrease in H(r b ) with the interaction strengthening observed in the HB as well as the XB complexes, is mainly due to the increase in the attractive electrostatic part of the interaction energy and in lesser extent to the increase in its covalent character, as is commonly considered.

  3. Exposing the Symbiosis of 3A 1954+319

    NASA Astrophysics Data System (ADS)

    Pottschmidt, Katja; Marcu, D. M.; Hell, N.; Fuerst, F.; Miškoviča, I.; Müller, S.; Grinberg, V.; Corbet, R. H.; Wilms, J.

    2013-04-01

    Symbiotic X-ray Binaries (SyXB) are a rare class 8 known members) of Low Mass X-ray Binaries (LMXB), in which a compact object accretes material from an evolved M-type giant. The SyXB and accreting pulsar 3A 1954+319 is further exceptional since it has the longest pulse period known for an X-ray binary. It undergoes rapid changes, which we found span a range of 5.0-5.8 hours over the interval 2005-2012 monitored with Swift-BAT, probably an indication of the expected strong interaction with the dense M-giant wind. We present an analysis of a Chandra observation performed on 2010, December 26, and an RXTE observation performed on 2011, January 10-11, both spanning two pulse cycles. The Swift-BAT context shows that during both observations the source was in a state of comparatively stable and low hard X-ray flux (at about 15 mCrab, with a pulse period around 5.6 h and overall slowing down). We discuss the broad band ``baseline'' spectrum and compare it to the two earlier X-ray broad band studies described in the literature. Strong flaring activity on timescales of hundreds to thousands of seconds is observed and studied in the light of a possible accretion shock interpretation.

  4. Transgenic Expression of the Dicotyledonous Pattern Recognition Receptor EFR in Rice Leads to Ligand-Dependent Activation of Defense Responses

    PubMed Central

    Thomas, Nicolas; Holton, Nicolas; Nekrasov, Vladimir; Ruan, Deling; Canlas, Patrick E.; Daudi, Arsalan; Petzold, Christopher J.; Singan, Vasanth R.; Kuo, Rita; Chovatia, Mansi; Daum, Christopher; Heazlewood, Joshua L.; Zipfel, Cyril; Ronald, Pamela C.

    2015-01-01

    Plant plasma membrane localized pattern recognition receptors (PRRs) detect extracellular pathogen-associated molecules. PRRs such as Arabidopsis EFR and rice XA21 are taxonomically restricted and are absent from most plant genomes. Here we show that rice plants expressing EFR or the chimeric receptor EFR::XA21, containing the EFR ectodomain and the XA21 intracellular domain, sense both Escherichia coli- and Xanthomonas oryzae pv. oryzae (Xoo)-derived elf18 peptides at sub-nanomolar concentrations. Treatment of EFR and EFR::XA21 rice leaf tissue with elf18 leads to MAP kinase activation, reactive oxygen production and defense gene expression. Although expression of EFR does not lead to robust enhanced resistance to fully virulent Xoo isolates, it does lead to quantitatively enhanced resistance to weakly virulent Xoo isolates. EFR interacts with OsSERK2 and the XA21 binding protein 24 (XB24), two key components of the rice XA21-mediated immune response. Rice-EFR plants silenced for OsSERK2, or overexpressing rice XB24 are compromised in elf18-induced reactive oxygen production and defense gene expression indicating that these proteins are also important for EFR-mediated signaling in transgenic rice. Taken together, our results demonstrate the potential feasibility of enhancing disease resistance in rice and possibly other monocotyledonous crop species by expression of dicotyledonous PRRs. Our results also suggest that Arabidopsis EFR utilizes at least a subset of the known endogenous rice XA21 signaling components. PMID:25821973

  5. Sample preparation and determination of biomass content in solid recovered fuels: a comparison of methods.

    PubMed

    Schnöller, Johannes; Aschenbrenner, Philipp; Hahn, Manuel; Fellner, Johann

    2014-10-01

    The biomass content of material from pulp and paper production (a mixture of waste and paper and thin layer packaging plastics) is determined by the adapted balance method. This novel approach is a combination of combustion elemental analysis (CHNSO) and a data reconciliation algorithm based on successive linearisation for evaluation of the analysis results. It also involves less effort and expense than conventional procedures. However, the CHNSO technique only handles small mass amounts (few hundred milligrams), so cryogenic impact milling was applied for particle size reduction below 200 µm in order to generate homogeneous, representative analysis samples. The investigation focuses on the parameters biogenic content as a percentage of the total mass xB and xB (TC), which is the biomass stated as a fraction of the total carbon value. The results are within 1%-5% of the data obtained by the reference methods, namely the selective dissolution method and (14)C- method. Additionally, advantages and drawbacks of the adapted balance method in comparison with standard methods are discussed, showing that the adapted balance method is a method to be considered for the determination of biomass content in solid recovered fuels or similar materials. PMID:25245296

  6. Genetic diversity in population of largemouth bronze gudgeon (Coreius guichenoti Sauvage et Dabry) from Yangtze River determined by microsatellite DNA analysis.

    PubMed

    Zhang, Futie; Tan, Deqing

    2010-01-01

    Largemouth bronze gudgeon (Coreius guichenoti Sauvage et Dabry 1874), one of the endemic fish species in the upper reaches of the Yangtze River in China, is a benthic and potamodromous fish that is typically found in rivers with torrential flow. Three dams in the Yangtze River, Ertan Dam, Three Gorges Dam and Gezhouba Dam, may have had vital impacts on the habitat and spawning behaviors of largemouth bronze gudgeon, and could ultimately threaten the survival of this fish. We studied the population genetic diversity of C. guichenoti samples collected at seven sites (JH, GLP, BX, HJ, MD, SDP and XB) within the Yangtze River and one of its tributaries, the Yalong River. Genetic diversity patterns were determined by analyzing genetic data from 11 polymorphic microsatellite loci. A high genetic diversity among these largemouth bronze gudgeon populations was indicated by the number of microsatellite alleles (A) and the expected heterozygosity (HE). No significant population variation occurred among GLP, BX, HJ and MD populations, but dramatic population differentiation was observed among JH and XB, two dam-blocked populations, versus other populations. Tests for bottlenecks did not indicate recent dramatic population declines and concurrent losses of genetic diversity in any largemouth bronze gudgeon populations. To the contrary, we found that dams accelerated the population differentiation of this fish. PMID:21317547

  7. A crystal engineering approach for the design of multicomponent crystals and assembly of nano-scale architectures

    NASA Astrophysics Data System (ADS)

    Hurley, Evan Patrick

    The work presented in this thesis has demonstrated that supramolecular synthons can be used to make multicomponent crystals, and various synthons can be combined to make supermolecules. The synthons can also be used to construct nanoscale assemblies. Molecules containing single and multiple hydrogen-bond (HB) and halogen-bond (XB) acceptor sites have been synthesized in an effort to carry out supramolecular synthesis in order to establish a reliable hierarchy for intermolecular interactions. Pyrazole-based molecules have been made, combined with various carboxylic acids, and characterized using infrared (IR) spectroscopy to give a success rate of 55-70%. Reactions that gave a positive result were converted to solution experiments, and crystals were grown and characterized using single-crystal X-ray diffraction (XRD). The co-crystals display infinite 1-D chains with the intended stoichiometry and structural landscape on 6/6 occasions. The salts, on the other hand, display unpredictable stoichiometry and structural landscape on 5/5 occasions. Furthermore, the electrostatic charge on the primary hydrogen-bond acceptor, N(pyz), can be altered by adding a nitro, R-NO 2, covalent handle to the backbone of the pyrazole molecule. Addition of a strongly electron withdrawing group significantly lowered the charge on the pyrazole nitrogen atom and, in turn, lowered the supramolecular yield to 10%. Ditopic molecules containing pyrazole and pyridine on the same molecular backbone were synthesized and characterized using 1H NMR. The molecules were co-crystallized with carboxylic acids, and the resulting solids were characterized using IR spectroscopy. The solids could then be classified as co-crystal or salt using specific markers in the IR spectrum. Single-crystal XRD was used to observe the intermolecular interactions in the co-crystals and salts, and the co-crystals were assigned to two groups: Group 1 (2) and Group 2 (2). The salts (4) show more unpredictability with

  8. Matrix-free constructions of circulant and block circulant preconditioners

    SciTech Connect

    Yang, Chao; Ng, Esmond G.; Penczek, Pawel A.

    2001-12-01

    A framework for constructing circulant and block circulant preconditioners (C) for a symmetric linear system Ax=b arising from certain signal and image processing applications is presented in this paper. The proposed scheme does not make explicit use of matrix elements of A. It is ideal for applications in which A only exists in the form of a matrix vector multiplication routine, and in which the process of extracting matrix elements of A is costly. The proposed algorithm takes advantage of the fact that for many linear systems arising from signal or image processing applications, eigenvectors of A can be well represented by a small number of Fourier modes. Therefore, the construction of C can be carried out in the frequency domain by carefully choosing its eigenvalues so that the condition number of C{sup T} AC can be reduced significantly. We illustrate how to construct the spectrum of C in a way such that the smallest eigenvalues of C{sup T} AC overlaps with those of A extremely well while the largest eigenvalues of C{sup T} AC are smaller than those of A by several orders of magnitude. Numerical examples are provided to demonstrate the effectiveness of the preconditioner on accelerating the solution of linear systems arising from image reconstruction application.

  9. Repeat what after whom? Exploring variable selectivity in a cross-dialectal shadowing task.

    PubMed

    Walker, Abby; Campbell-Kibler, Kathryn

    2015-01-01

    Twenty women from Christchurch, New Zealand and 16 from Columbus Ohio (dialect region U.S. Midland) participated in a bimodal lexical naming task where they repeated monosyllabic words after four speakers from four regional dialects: New Zealand, Australia, U.S. Inland North and U.S. Midland. The resulting utterances were acoustically analyzed, and presented to listeners on Amazon Mechanical Turk in an AXB task. Convergence is observed, but differs depending on the dialect of the speaker, the dialect of the model, the particular word class being shadowed, and the order in which dialects are presented to participants. We argue that these patterns are generally consistent with findings that convergence is promoted by a large phonetic distance between shadower and model (Babel, 2010, contra Kim et al., 2011), and greater existing variability in a vowel class (Babel, 2012). The results also suggest that more comparisons of accommodation toward different dialects are warranted, and that the investigation of the socio-indexical meaning of specific linguistic forms in context is a promising avenue for understanding variable selectivity in convergence. PMID:26029129

  10. Measuring FLOPS Using Hardware Performance Counter Technologies on LC systems

    SciTech Connect

    Ahn, D H

    2008-09-05

    FLOPS (FLoating-point Operations Per Second) is a commonly used performance metric for scientific programs that rely heavily on floating-point (FP) calculations. The metric is based on the number of FP operations rather than instructions, thereby facilitating a fair comparison between different machines. A well-known use of this metric is the LINPACK benchmark that is used to generate the Top500 list. It measures how fast a computer solves a dense N by N system of linear equations Ax=b, which requires a known number of FP operations, and reports the result in millions of FP operations per second (MFLOPS). While running a benchmark with known FP workloads can provide insightful information about the efficiency of a machine's FP pipelines in relation to other machines, measuring FLOPS of an arbitrary scientific application in a platform-independent manner is nontrivial. The goal of this paper is twofold. First, we explore the FP microarchitectures of key processors that are underpinning the LC machines. Second, we present the hardware performance monitoring counter-based measurement techniques that a user can use to get the native FLOPS of his or her program, which are practical solutions readily available on LC platforms. By nature, however, these native FLOPS metrics are not directly comparable across different machines mainly because FP operations are not consistent across microarchitectures. Thus, the first goal of this paper represents the base reference by which a user can interpret the measured FLOPS more judiciously.

  11. Fast solution of elliptic partial differential equations using linear combinations of plane waves.

    PubMed

    Pérez-Jordá, José M

    2016-02-01

    Given an arbitrary elliptic partial differential equation (PDE), a procedure for obtaining its solution is proposed based on the method of Ritz: the solution is written as a linear combination of plane waves and the coefficients are obtained by variational minimization. The PDE to be solved is cast as a system of linear equations Ax=b, where the matrix A is not sparse, which prevents the straightforward application of standard iterative methods in order to solve it. This sparseness problem can be circumvented by means of a recursive bisection approach based on the fast Fourier transform, which makes it possible to implement fast versions of some stationary iterative methods (such as Gauss-Seidel) consuming O(NlogN) memory and executing an iteration in O(Nlog(2)N) time, N being the number of plane waves used. In a similar way, fast versions of Krylov subspace methods and multigrid methods can also be implemented. These procedures are tested on Poisson's equation expressed in adaptive coordinates. It is found that the best results are obtained with the GMRES method using a multigrid preconditioner with Gauss-Seidel relaxation steps. PMID:26986436

  12. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.).

    PubMed

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean) revealed motifs unique to monocots (Poales) or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW) in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production. PMID:26771740

  13. Shell runs 14,500-ft sucker rod completion

    SciTech Connect

    Wilson, J.W.

    1982-12-01

    Discusses a well in Wyoming's Reno field which features a modified downhole pump, a custom-made polished rod, and a special electric motor. String design was augmented by Shell's RodCal computer program that calculates load, stress, torque, horsepower requirements, stroke length, strokes per minute, and rod length and number. The pump is a 1 1/4-in. RHBM (API Spec. 11AX-B12) with an 11/16-in. valve rod. The polished rod is 30-ft long with a 1 1/2 diam, with a shoulder at the bottom and a conventional end at the top. The steel tapered rod string is a binary construction, run in 25-ft sections. The length of the string presented problems on the surface. To avoid midstring shock loading, Shell used an ultrahigh slip motor which slows from 1,170 to approximately 800 rpm on the downstroke to allow the string time to synchronize before starting the upstroke. The 70 b/d rate is expected to increase as the Reno field is under waterflood.

  14. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.).

    PubMed

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean) revealed motifs unique to monocots (Poales) or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW) in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production.

  15. Effects of consonantal context on perception of French rounded vowels by American English adults with and without French language experience

    NASA Astrophysics Data System (ADS)

    Levy, Erika S.; Strange, Winifred

    2002-05-01

    This study extended Gottfried's [J. Phonetics 12, 91-114 (1984)] investigation of the effects of learning French on AE listeners categorial discrimination of the contrasts involving Parisian French vowels /y/, /ø/, /u/, and /i/. Vowels were presented in /rabVp/ and /radVt/ bisyllables embedded in carrier phrases by three different speakers in an AXB discrimination task. Two groups were tested: proficient L2-French-speaking AE listeners (Exp) and non-French-speaking AE listeners (Inexp). Overall, the Exp group performed better than the Inexp group on /u-ø/, /y-i/, and /y-ø/ distinctions (mean errors: Exp=5%, Inexp=24%). However, for /u-y/, the groups did not differ (Exp=30% vs Inexp=24% errors). The findings may be explained by perceptual assimilation patterns, which are determined, in part, by consonantal context. The Inexp group confused /y/ with /i/ in bilabial context, but /y/ with /u/ in alveolar context, whereas the Exp group confused /y/ with /u/, in both contexts. For all contrasts, the Inexp group performed better in bilabial than in alveolar context (16% vs 32% errors), whereas no context effect was revealed for the Exp group. The results suggest that learning a foreign language includes learning its coarticulatory rules.

  16. Phase Behavior of All-Hydrocarbon ``Diblock-Random'' Copolymers

    NASA Astrophysics Data System (ADS)

    Beckingham, Bryan; Register, Richard

    2013-03-01

    ``Block-random'' copolymers (AxB1-x) -(AyB1-y) , where each of the two blocks is a random copolymer of monomers A and B, present a convenient and useful variation on the typical block copolymer architecture, as the interblock interactions and physical properties can be tuned continuously through the random block's composition. The ability to tune the effective interaction parameter between the blocks continuously, allows for the order-disorder transition temperature (TODT) to be tuned independently of molecular weight using only two monomers. This flexibility makes block-random copolymers a versatile platform for the exploration of polymer phase behavior and structure-property relationships. Here, we present the phase behavior of hydrogenated derivatives of various lamellae-forming diblock-random copolymers where one block is a styrene/isoprene (S rI) random copolymer. Using small-angle x-ray scattering, we investigate a series of isoprene hydrogenated hI-S rhI with varying styrene content, determine order-disorder transition temperatures and compare the observed phase behavior to that of more typical S-hI block copolymers via mean-field theory. Additionally, diblock-random copolymers, 50 wt. % styrene in the S rI block, are synthesized with polyisoprene, polybutadiene or polystyrene blocks and we examine the phase behavior of both their hydrogenated derivatives, prepared with catalysts which either leave the S units intact or saturate them to vinylcyclohexane.

  17. Uncertainty analysis

    SciTech Connect

    Thomas, R.E.

    1982-03-01

    An evaluation is made of the suitability of analytical and statistical sampling methods for making uncertainty analyses. The adjoint method is found to be well-suited for obtaining sensitivity coefficients for computer programs involving large numbers of equations and input parameters. For this purpose the Latin Hypercube Sampling method is found to be inferior to conventional experimental designs. The Latin hypercube method can be used to estimate output probability density functions, but requires supplementary rank transformations followed by stepwise regression to obtain uncertainty information on individual input parameters. A simple Cork and Bottle problem is used to illustrate the efficiency of the adjoint method relative to certain statistical sampling methods. For linear models of the form Ax=b it is shown that a complete adjoint sensitivity analysis can be made without formulating and solving the adjoint problem. This can be done either by using a special type of statistical sampling or by reformulating the primal problem and using suitable linear programming software.

  18. Transfer of cadmium from soil to vegetable in the Pearl River Delta area, South China.

    PubMed

    Zhang, Huihua; Chen, Junjian; Zhu, Li; Yang, Guoyi; Li, Dingqiang

    2014-01-01

    The purpose of this study was to investigate the regional Cadmium (Cd) concentration levels in soils and in leaf vegetables across the Pearl River Delta (PRD) area; and reveal the transfer characteristics of Cadmium (Cd) from soils to leaf vegetable species on a regional scale. 170 paired vegetables and corresponding surface soil samples in the study area were collected for calculating the transfer factors of Cadmium (Cd) from soils to vegetables. This investigation revealed that in the study area Cd concentration in soils was lower (mean value 0.158 mg kg(-1)) compared with other countries or regions. The Cd-contaminated areas are mainly located in west areas of the Pearl River Delta. Cd concentrations in all vegetables were lower than the national standard of Safe vegetables (0.2 mg kg(-1)). 88% of vegetable samples met the standard of No-Polluted vegetables (0.05 mg kg(-1)). The Cd concentration in vegetables was mainly influenced by the interactions of total Cd concentration in soils, soil pH and vegetable species. The fit lines of soil-to-plant transfer factors and total Cd concentration in soils for various vegetable species were best described by the exponential equation (y = ax(b)), and these fit lines can be divided into two parts, including the sharply decrease part with a large error range, and the slowly decrease part with a low error range, according to the gradual increasing of total Cd concentrations in soils.

  19. Theoretical study of surface plasmons coupling in transition metallic alloy 2D binary grating

    NASA Astrophysics Data System (ADS)

    Dhibi, Abdelhak; Khemiri, Mehdi; Oumezzine, Mohamed

    2016-05-01

    The excitation of a surface plasmon polariton (SPP) wave on a metal-air interface by a 2D diffraction grating is numerically investigated. The grating consists of homogeneous alloys of two metals of a formula AxB1-x, or three metals of a formula AxByCz, where A, B and C could be silver (Ag), copper (Cu), gold (Au) or aluminum (Al). It is observed that all the alloys of two metals present a very small change of surface plasmon resonance (SPR) irrespective of composition x. Moreover, the addition of 25% of Al to two metals alloy is insufficient to change the SPR curves. The influence of the different grating parameters is discussed in details using rigorous coupled-wave analysis (RCWA) method. Furthermore, the SPR is highly dependent on grating periods (dx and dy) and the height of the grating h. The results reveal that dx= dy= 700 nm, h=40 nm and duty cycle w=0.5 are the optimal parameters for exciting SPP.

  20. The interaction of short-term and long-term memory in phonetic category formation

    NASA Astrophysics Data System (ADS)

    Harnsberger, James D.

    2002-05-01

    This study examined the role that short-term memory capacity plays in the relationship between novel stimuli (e.g., non-native speech sounds, native nonsense words) and phonetic categories in long-term memory. Thirty native speakers of American English were administered five tests: categorial AXB discrimination using nasal consonants from Malayalam; categorial identification, also using Malayalam nasals, which measured the influence of phonetic categories in long-term memory; digit span; nonword span, a short-term memory measure mediated by phonetic categories in long-term memory; and paired-associate word learning (word-word and word-nonword pairs). The results showed that almost all measures were significantly correlated with one another. The strongest predictor for the discrimination and word-nonword learning results was nonword (r=+0.62) and digit span (r=+0.51), respectively. When the identification test results were partialed out, only nonword span significantly correlated with discrimination. The results show a strong influence of short-term memory capacity on the encoding of phonetic detail within phonetic categories and suggest that long-term memory representations regulate the capacity of short-term memory to preserve information for subsequent encoding. The results of this study will also be discussed with regards to resolving the tension between episodic and abstract models of phonetic category structure.

  1. Magnetic and nonmagnetic doping dependence of the conducting surface states in Sm B6

    NASA Astrophysics Data System (ADS)

    Kang, B. Y.; Min, Chul-Hee; Lee, S. S.; Song, M. S.; Cho, K. K.; Cho, B. K.

    2016-10-01

    Kondo insulator Sm B6 has attracted attention because it can realize new topological phenomena driven by the interplay between strong correlation effect and topology. However, its topological nature is still under debate. To examine the topological aspect, we demonstrate the nonmagnetic La and magnetic Ce doping dependence of the resistance of Sm B6 . Moreover, the resistance ratios of different thicknesses are analyzed to confirm the surface contribution. Lightly doped La samples show a purely conducting surface region at low temperature, whereas the lightly doped Ce samples do not have any conducting region at low temperature. Furthermore, based on the analysis of the electrical transport data of S m1 -xL axB6 (0.0 ≤x ≤1.0 ), an electronic phase diagram was found, composed of four regions: region I (0.0 ≤x ≤0.06 ), II (0.1 ≤x ≤0.15 ), III (x ≈0.2 ) , and IV (0.25 ≤x ≤1.0 ). Region I is characterized by the presence of conducting surface states, region II is characterized by the insulating phase due to the d -f hybridization gap without the conducting surface state, region III is characterized by the disappearance of the d -f hybridization gap and the existence of valence fluctuation, and region IV is a typical metallic state.

  2. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.)

    PubMed Central

    Kaur, Simerjeet; Dhugga, Kanwarpal S.; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean) revealed motifs unique to monocots (Poales) or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW) in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production. PMID:26771740

  3. Porous nanoarchitectures of spinel-type transition metal oxides for electrochemical energy storage systems.

    PubMed

    Park, Min-Sik; Kim, Jeonghun; Kim, Ki Jae; Lee, Jong-Won; Kim, Jung Ho; Yamauchi, Yusuke

    2015-12-14

    Transition metal oxides possessing two kinds of metals (denoted as AxB3-xO4, which is generally defined as a spinel structure; A, B = Co, Ni, Zn, Mn, Fe, etc.), with stoichiometric or even non-stoichiometric compositions, have recently attracted great interest in electrochemical energy storage systems (ESSs). The spinel-type transition metal oxides exhibit outstanding electrochemical activity and stability, and thus, they can play a key role in realising cost-effective and environmentally friendly ESSs. Moreover, porous nanoarchitectures can offer a large number of electrochemically active sites and, at the same time, facilitate transport of charge carriers (electrons and ions) during energy storage reactions. In the design of spinel-type transition metal oxides for energy storage applications, therefore, nanostructural engineering is one of the most essential approaches to achieving high electrochemical performance in ESSs. In this perspective, we introduce spinel-type transition metal oxides with various transition metals and present recent research advances in material design of spinel-type transition metal oxides with tunable architectures (shape, porosity, and size) and compositions on the micro- and nano-scale. Furthermore, their technological applications as electrode materials for next-generation ESSs, including metal-air batteries, lithium-ion batteries, and supercapacitors, are discussed.

  4. NAS Experiences of Porting CM Fortran Codes to HPF on IBM SP2 and SGI Power Challenge

    NASA Technical Reports Server (NTRS)

    Saini, Subhash

    1995-01-01

    Current Connection Machine (CM) Fortran codes developed for the CM-2 and the CM-5 represent an important class of parallel applications. Several users have employed CM Fortran codes in production mode on the CM-2 and the CM-5 for the last five to six years, constituting a heavy investment in terms of cost and time. With Thinking Machines Corporation's decision to withdraw from the hardware business and with the decommissioning of many CM-2 and CM-5 machines, the best way to protect the substantial investment in CM Fortran codes is to port the codes to High Performance Fortran (HPF) on highly parallel systems. HPF is very similar to CM Fortran and thus represents a natural transition. Conversion issues involved in porting CM Fortran codes on the CM-5 to HPF are presented. In particular, the differences between data distribution directives and the CM Fortran Utility Routines Library, as well as the equivalent functionality in the HPF Library are discussed. Several CM Fortran codes (Cannon algorithm for matrix-matrix multiplication, Linear solver Ax=b, 1-D convolution for 2-D datasets, Laplace's Equation solver, and Direct Simulation Monte Carlo (DSMC) codes have been ported to Subset HPF on the IBM SP2 and the SGI Power Challenge. Speedup ratios versus number of processors for the Linear solver and DSMC code are presented.

  5. The albino mutation of tyrosinase alters ocular angiogenic responsiveness.

    PubMed

    Rogers, Michael S; Adini, Irit; McBride, Aaron F; Birsner, Amy E; D'Amato, Robert J

    2013-07-01

    We have observed substantial differences in angiogenic responsiveness in mice and have mapped the genetic loci responsible for these differences. We have found that the albino mutation is one of the loci responsible for such differences. Using B6.A consomic strains, we determined that chromosome 7 bears a locus that inhibits VEGF-induced corneal neovascularization. F2 crosses between B6.A consomic mice and C57BL/6J parents along with AXB and BXA recombinant inbred strains demonstrated highest linkage near the tyrosinase gene. This region was named AngVq4. Congenic animals confirmed this locus, but could not demonstrate that the classical tyrosinase albino (c) mutation was causative because of the existence of additional linked loci in the congenic region. However, in 1970, a second tyrosinase albino mutation (c-2J) arose in the C57BL/6J background at Jackson Labs. Testing this strain (C57BL/6J) demonstrated that the albino mutation is sufficient to completely explain the alteration in angiogenic response that we observed in congenic animals. Thus, we conclude that the classical tyrosinase mutation is responsible for AngVq4. In contrast to the cornea, where pigmented animals exhibit increased angiogenic responsiveness, iris neovascularization was inhibited in pigmented animals. These results may partially explain increased aggressiveness in amelanotic melanoma, as well as ethnic differences in diabetic retinopathy and macular degeneration. PMID:23423728

  6. Perception and production of English vowels by Mandarin speakers: age-related differences vary with amount of L2 exposure.

    PubMed

    Jia, Gisela; Strange, Winifred; Collado, Julissa; Guan, Qi

    2006-02-01

    In this study we assessed age-related differences in the perception and production of American English (AE) vowels by native Mandarin speakers as a function of the amount of exposure to the target language. Participants included three groups of native Mandarin speakers: 87 children, adolescents and young adults living in China, 77 recent arrivals who had lived in the U.S. for two years or less, and 54 past arrivals who had lived in the U.S. between three and five years. The latter two groups arrived in the U.S. between the ages of 7 and 44 years. Discrimination of six AE vowel pairs /i-i/, /i-e(I)/, /e-ae/, /ae-a/, /a-(symbol see text)/, and /u-a/ was assessed with a categorial AXB task. Production of the eight vowels /i, i, e(I), e, ae, (symbol see text), a, u/ was assessed with an immediate imitation task. Age-related differences in performance accuracy changed from an older-learner advantage among participants in China, to no age differences among recent arrivals, and to a younger-learner advantage among past arrivals. Performance on individual vowels and vowel contrasts indicated the influence of the Mandarin phonetic/phonological system. These findings support a combined environmental and L1 interference/transfer theory as an explanation of the long-term younger-learner advantage in mastering L2 phonology.

  7. Porous nanoarchitectures of spinel-type transition metal oxides for electrochemical energy storage systems.

    PubMed

    Park, Min-Sik; Kim, Jeonghun; Kim, Ki Jae; Lee, Jong-Won; Kim, Jung Ho; Yamauchi, Yusuke

    2015-12-14

    Transition metal oxides possessing two kinds of metals (denoted as AxB3-xO4, which is generally defined as a spinel structure; A, B = Co, Ni, Zn, Mn, Fe, etc.), with stoichiometric or even non-stoichiometric compositions, have recently attracted great interest in electrochemical energy storage systems (ESSs). The spinel-type transition metal oxides exhibit outstanding electrochemical activity and stability, and thus, they can play a key role in realising cost-effective and environmentally friendly ESSs. Moreover, porous nanoarchitectures can offer a large number of electrochemically active sites and, at the same time, facilitate transport of charge carriers (electrons and ions) during energy storage reactions. In the design of spinel-type transition metal oxides for energy storage applications, therefore, nanostructural engineering is one of the most essential approaches to achieving high electrochemical performance in ESSs. In this perspective, we introduce spinel-type transition metal oxides with various transition metals and present recent research advances in material design of spinel-type transition metal oxides with tunable architectures (shape, porosity, and size) and compositions on the micro- and nano-scale. Furthermore, their technological applications as electrode materials for next-generation ESSs, including metal-air batteries, lithium-ion batteries, and supercapacitors, are discussed. PMID:26549729

  8. Repeat what after whom? Exploring variable selectivity in a cross-dialectal shadowing task

    PubMed Central

    Walker, Abby; Campbell-Kibler, Kathryn

    2015-01-01

    Twenty women from Christchurch, New Zealand and 16 from Columbus Ohio (dialect region U.S. Midland) participated in a bimodal lexical naming task where they repeated monosyllabic words after four speakers from four regional dialects: New Zealand, Australia, U.S. Inland North and U.S. Midland. The resulting utterances were acoustically analyzed, and presented to listeners on Amazon Mechanical Turk in an AXB task. Convergence is observed, but differs depending on the dialect of the speaker, the dialect of the model, the particular word class being shadowed, and the order in which dialects are presented to participants. We argue that these patterns are generally consistent with findings that convergence is promoted by a large phonetic distance between shadower and model (Babel, 2010, contra Kim et al., 2011), and greater existing variability in a vowel class (Babel, 2012). The results also suggest that more comparisons of accommodation toward different dialects are warranted, and that the investigation of the socio-indexical meaning of specific linguistic forms in context is a promising avenue for understanding variable selectivity in convergence. PMID:26029129

  9. A generic high-dose rate {sup 192}Ir brachytherapy source for evaluation of model-based dose calculations beyond the TG-43 formalism

    SciTech Connect

    Ballester, Facundo; Carlsson Tedgren, Åsa; Granero, Domingo; Haworth, Annette; Mourtada, Firas; Fonseca, Gabriel Paiva; Rivard, Mark J.; Siebert, Frank-André; Sloboda, Ron S.; and others

    2015-06-15

    Purpose: In order to facilitate a smooth transition for brachytherapy dose calculations from the American Association of Physicists in Medicine (AAPM) Task Group No. 43 (TG-43) formalism to model-based dose calculation algorithms (MBDCAs), treatment planning systems (TPSs) using a MBDCA require a set of well-defined test case plans characterized by Monte Carlo (MC) methods. This also permits direct dose comparison to TG-43 reference data. Such test case plans should be made available for use in the software commissioning process performed by clinical end users. To this end, a hypothetical, generic high-dose rate (HDR) {sup 192}Ir source and a virtual water phantom were designed, which can be imported into a TPS. Methods: A hypothetical, generic HDR {sup 192}Ir source was designed based on commercially available sources as well as a virtual, cubic water phantom that can be imported into any TPS in DICOM format. The dose distribution of the generic {sup 192}Ir source when placed at the center of the cubic phantom, and away from the center under altered scatter conditions, was evaluated using two commercial MBDCAs [Oncentra{sup ®} Brachy with advanced collapsed-cone engine (ACE) and BrachyVision ACUROS{sup TM}]. Dose comparisons were performed using state-of-the-art MC codes for radiation transport, including ALGEBRA, BrachyDose, GEANT4, MCNP5, MCNP6, and PENELOPE2008. The methodologies adhered to recommendations in the AAPM TG-229 report on high-energy brachytherapy source dosimetry. TG-43 dosimetry parameters, an along-away dose-rate table, and primary and scatter separated (PSS) data were obtained. The virtual water phantom of (201){sup 3} voxels (1 mm sides) was used to evaluate the calculated dose distributions. Two test case plans involving a single position of the generic HDR {sup 192}Ir source in this phantom were prepared: (i) source centered in the phantom and (ii) source displaced 7 cm laterally from the center. Datasets were independently produced by

  10. Disordered electronic systems: Concentration dependence of the dc conductivity in amorphous transition-metal-metalloid alloys (metallic regime)

    NASA Astrophysics Data System (ADS)

    Sonntag, Joachim

    1989-08-01

    In the metallic regime of several a-N1-xMx and a-T1-xMx alloys, the concentration dependence of the electrical resistivity ρ can be approximated by dlnρ=α*dξ, where α* is constant for a given alloy and ξ=x/(1-x). $N- and -T- stand for a transition metal with completely and incompletely occupied d bands, respectively, and M stands for a metalloid element. If, in the alloy, phase separation is realized, there is electron redistribution between the two phases A and B. For a-N1-xMx alloys this can be described by -dn=βndζ with ζ=XB/XA, where n is the electron density in the conduction band (CB) formed by the A phase. XA and XB are the fractions of the A and B phases having the average concentrations xA and xB, respectively. β depends on the average potential difference between the A and B phases. B is the phase with the deeper average potential. Part of the electrons in the B phase occupies the valence band (VB) formed by the B phase. Another part occupies trap states (as far as available below EF), leading to electron localization. The electron redistribution leads to long-range electron-density fluctuations expressed by δn=(1+ζ-1)(n0-n) n0 is the total s and p valence-electron concentration. Under certain conditions both CB and VB can contribute to the electronic transport. -dn=βn dζ is expected to apply also to a-T1-xMx alloys, where the electron redistribution can enclose part of the d electrons as well. Positive Hall coefficients are expected, when both the VB has ``hole'' conductivity, and this contribution dominates compared with those of the CB. Activation of electrons from the B to the A phase with increasing temperature can lead to a negative temperature coefficient of ρ.

  11. SU-E-T-547: A Method to Correlate Treatment Planning Issue with Clinical Analysis for Prostate Stereotactic Body Radiotherapy (SBRT)

    SciTech Connect

    Li, K; Jung, E; Newton, J; Cornell, D; Able, A

    2014-06-01

    Purpose: In this study, the algorithms and calculation setting effect and contribution weighing on prostate Volumetric Modulated Arc Therapy (VMAT) based SBRT were evaluated for clinical analysis. Methods: A low risk prostate patient under SBRT was selected for the treatment planning evaluation. The treatment target was divided into low dose prescription target volume (PTV) and high Dose PTV. Normal tissue constraints include urethra and femur head, and rectum was separated into anterior, lateral and posterior parts. By varying the constraint limit of treatment plan calculation setting and algorithms, the effect on dose coverage and normal tissue dose constraint parameter carried effective comparison for the nominal prescription and constraint. For each setting, their percentage differences to the nominal value were calculated with geometric mean and harmonic mean. Results: In the arbitrary prostate SBRT case, 14 variables were selected for this evaluation by using nominal prescription and constraint. Six VMAT planning settings were anisotropic analytic algorithm stereotactic beam with and without couch structure in grid size of 1mm and 2mm, non stereotactic beam, Acuros algorithm . Their geometry means of the variable sets for these plans were 112.3%, 111.9%, 112.09%, 111.75%, 111.28%, and 112.05%. And the corresponding harmonic means were 2.02%, 2.16%, 3.15%, 4.74%, 5.47% and 5.55%. Conclusions: In this study, the algorithm difference shows relatively larger harmonic mean between prostate SBRT VMAT plans. This study provides a methodology to find sensitive combined variables related to clinical analysis, and similar approach could be applied to the whole treatment procedure from simulation to treatment in radiotherapy for big clinical data analysis.

  12. SU-D-213-04: Accounting for Volume Averaging and Material Composition Effects in An Ionization Chamber Array for Patient Specific QA

    SciTech Connect

    Fugal, M; McDonald, D; Jacqmin, D; Koch, N; Ellis, A; Peng, J; Ashenafi, M; Vanek, K

    2015-06-15

    Purpose: This study explores novel methods to address two significant challenges affecting measurement of patient-specific quality assurance (QA) with IBA’s Matrixx Evolution™ ionization chamber array. First, dose calculation algorithms often struggle to accurately determine dose to the chamber array due to CT artifact and algorithm limitations. Second, finite chamber size and volume averaging effects cause additional deviation from the calculated dose. Methods: QA measurements were taken with the Matrixx positioned on the treatment table in a solid-water Multi-Cube™ phantom. To reduce the effect of CT artifact, the Matrixx CT image set was masked with appropriate materials and densities. Individual ionization chambers were masked as air, while the high-z electronic backplane and remaining solid-water material were masked as aluminum and water, respectively. Dose calculation was done using Varian’s Acuros XB™ (V11) algorithm, which is capable of predicting dose more accurately in non-biologic materials due to its consideration of each material’s atomic properties. Finally, the exported TPS dose was processed using an in-house algorithm (MATLAB) to assign the volume averaged TPS dose to each element of a corresponding 2-D matrix. This matrix was used for comparison with the measured dose. Square fields at regularly-spaced gantry angles, as well as selected patient plans were analyzed. Results: Analyzed plans showed improved agreement, with the average gamma passing rate increasing from 94 to 98%. Correction factors necessary for chamber angular dependence were reduced by 67% compared to factors measured previously, indicating that previously measured factors corrected for dose calculation errors in addition to true chamber angular dependence. Conclusion: By comparing volume averaged dose, calculated with a capable dose engine, on a phantom masked with correct materials and densities, QA results obtained with the Matrixx Evolution™ can be significantly

  13. CLAS12 and its initial Science Program at the Jefferson Lab Upgrade

    SciTech Connect

    Burkert, Volker

    2009-01-01

    An overview of the CLAS12 detector is presented and the initial physics program after the energy-doubling of the Jefferson Lab electron accelerator. Construction of the 12 GeV upgrade project has started October 2008. A broad program has been developed to map the nucleon's 3-dimensional spin and flavor content through the measurement of deeply exclusive and semi-inclusive processes. Other programs include forward distribution function to large $x_{B} \\le 0.85$ and of the quark and gluon polarized distribution functions, as well as nucleon ground state and transition form factors at high $Q^2$. The 12 GeV electron beam and the large acceptance of CLAS12 are also well suited to explore hadronization properties using the nucleus as a laboratory

  14. An experimental investigation of dynamic ground effect

    NASA Technical Reports Server (NTRS)

    Lee, Pai Hung; Lan, C. Edward; Muirhead, Vincent U.

    1987-01-01

    Sixty degree delta wing, F-106B, and XB-70 models with and without flap deflections were tested in static and dynamic ground effect in the 36 by 51 inch subsonic wind tunnel at the University of Kansas. Dynamic ground effect was measured with movable sting support. For flow visualization, a tufted wire grid was mounted on the movable sting behind the model. Tests results showed that the lift and drag increments in dynamic ground effect were always lower than the static values. Effect of the trailing-edge flap deflections on lift increments was slight. The fuselage reduced the lift increments at a given ground height. From flow visualization under static conditions, the vortex core was seen to enlarge as the ground approached.

  15. Uhuru observations of the Norma X-ray burster

    NASA Technical Reports Server (NTRS)

    Grindlay, J.; Gursky, H.

    1976-01-01

    Four X-ray bursts consistent with a single source in Norma are reported which were discovered by reexamining Uhuru data obtained between 1970 and 1973. The temporal and spectral characteristics of the bursts are described and shown to be similar to those displayed by bursts from the globular cluster NGC 6224. An error box of the source location is given, and it is found that both the position and intensity of the four bursts are consistent with those of 10 bursts detected by the Vela satellites in 1976. It is concluded that the source is the same as that observed by the Vela and is an X-ray burster with characteristics similar to those of certain other bursters. XB 1608-52 is suggested as the designation of this burster, possible burst models are considered, and it is noted that the error box of the present source contains an identified globular cluster.

  16. Glass capable of ionic conduction and method of preparation

    DOEpatents

    Susman, S.; Boehm, L.; Volin, K.J.; Delbecq, C.J.

    1982-05-06

    Sulfide glasses capable of conducting alkali metal ions are prepared from a nonmetal glass former such as GeS/sub 2/, B/sub 2/S/sub 2/ and SiS/sub 2/ in mixture with a glass modifier such as Na/sub 2/S or another alkali metal sulfide. A molten mixture of the constituents is rapidly quenched to below the glass transition temperature by contact with a metal mold. The rapid quench is sufficient to prevent crystallization and permit solidification as an amorphous solid mixture. An oxygen-free atmosphere is maintained over the mixture to prevent oxidation. A new glass system of (1 - X) Na/sub 2/O:XB/sub 2/S/sub 3/ is disclosed.

  17. Glass capable of ionic conduction and method of preparation

    DOEpatents

    Susman, Sherman; Boehm, Leah; Volin, Kenneth J.; Delbacq, Charles J.

    1985-01-01

    Sulfide glasses capable of conducting alkali metal ions are prepared from a nonmetal glass former such as GeS.sub.2, B.sub.2 S.sub.3 and SiS.sub.2 in mixture with a glass modifier such as Na.sub.2 S or another alkali metal sulfide. A molten mixture of the constituents is rapidly quenched to below the glass transition temperature by contact with a metal mold. The rapid quench is sufficient to prevent crystallization and permit solidification as an amorphous solid mixture. An oxygen-free atmosphere is maintained over the mixture to prevent oxidation. A new glass system of (1-X) Na.sub.2 O:XB.sub.2 S.sub.3 is disclosed.

  18. Glass capable of ionic conduction and method of preparation

    DOEpatents

    Susman, S.; Delbecq, C.J.; Volin, K.J.; Boehm, L.

    1984-02-21

    Sulfide glasses capable of conducting alkali metal ions are prepared from a nonmetal glass former such as GeS[sub 2], B[sub 2]S[sub 3] and SiS[sub 2] in mixture with a glass modifier such as Na[sub 2]S or another alkali metal sulfide. A molten mixture of the constituents is rapidly quenched to below the glass transition temperature by contact with a metal mold. The rapid quench is sufficient to prevent crystallization and permit solidification as an amorphous solid mixture. An oxygen-free atmosphere is maintained over the mixture to prevent oxidation. A new glass system of (1-X) Na[sub 2]O:XB[sub 2]S[sub 3] is disclosed. 4 figs.

  19. Glass capable of ionic conduction and method of preparation

    DOEpatents

    Susman, Sherman; Delbecq, Charles J.; Volin, Kenneth J.; Boehm, Leah

    1984-01-01

    Sulfide glasses capable of conducting alkali metal ions are prepared from a nonmetal glass former such as GeS.sub.2, B.sub.2 S.sub.3 and SiS.sub.2 in mixture with a glass modifier such as Na.sub.2 S or another alkali metal sulfide. A molten mixture of the constituents is rapidly quenched to below the glass transition temperature by contact with a metal mold. The rapid quench is sufficient to prevent crystallization and permit solidification as an amorphous solid mixture. An oxygen-free atmosphere is maintained over the mixture to prevent oxidation. A new glass system of (1-X) Na.sub.2 O:XB.sub.2 S.sub.3 is disclosed.

  20. Electroproduction of π0 at high momentum transfers in non-resonant region with CLAS

    NASA Astrophysics Data System (ADS)

    Kubarovskiy, Alex; CLAS Collaboration

    2013-10-01

    Generalized Parton Distributions (GPDs) offer a new way to access quark and gluon nucleon structure. The nucleon-to-meson transition distribution amplitudes (TDAs) are extensions of the GPD concept to three quark operators. In this talk we report the first preliminary results of studies of the reaction ep → epπ0 using the CEBAF Large Acceptance Spectrometer (CLAS) at Jefferson Lab with an electron beam energy of 5.75 GeV. Differential cross sections were extracted for 1.5 < Q2 < 4.5 GeV2, 0.1 < xB < 0.6 and -t up to 6.0 GeV2 in non-resonant region (W > 2.0 GeV). Results will be discussed in the framework of a u-channel TDA model.

  1. A clonal complex 12 methicillin-resistant Staphylococcus aureus strain, West Australian MRSA-59, harbors a novel pseudo-SCCmec element.

    PubMed

    Monecke, Stefan; Coombs, Geoffrey W; Pearson, Julie; Hotzel, Helmut; Slickers, Peter; Ehricht, Ralf

    2015-11-01

    A West Australian methicillin-resistant Staphylococcus aureus strain (WA MRSA-59) was characterized by microarray and sequencing. Its pseudo-staphylococcal cassette chromosome mec (SCCmec) element comprised dcs, Q9XB68-dcs, mvaS-SCC, Q5HJW6, dru, ugpQ, ydeM, mecA-mecR-mecI, txbi mecI, tnp IS431, copA2-mco (copper resistance), ydhK, arsC-arsB-arsR (arsenic resistance), open reading frame PT43, and per-2. Recombinase genes, xylR (mecR2), and PSM-mec (phenol-soluble modulin) were absent. We suggest that mec complex A should be split into two subtypes. One harbors PSM-mec and xylR (mecR2). It is found in SCCmec types II, III, and VIII. The second subtype, described herein, is present in WA MRSA-59 and some coagulase-negative staphylococci.

  2. Subsonic Wing Optimization for Handling Qualities Using ACSYNT

    NASA Technical Reports Server (NTRS)

    Soban, Danielle Suzanne

    1996-01-01

    The capability to accurately and rapidly predict aircraft stability derivatives using one comprehensive analysis tool has been created. The PREDAVOR tool has the following capabilities: rapid estimation of stability derivatives using a vortex lattice method, calculation of a longitudinal handling qualities metric, and inherent methodology to optimize a given aircraft configuration for longitudinal handling qualities, including an intuitive graphical interface. The PREDAVOR tool may be applied to both subsonic and supersonic designs, as well as conventional and unconventional, symmetric and asymmetric configurations. The workstation-based tool uses as its model a three-dimensional model of the configuration generated using a computer aided design (CAD) package. The PREDAVOR tool was applied to a Lear Jet Model 23 and the North American XB-70 Valkyrie.

  3. The use of Pettifor structure maps for the interstitially stabilized AB{sub 3}C-Cu{sub 3}Au intermetallics

    SciTech Connect

    Kassem, M.A.

    1995-04-15

    For a long period of time scientists have been trying to classify and order the crystal structures of binary, ternary, and quaternary phase. Pettifor set up a chemical scale X by arranging the elements along a single axis. The order of the elements preserve the Mendelev type characteristics of the periodic table. Each element has been assigned a number (Mendeleev-number) according to its order. This ordering of the elements has not created any overlap between the (VB, VB, and VIB) adjacent groups. Several two dimensional structural maps were constructed using (XA, XB). Such maps have achieved good structural separation. The boundaries of the structural domains in the Pettifor maps are meaningless and only define the areas of high potential of certain structure type to occur. The Pettifor maps can be used as a guide to structural changes due to substitutional alloying.

  4. Charmed partner of the exotic X (5568 ) state and its properties

    NASA Astrophysics Data System (ADS)

    Agaev, S. S.; Azizi, K.; Sundu, H.

    2016-05-01

    The mass, decay constant, and width of a hypothetical charmed partner Xc of the newly observed exotic Xb(5568 ) state are calculated using the technique of the QCD sum rule method. The Xc=[s u ][c ¯ d ¯ ] state with JP=0+ is described, employing two types of the diquark-antidiquark interpolating currents. The evaluation of the mass mXc and decay constant fXc is carried out utilizing the two-point sum rule method by including vacuum condensates up to eight dimensions. The widths of the decay channels Xc→Ds-π+ and Xc→D0K0 are also found. To this end, the strong couplings gXcDsπ and gXcDK are computed by means of QCD sum rules on the light-cone and soft-meson approximation.

  5. Solar wind controlled pulsations: A review

    SciTech Connect

    Odera, T.J.

    1986-02-01

    Studies of the solar wind controlled Pc 3, 4 pulsations by early and recent researchers are highlighted. The review focuses on the recent observations, which cover the time during the International Magnetospheric Study (IMS). Results from early and recent observations agree on one point, that is, that the Pc 3, 4 pulsations are influenced by three main solar wind parameters, namely, the solar wind velocity V/sub 5w/, the IMF orientation theta/sub x/B, and magnitude B. The results can be interpreted, preferably, in terms of an external origin for Pc 3, 4 pulsations. This implies, essentially, the signal model, which means that the pulsations originate in the upstream waves (in the interplanetary medium) and are transported by convection to the magnetopause, where they couple to oscillations of the magnetospheric field lines.

  6. PrFeCoB-based magnets derived from bulk alloy glass

    NASA Astrophysics Data System (ADS)

    Pawlik, Piotr; Davies, Hywel A.; Kaszuwara, Waldemar; Wysłocki, Jerzy J.

    2005-04-01

    The magnetic properties of nanocomposite Fe 61Co 13.5Zr 1Pr 4.5-xDy xB 20 ( x=0, 1) magnets, derived by devitrification annealing the thick amorphous melt-spun ribbon and suction-cast 1 and 3 mm outer diameter thin walled tube samples, are presented. The Zr addition was intended to improve the glass forming ability of similar Fe-Co-RE-B alloys studied by us earlier, while the Dy was substituted to enhance the magnetocrystalline anisotropy field. The results revealed useful magnetic hardening and modest remanence enhancement of the samples. In contrast, 1 mm dia rod shaped castings were not fully amorphous.

  7. Planet-Crossing Asteroid Search (PCAS)

    NASA Technical Reports Server (NTRS)

    Helin, E. F.

    1986-01-01

    511 independent fields were photographed with the 0.46m Schmidt during 15 observing runs along with a limited number of 1.2m Schmidt exposures. From these fields 122 new asteroids were reported. Special sets of field using the 1.2m Schmidt are continuing to yield numerous new faint asteroids. The combined result from both telescopes include 4 Mars-crossers, 3 Hungarias, 2 Phocaeas, a unique high inclination object (1985XB), 1 Apollo (1985PA) and Aten (3362) Khufu. Halley was regularly monitored (astrometry and large-scale phenomena) IHW participation. Scientifically value photographs were obtained from both 0.46m and 1.2m Schmidt Telescopes. Other accessible comets were observed including G-Z. Recently a new comet (1986d) was discovered.

  8. Flight calibration of compensated and uncompensated pitot-static airspeed probes and application of the probes to supersonic cruise vehicles

    NASA Technical Reports Server (NTRS)

    Webb, L. D.; Washington, H. P.

    1972-01-01

    Static pressure position error calibrations for a compensated and an uncompensated XB-70 nose boom pitot static probe were obtained in flight. The methods (Pacer, acceleration-deceleration, and total temperature) used to obtain the position errors over a Mach number range from 0.5 to 3.0 and an altitude range from 25,000 feet to 70,000 feet are discussed. The error calibrations are compared with the position error determined from wind tunnel tests, theoretical analysis, and a standard NACA pitot static probe. Factors which influence position errors, such as angle of attack, Reynolds number, probe tip geometry, static orifice location, and probe shape, are discussed. Also included are examples showing how the uncertainties caused by position errors can affect the inlet controls and vertical altitude separation of a supersonic transport.

  9. Direct Observation of Ion Exchange in Mechanically Activated LiH+MgB2 System Using Ultra-High Field Nuclear Magnetic Resonance Spectroscopy

    SciTech Connect

    Hu, Jian Z.; Kwak, Ja Hun; Yang, Zhenguo; Wan, Xiufeng; Shaw, Leonard D.

    2009-04-06

    The LiBH4 + MgH2 system has great potential for hydrogen vehicle applications. In this study, the reported solid-state hydrogenation system made of LiH + 1/2MgB2 has been investigated using ultra-high field nuclear magnetic resonance spectroscopy. It is found that Mg-Li ion exchange occurs within MgB2 during ball milling to form a compound of (Mg1-xLi2x)B2 which facilitates the formation of LiBH4 in the subsequent hydriding reaction. This discovery offers a scientific foundation for investigating the detailed mechanisms of solid-state hydrogenation and dehdrogenation of the LiBH4 +MgH2 system in the future.

  10. Hα diagnostic in a recombining plasma

    NASA Astrophysics Data System (ADS)

    Wenzel, U.; Goto, M.

    2016-05-01

    In fusion devices the hydrogen Balmer lines are used to measure the neutral flux from the walls into the plasma using the atomic physics factor S/XB. This is a standard diagnostic which can be applied in ionizing plasma using {{H}α} , {{H}β} or {{H}γ} without knowledge of the electron density. We will extend this method to a recombining plasma in front of a surface. {{H}α} can be used in an analogous way to measure the plasma flow to this surface which can be e.g. a divertor target. The other Balmer lines are not suitable because the corresponding atomic physics factor R/YB depends on density due to three-body recombination. An application of this diagnostic method is provided.

  11. A simplified flight-test method for determining aircraft takeoff performance that includes effects of pilot technique

    NASA Technical Reports Server (NTRS)

    Larson, T. J.; Schweikhard, W. G.

    1974-01-01

    A method for evaluating aircraft takeoff performance from brake release to air-phase height that requires fewer tests than conventionally required is evaluated with data for the XB-70 airplane. The method defines the effects of pilot technique on takeoff performance quantitatively, including the decrease in acceleration from drag due to lift. For a given takeoff weight and throttle setting, a single takeoff provides enough data to establish a standardizing relationship for the distance from brake release to any point where velocity is appropriate to rotation. The lower rotation rates penalized takeoff performance in terms of ground roll distance; the lowest observed rotation rate required a ground roll distance that was 19 percent longer than the highest. Rotations at the minimum rate also resulted in lift-off velocities that were approximately 5 knots lower than the highest rotation rate at any given lift-off distance.

  12. Cross Sections for the Exclusive Photon Electroproduction on the Proton and Generalized Parton Distributions.

    PubMed

    Jo, H S; Girod, F X; Avakian, H; Burkert, V D; Garçon, M; Guidal, M; Kubarovsky, V; Niccolai, S; Stoler, P; Adhikari, K P; Adikaram, D; Amaryan, M J; Anderson, M D; Anefalos Pereira, S; Ball, J; Baltzell, N A; Battaglieri, M; Batourine, V; Bedlinskiy, I; Biselli, A S; Boiarinov, S; Briscoe, W J; Brooks, W K; Carman, D S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Compton, N; Contalbrigo, M; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Dupre, R; Alaoui, A El; Fassi, L El; Elouadrhiri, L; Fedotov, G; Fegan, S; Filippi, A; Fleming, J A; Garillon, B; Gevorgyan, N; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Goetz, J T; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guler, N; Guo, L; Hafidi, K; Hakobyan, H; Harrison, N; Hattawy, M; Hicks, K; Hirlinger Saylor, N; Ho, D; Holtrop, M; Hughes, S M; Ilieva, Y; Ireland, D G; Ishkhanov, B S; Jenkins, D; Joo, K; Joosten, S; Keller, D; Khachatryan, G; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Kuhn, S E; Kuleshov, S V; Lenisa, P; Livingston, K; Lu, H Y; MacGregor, I J D; McKinnon, B; Meziani, Z E; Mirazita, M; Mokeev, V; Montgomery, R A; Moutarde, H; Movsisyan, A; Munevar, E; Munoz Camacho, C; Nadel-Turonski, P; Net, L A; Niculescu, G; Osipenko, M; Ostrovidov, A I; Paolone, M; Park, K; Pasyuk, E; Phillips, J J; Pisano, S; Pogorelko, O; Price, J W; Procureur, S; Prok, Y; Puckett, A J R; Raue, B A; Ripani, M; Rizzo, A; Rosner, G; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Simonyan, A; Skorodumina, Iu; Smith, G D; Sokhan, D; Sparveris, N; Stepanyan, S; Strakovsky, I I; Strauch, S; Sytnik, V; Tian, Ye; Tkachenko, S; Ungaro, M; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Weinstein, L B; Wood, M H; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2015-11-20

    Unpolarized and beam-polarized fourfold cross sections (d^{4}σ/dQ^{2}dx_{B}dtdϕ) for the ep→e^{'}p^{'}γ reaction were measured using the CLAS detector and the 5.75-GeV polarized electron beam of the Jefferson Lab accelerator, for 110 (Q^{2},x_{B},t) bins over the widest phase space ever explored in the valence-quark region. Several models of generalized parton distributions (GPDs) describe the data well at most of our kinematics. This increases our confidence that we understand the GPD H, expected to be the dominant contributor to these observables. Through a leading-twist extraction of Compton form factors, these results support the model predictions of a larger nucleon size at lower quark-momentum fraction x_{B}.

  13. Enhancement of critical current density of MgB2 by doping Ho2O3

    NASA Astrophysics Data System (ADS)

    Cheng, C.; Zhao, Y.

    2006-12-01

    Mg1-x(Ho2O3)xB2 alloys were prepared by in situ solid state reaction to study the effect of magnetic Ho2O3 dopant on flux pinning behavior of MgB2. Crystal structure, Tc, and Hc2 were not affected by Ho2O3 doping; however, Jc and Hirr were significantly enhanced. In 5T field, the best sample (x =3%) reached Jc of 1.0×103, 2.0×104, and 1.2×105A/cm2 at 20, 10, and 5K, respectively, much higher than those achieved by nonmagnetic impurity, such as Ti-, Zr-, and Y2O3-doped MgB2. The observed magnetic HoB4 nanoparticles were attributed to be the source for the enhanced flux pinning effects.

  14. Performance of local correlation methods for halogen bonding: The case of Br{sub 2}–(H{sub 2}O){sub n},n = 4,5 clusters and Br{sub 2}@5{sup 12}6{sup 2} clathrate cage

    SciTech Connect

    Batista-Romero, Fidel A.; Bernal-Uruchurtu, Margarita I.; Hernández-Lamoneda, Ramón; Pajón-Suárez, Pedro

    2015-09-07

    The performance of local correlation methods is examined for the interactions present in clusters of bromine with water where the combined effect of hydrogen bonding (HB), halogen bonding (XB), and hydrogen-halogen (HX) interactions lead to many interesting properties. Local methods reproduce all the subtleties involved such as many-body effects and dispersion contributions provided that specific methodological steps are followed. Additionally, they predict optimized geometries that are nearly free of basis set superposition error that lead to improved estimates of spectroscopic properties. Taking advantage of the local correlation energy partitioning scheme, we compare the different interaction environments present in small clusters and those inside the 5{sup 12}6{sup 2} clathrate cage. This analysis allows a clear identification of the reasons supporting the use of local methods for large systems where non-covalent interactions play a key role.

  15. Exclusive pi^0 electroproduction at W > 2 GeV with CLAS

    SciTech Connect

    Bedlinskiy, I; Kubarovsky, V; Niccolai, S; Stoler, P; Adhikari, K P; Anderson, M D; Pereira, S Anefalos; Avakian, H; Ball, J; Baltzell, N A; Battaglieri, M; Batourine, V; Biselli, A S; Boiarinov, S; Bono, J; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Colaneri, L; Cole, P L; Contalbrigo, M; Cortes, O; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Doughty, D; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Fleming, J A; Forest, T A; Garillon, B; Garcon, M; Gavalian, G; Gevorgyan, N; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guo, L; Hafidi, K; Hakobyan, H; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Ireland, D G; Ishkhanov, B S; Isupov, E L; Jenkins, D; Jo, H S; Joo, K; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kuhn, S E; Kuleshov, S V; Lenisa, P; Levine, W I; Livingston, K; Lu, H Y; MacGregor, I J.D.; Markov, N; Mayer, M; McKinnon, B; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Munoz Camacho, C; Nadel-Turonski, P; Niculescu, I; Osipenko, M; Ostrovidov, A I; Pappalardo, L L; Park, K; Park, S; Pasyuk, E; Phelps, E; Phelps, W; Phillips, J J; Pisano, S; Pogorelko, O; Price, J W; Prok, Y; Protopopescu, D; Procureur, S; Puckett, A J.R.; Raue, B A; Ripani, M; Ritchie, B G; Rizzo, A; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Senderovich, I; Sharabian, Y G; Simonyan, A; Smith, G D; Sober, D I; Sokhan, D; Stepanyan, S S; Strauch, S; Sytnik, V; Tang, W; Tian, Ye; Ungaro, M; Vlassov, A V; Voskanyan, H; Voutier, E; Walford, N K; Watts, D; Wei, X; Weinstein, L B; Yurov, M; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2014-08-01

    Exclusive neutral-pion electroproduction (ep-->e'p'pi0) was measured at Jefferson Lab with a 5.75-GeV electron beam and the CLAS detector. Differential cross sections d4sigma/dtdQ2dxBdphipi and structure functions sigmaT+epsilonsigmaL,sigmaTT and σLT as functions of t were obtained over a wide range of Q2 and xB. The data are compared with Regge and handbag theoretical calculations. Analyses in both frameworks find that a large dominance of transverse processes is necessary to explain the experimental results. For the Regge analysis it is found that the inclusion of vector meson rescattering processes is necessary to bring the magnitude of the calculated and measured structure functions into rough agreement. In the handbag framework, there are two independent calculations, both of which appear to roughly explain the magnitude of the structure functions in terms of transversity generalized parton distributions.

  16. The magnetization behavior of melt-spun FeDy-B alloys

    NASA Astrophysics Data System (ADS)

    Kim, K. S.; Lee, J. M.; Jeung, J. K.; Moon, Y. M.; Yu, S. C.; Lim, S. H.

    2001-05-01

    We report the salient features of the magnetization behavior of melt-spun ribbons of (Dy 0.33Fe 0.67) 1- xB x with x=0, 0.05, 0.1 and 0.15 alloys. The temperature dependence of magnetization and low-temperature hysteresis loops were measured using a vibrating sample magnetometer during heating from 5 to 900 K, with an applied field of 50 kOe. Our results show that the addition of B seems to decrease the magnetic order and hence to decrease the exchange stiffness and the Curie temperature. Very large values of the coercive force at a low temperature of 5 K, ranging from 19 800 to 22 900 Oe, was observed. The rapid increase of the coercive force at low temperatures is explained by the topological disorder due to the presence of rare earth spins distributed randomly.

  17. Effect of R(3+) ions on the structure and properties of lanthanum borate glasses

    NASA Technical Reports Server (NTRS)

    Chakraborty, I. N.; Day, D. E.

    1985-01-01

    The present investigation of glass formation in the (mole percent) systems 25La2O3 (x)R2O3 (75-x)B2O3, where R = Al, Ga, and (25-x)La2O3 (x)Ln2O3 75B2O3, where Ln = Gd, Er, Y, notes that up to 25 mol pct Al2O3 or Ga2O3 can be substituted for B2O3, while no more than about 5 mol pct Ln2O3, substituted for La2O3, caused macro-phase separation. The substitution of either R2O3 or Ln2O3 in the lanthanum borate system changes the separation distance between adjacent B3O6 chains. The effect of this structural change on the molar volume, transformation temperature, thermal expansion coefficient, and transformation-range viscosity is discussed.

  18. Strain-dependent lung tumor formation in mice transplacentally exposed to 3-methylcholanthrene and post-natally exposed to butylated hydroxytoluene.

    PubMed

    Gressani, K M; Leone-Kabler, S; O'Sullivan, M G; Case, L D; Malkinson, A M; Miller, M S

    1999-11-01

    The carcinogenic effects of in utero exposure to 3-methylcholanthrene (MC) have been demonstrated in the tumor-resistant C57BL/6 (B6) and DBA (D2) strains of mice. In this study, we determined the effects of in utero exposure to MC in BALB/c mice, a strain which demonstrates greater susceptibility to lung tumor induction, and compared our findings with those previously found in [D2xB6D2F(1)]F(2) mice. In addition, we assessed the molecular pathogenesis of the chemically induced tumors and examined the effects of the putative lung tumor promoter butylated hydroxytoluene (BHT) in BALB/c mice. BALB/c mice were treated on day 17 of gestation with 5, 15 or 45 mg/kg MC and 6 weeks after birth with BHT for 6 consecutive weeks. Mice were killed at 6 months of age. Ki-ras, p16Ink4a and p19ARF gene loci were amplified from paraffin-embedded lung tumor tissue and screened for the presence of point mutations via allele-specific oligonucleotide hybridization and single strand conformation polymorphism (SSCP) analyses. Ki-ras point mutations were found in 56% (20/36) of BALB/c lung tumors, with 33% (2/6) of the hyperplasias, 58% (10/19) of the adenomas and 73% (8/11) of the carcinomas exhibiting point mutations at this gene locus. Similar incidences of Ki-ras mutations were previously found following transplacental exposure of [D2xB6D2F(1)]F(2) mice to MC and treatment of adult A/J mice with urethane. Interestingly, a strain-dependent difference was observed in the mutational spectrum. Sixty-two and 38% of the lung lesions in BALB/c mice exhibited G-->C and G-->T transversions, respectively, in contrast to the 13 and 84% incidences previously observed in [D2xB6D2F(1)]F(2) mice. SSCP analysis of the tumor suppressor gene p16Ink4a showed a 6% incidence of point mutations, consistent with that found in [D2xB6D2F(1)]F(2) mice. No mutations were found in exon 1beta of the p19ARF gene of either strain. BHT, a lung tumor promoter in adult mice, had no statistically significant effects

  19. Longitudinal target-spin asymmetries for deeply virtual Compton scattering

    DOE PAGES

    Seder, E.; Biselli, A.; Pisano, S.; Niccolai, S.; Smith, G. D.; Joo, K.; Adhikari, K.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; et al

    2015-01-22

    A measurement of the electroproduction of photons off protons in the deeply inelastic regime was performed at Jefferson Lab using a nearly 6-GeV electron beam, a longitudinally polarized proton target and the CEBAF Large Acceptance Spectrometer. Target-spin asymmetries for ep → e'p'y events, which arise from the interference of the deeply virtual Compton scattering and the Bethe-Heitler processes, were extracted over the widest kinematics in Q2, xB, t and Φ, for 166 four-dimensional bins. In the framework of Generalized Parton Distributions (GPDs), at leading twist the t dependence of these asymmetries provides insight on the spatial distribution of the axialmore » charge of the proton, which appears to be concentrated in its center. In conclusion, these results bring important and necessary constraints for the existing parametrizations of chiral-even GPDs.« less

  20. Short Range Correlations and the EMC Effect

    SciTech Connect

    L.B. Weinstein, E. Piasetzky, D.W. Higinbotham, J. Gomez, O. Hen, R. Shneor

    2011-02-01

    This Letter shows quantitatively that the magnitude of the EMC effect measured in electron deep inelastic scattering at intermediate xB, 0.35≤xB≤0.7, is linearly related to the short range correlation (SRC) scale factor obtained from electron inclusive scattering at xB≥1. The observed phenomenological relationship is used to extract the ratio of the deuteron to the free pn pair cross sections and F2n/F2p, the ratio of the free neutron to free proton structure functions. We speculate that the observed correlation is because both the EMC effect and SRC are dominated by the high virtuality (high momentum) nucleons in the nucleus.

  1. Monte-Carlo Simulations of Chemical Erosion in TEXTOR-94 with the ERO-TEXTOR Code

    NASA Astrophysics Data System (ADS)

    Kirschner, A.; Philipps, V.; Pospieszczyk, A.; Wienhold, P.

    This paper presents ERO-TEXTOR simulation calculations of chemical erosion of a carbon limiter exposed to the TEXTOR Scrape-Off-Layer. The spatial distribution of CD-emission near a testlimiter is calculated in dependence on the plasma parameters and on the sticking probability for hydrocarbons hitting the limiter surface. The comparison of D/XB values with experimental data on TEXTOR-94 indicates that eroded hydrocarbons returning to the limiter surface have an extremely low effective sticking. This can be understood in terms of a high re-erosion of the freshly deposited a-C:D layer. The comparison of the radial distribution of the CD- and CII-emission between simulation and experiment shows a good agreement.

  2. Deeply Virtual Compton Scattering Beam-Spin Asymmetries

    SciTech Connect

    F.X. Girod; R.A. Niyazov

    2008-01-24

    The beam spin asymmetries in the hard exclusive electroproduction of photons on the proton (ep -> epg) were measured over a wide kinematic range and with high statistical accuracy. These asymmetries result from the interference of the Bethe-Heitler process and of deeply virtual Compton scattering. Over the whole kinematic range (x_B from 0.11 to 0.58, Q^2 from 1 to 4.8 GeV^2, -t from 0.09 to 1.8 GeV^2), the azimuthal dependence of the asymmetries is compatible with expectations from leading-twist dominance, A = a*sin(phi)/[1+c*cos(phi)]. This extensive set of data can thus be used to constrain significantly the generalized parton distributions of the nucleon in the valence quark sector.

  3. Analysis of the strong decay X(5568) → B_s^0π ^+ with QCD sum rules

    NASA Astrophysics Data System (ADS)

    Wang, Zhi-Gang

    2016-05-01

    In this article, we take the X(5568) to be the scalar diquark-antidiquark type tetraquark state, study the hadronic coupling constant g_{XB_sπ } with the three-point QCD sum rules by carrying out the operator product expansion up to the vacuum condensates of dimension-6 and including both the connected and the disconnected Feynman diagrams; then we calculate the partial decay width of the strong decay X(5568) → B_s^0 π ^+ and obtain the value Γ _X=( 20.5± 8.1) {MeV}, which is consistent with the experimental data Γ _X = ( 21.9 ± 6.4 {}^{+5.0}_{-2.5}) {MeV} from the D0 collaboration.

  4. Particle acceleration and plasma energization in substorms: MHD and test particle studies

    SciTech Connect

    Birn, Joachim

    2015-07-16

    The author organizes his slide presentation under the following topics: background, MHD simulation, orbit integration, typical orbits, spatial and temporal features, acceleration mechanisms, source locations, and source energies. Field-­aligned energetic particle fluxes are shown for 45-keV electrons and 80-keV protons. It is concluded that the onset from local thin current sheet is electron tearing. Acceleration is mainly from field collapse, governed by Ey = -vxXBz: importance of localization; betatron acceleration (similar if nonadiabatic); 1st order Fermi, type B (or A; current sheet acceleration). There are two source regions (of comparable importance in magnetotail): - flanks, inner tail - drift entry - early, higher energy - outer plasma sheet - reconnection entry - later, lower energy. Both thermal and suprathermal sources are important, with limited energy range for acceleration

  5. The characteristics of MBE-grown InxAl1-xN/GaN surface states

    NASA Astrophysics Data System (ADS)

    Jiao, Wenyuan; Kong, Wei; Li, Jincheng; Collar, Kristen; Kim, Tong-Ho; Losurdo, Maria; Brown, April S.

    2016-08-01

    The density and energy distribution of InxAl1-xN/GaN surface donor states are studied for InxAl1-xN structures with varying indium compositions. The results support a surface states model with a constant energy distribution of 2.17-2.63 eV below the conduction band minimum and a concentration of 4.64-8.27 × 1013 cm-2 eV-1. It is shown that the properties of the surface states are affected by the surface indium composition xs, as opposed to the bulk composition, xb (InxAl1-xN). Higher surface indium composition xs increases the density of surface states and narrows their energy distribution.

  6. Effect of Fe2O3 concentration on the structure of the SiO2-Na2O-Al2O3-B2O3 glass system.

    PubMed

    Dantas, Noelio O; Ayta, Walter E F; Silva, Anielle C A; Cano, Nilo F; Silva, Sebastião W; Morais, Paulo C

    2011-10-15

    The structural properties of the glass matrix 40SiO(2)·30Na(2)O·1Al(2)O(3)·(29-x)B(2)O(3)·xFe(2)O(3) (mol%), 0.0≤x≤29.0 were studied by X-ray diffraction (XRD), differential thermal analysis (DTA) and Raman and infrared spectroscopy (FT-IR). XRD demonstrated Fe(3)O(4) crystal formation for Fe(2)O(3) concentrations of 29.0 mol%. DTA showed that glass transition and crystallization temperatures changed as a function of Fe(2)O(3) concentration and that these alterations were related to structural change in the glass system. Interesting aspects of Raman and FT-IR spectra were found, and this gives information about of the structure changes in Si-O-Si units of these glasses as a function of Fe(2)O(3) concentration.

  7. Short-Range Nucleon-Nucleon Correlations

    SciTech Connect

    Douglas Higinbotham

    2011-10-01

    Valence-shell nucleon knock-out experiments, such as 12C(e,e'p)11B, measure less strength then is predicted by independent particle shell model calculations. The theoretical solution to this problem is to include the correlations between the nucleons in the nucleus in the calculations. Motivated by these results, many electron scattering experiments have tried to directly observe these correlations in order to gain new insight into the short-range part of the nucleon-nucleon potential. Unfortunately, many competing mechanisms can cause the same observable final-state as an initial-state correlation, making truly isolating the signal extremely challenging. This paper reviews the recent experimental evidence for short-range correlations, as well as explores the possibility that such correlations are responsible for the EMC effect in the 0.3 < xB < 0.7 deep inelastic scattering ratios.

  8. Generalized Parton Distributions And Deeply Virtual Compton Scattering At Clas

    SciTech Connect

    De Masi, Rita

    2007-09-01

    The deeply virtual Compton scattering is the simplest process to access the generalized parton distributions of the nucleon. A dedicated large statistics experiment for the measurement of deeply virtual Compton scattering with a 6 GeV polarized electron beam on a proton target has been performed at the Hall-B of Jefferson Laboratory with the CLAS spectrometer. The experiment covered a wide kinematic range, allowing the study of the beam spin asymmetry as function of the Bjorken variable xB, the Mandelstam variable t, the virtual photon four-momentum squared Q2 and the angle phi between leptonic and hadronic planes. The preliminary results are in agreement with previous measurements and with the predicted twist-2 dominance.

  9. Beam spin asymmetry in deep and exclusive pi0 electroproduction

    SciTech Connect

    R. De Masi

    2007-12-07

    The beam spin asymmetry (BSA) in the exclusive reaction ep->ep pi0 was measured with the CEBAF 5.77 GeV polarized electron beam and Large Acceptance Spectrometer(CLAS). The xB, Q2, t and phi dependences of the pi0 BSA are presented in the deep inelastic regime. The asymmetries are fitted with a sin(phi) function and their amplitudes are extracted. Overall, they are of the order of 0.04 - 0.11 and roughly independent of t. This is the signature of a non-zero longitudinal-transverse interference. The implications concerning the applicability of a formalism based on generalized parton distributions, as well as the extension of a Regge formalism at high photon virtualities, are discussed.

  10. Flight-measured base pressure coefficients for thick boundary-layer flow over an aft-facing step for Mach numbers from 0.4 to 2.5

    NASA Technical Reports Server (NTRS)

    Goecke, S. A.

    1973-01-01

    A 0.56-inch thick aft-facing step was located 52.1 feet from the leading edge of the left wing of an XB-70 airplane. A boundary-layer rake at a mirror location on the right wing was used to obtain local flow properties. Reynolds numbers were near 10 to the 8th power, resulting in a relatively thick boundary-layer. The momentum thickness ranged from slightly thinner to slightly thicker than the step height. Surface static pressures forward of the step were obtained for Mach numbers near 0.9, 1.5, 2.0, and 2.4. The data were compared with thin boundary-layer results from flight and wind-tunnel experiments and semiempirical relationships. Significant differences were found between the thick and the thin boundary-layer data.

  11. Identification and inspection of the vacancy site in Li doped BPO 4 ceramic electrolyte by NMR

    NASA Astrophysics Data System (ADS)

    Dodd, A. J.; van Eck, E. R. H.

    2002-10-01

    A study of the properties of the high temperature ceramic electrolyte Li xB 1- x/3 PO 4 (lithium boron phosphate) is reported. XRD and NMR are used to investigate changes of the material as a function of heat treatment. It was found that after synthesis at 450 °C the material contains a phase of Li 4P 2O 7 in addition to the BPO 4 phase. This second phase is removed by heat treatment at temperatures higher than 600 °C. Boron vacancies are present, REDOR and CPMAS techniques are used to investigate this defect site and show that for the heat treated material Li ions are present at the vacancy site.

  12. Experimental investigation of dynamic ground effect

    NASA Technical Reports Server (NTRS)

    Lee, Pai-Hung; Lan, C. Edward; Muirhead, Vincent U.

    1989-01-01

    A 60-degree delta wing, an F-106B, and an XB-70 model with and without flap deflections were tested in static and dynamic ground effect in the 36-by-51-inch subsonic wind tunnel at the University of Kansas. Dynamic ground effect was measured with movable sting support. For flow visualization, a tufted wire grid was mounted on the movable sting behind the model. Test results showed that lift and drag increments in dynamic ground effect were always lower than static values. Effect of the trailing edge flap deflections on lift increments was slight. The fuselage reduced the lift increments at a given ground height. From flow visualization under static conditions, the vortex core was seen to enlarge as the ground was approached.

  13. Comparative Phylogenetic Assignment of Environmental Sequences of Genes Encoding 16S rRNA and Numerically Abundant Culturable Bacteria from an Anoxic Rice Paddy Soil

    PubMed Central

    Hengstmann, Ulf; Chin, Kuk-Jeong; Janssen, Peter H.; Liesack, Werner

    1999-01-01

    We used both cultivation and direct recovery of bacterial 16S rRNA gene (rDNA) sequences to investigate the structure of the bacterial community in anoxic rice paddy soil. Isolation and phenotypic characterization of 19 saccharolytic and cellulolytic strains are described in the accompanying paper (K.-J. Chin, D. Hahn, U. Hengstmann, W. Liesack, and P. H. Janssen, Appl. Environ. Microbiol. 65:5042–5049, 1999). Here we describe the phylogenetic positions of these strains in relation to 57 environmental 16S rDNA clone sequences. Close matches between the two data sets were obtained for isolates from the culturable populations determined by the most-probable-number counting method to be large (3 × 107 to 2.5 × 108 cells per g [dry weight] of soil). This included matches with 16S rDNA similarity values greater than 98% within distinct lineages of the division Verrucomicrobia (strain PB90-1) and the Cytophaga-Flavobacterium-Bacteroides group (strains XB45 and PB90-2), as well as matches with similarity values greater than 95% within distinct lines of descent of clostridial cluster XIVa (strain XB90) and the family Bacillaceae (strain SB45). In addition, close matches with similarity values greater than 95% were obtained for cloned 16S rDNA sequences and bacteria (strains DR1/8 and RPec1) isolated from the same type of rice paddy soil during previous investigations. The correspondence between culture methods and direct recovery of environmental 16S rDNA suggests that the isolates obtained are representative geno- and phenotypes of predominant bacterial groups which account for 5 to 52% of the total cells in the anoxic rice paddy soil. Furthermore, our findings clearly indicate that a dual approach results in a more objective view of the structural and functional composition of a soil bacterial community than either cultivation or direct recovery of 16S rDNA sequences alone. PMID:10543822

  14. Spectral and timing nature of the symbiotic X-ray binary 4U 1954+319: The slowest rotating neutron star in an X-ray binary system

    SciTech Connect

    Enoto, Teruaki; Corbet, Robin H. D.; Sasano, Makoto; Yamada, Shin'ya; Tamagawa, Toru; Makishima, Kazuo; Pottschmidt, Katja; Marcu, Diana; Fuerst, Felix; Wilms, Jörn

    2014-05-10

    The symbiotic X-ray binary (SyXB) 4U 1954+319 is a rare system hosting a peculiar neutron star (NS) and an M-type optical companion. Its ∼5.4 hr NS spin period is the longest among all known accretion-powered pulsars and exhibited large (∼7%) fluctuations over 8 yr. A spin trend transition was detected with Swift/BAT around an X-ray brightening in 2012. The source was in quiescent and bright states before and after this outburst based on 60 ks Suzaku observations in 2011 and 2012. The observed continuum is well described by a Comptonized model with the addition of a narrow 6.4 keV Fe-Kα line during the outburst. Spectral similarities to slowly rotating pulsars in high-mass X-ray binaries, its high pulsed fraction (∼60%-80%), and the location in the Corbet diagram favor high B-field (≳ 10{sup 12} G) over a weak field as in low-mass X-ray binaries. The observed low X-ray luminosity (10{sup 33}-10{sup 35} erg s{sup –1}), probable wide orbit, and a slow stellar wind of this SyXB make quasi-spherical accretion in the subsonic settling regime a plausible model. Assuming a ∼10{sup 13} G NS, this scheme can explain the ∼5.4 hr equilibrium rotation without employing the magnetar-like field (∼10{sup 16} G) required in the disk accretion case. The timescales of multiple irregular flares (∼50 s) can also be attributed to the free-fall time from the Alfvén shell for a ∼10{sup 13} G field. A physical interpretation of SyXBs beyond the canonical binary classifications is discussed.

  15. Inactivation of ca10a and ca10b Genes Leads to Abnormal Embryonic Development and Alters Movement Pattern in Zebrafish

    PubMed Central

    Aspatwar, Ashok; Barker, Harlan R.; Saralahti, Anni K.; Bäuerlein, Carina A.; Ortutay, Csaba; Pan, Peiwen; Kuuslahti, Marianne; Parikka, Mataleena; Rämet, Mika; Parkkila, Seppo

    2015-01-01

    Carbonic anhydrase related proteins (CARPs) X and XI are highly conserved across species and are predominantly expressed in neural tissues. The biological role of these proteins is still an enigma. Ray-finned fish have lost the CA11 gene, but instead possess two co-orthologs of CA10. We analyzed the expression pattern of zebrafish ca10a and ca10b genes during embryonic development and in different adult tissues, and studied 61 CARP X/XI-like sequences to evaluate their phylogenetic relationship. Sequence analysis of zebrafish ca10a and ca10b reveals strongly predicted signal peptides, N-glycosylation sites, and a potential disulfide, all of which are conserved, suggesting that all of CARP X and XI are secretory proteins and potentially dimeric. RT-qPCR showed that zebrafish ca10a and ca10b genes are expressed in the brain and several other tissues throughout the development of zebrafish. Antisense morpholino mediated knockdown of ca10a and ca10b showed developmental delay with a high rate of mortality in larvae. Zebrafish morphants showed curved body, pericardial edema, and abnormalities in the head and eye, and there was increased apoptotic cell death in the brain region. Swim pattern showed abnormal movement in morphant zebrafish larvae compared to the wild type larvae. The developmental phenotypes of the ca10a and ca10b morphants were confirmed by inactivating these genes with the CRISPR/Cas9 system. In conclusion, we introduce a novel zebrafish model to investigate the mechanisms of CARP Xa and CARP Xb functions. Our data indicate that CARP Xa and CARP Xb have important roles in zebrafish development and suppression of ca10a and ca10b expression in zebrafish larvae leads to a movement disorder. PMID:26218428

  16. Does conduit artery diameter vary according to the anthropometric characteristics of children or men?

    PubMed

    Hopkins, N D; Green, D J; Tinken, T M; Sutton, L; McWhannell, N; Thijssen, D H J; Cable, N T; Stratton, G; George, K

    2009-12-01

    Arterial measurements are commonly undertaken to assess acute and chronic adaptations to exercise. Despite the widespread adoption of scaling practices in cardiac research, the relevance of scaling for body size and/or composition has not been addressed for arterial measures. We therefore investigated the relationships between brachial artery diameter and body composition in 129 children aged 9 to 10 yr (75 girls and 54 boys), and 50 men aged 16-49 yr. Body composition variables (total, lean, and fat mass in the whole body, arm, and forearm) were assessed by dual-energy X-ray absorptiometry, and brachial artery diameter was measured using high-resolution ultrasound. Bivariate correlations were performed, and arterial diameter was then scaled using simple ratios (y/x) and allometric approaches after log-log least squares linear regression and production of allometric exponents (b) and construction of power function ratios (y/xb). Size independence was checked via bivariate correlations (x:y/x; x:y/xb). As a result, significant correlations existed between brachial artery diameter and measures of body mass and lean mass in both cohorts (r=0.21-0.48, P<0.05). There were no significant relationships between diameter and fat mass. All b exponents were significantly different from 1 (0.08-0.50), suggesting that simple ratio scaling approaches were likely to be flawed. This was confirmed when ratio scaling produced negative residual size correlations, whereas allometric scaling produced size-independent indexes (r=0.00 to 0.03, P>0.05). In conclusion, when between- or within-group comparisons are performed under circumstances where it is important to control for differences in body size or composition, allometric scaling of artery diameter should be adopted rather than ratio scaling. Our data also suggest that scaling for lean or total mass may be more appropriate than scaling for indexes of fat mass.

  17. Halogen bond: a long overlooked interaction.

    PubMed

    Cavallo, Gabriella; Metrangolo, Pierangelo; Pilati, Tullio; Resnati, Giuseppe; Terraneo, Giancarlo

    2015-01-01

    Because of their high electronegativity, halogen atoms are typically considered, in most of their derivatives, as sites of high electron density and it is commonly accepted that they can form attractive interactions by functioning as the electron donor site (nucleophilic site). This is the case when they work as hydrogen bond acceptor sites. However, the electron density in covalently bound halogens is anisotropically distributed. There is a region of higher electron density, accounting for the ability of halogens to function as electron donor sites in attractive interactions, and a region of lower electron density where the electrostatic potential is frequently positive (mainly in the heavier halogens). This latter region is responsible for the ability of halogen atoms to function as the electron-acceptor site (electrophilic site) in attractive interactions formed with a variety of lone pair-possessing atoms, anions, and π-systems. This ability is quite general and is shown by a wide diversity of halogenated compounds (e.g., organohalogen derivatives and dihalogens). According to the definition proposed by the International Union of Pure and Applied Chemistry, any attractive interactions wherein the halogen atom is the electrophile is named halogen bond (XB). In this chapter, it is discussed how the practice and the concept of XB developed and a brief history of the interaction is presented. Papers (either from the primary or secondary literature) which have reported major experimental findings in the field or which have given important theoretical contributions for the development of the concept are recollected in order to trace how a unifying and comprehensive categorization emerged encompassing all interactions wherein halogen atoms function as the electrophilic site.

  18. Spectral and Timing Nature of the Symbiotic X-Ray Binary 4U 1954+319: The Slowest Rotating Neutron Star in AN X-Ray Binary System

    NASA Technical Reports Server (NTRS)

    Enoto, Teruaki; Sasano, Makoto; Yamada, Shin'Ya; Tamagawa, Toru; Makishima, Kazuo; Pottschmidt, Katja; Marcu, Diana; Corbet, Robin H. D.; Fuerst, Felix; Wilms, Jorn

    2014-01-01

    The symbiotic X-ray binary (SyXB) 4U 1954+319 is a rare system hosting a peculiar neutron star (NS) and an M-type optical companion. Its approx. 5.4 hr NS spin period is the longest among all known accretion-powered pulsars and exhibited large (is approx. 7%) fluctuations over 8 yr. A spin trend transition was detected with Swift/BAT around an X-ray brightening in 2012. The source was in quiescent and bright states before and after this outburst based on 60 ks Suzaku observations in 2011 and 2012. The observed continuum is well described by a Comptonized model with the addition of a narrow 6.4 keV Fe-K alpha line during the outburst. Spectral similarities to slowly rotating pulsars in high-mass X-ray binaries, its high pulsed fraction (approx. 60%-80%), and the location in the Corbet diagram favor high B-field (approx. greater than 10(exp12) G) over a weak field as in low-mass X-ray binaries. The observed low X-ray luminosity (10(exp33)-10(exp35) erg s(exp-1)), probable wide orbit, and a slow stellar wind of this SyXB make quasi-spherical accretion in the subsonic settling regime a plausible model. Assuming a approx. 10(exp13) G NS, this scheme can explain the approx. 5.4 hr equilibrium rotation without employing the magnetar-like field (approx. 10(exp16) G) required in the disk accretion case. The timescales of multiple irregular flares (approx. 50 s) can also be attributed to the free-fall time from the Alfv´en shell for a approx. 10(exp13) G field. A physical interpretation of SyXBs beyond the canonical binary classifications is discussed.

  19. Another thread in the tapestry of stellar feedback: X-ray binaries

    NASA Astrophysics Data System (ADS)

    Justham, Stephen; Schawinski, Kevin

    2012-06-01

    We consider X-ray binaries (XBs) as potential sources of stellar feedback. XBs observationally appear able to deposit a high fraction of their power output into their local interstellar medium, which may make them a non-negligible source of energy input. The formation rate of the most luminous XBs rises with decreasing metallicity, which should increase their significance during galaxy formation in the early Universe. We also argue that stochastic effects are important to XB feedback (XBF) and may dominate the systematic changes due to metallicity in many cases. Large stochastic variation in the magnitude of XBF at low absolute star formation rates provides a natural reason for diversity in the evolution of dwarf galaxies which were initially almost identical, with several per cent of such haloes experiencing energy input from XBs roughly two orders of magnitude above the most likely value. These probability distributions suggest that the effect of XBF is most commonly significant for total stellar masses between approximately 107 and 108 M⊙, which might resolve a current problem with modelling populations of such galaxies. We explain how XBs might inject energy before luminous supernovae (SNe) contribute significantly to feedback and how XBs can assist in keeping gas hot long after the last core-collapse SN has exploded. Energy input from XBs produces different behaviour to that from SNe, partly since the peak energy input from a mean XB population continues for ≈100 Myr after the start of a starburst. XBF could be especially important to some dwarf galaxies, potentially heating gas without expelling it; the properties of XBF also match those previously derived as allowing episodic star formation. We also argue that the efficiency of SN feedback (SNF) might be reduced when XBF has had the opportunity to act first. In addition, we note that the effect of SNF is unlikely to be scale-free; galaxies smaller than ≈100 pc might well experience less effective SNF.

  20. Optical emission measurements of H 2 and D 2 molecules in the divertor region of ASDEX Upgrade

    NASA Astrophysics Data System (ADS)

    Fantz, U.; Behringer, K.; Gafert, J.; Coster, D.; ASDEX Upgrade Team

    A spectroscopic method has been developed for measuring molecular influxes and particle densities in fusion edge plasmas, which is based on the H 2 and D 2 Fulcher emission bands around 600 nm wavelength. A first application to the ASDEX Upgrade divertor plasma is described. The influx of hydrogen molecules was determined from the population of the upper Fulcher state using the theoretical number of ionization and dissociation events per Fulcher photon ( Seff + Deff)/XB Ful, as calculated by a collisional-radiative model. These results were compared with expectations on the basis of the atomic hydrogen fluxes and a typical molecule/atom ratio. Measurements and calculations agree in their time dependence, but the experimental values are somewhat lower, which may be within the error margin or of more significance. The Fulcher radiation was also compared directly to B2-EIRENE predictions, resulting in a higher discrepancy. In addition, the vibrational population of the ground state molecules was determined from that of the excited state using a method based on Franck-Condon factors. It can be characterized by a Tvib between 3000 and 9000 K, inversely correlated with electron temperature. This variation is predicted by the collisional-radiative code and even allows an estimate of Te. Vibrational excitation increases ionization and dissociation rate coefficients, as clearly demonstrated by the code calculations. It is therefore very likely that the observed discrepancy in molecular intensity is mainly caused by the omission of vibrational excitation in the present version of B2-EIRENE. The described flux measurements are expected to be accurate above Te=5 eV, but are more difficult at lower temperatures due to the strong Te dependence of ( Seff + Deff)/XB Ful in that region.

  1. LOW-COST LED LUMINAIRE FOR GENERAL ILLUMINATION

    SciTech Connect

    Lowes, Ted

    2014-07-31

    During this two-year Solid-State Lighting (SSL) Manufacturing R&D project Cree developed novel light emitting diode (LED) technologies contributing to a cost-optimized, efficient LED troffer luminaire platform emitting at ~3500K correlated color temperature (CCT) at a color rendering index (CRI) of >90. To successfully achieve program goals, Cree used a comprehensive approach to address cost reduction of the various optical, thermal and electrical subsystems in the luminaire without impacting performance. These developments built on Cree’s high- brightness, low-cost LED platforms to design a novel LED component architecture that will enable low-cost troffer luminaire designs with high total system efficacy. The project scope included cost reductions to nearly all major troffer subsystems as well as assembly costs. For example, no thermal management components were included in the troffer, owing to the optimized distribution of compact low- to mid-power LEDs. It is estimated that a significant manufacturing cost savings will result relative to Cree’s conventional troffers at the start of the project. A chief project accomplishment was the successful development of a new compact, high-efficacy LED component geometry with a broad far-field intensity distribution and even color point vs. emission angle. After further optimization and testing for production, the Cree XQ series of LEDs resulted. XQ LEDs are currently utilized in Cree’s AR series troffers, and they are being considered for use in other platforms. The XQ lens geometry influenced the independent development of Cree’s XB-E and XB-G high-voltage LEDs, which also have a broad intensity distribution at high efficacy, and are finding wide implementation in Cree’s omnidirectional A-lamps.

  2. Predictive Models for Halogen-bond Basicity of Binding Sites of Polyfunctional Molecules.

    PubMed

    Glavatskikh, Marta; Madzhidov, Timur; Solov'ev, Vitaly; Marcou, Gilles; Horvath, Dragos; Graton, Jérôme; Le Questel, Jean-Yves; Varnek, Alexandre

    2016-02-01

    Halogen bonding (XB) strength assesses the ability of an electron-enriched group to be involved in complexes with polarizable electrophilic halogenated or diatomic halogen molecules. Here, we report QSPR models of XB of particular relevance for an efficient screening of large sets of compounds. The basicity is described by pKBI2 , the decimal logarithm of the experimental 1 : 1 (B : I2 ) complexation constant K of organic compounds (B) with diiodine (I2 ) as a reference halogen-bond donor in alkanes at 298 K. Modeling involved ISIDA fragment descriptors, using SVM and MLR methods on a set of 598 organic compounds. Developed models were then challenged to make predictions for an external test set of 11 polyfunctional compounds for which unambiguous assignment of the measured effective complexation constant to specific groups out of the putative acceptor sites is not granted. At this stage, developed models were used to predict pKBI2 of all putative acceptor sites, followed by an estimation of the predicted effective complexation constant using the ChemEqui program. The best consensus models perform well both in cross-validation (root mean squared error RMSE=0.39-0.47 logKBI2 units) and external predictions (RMSE=0.49). The SVM models are implemented on our website (http://infochim.u-strasbg.fr/webserv/VSEngine.html) together with the estimation of their applicability domain and an automatic detection of potential halogen-bond acceptor atoms. PMID:27491792

  3. Does conduit artery diameter vary according to the anthropometric characteristics of children or men?

    PubMed

    Hopkins, N D; Green, D J; Tinken, T M; Sutton, L; McWhannell, N; Thijssen, D H J; Cable, N T; Stratton, G; George, K

    2009-12-01

    Arterial measurements are commonly undertaken to assess acute and chronic adaptations to exercise. Despite the widespread adoption of scaling practices in cardiac research, the relevance of scaling for body size and/or composition has not been addressed for arterial measures. We therefore investigated the relationships between brachial artery diameter and body composition in 129 children aged 9 to 10 yr (75 girls and 54 boys), and 50 men aged 16-49 yr. Body composition variables (total, lean, and fat mass in the whole body, arm, and forearm) were assessed by dual-energy X-ray absorptiometry, and brachial artery diameter was measured using high-resolution ultrasound. Bivariate correlations were performed, and arterial diameter was then scaled using simple ratios (y/x) and allometric approaches after log-log least squares linear regression and production of allometric exponents (b) and construction of power function ratios (y/xb). Size independence was checked via bivariate correlations (x:y/x; x:y/xb). As a result, significant correlations existed between brachial artery diameter and measures of body mass and lean mass in both cohorts (r=0.21-0.48, P<0.05). There were no significant relationships between diameter and fat mass. All b exponents were significantly different from 1 (0.08-0.50), suggesting that simple ratio scaling approaches were likely to be flawed. This was confirmed when ratio scaling produced negative residual size correlations, whereas allometric scaling produced size-independent indexes (r=0.00 to 0.03, P>0.05). In conclusion, when between- or within-group comparisons are performed under circumstances where it is important to control for differences in body size or composition, allometric scaling of artery diameter should be adopted rather than ratio scaling. Our data also suggest that scaling for lean or total mass may be more appropriate than scaling for indexes of fat mass. PMID:19837946

  4. Spectral and Timing Nature of the Symbiotic X-Ray Binary 4U 1954+319: The Slowest Rotating Neutron Star in an X-Ray Binary System

    NASA Astrophysics Data System (ADS)

    Enoto, Teruaki; Sasano, Makoto; Yamada, Shin'ya; Tamagawa, Toru; Makishima, Kazuo; Pottschmidt, Katja; Marcu, Diana; Corbet, Robin H. D.; Fuerst, Felix; Wilms, Jörn

    2014-05-01

    The symbiotic X-ray binary (SyXB) 4U 1954+319 is a rare system hosting a peculiar neutron star (NS) and an M-type optical companion. Its ~5.4 hr NS spin period is the longest among all known accretion-powered pulsars and exhibited large (~7%) fluctuations over 8 yr. A spin trend transition was detected with Swift/BAT around an X-ray brightening in 2012. The source was in quiescent and bright states before and after this outburst based on 60 ks Suzaku observations in 2011 and 2012. The observed continuum is well described by a Comptonized model with the addition of a narrow 6.4 keV Fe-Kα line during the outburst. Spectral similarities to slowly rotating pulsars in high-mass X-ray binaries, its high pulsed fraction (~60%-80%), and the location in the Corbet diagram favor high B-field (gsim 1012 G) over a weak field as in low-mass X-ray binaries. The observed low X-ray luminosity (1033-1035 erg s-1), probable wide orbit, and a slow stellar wind of this SyXB make quasi-spherical accretion in the subsonic settling regime a plausible model. Assuming a ~1013 G NS, this scheme can explain the ~5.4 hr equilibrium rotation without employing the magnetar-like field (~1016 G) required in the disk accretion case. The timescales of multiple irregular flares (~50 s) can also be attributed to the free-fall time from the Alfvén shell for a ~1013 G field. A physical interpretation of SyXBs beyond the canonical binary classifications is discussed.

  5. PET/CT for Radiotherapy Treatment Planning in Patients With Soft Tissue Sarcomas

    SciTech Connect

    Karam, Irene; Devic, Slobodan; Hickeson, Marc; Roberge, David; Turcotte, Robert E.; Freeman, Carolyn R.

    2009-11-01

    Purpose: To study the possibility of incorporating positron emission tomography/computed tomography (PET/CT) information into radiotherapy treatment planning in patients with high-grade soft tissue sarcomas (STS). Methods and Materials: We studied 17 patients treated with preoperative radiotherapy at our institution from 2005 to 2007. All patients had a high-grade STS and had had a staging PET/CT scan. For each patient, an MRI-based gross tumor volume (GTV), considered to be the contemporary standard for radiotherapy treatment planning, was outlined on a T1-gadolinium enhanced axial MRI (GTV{sub MRI}), and a second set of GTVs were outlined using different threshold values on PET images (GTV{sub PET}). PET-based target volumes were compared with the MRI-based GTV. Threshold values for target contouring were determined as a multiple (from 2 to 10 times) of the background soft tissue uptake values (B) sampled over healthy tissue. Results: PET-based GTVs contoured using a threshold value of 2 or 2.5 most closely resembled the GTV{sub MRI} volumes. Higher threshold values lead to PET volumes much smaller than the GTV{sub MRI}. The standard deviations between the average volumes of GTV{sub PET} and GTV{sub MRI} ratios for all thresholds were large, ranging from 36% for 2 xB up to 93% for 10 xB. Maximum uptake-to-background ratio correlated poorly with the maximum standardized uptake values. Conclusions: It is unlikely that PET/CT will make a significant contribution in GTV definition for radiotherapy treatment planning in patients with STS using threshold methods on PET images. Future studies will focus on molecular imaging and tumor physiology.

  6. Transgenic expression of the dicotyledonous pattern recognition receptor EFR in rice leads to ligand-dependent activation of defense responses

    SciTech Connect

    Schwessinger, Benjamin; Bahar, Ofir; Thomas, Nicolas; Holton, Nicolas; Nekrasov, Vladimir; Ruan, Deling; Canlas, Patrick E.; Daudi, Arsalan; Petzold, Christopher J.; Singan, Vasanth R.; Kuo, Rita; Chovatia, Mansi; Daum, Christopher; Heazlewood, Joshua L.; Zipfel, Cyril; Ronald, Pamela C.

    2015-03-30

    Plant plasma membrane localized pattern recognition receptors (PRRs) detect extracellular pathogen-associated molecules. PRRs such as Arabidopsis EFR and rice XA21 are taxonomically restricted and are absent from most plant genomes. Here we show that rice plants expressing EFR or the chimeric receptor EFR::XA21, containing the EFR ectodomain and the XA21 intracellular domain, sense both Escherichia coli- and Xanthomonas oryzae pv. oryzae (Xoo)-derived elf18 peptides at sub-nanomolar concentrations. Treatment of EFR and EFR::XA21 rice leaf tissue with elf18 leads to MAP kinase activation, reactive oxygen production and defense gene expression. Although expression of EFR does not lead to robust enhanced resistance to fully virulent Xoo isolates, it does lead to quantitatively enhanced resistance to weakly virulent Xoo isolates. EFR interacts with OsSERK2 and the XA21 binding protein 24 (XB24), two key components of the rice XA21-mediated immune response. Rice-EFR plants silenced for OsSERK2, or overexpressing rice XB24 are compromised in elf18-induced reactive oxygen production and defense gene expression indicating that these proteins are also important for EFR-mediated signaling in transgenic rice. Taken together, our results demonstrate the potential feasibility of enhancing disease resistance in rice and possibly other monocotyledonous crop species by expression of dicotyledonous PRRs. Our results also suggest that Arabidopsis EFR utilizes at least a subset of the known endogenous rice XA21 signaling components.

  7. Effect of Air-Flow Distribution and Total-Pressure Loss on Performance of One-Sixth Segment of Turbojet Combuster

    NASA Technical Reports Server (NTRS)

    Hill, Francis U.; Mark, Herman

    1947-01-01

    An investigation has been conducted on a one-sixth segment of an annular turbojet combustor to determine the effects of modification in air-flow distribution and total-pressure loss on the performance of the segment. The performance features investigated during this series of determinations were the altitude operational limits and the temperature-rise efficiency. Altitude operational limits of the combustor segment, for the 19XB engine using the original combustor-basket design were approximately 38,000 feet at 17,000 rpm and 26,000 feet at 10,000 rpm. The altitude operational limits were approximately 50,000 feet at 17,000 rpm and 38,000 feet at 10,000 rpm for a combustor-basket design in which the air-passage area in the basket was redistributed so as to admit gradually no more than 20 percent of the air along the first half of the basket. In this case the total pressure loss through the combustor segment was not appreciably changed from the total-pressure loss for the original combustor basket design. Altitude operational limits of the combustor segment for the 19XB engine were above 52,000 feet at 17,000 rpm and were approximately 23,000 feet at 10,000 rpm for a combustor-basket design in which the distribution of the air-passage area in the basket was that of the original design but where the total-pressure loss was increased to 19 times the inlet reference kinetic pressure at an inlet-to-outlet density ratio of 2.4. The total-pressure loss for the original design was 14 times the inlet kinetic reference pressure at an inlet-to-outlet density ratio of 2.4.

  8. Haplo-diploid gene expression and pollen selection for tolerance to acetochlor in maize.

    PubMed

    Frascaroli, E; Galletti, S; Landi, P

    1994-08-01

    The objectives of this research were to determine if genes controlling the reaction to the herbicide acetochlor in maize (Zea mays L.) are active during both the haploid and the diploid phases of the life cycle and if pollen selection can be utilized for improving sporophytic resistance. Pollen of eight inbred lines, previously characterized through sporophytic analysis for the level of tolerance to acetochlor, showed a differential reaction to the herbicide forin vitro tube length; moreover, such pollen reactions proved to be significantly correlated (r =0.786(*),df=6) with those of the sporophytes producing the pollen. Pollen analysis of two inbred lines (i.e. Mo17, tolerant, and B79, susceptible) and their single cross showed that thein vitro pollen-tube length reaction of the hybrid was intermediate between those of two parents. An experiment on pollen selection was then performed by growing tassels of Mo17xB79 in the presence of the herbicide. Pollen obtained from treated tassels showed a greater tolerance to acetochlor, assessed asin vitro tube length reaction, than pollen obtained from control tassels. Moreover, the backcross [B79 (Mo17xB79)] sporophytic population obtained using pollen from the treated tassels was more tolerant (as indicated by the fresh weight of plants grown in the presence of the herbicide) than was the control backcross population. The two populations did not differ when grown without the herbicide. These findings indicate that genes controlling the reaction to acetochlor in maize have haplodiploid expression; consequently, pollen selection can be applied for improving plant tolerance. PMID:24186178

  9. Two grid iteration with a conjugate gradient fine grid smoother applied to a groundwater flow model

    SciTech Connect

    Hagger, M.J.; Spence, A.; Cliffe, K.A.

    1994-12-31

    This talk is concerned with the efficient solution of Ax=b, where A is a large, sparse, symmetric positive definite matrix arising from a standard finite element discretisation of the groundwater flow problem {triangledown}{sm_bullet}(k{triangledown}p)=0. Here k is the coefficient of rock permeability in applications and is highly discontinuous. The discretisation is carried out using the Harwell NAMMU finite element package, using, for 2D, 9 node biquadratic rectangular elements, and 27 node biquadratics for 3D. The aim is to develop a robust technique for iterative solutions of 3D problems based on a regional groundwater flow model of a geological area with sharply varying hydrogeological properties. Numerical experiments with polynomial preconditioned conjugate gradient methods on a 2D groundwater flow model were found to yield very poor results, converging very slowly. In order to utilise the fact that A comes from the discretisation of a PDE the authors try the two grid method as is well analysed from studies of multigrid methods, see for example {open_quotes}Multi-Grid Methods and Applications{close_quotes} by W. Hackbusch. Specifically they consider two discretisations resulting in stiffness matrices A{sub N} and A{sub n}, of size N and n respectively, where N > n, for both a model problem and the geological model. They perform a number of conjugate gradient steps on the fine grid, ie using A{sub N}, followed by an exact coarse grid solve, using A{sub n}, and then update the fine grid solution, the exact coarse grid solve being done using a frontal method factorisation of A{sub n}. Note that in the context of the standard two grid method this is equivalent to using conjugate gradients as a fine grid smoothing step. Experimental results are presented to show the superiority of the two grid iteration method over the polynomial preconditioned conjugate gradient method.

  10. SU-E-T-69: Cloud-Based Monte Carlo Patient-Specific Quality Assurance (QA) Method for Volumetric Modulated Arc Therapy (VMAT)

    SciTech Connect

    Chen, X; Xing, L; Luxton, G; Bush, K; Azcona, J

    2014-06-01

    Purpose: Patient-specific QA for VMAT is incapable of providing full 3D dosimetric information and is labor intensive in the case of severe heterogeneities or small-aperture beams. A cloud-based Monte Carlo dose reconstruction method described here can perform the evaluation in entire 3D space and rapidly reveal the source of discrepancies between measured and planned dose. Methods: This QA technique consists of two integral parts: measurement using a phantom containing array of dosimeters, and a cloud-based voxel Monte Carlo algorithm (cVMC). After a VMAT plan was approved by a physician, a dose verification plan was created and delivered to the phantom using our Varian Trilogy or TrueBeam system. Actual delivery parameters (i.e., dose fraction, gantry angle, and MLC at control points) were extracted from Dynalog or trajectory files. Based on the delivery parameters, the 3D dose distribution in the phantom containing detector were recomputed using Eclipse dose calculation algorithms (AAA and AXB) and cVMC. Comparison and Gamma analysis is then conducted to evaluate the agreement between measured, recomputed, and planned dose distributions. To test the robustness of this method, we examined several representative VMAT treatments. Results: (1) The accuracy of cVMC dose calculation was validated via comparative studies. For cases that succeeded the patient specific QAs using commercial dosimetry systems such as Delta- 4, MAPCheck, and PTW Seven29 array, agreement between cVMC-recomputed, Eclipse-planned and measured doses was obtained with >90% of the points satisfying the 3%-and-3mm gamma index criteria. (2) The cVMC method incorporating Dynalog files was effective to reveal the root causes of the dosimetric discrepancies between Eclipse-planned and measured doses and provide a basis for solutions. Conclusion: The proposed method offers a highly robust and streamlined patient specific QA tool and provides a feasible solution for the rapidly increasing use of VMAT

  11. Estimated times to exhaustion and power outputs at the gas exchange threshold, physical working capacity at the rating of perceived exertion threshold, and respiratory compensation point.

    PubMed

    Bergstrom, Haley C; Housh, Terry J; Zuniga, Jorge M; Camic, Clayton L; Traylor, Daniel A; Schmidt, Richard J; Johnson, Glen O

    2012-10-01

    The purposes of this study were to compare the power outputs and estimated times to exhaustion (T(lim)) at the gas exchange threshold (GET), physical working capacity at the rating of perceived exertion threshold (PWC(RPE)), and respiratory compensation point (RCP). Three male and 5 female subjects (mean ± SD: age, 22.4 ± 2.8 years) performed an incremental test to exhaustion on an electronically braked cycle ergometer to determine peak oxygen consumption rate, GET, and RCP. The PWC(RPE) was determined from ratings of perceived exertion data recorded during 3 continuous workbouts to exhaustion. The estimated T(lim) values for each subject at GET, PWC(RPE), and RCP were determined from power curve analyses (T(lim) = ax(b)). The results indicated that the PWC(RPE) (176 ± 55 W) was not significantly different from RCP (181 ± 54 W); however, GET (155 ± 42 W) was significantly less than PWC(RPE) and RCP. The estimated T(lim) for the GET (26.1 ± 9.8 min) was significantly greater than PWC(RPE) (14.6 ± 5.6 min) and RCP (11.2 ± 3.1 min). The PWC(RPE) occurred at a mean power output that was 13.5% greater than the GET and, therefore, it is likely that the perception of effort is not driven by the same mechanism that underlies the GET (i.e., lactate buffering). Furthermore, the PWC(RPE) and RCP were not significantly different and, therefore, these thresholds may be associated with the same mechanisms of fatigue, such as increased levels of interstitial and (or) arterial [K⁺]. PMID:22716291

  12. SU-E-T-458: Determining Threshold-Of-Failure for Dead Pixel Rows in EPID-Based Dosimetry

    SciTech Connect

    Gersh, J; Wiant, D

    2014-06-01

    Purpose: A pixel correction map is applied to all EPID-based applications on the TrueBeam (Varian Medical Systems, Palo Alto, CA). When dead pixels are detected, an interpolative smoothing algorithm is applied using neighboring-pixel information to supplement missing-pixel information. The vendor suggests that when the number of dead pixels exceeds 70,000, the panel should be replaced. It is common for entire detector rows to be dead, as well as their neighboring rows. Approximately 70 rows can be dead before the panel reaches this threshold. This study determines the number of neighboring dead-pixel rows that would create a large enough deviation in measured fluence to cause failures in portal dosimetry (PD). Methods: Four clinical two-arc VMAT plans were generated using Eclipse's AXB algorithm and PD plans were created using the PDIP algorithm. These plans were chosen to represent those commonly encountered in the clinic: prostate, lung, abdomen, and neck treatments. During each iteration of this study, an increasing number of dead-pixel rows are artificially applied to the correction map and a fluence QA is performed using the EPID (corrected with this map). To provide a worst-case-scenario, the dead-pixel rows are chosen so that they present artifacts in the highfluence region of the field. Results: For all eight arc-fields deemed acceptable via a 3%/3mm gamma analysis (pass rate greater than 99%), VMAT QA yielded identical results with a 5 pixel-width dead zone. When 10 dead lines were present, half of the fields had pass rates below the 99% pass rate. With increasing dead rows, the pass rates were reduced substantially. Conclusion: While the vendor still suggests to request service at the point where 70,000 dead rows are measured (as recommended by the vendor), the authors suggest that service should be requested when there are greater than 5 consecutive dead rows.

  13. Transfer of cadmium, lead, and zinc from industrially contaminated soil to crop plants: a field study.

    PubMed

    Dudka, S; Piotrowska, M; Terelak, H

    1996-01-01

    The documeneed adverse health effects of soil Cd and Pb have led to public concern over soil contamination with metals. A 4-year field experiment was conducted to study the transfer of Cd, Pb, and Zn from soil contaminated by smelter flue-dust to crop plants grown in a rotation. The soil was amended with Pb?Zn smelter flue-dust (2-66.8 kg per 10 m(2) plot) to simulate the long-term effect that the smelting of non-ferrous metal ore has on arable soils. The treated soil became strongly contaminated with metals (Cd 3.2-106 mg/kg, Pb 146-3452 mg/kg, Zn 465-11 375 mg/kg). Concentrations of Cd, Pb, and Zn in barley grain, barley straw meadow bluegrass, red clover, and potatoes were generally low. The highest metal concentrations were found in potato tubers (intact), meadow bluegrass, and barley straw. The observed reduction in crop yield was probably the result of possible nutrient imbalances rather than of metal (Zn, Cu) phytotoxicities. Zn and Cd uptake by the plants can be described by the saturation (plateau) model (y = ax(b), b < 1). The relationship between Pb in the soil and plants was linear with an extremely low slope (0.0001-0.0003). No excessive dietary intake of Cd is expected when Cd concentrations in barley grain and potato tubers grown on the contaminated soil are not higher than 0.6 and 1.0 mg/kg, respectively. Based on the risk analysis and taking into account the saturation model of the soil-plant metal relationship, it was concluded that, under the conditions of this experiment (neutral soil pH), soil with Cd concentrations of up to 30 mg/kg is still safe for production of these crop plants.

  14. Raspberry, not a car: context predictability and a phonological advantage in early and late learners’ processing of speech in noise

    PubMed Central

    Gor, Kira

    2014-01-01

    Second language learners perform worse than native speakers under adverse listening conditions, such as speech in noise (SPIN). No data are available on heritage language speakers’ (early naturalistic interrupted learners’) ability to perceive SPIN. The current study fills this gap and investigates the perception of Russian speech in multi-talker babble noise by the matched groups of high- and low-proficiency heritage speakers (HSs) and late second language learners of Russian who were native speakers of English. The study includes a control group of Russian native speakers. It manipulates the noise level (high and low), and context cloze probability (high and low). The results of the SPIN task are compared to the tasks testing the control of phonology, AXB discrimination and picture-word discrimination, and lexical knowledge, a word translation task, in the same participants. The increased phonological sensitivity of HSs interacted with their ability to rely on top–down processing in sentence integration, use contextual cues, and build expectancies in the high-noise/high-context condition in a bootstrapping fashion. HSs outperformed oral proficiency-matched late second language learners on SPIN task and two tests of phonological sensitivity. The outcomes of the SPIN experiment support both the early naturalistic advantage and the role of proficiency in HSs. HSs’ ability to take advantage of the high-predictability context in the high-noise condition was mitigated by their level of proficiency. Only high-proficiency HSs, but not any other non-native group, took advantage of the high-predictability context that became available with better phonological processing skills in high-noise. The study thus confirms high-proficiency (but not low-proficiency) HSs’ nativelike ability to combine bottom–up and top–down cues in processing SPIN. PMID:25566130

  15. Eliminating a Confounding Factor in Power Law Parameter Interpretation

    NASA Astrophysics Data System (ADS)

    Karst, N.; Dralle, D.; Thompson, S. E.

    2015-12-01

    Power law models of the form y = -axb are used to represent a wide range of phenomena in the physical, biological and social sciences. Power laws are well known to display a "scale-free property", meaning that the value of the exponent b is independent of the unit of measurement (the "scale") of the state variable x. While this makes estimation of the exponent robust, it raises significant estimation challenges for the linear multiplier a. Specifically, if both the multiplier a and exponent b are allowed to vary when undertaking an empirical fitting procedure, then physical units used to measure x induce a formal (i.e., entirely nonphysical) dependence between a and b, because the fitted value of a will contain a (potentially large) multiplicative factor that varies depending on the scale of x. This is problematic for two reasons: (i) if a is to be empirically estimated, but admits a physical interpretation, then the scale-dependent factor can confound the physically meaningful value (ii) the formal relationship between a and b due to the scaling of the relationship obscures any true relationship between the parameters and could motivate a spurious interpretation of their co-variation. To correct this issue, we present a technique to remove the formal correlation between a and b, and demonstrate an application of the technique in the context of streamflow recession analysis, where the falling limb of the hydrograph is modeled using a simple power law relationship, dq/dt = -aqb. Following the decorrelation of (a, b) recession parameter pairs, physically intuitive seasonal patterns, greatly obscured in the original data, are clearly found.

  16. Awareness of Rhythm Patterns in Speech and Music in Children with Specific Language Impairments.

    PubMed

    Cumming, Ruth; Wilson, Angela; Leong, Victoria; Colling, Lincoln J; Goswami, Usha

    2015-01-01

    Children with specific language impairments (SLIs) show impaired perception and production of language, and also show impairments in perceiving auditory cues to rhythm [amplitude rise time (ART) and sound duration] and in tapping to a rhythmic beat. Here we explore potential links between language development and rhythm perception in 45 children with SLI and 50 age-matched controls. We administered three rhythmic tasks, a musical beat detection task, a tapping-to-music task, and a novel music/speech task, which varied rhythm and pitch cues independently or together in both speech and music. Via low-pass filtering, the music sounded as though it was played from a low-quality radio and the speech sounded as though it was muffled (heard "behind the door"). We report data for all of the SLI children (N = 45, IQ varying), as well as for two independent subgroupings with intact IQ. One subgroup, "Pure SLI," had intact phonology and reading (N = 16), the other, "SLI PPR" (N = 15), had impaired phonology and reading. When IQ varied (all SLI children), we found significant group differences in all the rhythmic tasks. For the Pure SLI group, there were rhythmic impairments in the tapping task only. For children with SLI and poor phonology (SLI PPR), group differences were found in all of the filtered speech/music AXB tasks. We conclude that difficulties with rhythmic cues in both speech and music are present in children with SLIs, but that some rhythmic measures are more sensitive than others. The data are interpreted within a "prosodic phrasing" hypothesis, and we discuss the potential utility of rhythmic and musical interventions in remediating speech and language difficulties in children. PMID:26733848

  17. Awareness of Rhythm Patterns in Speech and Music in Children with Specific Language Impairments.

    PubMed

    Cumming, Ruth; Wilson, Angela; Leong, Victoria; Colling, Lincoln J; Goswami, Usha

    2015-01-01

    Children with specific language impairments (SLIs) show impaired perception and production of language, and also show impairments in perceiving auditory cues to rhythm [amplitude rise time (ART) and sound duration] and in tapping to a rhythmic beat. Here we explore potential links between language development and rhythm perception in 45 children with SLI and 50 age-matched controls. We administered three rhythmic tasks, a musical beat detection task, a tapping-to-music task, and a novel music/speech task, which varied rhythm and pitch cues independently or together in both speech and music. Via low-pass filtering, the music sounded as though it was played from a low-quality radio and the speech sounded as though it was muffled (heard "behind the door"). We report data for all of the SLI children (N = 45, IQ varying), as well as for two independent subgroupings with intact IQ. One subgroup, "Pure SLI," had intact phonology and reading (N = 16), the other, "SLI PPR" (N = 15), had impaired phonology and reading. When IQ varied (all SLI children), we found significant group differences in all the rhythmic tasks. For the Pure SLI group, there were rhythmic impairments in the tapping task only. For children with SLI and poor phonology (SLI PPR), group differences were found in all of the filtered speech/music AXB tasks. We conclude that difficulties with rhythmic cues in both speech and music are present in children with SLIs, but that some rhythmic measures are more sensitive than others. The data are interpreted within a "prosodic phrasing" hypothesis, and we discuss the potential utility of rhythmic and musical interventions in remediating speech and language difficulties in children.

  18. Re-Identification Risk versus Data Utility for Aggregated Mobility Research Using Mobile Phone Location Data

    PubMed Central

    Yin, Ling; Wang, Qian; Shaw, Shih-Lung; Fang, Zhixiang; Hu, Jinxing; Tao, Ye; Wang, Wei

    2015-01-01

    Mobile phone location data is a newly emerging data source of great potential to support human mobility research. However, recent studies have indicated that many users can be easily re-identified based on their unique activity patterns. Privacy protection procedures will usually change the original data and cause a loss of data utility for analysis purposes. Therefore, the need for detailed data for activity analysis while avoiding potential privacy risks presents a challenge. The aim of this study is to reveal the re-identification risks from a Chinese city’s mobile users and to examine the quantitative relationship between re-identification risk and data utility for an aggregated mobility analysis. The first step is to apply two reported attack models, the top N locations and the spatio-temporal points, to evaluate the re-identification risks in Shenzhen City, a metropolis in China. A spatial generalization approach to protecting privacy is then proposed and implemented, and spatially aggregated analysis is used to assess the loss of data utility after privacy protection. The results demonstrate that the re-identification risks in Shenzhen City are clearly different from those in regions reported in Western countries, which prove the spatial heterogeneity of re-identification risks in mobile phone location data. A uniform mathematical relationship has also been found between re-identification risk (x) and data (y) utility for both attack models: y = -axb+c, (a, b, c>0; 0

  19. Photosynthetic capacity peaks at intermediate size in temperate deciduous trees.

    PubMed

    Thomas, Sean C

    2010-05-01

    Studies of age-related changes in leaf functional biology have generally been based on dichotomous comparisons of young and mature individuals (e.g., saplings and mature canopy trees), with little data available to describe changes through the entire ontogeny of trees, particularly of broadleaf angiosperms. Leaf-level gas-exchange and morphological parameters were quantified in situ in the upper canopy of trees acclimated to high light conditions, spanning a wide range of ontogenetic stages from saplings (approximately 1 cm in stem diameter) to trees >60 cm d.b.h. and nearing their maximum lifespan, in three temperate deciduous tree species in central Ontario, Canada. Traits associated with growth performance, including leaf photosynthetic capacity (expressed on either an area, mass or leaf N basis), stomatal conductance, leaf size and leaf N content, generally showed a unimodal ('hump-shaped') pattern, with peak values at an intermediate ontogenetic stage. In contrast, leaf mass per area (LMA) and related morphological parameters (leaf thickness, leaf tissue density, leaf C content) increased monotonically with tree size, as did water-use efficiency; these monotonic relationships were well described by simple allometric functions of the form Y = aX(b). For traits showing unimodal patterns, tree size corresponding to the trait maximum differed markedly among traits: all three species showed a similar pattern in which the peak for leaf size occurred in trees approximately 2-6 cm d.b.h., followed by leaf chemical traits and photosynthetic capacity on a mass or leaf N basis and finally by photosynthetic capacity on a leaf area basis, which peaked approximately at the size of reproductive onset. It is argued that ontogenetic increases in photosynthetic capacity and related traits early in tree ontogeny are general among relatively shade-tolerant tree species that have a low capacity for leaf-level acclimation, as are declines in this set of traits late in tree ontogeny.

  20. Awareness of Rhythm Patterns in Speech and Music in Children with Specific Language Impairments

    PubMed Central

    Cumming, Ruth; Wilson, Angela; Leong, Victoria; Colling, Lincoln J.; Goswami, Usha

    2015-01-01

    Children with specific language impairments (SLIs) show impaired perception and production of language, and also show impairments in perceiving auditory cues to rhythm [amplitude rise time (ART) and sound duration] and in tapping to a rhythmic beat. Here we explore potential links between language development and rhythm perception in 45 children with SLI and 50 age-matched controls. We administered three rhythmic tasks, a musical beat detection task, a tapping-to-music task, and a novel music/speech task, which varied rhythm and pitch cues independently or together in both speech and music. Via low-pass filtering, the music sounded as though it was played from a low-quality radio and the speech sounded as though it was muffled (heard “behind the door”). We report data for all of the SLI children (N = 45, IQ varying), as well as for two independent subgroupings with intact IQ. One subgroup, “Pure SLI,” had intact phonology and reading (N = 16), the other, “SLI PPR” (N = 15), had impaired phonology and reading. When IQ varied (all SLI children), we found significant group differences in all the rhythmic tasks. For the Pure SLI group, there were rhythmic impairments in the tapping task only. For children with SLI and poor phonology (SLI PPR), group differences were found in all of the filtered speech/music AXB tasks. We conclude that difficulties with rhythmic cues in both speech and music are present in children with SLIs, but that some rhythmic measures are more sensitive than others. The data are interpreted within a “prosodic phrasing” hypothesis, and we discuss the potential utility of rhythmic and musical interventions in remediating speech and language difficulties in children. PMID:26733848

  1. Caudal fin allometry in the white shark Carcharodon carcharias: implications for locomotory performance and ecology

    NASA Astrophysics Data System (ADS)

    Lingham-Soliar, Theagarten

    2005-05-01

    Allometric scaling analysis was employed to investigate the consequences of size evolution on hydrodynamic performance and ecology in the white shark Carcharodon carcharias. Discriminant analysis using the power equation y=axb was negative for caudal fin span (S) versus fork length (FL) in C. carcharias. In contrast in two delphinid species, Delphinus capensis and Tursiops aduncus, the span of the flukes versus fork length rises in positive allometric fashion, and strong positive allometry of S versus √A (area) was also recorded. The latter reflects a high lift/drag ratio. S versus √A in C. carcharias displays negative allometry and consequently a lower lift/drag ratio. A lower aspect ratio (AR) caudal fin in C. carcharias compared to that of the delphinids (mean 3.33 and 4.1, respectively) and other thunniform swimmers provides the potential for better maneuverability and acceleration. The liver in sharks is frequently associated with a buoyancy function and was found to be positively allometric in C. carcharias. The overall findings suggest that the negatively allometric caudal fin morphometrics in C. carcharias are unlikely to have deleterious evolutionary fitness consequences for predation. On the contrary, when considered in the context of positive liver allometry in C. carcharias it is hereby suggested that buoyancy may play a dominant role in larger white sharks in permitting slow swimming while minimizing energy demands needed to prevent sinking. In contrast hydrodynamic lift is considered more important in smaller white sharks. Larger caudal fin spans and higher lift/drag ratio in smaller C. carcharias indicate greater potential for prolonged, intermediate swimming speeds and for feeding predominantly on fast-moving fish, in contrast to slow-swimming search patterns of larger individuals for predominantly large mammalian prey. Such data may provide some answers to the lifestyle and widespread habitat capabilities of this still largely mysterious animal.

  2. A variational ensemble scheme for noisy image data assimilation

    NASA Astrophysics Data System (ADS)

    Yang, Yin; Robinson, Cordelia; Heitz, Dominique; Mémin, Etienne

    2014-05-01

    Data assimilation techniques aim at recovering a system state variables trajectory denoted as X, along time from partially observed noisy measurements of the system denoted as Y. These procedures, which couple dynamics and noisy measurements of the system, fulfill indeed a twofold objective. On one hand, they provide a denoising - or reconstruction - procedure of the data through a given model framework and on the other hand, they provide estimation procedures for unknown parameters of the dynamics. A standard variational data assimilation problem can be formulated as the minimization of the following objective function with respect to the initial discrepancy, η, from the background initial guess: δ« J(η(x)) = 1∥Xb (x) - X (t ,x)∥2 + 1 tf∥H(X (t,x ))- Y (t,x)∥2dt. 2 0 0 B 2 t0 R (1) where the observation operator H links the state variable and the measurements. The cost function can be interpreted as the log likelihood function associated to the a posteriori distribution of the state given the past history of measurements and the background. In this work, we aim at studying ensemble based optimal control strategies for data assimilation. Such formulation nicely combines the ingredients of ensemble Kalman filters and variational data assimilation (4DVar). It is also formulated as the minimization of the objective function (1), but similarly to ensemble filter, it introduces in its objective function an empirical ensemble-based background-error covariance defined as: B ≡ <(Xb - <Xb>)(Xb - <Xb >)T>. (2) Thus, it works in an off-line smoothing mode rather than on the fly like sequential filters. Such resulting ensemble variational data assimilation technique corresponds to a relatively new family of methods [1,2,3]. It presents two main advantages: first, it does not require anymore to construct the adjoint of the dynamics tangent linear operator, which is a considerable advantage with respect to the method's implementation, and second, it enables the

  3. The margination propensity of spherical particles for vascular targeting in the microcirculation.

    PubMed

    Gentile, Francesco; Curcio, Antonio; Indolfi, Ciro; Ferrari, Mauro; Decuzzi, Paolo

    2008-01-01

    The propensity of circulating particles to drift laterally towards the vessel walls (margination) in the microcirculation has been experimentally studied using a parallel plate flow chamber. Fluorescent polystyrene particles, with a relative density to water of just 50 g/cm3comparable with that of liposomal or polymeric nanoparticles used in drug delivery and bio-imaging, have been used with a diameter spanning over three order of magnitudes from 50 nm up to 10 mum. The number n approximately s MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafmOvayLbaGaadaWgaaWcbaGaem4Camhabeaaaaa@2EB4@ of particles marginating per unit surface have been measured through confocal fluorescent microscopy for a horizontal chamber, and the corresponding total volume V approximately s MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafmOvayLbaGaadaWgaaWcbaGaem4Camhabeaaaaa@2EB4@ of particles has been calculated. Scaling laws have been derived as a function of the particle diameter d. In horizontal capillaries, margination is mainly due to the gravitational force for particles with d > 200 nm and V approximately s MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafmOvayLbaGaadaWgaaWcbaGaem4Camhabeaaaaa@2EB4@ increases with d4; whereas for smaller particles V approximately s MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspe

  4. Impact of Heterogeneity-Based Dose Calculation Using a Deterministic Grid-Based Boltzmann Equation Solver for Intracavitary Brachytherapy

    SciTech Connect

    Mikell, Justin K.; Klopp, Ann H.; Gonzalez, Graciela M.N.; Kisling, Kelly D.; Price, Michael J.; Berner, Paula A.; Eifel, Patricia J.; Mourtada, Firas

    2012-07-01

    Purpose: To investigate the dosimetric impact of the heterogeneity dose calculation Acuros (Transpire Inc., Gig Harbor, WA), a grid-based Boltzmann equation solver (GBBS), for brachytherapy in a cohort of cervical cancer patients. Methods and Materials: The impact of heterogeneities was retrospectively assessed in treatment plans for 26 patients who had previously received {sup 192}Ir intracavitary brachytherapy for cervical cancer with computed tomography (CT)/magnetic resonance-compatible tandems and unshielded colpostats. The GBBS models sources, patient boundaries, applicators, and tissue heterogeneities. Multiple GBBS calculations were performed with and without solid model applicator, with and without overriding the patient contour to 1 g/cm{sup 3} muscle, and with and without overriding contrast materials to muscle or 2.25 g/cm{sup 3} bone. Impact of source and boundary modeling, applicator, tissue heterogeneities, and sensitivity of CT-to-material mapping of contrast were derived from the multiple calculations. American Association of Physicists in Medicine Task Group 43 (TG-43) guidelines and the GBBS were compared for the following clinical dosimetric parameters: Manchester points A and B, International Commission on Radiation Units and Measurements (ICRU) report 38 rectal and bladder points, three and nine o'clock, and {sub D2cm3} to the bladder, rectum, and sigmoid. Results: Points A and B, D{sub 2} cm{sup 3} bladder, ICRU bladder, and three and nine o'clock were within 5% of TG-43 for all GBBS calculations. The source and boundary and applicator account for most of the differences between the GBBS and TG-43 guidelines. The D{sub 2cm3} rectum (n = 3), D{sub 2cm3} sigmoid (n = 1), and ICRU rectum (n = 6) had differences of >5% from TG-43 for the worst case incorrect mapping of contrast to bone. Clinical dosimetric parameters were within 5% of TG-43 when rectal and balloon contrast were mapped to bone and radiopaque packing was not overridden. Conclusions

  5. Boron induced structure modifications in Pd-Cu-B system: new Ti2Ni-type derivative borides Pd3Cu3B and Pd5Cu5B2.

    PubMed

    Sologub, Oksana; Salamakha, Leonid P; Eguchi, Gaku; Stöger, Berthold; Rogl, Peter F; Bauer, Ernst

    2016-03-21

    The formation of two distinct derivative structures of Ti2Ni-type, interstitial Pd3Cu3B and substitutive Pd5Cu5B2, has been elucidated in Pd-Cu-B alloys from analysis of X-ray single crystal and powder diffraction data and supported by SEM. The metal atom arrangement in the new boride Pd3Cu3B (space group Fd3m, W3Fe3C-type structure, a = 1.1136(3) nm) follows the pattern of atom distribution in the CdNi-type structure. Pd5Cu5B2 (space group F(4)3m, a = 1.05273(5) nm) exhibits a non-centrosymmetric substitutive derivative of the Ti2Ni-type structure. The reduction of symmetry on passing from Ti2Ni-type structure to Pd5Cu5B2 corresponds to the loss of an inversion centre delivered by an ordered occupation of the Ni position (32e) by dissimilar atoms, Cu and B. In both structures, the boron atom centers Pd forming [BPd6] octahedra in Pd3Cu3B and [BPd6] trigonal prisms in Pd5Cu5B2. Neither a perceptible homogeneity range nor mutual solid solubility was observed for two compounds at 600 °C, while in as cast conditions Pd5Cu5B2 exhibits an extended homogeneity range formed by a partial substitution of Cu atoms (in 24f) by Pd (Pd5+xCu5-xB2, 0 ≤x≤ 1). Electrical resistivity measurements performed on Pd3Cu3B as well as on Pd-poor and Pd-rich termini of Pd5+xCu5-xB2 annealed at 600 °C and in as cast conditions respectively demonstrated the absence of any phase transitions for this compounds in the temperature region from 0.3 K to 300 K. PMID:26875687

  6. Catching the role of anisotropic electronic distribution and charge transfer in halogen bonded complexes of noble gases

    SciTech Connect

    Bartocci, Alessio; Cappelletti, David; Pirani, Fernando; Belpassi, Leonardo; Falcinelli, Stefano; Grandinetti, Felice; Tarantelli, Francesco

    2015-05-14

    The systems studied in this work are gas-phase weakly bound adducts of the noble-gas (Ng) atoms with CCl{sub 4} and CF{sub 4}. Their investigation was motivated by the widespread current interest for the intermolecular halogen bonding (XB), a structural motif recognized to play a role in fields ranging from elementary processes to biochemistry. The simulation of the static and dynamic behaviors of complex systems featuring XB requires the formulation of reliable and accurate model potentials, whose development relies on the detailed characterization of strength and nature of the interactions occurring in simple exemplary halogenated systems. We thus selected the prototypical Ng-CCl{sub 4} and Ng-CF{sub 4} and performed high-resolution molecular beam scattering experiments to measure the absolute scale of their intermolecular potentials, with high sensitivity. In general, we expected to probe typical van der Waals interactions, consisting of a combination of size (exchange) repulsion with dispersion/induction attraction. For the He/Ne-CF{sub 4}, the analysis of the glory quantum interference pattern, observable in the velocity dependence of the integral cross section, confirmed indeed this expectation. On the other hand, for the He/Ne/Ar-CCl{sub 4}, the scattering data unravelled much deeper potential wells, particularly for certain configurations of the interacting partners. The experimental data can be properly reproduced only including a shifting of the repulsive wall at shorter distances, accompanied by an increased role of the dispersion attraction, and an additional short-range stabilization component. To put these findings on a firmer ground, we performed, for selected geometries of the interacting complexes, accurate theoretical calculations aimed to evaluate the intermolecular interaction and the effects of the complex formation on the electron charge density of the constituting moieties. It was thus ascertained that the adjustments of the potential

  7. Effects of metabolic acidosis on intracellular pH responses in multiple cell types

    PubMed Central

    Salameh, Ahlam Ibrahim; Ruffin, Vernon A.

    2014-01-01

    Metabolic acidosis (MAc), a decrease in extracellular pH (pHo) caused by a decrease in [HCO3−]o at a fixed [CO2]o, is a common clinical condition and causes intracellular pH (pHi) to fall. Although previous work has suggested that MAc-induced decreases in pHi (ΔpHi) differ among cell types, what is not clear is the extent to which these differences are the result of the wide variety of methodologies employed by various investigators. In the present study, we evaluated the effects of two sequential MAc challenges (MAc1 and MAc2) on pHi in 10 cell types/lines: primary-cultured hippocampal (HCN) neurons and astrocytes (HCA), primary-cultured medullary raphé (MRN) neurons, and astrocytes (MRA), CT26 colon cancer, the C2C12 skeletal muscles, primary-cultured bone marrow-derived macrophages (BMDM) and dendritic cells (BMDC), Ink4a/ARF-null melanocytes, and XB-2 keratinocytes. We monitor pHi using ratiometric fluorescence imaging of 2′,7′-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein while imposing MAc: lowering (pHo) from 7.4 to 7.2 by decreasing [HCO3−]o from 22 to 14 mM at 5% CO2 for 7 min. After MAc1, we return cells to the control solution for 10 min and impose MAc2. Using our definition of MAc resistance [(ΔpHi/ΔpHo) ≤ 40%], during MAc1, ∼70% of CT26 and ∼50% of C2C12 are MAc-resistant, whereas the other cell types are predominantly MAc-sensitive. During MAc2, some cells adapt [(ΔpHi/ΔpHo)2 < (ΔpHi/ΔpHo)1], particularly HCA, C2C12, and BMDC. Most maintain consistent responses [(ΔpHi/ΔpHo)2 ≅ (ΔpHi/ΔpHo)1], and a few decompensate [(ΔpHi/ΔpHo)2>(ΔpHi/ΔpHo)1], particularly HCN, C2C12, and XB-2. Thus, responses to twin MAc challenges depend both on the individual cell and cell type. PMID:25209413

  8. Comparative analysis of protein-protein interactions in the defense response of rice and wheat

    PubMed Central

    2013-01-01

    Background Despite the importance of wheat as a major staple crop and the negative impact of diseases on its production worldwide, the genetic mechanisms and gene interactions involved in the resistance response in wheat are still poorly understood. The complete sequence of the rice genome has provided an extremely useful parallel road map for genetic and genomics studies in wheat. The recent construction of a defense response interactome in rice has the potential to further enhance the translation of advances in rice to wheat and other grasses. The objective of this study was to determine the degree of conservation in the protein-protein interactions in the rice and wheat defense response interactomes. As entry points we selected proteins that serve as key regulators of the rice defense response: the RAR1/SGT1/HSP90 protein complex, NPR1, XA21, and XB12 (XA21 interacting protein 12). Results Using available wheat sequence databases and phylogenetic analyses we identified and cloned the wheat orthologs of these four rice proteins, including recently duplicated paralogs, and their known direct interactors and tested 86 binary protein interactions using yeast-two-hybrid (Y2H) assays. All interactions between wheat proteins were further tested using in planta bimolecular fluorescence complementation (BiFC). Eighty three percent of the known rice interactions were confirmed when wheat proteins were tested with rice interactors and 76% were confirmed using wheat protein pairs. All interactions in the RAR1/SGT1/ HSP90, NPR1 and XB12 nodes were confirmed for the identified orthologous wheat proteins, whereas only forty four percent of the interactions were confirmed in the interactome node centered on XA21. We hypothesize that this reduction may be associated with a different sub-functionalization history of the multiple duplications that occurred in this gene family after the divergence of the wheat and rice lineages. Conclusions The observed high conservation of

  9. Length-dependent changes in contractile dynamics are blunted due to cardiac myosin binding protein-C ablation

    PubMed Central

    Mamidi, Ranganath; Gresham, Kenneth S.; Stelzer, Julian E.

    2014-01-01

    Enhanced cardiac contractile function with increased sarcomere length (SL) is, in part, mediated by a decrease in the radial distance between myosin heads and actin. The radial disposition of myosin heads relative to actin is modulated by cardiac myosin binding protein-C (cMyBP-C), suggesting that cMyBP-C contributes to the length-dependent activation (LDA) in the myocardium. However, the precise roles of cMyBP-C in modulating cardiac LDA are unclear. To determine the impact of cMyBP-C on LDA, we measured isometric force, myofilament Ca2+-sensitivity (pCa50) and length-dependent changes in kinetic parameters of cross-bridge (XB) relaxation (krel), and recruitment (kdf) due to rapid stretch, as well as the rate of force redevelopment (ktr) in response to a large slack-restretch maneuver in skinned ventricular multicellular preparations isolated from the hearts of wild-type (WT) and cMyBP-C knockout (KO) mice, at SL's 1.9 μm or 2.1 μm. Our results show that maximal force was not significantly different between KO and WT preparations but length-dependent increase in pCa50 was attenuated in the KO preparations. pCa50 was not significantly different between WT and KO preparations at long SL (5.82 ± 0.02 in WT vs. 5.87 ± 0.02 in KO), whereas pCa50 was significantly different between WT and KO preparations at short SL (5.71 ± 0.02 in WT vs. 5.80 ± 0.01 in KO; p < 0.05). The ktr, measured at half-maximal Ca2+-activation, was significantly accelerated at short SL in WT preparations (8.74 ± 0.56 s−1 at 1.9 μm vs. 5.71 ± 0.40 s−1 at 2.1 μm, p < 0.05). Furthermore, krel and kdf were accelerated by 32% and 50%, respectively at short SL in WT preparations. In contrast, ktr was not altered by changes in SL in KO preparations (8.03 ± 0.54 s−1 at 1.9 μm vs. 8.90 ± 0.37 s−1 at 2.1 μm). Similarly, KO preparations did not exhibit length-dependent changes in krel and kdf. Collectively, our data implicate cMyBP-C as an important regulator of LDA via its impact on

  10. Development of High-Power, Long-Pulse Gyrotrons and Its Application for High Electron Temperature, EBWH and ECCD Experiments on LHD

    SciTech Connect

    Yoshimura, Y.; Kubo, S.; Shimozuma, T.; Igami, H.; Takahashi, H.; Nishiura, M.; Ito, S.; Kobayashi, S.; Mizuno, Y.; Okada, K.; Takita, Y.; Mutoh, T.; Yamada, H.; Komori, A.; Kariya, T.; Imai, T.; Marushchenko, Nikolai B.; Turkin, Yuri

    2011-12-23

    To sustain plasmas with higher parameters and with longer pulse duration in LHD, ECH system has been upgraded by introducing newly developed 77 GHz gyrotrons. The designed output power and operation duration time are over 1 MW for several seconds and 0.3 MW for continuous operation, respectively. Owing to the upgrade of gyrotrons and improved power supply operation procedure, total injection power of EC-waves to LHD increased up to 3.7 MW at the last LHD experimental campaign in 2010.Application of the high-power 77 GHz EC-waves of 3.4 MW as focused beams to the center of plasma with low line-average electron density of {approx}0.2x10{sup 19} m{sup -3} causes highly steep electron temperature profile and the central electron temperature reached up to 20 keV, which highly exceeds the former record of 15 keV. At higher density region of 1x10{sup 19} m{sup -3}, central electron temperature reached 8.6 keV.Additional electron Bernstein wave heatings, O-X-B and slow X-B heatings, using a 77 GHz ECH system caused clear increase in plasma stored energy even for the high-density plasmas over plasma cutoff (>7.35x10{sup 19} m{sup -3}) sustained with NBI. For the O-X-B scenario, the 77 GHz EC-wave was obliquely injected from low-field side in O-mode polarization, aiming at the point where high mode-conversion efficiency was expected. For realizing slow X-B scenario, new inner-vessel mirrors were installed in LHD just close to a helical coil, that is, at the high-field side (HFS) region. Using the inner-vessel mirror, X-mode waves were injected from HFS, showing evident increase in plasma stored energy.Oblique injection of long-pulse 0.77 MW/8 s 77 GHz wave with various N{sub ||} clearly demonstrated ECCD in LHD. The EC-driven current changes its direction with the sign of N{sub ||}, and the highest EC-driven current reached up to 42 kA.

  11. SMALL-SCALE PRESSURE-BALANCED STRUCTURES DRIVEN BY MIRROR-MODE WAVES IN THE SOLAR WIND

    SciTech Connect

    Yao, Shuo; He, J.-S.; Tu, C.-Y.; Wang, L.-H.; Marsch, E.

    2013-10-20

    Recently, small-scale pressure-balanced structures (PBSs) have been studied with regard to their dependence on the direction of the local mean magnetic field B{sub 0} . The present work continues these studies by investigating the compressive wave mode forming small PBSs, here for B{sub 0} quasi-perpendicular to the x-axis of Geocentric Solar Ecliptic coordinates (GSE-x). All the data used were measured by WIND in the quiet solar wind. From the distribution of PBSs on the plane determined by the temporal scale and angle θ{sub xB} between the GSE-x and B{sub 0} , we notice that at θ{sub xB} = 115° the PBSs appear at temporal scales ranging from 700 s to 60 s. In the corresponding temporal segment, the correlations between the plasma thermal pressure P{sub th} and the magnetic pressure P{sub B}, as well as that between the proton density N{sub p} and the magnetic field strength B, are investigated. In addition, we use the proton velocity distribution functions to calculate the proton temperatures T and T{sub ∥}. Minimum Variance Analysis is applied to find the magnetic field minimum variance vector B{sub N} . We also study the time variation of the cross-helicity σ{sub c} and the compressibility C{sub p} and compare these with values from numerical predictions for the mirror mode. In this way, we finally identify a short segment that has T > T{sub ∥}, proton β ≅ 1, both pairs of P{sub th}-P{sub B} and N{sub p}-B showing anti-correlation, and σ{sub c} ≈ 0 with C{sub p} > 0. Although the examination of σ{sub c} and C{sub p} is not conclusive, it provides helpful additional information for the wave mode identification. Additionally, B{sub N} is found to be highly oblique to B{sub 0} . Thus, this work suggests that a candidate mechanism for forming small-scale PBSs in the quiet solar wind is due to mirror-mode waves.

  12. Catching the role of anisotropic electronic distribution and charge transfer in halogen bonded complexes of noble gases

    NASA Astrophysics Data System (ADS)

    Bartocci, Alessio; Belpassi, Leonardo; Cappelletti, David; Falcinelli, Stefano; Grandinetti, Felice; Tarantelli, Francesco; Pirani, Fernando

    2015-05-01

    The systems studied in this work are gas-phase weakly bound adducts of the noble-gas (Ng) atoms with CCl4 and CF4. Their investigation was motivated by the widespread current interest for the intermolecular halogen bonding (XB), a structural motif recognized to play a role in fields ranging from elementary processes to biochemistry. The simulation of the static and dynamic behaviors of complex systems featuring XB requires the formulation of reliable and accurate model potentials, whose development relies on the detailed characterization of strength and nature of the interactions occurring in simple exemplary halogenated systems. We thus selected the prototypical Ng-CCl4 and Ng-CF4 and performed high-resolution molecular beam scattering experiments to measure the absolute scale of their intermolecular potentials, with high sensitivity. In general, we expected to probe typical van der Waals interactions, consisting of a combination of size (exchange) repulsion with dispersion/induction attraction. For the He/Ne-CF4, the analysis of the glory quantum interference pattern, observable in the velocity dependence of the integral cross section, confirmed indeed this expectation. On the other hand, for the He/Ne/Ar-CCl4, the scattering data unravelled much deeper potential wells, particularly for certain configurations of the interacting partners. The experimental data can be properly reproduced only including a shifting of the repulsive wall at shorter distances, accompanied by an increased role of the dispersion attraction, and an additional short-range stabilization component. To put these findings on a firmer ground, we performed, for selected geometries of the interacting complexes, accurate theoretical calculations aimed to evaluate the intermolecular interaction and the effects of the complex formation on the electron charge density of the constituting moieties. It was thus ascertained that the adjustments of the potential suggested by the analysis of the

  13. IMPACT OF MORNING STIFFNESS, EDUCATION, AND AGE ON THE FUNCTIONAL STATUS OF PATIENTS WITH RHEUMATOID ARTHRITIS.

    PubMed

    Sahatçiu-Meka, Vjollca; Rexhepi, Sylejman; Manxhuka-Kerliu, Suzana; Pallaska, Kelmend; Murtezani, Ardiana; Osmani-Vllasolli, Teuta; Rexhepi, Mjellma; Rexhepi, Blerta

    2015-01-01

    The purpose of this study was to explore the relationship between disability status and duration of morning stiffness in hands with regard to age, level of education, and gender in patients with rheumatoid arthritis (RA). Also, the authors wanted to investigate this relationship with regard to the presence of rheumatoid factor, i.e., the serological status. A retrospective study was conducted in 250 patients with the classic form of RA (186 females, s64 males, mean age Xb = 49.96 y ears, range 25-60 years, disease duration 1-27 years, Xb = 6.41) previously diagnosed with RA according to the ACR (American College of Rheumatology 1987 criteria). All patients were in Steinbrocker functional classes II and III. The probability level was expressed by p < 0.01 and p < 0.05. The relationship between the variables was measured by point-biserial correlation. The correlation between duration of morning stiffness and functional class was positive but low [(r = 0.10, y = 0.00x + 2.37, p > 0.05) seronegative, (r = 0.12, y = 0.00x + 2.30, p > 0.05) seropositive]. High positive values were obtained for the linear correlation coefficient between duration of the disease and functional class (p < 0.01). Also, high values were obtained regarding the coefficient of correlation between age and functional class [(r = 0.29, p < 0.01) seronegative, (r = 0.47, p < 0.01) seropositive]. Uneducated patients were significantly more represented in functional class III [ 23 (50%) seronegative, 19 (42.2%) seropositive] than in functional class II [16 (20.3%) seronegative, 22 (27.5%) seropositive]. In conclusion, in this study of patients with rheumatoid arthritis, increased duration of morning stiffness was associated with functional disability. Functional disability increased with the duration of the disease, depended on age and educational level, and was more pronounced in older age, regardless of RA serological status. With regard to serological status and sex, the differences were non

  14. Optical identification of X-ray source 1RXS J180431.1-273932 as a magnetic cataclysmic variable

    NASA Astrophysics Data System (ADS)

    Masetti, N.; Nucita, A. A.; Parisi, P.

    2012-08-01

    The X-ray source 1RXS J180431.1-273932 has been proposed as a new member of the symbiotic X-ray binary (SyXB) class of systems, which are composed of a late-type giant that loses matter to an extremely compact object, most likely a neutron star. In this paper, we present an optical campaign of imaging plus spectroscopy on selected candidate counterparts of this object. We also reanalyzed the available archival X-ray data collected with XMM-Newton. We find that the brightest optical source inside the 90% X-ray positional error circle is spectroscopically identified as a magnetic cataclysmic variable (CV), most likely of intermediate polar type, through the detection of prominent Balmer, He i, He ii, and Bowen blend emissions. On either spectroscopic or statistical grounds, we discard as counterparts of the X-ray source the other optical objects in the XMM-Newton error circle. A red giant star of spectral type M5 III is found lying just outside the X-ray position: we consider this latter object as a fore-/background one and likewise rule it out as a counterpart of 1RXS J180431.1-273932. The description of the X-ray spectrum of the source using a bremsstrahlung plus black-body model gives temperatures of kTbr ~ 40 keV and kTbb ~ 0.1 keV for these two components. We estimate a distance of d ~ 450 pc and a 0.2-10 keV X-ray luminosity of LX ~ 1.7 × 1032 erg s-1 for this system and, using the information obtained from the X-ray spectral analysis, a mass MWD ~ 0.8 M⊙ for the accreting white dwarf (WD). We also confirm an X-ray periodicity of 494 s for this source, which we interpret as the spin period of the WD. In summary, 1RXS J180431.1-273932 is identified as a magnetic CV and its SyXB nature is excluded. Partly based on observations collected at the Italian Telescopio Nazionale Galileo, located at the Observatorio del Roque de los Muchachos (Canary Islands, Spain).Reduced data used for imaging and spectra is only available at the CDS via anonymous ftp to cdsarc

  15. Interplay between the effects of a Protein Kinase C phosphomimic (T204E) and a dilated cardiomyopathy mutation (K211Δ or R206W) in rat cardiac troponin T blunts the magnitude of muscle length-mediated crossbridge recruitment against the β-myosin heavy chain background.

    PubMed

    Michael, John Jeshurun; Gollapudi, Sampath K; Chandra, Murali

    2016-06-01

    Failing hearts of dilated cardiomyopathy (DCM)-patients reveal systolic dysfunction and upregulation of several Protein Kinase C (PKC) isoforms. Recently, we demonstrated that the functional effects of T204E, a PKC phosphomimic of cardiac troponin T (TnT), were differently modulated by α- and β-myosin heavy chain (MHC) isoforms. Therefore, we hypothesized that the interplay between the effects of T204E and a DCM-linked mutation (K211Δ or R206W) in TnT would modulate contractile parameters linked-to systolic function in an MHC-dependent manner. To test our hypothesis, five TnT variants (wildtype, K211Δ, K211Δ + T204E, R206W, and R206W + T204E) were generated and individually reconstituted into demembranated cardiac muscle fibers from normal (α-MHC) and propylthiouracil-treated (β-MHC) rats. Steady-state and mechano-dynamic measurements were performed on reconstituted fibers. Myofilament Ca(2+) sensitivity (pCa50) was decreased by both K211Δ and R206W to a greater extent in α-MHC fibers (~0.15 pCa units) than in β-MHC fibers (~0.06 pCa units). However, T204E exacerbated the attenuating influence of both mutants on pCa50 only in β-MHC fibers. Moreover, the magnitude of muscle length (ML)-mediated crossbridge (XB) recruitment was decreased by K211Δ + T204E (~47 %), R206W (~34 %), and R206W + T204E (~36 %) only in β-MHC fibers. In relevance to human hearts, which predominantly express β-MHC, our data suggest that the interplay between the effects of DCM mutations, PKC phosphomimic in TnT, and β-MHC lead to systolic dysfunction by attenuating pCa50 and the magnitude of ML-mediated XB recruitment. PMID:27411801

  16. IMPACT OF MORNING STIFFNESS, EDUCATION, AND AGE ON THE FUNCTIONAL STATUS OF PATIENTS WITH RHEUMATOID ARTHRITIS.

    PubMed

    Sahatçiu-Meka, Vjollca; Rexhepi, Sylejman; Manxhuka-Kerliu, Suzana; Pallaska, Kelmend; Murtezani, Ardiana; Osmani-Vllasolli, Teuta; Rexhepi, Mjellma; Rexhepi, Blerta

    2015-01-01

    The purpose of this study was to explore the relationship between disability status and duration of morning stiffness in hands with regard to age, level of education, and gender in patients with rheumatoid arthritis (RA). Also, the authors wanted to investigate this relationship with regard to the presence of rheumatoid factor, i.e., the serological status. A retrospective study was conducted in 250 patients with the classic form of RA (186 females, s64 males, mean age Xb = 49.96 y ears, range 25-60 years, disease duration 1-27 years, Xb = 6.41) previously diagnosed with RA according to the ACR (American College of Rheumatology 1987 criteria). All patients were in Steinbrocker functional classes II and III. The probability level was expressed by p < 0.01 and p < 0.05. The relationship between the variables was measured by point-biserial correlation. The correlation between duration of morning stiffness and functional class was positive but low [(r = 0.10, y = 0.00x + 2.37, p > 0.05) seronegative, (r = 0.12, y = 0.00x + 2.30, p > 0.05) seropositive]. High positive values were obtained for the linear correlation coefficient between duration of the disease and functional class (p < 0.01). Also, high values were obtained regarding the coefficient of correlation between age and functional class [(r = 0.29, p < 0.01) seronegative, (r = 0.47, p < 0.01) seropositive]. Uneducated patients were significantly more represented in functional class III [ 23 (50%) seronegative, 19 (42.2%) seropositive] than in functional class II [16 (20.3%) seronegative, 22 (27.5%) seropositive]. In conclusion, in this study of patients with rheumatoid arthritis, increased duration of morning stiffness was associated with functional disability. Functional disability increased with the duration of the disease, depended on age and educational level, and was more pronounced in older age, regardless of RA serological status. With regard to serological status and sex, the differences were non-significant.

  17. Applied physiology of swimming.

    PubMed

    Lavoie, J M; Montpetit, R R

    1986-01-01

    Scientific research in swimming over the past 10 to 15 years has been oriented toward multiple aspects that relate to applied and basic physiology, metabolism, biochemistry, and endocrinology. This review considers recent findings on: 1) specific physical characteristics of swimmers; 2) the energetics of swimming; 3) the evaluation of aerobic fitness in swimming; and 4) some metabolic and hormonal aspects related to swimmers. Firstly, the age of finalists in Olympic swimming is not much different from that of the participants from other sports. They are taller and heavier than a reference population of the same age. The height bias in swimming may be the reason for lack of success from some Asian and African countries. Experimental data point toward greater leanness, particularly in female swimmers, than was seen 10 years ago. Overall, female swimmers present a range of 14 to 19% body fat whereas males are much lower (5 to 10%). Secondly, the relationship between O2 uptake and crawl swimming velocity (at training and competitive speeds) is thought to be linear. The energy cost varies between strokes with a dichotomy between the 2 symmetrical and the 2 asymmetrical strokes. Energy expenditure in swimming is represented by the sum of the cost of translational motion (drag) and maintenance of horizontal motion (gravity). The cost of the latter decreases as speed increases. Examination of the question of size-associated effects on the cost of swimming using Huxley's allometric equation (Y = axb) shows an almost direct relationship with passive drag. Expressing energy cost in litres of O2/m/kg is proposed as a better index of technical swimming ability than the traditional expression of VO2/distance in L/km. Thirdly, maximal direct conventional techniques used to evaluate maximal oxygen consumption (VO2 max) in swimming include free swimming, tethered swimming, and flume swimming. Despite the individual peculiarities of each method, with similar experimental conditions

  18. Monoamine Oxidase-A Occupancy by Moclobemide and Phenelzine: Implications for the Development of Monoamine Oxidase Inhibitors

    PubMed Central

    Chiuccariello, Lina; Cooke, Robert G; Miler, Laura; Levitan, Robert D; Baker, Glen B; Kish, Stephen J; Kolla, Nathan J; Rusjan, Pablo M; Houle, Sylvain; Wilson, Alan A

    2016-01-01

    Background: Monoamine oxidase inhibitors (MAOIs) are being developed for major depressive disorder, Alzheimer’s, and Parkinson’s Disease. Newer MAOIs have minimal sensitivity to tyramine, but a key limitation for optimizing their development is that standards for in vivo monoamine oxidase-A (MAO-A) occupancy in humans are not well established. The objectives were to determine the dose-occupancy relationship of moclobemide and the occupancy of phenelzine at typical clinical dosing. Methods: Major depressive episode (MDE) subjects underwent [11C]harmine positron emission tomography scanning prior to and following 6 weeks of treatment with moclobemide or phenelzine. Results: Mean brain MAO-A occupancies were 74.23±8.32% for moclobemide at 300–600mg daily (n = 11), 83.75±5.52% for moclobemide at 900–1200mg daily (n = 9), and 86.82±6.89% for phenelzine at 45–60mg daily (n = 4). The regional dose-occupancy relationship of moclobemide fit a hyperbolic function [F(x) = a(x/[b + x]); F(1,18) = 5.57 to 13.32, p = 0.002 to 0.03, mean ‘a’: 88.62±2.38%, mean ‘b’: 69.88±4.36 mg]. Multivariate analyses of variance showed significantly greater occupancy of phenelzine (45–60mg) and higher-dose moclobemide (900–1200mg) compared to lower-dose moclobemide [300–600mg; F(7,16) = 3.94, p = 0.01]. Conclusions: These findings suggest that for first-line MDE treatment, daily moclobemide doses of 300–600mg correspond to a MAO-A occupancy of 74%, whereas for treatment-resistant MDE, either phenelzine or higher doses of moclobemide correspond to a MAO-A occupancy of at least 84%. Therefore, novel MAO inhibitor development should aim for similar thresholds. The findings provide a rationale in treatment algorithm design to raise moclobemide doses to inhibit more MAO-A sites, but suggest switching from high-dose moclobemide to phenelzine is best justified by binding to additional targets. PMID:26316187

  19. The evolution of earthquake-nucleating slip instabilities under spatially variable steady-state rate dependence of friction

    NASA Astrophysics Data System (ADS)

    Ray, S.; Viesca, R. C.

    2014-12-01

    Following laboratory rock friction experiments, fault strength under sub-seismic slip speeds is thought to depend on a slip rate- and state-dependent friction. Laboratory-measured temperature dependence of the frictional properties and their implied variation with depth form the basis for current models of the seismic cycle. However, scant attention has been paid to the role such heterogeneity has on determining the location and manner in which an earthquake nucleating slip instability develops. Recent work demonstrates that a slip instability on a fault with rate-and-state friction (in which state evolution follows the aging law) occurs as the attraction of a dynamical system towards a fixed point (Viesca, this meeting). Based on this development, we find that the location of that fixed point may be determined if a heterogeneous distribution of the relative rate-weakening parameter a/b is known. (Rate-weakening occurs for 01). That this arises can be deduced considering that (i) the problem that determines the fixed points is equivalent to finding the equilibrium solution for a linearly slip-weakening crack, and (ii) heterogeneities in the parameter a/b have analogy in the equivalent problem to heterogeneities in the background stress. Physically, instability develops where rate-weakening is strongest. We examined the influence such a heterogeneity has on the fixed point attractor (and hence on the instability development) by considering the scenario of a rate-weakening patch embedded within a rate-strengthening region with in-plane or anti-plane slip conditions. Specifically, we solve for fixed points under a rate-weakening heterogeneity within |x|a(x)/b = (a/b)m + (1-(a/b)m)*|x|/H and rate-strengthening behavior (a/b>1) outside. Additionally, a linear stability analysis reveals the effect of heterogeneity on the stability of the fixed points of the dynamical system. The heterogeneity parameters (a

  20. Design review report: 200 East upgrades for Project W-314, tank farm restoration and safe operations

    SciTech Connect

    Boes, K.A.

    1998-04-15

    This Design Review Report (DRR) documents the contractor design verification methodology and records associated with project W-314`s 200 East (200E) Upgrades design package. The DRR includes the documented comments and their respective dispositions for this design. Acceptance of the comment dispositions and closure of the review comments is indicated by the signatures of the participating reviewers. Project W-314 is a project within the Tank Waste Remediation System (TWRS) Tank Waste Retrieval Program. This project provides capital upgrades for the existing Hanford tank farm waste transfer, instrumentation, ventilation, and electrical infrastructure systems. To support established TWRS programmatic objectives, the project is organized into two distinct phases. The initial focus of the project (i.e., Phase 1) is on waste transfer system upgrades needed to support the TWRS Privatization waste feed delivery system. Phase 2 of the project will provide upgrades to support resolution of regulatory compliance issues, improve tank infrastructure reliability, and reduce overall plant operating/maintenance costs. Within Phase 1 of the W-314 project, the waste transfer system upgrades are further broken down into six major packages which align with the project`s work breakdown structure. Each of these six sub-elements includes the design, procurement, and construction activities necessary to accomplish the specific tank farm upgrades contained within the package. The first design package (AN Valve Pit Upgrades) was completed in November 1997, and the associated design verification activities are documented in HNF-1893. The second design package, 200 East (200E) Upgrades, was completed in March 1998. This design package identifies modifications to existing valve pits 241-AX-B and 241-A-B, as well as several new waste transfer pipelines to be constructed within the A Farm Complex of the 200E Area. The scope of the valve pit modifications includes new pit cover blocks, valve

  1. Gross and microscopic visceral anatomy of the male Cape fur seal, Arctocephalus pusillus pusillus (Pinnipedia: Otariidae), with reference to organ size and growth

    PubMed Central

    STEWARDSON, CAROLYN L.; HEMSLEY, SUSAN; MEYER, MIKE A.; CANFIELD, PAUL J.; MAINDONALD, JOHN H.

    1999-01-01

    The gross and microscopic anatomy of the Cape fur seal heart, lung, liver, spleen, stomach, intestine and kidneys (n = 31 seals) is described. Absolute and relative size of organs from 30 male seals are presented, with histological examination conducted on 7 animals. The relationship between log body weight, log organ weight and age was investigated using linear regression. Twenty five animals were of known age, while 6 were aged from counts of incremental lines observed in the dentine of tooth sections. For the range of ages represented in this study, body weight changes were accurately described by the exponential growth equation, weight = wort, with body weight increasing by 23% per annum until at least 9–10 y of age. Organ weight increased at a rate of between 25% and 33% per annum until at least 9–10 y of age, with the exception of the intestines, where exponential increase appeared to have ceased by about 7 y. The relationship between body weight and organ weight was investigated using logarithmic transformations of the allometric equation, y = axb, where the exponent b is 1 if organ weight is proportional to body weight. Most organs increased in proportion to the body. However, the heart, liver and spleen had exponents b > 1, suggesting that these organs increased at a faster rate than the body. The basic anatomical features of the viscera were similar to those of other pinnipeds, with some exceptions, including the arrangement of the multilobed lung and liver. Apart from the large liver and kidneys, relative size of the organs did not differ greatly from similar sized terrestrial carnivores. The histological features of the organs were generally consistent with those previously described for this species and other otariids. The heart, as in other pinnipeds, was unlike that of cetacea in not having unusually thick endocardium or prominent Purkinje cells. Notable histological features of the lungs included prominent fibrous septa, prominent smooth muscle

  2. Applied physiology of swimming.

    PubMed

    Lavoie, J M; Montpetit, R R

    1986-01-01

    Scientific research in swimming over the past 10 to 15 years has been oriented toward multiple aspects that relate to applied and basic physiology, metabolism, biochemistry, and endocrinology. This review considers recent findings on: 1) specific physical characteristics of swimmers; 2) the energetics of swimming; 3) the evaluation of aerobic fitness in swimming; and 4) some metabolic and hormonal aspects related to swimmers. Firstly, the age of finalists in Olympic swimming is not much different from that of the participants from other sports. They are taller and heavier than a reference population of the same age. The height bias in swimming may be the reason for lack of success from some Asian and African countries. Experimental data point toward greater leanness, particularly in female swimmers, than was seen 10 years ago. Overall, female swimmers present a range of 14 to 19% body fat whereas males are much lower (5 to 10%). Secondly, the relationship between O2 uptake and crawl swimming velocity (at training and competitive speeds) is thought to be linear. The energy cost varies between strokes with a dichotomy between the 2 symmetrical and the 2 asymmetrical strokes. Energy expenditure in swimming is represented by the sum of the cost of translational motion (drag) and maintenance of horizontal motion (gravity). The cost of the latter decreases as speed increases. Examination of the question of size-associated effects on the cost of swimming using Huxley's allometric equation (Y = axb) shows an almost direct relationship with passive drag. Expressing energy cost in litres of O2/m/kg is proposed as a better index of technical swimming ability than the traditional expression of VO2/distance in L/km. Thirdly, maximal direct conventional techniques used to evaluate maximal oxygen consumption (VO2 max) in swimming include free swimming, tethered swimming, and flume swimming. Despite the individual peculiarities of each method, with similar experimental conditions

  3. [Analysis of alkaline CuO degradation products of acid detergent fiber from tobacco leaves by using liquid chromatography].

    PubMed

    Hao, Weiqiang; Wang, Leijun; Wu, Shun; Yue, Bangyi; Chen, Qiang; Zhang, Peipei

    2015-07-01

    The acid detergent fiber (ADF) from tobacco leaves was obtained by treating the sample with petroleum ether-ethanol (6:4, v/v), 30 g/L sodium dodecylsulfate and 0.5 mol/L sulphuric acid containing 20 g/L hexadecyl trimethyl ammonium bromide successively. The ADF was degraded by the alkaline CuO oxidation procedure. In this work, six samples of ADF degradation products from tobacco leaves were prepared. The samples were analyzed by using gradient liquid chromatography (LC) where an Ultimate XB C18 column was used as stationary phase, with a mixture of methanol and water as mobile phase, at a column temperature of 35 °C and a flow rate of 0.8 mL/min. Dual wavelengths of 280 nm and 320 nm were chosen for the detection. It was found that there were four characteristic peaks for the ADF degradation products. By taking these peaks as research object, the optimum time for the degradation was found to be 5 h and the sample solution could be kept stable within 7 days. The established method may provide a new approach for the studies of the differences between lignin composition in different tobacco leaves and the relationship between lignin content and the smoking quality of tobacco leaves. PMID:26672209

  4. Basic network structure of SiO2-B2O3-Na2O glasses from diffraction and reverse Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Fábián, M.; Araczki, Cs

    2016-05-01

    Neutron- and high-energy synchrotron x-ray diffraction experiments have been performed on the (75-x)SiO2-xB2O3-25Na2O x = 5, 10, 15 and 20 mol% glasses. The structure factor has been measured over a broad momentum transfer range, between 0.4 and 22 Å-1. For data analyses and modelling the Fourier transformation and the reverse Monte Carlo simulation techniques have been applied. The partial atomic pair correlation functions, the nearest neighbour distances, coordination number distributions and average coordination number values and three-particle bond angle distributions have been revealed. The Si-O network proved to be highly stable consisting of SiO4 tetrahedral units with characteristic distances at r Si-O = 1.60 Å and r Si-Si = 3.0(5) Å. The behaviour of network forming boron atoms proved to be more complex. The first neighbour B-O distances show two distinct values at 1.30 Å and a characteristic peak at 1.5(5) Å and, both trigonal BO3 and tetrahedral BO4 units are present. The relative abundance of BO4 and BO3 units depend on the boron content, and with increasing boron content the number of BO4 is decreasing, while BO3 is increasing.

  5. Electronic Properties and Work Functions of Metallic Hexaboride Rods and Slabs

    NASA Astrophysics Data System (ADS)

    Wang, Lu; Luo, Guangfu; Sabirianov, Renat F.; Mei, Wai-Ning; Lu, Jing; Cheung, Chin Li

    2011-03-01

    In this work, we performed electronic structure calculations of quasi one-dimensional metallic hexaboride XB6 nanorods, where X are mostly rare-earth metals with 4f levels such as La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu. In addition we included Ca, Sr, Ba, Sc, Y, and Si for comparison and then complimented those with calculations of LaB6 slabs with different boundaries and low index surfaces. Our purpose is to facilitate the research and manufacture of metal boride probes, thus we study extensively the size-dependence and element-specificity of the electronic properties, particularly the work functions, in nanorods and slabs composed of the rare-earth metal borides, which usually regarded as good thermoelectric materials. We uncovered few general features that elucidate their excellent thermionic and field emission property. To accomplish our calculations, we applied density functional theory together with minimization scheme based on the ensemble density functional theory to facilitate convergence when optimizing structures of these rare-earth metallic haxaboride rods, which have plenty of 4f levels at the Fermi levels.

  6. Structural investigation in the TiB 2-(Na 2O·B 2O 3·Al 2O 3) system

    NASA Astrophysics Data System (ADS)

    Buixaderas, Elena; Maria Anghel, Elena; Petrescu, Simona; Osiceanu, Petre

    2010-09-01

    Composites in the TiB 2-Na 2O·B 2O 3·Al 2O 3 systems, TiB 2-MBA (MB stands for sodium metaborate and A is Al 2O 3), were prepared by self-propagating high-temperature synthesis (SHS), in simultaneous mode. Selection of these compositions was ruled by the interesting properties of both TiB 2 and double borates of alkali metal and aluminum. The structure of the obtained materials was evaluated by micro-Raman spectroscopy, from room temperature up to 600 °C, and X-ray photoelectron spectroscopy (XPS). Formation of the TiB 2 and TiO 2- xB x phases along with TiO 2 as rutile were identified as titanium speciation in the grain phase embedded in a sodium aluminum borate matrix. Integration of the Raman spectra of the grain phases revealed a TiB 2 content of 16.99% and 23.32% for the two composite investigated 2TiB 2·2MBA and 3TiB 2·5MBA. A constrained-width model for the spectral deconvolution of the high-frequency Raman band was forwarded to calculate the proportion of tetrahedral boron atoms (7.424%) in the blank borate matrix Na 2B 2O 4·Al 2O 3 in solid phase.

  7. Measurement of Single and Double Spin Asymmetries in p(e, e' pi(+/-,0))X Semi-Inclusive Deep-Inelastic Scattering

    NASA Astrophysics Data System (ADS)

    Jawalkar, Sucheta Shrikant

    Measurements in the late 1980s at CERN revealed that quark spins account for a small fraction of the proton's spin. This so-called spin crisis spurred a number of new experiments to identify the proton's silent spin contributors, namely, the spin of the gluons, which hold the quarks together, and the orbital angular momentum of both quarks and gluons. One such experiment was eg1-dvcs at the Thomas Jefferson National Accelerator Facility in Newport News, Va., which ran in 2009 and collected approximately 19 billion electron triggers for hydrogen. I will present new measurements of the single and double-spin asymmetries ALU, AUL and ALL for pi+, pi - and pi0, measured as a function of Bjorken xB, squared momentum transfer Q2, hadron energy fraction z, and hadron transverse momentum Ph ⊥. These asymmetries, which are convolutions of transverse-momentum-dependent parton distributions and fragmentation functions, correlate with the transverse momentum, and therefore with the orbital motion, of the struck quark.

  8. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  9. Ion-implantation-induced stress in glasses: Variation of damage mode efficiency with changes in glass structure

    NASA Astrophysics Data System (ADS)

    Arnold, G. W.

    1988-05-01

    Ion implantation induces lateral stress in glass due to the volume dilatation in the implanted near-surface region. Cantilever-beam experiments allow these quantities to be measured as a function of fluence. For fused silica the stress data for various incident ions are found to scale with atomic collision energy deposition. In sharp contrast, Pyrex (alkali-borosilicate) glass, (1 - x)(Na, K) 2O· xB 2O 3·3SiO 2 glass, and a sodalime (microscope slide) glass, yield stress values which scale with energy deposition into electronic processes. More significantly, this mode of damage production is dominant for the nuclear waste glasses PNL 76-68 and SRP. The void space in fused silica allows room for displaced Si and/or O. For the complex alkali-containing silicates, the interstitial volume is restricted. In the latter case, the probability increases that permanent defects can be formed by ionization-induced bond-breaking and network relaxation. These data imply that alpha-particle ionization energy deposition may be an important factor in nuclear waste glass radiation damage production, but the magnitude of this contribution has not yet been evaluated.

  10. Description of Multipole in f-Electron Systems

    NASA Astrophysics Data System (ADS)

    Kusunose, Hiroaki

    2008-06-01

    A systematic description of multipole degrees of freedom is discussed on the basis of the Stevens’ operator-equivalent technique. The generalized Stevens’ multiplicative factors are derived for all of the electric and the magnetic multipoles relevant to f-electron systems. With extensive use of the Stevens’ factors, we express the spatial dependences of the electric and the magnetic fields, and the electric and the magnetic charge densities of localized f electrons. The latter is utilized to draw wave functions including their magnetic profile in addition to their shape with the charge density. The definite relation between the operators as quantum-mechanical variables in a multipole exchange model and the multipole moments in expansion of electromagnetic fields is given. The general treatments for the exchange model with the random-phase-approximation (RPA) susceptibility and the Ginzburg-Landau free-energy expansion are discussed, using CexLa1-xB6 as a typical example. The representative formula of the vector spherical harmonics are summarized, which are suitable basis for vector fields in the spherical expansion.

  11. Around 200 new X-ray binary IDs from 13 YR of Chandra observations of the M31 center

    SciTech Connect

    Barnard, R.; Garcia, M. R.; Primini, F.; Li, Z.; Baganoff, F. K.; Murray, S. S.

    2014-01-01

    We have created 0.3-10 keV, 13 yr, unabsorbed luminosity lightcurves for 528 X-ray sources in the central 20' of M31. We have 174 Chandra observations spaced at ∼1 month intervals due to our transient monitoring program, deeper observations of the M31 nucleus, and some public data from other surveys. We created 0.5-4.5 keV structure functions (SFs) for each source for comparison with the ensemble SF of active galactic nuclei (AGN). We find 220 X-ray sources with luminosities ≳10{sup 35} erg s{sup –1} that have SFs with significantly more variability than the ensemble AGN SF, and which are likely X-ray binaries (XBs). A further 30 X-ray sources were identified as XBs using other methods. We therefore have 250 probable XBs in total, including ∼200 new identifications. This result represents great progress over the ∼50 XBs and ∼40 XB candidates previously identified out of the ∼2000 X-ray sources within the D {sub 25} region of M31; it also demonstrates the power of SF analysis for identifying XBs in external galaxies. We also identify a new transient black hole candidate, associated with the M31 globular cluster B128.

  12. Qualitative and Quantitative Analysis of Volatile Components of Zhengtian Pills Using Gas Chromatography Mass Spectrometry and Ultra-High Performance Liquid Chromatography

    PubMed Central

    Liu, Cui-ting; Zhang, Min; Yan, Ping; Liu, Hai-chan; Liu, Xing-yun; Zhan, Ruo-ting

    2016-01-01

    Zhengtian pills (ZTPs) are traditional Chinese medicine (TCM) which have been commonly used to treat headaches. Volatile components of ZTPs extracted by ethyl acetate with an ultrasonic method were analyzed by gas chromatography mass spectrometry (GC-MS). Twenty-two components were identified, accounting for 78.884% of the total components of volatile oil. The three main volatile components including protocatechuic acid, ferulic acid, and ligustilide were simultaneously determined using ultra-high performance liquid chromatography coupled with diode array detection (UHPLC-DAD). Baseline separation was achieved on an XB-C18 column with linear gradient elution of methanol-0.2% acetic acid aqueous solution. The UHPLC-DAD method provided good linearity (R2 ≥ 0.9992), precision (RSD < 3%), accuracy (100.68–102.69%), and robustness. The UHPLC-DAD/GC-MS method was successfully utilized to analyze volatile components, protocatechuic acid, ferulic acid, and ligustilide, in 13 batches of ZTPs, which is suitable for discrimination and quality assessment of ZTPs. PMID:26904360

  13. Hadamard Factorization of Stable Polynomials

    NASA Astrophysics Data System (ADS)

    Loredo-Villalobos, Carlos Arturo; Aguirre-Hernández, Baltazar

    2011-11-01

    The stable (Hurwitz) polynomials are important in the study of differential equations systems and control theory (see [7] and [19]). A property of these polynomials is related to Hadamard product. Consider two polynomials p,q ∈ R[x]:p(x) = anxn+an-1xn-1+...+a1x+a0q(x) = bmx m+bm-1xm-1+...+b1x+b0the Hadamard product (p × q) is defined as (p×q)(x) = akbkxk+ak-1bk-1xk-1+...+a1b1x+a0b0where k = min(m,n). Some results (see [16]) shows that if p,q ∈R[x] are stable polynomials then (p×q) is stable, also, i.e. the Hadamard product is closed; however, the reciprocal is not always true, that is, not all stable polynomial has a factorization into two stable polynomials the same degree n, if n> 4 (see [15]).In this work we will give some conditions to Hadamard factorization existence for stable polynomials.

  14. Principal component analysis of persistent homology rank functions with case studies of spatial point patterns, sphere packing and colloids

    NASA Astrophysics Data System (ADS)

    Robins, Vanessa; Turner, Katharine

    2016-11-01

    Persistent homology, while ostensibly measuring changes in topology, captures multiscale geometrical information. It is a natural tool for the analysis of point patterns. In this paper we explore the statistical power of the persistent homology rank functions. For a point pattern X we construct a filtration of spaces by taking the union of balls of radius a centred on points in X, Xa =∪x∈X B(x , a) . The rank function βk(X) : {(a , b) ∈R2 : a ≤ b } → R is then defined by βk(X) (a , b) = rank(ι∗ :Hk(Xa) →Hk(Xb)) where ι∗ is the induced map on homology from the inclusion map on spaces. We consider the rank functions as lying in a Hilbert space and show that under reasonable conditions the rank functions from multiple simulations or experiments will lie in an affine subspace. This enables us to perform functional principal component analysis which we apply to experimental data from colloids at different effective temperatures and to sphere packings with different volume fractions. We also investigate the potential of rank functions in providing a test of complete spatial randomness of 2D point patterns using the distances to an empirically computed mean rank function of binomial point patterns in the unit square.

  15. Spontaneous scratching behaviour in DS-Nh mice as a possible model for pruritus in atopic dermatitis

    PubMed Central

    Yoshioka, T; Hikita, I; Asakawa, M; Hirasawa, T; Deguchi, M; Matsutani, T; Oku, H; Horikawa, T; Arimura, A

    2006-01-01

    Itching is one of the major clinical symptoms in atopic dermatitis (AD) and complicates the management of this pathological condition. An animal model of AD-like pruritus would contribute to a better understanding of AD and could lead to the development of safe and effective antipruritic agents. DS non-hair (DS-Nh) mice raised under conventional conditions spontaneously develop pruritus, which is associated with a dermatitis similar to human AD. There is a significant positive correlation between disease severity and the period of scratching behaviour in DS-Nh mice. In the present study, we found that levels of histamine and nerve growth factor (NGF) in serum and/or skin tissue were higher in DS-Nh mice with AD-like dermatitis than in age-matched mice without dermatitis. The histopathological data indicated that nerve fibres extend into and mast cells infiltrate the surrounding area of the skin lesion. NGF production by XB-2 cells, which was derived from mouse keratinocytes, was enhanced by histamine via the H1 receptor. We also found that prolonged treatment with an H1-antagonist was effective against pruritus through depression of the production of NGF, which is thought to be generated by keratinocytes. We conclude that DS-Nh mice can serve as a suitable model for gaining a better understanding of pruritus in AD, and that prolonged treatment with an H1-antagonist may be beneficial in patients with AD-associated pruritus. PMID:16827890

  16. Dehydrogenation kinetics and reversibility of LiAlH4-LiBH4 doped with Ti-based additives and MWCNT

    NASA Astrophysics Data System (ADS)

    Thaweelap, Natthaporn; Utke, Rapee

    2016-11-01

    Dehydrogenation kinetics and reversibility of LiAlH4-LiBH4 doped with Ti-based additives (TiCl3 and Ti-isopropoxide), multiwall carbon nanotubes (MWCNT), and MWCNT impregnated with Ti-based additives are proposed. Reduction of dehydrogenation temperature as well as improvements of kinetics and reversibility, especially decomposition of thermodynamically stable hydride (LiBH4) is obtained from the samples doped with Ti-isopropoxide and MWCNT. This can be due to the fact that the formations of LixAl(1-x)B2 and LiH-Al containing phase during dehydrogenation favor decomposition of LiH, leading to increment of hydrogen capacity, and stabilization of boron in solid state, resulting in improvement of reversibility. Besides, the curvatures and thermal conductivity of MWCNT benefit hydrogen diffusion and heat transfer during de/rehydrogenation. Nevertheless, deficient hydrogen content reversible is observed in all samples due to the irreversible of LiAlH4 and/or Li3AlH6 as well as the formation of stable phase (Li2B12H12) during de/rehydrogenation.

  17. Qualitative Confirmation of 9 Synthetic Cannabinoids and 20 Metabolites in Human Urine Using LC–MS/MS and Library Search

    PubMed Central

    Wohlfarth, Ariane; Scheidweiler, Karl B.; Chen, Xiaohong; Liu, Hua-fen; Huestis, Marilyn A.

    2013-01-01

    Introduction Synthetic cannabinoids are an emerging illicit drug class. The variety of available substances is large and ever-changing, making it difficult for laboratories to remain current. We present a qualitative LC–MS/MS method identifying urinary metabolites of JWH-018, JWH-073, JWH-081, JWH-122, JWH-200, JWH-210, JWH-250, RCS-4, and AM2201 and the parent compounds JWH-018, JWH-073, JWH-081, JWH-122, JWH-210, JWH-250, RCS-4, AM2201, and MAM2201. Methods After enzymatic hydrolysis, urinary proteins were precipitated with acetonitrile. Chromatography utilized a 10 min gradient on a Kinetex XB-C18 column with 0.1% formic acid in water and acetonitrile. Scheduled multiple reaction monitoring “survey scans” were followed by information-dependent acquisition-enhanced product ion scan experiments on an ABSciex 5500 QTRAP mass spectrometer. Analytes were identified by software-assisted library searching against reference spectra. Results The method was fully validated, including proof of selectivity (no exogenous or endogenous interferences were observed), assessment of matrix effects (95–122%) and recovery (53–95%), determination of limits of detection (0.5–10 ng/mL), carry-over studies (thresholds between 100 and 1000 ng/mL), and determination of autosampler stability (samples were stable for at least 3 days). Hydrolysis efficiency was thoroughly investigated for a wide range of glucuronides and for the reference standard, JWH-018 5-hydroxypentyl glucuronide PMID:23458260

  18. Six Decades of Flight Research: An Annotated Bibliography of Technical Publications of NASA Dryden Flight Research Center, 1946-2006

    NASA Technical Reports Server (NTRS)

    Fisher, David F.

    2007-01-01

    Titles, authors, report numbers, and abstracts are given for nearly 2900 unclassified and unrestricted technical reports and papers published from September 1946 to December 2006 by the NASA Dryden Flight Research Center and its predecessor organizations. These technical reports and papers describe and give the results of 60 years of flight research performed by the NACA and NASA, from the X-1 and other early X-airplanes, to the X-15, Space Shuttle, X-29 Forward Swept Wing, X-31, and X-43 aircraft. Some of the other research airplanes tested were the D-558, phase 1 and 2; M-2, HL-10 and X-24 lifting bodies; Digital Fly-By-Wire and Supercritical Wing F-8; XB-70; YF-12; AFTI F-111 TACT and MAW; F-15 HiDEC; F-18 High Alpha Research Vehicle, F-18 Systems Research Aircraft and the NASA Landing Systems Research aircraft. The citations of reports and papers are listed in chronological order, with author and aircraft indices. In addition, in the appendices, citations of 270 contractor reports, more than 200 UCLA Flight System Research Center reports, nearly 200 Tech Briefs, 30 Dryden Historical Publications, and over 30 videotapes are included.

  19. Determination of bevantolol in human plasma using liquid chromatography-electrospray ionization tandem mass spectrometry and its application to a bioequivalence study.

    PubMed

    Ren, Li; Wang, Zheng; Lou, Yiceng; Zheng, Lu; Zheng, Heng; Yin, Chunping

    2014-05-15

    A liquid chromatography-electrospray ionization tandem mass spectrometry method was established and validated for the determination of bevantolol in human plasma using propranolol as the internal standard. The optimal chromatographic behavior of bevantolol and propranolol was achieved on a Welch Ultimate XB-C18 column (5 μm, 150 mm × 2.1mm, Maryland, USA) with a mobile phase of acetonitrile-water (40:60, v/v) containing 10mM ammonium acetate and 0.1% formic acid. The mass spectrometer was operated in selected reaction monitoring mode using the transition m/z 346.1>165.1 for bevantolol and m/z 260.3>116.1 for propranolol. Sample preparation was carried out through protein precipitation with acetonitrile. The calibration curves were linear over the range of 5.00-1,000 ng/ml. The intra- and inter-day precisions were less than 6.7% and 6.6%, respectively. This method was successfully applied to the bioequivalence study of two kinds of bevantolol hydrochloride tablets in 24 Chinese male volunteers in fasting and postprandial experiment.

  20. High-throughput salting-out-assisted liquid-liquid extraction for the simultaneous determination of atorvastatin, ortho-hydroxyatorvastatin, and para-hydroxyatorvastatin in human plasma using ultrafast liquid chromatography with tandem mass spectrometry.

    PubMed

    Yang, Yong; Xu, Qiufang; Zhou, Lei; Zhong, Dafang; Chen, Xiaoyan

    2015-03-01

    A high-throughput, specific, and rapid liquid chromatography with tandem mass spectrometry method was established and validated for the simultaneous determination of atorvastatin and its two major metabolites, ortho-hydroxyatorvastatin and para-hydroxyatorvastatin, in human plasma. A simple salting-out-assisted liquid-liquid extraction using acetonitrile and a mass-spectrometry-friendly salt, ammonium acetate, was employed to extract the analytes from human plasma. A recovery of more than 81% for all analytes was achieved in 1 min extraction time. Chromatographic separation was performed on a Kinetex XB C18 column utilizing a gradient elution starting with a 60% of water solution (1% formic acid), followed by increasing percentages of acetonitrile. Analytes were detected on a tandem mass spectrometer equipped with an electrospray ionization source that was operated in the positive mode, using the transitions of m/z 559.3 → m/z 440.2 for atorvastatin, and m/z 575.3 → m/z 440.2 for both ortho- and para-hydroxyatorvastatin. Deuterium-labeled compounds were used as the internal standards. The method was validated over the concentration ranges of 0.0200-15.0 ng/mL for atorvastatin and ortho-hydroxyatorvastatin, and 0.0100-2.00 ng/mL for para-hydroxyatorvastatin with acceptable accuracy and precision. It was then successfully applied in a bioequivalence study of atorvastatin.

  1. Global series solutions of nonlinear differential equations with shocks using Walsh functions

    NASA Astrophysics Data System (ADS)

    Gnoffo, Peter A.

    2014-02-01

    An orthonormal basis set composed of Walsh functions is used for deriving global solutions (valid over the entire domain) to nonlinear differential equations that include discontinuities. Function gn(x) of the set, a scaled Walsh function in sequency order, is comprised of n piecewise constant values (square waves) across the domain xa⩽x⩽xb. Only two square wave lengths are allowed in any function and a new derivation of the basis functions applies a fractal-like algorithm (infinitely self-similar) focused on the distribution of wave lengths. This distribution is determined by a recursive folding algorithm that propagates fundamental symmetries to successive values of n. Functions, including those with discontinuities, may be represented on the domain as a series in gn(x) with no occurrence of a Gibbs phenomenon (ringing) across the discontinuity. A much more powerful, self-mapping characteristic of the series is closure under multiplication - the product of any two Walsh functions is also a Walsh function. This self-mapping characteristic transforms the solution of nonlinear differential equations to the solution of systems of polynomial equations if the original nonlinearities can be represented as products of the dependent variables and the convergence of the series for n→∞ can be demonstrated. Fundamental operations (reciprocal, integral, derivative) on Walsh function series representations of functions with discontinuities are defined. Examples are presented for solution of the time dependent Burger's equation and for quasi-one-dimensional nozzle flow including a shock.

  2. Thresholded Power law Size Distributions of Instabilities in Astrophysics

    NASA Astrophysics Data System (ADS)

    Aschwanden, Markus J.

    2015-11-01

    Power-law-like size distributions are ubiquitous in astrophysical instabilities. There are at least four natural effects that cause deviations from ideal power law size distributions, which we model here in a generalized way: (1) a physical threshold of an instability; (2) incomplete sampling of the smallest events below a threshold x0; (3) contamination by an event-unrelated background xb; and (4) truncation effects at the largest events due to a finite system size. These effects can be modeled in the simplest terms with a “thresholded power law” distribution function (also called generalized Pareto [type II] or Lomax distribution), N(x){dx}\\propto {(x+{x}0)}-a{dx}, where x0 > 0 is positive for a threshold effect, while x0 < 0 is negative for background contamination. We analytically derive the functional shape of this thresholded power law distribution function from an exponential growth evolution model, which produces avalanches only when a disturbance exceeds a critical threshold x0. We apply the thresholded power law distribution function to terrestrial, solar (HXRBS, BATSE, RHESSI), and stellar flare (Kepler) data sets. We find that the thresholded power law model provides an adequate fit to most of the observed data. Major advantages of this model are the automated choice of the power law fitting range, diagnostics of background contamination, physical instability thresholds, instrumental detection thresholds, and finite system size limits. When testing self-organized criticality models that predict ideal power laws, we suggest including these natural truncation effects.

  3. Complex Heat Capacity of Lithium Borate Glasses Studied by Modulated DSC

    SciTech Connect

    Matsuda, Yu; Ike, Yuji; Matsui, Chihiro; Kodama, Masao; Kojima, Seiji

    2006-05-05

    Complex heat capacity, C{sub p}* = C{sub p}' - iC{sub p}'', of lithium borate glasses Li2O{center_dot}(1-x)B2O3 (x = 0.00 - 0.33) has been investigated by Modulated DSC (MDSC). We have successfully observed the frequency dependent C{sub p}* by MDSC in the frequency range 0.01 to 0.1 Hz, and the average relaxation time of glass transition has been determined as a function of temperature. Moreover, the composition dependence of the thermal properties has been investigated. The calorimetric glass transition temperatures become higher with the increase of concentration of Li2O and show the board maximum around x = 0.26-0.28. The width of glass transition region becomes narrower as Li2O increases. These results relate to the change of the fragility of the system. It has been proven that the complex heat capacity spectroscopy by MDSC is a powerful tool to investigate the glass transition phenomena.

  4. Relative growth of Petrochirus diogenes (Linnaeus, 1758) (Crustacea, Anomura, Diogenidae) in the Ubatuba region, São Paulo, Brazil.

    PubMed

    Bertini, G; Fransozo, A

    1999-11-01

    The purpose of this paper is to investigate the relative growth and heterochely in the hermit crab Petrochirus diogenes. Hermit crabs were collected in the Ubatuba region, SP, from 1993 to 1996; using a commercial fishing boat equipped with two double-rig nets. Body mass of each individual was weighed and their cephalothoracic shield and chelar propodus size were measured. Body mass and chelar propodus size were regarded as dependent variables and plotted against length of cephalothoracic shield according to the allometric equation y = a x x(b). A total of 479 individuals were obtained being 307 males and 172 females. Cephalothoracic shield width follows an isometric growth for both sexes. Otherwise, right cheliped dimensions show different relative growth patterns and left cheliped ones present a positive allometry in males and females. Unlike brachyurans, ontogenetic changes in the growth rate of chelar propodus are not clearly discernible, which prevents the accurate detection of allometric variations. In both sexes, the right cheliped is larger than the right one. Cheliped size is a sexual dimorphic feature with males bearing larger chelipeds than females. Heterochely may be particularly adaptive in agonistic interactions and precopulatory behaviour in P diogenes.

  5. Sex Determination in Bees. IV. Genetic Control of Juvenile Hormone Production in MELIPONA QUADRIFASCIATA (Apidae)

    PubMed Central

    Kerr, Warwick Estevam; Akahira, Yukio; Camargo, Conceição A.

    1975-01-01

    Cell number and volume of corpora allata was determined for 8 phases of development, the first prepupal stage to adults 30 days old, in the social Apidae Melipona quadrifasciata. In the second prepupal stage a strong correlation was found between cell number and body weight ( r=0.651**), and cell number and corpora allata volume in prepupal stage (r=0.535*), which indicates that juvenile hormone has a definite role in caste determination in Melipona. The distribution of the volume of corpus allatum suggest a 3:1 segregation between bees with high volume of corpora allata against low and medium volume. This implies that genes xa and xb code for an enzyme that directly participates in juvenile hormone production. It was also concluded that the number of cells in the second prepupal stage is more important than the weight of the prepupa for caste determination. A scheme summarizing the genic control of sex and caste determination in Melipona bees in the prepupal phase is given. PMID:1213273

  6. Studies of cyclization reactions of linear cumulenes and heterocumulenes using the neutralization-reionization procedure and/or ab initio calculations.

    PubMed

    Wang, Tianfang; Bowie, John H

    2011-01-01

    A number of linear cumulenes and heterocumulenes have been made by charge stripping of anions of known bond connectivity in the source of a mass spectrometer. Some of these reactive molecules have been identified in interstellar molecular clouds. The structures of these neutrals may be investigated by reionization to a decomposing positive ion [the neutralization-reionization technique ((-)NR(+))], and/or by ab initio calculations. Energized linear cumulenes and heterocumulenes may undergo cyclization to form stable cyclic isomers. To cite a selection of the examples described in this review: (i) four-atom systems CCCC and some heterocumulenes CCCX (X=B, N, Al, Si, P) involve the formation of stable four-membered ring rhombic (also called kite and fan) structures. One of the cyclic molecules, cyclo-C(3) Si, has been detected in interstellar molecular clouds, (ii) five-atom cumulene and heterocumulene systems are more complex. Linear CCCCC rearranges the carbon skeleton by forming a C substituted rhomboid system, CCCCO forms a three-membered cyclic isomer, while nitrogen containing five-atom cumulenes effect nitrile to isonitrile interconversion via three-centered cyclized intermediates, and (iii) CCCCCC and CCCCBO cyclize to give unique six-membered ring systems.

  7. [HPLC combined with PCA technology for analysis of five gingerol compounds in different processing degrees of ginger charcoal].

    PubMed

    Yu, Jiang-yong; Chen, Qiu-fang; Lu, Guo-yong

    2015-11-01

    To establish a new method for simultaneously determining the content of five gingerol compounds in different processing degrees of ginger charcoal and PCA principal component analysis was conducted for analysis. Samples were analyzed on Ultimate TM XB-C18 column (4.6 mm x 250 mm, 5 μm) , with acetonitrile (A) -0.1% phosphoric acid solution (B) as mobile phase for gradient elution. Detection wavelength was set at 280 nm. The flow rate was 0.6 mL x min(-1) and the column temperature was 30 degrees C. The five compounds were separated well and showed good linearity (r ≥ 0.999 7) within the concentration ranges tested. The average value for recoveries was between 98.86% - 101.5% (RSD 1.4% - 2.9%). The contents of five compounds showed difference among different processing degrees of ginger charcoal. Zingiberone had the highest content in the standard carbon, and the content of gingerol was decreased as the deepening of processing degree. Different processing degrees of ginger charcoal were classified into three groups with PCA, and provided scientific basis for establishing the quality standards of ginger charcoal.

  8. [HPLC combined with PCA technology for analysis of five gingerol compounds in different processing degrees of ginger charcoal].

    PubMed

    Yu, Jiang-yong; Chen, Qiu-fang; Lu, Guo-yong

    2015-11-01

    To establish a new method for simultaneously determining the content of five gingerol compounds in different processing degrees of ginger charcoal and PCA principal component analysis was conducted for analysis. Samples were analyzed on Ultimate TM XB-C18 column (4.6 mm x 250 mm, 5 μm) , with acetonitrile (A) -0.1% phosphoric acid solution (B) as mobile phase for gradient elution. Detection wavelength was set at 280 nm. The flow rate was 0.6 mL x min(-1) and the column temperature was 30 degrees C. The five compounds were separated well and showed good linearity (r ≥ 0.999 7) within the concentration ranges tested. The average value for recoveries was between 98.86% - 101.5% (RSD 1.4% - 2.9%). The contents of five compounds showed difference among different processing degrees of ginger charcoal. Zingiberone had the highest content in the standard carbon, and the content of gingerol was decreased as the deepening of processing degree. Different processing degrees of ginger charcoal were classified into three groups with PCA, and provided scientific basis for establishing the quality standards of ginger charcoal. PMID:27071256

  9. RARE VARIANTS IN TENASCIN GENES IN A COHORT OF CHILDREN WITH PRIMARY VESICOURETERIC REFLUX

    PubMed Central

    Elahi, Shan; Homstad, Alison; Vaidya, Himani; Stout, Jennifer; Hall, Gentzon; Wu, Guanghong; Conlon, Peter; Routh, Jonathan C.; Wiener, John S.; Ross, Sherry S.; Nagaraj, Shashi; Wigfall, Delbert; Foreman, John; Adeyemo, Adebowale; Gupta, Indra R.; Brophy, Patrick D.; Rabinovich, C. Egla; Gbadegesin, Rasheed A.

    2016-01-01

    Background Primary vesicoureteral reflux (PVUR) is the most common malformation of the kidney and urinary tract and reflux nephropathy is a major cause of chronic kidney disease in children. Recently, we reported mutations in tenascin XB (TNXB) as a cause of PVUR with joint hypermobility. Methods To define the role of rare variants in tenascin genes in the etiology of PVUR, we screened a cohort of patients with familial PVUR (FPVUR) and non-familial PVUR (NFPVUR) for rare missense variants in TNXB and tenascin C (TNC) genes after excluding mutations in ROBO2 and SOX17. Results We identified 134 individuals from 112 families with PVUR, we excluded two families with mutations in ROBO2. We found rare missense variants in TNXB in the remaining 110 families comprising of 5/55 (9%) of families with FPVUR and 2/55 (4%) of NFPVUR. There were no differences in high-grade reflux, or renal parenchymal scarring between patients with and without TNXB variants. All patients with TNXB rare variants that were tested exhibited joint hypermobility. Overall we were able to identify causes of FPVUR in 7/57 (12%) families (9% in TNXB and 3% in ROBO2). Conclusions In conclusion, a rare missense variant in TNXB in combination with a positive family history of VUR and joint hypermobility may represent a non-invasive method to diagnose PVUR and warrants further evaluation in other cohorts. PMID:26408188

  10. Electronic/thermal transport phenomena in novel materials with structural complexity

    NASA Astrophysics Data System (ADS)

    Sharma, Peter Anand

    Understanding the varied behavior of solids is one of the central challenges of modern physics. Structurally complex materials often exhibit the most interesting and perplexing properties, and as such remain an important and exciting research area. Observing the macroscopic transport of heat and charge is a powerful way of understanding complex materials and is the subject of this thesis. Furthermore, relating the macroscopic response to microscopic properties is usually an important first step towards this end. The following main results shall illustrate this methodology: (1) the discovery of electronic phase separation through percolative charge transport and electron microscopy in the superconductor Mg1-xB 2; (2) an examination of the unusual coupling between lattice dynamics (phonons) and cooperative paramagnetic spin fluctuations found in geometrically frustrated magnets through measurements of the thermal conductivity and neutron scattering; (3) evidence for a possibly new kind of glass transition in the phase separated manganite La5/8-xPrxCa 3/8MnO3, involving the spin, charge, and lattice degrees of freedom.

  11. Ignitor and the High Density Approach for Fusion*

    NASA Astrophysics Data System (ADS)

    Bombarda, F.; Coppi, B.

    2010-11-01

    The high plasma density regimes discovered by high magnetic field toroidal experiments have both outstanding confinement characteristics and degree of purity, and are at the basis of the Ignitor design. The main purpose of the Ignitor experiment is, in fact, that of establishing the reactor physics in regimes close to ignition, where the thermonuclear instability can set in with all its associated non linear effects. ``Extended limiter'' and double X-point configurations have been analyzed and relevant transport simulations show that similar burning plasma conditions can be attained with both, by Ohmic heating only or with modest amounts of ICRH auxiliary heating. The driving factor for the machine design (R01.32 m, a xb0.47x0.83 m^2, BT<=13 T, Ip<=11 MA) is the poloidal field pressure that can contain, under macroscopically stable conditions, the peak plasma pressures corresponding to ignition. Objectives other than ignition can be envisioned for the relatively near term, for example that of high flux neutron sources for material testing involving compact, high density fusion machines. This has been one of the incentives that have led the Ignitor Project to adopt magnesium diboride (MgB2) superconducting cables in the machine design, a first in fusion research. Accordingly, the largest coils (about 5 m diameter) of the machine will be made entirely of MgB2 cables. *Sponsored in part by ENEA of Italy and by the U.S. D.O.E.

  12. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  13. Magnetic field annealing for improved creep resistance

    DOEpatents

    Brady, Michael P.; Ludtka, Gail M.; Ludtka, Gerard M.; Muralidharan, Govindarajan; Nicholson, Don M.; Rios, Orlando; Yamamoto, Yukinori

    2015-12-22

    The method provides heat-resistant chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloys having improved creep resistance. A precursor is provided containing preselected constituents of a chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloy, at least one of the constituents for forming a nanoscale precipitate MaXb where M is Cr, Nb, Ti, V, Zr, or Hf, individually and in combination, and X is C, N, O, B, individually and in combination, a=1 to 23 and b=1 to 6. The precursor is annealed at a temperature of 1000-1500.degree. C. for 1-48 h in the presence of a magnetic field of at least 5 Tesla to enhance supersaturation of the M.sub.aX.sub.b constituents in the annealed precursor. This forms nanoscale M.sub.aX.sub.b precipitates for improved creep resistance when the alloy is used at service temperatures of 500-1000.degree. C. Alloys having improved creep resistance are also disclosed.

  14. Thermal fluids for CSP systems: Alkaline nitrates/nitrites thermodynamics modelling method

    NASA Astrophysics Data System (ADS)

    Tizzoni, A. C.; Sau, S.; Corsaro, N.; Giaconia, A.; D'Ottavi, C.; Licoccia, S.

    2016-05-01

    Molten salt (MS) mixtures are used for the transport (HTF-heat transfer fluid) and storage of heat (HSM-heat storage material) in Concentration Solar Plants (CSP). In general, alkaline and earth-alkaline nitrate/nitrite mixtures are employed. Along with its upper stability temperature, the melting point (liquidus point) of a MS mixture is one of the main parameters which defines its usefulness as a HTF and HSM medium. As a result, we would like to develop a predictive model which will allow us to forecast freezing points for different MS mixture compositions; thus circumventing the need to determine experimentally the phase diagram for each MS mixture. To model ternary/quaternary phase diagram, parameters for the binary subsystems are to be determined, which is the purpose of the concerned work. In a binary system with components A and B, in phase equilibrium conditions (e.g. liquid and solid) the chemical potentials (partial molar Gibbs energy) for each component in each phase are equal. For an ideal solution it is possible to calculate the mixing (A+B) Gibbs energy:ΔG = ΔH - TΔS = RT(xAlnxA + xBlnxB) In case of non-ideal solid/liquid mixtures, such as the nitrates/nitrites compositions investigated in this work, the actual value will differ from the ideal one by an amount defined as the "mixing" (mix) Gibbs free energy. If the resulting mixtures is assumed, as indicated in the previous literature, to follow a "regular solution" model, where all the non-ideality is considered included in the enthalpy of mixing value and considering, for instance, the A component:Δ G ≡0 =(Δ HA-T Δ SA)+(ΔH¯ m i x AL-T ΔS¯ m i x AL)-(ΔH¯ m i x AS-T ΔS¯ m i x AS)where the molar partial amounts can be calculated from the total value by the Gibbs Duhem equation: (ΔH¯m i x AL=ΔHm i x-XB Ld/Δ Hm i x d XB L ) L;(ΔH¯m i x AS=ΔHm i x-XB Sd/Δ Hm i x d XB S ) S and, in general, it is possible to express the mixing enthalpy for solids and liquids as a function of the mol

  15. In situ deuterium inventory measurements of a-C:D layers on tungsten in TEXTOR by laser induced ablation spectroscopy

    NASA Astrophysics Data System (ADS)

    Gierse, N.; Brezinsek, S.; Coenen, J. W.; Giesen, T. F.; Huber, A.; Laengner, M.; Möller, S.; Nonhoff, M.; Philipps, V.; Pospieszczyk, A.; Schweer, B.; Sergienko, G.; Xiao, Q.; Zlobinski, M.; Samm, U.; the TEXTOR Team

    2014-04-01

    Laser induced ablation spectroscopy (LIAS) is a diagnostic to provide temporally and spatially resolved in situ measurements of tritium retention and material migration in order to characterize the status of the first wall in future fusion devices. In LIAS, a ns-laser pulse ablates the first nanometres of the first wall plasma-facing components into the plasma edge. The resulting line radiation by plasma excitation is observed by spectroscopy. In the case of the full ionizing plasma and with knowledge of appropriate photon efficiencies for the corresponding line emission the amount of ablated material can be measured in situ. We present the photon efficiency for the deuterium Balmer α-line resulting from ablation in TEXTOR by performing LIAS on amorphous hydrocarbon (a-C:D) layers deposited on tungsten substrate of thicknesses between 0.1 and 1.1 μm. An experimental inverse photon efficiency of [ {\\frac{{D}}{{{XB}}}} ]_{{D}_\\alpha({EXP})}^{{a {- C:D}}\\mathop {\\mathop \\to \\limits_{{LIAS}} } D}= 75.9 +/- 23.4 was determined. This value is a factor 5 larger than predicted values from the ADAS database for atomic injection of deuterium under TEXTOR plasma edge conditions and about twice as high, assuming normal wall recycling and release of molecular deuterium and break-up of D2 via the molecular ion which is usually observed at the high temperature tokamak edge (Te > 30 eV).

  16. Be I and Be II spectroscopy in divertor plasma relevant conditions

    NASA Astrophysics Data System (ADS)

    Nishijima, D.; Doerner, R. P.; Seraydarian, R. P.

    2013-07-01

    Intensity ratios of various Be I and Be II lines measured in Be-seeded D and He plasmas in the PISCES-B linear divertor plasma simulator are compared with the corresponding ratios of the photon emissivity coefficient, PEC, calculated by ADAS. Agreement of measured intensity ratios with calculated PEC ratios is satisfactory within a factor of ˜2 for both Be I and Be II. It is proposed that a Be I line ratio of 234.8 nm/265.0 nm and a Be II line ratio of 467.3 nm/313.1 nm can be used to estimate the electron temperature, while a 265.0 nm/332.1 nm Be I line ratio is sensitive to the electron density. Further, S/XB values of a Be I line at 457.3 nm were experimentally determined from a ratio of the sputtered Be flux to the emission intensity. Measured values are systematically lower than calculated ADAS values, which may be explained by the increased sputtering yield of redeposited Be atoms.

  17. Angular distribution of different vibrational components of the X and B states reached after resonant Auger decay of core-excited H2O: Experiment and theory

    NASA Astrophysics Data System (ADS)

    Hjelte, I.; Karlsson, L.; Svensson, S.; De Fanis, A.; Carravetta, V.; Saito, N.; Kitajima, M.; Tanaka, H.; Yoshida, H.; Hiraya, A.; Koyano, I.; Ueda, K.; Piancastelli, M. N.

    2005-02-01

    Vibrationally resolved spectra have been obtained for the lowest-lying cationic states XB12,AA12, and BB22 of the water molecule reached after participator resonant Auger decay of core-excited states. The angular distribution has been measured of the first four vibrational components of the X state in the photon energy regions including the O 1s →4a1 and the O 1s→2b2 core excitations, and for different portions of the vibrational envelope of the B state in the photon energy region including the O 1s→2b2 core excitation. For the X state, a large relative spread in β values of the different vibrational components is observed across both resonances. For the B state, a very different trend is observed for the high binding energy side and the low binding energy side of the related spectral feature as a function of photon energy. A theoretical method based on the scattering K matrix has been used to calculate both the photoabsorption spectrum and the β values, by taking both interference between direct and resonant photoemission and vibrational/lifetime interference into account. The numerical results show qualitative agreement with the trends detected in the experimental values and explain the conspicuous variations of the β values primarily in terms of coupling between direct and resonant photoemission by interaction terms of different sign for different final vibrational states.

  18. Structure of superhard tungsten tetraboride: a missing link between MB2 and MB12 higher borides.

    PubMed

    Lech, Andrew T; Turner, Christopher L; Mohammadi, Reza; Tolbert, Sarah H; Kaner, Richard B

    2015-03-17

    Superhard metals are of interest as possible replacements with enhanced properties over the metal carbides commonly used in cutting, drilling, and wear-resistant tooling. Of the superhard metals, the highest boride of tungsten--often referred to as WB4 and sometimes as W(1-x)B3--is one of the most promising candidates. The structure of this boride, however, has never been fully resolved, despite the fact that it was discovered in 1961--a fact that severely limits our understanding of its structure-property relationships and has generated increasing controversy in the literature. Here, we present a new crystallographic model of this compound based on refinement against time-of-flight neutron diffraction data. Contrary to previous X-ray-only structural refinements, there is strong evidence for the presence of interstitial arrangements of boron atoms and polyhedral bonding. The formation of these polyhedral--slightly distorted boron cuboctahedra--appears to be dependent upon the defective nature of the tungsten-deficient metal sublattice. This previously unidentified structure type has an intermediary relationship between MB2 and MB12 type boride polymorphs. Manipulation of the fractionally occupied metal and boron sites may provide insight for the rational design of new superhard metals.

  19. IAA transport in corn roots includes the root cap

    SciTech Connect

    Hasenstein, K.H. )

    1989-04-01

    In earlier reports we concluded that auxin is the growth regulator that controls gravicurvature in roots and that the redistribution of auxin occurs within the root cap. Since other reports did not detect auxin in the root cap, we attempted to confirm the IAA does move through the cap. Agar blocks containing {sup 3}H-IAA were applied to the cut surface of 5 mm long apical segments of primary roots of corn (mo17xB73). After 30 to 120 min radioactivity (RA) of the cap and root tissue was determined. While segments suspended in water-saturated air accumulated very little RA in the cap, application of 0.5 {mu}1 of dist. water to the cap (=controls) increased RA of the cap dramatically. Application to the cap of 0.5 {mu}1 of sorbitol or the Ca{sup 2+} chelator EGTA reduced cap RA to 46% and 70% respectively compared to water, without affecting uptake. Control root segments gravireacted faster than non-treated or osmoticum or EGTA treated segments. The data indicate that both the degree of hydration and calcium control the amount of auxin moving through the cap.

  20. Probing the Repulsive Core of the Nucleon-Nucleon Interaction via the 4He(e,e`pN) Triple-Coincidence Reaction

    DOE PAGES

    Korover, Igor; Muangma, Navaphon; Hen, Or; Shneor, Ran; Sulkosky, Vincent; Kelleher, Aidan; Gilad, Shalev; Higinbotham, Douglas; Piasetzky, Eliazer; Wood, Stephen; et al

    2014-07-01

    We studied simultaneously the 4He(e,e'p), 4He(e,e'pp), and 4He(e,e'pn) reactions at Q2=2 [GeV/c]2 and xB >1, for a (e,e'p) missing-momentum range of 400 to 830 MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum in a region where the nucleon-nucleon force is expected to change from predominantly tensor to repulsive. Neutron-proton pairs dominate the high-momentum tail ofmore » the nucleon momentum distributions, but their abundance is reduced as the nucleon momentum increases beyond ~500 MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum in the range we studied. Our data are compared with ab-initio calculations of two-nucleon momentum distributions in 4He.« less

  1. Generation of tunable ultrafast ultraviolet third harmonic by collinear compensation of group-velocity mismatch

    NASA Astrophysics Data System (ADS)

    Meng, Xianghao; Liu, Huagang; Huang, Jianhong; Wu, Hongchun; Deng, Jing; Dai, Shutao; Weng, Wen; Lin, Wenxiong

    2015-10-01

    We demonstrate a high efficient frequency tripling configuration of Ti: sapphire amplifier system for wavelength-tunable ultrafast ultraviolet laser generation. A new nonlinear crystal Ba1-xB2-y-zO4SixAlyGaz and a type-II phase-matched β-BaB2O4 crystal are employed for the second and the third harmonic generation, respectively. Significant improvement in conversion efficiency of frequency tripling is achieved by using a 65°-cut, 3-mm-long β-BaB2O4 crystal as the collinear group velocity compensation plate. Tunable ultraviolet pulse within the wavelength range from 256.7 to 276.7 nm have been produced, with a maximum average power of 212 mW, corresponding to a conversion efficiency of 8.48% for the third harmonic generation with 2.5 W fundamental power. The maximum pulse energy of the third harmonic is up to 0.21 mJ and it is estimated that the peak power is above 1 GW at 266.7 nm.

  2. Determination of lapachol in the presence of other naphthoquinones using 3MPA-CdTe quantum dots fluorescent probe

    NASA Astrophysics Data System (ADS)

    Aucélio, Ricardo Q.; Peréz-Cordovés, Ana I.; Xavier Lima, Juliano L.; Ferreira, Aurélio Baird B.; Esteva Guas, Ana M.; da Silva, Andrea R.

    3MPA-CdTe QDs in aqueous dispersion was used as a fluorescent probe for the determination of lapachol, a natural naphthoquinone found in plants of the Bignoniaceae family genus Tabebuia. Working QDs dispersions (4.5 × 10-8 mol L-1 of QDs) was prepared in aqueous media containing Tris-HCl buffer pH 7.4 and methanol (10% in volume). The excitation was made at 380 nm with signal measurement at 540 nm. To establish a relationship between fluorescence (corrected to inner filter effect) and concentration of lapachol, a Stern-Volmer model was used. The linear range obtained was from 1.0 × 10-5 to 1.0 × 10-4 mol L-1. The limit of detection (xb - 3 sb) was 8.0 × 10-6 mol L-1. The 3MPA-CdTe QDs probe was tested in the determination of lapachol in urine, previously cleansed in an acrylic polymer. The average recovery was satisfactory.

  3. Propulsion Flight Research at NASA Dryden From 1967 to 1997

    NASA Technical Reports Server (NTRS)

    Burcham, Frank W., Jr.; Ray, Ronald J.; Conners, Timothy R.; Walsh, Kevin R.

    1997-01-01

    From 1967 to 1997, pioneering propulsion flight research activities have been conceived and conducted at the NASA Dryden Flight Research Center. Many of these programs have been flown jointly with the United States Department of Defense, industry, or the Federal Aviation Administration. Propulsion research has been conducted on the XB-70, F-111 A, F-111E, YF-12, JetStar, B-720, MD-11, F-15, F- 104, Highly Maneuverable Aircraft Technology, F-14, F/A-18, SR-71, and the hypersonic X-15 airplanes. Research studies have included inlet dynamics and control, in-flight thrust computation, integrated propulsion controls, inlet and boattail drag, wind tunnel-to-flight comparisons, digital engine controls, advanced engine control optimization algorithms, acoustics, antimisting kerosene, in-flight lift and drag, throttle response criteria, and thrust-vectoring vanes. A computer-controlled thrust system has been developed to land the F-15 and MD-11 airplanes without using any of the normal flight controls. An F-15 airplane has flown tests of axisymmetric thrust-vectoring nozzles. A linear aerospike rocket experiment has been developed and tested on the SR-71 airplane. This paper discusses some of the more unique flight programs, the results, lessons learned, and their impact on current technology.

  4. Supersonic Flying Qualities Experience Using the SR-71

    NASA Technical Reports Server (NTRS)

    Cox, Timothy H.; Jackson, Dante

    1997-01-01

    Approximately 25 years ago NASA Dryden Flight Research Center, Edwards, California, initiated the evaluation of supersonic handling qualities issues using the XB-70 and the YF-12. Comparison of pilot comments and ratings with some of the classical handling qualities criteria for transport aircraft provided information on the usefulness of these criteria and insight into supersonic flying qualities issues. A second research study has recently been completed which again addressed supersonic flying qualities issues through evaluations of the SR-71 in flight at Mach 3. Additional insight into supersonic flying qualities issues was obtained through pilot ratings and comments. These ratings were compared with existing military specifications and proposed criteria for the High Speed Civil Transport. This paper investigates the disparity between pilot comments and the Neal/Smith criteria through a modification of the technique using vertical speed at the pilot station. The paper specifically addresses the pilot ability to control flightpath and pitch attitude in supersonic flight and pilot displays typical of supersonic maneuvering.

  5. Longitudinal Handling Qualities of the Tu-144LL Airplane and Comparisons With Other Large, Supersonic Aircraft

    NASA Technical Reports Server (NTRS)

    Cox, Timothy H.; Marshall, Alisa

    2000-01-01

    Four flights have been conducted using the Tu-144LL supersonic transport aircraft with the dedicated objective of collecting quantitative data and qualitative pilot comments. These data are compared with the following longitudinal flying qualities criteria: Neal-Smith, short-period damping, time delay, control anticipation parameter, phase delay (omega(sp)*T(theta(2))), pitch bandwidth as a function of time delay, and flight path as a function of pitch bandwidth. Determining the applicability of these criteria and gaining insight into the flying qualities of a large, supersonic aircraft are attempted. Where appropriate, YF-12, XB-70, and SR-71 pilot ratings are compared with the Tu-144LL results to aid in the interpretation of the Tu-144LL data and to gain insight into the application of criteria. The data show that approach and landing requirements appear to be applicable to the precision flightpath control required for up-and-away flight of large, supersonic aircraft. The Neal-Smith, control anticipation parameter, and pitch-bandwidth criteria tend to correlate with the pilot comments better than the phase delay criterion, omega(sp)*T(theta(2)). The data indicate that the detrimental flying qualities implication of decoupled pitch-attitude and flightpath responses occurring for high-speed flight may be mitigated by requiring the pilot to close the loop on flightpath or vertical speed.

  6. Design Criteria and Machine Integration of the Ignitor Experiment

    NASA Astrophysics Data System (ADS)

    Bianchi, A.; Coppi, B.

    2010-11-01

    High field, high density compact experiments are the only ones capable of producing, on the basis of available technology and knowledge of plasma physics, plasmas that can reach ignition conditions. The Ignitor machine (R01.32 m, a xb0.47x0.83 m^2, BT<=13 T, Ip<=11 MA) is characterized by a complete structural integration of its major components. A sophisticated Poloidal Field system provides the flexibility to produce the expected sequence of plasma equilibrium configurations during the plasma current and pressure rise. The structural concept of the machine is based on an optimized combination of ``bucking'' and ``wedging''. All components, with the exception of the vacuum vessel, are cooled before each plasma pulse by means of He gas, to an optimal temperature of 30 K, at which the ratio of the electrical resistivity to the specific heat of copper is minimum. The 3D and 2D design and integration of all the core machine components, including electro-fluidic and fluidic lines, has been produced using the Dassault CATIA-V software. A complete structural analysis has verified that the machine can withstand the forces produced for all the main operational scenarios.

  7. Fast targeted analysis of 132 acidic and neutral drugs and poisons in whole blood using LC-MS/MS.

    PubMed

    Di Rago, Matthew; Saar, Eva; Rodda, Luke N; Turfus, Sophie; Kotsos, Alex; Gerostamoulos, Dimitri; Drummer, Olaf H

    2014-10-01

    The aim of this study was to develop an LC-MS/MS based screening technique that covers a broad range of acidic and neutral drugs and poisons by combining a small sample volume and efficient extraction technique with simple automated data processing. After protein precipitation of 100μL of whole blood, 132 common acidic and neutral drugs and poisons including non-steroidal anti-inflammatory drugs, barbiturates, anticonvulsants, antidiabetics, muscle relaxants, diuretics and superwarfarin rodenticides (47 quantitated, 85 reported as detected) were separated using a Shimadzu Prominence HPLC system with a C18 separation column (Kinetex XB-C18, 4.6mm×150mm, 5μm), using gradient elution with a mobile phase of 25mM ammonium acetate buffer (pH 7.5)/acetonitrile. The drugs were detected using an ABSciex(®) API 2000 LC-MS/MS system (ESI+ and -, MRM mode, two transitions per analyte). The method was fully validated in accordance with international guidelines. Quantification data obtained using one-point calibration compared favorably to that using multiple calibrants. The presented LC-MS/MS assay has proven to be applicable for determination of the analytes in blood. The fast and reliable extraction method combined with automated processing gives the opportunity for high throughput and fast turnaround times for forensic and clinical toxicology.

  8. Hidden-beauty charged tetraquarks and heavy quark spin conservation

    NASA Astrophysics Data System (ADS)

    Ali, A.; Maiani, L.; Polosa, A. D.; Riquer, V.

    2015-01-01

    Assuming the dominance of the spin-spin interaction in a diquark, we point out that the mass difference in the beauty sector M (Zb')±-M (Zb)± scales with quark masses as expected in QCD, with respect to the corresponding mass difference M (Zc')±-M (Zc)± . Notably, we show that the decays ϒ (10890 )→ϒ (n S )π+π- and ϒ (10890 )→(hb(1 P ),hb(2 P ))π+π- are compatible with heavy quark spin conservation if the contributions of Zb,Zb' intermediate states are taken into account, ϒ (10890 ) being either a ϒ (5 S ) or the beauty analog of Yc(4260 ). Belle results on these decays support the quark spin wave function of the Z states as tetraquarks. We also consider the role of light quark spin nonconservaton in Zb,Zb' decays into B B* and B*B*. Indications of possible signatures of the still missing Xb resonance are proposed.

  9. Fifty Years of Flight Research: An Annotated Bibliography of Technical Publications of NASA Dryden Flight Research Center, 1946-1996

    NASA Technical Reports Server (NTRS)

    Fisher, David F.

    1999-01-01

    Titles, authors, report numbers, and abstracts are given for more than 2200 unclassified and unrestricted technical reports and papers published from September 1946 to December 1996 by NASA Dryden Flight Research Center and its predecessor organizations. These technical reports and papers describe and give the results of 50 years of flight research performed by the NACA and NASA, from the X-1 and other early X-airplanes, to the X-15, Space Shuttle, X-29 Forward Swept Wing, and X-31 aircraft. Some of the other research airplanes tested were the D-558, phase 1 and 2; M-2, HL-10 and X-24 lifting bodies; Digital Fly-By-Wire and Supercritical Wing F-8; XB-70; YF-12; AFTI F-111 TACT and MAW; F-15 HiDEC; F-18 High Alpha Research Vehicle, and F-18 Systems Research Aircraft. The citations of reports and papers are listed in chronological order, with author and aircraft indices. In addition, in the appendices, citations of 233 contractor reports, more than 200 UCLA Flight System Research Center reports and 25 video tapes are included.

  10. Profiles of electron temperature and Bz along Earth's magnetotail

    NASA Astrophysics Data System (ADS)

    Artemyev, A. V.; Petrukovich, A. A.; Nakamura, R.; Zelenyi, L. M.

    2013-06-01

    We study the electron temperature distribution and the structure of the current sheet along the magnetotail using simultaneous observations from THEMIS spacecraft. We perform a statistical study of 40 crossings of the current sheet when the three spacecraft THB, THC, and THD were distributed along the tail in the vicinity of midnight with coordinates XB \\in [-30 RE, -20 RE], XC \\in [-20 RE, -15 RE], and XD ~ -10 RE. We obtain profiles of the average electron temperature \\mlab Te\\mrab and the average magnetic field \\mlab Bz\\mrab along the tail. Electron temperature and \\mlab Bz\\mrab increase towards the Earth with almost the same rates (i.e., ratio \\mlab Te\\mrab/\\mlab Bz\\mrab ≈ 2 keV/7 nT is approximately constant along the tail). We also use statistics of 102 crossings of the current sheet from THB and THC to estimate dependence of Te and Bz distributions on geomagnetic activity. The ratio \\mlab Te \\mrab/\\mlab Bz\\mrab depends on geomagnetic activity only slightly. Additionally we demonstrate that anisotropy of the electron temperature \\mlab T∥/T⊥\\mrab ≈ 1.1 is almost constant along the tail for X \\in [-30 RE, -10 RE].

  11. Test pilots 1962 - Thompson, McKay, Dana, Armstrong, Peterson, Butchart, Walker

    NASA Technical Reports Server (NTRS)

    1962-01-01

    A group photo of NASA research pilots at the front door of the Flight Research Center headquarters building. In the front row are (left to right) Milt Thompson, Jack McKay, and Bill Dana. All three flew the X-15, and Thompson and Dana were also involved in the lifting body flights. McKay was injured in a crash landing in X-15 #2. Although he recovered, the injuries eventually forced him to retire from research flying. In the back row (left to right) are Neil Armstrong, Bruce Peterson, Stanley Butchart, and Joe Walker. Armstrong and Walker also both flew the X-15. Soon after this photo was taken, Armstrong was selected as an astronaut, and seven years later became the first man to walk on the Moon. Walker made the highest flight in the X-15, reaching 354,200 feet. He then went on to fly the Lunar Landing Research Vehicle, and was killed on June 8, 1966 when his F-104N collided with the XB-70. Peterson made the first flight in the HL-10 lifting body, and was later badly injured in the crash of the M2-F2 lifting body. Butchart flew a wide range of research missions in the 1950s, and was the B-29 drop plane pilot for a number of rocket flight.

  12. Enhanced critical current properties observed in Na2CO3-doped MgB2

    NASA Astrophysics Data System (ADS)

    Ueda, Shinya; Shimoyama, Jun-ichi; Yamamoto, Akiyasu; Horii, Shigeru; Kishio, Kohji

    2004-07-01

    A significant improvement of the critical current properties in MgB2 bulk has been attained by sodium carbonate doping. A series of Mg1-2xB2(Na2CO3)x bulk samples with x = 0-0.1 were prepared by solid-state reaction in sealed stainless tubes. Both the critical current density, Jc, and irreversibility field, Hirr, at 20 K were systematically improved up to x = 0.055 and decreased monotonically by excess doping, while their Tcs were continuously decreased with an increase of x. The sample with x = 0.055, having a slightly decreased Tc of 37.6 K, recorded the best critical current performance at 20 K with Jc of 3.8 × 105 A cm-2 in self-field and mgr0Hirr of approximately 6 T. Both small particles of MgO and a carbon-containing local region, Mg(B,C)2, are believed to act as effective pinning centres, resulting in an enhancement of the flux pinning force. In addition, the coherence length xgr of the MgB2 was dramatically shortened by sodium carbonate doping, and consequently the mgr0Hc 2 was enhanced to approximately 29 T at the highest doping level of x = 0.10.

  13. Correlated random walk on lattices. II. Tracer diffusion through a two-component dynamic background

    NASA Astrophysics Data System (ADS)

    Tahir-Kheli, R. A.

    1983-06-01

    A detailed calculation of frequency- and wave-vector-dependent correlation functions for an arbitrary tracer diffusing in a regular crystal against a background of hopping classical particles has recently been given by Tahir-Kheli and Elliott

    [Phys. Rev. B 27, 844 (1983)]
    . Here we present an important generalization of this work to a system with a dynamic background consisting of two arbitrary species of particles. In particular, the generalization includes a system where the tracer concentration itself is finite while an arbitrary concentration of other atoms is also present in the dynamic stream. The theory is exact to the leading nontrivial order in particle concentration xA and xB. In the intermediate-concentration regime, the theory incorporates dominant fluctuations from the mean field. The present model can serve to usefully describe incoherent neutron scattering in metal-hydride interstitial solutions such as MAxABxB with A,B≡H, D, and T and M≡Pd and Ti. Moreover, it can be used to treat tracer diffusion dynamics in nonstoichiometric metal oxides and, somewhat more simplistically, ionic conduction in the superionic state.

  14. Performance Evaluation Method for Dissimilar Aircraft Designs

    NASA Technical Reports Server (NTRS)

    Walker, H. J.

    1979-01-01

    A rationale is presented for using the square of the wingspan rather than the wing reference area as a basis for nondimensional comparisons of the aerodynamic and performance characteristics of aircraft that differ substantially in planform and loading. Working relationships are developed and illustrated through application to several categories of aircraft covering a range of Mach numbers from 0.60 to 2.00. For each application, direct comparisons of drag polars, lift-to-drag ratios, and maneuverability are shown for both nondimensional systems. The inaccuracies that may arise in the determination of aerodynamic efficiency based on reference area are noted. Span loading is introduced independently in comparing the combined effects of loading and aerodynamic efficiency on overall performance. Performance comparisons are made for the NACA research aircraft, lifting bodies, century-series fighter aircraft, F-111A aircraft with conventional and supercritical wings, and a group of supersonic aircraft including the B-58 and XB-70 bomber aircraft. An idealized configuration is included in each category to serve as a standard for comparing overall efficiency.

  15. Kernels and point processes associated with Whittaker functions

    NASA Astrophysics Data System (ADS)

    Blower, Gordon; Chen, Yang

    2016-09-01

    This article considers Whittaker's confluent hypergeometric function Wκ,μ where κ is real and μ is real or purely imaginary. Then φ(x) = x-μ-1/2Wκ,μ(x) arises as the scattering function of a continuous time linear system with state space L2(1/2, ∞) and input and output spaces C. The Hankel operator Γφ on L2(0, ∞) is expressed as a matrix with respect to the Laguerre basis and gives the Hankel matrix of moments of a Jacobi weight w0(x) = xb(1 - x)a. The operation of translating φ is equivalent to deforming w0 to give wt(x) = e-t/xxb(1 - x)a. The determinant of the Hankel matrix of moments of wɛ satisfies the σ form of Painlevé's transcendental differential equation PV. It is shown that Γφ gives rise to the Whittaker kernel from random matrix theory, as studied by Borodin and Olshanski [Commun. Math. Phys. 211, 335-358 (2000)]. Whittaker kernels are closely related to systems of orthogonal polynomials for a Pollaczek-Jacobi type weight lying outside the usual Szegö class.

  16. Universal Associated Legendre Polynomials and Some Useful Definite Integrals

    NASA Astrophysics Data System (ADS)

    Chen, Chang-Yuan; You, Yuan; Lu, Fa-Lin; Sun, Dong-Sheng; Dong, Shi-Hai

    2016-08-01

    We first introduce the universal associated Legendre polynomials, which are occurred in studying the non-central fields such as the single ring-shaped potential and then present definite integrals IA ±(a, τ) = ∫-1 +1 xa[Pl‧ m‧ (x)]2/(1 ± x)τ dx, a = 0, 1, 2, 3, 4, 5, 6, τ = 1, 2, 3, IB(b, σ) = ∫-1 +1 xb[Pl‧ m‧ (x)]2/(1 - x2)σ dx, b = 0, 2, 4, 6, 8, σ = 1, 2, 3, and IC ±(c, κ) = ∫-1 +1 xc[Pl‧ m‧ (x)]2/[(1 - x2)κ (1 ± x)] dx, c = 0, 1, 2, 3, 4, 5, 6, 7, 8, κ = 1, 2. The superindices “±” in IA ±(a, τ) and IC ± (c, κ) correspond to those of the factor (1 ± x) involved in weight functions. The formulas obtained in this work and also those for integer quantum numbers l‧ and m‧ are very useful and unavailable in classic handbooks. Supported by the National Natural Science Foundation of China under Grant No. 11275165 and partially by 20160978-SIP-IPN, Mexico.

  17. E00-110 experiment at Jefferson Lab Hall A: Deeply virtual Compton scattering off the proton at 6 GeV

    NASA Astrophysics Data System (ADS)

    Defurne, M.; Amaryan, M.; Aniol, K. A.; Beaumel, M.; Benaoum, H.; Bertin, P.; Brossard, M.; Camsonne, A.; Chen, J.-P.; Chudakov, E.; Craver, B.; Cusanno, F.; de Jager, C. W.; Deur, A.; Feuerbach, R.; Ferdi, C.; Fieschi, J.-M.; Frullani, S.; Fuchey, E.; Garçon, M.; Garibaldi, F.; Gayou, O.; Gavalian, G.; Gilman, R.; Gomez, J.; Gueye, P.; Guichon, P. A. M.; Guillon, B.; Hansen, O.; Hayes, D.; Higinbotham, D.; Holmstrom, T.; Hyde, C. E.; Ibrahim, H.; Igarashi, R.; Jiang, X.; Jo, H. S.; Kaufman, L. J.; Kelleher, A.; Keppel, C.; Kolarkar, A.; Kuchina, E.; Kumbartzki, G.; Laveissière, G.; LeRose, J. J.; Lindgren, R.; Liyanage, N.; Lu, H.-J.; Margaziotis, D. J.; Mazouz, M.; Meziani, Z.-E.; McCormick, K.; Michaels, R.; Michel, B.; Moffit, B.; Monaghan, P.; Muñoz Camacho, C.; Nanda, S.; Nelyubin, V.; Paremuzyan, R.; Potokar, M.; Qiang, Y.; Ransome, R. D.; Réal, J.-S.; Reitz, B.; Roblin, Y.; Roche, J.; Sabatié, F.; Saha, A.; Sirca, S.; Slifer, K.; Solvignon, P.; Subedi, R.; Sulkosky, V.; Ulmer, P. E.; Voutier, E.; Wang, K.; Weinstein, L. B.; Wojtsekhowski, B.; Zheng, X.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2015-11-01

    We present final results on the photon electroproduction (e ⃗p →e p γ ) cross section in the deeply virtual Compton scattering (DVCS) regime and the valence quark region from Jefferson Lab experiment E00-110. Results from an analysis of a subset of these data were published before, but the analysis has been improved, which is described here at length, together with details on the experimental setup. Furthermore, additional data have been analyzed, resulting in photon electroproduction cross sections at new kinematic settings for a total of 588 experimental bins. Results of the Q2 and xB dependencies of both the helicity-dependent and the helicity-independent cross sections are discussed. The Q2 dependence illustrates the dominance of the twist-2 handbag amplitude in the kinematics of the experiment, as previously noted. Thanks to the excellent accuracy of this high-luminosity experiment, it becomes clear that the unpolarized cross section shows a significant deviation from the Bethe-Heitler process in our kinematics, compatible with a large contribution from the leading twist-2 DVCS2 term to the photon electroproduction cross section. The necessity to include higher-twist corrections to fully reproduce the shape of the data is also discussed. The DVCS cross sections in this paper represent the final set of experimental results from E00-110, superseding the previous publication.

  18. Deeply Virtual Pseudoscalar Meson Production at Jefferson Lab and Transversity GPDs

    NASA Astrophysics Data System (ADS)

    Kubarovsky, Valery

    2016-02-01

    The cross section of the exclusive π0 and η electroproduction reaction ep → e‧p‧π0/η was measured at Jefferson Lab with a 5.75-GeV electron beam and the CLAS detector. Differential cross sections d4σ/dtdQ2dx Bdϕπ and structure functions σT + ɛσL,σTT and σLT as functions of t were obtained over a wide range of Q2 and xB. The data are compared with the GPD based theoretical models. Analyses find that a large dominance of transverse processes is necessary to explain the experimental results. Generalized form factors of the transversity GPDs π,η and <ĒT>π,η were directly extracted from the experimental observables for the first time. It was found that GPD ĒT dominates in pseudoscalar meson production. The combined π0 and η data opens the way for the flavor decomposition of the transversity GPDs. The first ever evaluation of this decomposition was demonstrated.

  19. Photoluminescence of CuInS2 nanocrystals: effect of surface modification

    NASA Astrophysics Data System (ADS)

    Kim, Young-Kuk; Cho, Young-Sang; Chung, Kookchae; Choi, Chul-Jin

    2011-09-01

    We have synthesized highly luminescent Cu-In-S(CIS) nanocrystals (NCs) by heating the mixture of metal carboxylates and alkylthiol under inert atmosphere. We modified the surface of CIS NCs with zinc carboxylate and subsequent injection of alkylthiol. As a result of the surface modification, highly luminescent CIS@ZnS core/shell nanocrystals were synthesized. The luminescence quantum yield (QY) of best CIS@ZnS NCs was above 50%, which is 10 times higher than the initial QY of CIS NCs before surface modification (QY=3%). Detailed study on the luminescence mechanism implies that etching of the surface of NCs by dissociated carboxylate group (CH3COO-) and formation of epitaxial shell by Zn with sulfur from alkylthiol efficiently removed the surface defects which are known to be major non-radiative recombination sites in semiconductor nanocrystals. In this study, we developed a novel surface modification route for monodispersed highly luminescent Cu-In-S NCs with less toxic and highly stable precursors. Investigation with the timeand the temperature-dependent photoluminescence showed that the trap related emission was minimized by surface modification and the donor-acceptor pair recombination was enhanced by controlling copper stoichiometry.xb

  20. Vibrational energies for the X1A1, A1B1, and B1A1 states of SiH2/SiD2 and related transition probabilities based on global potential energy surfaces.

    PubMed

    Tokue, Ikuo; Yamasaki, Katsuyoshi; Nanbu, Shinkoh

    2005-04-01

    Transition probabilities were evaluated for the X(1)A(1)-A(1)B(1) and A(1)B(1)-B(1)A(1) systems of SiH(2) and SiD(2) to analyze the X-->A-->B photoexcitation. The Franck-Condon factors (FCFs) and Einstein's B coefficients were computed by quantum vibrational calculations using the three-dimensional potential energy surfaces (PESs) of the SiH(2)(X(1)A(1),A(1)B(1),B(1)A(1)) electronic states and the electronic transition moments for the X-A, X-B, and A-B system. The global PESs were determined by the multireference configuration interaction calculations with the Davidson correction and the interpolant moving least-squares method combined with the Shepard interpolation. The obtained FCFs for the X-A and A-B systems exhibit that the bending mode is strongly enhanced in the excitation since the equilibrium bond angle greatly varies with the three states; the barrier to linearity is evaluated to be 21,900 cm(-1) for the X state, 6400 cm(-1) for the A state, and 230-240 cm(-1) for the B state. The theoretical lifetimes for the pure bending levels of the A and B states were calculated from the fluorescence decay rates for the A-X, B-A, and B-X emissions.

  1. NIR luminescence studies on Er3+:Yb3+ co-doped sodium telluroborate glasses for lasers and optical amplifer applications

    NASA Astrophysics Data System (ADS)

    Annapoorani, K.; Murthy, N. Suriya; Marimuthu, K.

    2016-05-01

    Er3+:Yb3+ co-doped Sodium telluroborate glasses were prepared with the chemical composition (49.5-x)B2O3+25TeO2+5Li2CO3+10ZnO+10NaF+0.5Er2O3+xYb2O3 (where x= 0.1, 0.5, 1.0 and 2.0 in mol %) following the melt quenching technique. With the addition of Yb3+ ions into Er3+ ions in the prepared glasses, the absorption cross-section values were found to increase due to the effective energy transfer from 2F5/2 level of Yb3+ ions to the 4I11/2 level of Er3+ ions. The fluorescence around 1550 nm correspond to the 4I13/2→4I15/2 transition was observed under 980 nm pumping. Among the present glasses, integrated intensity was found to be higher for 1.0 mol% Yb3+ ion glass. The parameters such as stimulated emission cross- section, Gain bandwidth and quantum efficiency of the 4I13/2→4I15/2 transition was found to be higher for the NTBE1.0Y glass and the same is suggested for potential NIR lasers and optical amplifier applications.

  2. Interventricular comparison of the energetics of contraction of trabeculae carneae isolated from the rat heart

    PubMed Central

    Han, June-Chiew; Taberner, Andrew J; Nielsen, Poul M F; Loiselle, Denis S

    2013-01-01

    We compare the energetics of right ventricular and left ventricular trabeculae carneae isolated from rat hearts. Using our work-loop calorimeter, we subjected trabeculae to stress-length work (W), designed to mimic the pressure–volume work of the heart. Simultaneous measurement of heat production (Q) allowed calculation of the accompanying change of enthalpy (ΔH=W+Q). From the mechanical measurements (i.e. stress and change of length), we calculated work, shortening velocity and power. In combination with heat measurements, we calculated activation heat (QA), crossbridge heat (Qxb) and two measures of cardiac efficiency: ‘mechanical efficiency’ (ɛmech=W/ΔH) and ‘crossbridge efficiency’ (ɛxb=W/(ΔH–QA)). With respect to their left ventricular counterparts, right venticular trabeculae have higher peak shortening velocity, and higher peak mechanical efficiency, but with no difference of stress development, twitch duration, work performance, shortening power or crossbridge efficiency. That is, the 35% greater maximum mechanical efficiency of right venticular than left ventricular trabeculae (13.6 vs. 10.2%) is offset by the greater metabolic cost of activation (QA) in the latter. When corrected for this difference, crossbridge efficiency does not differ between the ventricles. PMID:23184511

  3. Chandra and XMM-Newton identify ~50 black hole binary candidates in M31

    NASA Astrophysics Data System (ADS)

    Barnard, Robin; Primini, F.; Murray, S. S.; Garcia, M. R.

    2014-01-01

    We have identified ~50 X-ray binaries (XBs) containing black hole candidates in M31, falling into two groups. The first group exhibited characteristic "hard state" properties at luminosities that exceed the upper threshold for neutron star (NS) XBs; furthermore, their long-term variability, proximity to a globular cluster, or particularly high flux meant that they were highly unlikely to be background galaxies. The second group consists of bright transient X-ray sources that resemble Galactic black hole binaries with low mass donors. A double thermal (disk blackbody + blackbody) emission model has successfully described the full gamut of NS XB spectra, with two exceptions: the hard state, and the horizontal branch of the "Z-source" subclass of NS XBs. Since many of our BHCs are apparently in the hard state, they exist outside the NS parameter space when fitted with the double thermal model. Furthermore, transient BH XBs often exhibit a "thermally dominated" state in outburst that is never observed in NS XBs. For each of our BHCs we estimate the probabiliy that its emission spectrum is consistent with the NS parameter space: BHCs with probability < 0.27% of being consistent with a NS spectrum (equivalent to 3σ difference) are rated as Strong BHCs, and the others are "plausible" BHCs.

  4. Measurement of transparency ratios for protons from short-range correlated pairs

    SciTech Connect

    Hen, O.; Hakobyan, Hayk; Shneor, Ran; Piasetzky, Eliazer Israel; Weinstein, Lawrence B.

    2013-05-01

    Nuclear transparency, T{sub p}(A), is a measure of the average probability for a struck proton to escape the nucleus without significant re-interaction. Previously, nuclear transparencies were extructed for quasi-elastic A(e,e'p) knockout of protons with momentum below the Fermi momentum, where the spectral functions are well known. In this paper we extract a novel observable, the transparency ratio, T{sub p}(A)/T{sub p}({sup 12}C), for knockout of high-missing-momentum protons from the breakup of short range correlated pairs (2N-SRC) in Al, Fe and Pb nuclei relative to C. The ratios were measured at momentum transfer Q^2 > 1.5 (GeV/c)^2 and x_B > 1.2 where the reaction is expected to be dominated by electron scattering from 2N-SRC. The transparency ratios of the knocked-out protons coming from 2N-SRC breakup are 20 - 30% lower than those of previous results for low missing momentum. They agree with Glauber calculations and agree with renormalization of the previously published transparencies as proposed by recent theoretical investigations. The new transparencies scale as A^-1/3, which is consistent with dominance of scattering from nucleons at the nuclear surface.

  5. Deeply virtual Compton Scattering cross section measured with CLAS

    SciTech Connect

    Guegan, Baptistse

    2014-09-01

    The Generalized Parton Distributions (GPDs) provide a new description of nucleon structure in terms of its elementary constituents, the quarks and the gluons. Including and extending the information provided by the form factors and the parton distribution functions, they describe the correlation between the transverse position and the longitudinal momentum fraction of the partons in the nucleon. Deeply Virtual Compton Scattering (DVCS), the electroproduction of a real photon on a single quark in the nucleon eN --> e'N'g, is the exclusive process most directly interpretable in terms of GPDs. A dedicated experiment to study DVCS with the CLAS detector at Jefferson Lab has been carried out using a 5.9-GeV polarized electron beam and an unpolarized hydrogen target, allowing us to collect DVCS events in the widest kinematic range ever explored in the valence region : 1.0 < Q2 < 4.6 GeV2, 0.1 < xB < 0.58 and 0.09 < -t < 2.0 GeV2. In this paper, we show preliminary results of unpolarized cross sections and of polarized cross section differences for the DVCS channel.

  6. The Autoignition of Tetralin, an Endothermic Fuel

    NASA Astrophysics Data System (ADS)

    Gerken, William James

    The history of the evolution of jet fuel, starting with JP-1 in the early 1950s and resulting in JP-8-100 is presented. The importance of fuel properties from a perspective of balancing availability, cost, and performance is illustrated with insight from the XB-70, SR-71, and U-2. Current jet fuel advancements are discussed, and found to revolve around the need for increased heat capacity for high speed aircraft. Benefits of increased thermal management, such as reduced emissions, engine weight, and increased performance are also discussed. Endothermic fuels, which undergo controlled pyrolysis at high temperatures reduce the formation of coke through hydrogen donation, and absorb energy in their pyrolysis reaction. Due to the potential applications of tetralin, an endothermic hydrocarbon, as an additive or fuel to increase the capacity of aircraft fuels to absorb energy, the ignition delay characteristics of tetralin are experimentally investigated and compared with other fuels containing aromatic and naphthenic functionalities. Future work should focus on developing a kinetic model to describe tetralin oxidation and ignition for use in combustion simulations.

  7. Atypical Exciton-Phonon Interactions in WS2 and WSe2 Monolayers Revealed by Resonance Raman Spectroscopy.

    PubMed

    Del Corro, E; Botello-Méndez, A; Gillet, Y; Elias, A L; Terrones, H; Feng, S; Fantini, C; Rhodes, Daniel; Pradhan, N; Balicas, L; Gonze, X; Charlier, J-C; Terrones, M; Pimenta, M A

    2016-04-13

    Resonant Raman spectroscopy is a powerful tool for providing information about excitons and exciton-phonon coupling in two-dimensional materials. We present here resonant Raman experiments of single-layered WS2 and WSe2 using more than 25 laser lines. The Raman excitation profiles of both materials show unexpected differences. All Raman features of WS2 monolayers are enhanced by the first-optical excitations (with an asymmetric response for the spin-orbit related XA and XB excitons), whereas Raman bands of WSe2 are not enhanced at XA/B energies. Such an intriguing phenomenon is addressed by DFT calculations and by solving the Bethe-Salpeter equation. These two materials are very similar. They prefer the same crystal arrangement, and their electronic structure is akin, with comparable spin-orbit coupling. However, we reveal that WS2 and WSe2 exhibit quite different exciton-phonon interactions. In this sense, we demonstrate that the interaction between XC and XA excitons with phonons explains the different Raman responses of WS2 and WSe2, and the absence of Raman enhancement for the WSe2 modes at XA/B energies. These results reveal unusual exciton-phonon interactions and open new avenues for understanding the two-dimensional materials physics, where weak interactions play a key role coupling different degrees of freedom (spin, optic, and electronic). PMID:26998817

  8. Several Salmonella enterica subsp. enterica Serotype 4,5,12:i:− Phage Types Isolated from Swine Samples Originate from Serotype Typhimurium DT U302

    PubMed Central

    de la Torre, E.; Zapata, D.; Tello, M.; Mejía, W.; Frías, N.; García Peña, F. J.; Mateu, E. M.; Torre, E.

    2003-01-01

    Pulsed-field gel electrophoresis, plasmid profiling, and phage typing were used to characterize and determine possible genetic relationships between 48 Salmonella enterica subsp. enterica isolates of pig origin collected in Catalonia, Spain, from 1998 to 2000. The strains were grouped into 23 multidrug-resistant fljB-lacking S. enterica serovar 4,5,12:i:− isolates, 24 S. enterica serovar Typhimurium isolates, and 1 S. enterica serovar 4,5,12:−:− isolate. After combining the XbaI and BlnI macrorestriction profiles (XB profile), we observed 29 distinct subtypes which were grouped into seven main patterns. All 23 of the 4,5,12:i:− serovar strains and 10 serovar Typhimurium isolates were found to have pattern AR, and similarities of >78% were detected among the subtypes. Three of the serovar Typhimurium DT U302 strains (strains T3, T4, and T8) were included in the same 4,5,12:i:− serovar cluster and shared a plasmid profile (profile I) and a pattern of multidrug resistance (resistance to ampicillin, chloramphenicol, streptomycin, sulfonamide, tetracycline, gentamicin, and trimethoprim-sulfamethoxazole) commonly found in monophasic isolates. This led us to the conclusion that strains of the S. enterica 4,5,12:i:− serovar might have originated from an S. enterica serovar Typhimurium DT U302 strain. PMID:12791855

  9. Crystallographic and Mössbauer investigations on Np1- xPuxB2

    NASA Astrophysics Data System (ADS)

    Chipaux, R.; Bonnisseau, D.; Bogé, M.; Larroque, J.

    1988-08-01

    The diborides of neptunium and plutonium and their solid solutions Np 1- xPu xB 2 have been synthesized by direct reaction with a good purity. The lattice parameters follow Vegard's law. The magnetic properties of the samples containing neptunium have been investigated by Mössbauer spectrometry. The isomer shift is almost constant in all compounds (-14.5 (0.2) mm/s resp. to NpAl 2), suggesting tetravalent Np ions. At high temperatures, a large quadrupolar interaction, clearly connected to the crystal structure, is observed in all compounds, decreasing slowly with the neptunium concentration. At low temperature, magnetic patterns appear for x ⩽ 0.5. The magnetic moments are ordered perpendicular to the c-axis and equal to 0.57μ B for x = 0. In Np 0.5Pu 0.5B 2 and, in less degree in Np 0.7Pu 0.3B 2 and Np 0.33Pu 0.67B 2, magnetic fluctuations are detec ted.

  10. Effect of TeO 2 on the elastic moduli of sodium borate glasses

    NASA Astrophysics Data System (ADS)

    Saddeek, Yasser B.; Latif, Lamia. Abd El

    2004-05-01

    Sodium borate glass containing tellurite as Te xNa 2-2 xB 4-4 xO 7-5 x with x=0, 0.05, 0.15, 0.25 and 0.35 have been prepared by rapid quenching. Ultrasonic velocity (both longitudinal and shear) measurements have been made using a transducer operated at the fundamental frequency of 4 MHz at room temperature. The density was measured by the conventional Archimedes method. The elastic moduli, the Debye temperature, Poisson's ratio, and the parameters derived from the Makishima-Mackenzie model and the bond compression model have been obtained as a function of TeO 2 content. The monotonic decrease in the velocities and the elastic moduli, and the increase in the ring diameter and the ratio Kbc/ Ke as a function of TeO 2 modifier content reveals the loose packing structure, which is attributed to the increase in the molar volume and the reduction in the vibrations of the borate lattice. The observed results confirm that the addition of TeO 2 changes the rigid character of Na 2B 4O 7 to a matrix of ionic behaviour bonds (NBOs). This is due to the creation of more and more discontinuities and defects in the glasses, thus breaking down the borax structure.

  11. Structural properties of Bi2O3-B2O3-SiO2-Na2O glasses for gamma ray shielding applications

    NASA Astrophysics Data System (ADS)

    Kaur, Kulwinder; Singh, K. J.; Anand, Vikas

    2016-03-01

    Glass samples of the xBi2O3-(0.70-x)B2O3-0.15SiO2-0.15Na2O (where x=0 up to 0.5 mol fraction) have been prepared in the laboratory by using melt quenching technique. 137Cs source has been used for experimental measurements of mass attenuation coefficient of γ-rays at 662 keV. Mass attenuation coefficient of our glass samples has been compared with standard nuclear radiation shield "barite concrete". It has been concluded that bismuth containing glass samples can be potential candidates for γ-ray shielding applications. Glasses must have appreciable elastic moduli values for their practical utility as γ-ray shields which are related to coordination number and non-bridging oxygens. Structural properties including coordination number and non-bridging oxygens of the structural units of the glass system have been estimated from the detailed analysis of Optical, Raman and FTIR spectra. Reported investigations can contribute to the development of transparent gamma ray shields.

  12. Spin Asymmetry Measurements for Deeply Virtual Compton Scattering on Polarized Protons

    NASA Astrophysics Data System (ADS)

    Seder, Erin; CLAS Collaboration

    2013-10-01

    Generalized Parton Distributions (GPDs) have emerged as a universal tool to describe hadrons, particularly nucleons, in terms of their elementary constituents, quarks and gluons. Spin asymmetry measurements in the reaction e --> p --> --> ep γ, such as the proton target spin asymmetry which is directly proportional to the imaginary part of the Deeply Virtual Compton Scattering amplitude, give access to different combinations of GPDs. Combined measurements of proton target spin asymmetry (TSA), electron beam helicity asymmetry (BSA), and electron-proton double spin asymmetry (DSA) at the same kinematic points allows access to GPDs through a semi-model independent extraction of Compton Form Factors (CFFs). Preliminary TSA, BSA, and DSA studies for the reaction e --> p --> --> ep γ and extracted CFFs will be presented from a dedicated experiment at Jefferson Lab using the CEBAF 6 GeV polarized electron beam, a polarized solid state 14 NH3 target, and the CEBAF Large Acceptance Spectrometer (CLAS) equipped with an additional Inner Calorimeter (IC). The accessible kinematic range for these measurements covers 1 < Q2 < 4.5 GeV2, 0.1 < xB < 0.58, and 0.08 < - t < 1.8 GeV2.

  13. Identification of qRL7, a major quantitative trait locus associated with rice root length in hydroponic conditions

    PubMed Central

    Wang, Huimin; Xu, Xiaoming; Zhan, Xiaodeng; Zhai, Rongrong; Wu, Weiming; Shen, Xihong; Dai, Gaoxing; Cao, Liyong; Cheng, Shihua

    2013-01-01

    Root system development is an important target for improving yield in rice. Active roots that can take up nutrients more efficiently are essential for improving grain yield. In this study, we performed quantitative trait locus (QTL) analyses using 215 recombinant inbred lines derived from a cross between Xieqingzao B (XB), a maintainer line with short roots and R9308, a restorer line with long roots. Only a QTLs associated with root length were mapped on chromosomes 7. The QTL, named qRL7, was located between markers RM3859 and RM214 on chromosome 7 and explained 18.14–18.36% of the total phenotypic variance evaluated across two years. Fine mapping of qRL7 using eight BC3F3 recombinant lines mapped the QTL to between markers InDel11 and InDel17, which delimit a 657.35 kb interval in the reference cultivar Nipponbare. To determine the genotype classes for the target QTL in these BC3F3 recombinants, the root lengths of their BC3F4 progeny were investigated, and the result showed that qRL7 plays a crucial role in root length. The results of this study will increase our understanding of the genetic factors controlling root architecture, which will help rice breeders to breed varieties with deep, strong and vigorous root systems. PMID:24273421

  14. Identification of qRL7, a major quantitative trait locus associated with rice root length in hydroponic conditions.

    PubMed

    Wang, Huimin; Xu, Xiaoming; Zhan, Xiaodeng; Zhai, Rongrong; Wu, Weiming; Shen, Xihong; Dai, Gaoxing; Cao, Liyong; Cheng, Shihua

    2013-09-01

    Root system development is an important target for improving yield in rice. Active roots that can take up nutrients more efficiently are essential for improving grain yield. In this study, we performed quantitative trait locus (QTL) analyses using 215 recombinant inbred lines derived from a cross between Xieqingzao B (XB), a maintainer line with short roots and R9308, a restorer line with long roots. Only a QTLs associated with root length were mapped on chromosomes 7. The QTL, named qRL7, was located between markers RM3859 and RM214 on chromosome 7 and explained 18.14-18.36% of the total phenotypic variance evaluated across two years. Fine mapping of qRL7 using eight BC3F3 recombinant lines mapped the QTL to between markers InDel11 and InDel17, which delimit a 657.35 kb interval in the reference cultivar Nipponbare. To determine the genotype classes for the target QTL in these BC3F3 recombinants, the root lengths of their BC3F4 progeny were investigated, and the result showed that qRL7 plays a crucial role in root length. The results of this study will increase our understanding of the genetic factors controlling root architecture, which will help rice breeders to breed varieties with deep, strong and vigorous root systems.

  15. Single-Crystal Growth and Structure Determination of a New Oxide Apatite, NaLa 9(GeO 4) 6O 2

    NASA Astrophysics Data System (ADS)

    Takahashi, Masaru; Uematsu, Kazuyoshi; Ye, Zuo-Guang; Sato, Mineo

    1998-09-01

    NaLa9Ge6O26, hexagonal,a=0.9883(2) nm,c=0.7267(3) nm,V=6.147(3)×105nm3, space groupP63/m,Z=1,Dcalc= 5.739 g cm-3,λ(MoKα)=0.071069 nm,μ=225.16 cm-1,F(000)=924,T=298 K,R=0.031,Rw=0.037 for 966 measured unique reflections. Single crystals of NaLa9Ge6O26were grown both by a high-temperature flux method and from a melt system. The crystal structure was found to be similar to that of the silicate oxyapatite NaY9Si6O26. The 4fcation sites are occupied disorderedly by La and Na. On the other hand, the 6hcation sites are occupied by La only. This compound constitutes a new member of the oxyapatite-type structure family with general formulaAxLn10-xB6O24O3-x(x=1,A=alkali metals,B=Si, Ge,Ln=rare earth).

  16. Course and prognosis in seropositive and seronegative rheumatoid arthritis.

    PubMed

    Sahatçiu-Meka, Vjollca; Rexhepi, Sylejman; Kukeli, Anton; Manxhuka-Kërliu, Suzana; Pallaskas, Kelmend; Murtezani, Ardiana; Rexhepi, Mjellma; Rexhepi, Blerta

    2013-01-01

    Long since it have been suggested that a subpopulation of patients with rheumatoid arthritis (RA), diagnosed with negative rheumatoid factor (RF) tests, represents a clinical entity quite distinct from that of seropositive rheumatoid arthritis. The aim of the study was to establish a scientific comparative analysis between RA seronegative and seropositive, regarding course and prognoses of the disease. Two hundred fifty patients with rheumatoid arthritis according to the (American College of Rheumatology) criteria were retrospectively studied by analysis the course and prognoses of disease. All examinees were between 25-60 years of age (Xb=49.9, SD=10.3) with disease duration between 1-27 years (Xbox=6.41, SD=6.47). Course of the disease with "remissions and exacerbations", progressive continual course and bad prognoses, were more presented in seropositive group ofpatients. Partial remission was more common in seronegative patients but according to serostatus and gender has not shown statistically significant difference. Duration of the disease was a specific prognostic sign for both subsets [(r=0.32, p<0.01) seronegative, (r=0.22, p<0.05) seropositive], while age was only a specific prognostic sign for the seropositive subset [(r=0.01, p>0.05) seronegative, (r=0.18, p<0.05) seropositive]. Seropositive and seronegative RA distinguish in course and prognostic feature, but not enough to differentiate them in two different forms of the disease. Regarding the sero-status, differences within sex, with some exceptions, are not relevant.

  17. Full-wave Modeling of EBWs in Pegasus

    NASA Astrophysics Data System (ADS)

    Gallian, Sara; Bongard, Michael; Volpe, Francesco; Jacquot, Jonathan; Köhn, Alf

    2010-11-01

    We model the injection of ordinary(O) and extraordinary(X) waves at 2.45GHz, their conversion in Electron Bernstein Waves(EBWs) and the initial propagation of EBWs in the Pegasus spherical torus, by means of the recently improved IPF-FDMC finite-difference-time-domain Maxwell-fluid solver. Simulations are performed in 2D in cylindrical and Cartesian coordinates, in a poloidal, horizontal or ``oblique'' cut (at the magnetic pitch inclination, where the OXB conversion is most efficient). The OXB and XB conversion efficiencies are evaluated for various antenna designs and launch geometries. Reflections from the wall and collisions at the upper hybrid are included. The motivation for the full-wave approach is that the O and X vacuum wavelength (12cm) is comparable with the plasma radius(30-45cm). EBWs, however, develop a short wavelength fulfilling the ray tracing approximation. For this reason, EBW wavefronts are separated from the long-wavelength O and X-mode by means of high-pass spatial filtering of the full-wave results. Then, local wave-vectors are defined, that might serve as initial conditions for future ray tracings including absorption.

  18. Electron Bernstein Wave Studies in MST

    NASA Astrophysics Data System (ADS)

    Seltzman, A.; Anderson, J.; Forest, C.; Nonn, P.; Kauffold, J.; Diem, S.

    2010-11-01

    The electron Bernstein wave (EBW) has potential to stabilize resistive tearing modes with off-axis current drive for further improvement of RFP confinement. Hardware upgrades to the MST-EBW experiment include a 5.5GHz radar klystron tube capable of 1MW power output driven by a novel resonant switchmode power supply and directed toward the RFP plasma edge through a cylindrical molybdenum wave guide antenna. By utilizing XB conversion, the X-mode evanescently decays in the narrow region between the R and UH layers and couples to the Bernstein mode at the UH layer. The Bernstein wave is strongly damped at the electron cyclotron resonance where it coupled to the electron gyromotion, thereby altering the electron distribution. By external control of magnetic field, either Fisch-Boozer or Ohkawa current drive mechanisms can be activated to drive off axis current in the plasma. Current profile may then be optimized experimentally to reduce particle transport. Initial experiments are presented to verify high power coupling and understand heating via observed x-ray emission and compared to Fokker-Plank modeling.

  19. Universal Associated Legendre Polynomials and Some Useful Definite Integrals

    NASA Astrophysics Data System (ADS)

    Chen, Chang-Yuan; You, Yuan; Lu, Fa-Lin; Sun, Dong-Sheng; Dong, Shi-Hai

    2016-08-01

    We first introduce the universal associated Legendre polynomials, which are occurred in studying the non-central fields such as the single ring-shaped potential and then present definite integrals IA ±(a, τ) = ∫‑1 +1 xa[Pl‧ m‧ (x)]2/(1 ± x)τ dx, a = 0, 1, 2, 3, 4, 5, 6, τ = 1, 2, 3, IB(b, σ) = ∫‑1 +1 xb[Pl‧ m‧ (x)]2/(1 ‑ x2)σ dx, b = 0, 2, 4, 6, 8, σ = 1, 2, 3, and IC ±(c, κ) = ∫‑1 +1 xc[Pl‧ m‧ (x)]2/[(1 ‑ x2)κ (1 ± x)] dx, c = 0, 1, 2, 3, 4, 5, 6, 7, 8, κ = 1, 2. The superindices “±” in IA ±(a, τ) and IC ± (c, κ) correspond to those of the factor (1 ± x) involved in weight functions. The formulas obtained in this work and also those for integer quantum numbers l‧ and m‧ are very useful and unavailable in classic handbooks. Supported by the National Natural Science Foundation of China under Grant No. 11275165 and partially by 20160978-SIP-IPN, Mexico.

  20. Sivers, Boer-Mulders and transversity distributions in the difference cross sections in SIDIS

    NASA Astrophysics Data System (ADS)

    Christova, Ekaterina; Leader, Elliot

    2016-02-01

    A major experimental program is presently underway to determine the Sivers, Boer-Mulders and transversity distributions, vital for understanding the internal structure of the nucleon. To this end we consider the Sivers, Boer-Mulders and transversity azimuthal asymmetries of the difference cross sections of hadrons with opposite charges in SIDIS reactions with unpolarized and transversely polarized target l + N → l' + h + X, h = π±, K±, h±. We show that on deuteron target these asymmetries are particularly simple and determine the sum of the valence-quark Qv = uv + dv transverse momentum dependent distributions without any contributions from the strange or other sea-quark functions. At present, data on these asymmetries are presented for the integrated asymmetries i.e. the xB- and zh-dependent asymmetries. If data are available in small bins in Q2, so that Q2-dependence can be neglected, these expressions simplify dramatically leading to remarkably simple and powerful tests of the simplifying assumptions used in extracting these functions from the data.

  1. Guiding center plasma models in three dimensions

    SciTech Connect

    Sugiyama, Linda E.

    2008-09-15

    Guiding center plasma models describe the fast charged particle gyration around magnetic field lines by an angle coordinate, defined relative to local orthogonal coordinate axes (e{sub 1},e{sub 2},b=B/B) at each guiding center location. In three dimensions (3D), unlike uniform straight two-dimensional (2D) fields, geometrical effects make the small gyroradius expansion nonuniform in velocity phase space in first order O({rho}{sub i}/L). At second order, Hamiltonian and Lagrangian solutions may be undefined even when good magnetic flux surfaces exist; existence requires the magnetic field torsion {tau}=b{center_dot}{nabla}xb=0 and {tau}{sub g}{identical_to}b{center_dot}({nabla}e{sub 1}){center_dot}e{sub 2}=0, unless the magnetic field has a 2D symmetry, such as toroidal axisymmetry. Keeping complete 3D geometrical effects also requires the magnetic vector potential term to appear in the electric field at the same order as the electrostatic potential. These problems express properties of magnetic vector potentials, Lagrangians, and the curvature of manifolds, and have analogies to attempts to connect small scale Lagrangian theories to higher dimensional, large scale ones in the grand unification theories of physics.

  2. Independent calculation of monitor units for VMAT and SPORT

    SciTech Connect

    Chen, Xin; Bush, Karl; Ding, Aiping; Xing, Lei

    2015-02-15

    , dose profiles, gamma index, and dose volume histogram (DVH) for these cases. For the lung cases, the MC-calculated MUs differ significantly from that of the treatment plan computed using AAA. However, the discrepancies are reduced to within 3% when the TPS dose calculation algorithm is switched to a transport equation-based technique (Acuros™). Comparison in the dose domain between the MC and Eclipse AAA/Acuros calculation yields conclusion consistent with the MU calculation. Conclusions: A computational framework relating the MU and dose domains has been established. The framework does not only enable them to verify the MU values of the involved station points of a VMAT plan directly in the MU domain but also provide a much needed mechanism to adaptively modify the MU values of the station points in accordance to a specific change in the dose domain.

  3. Independent calculation of monitor units for VMAT and SPORT

    PubMed Central

    Chen, Xin; Bush, Karl; Ding, Aiping; Xing, Lei

    2015-01-01

    , dose profiles, gamma index, and dose volume histogram (DVH) for these cases. For the lung cases, the MC-calculated MUs differ significantly from that of the treatment plan computed using AAA. However, the discrepancies are reduced to within 3% when the TPS dose calculation algorithm is switched to a transport equation-based technique (Acuros™). Comparison in the dose domain between the MC and Eclipse AAA/Acuros calculation yields conclusion consistent with the MU calculation. Conclusions: A computational framework relating the MU and dose domains has been established. The framework does not only enable them to verify the MU values of the involved station points of a VMAT plan directly in the MU domain but also provide a much needed mechanism to adaptively modify the MU values of the station points in accordance to a specific change in the dose domain. PMID:25652504

  4. NGC 300 X-1 and IC 10 X-1: a new breed of black hole binary?

    NASA Astrophysics Data System (ADS)

    Barnard, R.; Clark, J. S.; Kolb, U. C.

    2008-09-01

    are transient. The violent transition from low state to high state may temporarily eject the disc corona from the BH LMXBs, drastically reducing the non-thermal component. However, BH XBs in a persistent high state could retain their corona, and hence exhibit a large non-thermal component. LMC X-1 is a BH XB that has only been observed in the high state, and its spectrum is remarkably similar to those of NGC 300 X-1 in Observation 1 and IC 10 X-1. We therefore classify NGC 300 X-1, IC 10 X-1 and perhaps LMC X-1 as a new breed of BH XB, defined by their persistently high accretion rates and consequent stable disc configuration and corona. This scenario may also explain the lack of ultraluminous X-ray sources in the canonical soft state.

  5. Investigation of probabilistic orbital evolution of near-Earth asteroids moving in the vicinity of resonances with Mercury

    NASA Astrophysics Data System (ADS)

    Galushina, T. Yu.; Titarenko, E. Yu

    2014-12-01

    The purpose of this work is the investigation of probabilistic orbital evolution of near-Earth asteroids (NEA) moving in the vicinity of resonances with Mercury. In order to identify such objects the equations of all NEA motion have been integrated on the time interval (1000, 3000 years). The initial data has been taken from the E. Bowell catalog on February 2014. The motion equations have been integrated numerically by Everhart method. The resonance characteristics are critical argument that defines the connection longitude of the asteroid and the planet and its time derivative, called resonance "band". The study has identified 15 asteroids moving in the vicinity of different resonances with Mercury. Six of them (52381 1993 HA, 172034 2001 WR1, 2008 VB1, 2009 KT4, 2013 CQ35, 2013 TH) move in the vicinity of the resonance 1/6, five of them (142561 2002 TX68, 159608 2002 AC2, 241370 2008 LW8, 2006 UR216, 2009 XB2) move in the vicinity of the resonance 1/9 and one by one asteroid moves in the vicinity of resonances 1/3, 1/7, 1/8 and 2/7 (2006 SE6, 2002 CV46, 2013 CN35 and 2006 VY2 respectively). The orbits of all identified asteroids have been improved by least square method using the available optical observations and probabilistic orbital evolution has been investigated. Improvement have been carried out at the time of the best conditionality in accounting perturbations from the major planets, Pluto, Moon, Ceres, Pallas and Vesta, the relativistic effects from the Sun and the Solar oblateness. The estimation of the nonlinearity factor has showed that for all the considered NEA it does not exceed the critical value of 0.1, which makes it possible to use the linear method for constructing the initial probability domain. The domain has been built in the form of an ellipsoid in six-dimensional phase space of coordinates and velocity components on the base of the full covariance matrix, the center of ellipsoid is the nominal orbit obtained by improving. The 10 000

  6. Interaction of octyl-beta-thioglucopyranoside with lipid membranes.

    PubMed

    Wenk, M R; Seelig, J

    1997-11-01

    Octyl-beta-thioglucopyranoside (octyl thioglucoside, OTG) is a nonionic surfactant used for the purification, reconstitution, and crystallization of membrane proteins. The thermodynamic properties of the OTG-membrane partition equilibrium are not known and have been investigated here with high-sensitivity titration calorimetry. The critical concentration for inducing the bilayer <==> micelle transition was determined as cD* = 7.3 mM by 90 degree light scattering. All thermodynamic studies were performed well below this limit. Sonified, unilamellar lipid vesicles composed of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) with and without cholesterol were employed in the titration calorimetry experiments, and the temperature was varied between 28 degrees C and 45 degrees C. Depending on the surfactant concentration in the membrane, the partition enthalpy was found to be exothermic or endothermic, leading to unusual titration patterns. A quantitative interpretation of all titration curves was possible with the following model: 1) The partitioning of OTG into the membrane follows a simple partition law, i.e., Xb = Kc(D,f), where Xb denotes the molar amount of detergent bound per mole of lipid and c(D,f) is the detergent concentration in bulk solution. 2) The partition enthalpy for the transfer of OTG from the aqueous phase to the membrane depends linearly on the mole fraction, R, of detergent in the membrane. All calorimetric OTG titration curves can be characterized quantitatively by using a composition-dependent partition enthalpy of the form deltaHD(R) = -0.08 + 1.7 R (kcal/mol) (at 28 degrees C). At low OTG concentrations (R < or = 0.05) the reaction enthalpy is exothermic; it becomes distinctly endothermic as more and more surfactant is incorporated into the membrane. OTG has a partition constant of 240 M(-1) and is more hydrophobic than its oxygen-containing analog, octyl-beta-D-glucopyranoside (OG). Including a third nonionic amphiphile, octa

  7. Near-Infrared (2 - 4 µm) spectroscopy of Near-Earth Asteroids: Searching for OH/H2O on small planetary bodies

    NASA Astrophysics Data System (ADS)

    Wigton, Nathanael; Emery, Josh P.; Rivkin, Andrew S.; Thomas, Cristina A.

    2014-11-01

    Near-Earth asteroids (NEAs) are not expected to have H2O ice on their surfaces because; a) most accreted dry and therefore never contained H2O, and b) their relatively high surface temperatures should drive rapid H2O ice sublimation. However, OH/H2O has been detected on other anhydrous inner solar system objects, including the Moon and Vesta. Possible sources for OH/H2O in the inner Solar System might include production via solar wind interactions, carbonaceous chondrite or cometary impact delivery, or native OH/H2O molecules bound to phyllosilicates. As these processes are active in near-Earth space, detectable levels of OH/H2O might also be present on NEAs. OH/H2O can be detected by its spectral signature near 3-µm absorption feature using near-infrared (2 - 4 μm) spectroscopy from terrestrial infrared telescopes. This feature can be comprised of an OH absorption feature centered near 2.7 μm and H2O features near 2.9 and 3.1 μm, or a blend of both, producing a relatively wide feature spanning 2.7 - 3.1 μm. Analysis of the shape of the 3-µm feature, coupled with the observed NEA orbital parameters and albedos, can help distinguish between the possible sources of OH/H2O.Here we present preliminary results of an ongoing observational program to measure spectra of NEAs in the 3-μm region. We are using the SpeX instrument on NASA’s Infrared Telescope Facility (IRTF) to measure spectra in from ~2 to 4 μm. So far, we have 10 observations for 5 NEAs. 443 Eros has been observed twice: 1/09/2009, and 1/28/2012. 1036 Ganymed has been observed five times in 2011: 6/10, 7/4, 9/17, 9/27, and 10/19. 3122 Florence was observed 2010 August 5. (54789) 2001 MZ7 was observed on 2/1/2010. (96590) 1998 XB was observed on 2/15/2010 December . Rivkin et al. (2013; LPSC) reported detections of the 3-μm feature on Ganymed and Eros with data taken in 2012. Data from our data of Ganymed, Eros, and 1998 XB is still in progress. Spectra of Florence and 2001 MZ7 appear to exhibit

  8. Diversity of oxygenase genes from methane- and ammonia-oxidizing bacteria in the Eastern Snake River Plain aquifer.

    PubMed

    Erwin, Daniel P; Erickson, Issac K; Delwiche, Mark E; Colwell, Frederick S; Strap, Janice L; Crawford, Ronald L

    2005-04-01

    PCR amplification, restriction fragment length polymorphism, and phylogenetic analysis of oxygenase genes were used for the characterization of in situ methane- and ammonia-oxidizing bacteria from free-living and attached communities in the Eastern Snake River Plain aquifer. The following three methane monooxygenase (MMO) PCR primer sets were used: A189-A682, which amplifies an internal region of both the pmoA gene of the MMO particulate form and the amoA gene of ammonia monooxygenase; A189-mb661, which specifically targets the pmoA gene; and mmoXA-mmoXB, which amplifies the mmoX gene of the MMO soluble form (sMMO). Whole-genome amplification (WGA) was used to amplify metagenomic DNA from each community to assess its applicability for generating unbiased metagenomic template DNA. The majority of sequences in each archive were related to oxygenases of type II-like methanotrophs of the genus Methylocystis. A small subset of type I sequences found only in free-living communities possessed oxygenase genes that grouped nearest to Methylobacter and Methylomonas spp. Sequences similar to that of the amoA gene associated with ammonia-oxidizing bacteria (AOB) most closely matched a sequence from the uncultured bacterium BS870 but showed no substantial alignment to known cultured AOB. Based on these functional gene analyses, bacteria related to the type II methanotroph Methylocystis sp. were found to dominate both free-living and attached communities. Metagenomic DNA amplified by WGA showed characteristics similar to those of unamplified samples. Overall, numerous sMMO-like gene sequences that have been previously associated with high rates of trichloroethylene cometabolism were observed in both free-living and attached communities in this basaltic aquifer.

  9. Quantification of the neurotransmitters melatonin and N-acetyl-serotonin in human serum by supercritical fluid chromatography coupled with tandem mass spectrometry.

    PubMed

    Wolrab, Denise; Frühauf, Peter; Gerner, Christopher

    2016-09-21

    The aim of this study was developing a supercritical fluid chromatography tandem mass spectrometry (SFC-MS/MS) method and an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method, for the analysis of N-acetyl-serotonin (NAS) and melatonin (Mel) in human serum, and to compare the performance of these methods. Deuterated isotopologues of the neurotransmitters were synthesized and evaluated for suitability as internal standards in sample preparation. Liquid-liquid extraction was selected as sample preparation procedure. With chloroform, the best extraction solvent tested, an extraction yield of 48 ± 2% for N-acetyl-serotonin and 101 ± 10% for melatonin was achieved. SFC separation was accomplished within 3 min on a BEH stationary phase, employing isocratic elution with 90% carbon dioxide and 0.1% formic acid as well as 0.05% ammonium formate in methanol. For the 4 min UHPLC gradient separation with 0.1% formic acid in water and methanol, respectively, a Kinetex XB-C18 was used as stationary phase. Both chromatographic techniques were optimized regarding mobile phase composition, additives to the mobile phase and column temperature. Multiple reaction monitoring (MRM) analysis was used for quantification of the metabolites. Both methods were validated regarding retention time stability, LOD, LOQ, repeatability and reproducibility of quantification, process efficiency, extraction recovery and matrix effects. LOD and LOQ were 0.017 and 0.05 pg μL(-1) for NAS and 0.006 and 0.018 pg μL(-1) for Mel in SFC-MS/MS compared to 0.028 and 0.1 pg μL(-1) for NAS and 0.006 and 0.017 pg μL(-1) for Mel in UHPLC-MS/MS. PMID:27590559

  10. A new method for rapid determination of indole-3-carbinol and its condensation products in nutraceuticals using core-shell column chromatography method.

    PubMed

    Fibigr, Jakub; Šatínský, Dalibor; Havlíková, Lucie; Solich, Petr

    2016-02-20

    Indole-3-carbinol is a natural glucosinolate known for prevention of human breast, prostate and other types of cancer and it started to be used in commercial preparations, as food supplements. However no analytical method has been proposed for quality control of nutraceuticals with this substance yet. In this paper a new high-performance liquid chromatography (HPLC) method using core-shell column for separation of indole-3-carbinol and its condensation/degradation products was developed and used for the quantitative determination of indole-3-carbinol in nutraceuticals. Separation of indole-3-carbinol, its condensation/degradation products and internal standard ethylparaben was performed on the core-shell column Kinetex 5μ XB-C18 100A (100×4.6mm), particle size 5.0μm, with mobile phase acetonitrile/water according to the gradient program at a flow rate of 1.25mLmin(-1) and at temperature 50°C. The detection wavelength was set at 270nm. Under the optimal chromatographic conditions good linearity of determination was achieved. Available commercial samples of nutraceuticals were extracted with 100% methanol using ultrasound bath. A 5-μL sample volume of the supernatant was directly injected into the HPLC system. The developed method provided rapid and accurate tool for quality control of nutraceuticals based on cruciferous vegetable extracts with indole-3-carbinol content. The presented study showed that the declared content of indole-3-carbinol significantly varied in the different nutraceuticals available on the market. Two analyzed preparations showed the presence of condensation/degradation products of indole-3-carbinol which were not officially declared by the manufacturer. Moreover, further two analyzed nutraceutical preparations showed absolutely no content of declared amount of indole-3-carbinol.

  11. Size at the onset of maturity (SOM) revealed in length-weight relationships of brackish amphipods and isopods: An information theory approach

    NASA Astrophysics Data System (ADS)

    Longo, Emanuela; Mancinelli, Giorgio

    2014-01-01

    In amphipods and other small-sized crustaceans, allometric relationships are conventionally analysed by fitting the standard model Y = a·Xb (X and Y are, e.g., body length and weight, respectively) whose scaling exponent b is assumed to be constant. However, breakpoints in allometric relationships have long been documented in large-sized crustaceans, ultimately determined by ontogenetic, abrupt variations in the value of b. Here, the existence of breakpoints in length-weight relationships was investigated in four amphipod (i.e., Gammarus aequicauda, Gammarus insensibilis, Microdeutopus gryllotalpa, and Dexamine spinosa) and three isopod species (i.e., Lekanesphaera hookeri, Sphaeroma serratum, and Cymodoce truncata) from three Mediterranean lagoons. The power of two candidate linear models fitted to log10-transformed data - a simple model assuming a constant exponent b and a segmented model assuming b to vary after a breakpoint - was compared using a parsimonious selection strategy based on the Akaike information criterion. The segmented model with a breakpoint provided the most accurate fitting of length-weight data in the majority of the species analysed; non-conclusive results were obtained only for D. spinosa and C. truncata, of which a limited number of specimens was examined. Model parameters were consistent for amphipod and isopod species collected across the three different habitats; the generality of the results was further supported by a literature search confirming that the identified breakpoints corresponded with ontogenetic discontinuities related with sexual maturation in all the species investigated. In this study, segmented regression models were revealed to provide a statistically accurate and biologically meaningful description of length-weight relationships of common amphipod and isopod species. The methodological limitations of the approach are considered, while the practical implications for secondary production estimates are discussed.

  12. Characterizations of volatile organic compounds during high ozone episodes in Beijing, China.

    PubMed

    An, Jun-lin; Wang, Yue-si; Wu, Fang-kun; Zhu, Bin

    2012-04-01

    Air samples were collected in Beijing from June through August 2008, and concentrations of volatile organic compounds (VOCs) in those samples are here discussed. This sampling was performed to increase understanding of the distributions of their compositions, illustrate the overall characteristics of different classes of VOCs, assess the ages of air masses, and apportion sources of VOCs using principal compound analysis/absolute principal component scores (PCA/APCS). During the sampling periods, the relative abundance of the four classes of VOCs as determined by the concentration-based method was different from that determined by the reactivity approach. Alkanes were found to be most abundant (44.3-50.1%) by the concentration-based method, but aromatic compounds were most abundant (38.2-44.5%) by the reactivity approach. Aromatics and alkenes contributed most (73-84%) to the ozone formation potential. Toluene was the most abundant compound (11.8-12.7%) during every sampling period. When the maximum incremental reactivity approach was used, propene, toluene, m,p-xylene, 1-butene, and 1,2,4-trimethylbenzene were the five most abundant compounds during two sampling periods. X/B, T/B, and E/B ratios in this study were lower than those found in other cities, possibly due to the aging of the air mass at this site. Four components were extracted from application of PCA to the data. It was found that the contribution of vehicle exhaust to total VOCs accounted for 53% of VOCs, while emissions due to the solvent use contributed 33% of the total VOCs. Industrial sources contributed 3% and biogenic sources contributed 11%. The results showed that vehicle exhausts (i.e., unburned vehicle emissions + vehicle internal engine combustion) were dominant in VOC emissions during the experimental period. The solvent use made the second most significant contribution to ambient VOCs. PMID:21552987

  13. High-precision drop shape analysis (HPDSA) of quasistatic contact angles on silanized silicon wafers with different surface topographies during inclining-plate measurements: Influence of the surface roughness on the contact line dynamics

    NASA Astrophysics Data System (ADS)

    Heib, F.; Hempelmann, R.; Munief, W. M.; Ingebrandt, S.; Fug, F.; Possart, W.; Groß, K.; Schmitt, M.

    2015-07-01

    Contact angles and wetting of solid surfaces are strongly influenced by the physical and chemical properties of the surfaces. These influence quantities are difficult to distinguish from each other if contact angle measurements are performed by measuring only the advancing θa and the receding θr contact angle. In this regard, time-dependent water contact angles are measured on two hydrophobic modified silicon wafers with different physical surface topographies. The first surface is nearly atomically flat while the second surface is patterned (alternating flat and nanoscale rough patterns) which is synthesized by a photolithography and etching procedure. The different surface topographies are characterized with atomic force microscopy (AFM), Fourier transform infrared reflection absorption spectroscopy (FTIRRAS) and Fourier transform infrared attenuated total reflection spectroscopy (FTIR-ATR). The resulting set of contact angle data obtained by the high-precision drop shape analysis approach is further analyzed by a Gompertzian fitting procedure and a statistical counting procedure in dependence on the triple line velocity. The Gompertzian fit is used to analyze overall properties of the surface and dependencies between the motion on the front and the back edge of the droplets. The statistical counting procedure results in the calculation of expectation values E(p) and standard deviations σ(p) for the inclination angle φ, contact angle θ, triple line velocity vel and the covered distance of the triple line dis relative to the first boundary points XB,10. Therefore, sessile drops during the inclination of the sample surface are video recorded and different specific contact angle events in dependence on the acceleration/deceleration of the triple line motion are analyzed. This procedure results in characteristically density distributions in dependence on the surface properties. The used procedures lead to the possibility to investigate influences on contact

  14. CXOGBS J173620.2-293338: A candidate symbiotic X-ray binary associated with a bulge carbon star

    SciTech Connect

    Hynes, Robert I.; Britt, C. T.; Johnson, C. B.; Torres, M. A. P.; Jonker, P. G.; Heinke, C. O.; Maccarone, T. J.; Mikles, V. J.; Knigge, C.; Greiss, S.; Steeghs, D.; Nelemans, G.; Bandyopadhyay, R. M.

    2014-01-01

    The Galactic Bulge Survey (GBS) is a wide but shallow X-ray survey of regions above and below the Plane in the Galactic Bulge. It was performed using the Chandra X-ray Observatory's ACIS camera. The survey is primarily designed to find and classify low luminosity X-ray binaries. The combination of the X-ray depth of the survey and the accessibility of optical and infrared counterparts makes this survey ideally suited to identification of new symbiotic X-ray binaries (SyXBs) in the Bulge. We consider the specific case of the X-ray source CXOGBS J173620.2-293338. It is coincident to within 1 arcsec with a very red star, showing a carbon star spectrum and irregular variability in the Optical Gravitational Lensing Experiment data. We classify the star as a late C-R type carbon star based on its spectral features, photometric properties, and variability characteristics, although a low-luminosity C-N type cannot be ruled out. The brightness of the star implies it is located in the Bulge, and its photometric properties are overall consistent with the Bulge carbon star population. Given the rarity of carbon stars in the Bulge, we estimate the probability of such a close chance alignment of any GBS source with a carbon star to be ≲ 10{sup –3}, suggesting that this is likely to be a real match. If the X-ray source is indeed associated with the carbon star, then the X-ray luminosity is around 9 × 10{sup 32} erg s{sup –1}. Its characteristics are consistent with a low luminosity SyXB, or possibly a low accretion rate white dwarf symbiotic.

  15. A gene defect causing a novel progressive epilepsy with mental retardation, EPMR, maps to chromosome 8p

    SciTech Connect

    Ranta, S.; Tahvanainen, E.; Karila, E.

    1994-09-01

    EPMR (progressive epilepsy with mental retardation) is a newly discovered autosomal recessively inherited disorder which occurs with high frequency in an isolated rural population in Finland. So far 25 patients have been identified, 21 of whom are alive. Twenty-three patients share a common ancestor from the 18th century. The main features of EPMR are: normal early development, tonic-clonic seizures with onset between ages 5 and 10, and mental retardation which begins approximately 2 years after the onset of epilepsy and soon leads to deepening mental retardation. Adult patients do not manage their daily life without help. The EEG is normal at the onset of epilepsy but later progressive slowing of the background activity occurs. The etiology and pathogenesis of EPMR remain known. As this is a novel disease entity without any definitive diagnostic marker we wished to begin its elucidation by first defining its gene locus. A random search for linkage in four multiplex families (only 20 individuals tested) resulted in the finding of linkage to marker D8S264 with a lod score of 4.45 at zero recombination. The EPMR gene resides in a 7 centimorgan interval between marker loci AFM185xb2 and D8S262 with a maximum multipoint lod score of 7.03 at 1.8 centimorgans proximal to D8S264. Physically this region is very distal on 8p. Of the sixteen EPMR chromosomes haplotyped 15 were identical or almost identical. One chromosome, however, had a distinctly different haplotype raising the possibility of there being two different mutations or one very old mutation. These findings are a starting point toward isolating and characterizing the gene and its protein product. Physical mapping has been initiated by isolating nine YACs from the region.

  16. β-Estradiol and ethinyl-estradiol contamination in the rivers of the Carpathian Basin.

    PubMed

    Avar, Péter; Zrínyi, Zita; Maász, Gábor; Takátsy, Anikó; Lovas, Sándor; G-Tóth, László; Pirger, Zsolt

    2016-06-01

    17β-Estradiol (E2) and 17α-ethinyl estradiol (EE2), which are environmental estrogens, have been determined with LC-MS in freshwater. Their sensitive analysis needs derivatization and therefore is very hard to achieve in multiresidue screening. We analyzed samples from all the large and some small rivers (River Danube, Drava, Mur, Sava, Tisza, and Zala) of the Carpathian Basin and from Lake Balaton. Freshwater was extracted on solid phase and derivatized using dansyl chloride. Separation was performed on a Kinetex XB-C18 column. Detection was achieved with a benchtop orbitrap mass spectrometer using targeted MS analysis for quantification. Limits of quantification were 0.05 ng/L (MS1) and 0.1 ng/L (MS/MS) for E2, and 0.001 ng/L (MS1) and 0.2 ng/L (MS/MS) for EE2. River samples contained n.d.-5.2 ng/L E2 and n.d.-0.68 ng/L EE2. Average levels of E2 and EE2 were 0.61 and 0.084 ng/L, respectively, in rivers, water courses, and Lake Balaton together, but not counting city canal water. EE2 was less abundant, but it was still present in almost all of the samples. In beach water samples from Lake Balaton, we measured 0.076-0.233 E2 and n.d.-0.133 EE2. A relative high amount of EE2 was found in river Zala (0.68 ng/L) and in Hévíz-Páhoki canal (0.52 ng/L), which are both in the catchment area of Lake Balaton (Hungary).

  17. Spectral analysis of Cu(2+): B(2)O(3)--ZnO--PbO glasses.

    PubMed

    Lakshminarayana, G; Buddhudu, S

    2005-11-01

    A new series of heavy metal oxide (PbO) based zinc borate glasses in the chemical composition of (95-x)B(2)O(3)-5ZnO-xPbO (x=10, 15, 20, 25, 30, 35, 40, 45 and 50 mol%) have been prepared to verify their UV filtering performance. Both direct and indirect optical band gaps (E(opt)) have been evaluated for these glasses. For a reference glass of 45B(2)O(3)-5ZnO-50PbO, refractive indices at different wavelengths are measured and found the results satisfactorily correlated with the theoretical data upon the computation of Cauchy's constants of A=1.766029949, B=159531.024 nm(2) and C=-1.078 x 10(10) nm(4). Measurements concerning X-ray diffraction (XRD), FT-IR, differential scanning colorimeter (DSC) profiles have been carried out for this glass. The FT-IR profile has revealed that the glass has both BO(3) and BO(4) units. From DSC thermogram, glass transition temperature (T(g)), crystallization temperature (T(c)) and melting temperature (T(m)) have been located and from them, other related parameters of the glass have also been calculated. Visible absorption spectra of 45B(2)O(3)-5ZnO-(50-x)PbO-xCuO (x=0. 1, 0.2, 0.5 and 1.0 mol%) have revealed two absorption bands at around 400 nm ((2)B(1g)-->(2)E(g)) and 780 nm ((2)B(1g)-->(2)B(2g)) of Cu(2+) ions, respectively. Emission bands at 422 and 512 nm are found for the 1 mol % CuO doped glass with excitations at 306 and 332 nm.

  18. Sweetwater, Texas Large N Experiment

    NASA Astrophysics Data System (ADS)

    Sumy, D. F.; Woodward, R.; Barklage, M.; Hollis, D.; Spriggs, N.; Gridley, J. M.; Parker, T.

    2015-12-01

    From 7 March to 30 April 2014, NodalSeismic, Nanometrics, and IRIS PASSCAL conducted a collaborative, spatially-dense seismic survey with several thousand nodal short-period geophones complemented by a backbone array of broadband sensors near Sweetwater, Texas. This pilot project demonstrates the efficacy of industry and academic partnerships, and leveraged a larger, commercial 3D survey to collect passive source seismic recordings to image the subsurface. This innovative deployment of a large-N mixed-mode array allows industry to explore array geometries and investigate the value of broadband recordings, while affording academics a dense wavefield imaging capability and an operational model for high volume instrument deployment. The broadband array consists of 25 continuously-recording stations from IRIS PASSCAL and Nanometrics, with an array design that maximized recording of horizontal-traveling seismic energy for surface wave analysis over the primary target area with sufficient offset for imaging objectives at depth. In addition, 2639 FairfieldNodal Zland nodes from NodalSeismic were deployed in three sub-arrays: the outlier, backbone, and active source arrays. The backbone array consisted of 292 nodes that covered the entire survey area, while the outlier array consisted of 25 continuously-recording nodes distributed at a ~3 km distance away from the survey perimeter. Both the backbone and outlier array provide valuable constraints for the passive source portion of the analysis. This project serves as a learning platform to develop best practices in the support of large-N arrays with joint industry and academic expertise. Here we investigate lessons learned from a facility perspective, and present examples of data from the various sensors and