Sample records for acute immune response

  1. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    PubMed

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  2. The Immune Response to Acute Focal Cerebral Ischemia and Associated Post-stroke Immunodepression: A Focused Review

    PubMed Central

    Famakin, Bolanle M.

    2014-01-01

    It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490

  3. Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.

    PubMed

    Maeda, Yoshinobu

    2013-09-01

    In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.

  4. Body temperature modulates the antioxidant and acute immune responses to exercise.

    PubMed

    Mestre-Alfaro, Antonia; Ferrer, Miguel D; Banquells, Montserrat; Riera, Joan; Drobnic, Franchek; Sureda, Antoni; Tur, Josep A; Pons, Antoni

    2012-06-01

    The aim of this study was to determine the effects of whole body heat in combination with exercise on the oxidative stress and acute phase immune response. Nine male endurance-trained athletes voluntarily performed two running bouts of 45 minutes at 75-80% of VO(2max) in a climatic chamber in two conditions: cold and hot humid environment. Leukocyte, neutrophil and basophil counts significantly rose after exercise in both environments; it was significantly greater in the hot environment. Lymphocyte and neutrophil antioxidant enzyme activities and carbonyl index significantly increased or decreased after exercise only in the hot environment, respectively. The lymphocytes expression of catalase, Hsp72 and CuZn-superoxide dismutase was increased in the hot environment and Sirt3 in the cold environment, mainly during recovery. In conclusion, the increased core body temperature results in the acute phase immune response associated to intense exercise and in the immune cell adaptations to counteract the oxidative stress situation.

  5. Flight performance of western sandpipers, Calidris mauri, remains uncompromised when mounting an acute phase immune response.

    PubMed

    Nebel, Silke; Buehler, Deborah M; MacMillan, Alexander; Guglielmo, Christopher G

    2013-07-15

    Migratory birds have been implicated in the spread of some zoonotic diseases, but how well infected individuals can fly remains poorly understood. We used western sandpipers, Calidris mauri, to experimentally test whether flight is affected when long-distance migrants are mounting an immune response and whether migrants maintain immune defences during a flight in a wind tunnel. We measured five indicators of innate immunity in 'flown-healthy' birds (flying in a wind tunnel without mounting an immune response), 'flown-sick' birds (flying while mounting an acute phase response, which is part of induced innate immunity), and a non-flying control group ('not-flown'). Voluntary flight duration did not differ between flown-healthy and flown-sick birds, indicating that mounting an acute phase response to simulated infection did not hamper an individual's ability to fly for up to 3 h. However, in comparison to not-flown birds, bacterial killing ability of plasma was significantly reduced after flight in flown-sick birds. In flown-healthy birds, voluntary flight duration was positively correlated with bacterial killing ability and baseline haptoglobin concentration of the blood plasma measured 1-3 weeks before experimental flights, suggesting that high quality birds had strong immune systems and greater flight capacity. Our findings indicate that flight performance is not diminished by prior immune challenge, but that flight while mounting an acute phase response negatively affects other aspects of immune function. These findings have important implications for our understanding of the transmission of avian diseases, as they suggest that birds can still migrate while fighting an infection.

  6. Profiling the humoral immune response of acute and chronic Q fever by protein microarray.

    PubMed

    Vigil, Adam; Chen, Chen; Jain, Aarti; Nakajima-Sasaki, Rie; Jasinskas, Algimantas; Pablo, Jozelyn; Hendrix, Laura R; Samuel, James E; Felgner, Philip L

    2011-10-01

    Antigen profiling using comprehensive protein microarrays is a powerful tool for characterizing the humoral immune response to infectious pathogens. Coxiella burnetii is a CDC category B bioterrorist infectious agent with worldwide distribution. In order to assess the antibody repertoire of acute and chronic Q fever patients we have constructed a protein microarray containing 93% of the proteome of Coxiella burnetii, the causative agent of Q fever. Here we report the profile of the IgG and IgM seroreactivity in 25 acute Q fever patients in longitudinal samples. We found that both early and late time points of infection have a very consistent repertoire of IgM and IgG response, with a limited number of proteins undergoing increasing or decreasing seroreactivity. We also probed a large collection of acute and chronic Q fever patient samples and identified serological markers that can differentiate between the two disease states. In this comparative analysis we confirmed the identity of numerous IgG biomarkers of acute infection, identified novel IgG biomarkers for acute and chronic infections, and profiled for the first time the IgM antibody repertoire for both acute and chronic Q fever. Using these results we were able to devise a test that can distinguish acute from chronic Q fever. These results also provide a unique perspective on isotype switch and demonstrate the utility of protein microarrays for simultaneously examining the dynamic humoral immune response against thousands of proteins from a large number of patients. The results presented here identify novel seroreactive antigens for the development of recombinant protein-based diagnostics and subunit vaccines, and provide insight into the development of the antibody response.

  7. Progranulin Protects Hippocampal Neurogenesis via Suppression of Neuroinflammatory Responses Under Acute Immune Stress.

    PubMed

    Ma, Yanbo; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi

    2017-07-01

    Immune stress is well known to suppress adult neurogenesis in the hippocampus. We have demonstrated that progranulin (PGRN) has a mitogenic effect on neurogenesis under several experimental conditions. We have also shown that PGRN suppresses excessive neuroinflammatory responses after traumatic brain injury. However, the role of PGRN in modulating neurogenesis under acute immune stress is yet to be elucidated. In the present study, we evaluated the involvement of PGRN in neurogenesis and inflammatory responses in the hippocampus using a lipopolysaccharide (LPS)-induced immune stress model. Treatment of mice with LPS significantly increased the expression of PGRN in activated microglia and decreased neurogenesis in the dentate gyrus of the hippocampus. PGRN deficiency increased CD68-immunoreactive area and exacerbated suppression of neurogenesis following LPS treatment. The expression levels of lysosomal genes including lysozyme M, macrophage expressed gene 1, and cathepsin Z were higher in PGRN-deficient than in wild-type mice, while PGRN deficiency decreased mammalian target of rapamycin (mTOR) mRNA levels, suggesting that PGRN suppresses excessive lysosomal biogenesis by promoting mTOR signaling. LPS treatment also increased the expression of proinflammatory genes such as interleukin (IL)-1β, tumor necrosis factor-α, and microsomal prostaglandin E synthase-1 (mPGES-1) in the hippocampus, and PGRN deficiency further enhanced gene expression of IL-6 and mPGES-1. These results suggest that PGRN plays a protecting role in hippocampal neurogenesis at least partially by attenuating neuroinflammatory responses during LPS-induced acute immune stress.

  8. Immune status influences fear and anxiety responses in mice after acute stress exposure

    PubMed Central

    Clark, Sarah M.; Sand, Joseph; Francis, T. Chase; Nagaraju, Anitha; Michael, Kerry C.; Keegan, Achsah D.; Kusnecov, Alexander; Gould, Todd D.; Tonelli, Leonardo H.

    2014-01-01

    Significant evidence suggests that exposure to traumatic and/or acute stress in both mice and humans results in compromised immune function that in turn may affect associated brain processes. Additionally, recent studies in mouse models of immune deficiency have suggested that adaptive immunity may play a role during traumatic stress exposure and that impairments in lymphocyte function may contribute to increased susceptibility to various psychogenic stressors. However, rodent studies on the relationship between maladaptive stress responses and lymphocyte deficiency have been complicated by the fact that genetic manipulations in these models may also result in changes in CNS function due to the expression of targeted genes in tissues other than lymphocytes, including the brain. To address these issues we utilized mice with a deletion of recombination-activating gene 2 (Rag2), which has no confirmed expression in the CNS; thus, its loss should result in the absence of mature lymphocytes without altering CNS function directly. Stress responsiveness of immune deficient Rag2−/− mice on a BALB/c background was evaluated in three different paradigms: predator odor exposure (POE), fear conditioning (FC) and learned helplessness (LH). These models are often used to study different aspects of stress responsiveness after the exposure to an acute stressor. In addition, immunoblot analysis was used to assess hippocampal BDNF expression under both stressed and non-stressed conditions. Subsequent to POE, Rag2−/− mice exhibited a reduced acoustic startle response compared to BALB/c mice; no significant differences in behavior were observed in either FC or LH. Furthermore, analysis of hippocampal BDNF indicated that Rag2−/− mice have elevated levels of the mature form of BDNF compared to BALB/c mice. Results from our studies suggest that the absence of mature lymphocytes is associated with increased resilience to stress exposure in the POE and does not affect

  9. Multi-Agent Simulations of the Immune Response to Hiv during the Acute Stage of Infection

    NASA Astrophysics Data System (ADS)

    Walshe, R.; Ruskin, H. J.; Callaghan, A.

    Results of multi-agent based simulations of the immune response to HIV during the acute phase of infection are presented here. The model successfully recreates the viral dynamics associated with the acute phase of infection, i.e., a rapid rise in viral load followed by a sharp decline to what is often referred to as a "set point", a result of T-cell response and emergence of HIV neutralizing antibodies. The results indicate that sufficient T Killer cell response is the key factor in controlling viral growth during this phase with antibody levels of critical importance only in the absence of a sufficient T Killer response.

  10. Hyperactive immune cells (T cells) may be responsible for acute lung injury in influenza virus infections: a need for early immune-modulators for severe cases.

    PubMed

    Lee, Kyung-Yil; Rhim, Jung-Woo; Kang, Jin-Han

    2011-01-01

    It has been believed that acute lung injury in influenza virus infections is caused by a virus-induced cytopathy; viruses that have multiplied in the upper respiratory tract spread to lung tissues along the lower respiratory tract. However, some experimental and clinical studies have suggested that the pathogenesis of acute lung injury in influenza virus infections is associated with excessive host response including a cell-mediated immune reaction. During the pandemic H1N1 2009 influenza A virus infections in Korea, we experienced a dramatic effect of immune-modulators (corticosteroids) on the patients with severe pneumonia who had significant respiratory distress at presentation and those who showed rapidly progressive pneumonia during oseltamivir treatment. We also found that the pneumonia patients treated with corticosteroids showed the lowest lymphocyte differential and that the severity of pneumonia was associated with the lymphocyte count at presentation. From our findings and previous experimental and clinical studies, we postulated that hyperactive immune cells (T cells) may be involved in the acute lung injury of influenza virus infections, using a hypothesis of 'protein homeostasis system'; the inducers of the cell-mediated immune response are initially produced at the primary immune sites by the innate immune system. These substances reach the lung cells, the main target organ, via the systemic circulation, and possibly the cells of other organs, including myocytes or central nerve system cells, leading to extrapulmonary symptoms (e.g., myalgia and rhabdomyolysis, and encephalopathy). To control these substances that may be possibly toxic to host cells, the adaptive immune reaction may be operated by immune cells, mainly lymphocytes. Hyperimmune reaction of immune cells produces higher levels of cytokines which may be associated with acute lung injury, and may be controlled by early use of immune-modulators. Early initiation and proper dosage of immune

  11. Immune-modulating therapy in acute pancreatitis: Fact or fiction

    PubMed Central

    Akinosoglou, Karolina; Gogos, Charalambos

    2014-01-01

    Acute pancreatitis (AP) is one of the most common diseases of the gastrointestinal tract, bearing significant morbidity and mortality worldwide. Current treatment of AP remains unspecific and supportive and is mainly targeted to aggressively prevent systemic complications and organ failure by intensive care. As acute pancreatitis shares an indistinguishable profile of inflammation with sepsis, therapeutic approaches have turned towards modulating the systemic inflammatory response. Targets, among others, have included pro- and anti-inflammatory modulators, cytokines, chemokines, immune cells, adhesive molecules and platelets. Even though, initial results in experimental models have been encouraging, clinical implementation of immune-regulating therapies in acute pancreatitis has had a slow progress. Main reasons include difficulty in clinical translation of experimental data, poor understanding of inflammatory response time-course, flaws in experimental designs, need for multimodal approaches and commercial drawbacks. Whether immune-modulation in acute pancreatitis remains a fact or just fiction remains to be seen in the future. PMID:25386069

  12. Acidic Mammalian Chitinase Negatively Affects Immune Responses during Acute and Chronic Aspergillus fumigatus Exposure.

    PubMed

    Garth, Jaleesa M; Mackel, Joseph J; Reeder, Kristen M; Blackburn, Jonathan P; Dunaway, Chad W; Yu, Zhihong; Matalon, Sadis; Fitz, Lori; Steele, Chad

    2018-07-01

    Chitin is a polysaccharide that provides structure and rigidity to the cell walls of fungi and insects. Mammals possess multiple chitinases, which function to degrade chitin, thereby supporting a role for chitinases in immune defense. However, chitin degradation has been implicated in the pathogenesis of asthma. Here, we determined the impact of acidic mammalian chitinase (AMCase) ( Chia ) deficiency on host defense during acute exposure to the fungal pathogen Aspergillus fumigatus as well as its contribution to A. fumigatus -associated allergic asthma. We demonstrate that chitin in the fungal cell wall was detected at low levels in A. fumigatus conidia, which emerged at the highest level during hyphal transition. In response to acute A. fumigatus challenge, Chia -/- mice unexpectedly demonstrated lower A. fumigatus lung burdens at 2 days postchallenge. The lower fungal burden correlated with decreased lung interleukin-33 (IL-33) levels yet increased IL-1β and prostaglandin E 2 (PGE 2 ) production, a phenotype that we reported previously to promote the induction of IL-17A and IL-22. During chronic A. fumigatus exposure, AMCase deficiency resulted in lower dynamic and airway lung resistance than in wild-type mice. Improved lung physiology correlated with attenuated levels of the proallergic chemokines CCL17 and CCL22. Surprisingly, examination of inflammatory responses during chronic exposure revealed attenuated IL-17A and IL-22 responses, but not type 2 responses, in the absence of AMCase. Collectively, these data suggest that AMCase functions as a negative regulator of immune responses during acute fungal exposure and is a contributor to fungal asthma severity, putatively via the induction of proinflammatory responses. Copyright © 2018 American Society for Microbiology.

  13. The role of parvovirus B19 and the immune response in the pathogenesis of acute leukemia.

    PubMed

    Kerr, Jonathan R; Mattey, Derek L

    2015-05-01

    In this article, we review the evidence suggesting a possible role for B19 virus in the pathogenesis of a subset of cases of acute leukemia. Human parvovirus B19 infection may complicate the clinical course of patients with acute leukemia and may also precede the development of acute leukemia by up to 180 days. Parvovirus B19 targets erythroblasts in the bone marrow and may cause aplastic crisis in patients with shortened-red cell survival. Aplastic crisis represents a prodrome of acute lymphoblastic leukemia in 2% patients. There is a significant overlap between those HLA classes I and II alleles that are associated with a vigorous immune response and development of symptoms during B19 infection and those HLA alleles that predispose to development of acute leukemia. Acute symptomatic B19 infection is associated with low circulating IL-10 consistent with a vigorous immune response; deficient IL-10 production at birth was recently found to be associated with subsequent development of acute leukemia. Anti-B19 IgG has been associated with a particular profile of methylation of human cancer genes in patients with acute leukemia, suggesting an additional hit and run mechanism. The proposed role for parvovirus B19 in the pathogenesis of acute leukemia fits well with the delayed infection hypothesis and with the two-step mutation model, which describes carriage of the first mutation prior to birth, followed by suppression of hematopoiesis, which allows rapid proliferation of cells harboring the first mutation, acquisition of a second activating mutation, and expansion of cells carrying both mutations, resulting in acute leukemia. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Activation of cellular immune response in acute pancreatitis.

    PubMed Central

    Mora, A; Pérez-Mateo, M; Viedma, J A; Carballo, F; Sánchez-Payá, J; Liras, G

    1997-01-01

    BACKGROUND: Inflammatory mediators have recently been implicated as potential markers of severity in acute pancreatitis. AIMS: To determine the value of neopterin and polymorphonuclear (PMN) elastase as markers of activation of cellular immunity and as early predictors of disease severity. PATIENTS: Fifty two non-consecutive patients classified according to their clinical outcome into mild (n = 26) and severe pancreatitis (n = 26). METHODS: Neopterin in serum and the PMN elastase/A1PI complex in plasma were measured during the first three days of hospital stay. RESULTS: Within three days after the onset of acute pancreatitis, PMN elastase was significantly higher in the severe pancreatitis group. Patients with severe disease also showed significantly higher values of neopterin on days 1 and 2 but not on day 3 compared with patients with mild disease. There was a significant correlation between PMN elastase and neopterin values on days 1 and 2. PMN elastase on day 1 predicted disease severity with a sensitivity of 76.7% and a specificity of 91.6%. Neopterin did not surpass PMN elastase in the probability of predicting disease severity. CONCLUSIONS: These data show that activation of cellular immunity is implicated in the pathogenesis of acute pancreatitis and may be a main contributory factor to disease severity. Neopterin was not superior to PMN elastase in the prediction of severity. PMID:9245935

  15. Immune Responses in Acute and Convalescent Patients with Mild, Moderate and Severe Disease during the 2009 Influenza Pandemic in Norway

    PubMed Central

    Mohn, Kristin G.-I.; Cox, Rebecca Jane; Tunheim, Gro; Berdal, Jan Erik; Hauge, Anna Germundsson; Jul-Larsen, Åsne; Peters, Bjoern; Oftung, Fredrik

    2015-01-01

    Increased understanding of immune responses influencing clinical severity during pandemic influenza infection is important for improved treatment and vaccine development. In this study we recruited 46 adult patients during the 2009 influenza pandemic and characterized humoral and cellular immune responses. Those included were either acute hospitalized or convalescent patients with different disease severities (mild, moderate or severe). In general, protective antibody responses increased with enhanced disease severity. In the acute patients, we found higher levels of TNF-α single-producing CD4+T-cells in the severely ill as compared to patients with moderate disease. Stimulation of peripheral blood mononuclear cells (PBMC) from a subset of acute patients with peptide T-cell epitopes showed significantly lower frequencies of influenza specific CD8+ compared with CD4+ IFN-γ T-cells in acute patients. Both T-cell subsets were predominantly directed against the envelope antigens (HA and NA). However, in the convalescent patients we found high levels of both CD4+ and CD8+ T-cells directed against conserved core antigens (NP, PA, PB, and M). The results indicate that the antigen targets recognized by the T-cell subsets may vary according to the phase of infection. The apparent low levels of cross-reactive CD8+ T-cells recognizing internal antigens in acute hospitalized patients suggest an important role for this T-cell subset in protective immunity against influenza. PMID:26606759

  16. The acute phase response of cod (Gadus morhua L.): expression of immune response genes.

    PubMed

    Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th

    2012-02-01

    An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Immune responses of eastern fence lizards (Sceloporus undulatus) to repeated acute elevation of corticosterone.

    PubMed

    McCormick, Gail L; Langkilde, Tracy

    2014-08-01

    Prolonged elevations of glucocorticoids due to long-duration (chronic) stress can suppress immune function. It is unclear, however, how natural stressors that result in repeated short-duration (acute) stress, such as frequent agonistic social encounters or predator attacks, fit into our current understanding of the immune consequences of stress. Since these types of stressors may activate the immune system due to increased risk of injury, immune suppression may be reduced at sites where individuals are repeatedly exposed to potentially damaging stressors. We tested whether repeated acute elevation of corticosterone (CORT, a glucocorticoid) suppresses immune function in eastern fence lizards (Sceloporus undulatus), and whether this effect varies between lizards from high-stress (high baseline CORT, invaded by predatory fire ants) and low-stress (low baseline CORT, uninvaded) sites. Lizards treated daily with exogenous CORT showed higher hemagglutination of novel proteins by their plasma (a test of constitutive humoral immunity) than control lizards, a pattern that was consistent across sites. There was no significant effect of CORT treatment on bacterial killing ability of plasma. These results suggest that repeated elevations of CORT, which are common in nature, produce immune effects more typical of those expected at the acute end of the acute-chronic spectrum and provide no evidence of modulated consequences of elevated CORT in animals from high-stress sites. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. The role of innate immunity in acute allograft rejection after lung transplantation.

    PubMed

    Palmer, Scott M; Burch, Lauranell H; Davis, R Duane; Herczyk, Walter F; Howell, David N; Reinsmoen, Nancy L; Schwartz, David A

    2003-09-15

    Although innate immunity is crucial to pulmonary host defense and can initiate immune and inflammatory responses independent of adaptive immunity, it remains unstudied in the context of transplant rejection. To investigate the role of innate immunity in the development of allograft rejection, we assessed the impact of two functional polymorphisms in the toll-like receptor 4 (TLR4) associated with endotoxin hyporesponsiveness on the development of acute rejection after human lung transplantation. Patients and donors were screened for the TLR4 Asp299Gly and Thr399Ile polymorphisms by polymerase chain reaction using sequence-specific primers. The rate of acute rejection at 6 months was significantly reduced in recipients, but not in donors, with the Asp299Gly or Thr399Ile alleles as compared with wild type (29 vs. 56%, respectively, p = 0.05). This association was confirmed in Cox proportional hazards and multivariate logistic regression models. Our results suggest activation of innate immunity in lung transplant recipients through TLR4 contributes to the development acute rejection after lung transplantation. Therapies directed at inhibition of innate immune responses mediated by TLR4 may represent a novel and effective means to prevent acute rejection after lung transplantation.

  19. Host immune response and acute disease in a zebrafish model of francisella pathogenesis

    USGS Publications Warehouse

    Vojtech, L.N.; Sanders, G.E.; Conway, C.; Ostland, V.; Hansen, J.D.

    2009-01-01

    Members of the bacterial genus Francisella are highly virulent and infectious pathogens. New models to study Francisella pathogenesis in evolutionarily distinct species are needed to provide comparative insight, as the mechanisms of host resistance and pathogen virulence are not well understood. We took advantage of the recent discovery of a novel species of Francisella to establish a zebrafish/Francisella comparative model of pathogenesis and host immune response. Adult zebraflsh were susceptible to acute Francisella-induced disease and suffered mortality in a dose-dependent manner. Using immunohistochemical analysis, we localized bacterial antigens primarily to lymphoid tissues and livers of zebraflsh following infection by intraperitoneal injection, which corresponded to regions of local cellular necrosis. Francisella sp. bacteria replicated rapidly in these tissues beginning 12 h postinfection, and bacterial titers rose steadily, leveled off, and then decreased by 7 days postinfection. Zebraflsh mounted a significant tissue-specific proinflammatory response to infection as measured by the upregulation of interleukin-l?? (IL-1??), gamma interferon, and tumor necrosis factor alpha mRNA beginning by 6 h postinfection and persisting for up to 7 days postinfection. In addition, exposure of zebraflsh to heat-killed bacteria demonstrated that the significant induction of IL-?? was highly specific to live bacteria. Taken together, the pathology and immune response to acute Francisella infection in zebraflsh share many features with those in mammals, highlighting the usefulness of this new model system for addressing both general and specific questions about Francisella host-pathogen interactions via an evolutionary approach. Copyright ?? 2009, American Society for Microbiology. All Rights Reserved.

  20. The role of the immune system in central nervous system plasticity after acute injury.

    PubMed

    Peruzzotti-Jametti, Luca; Donegá, Matteo; Giusto, Elena; Mallucci, Giulia; Marchetti, Bianca; Pluchino, Stefano

    2014-12-26

    Acute brain injuries cause rapid cell death that activates bidirectional crosstalk between the injured brain and the immune system. In the acute phase, the damaged CNS activates resident and circulating immune cells via the local and systemic release of soluble mediators. This early immune activation is necessary to confine the injured tissue and foster the clearance of cellular debris, thus bringing the inflammatory reaction to a close. In the chronic phase, a sustained immune activation has been described in many CNS disorders, and the degree of this prolonged response has variable effects on spontaneous brain regenerative processes. The challenge for treating acute CNS damage is to understand how to optimally engage and modify these immune responses, thus providing new strategies that will compensate for tissue lost to injury. Herein we have reviewed the available information regarding the role and function of the innate and adaptive immune responses in influencing CNS plasticity during the acute and chronic phases of after injury. We have examined how CNS damage evolves along the activation of main cellular and molecular pathways that are associated with intrinsic repair, neuronal functional plasticity and facilitation of tissue reorganization. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  1. Reovirus-Mediated Cytotoxicity and Enhancement of Innate Immune Responses Against Acute Myeloid Leukemia

    PubMed Central

    Hall, Kathryn; Scott, Karen J.; Rose, Ailsa; Desborough, Michael; Harrington, Kevin; Pandha, Hardev; Parrish, Christopher; Vile, Richard; Coffey, Matt; Bowen, David; Errington-Mais, Fiona

    2012-01-01

    Abstract Reovirus is a naturally occurring oncolytic virus that has shown preclinical efficacy in the treatment of a wide range of tumor types and has now reached phase III testing in clinical trials. The anti-cancer activity of reovirus has been attributed to both its direct oncolytic activity and the enhancement of anti-tumor immune responses. In this study, we have investigated the direct effect of reovirus on acute myeloid leukemia (AML) cells and its potential to enhance innate immune responses against AML, including the testing of primary samples from patients. Reovirus was found to replicate in and kill AML cell lines, and to reduce cell viability in primary AML samples. The pro-inflammatory cytokine interferon alpha (IFNα) and the chemokine (C-C motif) ligand 5 (known as RANTES [regulated upon activation, normal T-cell expressed, and secreted]) were also secreted from AML cells in response to virus treatment. In addition, reovirus-mediated activation of natural killer (NK) cells, within the context of peripheral blood mononuclear cells, stimulated their anti-leukemia response, with increased NK degranulation and IFNγ production and enhanced killing of AML targets. These data suggest that reovirus has the potential as both a direct cytotoxic and an immunotherapeutic agent for the treatment of AML. PMID:23515241

  2. Innate immune response to Burkholderia mallei.

    PubMed

    Saikh, Kamal U; Mott, Tiffany M

    2017-06-01

    Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.

  3. Innate immune response to Burkholderia mallei

    PubMed Central

    Saikh, Kamal U.; Mott, Tiffany M.

    2017-01-01

    Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960

  4. Immune Responses to HCV and Other Hepatitis Viruses

    PubMed Central

    Park, Su-Hyung; Rehermann, Barbara

    2014-01-01

    Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265

  5. The acute transcriptional response of the coral Acropora millepora to immune challenge: expression of GiMAP/IAN genes links the innate immune responses of corals with those of mammals and plants.

    PubMed

    Weiss, Yvonne; Forêt, Sylvain; Hayward, David C; Ainsworth, Tracy; King, Rob; Ball, Eldon E; Miller, David J

    2013-06-14

    As a step towards understanding coral immunity we present the first whole transcriptome analysis of the acute responses of Acropora millepora to challenge with the bacterial cell wall derivative MDP and the viral mimic poly I:C, defined immunogens provoking distinct but well characterised responses in higher animals. These experiments reveal similarities with the responses both of arthropods and mammals, as well as coral-specific effects. The most surprising finding was that MDP specifically induced three members of the GiMAP gene family, which has been implicated in immunity in mammals but is absent from Drosophila and Caenorhabditis. Like their mammalian homologs, GiMAP genes are arranged in a tandem cluster in the coral genome. A phylogenomic survey of this gene family implies ancient origins, multiple independent losses and lineage-specific expansions during animal evolution. Whilst functional convergence cannot be ruled out, GiMAP expression in corals may reflect an ancestral role in immunity, perhaps in phagolysosomal processing.

  6. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    PubMed Central

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  7. Exploring the collaboration between antibiotics and the immune response in the treatment of acute, self-limiting infections.

    PubMed

    Ankomah, Peter; Levin, Bruce R

    2014-06-10

    The successful treatment of bacterial infections is the product of a collaboration between antibiotics and the host's immune defenses. Nevertheless, in the design of antibiotic treatment regimens, few studies have explored the combined action of antibiotics and the immune response to clearing infections. Here, we use mathematical models to examine the collective contribution of antibiotics and the immune response to the treatment of acute, self-limiting bacterial infections. Our models incorporate the pharmacokinetics and pharmacodynamics of the antibiotics, the innate and adaptive immune responses, and the population and evolutionary dynamics of the target bacteria. We consider two extremes for the antibiotic-immune relationship: one in which the efficacy of the immune response in clearing infections is directly proportional to the density of the pathogen; the other in which its action is largely independent of this density. We explore the effect of antibiotic dose, dosing frequency, and term of treatment on the time before clearance of the infection and the likelihood of antibiotic-resistant bacteria emerging and ascending. Our results suggest that, under most conditions, high dose, full-term therapy is more effective than more moderate dosing in promoting the clearance of the infection and decreasing the likelihood of emergence of antibiotic resistance. Our results also indicate that the clinical and evolutionary benefits of increasing antibiotic dose are not indefinite. We discuss the current status of data in support of and in opposition to the predictions of this study, consider those elements that require additional testing, and suggest how they can be tested.

  8. Mucosal Immunity and acute viral gastroenteritis

    PubMed Central

    Rose, Markus A

    2014-01-01

    Acute gastroenteritis is a major killer of the very young worldwide. Rotavirus is the most common intestinal virus, causing acute gastroenteritis and extra-intestinal complications especially in young and chronically ill subjects. As early as 1991, the WHO recommended as high priority the development of a vaccine against rotavirus, the major pathogen causing enteric infections. Since the introduction of rotavirus vaccines for infant immunization programmes in different parts of the world in 2006, vaccination against rotavirus has resulted in substantial declines in severe gastroenteritis. The oral rotavirus vaccines RotaTeq® and Rotarix® are excellent examples for their unique features and principles of mucosal immunization. We elaborate on rotavirus immunity and the success of rotavirus vaccination and aspects also beyond infants’ acute gastroenteritis. PMID:25424826

  9. Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection

    PubMed Central

    2012-01-01

    Background During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. Methods To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Results Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Conclusions Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses. PMID:22873687

  10. Allicin enhances host pro-inflammatory immune responses and protects against acute murine malaria infection.

    PubMed

    Feng, Yonghui; Zhu, Xiaotong; Wang, Qinghui; Jiang, Yongjun; Shang, Hong; Cui, Liwang; Cao, Yaming

    2012-08-08

    During malaria infection, multiple pro-inflammatory mediators including IFN-γ, TNF and nitric oxide (NO) play a crucial role in the protection against the parasites. Modulation of host immunity is an important strategy to improve the outcome of malaria infection. Allicin is the major biologically active component of garlic and shows anti-microbial activity. Allicin is also active against protozoan parasites including Plasmodium, which is thought to be mediated by inhibiting cysteine proteases. In this study, the immunomodulatory activities of allicin were assessed during acute malaria infection using a rodent malaria model Plasmodium yoelii 17XL. To determine whether allicin modulates host immune responses against malaria infection, mice were treated with allicin after infection with P. yoelii 17XL. Mortality was checked daily and parasitaemia was determined every other day. Pro-inflammatory mediators and IL-4 were quantified by ELISA, while NO level was determined by the Griess method. The populations of dendritic cells (DCs), macrophages, CD4+ T and regulatory T cells (Treg) were assessed by FACS. Allicin reduced parasitaemia and prolonged survival of the host in a dose-dependent manner. This effect is at least partially due to improved host immune responses. Results showed that allicin treatment enhanced the production of pro-inflammatory mediators such as IFN-γ, TNF, IL-12p70 and NO. The absolute numbers of CD4+ T cells, DCs and macrophages were significantly higher in allicin-treated mice. In addition, allicin promoted the maturation of CD11c+ DCs, whereas it did not cause major changes in IL-4 and the level of anti-inflammatory cytokine IL-10. Allicin could partially protect host against P. yoelii 17XL through enhancement of the host innate and adaptive immune responses.

  11. Imbalanced immune responses involving inflammatory molecules and immune-related pathways in the lung of acute and subchronic arsenic-exposed mice.

    PubMed

    Li, Jinlong; Zhao, Lu; Zhang, Yang; Li, Wei; Duan, Xiaoxu; Chen, Jinli; Guo, Yuanyuan; Yang, Shan; Sun, Guifan; Li, Bing

    2017-11-01

    treatment. Conclusively, our present study demonstrated both acute and subchronic oral administration of arsenic triggers multiple pulmonary immune responses involving inflammatory molecules and T-cell differentiation, which might be closely associated with the imbalanced redox status and activation of immune-related MAPKs, NF-κB and anti-inflammatory NRF2 pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Host Immune Status and Response to Hepatitis E Virus Infection

    PubMed Central

    Krain, Lisa J.; Nelson, Kenrad E.

    2014-01-01

    SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140

  13. The innate immune response during urinary tract infection and pyelonephritis

    PubMed Central

    Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.

    2013-01-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397

  14. The innate immune response during urinary tract infection and pyelonephritis.

    PubMed

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  15. Innate immune responses following Kawasaki disease and toxic shock syndrome

    PubMed Central

    Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181

  16. Innate immune responses following Kawasaki disease and toxic shock syndrome.

    PubMed

    Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.

  17. Dynamics of Viral and Host Immune Cell MicroRNA Expression during Acute Infectious Mononucleosis

    PubMed Central

    Kaul, Vandana; Weinberg, Kenneth I.; Boyd, Scott D.; Bernstein, Daniel; Esquivel, Carlos O.; Martinez, Olivia M.; Krams, Sheri M.

    2018-01-01

    Epstein–Barr virus (EBV) is the etiological agent of acute infectious mononucleosis (IM). Since acute IM is a self-resolving disease with most patients regaining health in 1–3 weeks there have been few studies examining molecular signatures in early acute stages of the disease. MicroRNAs (miRNAs) have been shown, however, to influence immune cell function and consequently the generation of antibody responses in IM. In this study, we performed a comprehensive analysis of differentially expressed miRNAs in early stage uncomplicated acute IM. miRNAs were profiled from patient peripheral blood obtained at the time of IM diagnosis and at subsequent time points, and pathway analysis performed to identify important immune and cell signaling pathways. We identified 215 differentially regulated miRNAs at the most acute stage of infection when the patients initially sought medical help. The number of differentially expressed miRNAs decreased to 148 and 68 at 1 and 2 months post-primary infection, with no significantly changed miRNAs identified at 7 months post-infection. Interferon signaling, T and B cell signaling and antigen presentation were the top pathways influenced by the miRNAs associated with IM. Thus, a dynamic and regulated expression profile of miRNA accompanies the early acute immune response, and resolution of infection, in IM. PMID:29379474

  18. Immune response

    MedlinePlus

    Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...

  19. Pathology during acute infections: contributions of intracellular pathogens and the CTL response.

    PubMed

    Ganusov, Vitaly V; Antia, Rustom

    2005-06-22

    Previous work has shown how, in the case of cytotoxic T-lymphocyte (CTL) responses to persistent viral infections, pathology may arise as a consequence of cell destruction directly by the virus or indirectly due to the CTL response, leading to maximum pathology at intermediate efficacy of the immune response. We expand these studies to consider pathology arising during acute infections with intracellular pathogens controlled by the CTL response. We show that, in contrast to persistent infections, pathology during acute infections is minimized with increasing efficacy of the immune response. The implications of these results for vaccination are discussed.

  20. Acute injury in the peripheral nervous system triggers an alternative macrophage response

    PubMed Central

    2012-01-01

    Background The activation of the immune system in neurodegeneration has detrimental as well as beneficial effects. Which aspects of this immune response aggravate the neurodegenerative breakdown and which stimulate regeneration remains an open question. To unravel the neuroprotective aspects of the immune system we focused on a model of acute peripheral nerve injury, in which the immune system was shown to be protective. Methods To determine the type of immune response triggered after axotomy of the sciatic nerve, a model for Wallerian degeneration in the peripheral nervous system, we evaluated markers representing the two extremes of a type I and type II immune response (classical vs. alternative) using real-time quantitative polymerase chain reaction (RT-qPCR), western blot, and immunohistochemistry. Results Our results showed that acute peripheral nerve injury triggers an anti-inflammatory and immunosuppressive response, rather than a pro-inflammatory response. This was reflected by the complete absence of classical macrophage markers (iNOS, IFNγ, and IL12p40), and the strong up-regulation of tissue repair markers (arginase-1, Ym1, and Trem2). The signal favoring the alternative macrophage environment was induced immediately after nerve damage and appeared to be established within the nerve, well before the infiltration of macrophages. In addition, negative regulators of the innate immune response, as well as the anti-inflammatory cytokine IL-10 were induced. The strict regulation of the immune system dampens the potential tissue damaging effects of an over-activated response. Conclusions We here demonstrate that acute peripheral nerve injury triggers an inherent protective environment by inducing the M2 phenotype of macrophages and the expression of arginase-1. We believe that the M2 phenotype, associated with a sterile inflammatory response and tissue repair, might explain their neuroprotective capacity. As such, shifting the neurodegeneration-induced immune

  1. Differences in immune responses between CMV-seronegative and -seropositive patients with myocardial ischemia and reperfusion

    PubMed Central

    Shmeleva, Evgeniya V; Boag, Stephen E; Murali, Santosh; Bennaceur, Karim; Das, Rajiv; Egred, Mohaned; Purcell, Ian; Edwards, Richard; Todryk, Stephen; Spyridopoulos, Ioakim

    2015-01-01

    CMV infection is responsible for acceleration of immune senescence and linked to systemic pathologies, including cardiovascular diseases. In this study, we investigated differences in the immune response between CMV-seropositive and seronegative patients undergoing primary percutaneous coronary intervention (PPCI) for acute myocardial infarction (MI). Peripheral blood samples were taken at six different time points: pre-, 15, 30, 90 min, 24 h after PPCI and at 3 months after MI. Absolute counts of lymphocyte subpopulations, immune response to specific and nonspecific stimulation, serum cytokines and levels of CMV-IgG, cardiolipin-IgG, and anti-endothelial cell antibodies were assessed. CMV-seropositive patients with MI showed a twofold higher IFN-γ production to PHA-stimulation, up to 2.5-fold higher levels of IP-10 in serum and up to 30% lower serum levels of IL-16 compared to CMV-seronegative individuals. CMV-seropositive patients could be divided into two subgroups with high (IL-10Hi) and low (IL-10Lo) IL-10 serum levels during the acute stage of MI. The IL-10Hi CMV-seropositive subgroup showed an increased exit of late-differentiated T lymphocytes, NK and NKT-like cells from the circulation, which may potentially enhance cytotoxic damage in the ischemic myocardium. Finally, we did not observe an acceleration of autoimmunity by MI in CMV-seropositive individuals. The immune response during acute MI showed characteristic differences between CMV seronegative and seropositive patients, with a stronger pro-inflammatory response in seropositive patients. The effects of IP-10, IL-16, and IL-10 on characteristics of acute immune responses and formation of different immune profiles in CMV-seropositive individuals require further investigation. PMID:26029366

  2. Acute psychosocial stress differentially influences salivary endocrine and immune measures in undergraduate students.

    PubMed

    Campisi, Jay; Bravo, Yesika; Cole, Jennifer; Gobeil, Kyle

    2012-10-10

    Undergraduate students routinely experience acute psychosocial stress when interviewing for post-collegiate employment. While numerous studies have demonstrated that acute stress can increase release of immune-relevant molecules in blood, fewer studies have examined if acute stress also increases immune-relevant molecules into saliva. Saliva, and the biomolecules found in saliva often serve important immune defense roles and can be used to non-invasively screen for many systemic diseases. Therefore, the current study examined saliva concentrations of endocrine and immune molecules following exposure to an acute psychosocial stressor (mock job interview) in undergraduates. Heart rate, blood pressure, salivary cortisol, salivary immunoglobulin-A (S-IgA), and salivary C-reactive protein (S-CRP) were compared in healthy college undergraduates (n=15) before and after completion of the Trier Social Stress Test (TSST). The TSST induced significant increases in heart rate, systolic blood pressure, and salivary cortisol. Additional analyses revealed a non-significant (p=0.1) increase in the level of S-IgA following the TSST. A significant decrease in S-IgA was observed during the recovery period. No change in S-CRP was observed following the TSST. These results suggest that acute stress experienced by undergraduates when interviewing for a job activates the sympathetic nervous system and hypothalamic-pituitary-adrenal axis and that cortisol levels increase in saliva. Stress-induced elevations in cortisol might be responsible for the decreased S-IgA observed following the recovery period. Collectively, these data provide further insight into the interaction between psychosocial stress, endocrine, and immune functioning. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Immune Responses in Rhinovirus-Induced Asthma Exacerbations.

    PubMed

    Steinke, John W; Borish, Larry

    2016-11-01

    Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.

  4. Acute Morphine Administration Reduces Cell-Mediated Immunity and Induces Reactivation of Latent Herpes Simplex Virus Type 1 in BALB/c Mice

    PubMed Central

    Mojadadi, Shafi; Jamali, Abbas; Khansarinejad, Behzad; Soleimanjahi, Hoorieh; Bamdad, Taravat

    2009-01-01

    Acute morphine administration is known to alter the course of herpes simplex virus infection. In this study, the effect of acute morphine administration on the reactivation of latent herpes was investigated in a mouse model. Because of the important role of cytolytic T lymphocyte (CTL) activity in the inhibition of herpes simplex virus type 1 (HSV-1) reactivation, the effect of acute morphine administration on CTL responses was also evaluated. Furthermore, lymphocyte proliferation and IFN-γ production were evaluated for their roles in the induction of the CTL response. The findings showed that acute morphine administration significantly reduced CTL responses, lymphocyte proliferation, and IFN-γ production. Furthermore, acute morphine administration has been shown to reactivate latent HSV-1. Previous studies have shown that cellular immune responses have important roles in the inhibition of HSV reactivation. These findings suggest that suppression of a portion of the cellular immune response after acute morphine administration may constitute one part of the mechanism that induces HSV reactivation. PMID:19403060

  5. Characterization of the local immune response to cyst antigens during the acute and elimination phases of primary murine giardiasis.

    PubMed

    Abdul-Wahid, Aws; Faubert, Gaétan

    2008-05-01

    During the course of a giardial infection, the host's immune system is presented with a variety of Giardia antigens as trophozoites differentiate, through encysting cells, to form the infective cysts. Previous studies examining the host's immune response during giardial infections have focused on trophozoite-derived antigens (Ags). In this study, we were interested to determine if the host's immune system reacts to cyst Ags during the acute and elimination phases, when there is cyst shedding. For this purpose, we used antigenic extracts from trophozoites (Troph), encysting cells (ENC), and purified giardial cyst walls (PCW), as well as purified recombinant cyst wall protein 2 (rCWP2). Comparative analysis of the parasite extracts using SDS-PAGE analysis and surface-enhanced laser desorption/ionization time of flight mass spectrometry resulted in the detection of 175 protein entities, of which 26 were Troph-specific proteins, 17 ENC-specific proteins, and 31 were PCW-specific proteins. On the other hand, we detected 34 proteins shared between Troph and ENC, 19 proteins that were shared between ENC and PCW, and 29 proteins that were common to Troph and PCW. Finally, we detected 19 proteins that were shared by all three extract samples. BALB/c mice were infected with 10(5)Giardia muris cysts and sacrificed either at the acute or elimination phases of infection (days 12 and 40, respectively), and lymphocytes were isolated from the Peyer's patches (PP). Using flow cytometry, we detected significant increases in the number of PP-derived CD4(+) and CD19(+), but not CD8(+) lymphocytes. Quantification of the number of mucosal IL-4 and IFN-gamma secreting T-lymphocytes by enzyme-linked immunosorbent spot assay showed that these cells reacted by secreting similar levels of IL-4 and IFN-gamma, regardless of the Ag or the phase of infection. Analysis of intestinal humoral immune responses by ELISA resulted in the detection of Ag-specific IgA and IgG intestinal antibodies

  6. Immune Responses to HIV and SIV in Mucosal Tissues: “Location, Location, Location”

    PubMed Central

    Shacklett, Barbara L.

    2010-01-01

    Purpose of review This review summarizes research literature regarding mucosal immunity to HIV and SIV, with an emphasis on work published within the past 18 months. Recent findings Notable recent studies have focused on the pivotal events occurring within mucosal tissues during acute HIV/SIV infection that serve to establish a balance between detrimental immune activation and beneficial adaptive responses. In cervicovaginal mucosa, an early inflammatory response leads to recruitment of susceptible target cells. At this acute stage, the in vivo ratio between CD8+ effector cells and infected CD4+ T-cells may be critical for limiting viral dissemination. Acute infection is also accompanied by loss of germinal center architecture and T/B cell apoptosis in Peyer’s patches of the gastrointestinal tract. During chronic infection, mucosal CD8+ T-cells may play a role in immune control, as suggested by studies of elite controllers. Summary Mucosal tissues serve as the major portal of entry for HIV, and house a majority of the body’s lymphocytes, including CD4+ T-cells that are targets for infection. Recent studies have focused renewed attention on events occurring immediately after transmission, and underscore the concept that the balance between inflammation and protective immunity is established by host responses in mucosal tissues. PMID:20543589

  7. The intensity of radiotherapy-elicited immune response is associated with esophageal cancer clearance.

    PubMed

    Ma, Jin-lu; Jin, Long; Li, Yao-Dong; He, Chen-chen; Guo, Xi-jing; Liu, Rui; Yang, Yun-Yi; Han, Su-xia

    2014-01-01

    Radiation therapy is one of the standard therapeutic modalities for esophageal cancer, achieving its main antitumor efficacy through DNA damage. However, accumulating evidence shows that radiotherapy can substantially alter the tumor microenvironment, particularly with respect to its effects on immune cells. We hypothesized that the immune response elicited by radiotherapy may be as important as the radiation itself for successful treatment. More specifically, immunomodulatory cytokines may enhance the effectiveness of radiotherapy. To investigate this hypothesis, we measured changes in the serum interferon-gamma (IFN- γ ) and interleukin-2 (IL-2) concentrations during radiotherapy and compared these modifications with outcomes. We found that serum concentrations of IL-2 and IFN- γ were positively associated with local response to radiotherapy in esophageal cancer. More generally, the intensity of the radiotherapy-elicited immune response was positively associated with local response to radiotherapy in esophageal cancer. Changes in serum IL-2 and IFN- γ concentrations were further associated with increased risks of acute hematologic toxicity and acute organ toxicity of the esophagus, lung, and skin. These results suggest that deciphering the mechanisms of radiotherapy-elicited immune response may help in the development of therapeutic interventions that would enhance the efficacy of radiotherapy and convert some ineffective responses to effective responses.

  8. Effect of nanovaccine chemistry on humoral immune response kinetics and maturation

    NASA Astrophysics Data System (ADS)

    Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji

    2014-10-01

    Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry

  9. Toll-Like Receptor 3 Signaling via TRIF Contributes to a Protective Innate Immune Response to Severe Acute Respiratory Syndrome Coronavirus Infection

    PubMed Central

    Totura, Allison L.; Whitmore, Alan; Agnihothram, Sudhakar; Schäfer, Alexandra; Katze, Michael G.; Heise, Mark T.

    2015-01-01

    ABSTRACT Toll-like receptors (TLRs) are sensors that recognize molecular patterns from viruses, bacteria, and fungi to initiate innate immune responses to invading pathogens. The emergence of highly pathogenic coronaviruses severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) is a concern for global public health, as there is a lack of efficacious vaccine platforms and antiviral therapeutic strategies. Previously, it was shown that MyD88, an adaptor protein necessary for signaling by multiple TLRs, is a required component of the innate immune response to mouse-adapted SARS-CoV infection in vivo. Here, we demonstrate that TLR3−/−, TLR4−/−, and TRAM−/− mice are more susceptible to SARS-CoV than wild-type mice but experience only transient weight loss with no mortality in response to infection. In contrast, mice deficient in the TLR3/TLR4 adaptor TRIF are highly susceptible to SARS-CoV infection, showing increased weight loss, mortality, reduced lung function, increased lung pathology, and higher viral titers. Distinct alterations in inflammation were present in TRIF−/− mice infected with SARS-CoV, including excess infiltration of neutrophils and inflammatory cell types that correlate with increased pathology of other known causes of acute respiratory distress syndrome (ARDS), including influenza virus infections. Aberrant proinflammatory cytokine, chemokine, and interferon-stimulated gene (ISG) signaling programs were also noted following infection of TRIF−/− mice that were similar to those seen in human patients with poor disease outcome following SARS-CoV or MERS-CoV infection. These findings highlight the importance of TLR adaptor signaling in generating a balanced protective innate immune response to highly pathogenic coronavirus infections. PMID:26015500

  10. Leptospirosis in human: Biomarkers in host immune responses.

    PubMed

    Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha

    2018-03-01

    Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    PubMed

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  12. Immune- and Nonimmune-Compartment-Specific Interferon Responses Are Critical Determinants of Herpes Simplex Virus-Induced Generalized Infections and Acute Liver Failure.

    PubMed

    Parker, Zachary M; Pasieka, Tracy Jo; Parker, George A; Leib, David A

    2016-12-01

    The interferon (IFN) response to viral pathogens is critical for host survival. In humans and mouse models, defects in IFN responses can result in lethal herpes simplex virus 1 (HSV-1) infections, usually from encephalitis. Although rare, HSV-1 can also cause fulminant hepatic failure, which is often fatal. Although herpes simplex encephalitis has been extensively studied, HSV-1 generalized infections and subsequent acute liver failure are less well understood. We previously demonstrated that IFN-αβγR -/- mice are exquisitely susceptible to liver infection following corneal infection with HSV-1. In this study, we used bone marrow chimeras of IFN-αβγR -/- (AG129) and wild-type (WT; 129SvEv) mice to probe the underlying IFN-dependent mechanisms that control HSV-1 pathogenesis. After infection, WT mice with either IFN-αβγR -/- or WT marrow exhibited comparable survival, while IFN-αβγR -/- mice with WT marrow had a significant survival advantage over their counterparts with IFN-αβγR -/- marrow. Furthermore, using bioluminescent imaging to maximize data acquisition, we showed that the transfer of IFN-competent hematopoietic cells controlled HSV-1 replication and damage in the livers of IFN-αβγR -/- mice. Consistent with this, the inability of IFN-αβγR -/- immune cells to control liver infection in IFN-αβγR -/- mice manifested as profoundly elevated aspartate transaminase (AST) and alanine transaminase (ALT) levels, indicative of severe liver damage. In contrast, IFN-αβγR -/- mice receiving WT marrow exhibited only modest elevations of AST and ALT levels. These studies indicate that IFN responsiveness of the immune system is a major determinant of viral tropism and damage during visceral HSV infections. Herpes simplex virus 1 (HSV-1) infection is an incurable viral infection with the most significant morbidity and mortality occurring in neonates and patients with compromised immune systems. Severe pathologies from HSV include the blindness

  13. Immune thrombocytopenic purpura in a child with acute lymphoblastic leukemia and mumps.

    PubMed

    Kurekci, A Emin; Atay, A Avni; Demirkaya, Erkan; Sarici, S Umit; Ozcan, Okan

    2006-03-01

    Immune thrombocytopenic purpura in childhood is characterized by a typical history of acute development of purpura and bruising in an otherwise healthy child. In children it usually follows a viral infection (eg, mumps, rubella) or immunization. We report for the first time a child with acute lymphoblastic leukemia who developed immune thrombocytopenic purpura due to mumps during the maintenance phase of acute lymphoblastic leukemia treatment.

  14. Malnutrition: Modulator of Immune Responses in Tuberculosis

    PubMed Central

    Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth

    2017-01-01

    Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710

  15. Dietary astaxanthin enhances immune response in dogs.

    PubMed

    Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon

    2011-04-15

    No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Stressed (acute) mice display neuroimmunodysregulation and defective innate immune response against coliform infection.

    PubMed

    Mehrzad, Jalil; Shajari, Majid; Saleh-Moghaddam, Massoud; Sarmad-Nabavi, Mohammad

    2015-09-01

    We examined the impact of acute restraint stress (ARS) with(out) intraperitoneal E. coli infection on TLR4 mRNA abundance in brain and spleen, clinical signs, cytokines and oxidative loads and peritoneal E. coli growth in balb/c mice. ARS exacerbated E. coli virulence and behavioral abnormality. At different post-stress hour the pattern and intensity of TLR4 activity differed in brain and spleen. While TLR4 stimulation in spleen of E. coli-infected mice was maximal, it superseded in brain of post-stressed E. coli-infected mice. ARS and E. coli infection elicited systemic pro-inflammatory and pro-oxidant status, with defective peritoneal E. coli clearance in post-ARS mice. Continuous TLR4 activation in post-stressed mice partially disarms innate immune response, and contributes to inappropriate host-E. coli interactions and thus neuroimmune dysregulation/toxicity. The description of these observed novel effects induced by ARS will provide a basis for deeper investigations of the effects from increasingly stress-oriented rural/urban life upon neuroimmune system. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

    2010-02-01

    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  18. New perspectives on central and peripheral immune responses to acute traumatic brain injury

    PubMed Central

    2012-01-01

    Traumatic injury to the brain (TBI) results in a complex set of responses involving various symptoms and long-term consequences. TBI of any form can cause cognitive, behavioral and immunologic changes in later life, which underscores the problem of underdiagnosis of mild TBI that can cause long-term neurological deficits. TBI disrupts the blood–brain barrier (BBB) leading to infiltration of immune cells into the brain and subsequent inflammation and neurodegeneration. TBI-induced peripheral immune responses can also result in multiorgan damage. Despite worldwide research efforts, the methods of diagnosis, monitoring and treatment for TBI are still relatively ineffective. In this review, we delve into the mechanism of how TBI-induced central and peripheral immune responses affect the disease outcome and discuss recent developments in the continuing effort to combat the consequences of TBI and new ways to enhance repair of the damaged brain. PMID:23061919

  19. IL-21 Therapy Controls Immune Activation and Maintains Antiviral CD8+ T Cell Responses in Acute Simian Immunodeficiency Virus Infection.

    PubMed

    Méndez-Lagares, Gema; Lu, Ding; Merriam, David; Baker, Christopher A; Villinger, François; Van Rompay, Koen K A; McCune, Joseph M; Hartigan-O'Connor, Dennis J

    2017-11-01

    Human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) replicate during acute infection in lymphocytes of the gastrointestinal tract, before disseminating systemically. Localized replication and associated loss of gut-resident CD4 + T cells occur regardless of the portal of entry of the virus (e.g., intravenous vs. rectal). Thus, HIV and SIV are tropic for gut tissue, and their pathogenesis requires the special environment of the intestine. T helper 17 (Th17) cells are important contributors to microbial defense in the gut that are vulnerable to HIV infection and whose loss is associated with translocation of microbial products to the systemic circulation, leading to chronic immune activation and disease progression. Interleukin (IL)-21 promotes differentiation and survival of Th17 cells and stimulates CD8 + T cell function. By promoting Th17 cell survival, IL-21 could limit bacterial translocation and immune activation in the setting of acute or rebounding HIV/SIV disease. In this study, we tested the effect of recombinant IL-21-IgFc treatment, given at the time of infection, on SIV mac251 infection. We found that rIL-21-IgFc decreases immune activation and maintains effective antiviral responses by CD8 + T cells in blood, but this maintenance is not associated with lower viral loads. rIL-21-IgFc treatment also did not generally support Th17 cell populations, but Th17 cells remained strongly and independently associated with control of plasma viremia. For example, the single animal exhibiting greatest control over viremia in our study also manifested the highest levels of IL-21 in plasma, Th17 cell maintenance in blood, and Th17 cells in intestinal tissue. These findings provide rationale for further exploration of IL-21 treatment as a support for host CD8 + T cell responses in HIV cure strategies.

  20. Systemic inflammatory response following acute myocardial infarction

    PubMed Central

    Fang, Lu; Moore, Xiao-Lei; Dart, Anthony M; Wang, Le-Min

    2015-01-01

    Acute cardiomyocyte necrosis in the infarcted heart generates damage-associated molecular patterns, activating complement and toll-like receptor/interleukin-1 signaling, and triggering an intense inflammatory response. Inflammasomes also recognize danger signals and mediate sterile inflammatory response following acute myocardial infarction (AMI). Inflammatory response serves to repair the heart, but excessive inflammation leads to adverse left ventricular remodeling and heart failure. In addition to local inflammation, profound systemic inflammation response has been documented in patients with AMI, which includes elevation of circulating inflammatory cytokines, chemokines and cell adhesion molecules, and activation of peripheral leukocytes and platelets. The excessive inflammatory response could be caused by a deregulated immune system. AMI is also associated with bone marrow activation and spleen monocytopoiesis, which sustains a continuous supply of monocytes at the site of inflammation. Accumulating evidence has shown that systemic inflammation aggravates atherosclerosis and markers for systemic inflammation are predictors of adverse clinical outcomes (such as death, recurrent myocardial infarction, and heart failure) in patients with AMI. PMID:26089856

  1. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.

    PubMed

    Griffin, Diane E

    2016-10-12

    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.

  2. Stressor-Specific Alterations in Corticosterone and Immune Responses in Mice

    PubMed Central

    Bowers, Stephanie L.; Bilbo, Staci D.; Dhabhar, Firdaus S.; Nelson, Randy J.

    2007-01-01

    Different stressors likely elicit different physiological and behavioral responses. Previously reported differences in the effects of stressors on immune function may reflect qualitatively different physiological responses to stressors; alternatively, both large and subtle differences in testing protocols and methods among laboratories may make direct comparisons among studies difficult. Here we examine the effects of chronic stressors on plasma corticosterone concentrations, leukocyte redistribution, and skin delayed-type hypersensitivity (DTH) and the effects of acute stressors on plasma corticosterone and leukocyte redistribution. The effects of several commonly used laboratory stressors including restraint, forced swim, isolation, and low ambient temperatures (4°C) were examined. Exposure to each stressor elevated corticosterone concentrations, with restraint (a putative psychological stressor) evoking a significantly higher glucocorticoid response than other stressors. Chronic restraint and forced swim enhanced the DTH response compared to the handled, low temperature, or isolation conditions. Restraint, low temperature, and isolation significantly increased trafficking of lymphocytes and monocytes compared to forced swim or handling. Generally, acute restraint, low temperature, isolation, and handling increased trafficking of lymphocytes and monocytes. Considered together, our results suggest that the different stressors commonly used in psychoneuroimmunology research may not activate the physiological stress response to the same extent. The variation observed in the measured immune responses may reflect differential glucocorticoid activation, differential metabolic adjustments, or both processes in response to specific stressors. PMID:17890050

  3. Transient immune deficiency in patients with acute Epstein-Barr virus infection.

    PubMed

    Junker, A K; Ochs, H D; Clark, E A; Puterman, M L; Wedgwood, R J

    1986-09-01

    To study the effect of primary Epstein-Barr virus (EBV) infection on antigen-specific antibody production, we immunized 17 college students who had developed acute infectious mononucleosis with the T-cell dependent neoantigen bacteriophage phi X174. During the early phase of infectious mononucleosis, the proportion of peripheral blood lymphocytes displaying Ia and T8 (CD8) phenotypes was increased and the T helper/suppressor (T4/T8) ratio was decreased (less than 1). These abnormalities disappeared during the convalescent phase. Correlating with EBV-induced changes in T lymphocytes, we demonstrated depressed humoral immune responses to bacteriophage phi X174 both in vivo and in vitro. In vitro coculture experiments indicated that the Ia+ suppressor T cells could inhibit antibody production and isotype switch. Removal of T8+ lymphocytes from patient T cells normalized in vitro antibody synthesis. In addition, impaired B-cell function was shown to be in part responsible for deficient antibody production. These studies demonstrate that infection with EBV affects both B and T lymphocytes and causes a broad-based transient immune deficiency in patients with uncomplicated infectious mononucleosis.

  4. Host Immune Responses That Promote Initial HIV Spread

    DTIC Science & Technology

    2011-07-01

    exposure to virus and peak viremia. The vaginal mucosa is the most common site of infection and vaccine strategies focus mainly on promoting...spread to the lymph node specifically in the acute phase, i.e., upon vaginal inoculation. The resulting mathematical model is based on mechanistic...for early immune response to SIV and HIV infection are generally assumed to be similar and are described as follows. Virus enters the vaginal lumen and

  5. The role of microglia and myeloid immune cells in acute cerebral ischemia

    PubMed Central

    Benakis, Corinne; Garcia-Bonilla, Lidia; Iadecola, Costantino; Anrather, Josef

    2015-01-01

    The immune response to acute cerebral ischemia is a major contributor to stroke pathobiology. The inflammatory response is characterized by the participation of brain resident cells and peripheral leukocytes. Microglia in the brain and monocytes/neutrophils in the periphery have a prominent role in initiating, sustaining and resolving post-ischemic inflammation. In this review we aim to summarize recent literature concerning the origins, fate and role of microglia, monocytes and neutrophils in models of cerebral ischemia and to discuss their relevance for human stroke. PMID:25642168

  6. Cytokine polymorphisms have a synergistic effect on severity of the acute sickness response to infection.

    PubMed

    Vollmer-Conna, Uté; Piraino, Barbara F; Cameron, Barbara; Davenport, Tracey; Hickie, Ian; Wakefield, Denis; Lloyd, Andrew R

    2008-12-01

    Functional polymorphisms in immune response genes are increasingly recognized as important contributors to the marked individual differences in susceptibility to and outcomes of infectious disease. The acute sickness response is a stereotypical set of illness manifestations mediated by the proinflammatory cytokines induced by many different pathogens. The genetic determinants of severity of the acute sickness response have not previously been explored. We examined the impact of functional polymorphisms in cytokine genes with critical roles in the early immune response (tumor necrosis factor-alpha, interleukin-6, interleukin-10, and interferon-gamma) on the severity and duration of illness following acute infection with Epstein-Barr virus, Coxiella burnetii (the causative agent of Q fever), or Ross River virus. We found that the interferon-gamma +874T/A and the interleukin-10 -592C/A polymorphisms significantly affected illness severity, cytokine protein levels, and the duration of illness. These cytokine genotypes acted in synergy to potentiate their influence on disease outcomes. These findings suggest that genetically determined variations in the intensity of the inflammatory response underpin the severity of the acute sickness response and predict the recovery time across varied infections.

  7. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    PubMed

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  8. Antioxidant defense system, immune response and erythron profile modulation in gold fish, Carassius auratus, after acute manganese treatment.

    PubMed

    Aliko, Valbona; Qirjo, Mihallaq; Sula, Eldores; Morina, Valon; Faggio, Caterina

    2018-05-01

    The manganese contamination has become a global problem, recently, because it is perceived as a real threat to the human health and the environment. It is well-known that overexposure to Mn 2+ may have negative physiological effects on fish and other organisms inhabiting heavy metal polluted waters. To the best of our knowledge, studies relating with manganese effects on fish antioxidant enzyme response in the blood, immunocompetence and erythron profile alteration, are scarce. In this study, the acute sub-lethal effects of manganese on blood antioxidant response, immune status and erythron profile were determined by exposing the freshwater model organism, Carassius auratus, to two doses of this metal (3.88 ± 0.193 mg/L and 7.52 ± 0.234 mg/L Mn 2+ ) for 96 h. Significant increases in blood antioxidant enzyme activity like superoxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST), were observed in fish exposed to manganese. Furthermore, plasmatic glucose and cortisol levels increased, while total protein decreased significantly. White blood cell differential count revealed a significant increase in monocyte and neutrophil number and a significant decrease of lymphocyte's number in fish exposed to manganese compared with those of control group. That can be considered as a clear evidence of altered immune system. Measured of erythron profile revealed a significant increasing of cellular and nuclear alteration of red blood cells, with karryorhectic, dividing and micronucleated erythrocytes in exposed fish, indicating the cytotoxic and genotoxic effects Mn 2+ ions. Our data shown also that manganese could trigger antioxidant response, modulate immune response and induce erythron profile modification leading to eryptosis, compromising the blood oxygen carrying capacity, and overall health status in fish. This may suggest those parameters consider as useful biomarkers for monitoring effects of sub-lethal metal exposure on fish

  9. Dietary phytosterols modulate T-helper immune response but do not induce apparent anti-inflammatory effects in a mouse model of acute, aseptic inflammation.

    PubMed

    Calpe-Berdiel, Laura; Escolà-Gil, Joan Carles; Benítez, Sonia; Bancells, Cristina; González-Sastre, Francesc; Palomer, Xavier; Blanco-Vaca, Francisco

    2007-05-01

    Although most studies have focused on the cholesterol-lowering activity of phytosterols, other biological actions have been ascribed to these plant sterol compounds, one of which is a potential immune modulatory effect. To gain insight into this issue, we used a mouse model of acute, aseptic inflammation induced by a single subcutaneous turpentine injection. Hypercholesterolemic apolipoprotein E-deficient (apoE(-/-)) mice, fed with or without a 2% phytosterol supplement, were treated with turpentine or saline and euthanized 48 h later. No differences were observed in spleen lymphocyte subsets between phytosterol- and control-fed apoE(-/-) mice. However, cultured spleen lymphocytes of apoE(-/-) mice fed with phytosterols and treated with turpentine showed increased IL-2 and IFN-gamma secretion (T-helper type1, Th1 lymphocyte cytokines) compared with turpentine-treated, control-fed animals. In contrast, there was no change in Th2 cytokines IL-4 and IL-10. Phytosterols also inhibit intestinal cholesterol absorption in wild-type C57BL/6J mice but, in this case, without decreasing plasma cholesterol. Spleen lymphocytes of turpentine-treated C57BL/6J mice fed with phytosterols also showed increased IL-2 production, but IFN-gamma, IL-4 and IL-10 production was unchanged. The Th1/Th2 ratio was significantly increased both in phytosterol-fed apoE(-/-) and C57BL/6J mice. We conclude that phytosterols modulate the T-helper immune response in vivo, in part independently of their hypocholesterolemic effect in a setting of acute, aseptic inflammation. Further study of phytosterol effects on immune-based diseases characterized by an exacerbated Th2 response is thus of interest.

  10. Assessment of the innate immune response in the periparturient cow.

    PubMed

    Trevisi, Erminio; Minuti, Andrea

    2018-02-01

    The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Behavioural fever is a synergic signal amplifying the innate immune response.

    PubMed

    Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S

    2013-09-07

    Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.

  12. Dynamics of the cytotoxic T cell response to a model of acute viral infection.

    PubMed

    DeWitt, William S; Emerson, Ryan O; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H; McElrath, Juliana; Makar, Karen W; Wald, Anna; Robins, Harlan S

    2015-04-01

    A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8(+) T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8(+) T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼ 2,000 CD8(+) T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we extend this

  13. Dynamics of the Cytotoxic T Cell Response to a Model of Acute Viral Infection

    PubMed Central

    DeWitt, William S.; Emerson, Ryan O.; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M.; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H.; McElrath, Juliana; Makar, Karen W.; Wald, Anna

    2015-01-01

    ABSTRACT A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8+ T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8+ T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼2,000 CD8+ T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. IMPORTANCE The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we

  14. Hippocampal protection in mice with an attenuated inflammatory monocyte response to acute CNS picornavirus infection

    PubMed Central

    Howe, Charles L.; LaFrance-Corey, Reghann G.; Sundsbak, Rhianna S.; Sauer, Brian M.; LaFrance, Stephanie J.; Buenz, Eric J.; Schmalstieg, William F.

    2012-01-01

    Neuronal injury during acute viral infection of the brain is associated with the development of persistent cognitive deficits and seizures in humans. In C57BL/6 mice acutely infected with the Theiler's murine encephalomyelitis virus, hippocampal CA1 neurons are injured by a rapid innate immune response, resulting in profound memory deficits. In contrast, infected SJL and B6xSJL F1 hybrid mice exhibit essentially complete hippocampal and memory preservation. Analysis of brain-infiltrating leukocytes revealed that SJL mice mount a sharply attenuated inflammatory monocyte response as compared to B6 mice. Bone marrow transplantation experiments isolated the attenuation to the SJL immune system. Adoptive transfer of B6 inflammatory monocytes into acutely infected B6xSJL hosts converted these mice to a hippocampal damage phenotype and induced a cognitive deficit marked by failure to recognize a novel object. These findings show that inflammatory monocytes are the critical cellular mediator of hippocampal injury during acute picornavirus infection of the brain. PMID:22848791

  15. Analysis of adrenocortical secretory responses during acute an prolonged immune stimulation in inflammation-susceptible and -resistant rat strains.

    PubMed

    Andersson, I M; Lorentzen, J C; Ericsson-Dahlstrand, A

    2000-11-01

    Endogenous corticosterone secreted during immune challenge restricts the inflammatory process and genetic variations in this neuroendocrine-immune dialogue have been suggested to influence an individuals sensitivity to develop chronic inflammatory disorders. We have tested inflammation-susceptible Dark Agouti (DA) rats and resistant, MHC-identical, PVG.1AV1 rats for their abilities to secrete corticosterone in response to acute challenge with bacterial lipopolysaccharide (LPS) or a prolonged activation of the nonspecific immune system with arthritogenic yeast beta-glucan. Intravenous injection of LPS triggered equipotent secretion of corticosterone in both rat strains. Interestingly, peak concentrations of corticosterone did not differ significantly between the strains. Intradermal injection of beta-glucan caused severe, monophasic, polyarthritis in DA rats while PVG.1AV1 responded with significantly milder joint inflammation. Importantly, serial sampling of plasma from glucan-injected DA and PVG.1AV1 rats did not reveal elevated concentrations of plasma corticosterone at any time from days 1-30 postinjection compared to preinjection values, in spite of the ongoing inflammatory process. Interestingly, adrenalectomized, beta-glucan-challenged DA rats responded with an aggravated arthritic process, indicating an anti-inflammatory role for the basal levels of corticosterone that were detected in intact DA rats challenged with beta-glucan. Moreover, substitution with subcutaneous corticosterone-secreting pellets, yielding moderate stress-levels, significantly attenuated the arthritic response. In contrast, adrenalectomized and glucan-challenged PVG.1AV1 rats did not respond with an elevated arthritic response, suggesting that these rats contain the arthritic process via corticosterone-independent mechanisms. In conclusion, the hypothalamic-pituitary-adrenal axis in both rat strains exhibited strong activation after challenge with LPS. This contrasted to the basal

  16. Immune response and histology of humoral rejection in kidney transplantation.

    PubMed

    González-Molina, Miguel; Ruiz-Esteban, Pedro; Caballero, Abelardo; Burgos, Dolores; Cabello, Mercedes; Leon, Miriam; Fuentes, Laura; Hernandez, Domingo

    2016-01-01

    The adaptive immune response forms the basis of allograft rejection. Its weapons are direct cellular cytotoxicity, identified from the beginning of organ transplantation, and/or antibodies, limited to hyperacute rejection by preformed antibodies and not as an allogenic response. This resulted in allogenic response being thought for decades to have just a cellular origin. But the experimental studies by Gorer demonstrating tissue damage in allografts due to antibodies secreted by B lymphocytes activated against polymorphic molecules were disregarded. The special coexistence of binding and unbinding between antibodies and antigens of the endothelial cell membranes has been the cause of the delay in demonstrating the humoral allogenic response. The endothelium, the target tissue of antibodies, has a high turnover, and antigen-antibody binding is non-covalent. If endothelial cells are attacked by the humoral response, immunoglobulins are rapidly removed from their surface by shedding and/or internalization, as well as degrading the components of the complement system by the action of MCP, DAF and CD59. Thus, the presence of complement proteins in the membrane of endothelial cells is transient. In fact, the acute form of antibody-mediated rejection was not demonstrated until C4d complement fragment deposition was identified, which is the only component that binds covalently to endothelial cells. This review examines the relationship between humoral immune response and the types of acute and chronic histological lesion shown on biopsy of the transplanted organ. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  17. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  18. Suppression of Virus Specific Immune Responses by IL-10 in Acute Dengue Infection

    PubMed Central

    Malavige, Gathsaurie Neelika; Jeewandara, Chandima; Alles, K. M. Luckmaal; Salimi, Maryam; Gomes, Laksiri; Kamaladasa, Achala; Jayaratne, S. D.; Ogg, Graham Stuart

    2013-01-01

    Background Elevated IL-10 has been shown to be associated with severe dengue infection (DI). We proceeded to investigate the role of IL-10 in the pathogenesis of acute DI. Materials and methods Ex vivo and cultured IFNγ ELISpot assays for dengue virus (DENV) NS3 protein and non dengue viral proteins were carried out in 26 patients with acute DI (16 with dengue haemorrhagic fever) and 12 healthy dengue seropositive individuals from Sri Lanka. DENV serotype specific (SS) responses were determined by using a panel of SS peptides. Results Serum IL-10 level were significantly higher (p = 0.02) in those who did not have in vitro responses to DENV-SS peptides (mean 144.2 pg/ml) when compared to those who responded (mean 75.7 pg/ml). DENV-NS3 specific ex vivo IFNγ ELISpot responses were also significantly lower (p = 0.0001) in those who did not respond to DENV-SS peptides (mean 42 SFU/million PBMCs) when compared to those who responded to DENV-SS peptides (mean 1024 SFU/million PBMCs). Serum IL-10 levels correlated significantly (p = 0.03) and inversely (Spearmans R = −0.45) with ex vivo DENV-NS3 specific responses but not with ex vivo non DENV specific responses (Spearmans R = −014, p = 0.52). Blockage of IL-10 in vitro significantly increased (p = 0.04) the ex vivo IFNγ ELISpot DENV-NS3 specific responses but had no effect on responses to non DENV proteins. Conclusion IL-10 appears to contribute to the pathogenesis of acute dengue infections by inhibiting DENV-specific T cell responses, which can be restored by blocking IL-10. PMID:24040431

  19. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  20. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  1. Immune responses to HTLV-I(ACH) during acute infection of pig-tailed macaques.

    PubMed

    McGinn, Therese M; Wei, Qing; Stallworth, Jackie; Fultz, Patricia N

    2004-04-01

    Human T cell lymphotropic virus type 1 (HTLV-I) is causally linked to adult T cell leukemia/lymphoma (ATL) and a chronic progressive neurological disease, HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A nonhuman primate model that reproduces disease symptoms seen in HTLV-I-infected humans might facilitate identification of initial immune responses to the virus and an understanding of pathogenic mechanisms in HTLV-I-related disease. Previously, we showed that infection of pig-tailed macaques with HTLV-I(ACH) is associated with multiple signs of disease characteristic of both HAM/TSP and ATL. We report here that within the first few weeks after HTLV-I(ACH) infection of pig-tailed macaques, serum concentrations of interferon (IFN)-alpha increased and interleukin-12 decreased transiently, levels of nitric oxide were elevated, and activation of CD4(+) and CD8(+) lymphocytes and CD16(+) natural killer cells in peripheral blood were observed. HTLV-I(ACH) infection elicited virus-specific antibodies in all four animals within 4 to 6 weeks; however, Tax-specific lymphoproliferative responses were not detected until 25-29 weeks after infection in all four macaques. IFN-gamma production by peripheral blood cells stimulated with a Tax or Gag peptide was detected to varying degrees in all four animals by ELISPOT assay. Peripheral blood lymphocytes from one animal that developed only a marginal antigen-specific cellular response were unresponsive to mitogen stimulation during the last few weeks preceding its death from a rapidly progressive disease syndrome associated with HTLV-I(ACH) infection of pig-tailed macaques. The results show that during the first few months after HTLV-I(ACH) infection, activation of both innate and adaptive immunity, limited virus-specific cellular responses, sustained immune system activation, and, in some cases, immunodeficiency were evident. Thus, this animal model might be valuable for understanding early stages of infection

  2. Maternal immune response to helminth infection during pregnancy determines offspring susceptibility to allergic airway inflammation.

    PubMed

    Straubinger, Kathrin; Paul, Sabine; Prazeres da Costa, Olivia; Ritter, Manuel; Buch, Thorsten; Busch, Dirk H; Layland, Laura E; Prazeres da Costa, Clarissa U

    2014-12-01

    Schistosomiasis, a chronic helminth infection, elicits distinct immune responses within the host, ranging from an initial TH1 and subsequent TH2 phase to a regulatory state, and is associated with dampened allergic reactions within the host. We sought to evaluate whether non-transplacental helminth infection during pregnancy alters the offspring's susceptibility to allergy. Ovalbumin-induced allergic airway inflammation was analyzed in offspring from Schistosoma mansoni-infected mothers mated during the TH1, TH2, or regulatory phase of infection. Embryos derived from in vitro fertilized oocytes of acutely infected females were transferred into uninfected foster mice to determine the role of placental environment. The fetomaternal unit was further characterized by helminth-specific immune responses and microarray analyses. Eventually, IFN-γ-deficient mice were infected to evaluate the role of this predominant cytokine on the offspring's allergy phenotype. We demonstrate that offspring from schistosome-infected mothers that were mated in the TH1 and regulatory phases, but not the TH2 immune phase, are protected against the onset of allergic airway inflammation. Interestingly, these effects were associated with distinctly altered schistosome-specific cytokine and gene expression profiles within the fetomaternal interface. Furthermore, we identified that it is not the transfer of helminth antigens but rather maternally derived IFN-γ during the acute phase of infection that is essential for the progeny's protective immune phenotype. Overall, we present a novel immune phase-dependent coherency between the maternal immune responses during schistosomiasis and the progeny's predisposition to allergy. Therefore, we propose to include helminth-mediated transmaternal immune modulation into the expanded hygiene hypothesis. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. [Three levels of stress reaction of the immune system in an acute infectious process in children (facts and a hypothesis)].

    PubMed

    Zheleznikova, G F

    1997-01-01

    Three variants of immune response (IR) in children with acute respiratory viral infections are determined and characterized in detail: the difference between these shows in the level of specific antibody production as well as in the non-specific immune suppression which is tested by lymphocyte blast transformation to phytogemagglutinin. According to our hypothesis, this phenomenon may by explained as a manifestation of three types of neuroendocrine IR regulation corresponding to three levels of immune system stress response. The proof of genetic and physiological factors involvement in the process of choosing any type of IR is adduced. The important role of ontogenetic development of cooperation between immune and nervous systems in IR variants formation is emphasized.

  4. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.

    PubMed

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T

    2013-11-01

    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  5. Polyomavirus Reactivation and Immune Responses to Kidney-Specific Self-Antigens in Transplantation.

    PubMed

    Seifert, Michael E; Gunasekaran, Muthukumar; Horwedel, Timothy A; Daloul, Reem; Storch, Gregory A; Mohanakumar, Thalachallour; Brennan, Daniel C

    2017-04-01

    Humoral immune responses against donor antigens are important determinants of long-term transplant outcomes. Reactivation of the polyomavirus BK has been associated with de novo antibodies against mismatched donor HLA antigens in kidney transplantation. The effect of polyomavirus reactivation (BK viremia or JC viruria) on antibodies to kidney-specific self-antigens is unknown. We previously reported excellent 5-year outcomes after minimization of immunosuppression for BK viremia and after no intervention for JC viruria. Here, we report the 10-year results of this trial ( n =193) along with a nested case-control study ( n =40) to explore associations between polyomavirus reactivation and immune responses to the self-antigens fibronectin (FN) and collagen type-IV (Col-IV). Consistent with 5-year findings, subjects taking tacrolimus, compared with those taking cyclosporin, had less acute rejection (11% versus 22%, P =0.05) and graft loss (9% versus 22%, P =0.01) along with better transplant function (eGFR 65±19 versus 50±24 ml/min per 1.73 m 2 , P <0.001) at 10 years. Subjects undergoing immunosuppression reduction for BK viremia had 10-year outcomes similar to those without viremia. In the case-control study, antibodies to FN/Col-IV were more prevalent during year 1 in subjects with polyomavirus reactivation than in those without reactivation (48% versus 11%, P= 0.04). Subjects with antibodies to FN/Col-IV had more acute rejection than did those without these antibodies (38% versus 8%, P =0.02). These data demonstrate the long-term safety and effectiveness of minimizing immunosuppression to treat BK viremia. Furthermore, these results indicate that polyomavirus reactivation associates with immune responses to kidney-specific self-antigens that may increase the risk for acute rejection through unclear mechanisms. Copyright © 2017 by the American Society of Nephrology.

  6. Innate and Adaptive Immune Responses during Acute M. tuberculosis Infection in Adult Household Contacts in Kampala, Uganda

    PubMed Central

    Mahan, C. Scott; Zalwango, Sarah; Thiel, Bonnie A.; Malone, LaShaunda L.; Chervenak, Keith A.; Baseke, Joy; Dobbs, Dennis; Stein, Catherine M.; Mayanja, Harriet; Joloba, Moses; Whalen, Christopher C.; Boom, W. Henry

    2012-01-01

    Contacts of active pulmonary tuberculosis (TB) patients are at risk for Mycobacterium tuberculosis (MTB) infection. Because most infections are controlled, studies during MTB infection provide insight into protective immunity. We compared immune responses of adult household contacts that did and did not convert the tuberculin skin test (TST). Innate and adaptive immune responses were measured by whole blood assay. Responses of TST converters (TSTC) were compared with persistently TST negative contacts (PTST–) and contacts who were TST+ at baseline (TST+). TLR-2, TLR-4, and IFN-γR responses to IFN-γ did not differ between the groups, nor did γδ T cell responses. T cell responses to MTB antigens differed markedly among TSTC, PTST–, and TST+ contacts. Thus, no differences in innate responses were found among the three household contact groups. However, adaptive T cell responses to MTB antigens did differ before and during MTB infection among PTST–, TSTC, and TST+ contacts. PMID:22492155

  7. Acute Immune-Inflammatory Responses to a Single Bout of Aerobic Exercise in Smokers; The Effect of Smoking History and Status

    PubMed Central

    Kastelein, Tegan Emma; Duffield, Rob; Marino, Frank E.

    2015-01-01

    This study examined the acute immune and inflammatory responses to exercise in smokers compared to non-smokers, and further, the effect of smoking history on these immune-inflammatory responses. Fifty-four recreationally active males who were either smokers (SM; n = 27) or non-smokers (NS; n = 27) were allocated into either young (YSM, YNS) or middle-aged groups (MSM, MNS) based on smoking status. Participants were matched for fitness and smoking habits and following familiarization and baseline testing, undertook an exercise protocol that involved 40 min of cycle ergometry at 50% of VO2peak. Venous blood was obtained pre- and post- (0 min, 1, and 4 h) exercise to measure circulating leukocytes and inflammatory markers interleukin (IL)-6, IL-1β, IL-1ra, and monocyte chemoattractant protein-1 (MCP-1). Compared to MNS, MSM showed elevated basal concentrations of MCP-1, which were increased with a longer smoking history (P < 0.05). In response to exercise, YSM demonstrated an amplified IL-6 response from immediately- to 1 h-post compared to YNS. Furthermore, IL-1ra in YSM was elevated above that of YNS across all time points (P < 0.05). The MSM group had higher IL-1β at baseline when compared to YSM, although IL-1ra was greater for YSM at baseline (P < 0.05). Finally, the post-exercise leukocyte response was greater in MSM compared to YSM and non-smokers (P < 0.05). In conclusion, smoker’s exhibit elevated MCP-1 and IL-1β that seem to be evident with a longer smoking history (~15 years). Furthermore, the differences in exercise-induced inflammatory responses noted in YSM may be indicative tobacco smoke exposure priming circulating leukocytes to amplify inflammatory responses. PMID:26779179

  8. Differential immune response in the hard clam (mercenaria mercenaria) against bacteria and the protistan pathogen QPX (quahog parasite unknown).

    PubMed

    Perrigault, Mickael; Allam, Bassem

    2012-06-01

    The immune response of the hard clam (quahog) Mercenaria mercenaria following challenge with live bacteria (Vibrio alginolyticus) and the protist QPX (Quahog Parasite Unknown) was investigated. The study also compared immune responses following QPX challenge in two different hard clam broodstocks exhibiting different degrees of susceptibility toward this parasite. Different immune and stress-related cellular and humoral factors were assessed including general hemocyte parameters (total and differential hemocyte counts, percentage of dead cells, reactive oxygen production, phagocytosis), parameters geared toward QPX (anti-QPX activity in plasma and hemocyte resistance to the cytotoxicity of QPX extracellular products). Two genes (ferritin and metallothionein) previously shown to be modulated following QPX exposure were molecularly characterized by rapid amplification of cDNA ends (RACE) and their transcription levels were determined in resistant and susceptible clams in response to QPX and bacterial challenge. Results indicated that both V. alginolyticus and QPX challenge triggered significant immune responses in clams with similar trends for most measured parameters. However, specific responses were observed for anti-QPX activity in plasma and hemocyte resistance to QPX products as well as ferritin and metallothionein expression according to each inoculum. Similarly, different response patterns were detected following QPX challenge in susceptible and resistant clam stocks. Resistant clams were able to elicit effective response against the parasite leading to the elimination of QPX and the restoration of constitutive immune status whereas QPX-susceptible clams triggered a strong immune modulation characterized by an acute phase response and associated acute phase protein but appeared to be less active in eliminating the parasite. These results suggest that different signaling pathways are triggered during V. alginolyticus and QPX challenge. Moreover, differences in

  9. The Hepatitis C Virus Glycan Shield and Evasion of the Humoral Immune Response

    PubMed Central

    Helle, François; Duverlie, Gilles; Dubuisson, Jean

    2011-01-01

    Despite the induction of effective immune responses, 80% of hepatitis C virus (HCV)-infected individuals progress from acute to chronic hepatitis. In contrast to the cellular immune response, the role of the humoral immune response in HCV clearance is still subject to debate. Indeed, HCV escapes neutralizing antibodies in chronically infected patients and reinfection has been described in human and chimpanzee. Studies of antibody-mediated HCV neutralization have long been hampered by the lack of cell-culture-derived virus and the absence of a small animal model. However, the development of surrogate models and recent progress in HCV propagation in vitro now enable robust neutralization assays to be performed. These advances are beginning to shed some light on the mechanisms of HCV neutralization. This review summarizes the current state of knowledge of the viral targets of anti-HCV-neutralizing antibodies and the mechanisms that enable HCV to evade the humoral immune response. The recent description of the HCV glycan shield that reduces the immunogenicity of envelope proteins and masks conserved neutralizing epitopes at their surface constitutes the major focus of this review. PMID:22069522

  10. Diminished neutrophil extracellular trap (NET) formation is a novel innate immune deficiency induced by acute ethanol exposure in polymicrobial sepsis, which can be rescued by CXCL1

    PubMed Central

    Jin, Liliang; Batra, Sanjay

    2017-01-01

    Polymicrobial sepsis is the result of an exaggerated host immune response to bacterial pathogens. Animal models and human studies demonstrate that alcohol intoxication is a key risk factor for sepsis-induced mortality. Multiple chemokines, such as CXCL1, CXCL2 and CXCL5 are critical for neutrophil recruitment and proper function of neutrophils. However, it is not quite clear the mechanisms by which acute alcohol suppresses immune responses and whether alcohol-induced immunosuppression can be rescued by chemokines. Thus, we assessed whether acute ethanol challenge via gavage diminishes antibacterial host defense in a sepsis model using cecal ligation and puncture (CLP) and whether this immunosuppression can be rescued by exogenous CXCL1. We found acute alcohol intoxication augments mortality and enhances bacterial growth in mice following CLP. Ethanol exposure impairs critical antibacterial functions of mouse and human neutrophils including reactive oxygen species production, neutrophil extracellular trap (NET) formation, and NET-mediated killing in response to both Gram-negative (E. coli) and Gram-positive (Staphylococcus aureus) pathogens. As compared with WT (C57Bl/6) mice, CXCL1 knockout mice display early mortality following acute alcohol exposure followed by CLP. Recombinant CXCL1 (rCXCL1) in acute alcohol challenged CLP mice increases survival, enhances bacterial clearance, improves neutrophil recruitment, and enhances NET formation (NETosis). Recombinant CXCL1 (rCXCL1) administration also augments bacterial killing by alcohol-treated and E. coli- and S. aureus-infected neutrophils. Taken together, our data unveils novel mechanisms underlying acute alcohol-induced dysregulation of the immune responses in polymicrobial sepsis, and CXCL1 is a critical mediator to rescue alcohol-induced immune dysregulation in polymicrobial sepsis. PMID:28922428

  11. Anti-tumor immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.

    2009-06-01

    Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp

  12. Immune oncology, immune responsiveness and the theory of everything.

    PubMed

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  13. Dynamic range of Nef-mediated evasion of HLA class II-restricted immune responses in early HIV-1 infection.

    PubMed

    Mahiti, Macdonald; Brumme, Zabrina L; Jessen, Heiko; Brockman, Mark A; Ueno, Takamasa

    2015-07-31

    HLA class II-restricted CD4(+) T lymphocytes play an important role in controlling HIV-1 replication, especially in the acute/early infection stage. But, HIV-1 Nef counteracts this immune response by down-regulating HLA-DR and up-regulating the invariant chain associated with immature HLA-II (Ii). Although functional heterogeneity of various Nef activities, including down-regulation of HLA class I (HLA-I), is well documented, our understanding of Nef-mediated evasion of HLA-II-restricted immune responses during acute/early infection remains limited. Here, we examined the ability of Nef clones from 47 subjects with acute/early progressive infection and 46 subjects with chronic progressive infection to up-regulate Ii and down-regulate HLA-DR and HLA-I from the surface of HIV-infected cells. HLA-I down-regulation function was preserved among acute/early Nef clones, whereas both HLA-DR down-regulation and Ii up-regulation functions displayed relatively broad dynamic ranges. Nef's ability to down-regulate HLA-DR and up-regulate Ii correlated positively at this stage, suggesting they are functionally linked in vivo. Acute/early Nef clones also exhibited higher HLA-DR down-regulation and lower Ii up-regulation functions compared to chronic Nef clones. Taken together, our results support enhanced Nef-mediated HLA class II immune evasion activities in acute/early compared to chronic infection, highlighting the potential importance of these functions following transmission. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Class II obese and healthy pregnant controls exhibit indistinguishable pro‐ and anti‐inflammatory immune responses to Caesarian section

    PubMed Central

    Graham, Caroline; Thorleifson, Mullein; Stefura, William P.; Funk, Duane J.

    2017-01-01

    Abstract Introduction Obesity during pregnancy is associated with meta‐inflammation and an increased likelihood of clinical complications. Surgery results in intense, acute inflammatory responses in any individual. Because obese individuals exhibit constitutive inflammatory responses and high rates of Caesarian section, it is important to understand the impact of surgery in such populations. Whether more pronounced pro‐inflammatory cytokine responses and/or counterbalancing changes in anti‐inflammatory immune modulators occurs is unknown. Here we investigated innate immune capacity in vivo and in vitro in non‐obese, term‐pregnant controls versus healthy, term‐pregnant obese women (Class II, BMI 35–40). Methods Systemic in vivo induction of eleven pro‐ and anti‐inflammatory biomarkers and acute phase proteins was assessed in plasma immediately prior to and again following Caesarian section surgery. Independently, innate immune capacity was examined by stimulating freshly isolated PBMC in vitro with a panel of defined PRR‐ligands for TLR4, TLR8, TLR3, and RLR 24 h post‐surgery. Results The kinetics and magnitude of the in vivo inflammatory responses examined were indistinguishable in the two populations across the broad range of biomarkers examined, despite the fact that obese women had higher baseline inflammatory status. Deliberate in vitro stimulation with a range of PRR ligands also elicited pro‐ and anti‐inflammatory cytokine responses that were indistinguishable between control and obese mothers. Conclusions Acute in vivo innate immune responses to C‐section, as well as subsequent in vitro stimulation with a panel of microbial mimics, are not detectably altered in Class II obese women. The data argue that while Class II obesity is undesirable, it has minimal impact on the in vivo inflammatory response, or innate immunomodulatory capacity, in women selecting C‐section. PMID:28544689

  15. Immune System and Kidney Transplantation.

    PubMed

    Shrestha, Badri Man

    2017-01-01

    The immune system recognises a transplanted kidney as foreign body and mounts immune response through cellular and humoral mechanisms leading to acute or chronic rejection, which ultimately results in graft loss. Over the last five decades, there have been significant advances in the understanding of the immune responses to transplanted organs in both experimental and clinical transplant settings. Modulation of the immune response by using immunosuppressive agents has led to successful outcomes after kidney transplantation. The paper provides an overview of the general organisation and function of human immune system, immune response to kidney transplantation, and the current practice of immunosuppressive therapy in kidney transplantation in the United Kingdom.

  16. Toll immune signal activates cellular immune response via eicosanoids.

    PubMed

    Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun

    2018-07-01

    Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Immune cell inflammatory cytokine responses differ between central and systemic compartments in response to acute exercise in mice.

    PubMed

    Pervaiz, Nabeel; Hoffman-Goetz, Laurie

    2012-01-01

    Exhaustive exercise induces apoptosis and oxidative stress in systemic organs and tissues and is associated with increased levels of pro-inflammatory cytokines. The effects of acute exercise on cytokine expression and apoptosis of immune cells in the central nervous system (CNS) have not been well characterized. We investigated the effects of a single bout of strenuous exercise on the expression of TNF-alpha, IL-6, and IL-beta, as well as the apoptotic status of cells in the hippocampus of healthy mice. To compare central vs. systemic differences, cytokine expression in the intestinal lymphocytes of a subset of mice were also assessed. Female C57BL/6 mice were divided into three groups: sedentary controls (NOTREAD) (n = 22), treadmill exercise with immediate sacrifice (TREAD-Imm) (n = 21), or treadmill exercise with sacrifice after 2 hours (TREAD-2h). TNF-alpha, IL-6, and IL-1beta expression in the hippocampus and intestinal lymphocytes were measured by Western blot analysis. Percentages of hippocampal cells undergoing apoptosis (Annexin+) or necrosis (Propidium Iodide+) were determined through flow cytometry. Plasma levels of 8-isoprostane and corticosterone were measured using commercially available EIA kits. Acute treadmill exercise led to significant decreases in TNF-alpha (p<0.05) and increases in IL-6 (p<0.05) expression in the hippocampus of healthy mice. No effects of acute exercise on the apoptotic status of hippocampal cells were observed. In intestinal lymphocytes, the exercise bout led to significant increases in TNF-alpha (p<0.05), IL-6 (p<0.05), and IL-1beta (p<0.05). Acute exercise was associated with a significant increase in both plasma 8-isoprostane (p<0.05) and corticosterone (p<0.05) levels. Acute exercise differentially affects the pattern ofpro-inflammatory cytokine expression in the hippocampus compared to intestinal lymphocytes and, further, does not induce apoptosis in hippocampal cells.

  18. T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.

    PubMed

    Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua

    2018-05-09

    B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.

  19. Genomic Circuitry Underlying Immunological Response to Pediatric Acute Respiratory Infection.

    PubMed

    Henrickson, Sarah E; Manne, Sasikanth; Dolfi, Douglas V; Mansfield, Kathleen D; Parkhouse, Kaela; Mistry, Rakesh D; Alpern, Elizabeth R; Hensley, Scott E; Sullivan, Kathleen E; Coffin, Susan E; Wherry, E John

    2018-01-09

    Acute respiratory tract viral infections (ARTIs) cause significant morbidity and mortality. CD8 T cells are fundamental to host responses, but transcriptional alterations underlying anti-viral mechanisms and links to clinical characteristics remain unclear. CD8 T cell transcriptional circuitry in acutely ill pediatric patients with influenza-like illness was distinct for different viral pathogens. Although changes included expected upregulation of interferon-stimulated genes (ISGs), transcriptional downregulation was prominent upon exposure to innate immune signals in early IFV infection. Network analysis linked changes to severity of infection, asthma, sex, and age. An influenza pediatric signature (IPS) distinguished acute influenza from other ARTIs and outperformed other influenza prediction gene lists. The IPS allowed a deeper investigation of the connection between transcriptional alterations and clinical characteristics of acute illness, including age-based differences in circuits connecting the STAT1/2 pathway to ISGs. A CD8 T cell-focused systems immunology approach in pediatrics identified age-based alterations in ARTI host response pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological

  1. Redox rhythm reinforces the circadian clock to gate immune response.

    PubMed

    Zhou, Mian; Wang, Wei; Karapetyan, Sargis; Mwimba, Musoki; Marqués, Jorge; Buchler, Nicolas E; Dong, Xinnian

    2015-07-23

    Recent studies have shown that in addition to the transcriptional circadian clock, many organisms, including Arabidopsis, have a circadian redox rhythm driven by the organism's metabolic activities. It has been hypothesized that the redox rhythm is linked to the circadian clock, but the mechanism and the biological significance of this link have only begun to be investigated. Here we report that the master immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) of Arabidopsis is a sensor of the plant's redox state and regulates transcription of core circadian clock genes even in the absence of pathogen challenge. Surprisingly, acute perturbation in the redox status triggered by the immune signal salicylic acid does not compromise the circadian clock but rather leads to its reinforcement. Mathematical modelling and subsequent experiments show that NPR1 reinforces the circadian clock without changing the period by regulating both the morning and the evening clock genes. This balanced network architecture helps plants gate their immune responses towards the morning and minimize costs on growth at night. Our study demonstrates how a sensitive redox rhythm interacts with a robust circadian clock to ensure proper responsiveness to environmental stimuli without compromising fitness of the organism.

  2. Tilapia show immunization response against Ich

    USDA-ARS?s Scientific Manuscript database

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  3. The immune response to human CMV

    PubMed Central

    La Rosa, Corinna; Diamond, Don J

    2012-01-01

    This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079

  4. Serum Immune Responses Predict Rapid Disease Progression among Children with Crohn’s Disease: Immune Responses Predict Disease Progression

    PubMed Central

    Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying

    2007-01-01

    BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844

  5. Cellular immune responses to HIV

    NASA Astrophysics Data System (ADS)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.

    2001-04-01

    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  6. 3,4-Methylenedioxymethamphetamine (MDMA) alters acute gammaherpesvirus burden and limits Interleukin 27 responses in a mouse model of viral infection

    PubMed Central

    Nelson, Daniel A.; Singh, Sam J.; Young, Amy B.; Tolbert, Melanie D.; Bost, Kenneth L.

    2011-01-01

    Aims To test whether 3,4-methylenedioxymethamphetamine (MDMA, “Ecstasy”) abuse might increase the susceptibility, or alter the immune response, to murine gammaherpesvirus 68 (HV-68) and/or bacterial lipopolysaccharide. Methods Groups of experimental and control mice were subjected to three day binges of MDMA, and the effect of this drug abuse on acute and latent HV-68 viral burden were assessed. In vitro and in vivo studies were also performed to assess the MDMA effect on IL-27 expression in virally infected or LPS-exposed macrophages and dendritic cells, and latently infected animals, exposed to this drug of abuse. Results Acute viral burden was significantly increased in MDMA-treated mice when compared to controls. However the latent viral burden, and physiological and behavioral responses were not altered in infected mice despite repeated bingeing with MDMA. MDMA could limit the IL-27 response of HV-68 infected or LPS-exposed macrophages and dendritic cells in vitro and in vivo, demonstrating the ability of this drug to alter normal cytokine responses in the context of a viral infection and/or a TLR4 agonist. Conclusion MDMA bingeing could alter the host’s immune response resulting in greater acute viral replication and reductions in the production of the cytokine, IL-27 during immune responses. PMID:21269783

  7. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    PubMed Central

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  8. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.

    PubMed

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  9. Effect of major abdominal surgery on the host immune response to infection.

    PubMed

    Buttenschoen, Klaus; Fathimani, Kamran; Buttenschoen, Daniela Carli

    2010-06-01

    The present review summarizes key studies on the effects of major abdominal surgery on the host response to infection published during the last 18 months. Surgical trauma causes stereotyped systemic proinflammatory and compensatory anti-inflammatory reactions. It is leukocyte reprogramming rather than general immune suppression. The list of recent findings is long. Preoperative infectious challenge was found to increase survival. Obesity is associated with increased production of interleukin-17A in peritonitis. Abdominal surgery alters expression of toll-like receptors (TLRs). The acute phase reaction down-regulates the transcription factor carbohydrate response element binding protein. Myosin light chain kinase activation is a final pathway of acute tight junction regulation of gut barrier and zonula occludens 1 protein is an essential effector. The brain is involved in regulating the immune and gut system. Elimination of lipopolysaccharide is challenging. Th1/Th2 ratio is lowered in patients with postoperative complications. Cholinergic anti-inflammatory pathways can inhibit tissue damage. The new substance PXL01 prevents adhesions. Postoperative infection causes incisional hernias. Hypothermia reduced human leukocyte antigen DR surface expression and delayed tumor necrosis factor clearance. Systems biology identified interferon regulatory factor 3 as the negative regulator of TLR signaling. Protective immunity could contribute defeating surgical infections. Systemic inflammation is the usual response to trauma. All organs seem to be involved and linked up in cybernetic systems aiming at reconstitution of homeostasis. Although knowledge is still fragmentary, it is already difficult to integrate known facts and new technologies are required for information processing. Defining criteria to develop therapeutic strategies requires much more insight into molecular mechanisms and cybernetics of organ systems.

  10. Undernutrition, the Acute Phase Response to Infection, and Its Effects on Micronutrient Status Indicators12

    PubMed Central

    Bresnahan, Kara A.; Tanumihardjo, Sherry A.

    2014-01-01

    Infection and undernutrition are prevalent in developing countries and demonstrate a synergistic relation. Undernutrition increases infection-related morbidity and mortality. The acute phase response (APR) is an innate, systemic inflammatory reaction to a wide array of disruptions in a host’s homeostasis, including infection. Released from immune cells in response to deleterious stimuli, proinflammatory cytokines act on distant tissues to induce behavioral (e.g., anorexia, weakness, and fatigue) and systemic effects of the APR. Cytokines act to increase energy and protein requirements to manifest fever and support hepatic acute phase protein (APP) production. Blood concentrations of glucose and lipid are augmented to provide energy to immune cells in response to cytokines. Additionally, infection decreases intestinal absorption of nutrients and can cause direct loss of micronutrients. Traditional indicators of iron, zinc, and vitamin A status are altered during the APR, leading to inaccurate estimations of deficiency in populations with a high or unknown prevalence of infection. Blood concentrations of APPs can be measured in nutrition interventions to assess the time stage and severity of infection and correct for the APR; however, standardized cutoffs for nutrition applications are needed. Protein-energy malnutrition leads to increased gut permeability to pathogens, abnormal immune cell populations, and impaired APP response. Micronutrient deficiencies cause specific immune impairments that affect both innate and adaptive responses. This review describes the antagonistic interaction between the APR and nutritional status and emphasizes the need for integrated interventions to address undernutrition and to reduce disease burden in developing countries. PMID:25398733

  11. Anti-Donor Immune Responses Elicited by Allogeneic Mesenchymal Stem Cells and Their Extracellular Vesicles: Are We Still Learning?

    PubMed Central

    Lohan, Paul; Treacy, Oliver; Griffin, Matthew D.; Ritter, Thomas; Ryan, Aideen E.

    2017-01-01

    Mesenchymal stromal cells (MSC) have been used to treat a broad range of disease indications such as acute and chronic inflammatory disorders, autoimmune diseases, and transplant rejection due to their potent immunosuppressive/anti-inflammatory properties. The breadth of their usage is due in no small part to the vast quantity of published studies showing their ability to modulate multiple immune cell types of both the innate and adaptive immune response. While patient-derived (autologous) MSC may be the safer choice in terms of avoiding unwanted immune responses, factors including donor comorbidities may preclude these cells from use. In these situations, allogeneic MSC derived from genetically unrelated individuals must be used. While allogeneic MSC were initially believed to be immune-privileged, substantial evidence now exists to prove otherwise with multiple studies documenting specific cellular and humoral immune responses against donor antigens following administration of these cells. In this article, we will review recent published studies using non-manipulated, inflammatory molecule-activated (licensed) and differentiated allogeneic MSC, as well as MSC extracellular vesicles focusing on the immune responses to these cells and whether or not such responses have an impact on allogeneic MSC-mediated safety and efficacy. PMID:29225601

  12. Acute Loss of Apolipoprotein E Triggers an Autoimmune Response That Accelerates Atherosclerosis.

    PubMed

    Centa, Monica; Prokopec, Kajsa E; Garimella, Manasa G; Habir, Katrin; Hofste, Lisa; Stark, Julian M; Dahdah, Albert; Tibbit, Chris A; Polyzos, Konstantinos A; Gisterå, Anton; Johansson, Daniel K; Maeda, Nobuyo N; Hansson, Göran K; Ketelhuth, Daniel F J; Coquet, Jonathan M; Binder, Christoph J; Karlsson, Mikael C I; Malin, Stephen

    2018-06-07

    Dyslipidemia is a component of the metabolic syndrome, an established risk factor for atherosclerotic cardiovascular disease, and is also observed in various autoimmune and chronic inflammatory conditions. However, there are limited opportunities to study the impact of acquired dyslipidemia on cardiovascular and immune pathology. We designed a model system that allows for the conversion to a state of acute hyperlipidemia in adult life, so that the consequences of such a transition could be observed, through conditionally deleting APOE (apolipoprotein E) in the adult mouse. The transition to hypercholesterolemia was accompanied by adaptive immune responses, including the expansion of T lymphocyte helper cell 1, T follicular helper cell, and T regulatory subsets and the formation of germinal centers. Unlike steady-state Apoe -deficientmice, abrupt loss of APOE induced rapid production of antibodies recognizing rheumatoid disease autoantigens. Genetic ablation of the germinal center reduced both autoimmunity and atherosclerosis, indicating that the immune response that follows loss of APOE is independent of atherosclerosis but nevertheless promotes plaque development. Our findings suggest that immune activation in response to hyperlipidemia could contribute to a wide range of inflammatory autoimmune diseases, including atherosclerosis. © 2018 American Heart Association, Inc.

  13. In utero exposure to lipopolysaccharide alters the postnatal acute phase response in beef heifers

    USDA-ARS?s Scientific Manuscript database

    This study was designed to determine the potential effect of prenatal lipopolysaccharide (LPS) exposure on the postnatal acute phase response (APR) to an LPS challenge in heifers. Pregnant crossbred cows (n = 50) were separated into prenatal immune stimulation (PIS; n = 25; administered 0.1 microgr...

  14. Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.

    PubMed

    Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita

    2007-04-01

    The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.

  15. Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish

    PubMed Central

    Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita

    2010-01-01

    Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783

  16. T-cell-mediated immune response to respiratory coronaviruses

    PubMed Central

    Channappanavar, Rudragouda; Zhao, Jincun; Perlman, Stanley

    2014-01-01

    Emerging respiratory coronaviruses such as the Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and Middle East Respiratory Syndrome coronavirus (MERS-CoV) pose potential biological threats to humans. SARS and MERS are manifested as severe atypical pneumonia associated with high morbidity and mortality in humans. The majority of studies carried out in SARS-CoV-infected humans and animals attribute a dysregulated/exuberant innate response as a leading contributor to SARS-CoV-mediated pathology. A decade after the 2002–2003 SARS epidemic, we do not have any approved preventive or therapeutic agents available in case of re-emergence of SARS-CoV or other related viruses. A strong neutralizing antibody response generated against the spike (S) glycoprotein of SARS-CoV is completely protective in the susceptible host. However, neutralizing antibody titers and the memory B cell response are short-lived in SARS-recovered patients and the antibody will target primary homologous strain. Interestingly, the acute phase of SARS in humans is associated with a severe reduction in the number of T cells in the blood. Surprisingly, only a limited number of studies have explored the role of the T cell-mediated adaptive immune response in respiratory coronavirus pathogenesis. In this review, we discuss the role of anti-virus CD4 and CD8 T cells during respiratory coronavirus infections with a special emphasis on emerging coronaviruses. PMID:24845462

  17. Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.

    PubMed

    VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H

    1996-04-01

    Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.

  18. Human Innate Immune Responses to Hexamethylene Diisocyanate (HDI) and HDI-Albumin Conjugates

    PubMed Central

    Wisnewski, Adam V.; Liu, Qing; Liu, Jian; Redlich, Carrie A.

    2011-01-01

    Background Isocyanates, a leading cause of occupational asthma, are known to induce adaptive immune responses; however, innate immune responses, which generally precede and regulate adaptive immunity, remain largely uncharacterized. Objective Identify and characterize cellular, molecular and systemic innate immune responses induced by hexamethylene diisocyanate (HDI). Methods Human peripheral blood mononuclear cells (PBMCs) were stimulated in vitro with HDI-albumin conjugates or control antigen, and changes in phenotype, gene, and protein expression were characterized by flow cytometry, microarray, Western blot and ELISA. Cell uptake of isocyanate was visualized microscopically using HDI-albumin conjugates prepared with fluorescently-labeled albumin. In vivo, human HDI exposure was performed via specific inhalation challenge, and subsequent changes in PBMCs and serum proteins were measured by flow cytometry and ELISA. Genotypes were determined by PCR. Results Human monocytes take-up HDI-albumin conjugates and undergo marked changes in morphology and gene/protein expression in vitro. The most significant (p 0.007 – 0.05) changes in mircoarray gene expression were noted in lysosomal genes, especially peptidases and proton pumps involved in antigen processing. Chemokines that regulate monocyte/macrophage trafficking (MIF, MCP-1), and pattern recognition receptors that bind chitin (chitinases) and oxidized low-density lipoprotein (CD68) were also increased following isocyanate-albumin exposure. In vivo, HDI exposed subjects exhibited an acute increase in the percentage of PBMCs with the same HDI-albumin responsive phenotype characterized in vitro (HLA-DR+/CD11c+ with altered light scatter properties). An exposure-dependent decrease (46±11%; p<0.015) in serum concentrations of chitinase-3-like-1 was also observed, in individuals that lack the major (type 1) human chitinase (due to genetic polymorphism), but not in individuals possessing at least one functional

  19. A Novel Model of Asymptomatic Plasmodium Parasitemia That Recapitulates Elements of the Human Immune Response to Chronic Infection

    PubMed Central

    Baccarella, Alyssa; Craft, Joshua F.; Boyle, Michelle J.; McIntyre, Tara I.; Wood, Matthew D.; Thorn, Kurt S.; Anidi, Chioma; Bayat, Aqieda; Chung, Me Ree; Hamburger, Rebecca; Kim, Chris Y.; Pearman, Emily; Pham, Jennifer; Tang, Jia J.; Boon, Louis; Kamya, Moses R.; Dorsey, Grant; Feeney, Margaret E.; Kim, Charles C.

    2016-01-01

    In humans, immunity to Plasmodium sp. generally takes the form of protection from symptomatic malaria (i.e., 'clinical immunity') rather than infection ('sterilizing immunity'). In contrast, mice infected with Plasmodium develop sterilizing immunity, hindering progress in understanding the mechanistic basis of clinical immunity. Here we present a novel model in which mice persistently infected with P. chabaudi exhibit limited clinical symptoms despite sustaining patent parasite burdens for many months. Characterization of immune responses in persistently infected mice revealed development of CD4+ T cell exhaustion, increased production of IL-10, and expansion of B cells with an atypical surface phenotype. Additionally, persistently infected mice displayed a dramatic increase in circulating nonclassical monocytes, a phenomenon that we also observed in humans with both chronic Plasmodium exposure and asymptomatic infection. Following pharmacological clearance of infection, previously persistently infected mice could not control a secondary challenge, indicating that persistent infection disrupts the sterilizing immunity that typically develops in mouse models of acute infection. This study establishes an animal model of asymptomatic, persistent Plasmodium infection that recapitulates several central aspects of the immune response in chronically exposed humans. As such, it provides a novel tool for dissection of immune responses that may prevent development of sterilizing immunity and limit pathology during infection. PMID:27583554

  20. Hallmarks of response to immune checkpoint blockade

    PubMed Central

    Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A

    2017-01-01

    Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159

  1. The influence of innate and adaptative immune responses on the differential clinical outcomes of leprosy.

    PubMed

    Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro

    2017-02-06

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.

  2. Epstein-Barr Virus-Specific Humoral Immune Responses in Health and Disease.

    PubMed

    Middeldorp, Jaap M

    2015-01-01

    Epstein-Barr virus (EBV) is widely distributed in the world and associated with a still increasing number of acute, chronic, malignant and autoimmune disease syndromes. Humoral immune responses to EBV have been studied for diagnostic, pathogenic and protective (vaccine) purposes. These studies use a range of methodologies, from cell-based immunofluorescence testing to antibody-diversity analysis using immunoblot and epitope analysis using recombinant or synthetic peptide-scanning. First, the individual EBV antigen complexes (VCA , MA, EA(D), EA(R) and EBNA) are defined at cellular and molecular levels, providing a historic overview. The characteristic antibody responses to these complexes in health and disease are described, and differences are highlighted by clinical examples. Options for EBV vaccination are briefly addressed. For a selected number of immunodominant proteins, in particular EBNA1, the interaction with human antibodies is further detailed at the epitope level, revealing interesting insights for structure, function and immunological aspects, not considered previously. Humoral immune responses against EBV-encoded tumour antigens LMP1, LMP2 and BARF1 are addressed, which provide novel options for targeted immunotherapy. Finally, some considerations on EBV-linked autoimmune diseases are given, and mechanisms of antigen mimicry are briefly discussed. Further analysis of humoral immune responses against EBV in health and disease in carefully selected patient cohorts will open new options for understanding pathogenesis of individual EBV-linked diseases and developing targeted diagnostic and therapeutic approaches.

  3. Spaceflight and immune responses of Rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1994-01-01

    Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.

  4. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  5. The energetic cost of mounting an immune response for Pallas’s long-tongued bat (Glossophaga soricina)

    PubMed Central

    2018-01-01

    The acute phase response (APR) is the first line of defense of the vertebrate immune system against pathogens. Mounting an immune response is believed to be energetically costly but direct measures of metabolic rate during immune challenges contradict this assumption. The energetic cost of APR for birds is higher than for rodents, suggesting that this response is less expensive for mammals. However, the particularly large increase in metabolic rate after APR activation for a piscivorous bat (Myotis vivesi) suggests that immune response might be unusually costly for bats. Here we quantified the energetic cost and body mass change associated with APR for the nectarivorous Pallas’s long-tongued bat (Glossophaga soricina). Activation of the APR resulted in a short-term decrease in body mass and an increase in resting metabolic rate (RMR) with a total energy cost of only 2% of the total energy expenditure estimated for G. soricina. This increase in RMR was far from the large increase measured for piscivorous bats; rather, it was similar to the highest values reported for birds. Overall, our results suggest that the costs of APR for bats may vary interspecifically. Measurement of the energy cost of vertebrate immune response is limited to a few species and further work is warranted to evaluate its significance for an animal’s energy budget. PMID:29888121

  6. The Systemic and Pulmonary Immune Response to Staphylococcal Enterotoxins

    PubMed Central

    Kumar, Sanjeev; Ménoret, Antoine; Ngoi, Soo-Mun; Vella, Anthony T.

    2010-01-01

    In response to environmental cues the human pathogen Staphylococcus aureus synthesizes and releases proteinaceous enterotoxins. These enterotoxins are natural etiologic entities of severe food poisoning, toxic shock syndrome, and acute diseases. Staphylococcal enterotoxins are currently listed as Category B Bioterrorism Agents by the Center for Disease Control and Prevention. They are associated with respiratory illnesses, and may contribute to exacerbation of pulmonary disease. This likely stems from the ability of Staphylococcal enterotoxins to elicit powerful episodes of T cell stimulation resulting in release of pro-inflammatory cytokines. Here, we discuss the role of the immune system and potential mechanisms of disease initiation and progression. PMID:22069664

  7. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  8. Chimpanzee adenovirus vaccine generates acute and durable protective immunity against ebolavirus challenge.

    PubMed

    Stanley, Daphne A; Honko, Anna N; Asiedu, Clement; Trefry, John C; Lau-Kilby, Annie W; Johnson, Joshua C; Hensley, Lisa; Ammendola, Virginia; Abbate, Adele; Grazioli, Fabiana; Foulds, Kathryn E; Cheng, Cheng; Wang, Lingshu; Donaldson, Mitzi M; Colloca, Stefano; Folgori, Antonella; Roederer, Mario; Nabel, Gary J; Mascola, John; Nicosia, Alfredo; Cortese, Riccardo; Koup, Richard A; Sullivan, Nancy J

    2014-10-01

    Ebolavirus disease causes high mortality, and the current outbreak has spread unabated through West Africa. Human adenovirus type 5 vectors (rAd5) encoding ebolavirus glycoprotein (GP) generate protective immunity against acute lethal Zaire ebolavirus (EBOV) challenge in macaques, but fail to protect animals immune to Ad5, suggesting natural Ad5 exposure may limit vaccine efficacy in humans. Here we show that a chimpanzee-derived replication-defective adenovirus (ChAd) vaccine also rapidly induced uniform protection against acute lethal EBOV challenge in macaques. Because protection waned over several months, we boosted ChAd3 with modified vaccinia Ankara (MVA) and generated, for the first time, durable protection against lethal EBOV challenge.

  9. Adaptive Immune Responses following Senecavirus A Infection in Pigs.

    PubMed

    Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G

    2018-02-01

    Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease

  10. [The liver and the immune system].

    PubMed

    Jakab, Lajos

    2015-07-26

    The liver is known to be the metabolic centre of the organism and is under the control of the central nervous system. It has a peculiar tissue structure and its anatomic localisation defines it as part of the immune system having an individual role in the defence of the organism. The determinant of its particular tissue build-up is the sinusoid system. In addition to hepatocytes, one cell row "endothelium", stellate cells close to the external surface, Kupffer cells tightly to its inner surface, as well as dendritic cells and other cell types (T and B lymphocytes, natural killer and natural killer T-cells, mast cells, granulocytes) are present. The multitudes and variety of cells make it possible to carry out the tasks according to the assignment of the organism. The liver is a member of the immune system having immune cells largely in an activated state. Its principal tasks are the assurance of the peripheral immune tolerance of the organism with the help of the haemopoetic cells and transforming growth factor-β. The liver takes part in the determination of the manner of the non-specific immune response of the organism. In addition to acute phase reaction of the organism, the liver has a role in the adaptive/specific immune response. These functions include retardation of the T and B lymphocytes and the defence against harmful pathogens. With the collaboration of transforming growth factor-β, immunoglobulins and their subclasses are inhibited just as the response of the T lymphocytes. The only exception is the undisturbed immunoglobulin A production. Particularly important is the intensive participation of the liver in the acute phase reaction of the organism, which is organised and guided by the coordinated functions of the cortico-hypothalamo-hypophysis-adrenal axis. Beside cellular elements, hormones, adhesion molecules, chemokines and cytokines are also involved in the cooperation with the organs. Acute phase reactants play a central role in these processes

  11. Measles virus-induced suppression of immune responses.

    PubMed

    Griffin, Diane E

    2010-07-01

    Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.

  12. Dendritic Cell Immune Responses in HIV-1 Controllers.

    PubMed

    Martin-Gayo, Enrique; Yu, Xu G

    2017-02-01

    Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

  13. Identification of an immune-responsive mesolimbocortical serotonergic system: Potential role in regulation of emotional behavior

    PubMed Central

    Lowry, C.A.; Hollis, J.H.; de Vries, A.; Pan, B.; Brunet, L.R.; Hunt, J.R.F.; Paton, J.F.R.; van Kampen, E.; Knight, D.M.; Evans, A.K.; Rook, G.A.W.; Lightman, S.L.

    2007-01-01

    Peripheral immune activation can have profound physiological and behavioral effects including induction of fever and sickness behavior. One mechanism through which immune activation or immunomodulation may affect physiology and behavior is via actions on brainstem neuromodulatory systems, such as serotonergic systems. We have found that peripheral immune activation with antigens derived from the nonpathogenic, saprophytic bacterium, Mycobacterium vaccae, activated a specific subset of serotonergic neurons in the interfascicular part of the dorsal raphe nucleus (DRI) of mice, as measured by quantification of c-Fos expression following intratracheal (12 h) or s.c. (6 h) administration of heat-killed, ultrasonically disrupted M. vaccae, or heat-killed, intact M. vaccae, respectively. These effects were apparent after immune activation by M. vaccae or its components but not by ovalbumin, which induces a qualitatively different immune response. The effects of immune activation were associated with increases in serotonin metabolism within the ventromedial prefrontal cortex, consistent with an effect of immune activation on mesolimbocortical serotonergic systems. The effects of M. vaccae administration on serotonergic systems were temporally associated with reductions in immobility in the forced swim test, consistent with the hypothesis that the stimulation of mesolimbocortical serotonergic systems by peripheral immune activation alters stress-related emotional behavior. These findings suggest that the immune-responsive subpopulation of serotonergic neurons in the DRI is likely to play an important role in the neural mechanisms underlying regulation of the physiological and pathophysiological responses to both acute and chronic immune activation, including regulation of mood during health and disease states. Together with previous studies, these findings also raise the possibility that immune stimulation activates a functionally and anatomically distinct subset of

  14. Immune Mechanisms Responsible for Vaccination against and Clearance of Mucosal and Lymphatic Norovirus Infection

    PubMed Central

    Chachu, Karen A.; LoBue, Anna D.; Strong, David W.; Baric, Ralph S.; Virgin, Herbert W.

    2008-01-01

    Two cardinal manifestations of viral immunity are efficient clearance of acute infection and the capacity to vaccinate against secondary viral exposure. For noroviruses, the contributions of T cells to viral clearance and vaccination have not been elucidated. We report here that both CD4 and CD8 T cells are required for efficient clearance of primary murine norovirus (MNV) infection from the intestine and intestinal lymph nodes. Further, long-lasting protective immunity was generated by oral live virus vaccination. Systemic vaccination with the MNV capsid protein also effectively protected against mucosal challenge, while vaccination with the capsid protein of the distantly related human Lordsdale virus provided partial protection. Fully effective vaccination required a broad immune response including CD4 T cells, CD8 T cells, and B cells, but the importance of specific immune cell types varied between the intestine and intestinal lymph nodes. Perforin, but not interferon gamma, was required for clearance of MNV infection by adoptively transferred T lymphocytes from vaccinated hosts. These studies prove the feasibility of both mucosal and systemic vaccination against mucosal norovirus infection, demonstrate tissue specificity of norovirus immune cells, and indicate that efficient vaccination strategies should induce potent CD4 and CD8 T cell responses. PMID:19079577

  15. Lamellar pro-inflammatory cytokine expression patterns in laminitis at the developmental stage and at the onset of lameness: innate vs. adaptive immune response.

    PubMed

    Belknap, J K; Giguère, S; Pettigrew, A; Cochran, A M; Van Eps, A W; Pollitt, C C

    2007-01-01

    Recent research has indicated that inflammation plays a role in the early stages of laminitis and that, similar to organ failure in human sepsis, early inflammatory mechanisms may lead to downstream events resulting in lamellar failure. Characterisation of the type of immune response (i.e. innate vs. adaptive) is essential in order to develop therapeutic strategies to counteract these deleterious events. To quantitate gene expression of pro-inflammatory cytokines known to be important in the innate and adaptive immune response during the early stages of laminitis, using both the black walnut extract (BWE) and oligofructose (OF) models of laminitis. Real-time qPCR was used to assess lamellar mRNA expression of interleukins-1beta, 2, 4, 6, 8, 10, 12 and 18, and tumour necrosis factor alpha and interferon gamma at the developmental stage and at the onset of lameness. Significantly increased lamellar mRNA expression of cytokines important in the innate immune response were present at the developmental stage of the BWE model, and at the onset of acute lameness in both the BWE model and OF model. Of the cytokines characteristic of the Th1 and Th2 arms of the adaptive immune response, a mixed response was noted at the onset of acute lameness in the BWE model, whereas the response was skewed towards a Th1 response at the onset of lameness in the OF model. Lamellar inflammation is characterised by strong innate immune response in the developmental stages of laminitis; and a mixture of innate and adaptive immune responses at the onset of lameness. These results indicate that anti-inflammatory treatment of early stage laminitis (and the horse at risk of laminitis) should include not only therapeutic drugs that address prostanoid activity, but should also address the marked increases in lamellar cytokine expression.

  16. Humoral and Cellular Immune Response in Canine Hypothyroidism.

    PubMed

    Miller, J; Popiel, J; Chełmońska-Soyta, A

    2015-07-01

    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.

    PubMed

    Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M

    2017-09-04

    Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.

  18. Innate Immunity and Resistance to Tolerogenesis in Allotransplantation

    PubMed Central

    Benichou, Gilles; Tonsho, Makoto; Tocco, Georges; Nadazdin, Ognjenka; Madsen, Joren C.

    2012-01-01

    The development of immunosuppressive drugs to control adaptive immune responses has led to the success of transplantation as a therapy for end-stage organ failure. However, these agents are largely ineffective in suppressing components of the innate immune system. This distinction has gained in clinical significance as mounting evidence now indicates that innate immune responses play important roles in the acute and chronic rejection of whole organ allografts. For instance, whereas clinical interest in natural killer (NK) cells was once largely confined to the field of bone marrow transplantation, recent findings suggest that these cells can also participate in the acute rejection of cardiac allografts and prevent tolerance induction. Stimulation of Toll-like receptors (TLRs), another important component of innate immunity, by endogenous ligands released in response to ischemia/reperfusion is now known to cause an inflammatory milieu favorable to graft rejection and abrogation of tolerance. Emerging data suggest that activation of complement is linked to acute rejection and interferes with tolerance. In summary, the conventional wisdom that the innate immune system is of little importance in whole organ transplantation is no longer tenable. The addition of strategies that target TLRs, NK cells, complement, and other components of the innate immune system will be necessary to eventually achieve long-term tolerance to human allograft recipients. PMID:22566954

  19. Comparison of the immune responses associated with experimental bovine mastitis caused by different strains of Escherichia coli.

    PubMed

    Blum, Shlomo E; Heller, Elimelech D; Jacoby, Shamay; Krifucks, Oleg; Leitner, Gabriel

    2017-05-01

    We studied the mammary immune response to different mammary pathogenic Escherichia coli (MPEC) strains in cows, hypothesising that the dynamics of response would differ. E. coli is a major aetiologic agent of acute clinical bovine mastitis of various degrees of severity with specific strains being associated with persistent infections. We compared challenge with three distinct pathogenic MPEC strains (VL2874, VL2732 and P4), isolated from different forms of mastitis (per-acute, persistent and acute, respectively). A secondary objective was to verify the lack of mammary pathogenicity of an environmental isolate (K71) that is used for comparison against MPEC in genomic and phenotypic studies. Twelve cows were challenged by intra-mammary infusion with one of the strains. Cellular and chemokine responses and bacterial culture follow-up were performed for 35 d. All cows challenged by any of the MPEC strains developed clinical mastitis. Differences were found in the intensity and duration of response, in somatic cell count, secreted cytokines (TNF-α, IL-6 and IL-17) and levels of milk leucocyte membrane Toll-like receptor 4 (TLR4). A sharp decrease of TLR4 on leucocytes was observed concomitantly to peak bacterial counts in milk. Intra-mammary infusion of strain K71 did not elicit inflammation and bacteria were not recovered from milk. Results suggest some differences in the mammary immune response to distinct MPEC strains that could be correlated to their previously observed pathogenic traits. This is also the first report of an E. coli strain that is non-pathogenic to the bovine mammary gland.

  20. [Acute renal pain as an adverse reaction of the rabies immunization].

    PubMed

    Lalosević, Dusan

    2009-01-01

    HRIG is the best preparate in rabies prophylaxis, and it's considered that optimal dose is 20 international units per kilogram and must not been reduced or overdosed. HRIG have to be injected infiltrative around bite wounds, and if after that remains a part of the dose, it has to be given in gluteal muscle. Application only in gluteus is vitium artis. At one patient immunized against rabies has occured acute bilateral renal pain and fever at time of immunization against rabies, and because of that vaccination must been stopped after the 3rd dose of vaccine. Patient was a 26-year-old female without significant pre-existing disease, bitten by stray dog. After the start of immunization, because the wrong direction, she received about 2.5 more amount of human rabies immunoglobuline (HRIG) then is recommended on declaration at etiquette of ampoule, and only in gluteus in quantity of 10.5 ml. Glomerulonephritis after rabies vaccination until now was described just once by Singhal et al. in 1981. year. Acute renal pain, after rabies vaccine, which aggravated after repeated vaccine doses in our patient who received overdosed HRIG, may be explained by immunopathological mechanism, rather with formation of circulating immune complexes, their precipitation on the glomerular basement membrane and developing glomerulonephritis. Low weight soluble molecular immune complexes formed when antigen is in excess, as in case after repeated doses of rabies vaccine, circulate and precipitate on glomerular membrane and causes glomerulonephritis. As contribution to this explanation, is that symptoms as renal pain disappeared after interrupting vaccination protocol in our patient.

  1. Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    PubMed Central

    Madigan, Allison A.; Sobek, Kathryn M.; Cummings, Jessica L.; Green, William R.; Bacich, Dean J.; O’Keefe, Denise S.

    2012-01-01

    Benign Prostatic Hyperplasia (BPH)is the most common urologic disease in men over age 50. Symptoms include acute urinary retention, urgency to urinate and nocturia. For patients with severe symptoms, surgical treatment is used to remove the affected tissue. Interestingly, the presence of histologic BPH does not always correlate with symptoms. The molecular basis of symptomatic BPH and how it differs from asymptomatic BPH is unknown. Investigation into the molecular players involved in symptomatic BPH will likely give insight into novel therapeutic, and potentially preventative, targets. We determined the expression of genes involved in the innate anti-viral immune response in tissues from patients undergoing surgery to alleviate the symptoms of BPH, and compared the results to prostate tissue with histologic BPH, but from patients with few urinary issues (asymptomatic BPH). We found that expression of CFI, APOBEC3G, OAS2, and IFIT1, four genes whose protein products are involved in the innate anti-viral immune response, were significantly transcriptionally upregulated in symptomatic BPH. Additionally we observe hypomethylation and concomitant expression of ancient retroviral-like sequences, the LINE-1 retrotransposons, in symptomatic BPH when compared to normal prostate tissue. These findings merit further investigation into the anti-viral immune response in symptomatic BPH. PMID:22952051

  2. Subclinical cytomegalovirus infection associates with altered host immunity, gut microbiota and vaccine responses.

    PubMed

    Santos Rocha, Clarissa; Hirao, Lauren A; Weber, Mariana G; Méndez-Lagares, Gema; Chang, W L William; Jiang, Guochun; Deere, Jesse D; Sparger, Ellen E; Roberts, Jeffrey; Barry, Peter A; Hartigan-O'Connor, Dennis J; Dandekar, Satya

    2018-04-18

    Subclinical viral infections (SVI) including cytomegalovirus (CMV) are highly prevalent in humans, resulting in life-long persistence. However, the impact of SVI on the interplay between the host immunity and gut microbiota in the context of environmental exposures is not well defined. We utilized the preclinical nonhuman primate (NHP) model consisting of SVI-free (SPF) rhesus macaques and compared them to the animals with SVI (non-SPF) acquired through natural exposure and investigated the impact of SVI on immune cell distribution and function as well as on gut microbiota. These changes were examined in animals housed in the outdoor environment as compared to the controlled indoor environment. We report that SVI are associated with altered immune cell subsets and gut microbiota composition in animals housed in the outdoor environment. Non-SPF animals harbored a higher proportion of potential butyrate-producing Firmicutes and higher numbers of lymphocytes, effector T cells and cytokine-producing T cells. Surprisingly, these differences diminished following their transfer to the controlled indoor environment, suggesting that non-SPFs had increased responsiveness to environmental exposures. An experimental infection of indoor SPF animals with CMV resulted in an increased abundance of butyrate-producing bacteria, validating that CMV enhanced colonization of butyrate-producing commensals. Finally, non-SPF animals displayed lower antibody responses to influenza vaccination as compared to SPF animals. Our data show that subclinical CMV infection heightens host immunity and gut microbiota changes in response to environmental exposures. This may contribute to the heterogeneity in host immune response to vaccines and environmental stimuli at the population level. IMPORTANCE Humans harbor several latent viruses that modulate host immunity and commensal microbiota, thus introducing heterogeneity in their responses to pathogens, vaccines and environmental exposures. Most of

  3. A phosphatidylinositol species acutely generated by activated macrophages regulates innate immune responses.

    PubMed

    Gil-de-Gómez, Luis; Astudillo, Alma M; Meana, Clara; Rubio, Julio M; Guijas, Carlos; Balboa, María A; Balsinde, Jesús

    2013-05-15

    Activation of macrophages with stimuli of the innate immune response results in the intense remodeling of arachidonate-containing phospholipids, leading to the mobilization of large quantities of this fatty acid for conversion into biologically active eicosanoids. As a consequence of this process, the arachidonate levels in membrane phospholipids markedly decrease. We have applied mass spectrometry-based lipid profiling to study the levels of arachidonate-containing phospholipids under inflammatory activation of macrophages. We identify an unusual inositol phospholipid molecule, PI(20:4/20:4), the levels of which do not decrease but actually increase by 300% after activation of the macrophages. PI(20:4/20:4) is formed and degraded rapidly, suggesting a role for this molecule in regulating cell signaling events. Using a metabolipidomic approach consisting in exposing the cells to deuterium-labeled arachidonate at the time they are exposed to stimuli, we show that PI(20:4/20:4) biosynthesis occurs via the sequential incorporation of arachidonate, first into the sn-2 position of a preformed phosphatidylinositol (PI) molecule, followed by the rapid introduction of a second arachidonate moiety into the sn-1 position. Generation requires the participation of cytosolic phospholipase A2α and CoA-dependent acyltransferases. PI(20:4/20:4) formation is also detected in vivo in murine peritonitis exudates. Elevating the intracellular concentration of PI(20:4/20:4) by introducing the lipid into the cells results in enhancement of the microbicidal capacity of macrophages, as measured by reactive oxygen metabolite production and lysozyme release. These findings suggest that PI(20:4/20:4) is a novel bioactive inositol phospholipid molecule that regulates innate immune responses in macrophages.

  4. A metabolomics and mouse models approach to study inflammatory and immune responses to radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fornace, Albert J.; Li, Henghong

    2013-12-02

    The three-year project entitled "A Metabolomics and Mouse Models Approach to Study Inflammatory and Immune Responses to Radiation" was initiated in September 2009. The overall objectives of this project were to investigate the acute and persistent effects of low dose radiation on T cell lymphocyte function and physiology, as well the contributions of these cells to radiation-induced inflammatory responses. Inflammation after ionizing radiation (IR), even at low doses, may impact a variety of disease processes, including infectious disease, cardiovascular disease, cancer, and other potentially inflammatory disorders. There were three overall specific aims: 1. To investigate acute and persistent effects ofmore » low dose radiation on T cell subsets and function; 2. A genetic approach with mouse models to investigate p38 MAPK pathways that are involved in radiation-induced inflammatory signaling; 3. To investigate the effect of radiation quality on the inflammatory response. We have completed the work proposed in these aims.« less

  5. Acute intraperitoneal lipopolysaccharide influences the immune system in the absence of gut dysbiosis.

    PubMed

    Sylvia, Kristyn E; Demas, Gregory E

    2018-03-01

    There is bidirectional communication between the immune system and the gut microbiome, however the precise mechanisms regulating this crosstalk are not well understood. Microbial-associated molecular patterns (MAMPs) within the gut, including lipopolysaccharide (LPS) that produces a quick and robust activation of the immune system, may be one way by which these interactions occur. Endogenous levels of LPS in the gut are low enough that they do not usually cause disease, although, in times of increased LPS loads, they may be capable of increasing vulnerability of the gut to pathogenic bacteria. Furthermore, chronic, low-grade inflammation can have lasting effects on the gut, but the effects of acute inflammation on gut communities have not been thoroughly assessed. In this study, we first investigated whether a single modest dose of LPS administered to adult male and female Siberian hamsters (Phodopus sungorus) activated the immune system by measuring levels of circulating cortisol and the proinflammatory cytokine TNF-α in the liver compared with saline-treated animals. We then investigated whether this same acute dose of LPS altered the microbiome 48 h after treatment. We found that, although LPS increased cortisol and liver cytokine levels, and produced changes in food intake and body mass in both sexes, immunological changes were independent of gut dysbiosis 48 h after LPS injection. These data suggest that an acute immune activation may not be capable of altering the gut microbiome in healthy individuals. It is likely, however, that this type of immune challenge may have other physiological impacts on the gut's vulnerability, and future studies will investigate these relationships further. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  6. Neuropeptide Substance P and the Immune Response

    PubMed Central

    Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza

    2016-01-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883

  7. Neuropeptide substance P and the immune response.

    PubMed

    Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza

    2016-11-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.

  8. Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.

    1978-01-01

    A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541

  9. Host Immune Response to Influenza A Virus Infection.

    PubMed

    Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long

    2018-01-01

    Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.

  10. Immunomodulator-based enhancement of anti smallpox immune responses.

    PubMed

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  11. Innate immunity against HIV-1 infection.

    PubMed

    Altfeld, Marcus; Gale, Michael

    2015-06-01

    During acute HIV-1 infection, viral pathogen-associated molecular patterns are recognized by pathogen-recognition receptors (PRRs) of infected cells, which triggers a signaling cascade that initiates innate intracellular antiviral defenses aimed at restricting the replication and spread of the virus. This cell-intrinsic response propagates outward via the action of secreted factors such as cytokines and chemokines that activate innate immune cells and attract them to the site of infection and to local lymphatic tissue. Antiviral innate effector cells can subsequently contribute to the control of viremia and modulate the quality of the adaptive immune response to HIV-1. The concerted actions of PRR signaling, specific viral-restriction factors, innate immune cells, innate-adaptive immune crosstalk and viral evasion strategies determine the outcome of HIV-1 infection and immune responses.

  12. OX62+OX6+OX35+ rat dendritic cells are unable to prime CD4+ T cells for an effective immune response following acute burn injury.

    PubMed

    Fazal, Nadeem

    2013-01-01

    Co-stimulatory molecules expressed on Dendritic Cells (DCs) function to coordinate an efficient immune response by T cells in the peripheral lymph nodes. We hypothesized that CD4+ T cell-mediated immune suppression following burn injury may be related to dysfunctional DCs residing in gut associated lymphoid tissues (GALT), such as Mesenteric Lymph Nodes (MLN). Therefore, we studied co-stimulatory molecules expressed on burn rat MLN DCs as an index of functional DCs that would mount an effective normal CD4+ T cell immune response. In a rat model of 30% Total Body Surface Area (TBSA) scald burn, OX62+OX6+OX35+ DCs and CD4+ T cells were isolated from MLN of day 3 post-burn and sham control rats. DCs were tested for their expression of co-stimulatory molecules, and prime CD4+ T cell (DC:CD4+T cell co-culture assays) to determine an effector immune response such as CD4+ T cell proliferation. The surface receptor expressions of MLN DCs co-stimulatory molecules, i.e., MHC-II, CD40, CD80 (B7-1), and CD86 (B7-2) were determined by Flow cytometry (quantitatively) and confocal microscopy (qualitatively). Tritiated thymidine and CFDA-SE determined CD4+ T cell proliferation following co-incubation with DCs. Cytokine milieu of MLN (IL-12 and IL-10) was assessed by mRNA determination by RT-PCR. The results showed down-regulated expressions of co-stimulatory markers (CD80, CD86, CD40 and MHC-II) of MLN DCs obtained from burn-injured rats, as well as lack of ability of these burn-induced DCs to stimulate CD4+ T cell proliferation in co-culture assays, as compared to the sham rats. Moreover, anti-CD40 stimulation of affected burn MLN DCs did not reverse this alteration. Furthermore, a marked up-regulation of mRNA IL-10 and down-regulation of mRNA IL-12 in burn MLN as compared to sham animals was also observed. To surmise, the data indicated that dysfunctional OX62+OX6+OX35+ rat MLN DCs may contribute to CD4+ T-cell-mediated immune suppression observed following acute burn injury.

  13. OX62+OX6+OX35+ rat dendritic cells are unable to prime CD4+ T cells for an effective immune response following acute burn injury☆

    PubMed Central

    Fazal, Nadeem

    2013-01-01

    Co-stimulatory molecules expressed on Dendritic Cells (DCs) function to coordinate an efficient immune response by T cells in the peripheral lymph nodes. We hypothesized that CD4+ T cell-mediated immune suppression following burn injury may be related to dysfunctional DCs residing in gut associated lymphoid tissues (GALT), such as Mesenteric Lymph Nodes (MLN). Therefore, we studied co-stimulatory molecules expressed on burn rat MLN DCs as an index of functional DCs that would mount an effective normal CD4+ T cell immune response. In a rat model of 30% Total Body Surface Area (TBSA) scald burn, OX62+OX6+OX35+ DCs and CD4+ T cells were isolated from MLN of day 3 post-burn and sham control rats. DCs were tested for their expression of co-stimulatory molecules, and prime CD4+ T cell (DC:CD4+T cell co-culture assays) to determine an effector immune response such as CD4+ T cell proliferation. The surface receptor expressions of MLN DCs co-stimulatory molecules, i.e., MHC-II, CD40, CD80 (B7-1), and CD86 (B7-2) were determined by Flow cytometry (quantitatively) and confocal microscopy (qualitatively). Tritiated thymidine and CFDA-SE determined CD4+ T cell proliferation following co-incubation with DCs. Cytokine milieu of MLN (IL-12 and IL-10) was assessed by mRNA determination by RT-PCR. The results showed down-regulated expressions of co-stimulatory markers (CD80, CD86, CD40 and MHC-II) of MLN DCs obtained from burn-injured rats, as well as lack of ability of these burn-induced DCs to stimulate CD4+ T cell proliferation in co-culture assays, as compared to the sham rats. Moreover, anti-CD40 stimulation of affected burn MLN DCs did not reverse this alteration. Furthermore, a marked up-regulation of mRNA IL-10 and down-regulation of mRNA IL-12 in burn MLN as compared to sham animals was also observed. To surmise, the data indicated that dysfunctional OX62+OX6+OX35+ rat MLN DCs may contribute to CD4+ T-cell-mediated immune suppression observed following acute burn injury

  14. Stress proteins and the immune response.

    PubMed

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  15. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1984-08-01

    ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON

  16. Immune Response And Anamnestic Immune Response In Children After A 3-Dose Primary Hepatitis B Vaccination.

    PubMed

    Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran

    2016-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population

  17. Public speaking stress-induced neuroendocrine responses and circulating immune cell redistribution in irritable bowel syndrome.

    PubMed

    Elsenbruch, Sigrid; Lucas, Ayscha; Holtmann, Gerald; Haag, Sebastian; Gerken, Guido; Riemenschneider, Natalie; Langhorst, Jost; Kavelaars, Annemieke; Heijnen, Cobi J; Schedlowski, Manfred

    2006-10-01

    Augmented neuroendocrine stress responses and altered immune functions may play a role in the manifestation of functional gastrointestinal (GI) disorders. We tested the hypothesis that IBS patients would demonstrate enhanced psychological and endocrine responses, as well as altered stress-induced redistribution of circulating leukocytes and lymphocytes, in response to an acute psychosocial stressor when compared with healthy controls. Responses to public speaking stress were analyzed in N = 17 IBS patients without concurrent psychiatric conditions and N = 12 healthy controls. At baseline, immediately following public speaking, and after a recovery period, state anxiety, acute GI symptoms, cardiovascular responses, serum cortisol and plasma adrenocorticotropic hormone (ACTH) were measured, and numbers of circulating leukocytes and lymphocyte subpopulations were analyzed by flow cytometry. Public speaking led to significant cardiovascular activation, a significant increase in ACTH, and a redistribution of circulating leukocytes and lymphocyte subpopulations, including significant increases in natural killer cells and cytotoxic/suppressor T cells. IBS patients demonstrated significantly greater state anxiety both at baseline and following public speaking. However, cardiovascular and endocrine responses, as well as the redistribution of circulating leukocytes and lymphocyte subpopulations after public speaking stress, did not differ for IBS patients compared with controls. In IBS patients without psychiatric comorbidity, the endocrine response as well as the circulation pattern of leukocyte subpopulations to acute psychosocial stress do not differ from healthy controls in spite of enhanced emotional responses. Future studies should discern the role of psychopathology in psychological and biological stress responses in IBS.

  18. The unfolded protein response in immunity and inflammation

    PubMed Central

    Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.

    2017-01-01

    The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803

  19. Stimulation of dendritic cells enhances immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.

    2009-02-01

    Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.

  20. Injury-induced immune responses in Hydra.

    PubMed

    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

    2014-08-01

    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

  1. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  2. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    PubMed Central

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  3. Investigation of whether the acute hemolysis associated with Rho(D) immune globulin intravenous (human) administration for treatment of immune thrombocytopenic purpura is consistent with the acute hemolytic transfusion reaction model

    PubMed Central

    Gaines, Ann Reed; Lee-Stroka, Hallie; Byrne, Karen; Scott, Dorothy E.; Uhl, Lynne; Lazarus, Ellen; Stroncek, David F.

    2012-01-01

    BACKGROUND Immune thrombocytopenic purpura and secondary thrombocytopenia patients treated with Rho(D) immune globulin intravenous (human; anti-D IGIV) have experienced acute hemolysis, which is inconsistent with the typical presentation of extravascular hemolysis—the presumed mechanism of action of anti-D IGIV. Although the mechanism of anti-D-IGIV–associated acute hemolysis has not been established, the onset, signs/symptoms, and complications appear consistent with the intravascular hemolysis of acute hemolytic transfusion reactions (AHTRs). In transfusion medicine, the red blood cell (RBC) antigen-antibody incompatibility(-ies) that precipitate AHTRs can be detected in vitro with compatibility testing. Under the premise that anti-D-IGIV–associated acute hemolysis results from RBC antigen-antibody–mediated complement activation, this study evaluated whether the incompatibility(-ies) could be detected in vitro with a hemolysin assay, which would support the AHTR model as the hemolytic mechanism. STUDY DESIGN AND METHODS Seven anti-D IGIV lots were tested to determine the RBC antibody identities in those lots, including four lots that had been implicated in acute hemolytic episodes. Hemolysin assays were performed that tested each of 73 RBC specimens against each lot, including the RBCs of one patient who had experienced acute hemolysis after anti-D IGIV administration. RESULTS Only two anti-D IGIV lots contained RBC antibodies beyond those expected. No hemolysis endpoint was observed in any of the hemolysin assays. CONCLUSION Although the findings did not support the AHTR model, the results are reported to contribute knowledge about the mechanism of anti-D-IGIV–associated acute hemolysis and to prompt continued investigation into cause(s), prediction, and prevention of this potentially serious adverse event. PMID:19220820

  4. Mucosal immune response to poliovirus vaccines in childhood.

    PubMed

    Ogra, P L

    1984-01-01

    Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.

  5. Effect of antipyretic analgesics on immune responses to vaccination.

    PubMed

    Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B

    2016-09-01

    While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.

  6. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    PubMed Central

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  7. Immune reactions in acute viral hepatitis.

    PubMed Central

    Newble, D I; Holmes, K T; Wangel, A G; Forbes, I J

    1975-01-01

    Serial studies of PHA-induced lymphocyte transformation, serum autoantibodies, immunoglobulins and complement were performed in seventeen patients with hepatitis A and nine patients with hepatitis B. In both types of hepatitis PHA-induced transformation was markedly impaired during the 1st week after the onset of jaundice and there was less marked but prolonged impairment for a further period of 6-10 weeks. A group of eleven subjects with a previous history of hepatitis had values which were similar to those of healthy persons. Serum from patients with hepatitis A and hepatitis B contains an inhibitor of lymphocyte response to PHA. The inhibitor depresses the function of both patients' and normal lymphocytes and is only detectable during the acute phase of the illness. Washing lymphocytes free from autologous serum did not restore the PHA response to normal but the markedly impaired response present during the first 2 weeks of the illness was improved. A serum factor or factors may therefore be responsible for at least part of the impaired response of lymphocytes to PHA during the acute phase of hepatitis but does not appear to account for the more prolonged impairment of the PHA response. The protracted lymphocyte defect is possibly induced by hepatitis virus. The incidence of autoantibodies and the changes in immunoglobulin levels were similar to those reported by other workers. PMID:1204253

  8. Agent-based modeling of endotoxin-induced acute inflammatory response in human blood leukocytes.

    PubMed

    Dong, Xu; Foteinou, Panagiota T; Calvano, Steven E; Lowry, Stephen F; Androulakis, Ioannis P

    2010-02-18

    Inflammation is a highly complex biological response evoked by many stimuli. A persistent challenge in modeling this dynamic process has been the (nonlinear) nature of the response that precludes the single-variable assumption. Systems-based approaches offer a promising possibility for understanding inflammation in its homeostatic context. In order to study the underlying complexity of the acute inflammatory response, an agent-based framework is developed that models the emerging host response as the outcome of orchestrated interactions associated with intricate signaling cascades and intercellular immune system interactions. An agent-based modeling (ABM) framework is proposed to study the nonlinear dynamics of acute human inflammation. The model is implemented using NetLogo software. Interacting agents involve either inflammation-specific molecules or cells essential for the propagation of the inflammatory reaction across the system. Spatial orientation of molecule interactions involved in signaling cascades coupled with the cellular heterogeneity are further taken into account. The proposed in silico model is evaluated through its ability to successfully reproduce a self-limited inflammatory response as well as a series of scenarios indicative of the nonlinear dynamics of the response. Such scenarios involve either a persistent (non)infectious response or innate immune tolerance and potentiation effects followed by perturbations in intracellular signaling molecules and cascades. The ABM framework developed in this study provides insight on the stochastic interactions of the mediators involved in the propagation of endotoxin signaling at the cellular response level. The simulation results are in accordance with our prior research effort associated with the development of deterministic human inflammation models that include transcriptional dynamics, signaling, and physiological components. The hypothetical scenarios explored in this study would potentially improve

  9. DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

    PubMed

    Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

  10. Antitumor immune responses mediated by dendritic cells

    PubMed Central

    Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

    2013-01-01

    Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

  11. Staphylococcus aureus-dependent septic arthritis in murine knee joints: local immune response and beneficial effects of vaccination

    PubMed Central

    Corrado, Alessia; Donato, Paolo; Maccari, Silvia; Cecchi, Raffaella; Spadafina, Tiziana; Arcidiacono, Letizia; Tavarini, Simona; Sammicheli, Chiara; Laera, Donatello; Manetti, Andrea Guido Oreste; Ruggiero, Paolo; Galletti, Bruno; Nuti, Sandra; De Gregorio, Ennio; Bertholet, Sylvie; Seubert, Anja; Bagnoli, Fabio; Bensi, Giuliano; Chiarot, Emiliano

    2016-01-01

    Staphylococcus aureus is the major cause of human septic arthritis and osteomyelitis, which deserve special attention due to their rapid evolution and resistance to treatment. The progression of the disease depends on both bacterial presence in situ and uncontrolled disruptive immune response, which is responsible for chronic disease. Articular and bone infections are often the result of blood bacteremia, with the knees and hips being the most frequently infected joints showing the worst clinical outcome. We report the development of a hematogenous model of septic arthritis in murine knees, which progresses from an acute to a chronic phase, similarly to what occurs in humans. Characterization of the local and systemic inflammatory and immune responses following bacterial infection brought to light specific signatures of disease. Immunization of mice with the vaccine formulation we have recently described (4C-Staph), induced a strong antibody response and specific CD4+ effector memory T cells, and resulted in reduced bacterial load in the knee joints, a milder general inflammatory state and protection against bacterial-mediated cellular toxicity. Possible correlates of protection are finally proposed, which might contribute to the development of an effective vaccine for human use. PMID:27901071

  12. Effect of antipyretic analgesics on immune responses to vaccination

    PubMed Central

    Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.

    2016-01-01

    ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296

  13. The development of a fully-integrated immune response model (FIRM) simulator of the immune response through integration of multiple subset models

    PubMed Central

    2013-01-01

    Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half

  14. Damage signals in the insect immune response

    PubMed Central

    Krautz, Robert; Arefin, Badrul; Theopold, Ulrich

    2014-01-01

    Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815

  15. A randomized controlled crossover trial of the effect of ginseng consumption on the immune response to moderate exercise in healthy sedentary men.

    PubMed

    Biondo, Patricia D; Robbins, Sarah J; Walsh, Jennifer D; McCargar, Linda J; Harber, Vicki J; Field, Catherine J

    2008-10-01

    Ginseng is a popular herbal remedy that is reputed to increase resistance to stress and improve immune function. Regular exercise results in acute physiologic stress that affects the immune response. This study was conducted to investigate the effects of daily consumption of a standardized ginsenoside-containing North American ginseng (Panax quinquefolius) extract on immune function before, during, and after a moderate-exercise protocol in healthy sedentary men. Ten healthy males were randomized to receive either ginseng (1125 mg.d-1) or placebo for 35 days. After a 3 month washout period, subjects received the opposite treatment for another 35 days. An exercise test and blood collection were performed at the end of each treatment period. Immune parameters and blood hormone levels were measured before, during, and after the exercise stress protocol. Ginseng treatment reduced the peripheral blood concentration of CD8+ T cells and increased mitogen-stimulated T cell production of interleukin-2 ex vivo. Ginseng had no effect on total white blood cell counts; on concentrations of neutrophils, monocytes, or lymphocytes (CD3+, CD4+, CD16+, CD20+); on lymphocyte proliferation; or on neutrophil oxidative burst. Ginseng did not significantly affect exercise-induced changes in plasma concentrations of lactate, insulin, cortisol, or growth hormone. The consumption of ginseng for 5 weeks had a limited effect on the immune response to an acute exercise protocol.

  16. Oxidative response of neutrophils to platelet-activating factor is altered during acute ruminal acidosis induced by oligofructose in heifers

    PubMed Central

    Concha, Claudia; Carretta, María Daniella; Alarcón, Pablo; Conejeros, Ivan; Gallardo, Diego; Hidalgo, Alejandra Isabel; Tadich, Nestor; Cáceres, Dante Daniel; Hidalgo, María Angélica

    2014-01-01

    Reactive oxygen species (ROS) production is one of the main mechanisms used to kill microbes during innate immune response. D-lactic acid, which is augmented during acute ruminal acidosis, reduces platelet activating factor (PAF)-induced ROS production and L-selectin shedding in bovine neutrophils in vitro. This study was conducted to investigate whether acute ruminal acidosis induced by acute oligofructose overload in heifers interferes with ROS production and L-selectin shedding in blood neutrophils. Blood neutrophils and plasma were obtained by jugular venipuncture, while ruminal samples were collected using rumenocentesis. Lactic acid from plasma and ruminal samples was measured by HPLC. PAF-induced ROS production and L-selectin shedding were measured in vitro in bovine neutrophils by a luminol chemiluminescence assay and flow cytometry, respectively. A significant increase in ruminal and plasma lactic acid was recorded in these animals. Specifically, a decrease in PAF-induced ROS production was observed 8 h after oligofructose overload, and this was sustained until 48 h post oligofructose overload. A reduction in PAF-induced L-selectin shedding was observed at 16 h and 32 h post oligofructose overload. Overall, the results indicated that neutrophil PAF responses were altered in heifers with ruminal acidosis, suggesting a potential dysfunction of the innate immune response. PMID:25013355

  17. Oxidative response of neutrophils to platelet-activating factor is altered during acute ruminal acidosis induced by oligofructose in heifers.

    PubMed

    Concha, Claudia; Carretta, María Daniella; Alarcón, Pablo; Conejeros, Ivan; Gallardo, Diego; Hidalgo, Alejandra Isabel; Tadich, Nestor; Cáceres, Dante Daniel; Hidalgo, María Angélica; Burgos, Rafael Agustín

    2014-01-01

    Reactive oxygen species (ROS) production is one of the main mechanisms used to kill microbes during innate immune response. D-lactic acid, which is augmented during acute ruminal acidosis, reduces platelet activating factor (PAF)-induced ROS production and L-selectin shedding in bovine neutrophils in vitro. This study was conducted to investigate whether acute ruminal acidosis induced by acute oligofructose overload in heifers interferes with ROS production and L-selectin shedding in blood neutrophils. Blood neutrophils and plasma were obtained by jugular venipuncture, while ruminal samples were collected using rumenocentesis. Lactic acid from plasma and ruminal samples was measured by HPLC. PAF-induced ROS production and L-selectin shedding were measured in vitro in bovine neutrophils by a luminol chemiluminescence assay and flow cytometry, respectively. A significant increase in ruminal and plasma lactic acid was recorded in these animals. Specifically, a decrease in PAF-induced ROS production was observed 8 h after oligofructose overload, and this was sustained until 48 h post oligofructose overload. A reduction in PAF-induced L-selectin shedding was observed at 16 h and 32 h post oligofructose overload. Overall, the results indicated that neutrophil PAF responses were altered in heifers with ruminal acidosis, suggesting a potential dysfunction of the innate immune response.

  18. Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase.

    PubMed

    Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L

    2014-12-01

    Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection. © 2014 John Wiley & Sons Ltd.

  19. Interplay between behavioural thermoregulation and immune response in mealworms.

    PubMed

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

    PubMed Central

    Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.

    2014-01-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

  1. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    PubMed

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  3. β-1,3/1,6-Glucan-supplemented diets antagonize immune inhibitory effects of hypoxia and enhance the immune response to a model vaccine.

    PubMed

    Rodríguez, Felipe E; Valenzuela, Beatriz; Farías, Ana; Sandino, Ana María; Imarai, Mónica

    2016-12-01

    The diets of farmed salmon are usually supplemented with immunostimulants to improve health status. Because β-glucan is one of the most common immunostimulants used in diets, here we examined the effect of two β-1,3/1,6-glucan-supplemented diets on the expression of immune response genes of Atlantic salmon. The relative abundances of IFN-α1, Mx, IFN-γ, IL-12, TGF-β1, IL-10, and CD4 transcripts were evaluated in head kidney by qRT-PCR. We assessed the effects of the diets under normoxia and acute hypoxia, as salmon are especially sensitive to changes in the concentration of dissolved oxygen, which can also affect immunity. These effects were also tested on vaccinated fish, as we expected that β-1,3/1,6-glucan-supplemented diets would enhance the adaptive immune response to the vaccine. We found that administration of the Bg diet (containing β-1,3/1,6-glucan) under normoxia had no effects on the expression of the analyzed genes in the kidney of the diet-fed fish, but under hypoxia/re-oxygenation (90 min of acute hypoxia), the βg diet affected the expression of the antiviral genes, IFN-α1 and Mx, preventing their decrease caused by hypoxia. The Bax diet, which in addition to β-1,3/1,6-glucan, contained astaxanthin, increased IL-12 and IFN-γ in kidneys. With fish exposed to hypoxia/reoxygenation, the diet prevented the decrease of IFN-α1 and Mx levels observed after hypoxia. When fish were vaccinated, only the levels of IL-12 and CD4 transcripts increased, but interestingly if fish were also fed the Bax diet, the vaccination induced a significant increase in all the analyzed transcripts. Finally, when vaccinated fish were exposed to hypoxia, the effect of the Bax diet was greatly reduced for all genes tested and moreover, inducible effects completely disappeared for IL-12, IFN-α, and Mx. Altogether, these results showed that the tested β-1,3/1,6-glucan diets increased the levels of transcripts of key genes involved in innate and adaptive immune response

  4. Early Immune Responses in Rainbow Trout Liver upon Viral Hemorrhagic Septicemia Virus (VHSV) Infection

    PubMed Central

    Castro, Rosario; Abós, Beatriz; Pignatelli, Jaime; von Gersdorff Jørgensen, Louise; González Granja, Aitor; Buchmann, Kurt; Tafalla, Carolina

    2014-01-01

    Among the essential metabolic functions of the liver, in mammals, a role as mediator of systemic and local innate immunity has also been reported. Although the presence of an important leukocyte population in mammalian liver is well documented, the characterization of leukocyte populations in the teleost liver has been only scarcely addressed. In the current work, we have confirmed the presence of IgM+, IgD+, IgT+, CD8α+, CD3+ cells, and cells expressing major histocompatibility complex (MHC-II) in rainbow trout (Oncorhynchus mykiss) liver by flow cytometry and/or immunohistochemistry analysis. Additionally, the effect of viral hemorrhagic septicemia virus (VHSV) on the liver immune response was assessed. First, we studied the effect of viral intraperitoneal injection on the transcription of a wide selection of immune genes at days 1, 2 and 5 post-infection. These included a group of leukocyte markers genes, pattern recognition receptors (PRRs), chemokines, chemokine receptor genes, and other genes involved in the early immune response and in acute phase reaction. Our results indicate that T lymphocytes play a key role in the initial response to VHSV in the liver, since CD3, CD8, CD4, perforin, Mx and interferon (IFN) transcription levels were up-regulated in response to VHSV. Consequently, flow cytometry analysis of CD8α+ cells in liver and spleen at day 5 post-infection revealed a decrease in the number of CD8α+ cells in the spleen and an increased population in the liver. No differences were found however in the percentages of B lymphocyte (IgM+ or IgD+) populations. In addition, a strong up-regulation in the transcription levels of several PRRs and chemokines was observed from the second day of infection, indicating an important role of these factors in the response of the liver to viral infections. PMID:25338079

  5. Q fever in pregnant goats: humoral and cellular immune responses

    PubMed Central

    2013-01-01

    Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213

  6. The innate and adaptive immune response to avian influenza virus

    USDA-ARS?s Scientific Manuscript database

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  7. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1986-07-01

    0-1 NO- 3K1- INO. "඄o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in

  8. SUMO-Enriched Proteome for Drosophila Innate Immune Response

    PubMed Central

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.

    2015-01-01

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

  9. SUMO-Enriched Proteome for Drosophila Innate Immune Response.

    PubMed

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S

    2015-08-18

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.

  10. Immune Control of Burkholderia pseudomallei––Common, High-Frequency T-Cell Responses to a Broad Repertoire of Immunoprevalent Epitopes

    PubMed Central

    Nithichanon, Arnone; Rinchai, Darawan; Buddhisa, Surachat; Saenmuang, Pornpun; Kewcharoenwong, Chidchamai; Kessler, Bianca; Khaenam, Prasong; Chetchotisakd, Ploenchan; Maillere, Bernard; Robinson, John; Reynolds, Catherine J.; Boyton, Rosemary J.; Altmann, Daniel M.; Lertmemongkolchai, Ganjana

    2018-01-01

    Burkholderia pseudomallei (Bp) is an environmental bacterial pathogen that causes potentially lethal sepsis in susceptible individuals and is considered a Category B, Tier-1 biothreat agent. As such, it is crucial to gain an improved understanding of protective immunity and potential vaccine candidates. The nature of immune correlates dictating why most exposed individuals in endemic regions undergo asymptomatic seroconversion while others succumb to life-threatening sepsis is largely uncharted. Bp seroreactive, immunogenic proteins have previously been identified by antigen microarray. We here set out to conduct an analysis of T-cell recognition of the Bp immunome using serodominant antigens represented in the original antigen microarray, examining immune correlates of disease in healthy seropositive individuals and those with acute disease or in convalescence. By screening a library of 739 overlapping peptides representing the sequences of 20 different Bp antigens, we aimed to define immune correlates of protection at the level of immunoprevalent T-cell epitopes. Responses to a large number of epitopes were common in healthy seropositive individuals: we found remarkably broad responsiveness to Bp epitopes, with 235 of 739 peptides recognized by ≥80% of all tested donors. The cumulative response to Bp epitopes in healthy, seropositive, donors from this endemic region were of the order of thousands of spot forming cells per million cells, making Bp recognition a significant component of the T-cell repertoire. Noteworthy among our findings, analysis revealed 10 highly immunoprevalent T-cell epitopes, able to induce Bp-specific IFNγ responses that were high in responding T-cell frequency within the repertoire, and also common across individuals with different human leukocyte antigen types. Acute melioidosis patients showed poor T-cell responses to the immunoprevalent epitopes, but acquired responsiveness following recovery from infection. Our findings suggest

  11. Immune responses and protection after DNA vaccination against Toxoplasma gondii calcium-dependent protein kinase 2 (TgCDPK2)

    PubMed Central

    Chen, Kai; Wang, Jin-Lei; Huang, Si-Yang; Yang, Wen-Bin; Zhu, Wei-Ning; Zhu, Xing-Quan

    2017-01-01

    Toxoplasma gondii, an intracellular zoonotic protozoan parasite, is possibly the most widespread parasite of warm-blooded animals and can cause serious public health problems and economic losses worldwide. TgCDPK2, a member of the T. gondii calcium-dependent protein kinase family, was recently identified as an essential regulator for viable cyst development in T. gondii. In the present study, we evaluated the protective immunity induced by DNA vaccination based on a recombinant eukaryotic plasmid, pVAX-TgCDPK2, against acute toxoplasmosis in mice. BALB/c mice were intramuscularly immunized with pVAX-TgCDPK2 plasmid and then challenged by infection with the highly virulent RH strain of T. gondii. The specific immune responses and protective efficacy against T. gondii were analyzed by cytokine and serum antibody measurements, lymphocyte proliferation assays, flow cytometric on lymphocytes and the survival time of mice after challenge. Our results showed that mice immunized with pVAX-TgCDPK2 could elicit special humoral and cellular responses, with higher levels of IgG antibody, and increased levels of Th1-type cytokines IFN-γ, IL-12(p70), and CD3 + CD4 + CD8 − and CD3 + CD8 + CD4 − T cells, and had a prolonged survival time (14.0 ± 2.32 days) compared to control mice. These results demonstrate that pVAX-TgCDPK2 is a potential vaccine candidate against acute toxoplasmosis. PMID:29119944

  12. Immune function trade-offs in response to parasite threats.

    PubMed

    Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W

    2017-04-01

    Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Innate immune sensing and response to influenza.

    PubMed

    Pulendran, Bali; Maddur, Mohan S

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.

  14. Control of epithelial immune-response genes and implications for airway immunity and inflammation.

    PubMed

    Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J

    1998-01-01

    A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.

  15. Innate immune response development in nestling tree swallows

    USGS Publications Warehouse

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  16. Modeling Systems-Level Regulation of Host Immune Responses

    PubMed Central

    Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka

    2007-01-01

    Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

  17. Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.

    PubMed

    Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C

    2016-05-01

    Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.

  18. Peripheral dendritic cells are essential for both the innate and adaptive antiviral immune responses in the central nervous system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steel, Christina D.; Hahto, Suzanne M.; Ciavarra, Richard P., E-mail: ciavarrp@evms.ed

    2009-04-25

    Intranasal application of vesicular stomatitis virus (VSV) causes acute infection of the central nervous system (CNS). However, VSV encephalitis is not invariably fatal, suggesting that the CNS may contain a professional antigen-presenting cell (APC) capable of inducing or propagating a protective antiviral immune response. To examine this possibility, we first characterized the cellular elements that infiltrate the brain as well as the activation status of resident microglia in the brains of normal and transgenic mice acutely ablated of peripheral dendritic cells (DCs) in vivo. VSV encephalitis was characterized by a pronounced infiltrate of myeloid cells (CD45{sup high}CD11b{sup +}) and CD8{supmore » +} T cells containing a subset that was specific for the immunodominant VSV nuclear protein epitope. This T cell response correlated temporally with a rapid and sustained upregulation of MHC class I expression on microglia, whereas class II expression was markedly delayed. Ablation of peripheral DCs profoundly inhibited the inflammatory response as well as infiltration of virus-specific CD8{sup +} T cells. Unexpectedly, the VSV-induced interferon-gamma (IFN-gamma) response in the CNS remained intact in DC-deficient mice. Thus, both the inflammatory and certain components of the adaptive primary antiviral immune response in the CNS are dependent on peripheral DCs in vivo.« less

  19. Agouron and immune response to commercialize remune immune-based treatment.

    PubMed

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  20. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  1. Modeling the interactions between pathogenic bacteria, bacteriophage and immune response

    NASA Astrophysics Data System (ADS)

    Leung, Chung Yin (Joey); Weitz, Joshua S.

    The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.

  2. Mathematical modeling the radiation effects on humoral immunity

    NASA Astrophysics Data System (ADS)

    Smirnova, O. A.

    A mathematical model of humoral immune response in nonirradiated and irradiated mammals is developed. It is based on conventional theories and experimental facts in this field. The model is a system of nonlinear differential equations which describe the dynamics of concentrations of antibody and antigen molecules, immunocompetent B lymphocytes, and the rest blood lymphocytes, as well as the bone-marrow lymphocyte precursors. The interaction of antigen molecules with antibodies and with antibody-like receptors on immunocompetent cells is also incorporated. The model quantitatively reproduces the dynamics of the humoral immune response to the T-independent antigen (capsular antigen of plague microbe) in nonirradiated mammals (CBA mice). It describes the peculiarities of the humoral immune response in CBA mice exposed to acute radiation before or after introducing antigen. The model predicts an adaptation of humoral immune system to low dose rate chronic irradiation in the result of which the intensity of immune response relaxes to a new, lower than normal, stable level. The mechanisms of this phenomenon are revealed. The results obtained show that the developed model, after the appropriate identification, can be used to predict the effects of acute and low-level long-term irradiation on the system of humoral immunity in humans. Employment of the mathematical model identified in the proper way should be important in estimating the radiation risk for cosmonauts and astronauts on long space missions such as a voyage to Mars or a lunar colony.

  3. Cellular Immune Response in Young Children Accounts for Recurrent Acute Otitis Media

    PubMed Central

    Sharma, Sharad K.; Pichichero, Michael E.

    2013-01-01

    Acute otitis media (AOM) is a common disease in young children. Streptococcus pneumoniae(Spn) and Haemophilus influenzae (NTHi) are the two most common pathogens that cause AOM. Over the past 5 years our group has been studying the immunologic profile of children that experience repeated AOM infections despite tympanocentesis drainage of middle ear fluid and individualized antibiotic treatment; we call these children stringently-defined otitis-prone (sOP). Although protection against AOM is primarily mediated by ototpathogen-specific antibody, our recent studies suggest that suboptimal memory B-& T- cell responses and an immaturity in antigen presenting cells may play a significant role in the propensity to recurrent AOM infections. This review focuses on the studies performed to define immunologic dysfunction in sOP children. PMID:24022464

  4. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  5. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.

    2010-01-01

    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  6. Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

    USGS Publications Warehouse

    Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.

    2000-01-01

    Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a

  7. Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.

    PubMed

    Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M

    2013-04-16

    Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.

  8. Immune and stress responses in oysters with insights on adaptation.

    PubMed

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Melatonin: Buffering the Immune System

    PubMed Central

    Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

    2013-01-01

    Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496

  10. Innate Immune Sensing and Response to Influenza

    PubMed Central

    Pulendran, Bali; Maddur, Mohan S.

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919

  11. Time matters - acute stress response and glucocorticoid sensitivity in early multiple sclerosis.

    PubMed

    Kern, Simone; Rohleder, Nicolas; Eisenhofer, Graeme; Lange, Jan; Ziemssen, Tjalf

    2014-10-01

    Psychosocial stress has frequently been associated with disease activity and acute exacerbations in multiple sclerosis (MS). Despite this well established finding, strikingly little is known about the acute hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) stress response in MS. Twenty-six early relapsing-remitting MS (RRMS) patients and seventeen age- and sex-matched healthy control subjects (CS) took part in the Trier Social Stress Test (TSST), a well validated psycho-social laboratory stress protocol. Repeated blood samples were analyzed for stress-related cortisol and catecholamine levels as well as for glucocorticoid sensitivity (GCS) of target immune cells. Chronic and acute stress appraisals were assessed by self-report measures. RRMS patients and CS did not differ in stress-related cortisol/catecholamine levels, GCS or stress appraisal in response to the TSST. However, cortisol release as well as GCS was strongly correlated with time since diagnosis but not with neurological disability. Patients with shorter disease duration (2-12 months) expressed a significantly higher cortisol stress response while MS patients with longer disease duration (14-36 months) showed a significantly diminished HPA response as well as lower post-stress GCS. There is evidence for a time-dependent variability in the HPA stress system with an increased cortisol stress response in the first year after diagnosis along with a more blunted HPA stress response and a diminished GCS in subsequent disease stages. Data underscore the highly dynamic nature of HPA axis regulation in the MS disease process, which could possibly relate to compensatory mechanisms within a cytokine-HPA axis feedback circuit model. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Probiotics, antibiotics and the immune responses to vaccines

    PubMed Central

    Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-01-01

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456

  13. Probiotics, antibiotics and the immune responses to vaccines.

    PubMed

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  14. Characterization of host immune responses in Ebola virus infections.

    PubMed

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  15. Immunity to fish rhabdoviruses

    USGS Publications Warehouse

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non-virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  16. Immunity to fish rhabdoviruses.

    PubMed

    Purcell, Maureen K; Laing, Kerry J; Winton, James R

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  17. Arginine and Citrulline and the Immune Response in Sepsis

    PubMed Central

    Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn

    2015-01-01

    Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985

  18. The immune response to Nipah virus infection.

    PubMed

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J

    2012-09-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.

  19. Chemokine-mediated immune responses in the female genital tract mucosa.

    PubMed

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  20. Influence of ionizing radiation on the immune response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brocadeszaalberg, O.

    1974-01-01

    The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)

  1. Inflammation in acute and chronic pancreatitis.

    PubMed

    Habtezion, Aida

    2015-09-01

    This report reviews recent animal model and human studies associated with inflammatory responses in acute and chronic pancreatitis. Animal model and limited human acute and chronic pancreatitis studies unravel the dynamic nature of the inflammatory processes and the ability of the immune cells to sense danger and environmental signals. In acute pancreatitis, such molecules include pathogen-associated molecular pattern recognition receptors such as toll-like receptors, and the more recently appreciated damage-associated molecular pattern molecules or 'alarmin' high mobility group box 1 and IL-33. In chronic pancreatitis, a recent understanding of a critical role for macrophage-pancreatic stellate cell interaction offers a potential targetable pathway that can alter fibrogenesis. Microbiome research in pancreatitis is a new field gaining interest but will require further investigation. Immune cell contribution to the pathogenesis of acute and chronic pancreatitis is gaining more appreciation and further understanding in immune signaling presents potential therapeutic targets that can alter disease progression.

  2. Essential oil of clove (Eugenia caryophyllata) augments the humoral immune response but decreases cell mediated immunity.

    PubMed

    Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K

    2011-08-01

    The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.

  3. Cytotoxic immune responses in the lungs correlate to disease severity in patients with hantavirus infection.

    PubMed

    Rasmuson, J; Pourazar, J; Mohamed, N; Lejon, K; Evander, M; Blomberg, A; Ahlm, C

    2016-04-01

    Hantavirus infections may cause severe and sometime life-threatening lung failure. The pathogenesis is not fully known and there is an urgent need for effective treatment. We aimed to investigate the association between pulmonary viral load and immune responses, and their relation to disease severity. Bronchoscopy with sampling of bronchoalveolar lavage (BAL) fluid was performed in 17 patients with acute Puumala hantavirus infection and 16 healthy volunteers acting as controls. Lymphocyte subsets, granzyme concentrations, and viral load were determined by flow cytometry, enzyme-linked immunosorbent assay (ELISA), and quantitative reverse transcription polymerase chain reaction (RT-PCR), respectively. Analyses of BAL fluid revealed significantly higher numbers of activated CD8(+) T cells and natural killer (NK) cells, as well as higher concentrations of the cytotoxins granzymes A and B in hantavirus-infected patients, compared to controls. In patients, Puumala hantavirus RNA was detected in 88 % of BAL cell samples and correlated inversely to the T cell response. The magnitude of the pulmonary cytotoxic lymphocyte response correlated to the severity of disease and systemic organ dysfunction, in terms of need for supplemental oxygen treatment, hypotension, and laboratory data indicating renal failure, cardiac dysfunction, vascular leakage, and cell damage. Regulatory T cell numbers were significantly lower in patients compared to controls, and may reflect inadequate immune regulation during hantavirus infection. Hantavirus infection elicits a pronounced cytotoxic lymphocyte response in the lungs. The magnitude of the immune response was associated with disease severity. These results give insights into the pathogenesis and possibilities for new treatments.

  4. Onchocerciasis modulates the immune response to mycobacterial antigens

    PubMed Central

    Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E

    1999-01-01

    Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056

  5. The Role of the Immune Response in Chlamydia trachomatis Infection of the Male Genital Tract: A Double-Edged Sword

    PubMed Central

    Redgrove, Kate A.; McLaughlin, Eileen A.

    2014-01-01

    Chlamydia trachomatis (CT) is the most prevalent bacterial sexually transmitted infection in the world, with more than 100 million cases reported annually. While there have been extensive studies into the adverse effects that CT infection has on the female genital tract, and on the subsequent ability of these women to conceive, studies into the consequences on male fertility have been limited and controversial. This is in part due to the asymptomatic nature of the infection, where it is estimated that 50% of men with Chlamydia fail to show any symptoms. It is accepted, however, that acute and/or persistent CT infection is the causative agent for conditions such as urethritis, epididymitis, epididymo-orchitis, and potentially prostatitis. As with most infections, the immune system plays a fundamental role in the body’s attempts to eradicate the infection. The first and most important immune response to Chlamydia infection is a local one, whereby immune cells such as leukocytes are recruited to the site of infections, and subsequently secrete pro-inflammatory cytokines and chemokines such as interferon gamma. Immune cells also work to initiate and potentiate chronic inflammation through the production of reactive oxygen species (ROS), and the release of molecules with degradative properties including defensins, elastase, collagenase, cathespins, and lysozyme. This long-term inflammation can lead to cell proliferation (a possible precursor to cancer), tissue remodeling, and scarring, as well as being linked to the onset of autoimmune responses in genetically disposed individuals. This review will focus on the ability of the immune system to recognize and clear acute and persistent chlamydial infections in the male genital tract, and on the paradoxical damage that chronic inflammation resulting from the infection can cause on the reproductive health of the individual. PMID:25386180

  6. The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

    PubMed Central

    Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID

  7. The ocular conjunctiva as a mucosal immunization route: a profile of the immune response to the model antigen tetanus toxoid.

    PubMed

    Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.

  8. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    PubMed

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The central role of hypothalamic inflammation in the acute illness response and cachexia.

    PubMed

    Burfeind, Kevin G; Michaelis, Katherine A; Marks, Daniel L

    2016-06-01

    When challenged with a variety of inflammatory threats, multiple systems across the body undergo physiological responses to promote defense and survival. The constellation of fever, anorexia, and fatigue is known as the acute illness response, and represents an adaptive behavioral and physiological reaction to stimuli such as infection. On the other end of the spectrum, cachexia is a deadly and clinically challenging syndrome involving anorexia, fatigue, and muscle wasting. Both of these processes are governed by inflammatory mediators including cytokines, chemokines, and immune cells. Though the effects of cachexia can be partially explained by direct effects of disease processes on wasting tissues, a growing body of evidence shows the central nervous system (CNS) also plays an essential mechanistic role in cachexia. In the context of inflammatory stress, the hypothalamus integrates signals from peripheral systems, which it translates into neuroendocrine perturbations, altered neuronal signaling, and global metabolic derangements. Therefore, we will discuss how hypothalamic inflammation is an essential driver of both the acute illness response and cachexia, and why this organ is uniquely equipped to generate and maintain chronic inflammation. First, we will focus on the role of the hypothalamus in acute responses to dietary and infectious stimuli. Next, we will discuss the role of cytokines in driving homeostatic disequilibrium, resulting in muscle wasting, anorexia, and weight loss. Finally, we will address mechanisms and mediators of chronic hypothalamic inflammation, including endothelial cells, chemokines, and peripheral leukocytes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Immune cell changes in response to a swimming training session during a 24-h recovery period.

    PubMed

    Morgado, José P; Monteiro, Cristina P; Teles, Júlia; Reis, Joana F; Matias, Catarina; Seixas, Maria T; Alvim, Marta G; Bourbon, Mafalda; Laires, Maria J; Alves, Francisco

    2016-05-01

    Understanding the impact of training sessions on the immune response is crucial for the adequate periodization of training, to prevent both a negative influence on health and a performance impairment of the athlete. This study evaluated acute systemic immune cell changes in response to an actual swimming session, during a 24-h recovery period, controlling for sex, menstrual cycle phases, maturity, and age group. Competitive swimmers (30 females, 15 ± 1.3 years old; and 35 males, 16.5 ± 2.1 years old) performed a high-intensity training session. Blood samples were collected before, immediately after, 2 h after, and 24 h after exercise. Standard procedures for the assessment of leukogram by automated counting (Coulter LH 750, Beckman) and lymphocytes subsets by flow cytometry (FACS Calibur BD, Biosciences) were used. Subjects were grouped according to competitive age groups and pubertal Tanner stages. Menstrual cycle phase was monitored. The training session induced neutrophilia, lymphopenia, and a low eosinophil count, lasting for at least 2 h, independent of sex and maturity. At 24 h postexercise, the acquired immunity of juniors (15-17 years old), expressed by total lymphocytes and total T lymphocytes (CD3(+)), was not fully recovered. This should be accounted for when planning a weekly training program. The observed lymphopenia suggests a lower immune surveillance at the end of the session that may depress the immunity of athletes, highlighting the need for extra care when athletes are exposed to aggressive environmental agents such as swimming pools.

  11. Enhancing the Immune Response to Recombinant Plague Antigens

    DTIC Science & Technology

    2006-05-01

    Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant

  12. Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens

    PubMed Central

    Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.

    2007-01-01

    In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440

  13. Costs of mounting an immune response during pregnancy in a lizard.

    PubMed

    Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald

    2013-01-01

    Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

  14. Multiscale modeling of mucosal immune responses

    PubMed Central

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  15. Multiscale modeling of mucosal immune responses.

    PubMed

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  16. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    PubMed

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  17. The immune response to Nipah virus infection

    PubMed Central

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.

    2012-01-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317

  18. Cytomegalovirus infection enhances the immune response to influenza.

    PubMed

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-04-01

    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.

  19. Cellular immune response experiment MA-031

    NASA Technical Reports Server (NTRS)

    Criswell, B. S.

    1976-01-01

    Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.

  20. Impaired Epstein-Barr Virus-Specific Neutralizing Antibody Response during Acute Infectious Mononucleosis Is Coincident with Global B-Cell Dysfunction

    PubMed Central

    Panikkar, Archana; Hislop, Andrew; Tellam, Nick; Dasari, Vijayendra; Hogquist, Kristin A.; Wykes, Michelle; Moss, Denis J.; Rickinson, Alan; Balfour, Henry H.

    2015-01-01

    Here we present evidence for previously unappreciated B-cell immune dysregulation during acute Epstein-Barr virus (EBV)-associated infectious mononucleosis (IM). Longitudinal analyses revealed that patients with acute IM have undetectable EBV-specific neutralizing antibodies and gp350-specific B-cell responses, which were associated with a significant reduction in memory B cells and no evidence of circulating antibody-secreting cells. These observations correlate with dysregulation of tumor necrosis factor family members BAFF and APRIL and increased expression of FAS on circulating B cells. PMID:26109734

  1. Toll-like receptor 7 is required for effective adaptive immune responses that prevent persistent virus infection.

    PubMed

    Walsh, Kevin B; Teijaro, John R; Zuniga, Elina I; Welch, Megan J; Fremgen, Daniel M; Blackburn, Shawn D; von Tiehl, Karl F; Wherry, E John; Flavell, Richard A; Oldstone, Michael B A

    2012-06-14

    TLR7 is an innate signaling receptor that recognizes single-stranded viral RNA and is activated by viruses that cause persistent infections. We show that TLR7 signaling dictates either clearance or establishment of life-long chronic infection by lymphocytic choriomeningitis virus (LCMV) Cl 13 but does not affect clearance of the acute LCMV Armstrong 53b strain. TLR7(-/-) mice infected with LCMV Cl 13 remained viremic throughout life from defects in the adaptive antiviral immune response-notably, diminished T cell function, exacerbated T cell exhaustion, decreased plasma cell maturation, and negligible antiviral antibody production. Adoptive transfer of TLR7(+/+) LCMV immune memory cells that enhanced clearance of persistent LCMV Cl 13 infection in TLR7(+/+) mice failed to purge LCMV Cl 13 infection in TLR7(-/-) mice, demonstrating that a TLR7-deficient environment renders antiviral responses ineffective. Therefore, methods that promote TLR7 signaling are promising treatment strategies for chronic viral infections. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Suppressive influences in the immune response to cancer.

    PubMed

    Bronte, Vincenzo; Mocellin, Simone

    2009-01-01

    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  3. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.

    PubMed

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-12-24

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  4. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    PubMed Central

    Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-01-01

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550

  5. Cytokine-Mediated Loss of Blood Dendritic Cells During Epstein-Barr Virus-Associated Acute Infectious Mononucleosis: Implication for Immune Dysregulation.

    PubMed

    Panikkar, Archana; Smith, Corey; Hislop, Andrew; Tellam, Nick; Dasari, Vijayendra; Hogquist, Kristin A; Wykes, Michelle; Moss, Denis J; Rickinson, Alan; Balfour, Henry H; Khanna, Rajiv

    2015-12-15

    Acute infectious mononucleosis (IM) is associated with altered expression of inflammatory cytokines and disturbed T-cell homeostasis, however, the precise mechanism of this immune dysregulation remains unresolved. In the current study we demonstrated a significant loss of circulating myeloid and plasmacytoid dendritic cells (DCs) during acute IM, a loss correlated with the severity of clinical symptoms. In vitro exposure of blood DCs to acute IM plasma resulted in loss of plasmacytoid DCs, and further studies with individual cytokines showed that exposure to interleukin 10 could replicate this effect. Our data provide important mechanistic insight into dysregulated immune homeostasis during acute IM. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Fetal immune response to chorioamnionitis

    PubMed Central

    Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.

    2014-01-01

    Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922

  7. Human Immune Response to Dengue Infections

    DTIC Science & Technology

    1989-07-31

    antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8

  8. Early-life inflammation, immune response and ageing.

    PubMed

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  9. Early-life inflammation, immune response and ageing

    PubMed Central

    2017-01-01

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145

  10. Acute symptomatic hypocalcemia from immune checkpoint therapy-induced hypoparathyroidism.

    PubMed

    Win, Myint Aung; Thein, Kyaw Zin; Qdaisat, Aiham; Yeung, Sai-Ching Jim

    2017-07-01

    Ipilimumab (a monoclonal antibody against CTLA-4) and nivolumab (a humanized antibody against PD-1) target these immune checkpoint pathways and are used for treatment of melanoma and an increasing number of other cancers. However, they may cause immune-related adverse effects (IRAEs). Although many endocrinopathies are known to be IRAEs, primary hypoparathyroidism with severe hypocalcemia has never been reported. This is the first case of hypoparathyroidism as an IRAE presenting to an Emergency Department with acute hypocalcemia. A 73-year-old man with metastatic melanoma presented to the Emergency Department for the chief complaints of imbalance, general muscle weakness, abdominal pain and tingling in extremities. He had wide spread metastasis, and begun immunotherapy with concurrent ipilimumab and nivolumab 1.5months ago. At presentation, he had ataxia, paresthesia in the hands and feet, and abdominal cramping. Magnetic resonance imaging of the brain was unremarkable. He was found to be hypocalcemic with undetectable plasma parathyroid hormone. He was admitted for treatment of symptomatic hypocalcemia and was diagnosed with primary hypoparathyroidism. Shortly afterwards, he had thyrotoxicosis manifesting as tachycardia and anxiety, followed by development of primary hypothyroidism. At 4months after the Emergency Department visit, his parathyroid function and thyroid function had not recovered, and required continued thyroid hormone replacement and calcium and vitamin D treatment for hypocalcemia. Primary hypoparathyroidism caused by ipilimumab and nivolumab may acute manifest with severe symptomatic hypocalcemia. Emergency care providers should be aware of hypoparathyroidism as a new IRAE in this new era of immuno-oncology. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Engineering Immunity: Modulating Dendritic Cell Subsets and Lymph Node Response to Direct Immune-polarization and Vaccine Efficacy

    PubMed Central

    Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu

    2017-01-01

    While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733

  12. Innate but not Adaptive Immune Responses Contribute to Behavioral Seizures Following Viral Infection

    PubMed Central

    Kirkman, Nikki J.; Libbey, Jane E.; Wilcox, Karen S.; White, H. Steve; Fujinami, Robert S.

    2011-01-01

    SUMMARY Purpose To examine the role of innate immunity in a novel viral infection-induced seizure model. Methods C57BL/6 mice, mouse strains deficient in interleukin (IL)-1RI, IL-6, tumor necrosis factor (TNF)-RI, or myeloid differentiation primary response gene 88 (MyD88), or transgenic mice (OT-I) were infected with Theiler’s murine encephalomyelitis virus (TMEV) or mock-infected. Mice were followed for acute seizures. Tissues were examined for neuron loss, the presence of virus (viral RNA and antigen), perivascular cuffs, macrophages/microglia and gliosis, and mRNA expression of IL-1, TNF-α and IL-6. Results IL-1 does not play a major role in seizures as IL-1RI and MyD88 deficient mice displayed a comparable seizure frequency relative to controls. In contrast, TNF-α and IL-6 appear to be important in the development of seizures as only 10% and 15% of TNF-RI and IL-6 deficient mice showed signs of seizure activity, respectively. TNF-α and IL-6 mRNA levels also increased in mice with seizures. Inflammation (perivascular cuffs, macrophages/microglia and gliosis) was greater in mice with seizures. OT-I mice (virus persists) had a seizure rate that was comparable to controls (no viral persistence) thereby discounting a role for TMEV-specific T–cells in seizures. Discussion We have implicated the innate immune response to viral infection, specifically TNF-α and IL-6, and concomitant inflammatory changes in the brain as contributing to the development of acute seizures. This model is a potential infection-driven model of mesial temporal lobe epilepsy with hippocampal sclerosis. PMID:19845729

  13. Immunobiography and the Heterogeneity of Immune Responses in the Elderly: A Focus on Inflammaging and Trained Immunity

    PubMed Central

    Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam

    2017-01-01

    Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086

  14. Fluorescent light exposure incites acute and prolonged immune responses in zebrafish (Danio rerio) skin.

    PubMed

    Gonzalez, Trevor J; Lu, Yuan; Boswell, Mikki; Boswell, William; Medrano, Geraldo; Walter, Sean; Ellis, Samuel; Savage, Markita; Varga, Zoltan M; Lawrence, Christian; Sanders, George; Walter, Ronald B

    2018-06-01

    Artificial light produces an emission spectrum that is considerably different than the solar spectrum. Artificial light has been shown to affect various behavior and physiological processes in vertebrates. However, there exists a paucity of data regarding the molecular genetic effects of artificial light exposure. Previous studies showed that one of the commonly used fluorescent light source (FL; 4100K or "cool white") can affect signaling pathways related to maintenance of circadian rhythm, cell cycle progression, chromosome segregation, and DNA repair/recombination in the skin of male Xiphophorus maculatus. These observations raise questions concerning the kinetics of the FL induced gene expression response, and which biological functions become modulated at various times after light exposure. To address these questions, we exposed zebrafish to 4100K FL and utilized RNA-Seq to assess gene expression changes in skin at various times (1 to 12h) after FL exposure. We found 4100K FL incites a robust early (1-2h) transcriptional response, followed by a more protracted late response (i.e., 4-12h). The early transcriptional response involves genes associated with cell migration/infiltration and cell proliferation as part of an overall increase in immune function and inflammation. The protracted late transcriptional response occurs within gene sets predicted to maintain and perpetuate the inflammatory response, as well as suppression of lipid, xenobiotic, and melatonin metabolism. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Strain difference in the immune response to hydralazine in inbred guinea-pigs

    PubMed Central

    Ellman, L.; Inman, J.; Green, Ira

    1971-01-01

    Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639

  16. Factors that deregulate the protective immune response in tuberculosis.

    PubMed

    Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana

    2009-01-01

    Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.

  17. Measles virus, immune control and persistence

    PubMed Central

    Griffin, Diane E.; Lin, Wen-Hsuan; Pan, Chien-Hsiung

    2012-01-01

    Measles remains one of the most important causes of child morbidity and mortality worldwide with the greatest burden in the youngest children. Most acute measles deaths are due to secondary infections that result from a poorly understood measles-induced suppression of immune responses. Young children are also vulnerable to late development of subacute sclerosing panencephalitis, a progressive, uniformly fatal neurologic disease caused by persistent measles virus (MeV) infection. During acute infection, the rash marks the appearance of the adaptive immune response and CD8+ T cell-mediated clearance of infectious virus. However, after clearance of infectious virus, MeV RNA persists and can be detected in blood, respiratory secretions, urine and lymphoid tissue for many weeks to months. This prolonged period of virus clearance may help to explain measles immunosuppression and the development of lifelong immunity to re-infection, as well as occasional infection of the nervous system. Once MeV infects neurons, the virus can spread transynaptically and the envelope proteins needed to form infectious virus are unnecessary, accumulate mutations and can establish persistent infection. Identification of the immune mechanisms required for clearance of MeV RNA from multiple sites will enlighten our understanding of the development of disease due to persistent infection. PMID:22316382

  18. Immune response profiling in early rheumatoid arthritis: discovery of a novel interaction of treatment response with viral immunity

    PubMed Central

    2013-01-01

    Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to

  19. Innate Immune Responses in Leprosy

    PubMed Central

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  20. Transcriptional Profiling of the Immune Response to Marburg Virus Infection.

    PubMed

    Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J

    2015-10-01

    Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells

  1. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    PubMed

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    PubMed Central

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  3. CD39 is upregulated during activation of mouse and human T cells and attenuates the immune response to Listeria monocytogenes.

    PubMed

    Raczkowski, Friederike; Rissiek, Anne; Ricklefs, Isabell; Heiss, Kirsten; Schumacher, Valéa; Wundenberg, Kira; Haag, Friedrich; Koch-Nolte, Friedrich; Tolosa, Eva; Mittrücker, Hans-Willi

    2018-01-01

    The ectoenzymes CD39 and CD73 degrade extracellular ATP to adenosine. ATP is released by stressed or damaged cells and provides pro-inflammatory signals to immune cells through P2 receptors. Adenosine, on the other hand, suppresses immune cells by stimulating P1 receptors. Thus, CD39 and CD73 can shape the quality of immune responses. Here we demonstrate that upregulation of CD39 is a consistent feature of activated conventional CD4+ and CD8+ T cells. Following stimulation in vitro, CD4+ and CD8+ T cells from human blood gained surface expression of CD39 but displayed only low levels of CD73. Activated human T cells from inflamed joints largely presented with a CD39+CD73- phenotype. In line, in spleens of mice with acute Listeria monocytogenes, listeria-specific CD4+ and CD8+ T cells acquired a CD39+CD73- phenotype. To test the function of CD39 in control of bacterial infection, CD39-deficient (CD39-/-) mice were infected with L. monocytogenes. CD39-/- mice showed better initial control of L. monocytogenes, which was associated with enhanced production of inflammatory cytokines. In the late stage of infection, CD39-/- mice accumulated more listeria-specific CD8+ T cells in the spleen than wildtype animals suggesting that CD39 attenuates the CD8+ T-cell response to infection. In conclusion, our results demonstrate that CD39 is upregulated on conventional CD4+ and CD8+ T cells at sites of acute infection and inflammation, and that CD39 dampens responses to bacterial infection.

  4. Innate Immune Responses to Cryptococcus.

    PubMed

    Heung, Lena J

    2017-09-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.

  5. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    PubMed

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  6. Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.

    PubMed

    Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi

    2018-04-16

    While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. A basic mathematical model of the immune response

    NASA Astrophysics Data System (ADS)

    Mayer, H.; Zaenker, K. S.; an der Heiden, U.

    1995-03-01

    Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.

  8. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel Therapeutic Formulation

    PubMed Central

    Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira

    2016-01-01

    ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel

  9. Impaired Epstein-Barr Virus-Specific Neutralizing Antibody Response during Acute Infectious Mononucleosis Is Coincident with Global B-Cell Dysfunction.

    PubMed

    Panikkar, Archana; Smith, Corey; Hislop, Andrew; Tellam, Nick; Dasari, Vijayendra; Hogquist, Kristin A; Wykes, Michelle; Moss, Denis J; Rickinson, Alan; Balfour, Henry H; Khanna, Rajiv

    2015-09-01

    Here we present evidence for previously unappreciated B-cell immune dysregulation during acute Epstein-Barr virus (EBV)-associated infectious mononucleosis (IM). Longitudinal analyses revealed that patients with acute IM have undetectable EBV-specific neutralizing antibodies and gp350-specific B-cell responses, which were associated with a significant reduction in memory B cells and no evidence of circulating antibody-secreting cells. These observations correlate with dysregulation of tumor necrosis factor family members BAFF and APRIL and increased expression of FAS on circulating B cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Natural Killer Cell Functions during the Innate Immune Response to Pathogenic Streptococci

    PubMed Central

    Lemire, Paul; Galbas, Tristan; Thibodeau, Jacques; Segura, Mariela

    2017-01-01

    Dendritic cells (DCs) and NK cells play a crucial role in the first phase of host defense against infections. Group B Streptococcus (GBS) and Streptococcus suis are encapsulated streptococci causing severe systemic inflammation, leading to septicemia and meningitis. Yet, the involvement of NK cells in the innate immune response to encapsulated bacterial infection is poorly characterized. Here, it was observed that these two streptococcal species rapidly induce the release of IFN-γ and that NK cells are the major cell type responsible for this production during the acute phase of the infection. Albeit S. suis capacity to activate NK cells was lower than that of GBS, these cells partially contribute to S. suis systemic infection; mainly through amplification of the inflammatory loop. In contrast, such a role was not observed during GBS systemic infection. IFN-γ release by NK cells required the presence of DCs, which in turn had a synergistic effect on DC cytokine production. These responses were mainly mediated by direct DC-NK cell contact and partially dependent on soluble factors. Though IL-12 and LFA-1 were shown to be critical in S. suis-mediated activation of the DC-NK cell crosstalk, different or redundant molecular pathways modulate DC-NK interactions during GBS infection. The bacterial capsular polysaccharides also differently modulated NK cell activation. Together, these results demonstrated a role of NK cells in the innate immune response against encapsulated streptococcal infections; yet the molecular pathways governing NK activation seem to differ upon the pathogen and should not be generalized when studying bacterial infections. PMID:28706510

  11. Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores

    PubMed Central

    Lampert, Evan

    2012-01-01

    Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545

  12. Acute stress promotes post-injury brain regeneration in fish.

    PubMed

    Sinyakov, Michael S; Haimovich, Amihai; Avtalion, Ramy R

    2017-12-01

    The central nervous system and the immune system, the two major players in homeostasis, operate in the ongoing bidirectional interaction. Stress is the third player that exerts strong effect on these two 'supersystems'; yet, its impact is studied much less. In this work employing carp model, we studied the influence of preliminary stress on neural and immune networks involved in post-injury brain regeneration. The relevant in vivo models of air-exposure stress and precisely directed cerebellum injury have been developed. Neuronal regeneration was evaluated by using specific tracers of cell proliferation and differentiation. Involvement of immune networks was accessed by monitoring the expression of selected T cells markers. Contrast difference between acute and chronic stress manifested in the fact that chronically stressed fish did not survive the brain injury. Neuronal regeneration appeared as a biphasic process whereas involvement of immune system proceeded as a monophasic route. In stressed fish, immune response was fast and accompanied or even preceded neuronal regeneration. In unstressed subjects, immune response took place on the second phase of neuronal regeneration. These findings imply an intrinsic regulatory impact of acute stress on neuronal and immune factors involved in post-injury brain regeneration. Stress activates both neuronal and immune defense mechanisms and thus contributes to faster regeneration. In this context, paradoxically, acute preliminary stress might be considered a distinct asset in speeding up the following post-injury brain regeneration. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Proteomic contributions to our understanding of vaccine and immune responses

    PubMed Central

    Galassie, Allison C.; Link, Andrew J.

    2015-01-01

    Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619

  14. Effects of rubber flooring during the first 2 lactations on production, locomotion, hoof health, immune functions, and stress

    USDA-ARS?s Scientific Manuscript database

    Some housing can result in long-term chronic pain. Acute pain on immunity has been explored, but chronic pain influence on immune responses is poorly understood. Therefore the objective of this research was to determine chronic effects on immune responses and production of flooring in free-stall h...

  15. Innate Immune Response to Burkholderia mallei

    DTIC Science & Technology

    2017-02-16

    stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the

  16. Administration of LPS three times during gestation alters the postnatal acute phase and metabolic responses to an LPS challenge in weaned beef heifers

    USDA-ARS?s Scientific Manuscript database

    This study evaluated whether three administrations of lipopolysaccharide (LPS) during gestation would alter the acute phase (APR) and metabolic responses to a postnatal LPS challenge in weaned heifers. Pregnant crossbred cows (n=50) were randomized into prenatal immune stimulation (PIS; n=24; admini...

  17. Netrin-1 guides inflammatory cell migration to control mucosal immune responses during intestinal inflammation

    PubMed Central

    Aherne, Carol M.; Collins, Colm B.; Eltzschig, Holger K.

    2013-01-01

    The intestinal epithelium is a dynamic barrier playing an active role in intestinal homeostasis and inflammation. Intestinal barrier function is dysregulated during inflammatory bowel disease (IBD), with epithelial cells playing a significant part in generating an inflammatory milieu through the release of signals that attract leukocytes to the intestinal lamina propria. However, it is increasingly appreciated that the intestinal epithelium mediates a counterbalancing response to drive resolution. Drawing analogies with neuronal development, where the balance of chemoattractive and chemorepellent signals is key to directed neuronal movement it has been postulated that such secreted cues play a role in leukocyte migration. Netrin-1 is one of the best-described neuronal guidance molecules, which has been shown to play a significant role in directed migration of leukocytes. Prior to our study the potential role of netrin-1 in IBD was poorly characterized. We defined netrin-1 as an intestinal epithelial-derived protein capable of limiting neutrophil recruitment to attenuate acute colitis. Our study highlights that the intestinal epithelium releases factors during acute inflammation that are responsible for fine-tuning the immune response. Exploration of these epithelial-mediated protective mechanisms will shed light on the complexity of the intestinal epithelial barrier in health and disease. PMID:24665394

  18. Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses

    PubMed Central

    van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.

    2012-01-01

    The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167

  19. Nitric oxide and redox mechanisms in the immune response

    PubMed Central

    Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.

    2011-01-01

    The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414

  20. Immune Dysfunction in Cirrhosis

    PubMed Central

    Noor, Mohd Talha; Manoria, Piyush

    2017-01-01

    Abstract Cirrhosis due to any etiology disrupts the homeostatic role of liver in the body. Cirrhosis-associated immune dysfunction leads to alterations in both innate and acquired immunity, due to defects in the local immunity of liver as well as in systemic immunity. Cirrhosis-associated immune dysfunction is a dynamic phenomenon, comprised of both increased systemic inflammation and immunodeficiency, and is responsible for 30% mortality. It also plays an important role in acute as well as chronic decompensation. Immune paralysis can accompany it, which is characterized by increase in anti-inflammatory cytokines and suppression of proinflammatory cytokines. There is also presence of increased gut permeability, reduced gut motility and altered gut flora, all of which leads to increased bacterial translocation. This increased bacterial translocation and consequent endotoxemia leads to increased blood stream bacterial infections that cause systemic inflammatory response syndrome, sepsis, multiorgan failure and death. The gut microbiota of cirrhotic patients has more pathogenic microbes than that of non-cirrhotic individuals, and this disturbs the homeostasis and favors gut translocation. Prompt diagnosis and treatment of such infections are necessary for better survival. We have reviewed the various mechanisms of immune dysfunction and its consequences in cirrhosis. Recognizing the exact pathophysiology of immune dysfunction will help treating clinicians in avoiding its complications in their patients and can lead to newer therapeutic interventions and reducing the morbidity and mortality rates. PMID:28507927

  1. CD14+ CD15- HLA-DR- myeloid-derived suppressor cells impair antimicrobial responses in patients with acute-on-chronic liver failure.

    PubMed

    Bernsmeier, Christine; Triantafyllou, Evangelos; Brenig, Robert; Lebosse, Fanny J; Singanayagam, Arjuna; Patel, Vishal C; Pop, Oltin T; Khamri, Wafa; Nathwani, Rooshi; Tidswell, Robert; Weston, Christopher J; Adams, David H; Thursz, Mark R; Wendon, Julia A; Antoniades, Charalambos Gustav

    2018-06-01

    Immune paresis in patients with acute-on-chronic liver failure (ACLF) accounts for infection susceptibility and increased mortality. Immunosuppressive mononuclear CD14 + HLA-DR - myeloid-derived suppressor cells (M-MDSCs) have recently been identified to quell antimicrobial responses in immune-mediated diseases. We sought to delineate the function and derivation of M-MDSC in patients with ACLF, and explore potential targets to augment antimicrobial responses. Patients with ACLF (n=41) were compared with healthy subjects (n=25) and patients with cirrhosis (n=22) or acute liver failure (n=30). CD14 + CD15 - CD11b + HLA-DR - cells were identified as per definition of M-MDSC and detailed immunophenotypic analyses were performed. Suppression of T cell activation was assessed by mixed lymphocyte reaction. Assessment of innate immune function included cytokine expression in response to Toll-like receptor (TLR-2, TLR-4 and TLR-9) stimulation and phagocytosis assays using flow cytometry and live cell imaging-based techniques. Circulating CD14 + CD15 - CD11b + HLA-DR - M-MDSCs were markedly expanded in patients with ACLF (55% of CD14+ cells). M-MDSC displayed immunosuppressive properties, significantly decreasing T cell proliferation (p=0.01), producing less tumour necrosis factor-alpha/interleukin-6 in response to TLR stimulation (all p<0.01), and reduced bacterial uptake of Escherichia coli (p<0.001). Persistently low expression of HLA-DR during disease evolution was linked to secondary infection and 28-day mortality. Recurrent TLR-2 and TLR-4 stimulation expanded M-MDSC in vitro. By contrast, TLR-3 agonism reconstituted HLA-DR expression and innate immune function ex vivo. Immunosuppressive CD14 + HLA-DR - M-MDSCs are expanded in patients with ACLF. They were depicted by suppressing T cell function, attenuated antimicrobial innate immune responses, linked to secondary infection, disease severity and prognosis. TLR-3 agonism reversed M-MDSC expansion and innate immune

  2. Innate Immune Responses to Cryptococcus

    PubMed Central

    Heung, Lena J.

    2017-01-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464

  3. Transcriptomics of the Vaccine Immune Response: Priming With Adjuvant Modulates Recall Innate Responses After Boosting.

    PubMed

    Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

    2018-01-01

    Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream

  4. Rotavirus intestinal infection induces an oral mucosa cytokine response.

    PubMed

    Gómez-Rial, José; Curras-Tuala, María José; Rivero-Calle, Irene; Rodríguez-Tenreiro, Carmen; Redondo-Collazo, Lorenzo; Gómez-Carballa, Alberto; Pardo-Seco, Jacobo; Salas, Antonio; Martinón-Torres, Federico

    2018-01-01

    Salivary glands are known immune effector sites and considered to be part of the whole mucosal immune system. The aim of the present study was to assess the salivary immune response to rotavirus (RV) infection through the analysis of the cytokine immune profile in saliva. A prospective comparative study of serial saliva samples from 27 RV-infected patients (sampled upon admission to the hospital during acute phase and at convalescence-i.e. at least three months after recovery) and 36 healthy controls was performed. Concentrations of 11 salivary cytokines (IFN-γ, IFN-α2, IL-1β, IL-6, IL-8, IL-10, IL-15, IL12p70, TNF-α, IFN-λ1, IL-22) were determined. Cytokine levels were compared between healthy controls acute infection and convalescence. The correlation between clinical data and salivary cytokine profile in infected children was assessed. The salivary cytokine profile changes significantly in response to acute RV infection. In RV-infected patients, IL-22 levels were increased in the acute phase with respect to convalescence (P-value < 0.001). Comparisons between infected and control group showed significant differences in salivary IFN-α2, IL-1β, IL-6, IL-8, IL-10 and IL-22. Although acute-phase levels of IL-12, IL-10, IL-6 and IFN-γ showed nominal association with Vesikari's severity, this trend did not reach statistical significance after multiple test adjustment. RV infection induces a host salivary immune response, indicating that immune mucosal response to RV infection is not confined to the intestinal mucosa. Our data point to a whole mucosal implication in the RV infection as a result of the integrative mucosal immune response, and suggest the salivary gland as effector site for RV infection.

  5. Rotavirus intestinal infection induces an oral mucosa cytokine response

    PubMed Central

    Curras-Tuala, María José; Rivero-Calle, Irene; Rodríguez-Tenreiro, Carmen; Redondo-Collazo, Lorenzo; Gómez-Carballa, Alberto; Pardo-Seco, Jacobo

    2018-01-01

    Introduction Salivary glands are known immune effector sites and considered to be part of the whole mucosal immune system. The aim of the present study was to assess the salivary immune response to rotavirus (RV) infection through the analysis of the cytokine immune profile in saliva. Material and methods A prospective comparative study of serial saliva samples from 27 RV-infected patients (sampled upon admission to the hospital during acute phase and at convalescence—i.e. at least three months after recovery) and 36 healthy controls was performed. Concentrations of 11 salivary cytokines (IFN-γ, IFN-α2, IL-1β, IL-6, IL-8, IL-10, IL-15, IL12p70, TNF-α, IFN-λ1, IL-22) were determined. Cytokine levels were compared between healthy controls acute infection and convalescence. The correlation between clinical data and salivary cytokine profile in infected children was assessed. Results The salivary cytokine profile changes significantly in response to acute RV infection. In RV-infected patients, IL-22 levels were increased in the acute phase with respect to convalescence (P-value < 0.001). Comparisons between infected and control group showed significant differences in salivary IFN-α2, IL-1β, IL-6, IL-8, IL-10 and IL-22. Although acute-phase levels of IL-12, IL-10, IL-6 and IFN-γ showed nominal association with Vesikari’s severity, this trend did not reach statistical significance after multiple test adjustment. Conclusions RV infection induces a host salivary immune response, indicating that immune mucosal response to RV infection is not confined to the intestinal mucosa. Our data point to a whole mucosal implication in the RV infection as a result of the integrative mucosal immune response, and suggest the salivary gland as effector site for RV infection. PMID:29621276

  6. Modulating the immune response by oral zinc supplementation: a single approach for multiple diseases.

    PubMed

    Overbeck, Silke; Rink, Lothar; Haase, Hajo

    2008-01-01

    Zinc is required for multiple cellular tasks, and especially the immune system depends on a sufficient availability of this essential trace element. During the last decades, many studies attempted to affect the outcome of various diseases by zinc supplementation. These efforts either aimed at supporting immunity by zinc administration or at correcting a loss of zinc secondary to the disease to restore the zinc-dependent functions of the immune system. This review aims to summarize the respective findings and to discuss possible molecular mechanisms by which zinc could influence viral, bacterial, and parasitic infections, autoimmune diseases, and the response to vaccination. Zinc supplementation in diseases such as diarrhea, chronic hepatitis C, shigellosis, leprosy, tuberculosis, pneumonia, acute lower respiratory infection, and leishmaniasis seems beneficial. In contrast, the results for the common cold and malaria are still not conclusive, and zinc was ineffective in most vaccination and rheumatoid arthritis studies. For AIDS and type 1 diabetes, zinc supplementation may even be a risk factor for increased mortality or deterioration of the glucose metabolism, respectively. In these cases, zinc supplementation should be used with care and limited to clearly zinc-deficient individuals.

  7. Verification of immune response optimality through cybernetic modeling.

    PubMed

    Batt, B C; Kompala, D S

    1990-02-09

    An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.

  8. Early life socioeconomic position and immune response to persistent infections among elderly Latinos.

    PubMed

    Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E

    2016-10-01

    Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights

  9. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    PubMed

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  10. Mathematical modeling the radiation effects on humoral immunity

    NASA Astrophysics Data System (ADS)

    Smirnova, O.

    One of the biological processes affecting the carcinogenesis is a response of humoral immune system to an antigen of malignant cells. Humoral immunity involves the production of protein molecules, antibodies, which can specifically bind to a certain antigen. This body system is radiosensitive. Therefore when simulating the radiation carcinogenesis, it is important to take into account the radiation effects on humoral immunity. To this end, a model of humoral immune response in irradiated mammals is developed. It is based on conventional theories and experimental facts. The model represents a system of nonlinear differential equations whose variables are the concentrations of antigen-sensitive immuno-competent cells carrying surface receptors and their bone-marrow precursor cells, as well as the concentrations of antibody-producing cells, antibodies, and an antigen. The dose of acute exposure and the dose rate of chronic exposure are the variable parameters in our approach. The model quantitatively reproduces the dynamics of the humoral immune response to the T-independent antigen (capsular antigen of Pasteurella pestis) in nonirradiated mammals (CBA mice). The model simulates the processes of the damage and recovery of the system of humoral immunity after acute exposure and predicts an adaptation of this system to low-level long-term chronic irradiation. These results give evidence that the developed model, after the appropriate identification, can be incorporated into a model of radiation carcinogenesis in humans. Together with a model of cellular immunity, such joined model will give capability to estimate the risk of radiation carcinogenesis for cosmonauts and astronauts on long space missions such as a voyage to Mars or a lunar colony.

  11. STAT3 activation in skeletal muscle links muscle wasting and the acute phase response in cancer cachexia.

    PubMed

    Bonetto, Andrea; Aydogdu, Tufan; Kunzevitzky, Noelia; Guttridge, Denis C; Khuri, Sawsan; Koniaris, Leonidas G; Zimmers, Teresa A

    2011-01-01

    Cachexia, or weight loss despite adequate nutrition, significantly impairs quality of life and response to therapy in cancer patients. In cancer patients, skeletal muscle wasting, weight loss and mortality are all positively associated with increased serum cytokines, particularly Interleukin-6 (IL-6), and the presence of the acute phase response. Acute phase proteins, including fibrinogen and serum amyloid A (SAA) are synthesized by hepatocytes in response to IL-6 as part of the innate immune response. To gain insight into the relationships among these observations, we studied mice with moderate and severe Colon-26 (C26)-carcinoma cachexia. Moderate and severe C26 cachexia was associated with high serum IL-6 and IL-6 family cytokines and highly similar patterns of skeletal muscle gene expression. The top canonical pathways up-regulated in both were the complement/coagulation cascade, proteasome, MAPK signaling, and the IL-6 and STAT3 pathways. Cachexia was associated with increased muscle pY705-STAT3 and increased STAT3 localization in myonuclei. STAT3 target genes, including SOCS3 mRNA and acute phase response proteins, were highly induced in cachectic muscle. IL-6 treatment and STAT3 activation both also induced fibrinogen in cultured C2C12 myotubes. Quantitation of muscle versus liver fibrinogen and SAA protein levels indicates that muscle contributes a large fraction of serum acute phase proteins in cancer. These results suggest that the STAT3 transcriptome is a major mechanism for wasting in cancer. Through IL-6/STAT3 activation, skeletal muscle is induced to synthesize acute phase proteins, thus establishing a molecular link between the observations of high IL-6, increased acute phase response proteins and muscle wasting in cancer. These results suggest a mechanism by which STAT3 might causally influence muscle wasting by altering the profile of genes expressed and translated in muscle such that amino acids liberated by increased proteolysis in cachexia are

  12. STAT3 Activation in Skeletal Muscle Links Muscle Wasting and the Acute Phase Response in Cancer Cachexia

    PubMed Central

    Kunzevitzky, Noelia; Guttridge, Denis C.; Khuri, Sawsan; Koniaris, Leonidas G.; Zimmers, Teresa A.

    2011-01-01

    Background Cachexia, or weight loss despite adequate nutrition, significantly impairs quality of life and response to therapy in cancer patients. In cancer patients, skeletal muscle wasting, weight loss and mortality are all positively associated with increased serum cytokines, particularly Interleukin-6 (IL-6), and the presence of the acute phase response. Acute phase proteins, including fibrinogen and serum amyloid A (SAA) are synthesized by hepatocytes in response to IL-6 as part of the innate immune response. To gain insight into the relationships among these observations, we studied mice with moderate and severe Colon-26 (C26)-carcinoma cachexia. Methodology/Principal Findings Moderate and severe C26 cachexia was associated with high serum IL-6 and IL-6 family cytokines and highly similar patterns of skeletal muscle gene expression. The top canonical pathways up-regulated in both were the complement/coagulation cascade, proteasome, MAPK signaling, and the IL-6 and STAT3 pathways. Cachexia was associated with increased muscle pY705-STAT3 and increased STAT3 localization in myonuclei. STAT3 target genes, including SOCS3 mRNA and acute phase response proteins, were highly induced in cachectic muscle. IL-6 treatment and STAT3 activation both also induced fibrinogen in cultured C2C12 myotubes. Quantitation of muscle versus liver fibrinogen and SAA protein levels indicates that muscle contributes a large fraction of serum acute phase proteins in cancer. Conclusions/Significance These results suggest that the STAT3 transcriptome is a major mechanism for wasting in cancer. Through IL-6/STAT3 activation, skeletal muscle is induced to synthesize acute phase proteins, thus establishing a molecular link between the observations of high IL-6, increased acute phase response proteins and muscle wasting in cancer. These results suggest a mechanism by which STAT3 might causally influence muscle wasting by altering the profile of genes expressed and translated in muscle such

  13. Innate immune memory in the brain shapes neurological disease hallmarks.

    PubMed

    Wendeln, Ann-Christin; Degenhardt, Karoline; Kaurani, Lalit; Gertig, Michael; Ulas, Thomas; Jain, Gaurav; Wagner, Jessica; Häsler, Lisa M; Wild, Katleen; Skodras, Angelos; Blank, Thomas; Staszewski, Ori; Datta, Moumita; Centeno, Tonatiuh Pena; Capece, Vincenzo; Islam, Md Rezaul; Kerimoglu, Cemil; Staufenbiel, Matthias; Schultze, Joachim L; Beyer, Marc; Prinz, Marco; Jucker, Mathias; Fischer, André; Neher, Jonas J

    2018-04-01

    Innate immune memory is a vital mechanism of myeloid cell plasticity that occurs in response to environmental stimuli and alters subsequent immune responses. Two types of immunological imprinting can be distinguished-training and tolerance. These are epigenetically mediated and enhance or suppress subsequent inflammation, respectively. Whether immune memory occurs in tissue-resident macrophages in vivo and how it may affect pathology remains largely unknown. Here we demonstrate that peripherally applied inflammatory stimuli induce acute immune training and tolerance in the brain and lead to differential epigenetic reprogramming of brain-resident macrophages (microglia) that persists for at least six months. Strikingly, in a mouse model of Alzheimer's pathology, immune training exacerbates cerebral β-amyloidosis and immune tolerance alleviates it; similarly, peripheral immune stimulation modifies pathological features after stroke. Our results identify immune memory in the brain as an important modifier of neuropathology.

  14. Immune Response to Dengue and Zika.

    PubMed

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  15. Immune cell phenotype and function in sepsis

    PubMed Central

    Rimmelé, Thomas; Payen, Didier; Cantaluppi, Vincenzo; Marshall, John; Gomez, Hernando; Gomez, Alonso; Murray, Patrick; Kellum, John A.

    2015-01-01

    Cells of the innate and adaptive immune systems play a critical role in the host response to sepsis. Moreover, their accessibility for sampling and their capacity to respond dynamically to an acute threat increases the possibility that leukocytes might serve as a measure of a systemic state of altered responsiveness in sepsis. The working group of the 14th Acute Dialysis Quality Initiative (ADQI) conference sought to obtain consensus on the characteristic functional and phenotypic changes in cells of the innate and adaptive immune system in the setting of sepsis. Techniques for the study of circulating leukocytes were also reviewed and the impact on cellular phenotypes and leukocyte function of non extracorporeal treatments and extracorporeal blood purification therapies proposed for sepsis was analyzed. A large number of alterations in the expression of distinct neutrophil and monocyte surface markers have been reported in septic patients. The most consistent alteration seen in septic neutrophils is their activation of a survival program that resists apoptotic death. Reduced expression of HLA-DR is a characteristic finding on septic monocytes but monocyte antimicrobial function does not appear to be significantly altered in sepsis. Regarding adaptive immunity, sepsis-induced apoptosis leads to lymphopenia in patients with septic shock and it involves all types of T cells (CD4, CD8 and Natural Killer) except T regulatory cells, thus favoring immunosuppression. Finally, numerous promising therapies targeting the host immune response to sepsis are under investigation. These potential treatments can have an effect on the number of immune cells, the proportion of cell subtypes and the cell function. PMID:26529661

  16. IMMUNE CELL PHENOTYPE AND FUNCTION IN SEPSIS.

    PubMed

    Rimmelé, Thomas; Payen, Didier; Cantaluppi, Vincenzo; Marshall, John; Gomez, Hernando; Gomez, Alonso; Murray, Patrick; Kellum, John A

    2016-03-01

    Cells of the innate and adaptive immune systems play a critical role in the host response to sepsis. Moreover, their accessibility for sampling and their capacity to respond dynamically to an acute threat increases the possibility that leukocytes might serve as a measure of a systemic state of altered responsiveness in sepsis.The working group of the 14th Acute Dialysis Quality Initiative (ADQI) conference sought to obtain consensus on the characteristic functional and phenotypic changes in cells of the innate and adaptive immune system in the setting of sepsis. Techniques for the study of circulating leukocytes were also reviewed and the impact on cellular phenotypes and leukocyte function of nonextracorporeal treatments and extracorporeal blood purification therapies proposed for sepsis was analyzed.A large number of alterations in the expression of distinct neutrophil and monocyte surface markers have been reported in septic patients. The most consistent alteration seen in septic neutrophils is their activation of a survival program that resists apoptotic death. Reduced expression of HLA-DR is a characteristic finding on septic monocytes, but monocyte antimicrobial function does not appear to be significantly altered in sepsis. Regarding adaptive immunity, sepsis-induced apoptosis leads to lymphopenia in patients with septic shock and it involves all types of T cells (CD4, CD8, and Natural Killer) except T regulatory cells, thus favoring immunosuppression. Finally, numerous promising therapies targeting the host immune response to sepsis are under investigation. These potential treatments can have an effect on the number of immune cells, the proportion of cell subtypes, and the cell function.

  17. Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.

    PubMed

    Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy

    2018-02-01

    We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.

  18. Immunity to viruses: learning from successful human vaccines.

    PubMed

    Pulendran, Bali; Oh, Jason Z; Nakaya, Helder I; Ravindran, Rajesh; Kazmin, Dmitri A

    2013-09-01

    For more than a century, immunologists and vaccinologists have existed in parallel universes. Immunologists have for long reveled in using 'model antigens', such as chicken egg ovalbumin or nitrophenyl haptens, to study immune responses in model organisms such as mice. Such studies have yielded many seminal insights about the mechanisms of immune regulation, but their relevance to humans has been questioned. In another universe, vaccinologists have relied on human clinical trials to assess vaccine efficacy, but have done little to take advantage of such trials for studying the nature of immune responses to vaccination. The human model provides a nexus between these two universes, and recent studies have begun to use this model to study the molecular profile of innate and adaptive responses to vaccination. Such 'systems vaccinology' studies are beginning to provide mechanistic insights about innate and adaptive immunity in humans. Here, we present an overview of such studies, with particular examples from studies with the yellow fever and the seasonal influenza vaccines. Vaccination with the yellow fever vaccine causes a systemic acute viral infection and thus provides an attractive model to study innate and adaptive responses to a primary viral challenge. Vaccination with the live attenuated influenza vaccine causes a localized acute viral infection in mucosal tissues and induces a recall response, since most vaccinees have had prior exposure to influenza, and thus provides a unique opportunity to study innate and antigen-specific memory responses in mucosal tissues and in the blood. Vaccination with the inactivated influenza vaccine offers a model to study immune responses to an inactivated immunogen. Studies with these and other vaccines are beginning to reunite the estranged fields of immunology and vaccinology, yielding unexpected insights about mechanisms of viral immunity. Vaccines that have been proven to be of immense benefit in saving lives offer us a new

  19. Eosinophils in mucosal immune responses

    PubMed Central

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  20. Spaceflight and Development of Immune Responses

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1996-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.

  1. Effect of gender and sex hormones on immune responses following shock.

    PubMed

    Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H

    2000-08-01

    Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.

  2. A multiherbal formulation influencing immune response in vitro.

    PubMed

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L

    2012-02-01

    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  3. Pathogen recognition in the innate immune response.

    PubMed

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  4. Inflammatory cytokines in the brain: does the CNS shape immune responses?

    PubMed

    Owens, T; Renno, T; Taupin, V; Krakowski, M

    1994-12-01

    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  5. Acute immune thrombocytopenic purpura as adverse reaction to oral polio vaccine (OPV).

    PubMed

    Jin, Cheng-qiang; Dong, Hai-xin; Sun, Zhuo-xiang; Zhou, Jian-wei; Dou, Cui-yun; Lu, Shu-hua; Yang, Rui-rui

    2013-08-01

    A case of acute immune thrombocytopenic purpura following oral polio vaccine (OPV) is reported. An 82-d-old infant developed purpura at the same day after the second dose of oral polio vaccine. Until the time of hospital admission, the male infant had been in good health and had not received any drugs, and the possible causes of this condition were excluded. His platelet count was 13×10(9)/L. Platelet-associated IgG was elevated, but the amount of megakaryocytes in bone marrow aspirates was within the normal range, suggesting immune mechanism-associated thrombocytopenia. The infant recovered with the proper treatment within 30 d. Attention should be paid to OPV-associated thrombocytopenia, though it seems to be less frequent than after natural infections.

  6. Drosophila blood cells and their role in immune responses.

    PubMed

    Vlisidou, Isabella; Wood, Will

    2015-04-01

    Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.

  7. SIRT1 and HIF1α signaling in metabolism and immune responses.

    PubMed

    Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei

    2018-04-01

    SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Influence of bedding type on mucosal immune responses.

    PubMed

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  9. Tim-3 directly enhances CD8 T cell responses to acute Listeria monocytogenes infection

    PubMed Central

    Gorman, Jacob V.; Starbeck-Miller, Gabriel; Pham, Nhat-Long L.; Traver, Geri L.; Rothman, Paul B.; Harty, John T.; Colgan, John D.

    2014-01-01

    Tim-3 is a surface molecule expressed throughout the immune system that can mediate both stimulatory and inhibitory effects. Previous studies have provided evidence that Tim-3 functions to enforce CD8 T cell exhaustion, a dysfunctional state associated with chronic stimulation. In contrast, the role of Tim-3 in the regulation of CD8 T cell responses to acute and transient stimulation remains undefined. To address this knowledge gap, we examined how Tim-3 affects CD8 T cell responses to acute Listeria monocytogenes (LM) infection. Analysis of wild-type (WT) mice infected with LM revealed that Tim-3 was transiently expressed by activated CD8 T cells and was associated primarily with acquisition of an effector phenotype. Comparison of responses to LM by WT and Tim-3 KO mice showed that the absence of Tim-3 significantly reduced the magnitudes of both primary and secondary CD8 T cell responses, which correlated with decreased IFN-γ production and degranulation by Tim-3 KO cells stimulated with peptide antigen ex vivo. To address the T cell-intrinsic role of Tim-3, we analyzed responses to LM infection by WT and Tim-3 KO TCR-transgenic CD8 T cells following adoptive transfer into a shared WT host. In this setting, the accumulation of CD8 T cells and the generation of cytokine-producing cells were significantly reduced by the lack of Tim-3, demonstrating that this molecule has a direct effect on CD8 T cell function. Combined, our results suggest that Tim-3 can mediate a stimulatory effect on CD8 T cell responses to an acute infection. PMID:24567532

  10. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans.

    PubMed

    Kox, Matthijs; van Eijk, Lucas T; Zwaag, Jelle; van den Wildenberg, Joanne; Sweep, Fred C G J; van der Hoeven, Johannes G; Pickkers, Peter

    2014-05-20

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot be voluntarily influenced. Herein, we evaluated the effects of a training program on the autonomic nervous system and innate immune response. Healthy volunteers were randomized to either the intervention (n = 12) or control group (n = 12). Subjects in the intervention group were trained for 10 d in meditation (third eye meditation), breathing techniques (i.a., cyclic hyperventilation followed by breath retention), and exposure to cold (i.a., immersions in ice cold water). The control group was not trained. Subsequently, all subjects underwent experimental endotoxemia (i.v. administration of 2 ng/kg Escherichia coli endotoxin). In the intervention group, practicing the learned techniques resulted in intermittent respiratory alkalosis and hypoxia resulting in profoundly increased plasma epinephrine levels. In the intervention group, plasma levels of the anti-inflammatory cytokine IL-10 increased more rapidly after endotoxin administration, correlated strongly with preceding epinephrine levels, and were higher. Levels of proinflammatory mediators TNF-α, IL-6, and IL-8 were lower in the intervention group and correlated negatively with IL-10 levels. Finally, flu-like symptoms were lower in the intervention group. In conclusion, we demonstrate that voluntary activation of the sympathetic nervous system results in epinephrine release and subsequent suppression of the innate immune response in humans in vivo. These results could have important implications for the treatment of conditions associated with excessive or persistent inflammation, such as autoimmune diseases.

  11. CELLS INVOLVED IN THE IMMUNE RESPONSE

    PubMed Central

    Singhal, Sharwan K.; Richter, Maxwell

    1968-01-01

    Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID

  12. EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  13. Gammaherpesvirus Co-infection with Malaria Suppresses Anti-parasitic Humoral Immunity

    PubMed Central

    Matar, Caline G.; Anthony, Neil R.; O’Flaherty, Brigid M.; Jacobs, Nathan T.; Priyamvada, Lalita; Engwerda, Christian R.; Speck, Samuel H.; Lamb, Tracey J.

    2015-01-01

    Immunity to non-cerebral severe malaria is estimated to occur within 1-2 infections in areas of endemic transmission for Plasmodium falciparum. Yet, nearly 20% of infected children die annually as a result of severe malaria. Multiple risk factors are postulated to exacerbate malarial disease, one being co-infections with other pathogens. Children living in Sub-Saharan Africa are seropositive for Epstein Barr Virus (EBV) by the age of 6 months. This timing overlaps with the waning of protective maternal antibodies and susceptibility to primary Plasmodium infection. However, the impact of acute EBV infection on the generation of anti-malarial immunity is unknown. Using well established mouse models of infection, we show here that acute, but not latent murine gammaherpesvirus 68 (MHV68) infection suppresses the anti-malarial humoral response to a secondary malaria infection. Importantly, this resulted in the transformation of a non-lethal P. yoelii XNL infection into a lethal one; an outcome that is correlated with a defect in the maintenance of germinal center B cells and T follicular helper (Tfh) cells in the spleen. Furthermore, we have identified the MHV68 M2 protein as an important virus encoded protein that can: (i) suppress anti-MHV68 humoral responses during acute MHV68 infection; and (ii) plays a critical role in the observed suppression of anti-malarial humoral responses in the setting of co-infection. Notably, co-infection with an M2-null mutant MHV68 eliminates lethality of P. yoelii XNL. Collectively, our data demonstrates that an acute gammaherpesvirus infection can negatively impact the development of an anti-malarial immune response. This suggests that acute infection with EBV should be investigated as a risk factor for non-cerebral severe malaria in young children living in areas endemic for Plasmodium transmission. PMID:25996913

  14. Immune dysfunction in cirrhosis

    PubMed Central

    Sipeki, Nora; Antal-Szalmas, Peter; Lakatos, Peter L; Papp, Maria

    2014-01-01

    Innate and adaptive immune dysfunction, also referred to as cirrhosis-associated immune dysfunction syndrome, is a major component of cirrhosis, and plays a pivotal role in the pathogenesis of both the acute and chronic worsening of liver function. During the evolution of the disease, acute decompensation events associated with organ failure(s), so-called acute-on chronic liver failure, and chronic decompensation with progression of liver fibrosis and also development of disease specific complications, comprise distinct clinical entities with different immunopathology mechanisms. Enhanced bacterial translocation associated with systemic endotoxemia and increased occurrence of systemic bacterial infections have substantial impacts on both clinical situations. Acute and chronic exposure to bacteria and/or their products, however, can result in variable clinical consequences. The immune status of patients is not constant during the illness; consequently, alterations of the balance between pro- and anti-inflammatory processes result in very different dynamic courses. In this review we give a detailed overview of acquired immune dysfunction and its consequences for cirrhosis. We demonstrate the substantial influence of inherited innate immune dysfunction on acute and chronic inflammatory processes in cirrhosis caused by the pre-existing acquired immune dysfunction with limited compensatory mechanisms. Moreover, we highlight the current facts and future perspectives of how the assessment of immune dysfunction can assist clinicians in everyday practical decision-making when establishing treatment and care strategies for the patients with end-stage liver disease. Early and efficient recognition of inappropriate performance of the immune system is essential for overcoming complications, delaying progression and reducing mortality. PMID:24627592

  15. Immune dysfunction in cirrhosis.

    PubMed

    Sipeki, Nora; Antal-Szalmas, Peter; Lakatos, Peter L; Papp, Maria

    2014-03-14

    Innate and adaptive immune dysfunction, also referred to as cirrhosis-associated immune dysfunction syndrome, is a major component of cirrhosis, and plays a pivotal role in the pathogenesis of both the acute and chronic worsening of liver function. During the evolution of the disease, acute decompensation events associated with organ failure(s), so-called acute-on chronic liver failure, and chronic decompensation with progression of liver fibrosis and also development of disease specific complications, comprise distinct clinical entities with different immunopathology mechanisms. Enhanced bacterial translocation associated with systemic endotoxemia and increased occurrence of systemic bacterial infections have substantial impacts on both clinical situations. Acute and chronic exposure to bacteria and/or their products, however, can result in variable clinical consequences. The immune status of patients is not constant during the illness; consequently, alterations of the balance between pro- and anti-inflammatory processes result in very different dynamic courses. In this review we give a detailed overview of acquired immune dysfunction and its consequences for cirrhosis. We demonstrate the substantial influence of inherited innate immune dysfunction on acute and chronic inflammatory processes in cirrhosis caused by the pre-existing acquired immune dysfunction with limited compensatory mechanisms. Moreover, we highlight the current facts and future perspectives of how the assessment of immune dysfunction can assist clinicians in everyday practical decision-making when establishing treatment and care strategies for the patients with end-stage liver disease. Early and efficient recognition of inappropriate performance of the immune system is essential for overcoming complications, delaying progression and reducing mortality.

  16. Effects of LPS-induced immune activation prior to trauma exposure on PTSD-like symptoms in mice.

    PubMed

    Deslauriers, Jessica; van Wijngaarde, Myrthe; Geyer, Mark A; Powell, Susan; Risbrough, Victoria B

    2017-04-14

    The prevalence of posttraumatic stress disorder (PTSD) is high in the armed services, with a rate up to 20%. Multiple studies have associated markers of inflammatory signaling prior to trauma with increased risk of PTSD, suggesting a potential role of the immune system in the development of this psychiatric disorder. One question that arises is if "priming" the immune system before acute trauma alters the stress response and increases enduring effects of trauma. We investigated the time course of inflammatory response to predator stress, a robust stressor that induces enduring PTSD-like behaviors, and the modulation of these effects via prior immune activation with the bacterial endotoxin, lipopolysaccharide (LPS), a Toll-like receptor 4 (TLR4) agonist. Mice exposed to predator stress exhibited decreased pro-/anti-inflammatory balance in the brain 6h after stress, suggesting that predator exposure acutely suppressed the immune system by increasing anti-inflammatory cytokines levels. Acute immune activation with LPS before a single predator stress did not alter the enduring avoidance behavior in stressed mice. Our findings suggest that acute inflammation, at least via TLR4 activation, is not sufficient to increase susceptibility for PTSD-like behaviors in this model. Future studies will examine if chronic inflammation is required to induce similar immune changes to those observed in PTSD patients in this model. Published by Elsevier B.V.

  17. Measles, mumps, and rubella antibody status and response to immunization in children after therapy for acute lymphoblastic leukemia.

    PubMed

    Aytac, Selin; Yalcin, S Songul; Cetin, Mualla; Yetgin, Sevgi; Gumruk, Fatma; Tuncer, Murat; Yurdakok, Kadriye; Gurgey, Aytemiz

    2010-08-01

    Seventy-seven patients with acute lymphoblastic leukemia (ALL) who were in complete remission and whose therapies had been stopped for at least 6 months before enrollment in this study were retrospectively analyzed regarding their antibody status for measles, mumps, and rubella, with the aim to demonstrate the seropositivity rate after treatment in the authors' group. Each patient's serum samples were analyzed by enzyme-linked immunosorbent assay (ELISA) method to determine the antibody titers before and after immunization. Measles serology was available in 77 children; 45 (58%) were seronegative. Initial ages of measle-seronegative patients were statistically lower than those of seropositive cases (median 3.29 versus 4.91 years, respectively). Mumps serology was available in 76 children; 36 (47%) were seronegative. Mumps-seropositive cases tended to have more frequent previous history of infection than seronegative cases (55.0% versus 28.6%, respectively, P = .05). Rubella serology was available in 76 children, and 20 (26.3%) were seronegative. It was determined that initial ages of rubella-seronegative patients were statistically lower than those of seropositive cases (median 3.03 versus 4.32 years, respectively). The authors concluded based on the results of their study that at a median of 3.31 years after completion of chemotherapy for ALL, the majority of cases had antibody levels lower than protective values for measles (58.4%); however, these values were 47.3% for mumps and 26.3% for rubella. Seroconversion rates after measles (55%) and mumps vaccination (57.1%) were still low. However, in the available cases, relatively adequate response to rubella vaccination (92.3%) was observed.

  18. Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein-Barr virus infection.

    PubMed

    Zhong, Huaqing; Hu, Xinran; Janowski, Andrew B; Storch, Gregory A; Su, Liyun; Cao, Lingfeng; Yu, Jinsheng; Xu, Jin

    2017-12-19

    Epstein-Barr virus (EBV) is a common human pathogen that infects over 95% of the population worldwide. In the present study, the whole transcriptome microarray data were generated from peripheral blood mononuclear cells from Chinese children with acute infectious mononucleosis (AIM) and chronic active EBV infection (CAEBV) that were also compared with a publicly available microarray dataset from a study of American college students with AIM. Our study characterized for the first time a broad spectrum of molecular signatures in AIM and CAEBV. The key findings from the transcriptome profiling were validated with qPCR and flow cytometry assays. The most important finding in our study is the discovery of predominant γδ TCR expression and γδ T cell expansion in AIM. This finding, in combination with the striking up-regulation of CD3, CD8 and CD94, suggests that CD8+ T cells and CD94+ NK cells may play a major role in AIM. Moreover, the unique up-regulation of CD64A/B and its significant correlation with the monocyte marker CD14 was observed in CAEBV and that implies an important role of monocytes in CAEBV. In conclusion, our study reveals major cell types (particularly γδ T cells) in the host cellular immune response against AIM and CAEBV.

  19. The host immune response to Clostridium difficile infection

    PubMed Central

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  20. Intravital imaging of cutaneous immune responses.

    PubMed

    Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji

    2018-05-25

    Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.

    PubMed

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  2. Genetic Susceptibility to Chagas Disease: An Overview about the Infection and about the Association between Disease and the Immune Response Genes

    PubMed Central

    Ayo, Christiane Maria; Dalalio, Márcia Machado de Oliveira; Visentainer, Jeane Eliete Laguila; Reis, Pâmela Guimarães; Jarduli, Luciana Ribeiro; Alves, Hugo Vicentin; Sell, Ana Maria

    2013-01-01

    Chagas disease, which is caused by the flagellate parasite Trypanosoma cruzi, affects 8–10 million people in Latin America. The disease is endemic and is characterised by acute and chronic phases that develop in the indeterminate, cardiac, and/or gastrointestinal forms. The immune response during human T. cruzi infection is not completely understood, despite its role in driving the development of distinct clinical manifestations of chronic infection. Polymorphisms in genes involved in the innate and specific immune response are being widely studied in order to clarify their possible role in the occurrence or severity of disease. Here we review the role of classic and nonclassic MHC, KIR, and cytokine host genetic factors on the infection by T. cruzi and the clinical course of Chagas disease. PMID:24069594

  3. Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.

    PubMed

    Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier

    2009-03-23

    Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

  4. Interplay of parasite-driven immune responses and autoimmunity.

    PubMed

    Zaccone, Paola; Burton, Oliver T; Cooke, Anne

    2008-01-01

    As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.

  5. Dynamic Repositioning of Dorsal to Two Different κB Motifs Controls Its Autoregulation during Immune Response in Drosophila

    PubMed Central

    Mrinal, Nirotpal; Nagaraju, Javaregowda

    2010-01-01

    Autoregulation is one of the mechanisms of imparting feedback control on gene expression. Positive autoregulatory feedback results in induction of a gene, and negative feedback leads to its suppression. Here, we report an interesting mechanism of autoregulation operating on Drosophila Rel gene dorsal that can activate as well as repress its expression. Using biochemical and genetic approaches, we show that upon immune challenge Dorsal regulates its activation as well as repression by dynamically binding to two different κB motifs, κBI (intronic κB) and κBP (promoter κB), present in the dorsal gene. Although the κBI motif functions as an enhancer, the κBP motif acts as a transcriptional repressor. Interestingly, Dorsal binding to these two motifs is dynamic; immediately upon immune challenge, Dorsal binds to the κBI leading to auto-activation, whereas at the terminal phase of the immune response, it is removed from the κBI and repositioned at the κBP, resulting in its repression. Furthermore, we show that repression of Dorsal as well as its binding to the κBP depends on the transcription factor AP1. Depletion of AP1 by RNA interference resulted in constitutive expression of Dorsal. In conclusion, this study suggests that during acute phase response dorsal is regulated by following two subcircuits: (i) Dl-κBI for activation and (ii) Dl-AP1-κBP for repression. These two subcircuits are temporally delineated and bring about overall regulation of dorsal during immune response. These results suggest the presence of a previously unknown mechanism of Dorsal autoregulation in immune-challenged Drosophila. PMID:20504768

  6. Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis

    2007-03-07

    The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.

  7. Eosinophil Activities Modulate the Immune/Inflammatory Character of Allergic Respiratory Responses in Mice

    PubMed Central

    Jacobsen, Elizabeth A.; LeSuer, William E.; Willetts, Lian; Zellner, Katie R.; Mazzolini, Kirea; Antonios, Nathalie; Beck, Brandon; Protheroe, Cheryl; Ochkur, Sergei I.; Colbert, Dana; Lacy, Paige; Moqbel, Redwan; Appleton, Judith; Lee, Nancy A.; Lee, James J.

    2014-01-01

    Background The importance and specific role(s) of eosinophils in modulating the immune/inflammatory phenotype of allergic pulmonary disease remain to be defined. Established animals models assessing the role(s) of eosinophils as contributors and/or causative agents of disease have relied on congenitally deficient mice where the developmental consequences of eosinophil depletion are unknown. Methods We developed a novel conditional eosinophil-deficient strain of mice (iPHIL) through a gene knock-in strategy inserting the human diphtheria toxin (DT) receptor (DTR) into the endogenous eosinophil peroxidase genomic locus. Results Expression of DTR rendered resistant mouse eosinophil progenitors sensitive to DT without affecting any other cell types. The presence of eosinophils was shown to be unnecessary during the sensitization phase of either ovalbumin (OVA) or house dust mite (HDM) acute asthma models. However, eosinophil ablation during airway challenge led to a predominantly neutrophilic phenotype (>15% neutrophils) accompanied by allergen-induced histopathologies and airway hyperresponsiveness in response to methacholine indistinguishable from eosinophilic wild type mice. Moreover, the iPHIL neutrophilic airway phenotype was shown to be a steroid-resistant allergic respiratory variant that was reversible upon restoration of peripheral eosinophils. Conclusions Eosinophil contributions to allergic immune/inflammatory responses appear to be limited to the airway challenge and not the sensitization phase of allergen provocation models. The reversible steroid-resistant character of the iPHIL neutrophilic airway variant suggests underappreciated mechanisms by which eosinophils shape the character of allergic respiratory responses. PMID:24266710

  8. Radiation-induced immune responses: mechanisms and therapeutic perspectives.

    PubMed

    Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One

    2016-09-01

    Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.

  9. RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

    PubMed Central

    Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

    2011-01-01

    Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

  10. Acute changes in serum immune markers due to swimming in a chlorinated pool.

    PubMed

    Vlaanderen, Jelle; van Veldhoven, Karin; Font-Ribera, Laia; Villanueva, Cristina M; Chadeau-Hyam, Marc; Portengen, Lützen; Grimalt, Joan O; Zwiener, Christian; Heederik, Dick; Zhang, Xiangru; Vineis, Paolo; Kogevinas, Manolis; Vermeulen, Roel

    2017-08-01

    Exposure to disinfectants and disinfection byproducts (DBPs) due to swimming in chlorinated water has been associated with allergic and respiratory health effects, including asthma. Biological mechanisms contributing to these associations are largely unknown. We hypothesized a potential pathway involving modulation of the immune system. We assessed levels of immune markers (CCL11, CCL22, CXCL10, CRP, EGF, GCSF, IL-8, IL-17, IL-1RA, MPO, VEGF, Periostin) in serum collected from 30 women and 29 men before and after 40min of swimming in a chlorinated pool. Exposure to DBPs was assessed by measuring bromodichloromethane, bromoform, chloroform, and dibromochloromethane in exhaled breath before and after swimming. Covariate data including information on physical activity was available through questionnaires and measurements. We assessed the association between indicators of swimming in a chlorinated pool and changes in serum immune marker concentrations using linear regression with bivariate normal distributions and adjusted for multiple comparisons by applying the Benjamini-Hochberg procedure. We observed a significant decrease in serum concentrations of IL-8 (-12.53%; q=2.00e-03), CCL22 (-7.28%; q=4.00e-04), CCL11 (-7.15%; q=9.48e-02), CRP (-7.06%; q=4.68e-05), and CXCL10 (-13.03%; q=6.34e-14) and a significant increase in IL-1RA (20.16%; q=4.18e-06) from before to after swimming. Associations with quantitative measurements of DBPs or physical activity were similar in direction and strength. Most of the observed associations became non-significant when we adjusted the effects of exposure to DBPs for physical activity or vice-versa. Our study indicates that swimming in a chlorinated pool induces perturbations of the immune response through acute alterations of patterns of cytokine and chemokine secretion. The observed effects could not be uniquely attributed to either exposure to DBPs or physical activity. Evidence in the literature suggests that observed decreases in

  11. Innate immune memory: implications for development of pediatric immunomodulatory agents and adjuvanted vaccines

    PubMed Central

    Levy, Ofer; Netea, Mihai G.

    2014-01-01

    Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now add an increasingly appreciated concept that the innate immune system displays epigenetic memory of an earlier infection or vaccination, a phenomenon that has been named “trained immunity”. Exposure of neonatal leukocytes in vitro or neonatal animals or humans in vivo to specific innate immune stimuli results in an altered innate immune set point. Given the particular importance of innate immunity early in life, trained immunity to early life infection and/or immunization may play an important role in modulating both acute and chronic diseases. PMID:24352476

  12. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    PubMed Central

    Zhong, Hong; Ma, Minjuan

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304

  13. Role of muscarinic receptors in the regulation of immune and inflammatory responses

    PubMed Central

    Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.

    2008-01-01

    Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972

  14. A comparative study of an innate immune response in Lamprologine cichlid fishes.

    PubMed

    O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  15. A comparative study of an innate immune response in Lamprologine cichlid fishes

    NASA Astrophysics Data System (ADS)

    O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  16. Deep Transcriptomic Analysis of Black Rockfish (Sebastes schlegelii) Provides New Insights on Responses to Acute Temperature Stress.

    PubMed

    Lyu, Likang; Wen, Haishen; Li, Yun; Li, Jifang; Zhao, Ji; Zhang, Simin; Song, Min; Wang, Xiaojie

    2018-06-14

    In the present study, we conducted an RNA-Seq analysis to characterize the genes and pathways involved in acute thermal and cold stress responses in the liver of black rockfish, a viviparous teleost that has the ability to cope with a wide range of temperature changes. A total of 584 annotated differentially expressed genes (DEGs) were identified in all three comparisons (HT vs NT, HT vs LT and LT vs NT). Based on an enrichment analysis, DEGs with a potential role in stress accommodation were classified into several categories, including protein folding, metabolism, immune response, signal transduction, molecule transport, membrane, and cell proliferation/apoptosis. Considering that thermal stress has a greater effect than cold stress in black rockfish, 24 shared DEGs in the intersection of the HT vs LT and HT vs NT groups were enriched in 2 oxidation-related gene ontology (GO) terms. Nine important heat-stress-reducing pathways were significantly identified and classified into 3 classes: immune and infectious diseases, organismal immune system and endocrine system. Eight DEGs (early growth response protein 1, bile salt export pump, abcb11, hsp70a, rtp3, 1,25-dihydroxyvitamin d(3) 24-hydroxylase, apoa4, transcription factor jun-b-like and an uncharacterized gene) were observed among all three comparisons, strongly implying their potentially important roles in temperature stress responses.

  17. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  18. The host immune response to gastrointestinal nematode infection in sheep.

    PubMed

    McRae, K M; Stear, M J; Good, B; Keane, O M

    2015-12-01

    Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.

  19. [Bone marrow stromal damage mediated by immune response activity].

    PubMed

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

    1994-01-01

    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  20. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)

    PubMed Central

    King, Paul T.; Sharma, Roleen

    2015-01-01

    Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124

  1. Orally administered Taenia solium Calreticulin prevents experimental intestinal inflammation and is associated with a type 2 immune response

    PubMed Central

    Cruz-Rivera, Mayra; Diaz-Gandarilla, Jose Alfredo; Flores-Torres, Marco Antonio; Avila, Guillermina; Perfiliev, Maria; Salazar, Ana Maria; Arriaga-Pizano, Lourdes; Ostrosky-Wegman, Patricia; Flisser, Ana

    2017-01-01

    Intestinal helminth antigens are inducers of type 2 responses and can elicit regulatory immune responses, resulting in dampened inflammation. Several platyhelminth proteins with anti-inflammatory activity have been reported. We have identified, cloned and expressed the Taenia solium calreticulin (rTsCRT) and shown that it predominantly induces a type 2 response characterized by IgG1, IL-4 and IL-5 production in mice. Here, we report the rTsCRT anti-inflammatory activity in a well-known experimental colitis murine model. Mice were orally immunized with purified rTsCRT and colitis was induced with trinitrobenzene sulfonic acid (TNBS). Clinical signs of disease, macroscopic and microscopic tissue inflammation, cytokine production and micronuclei formation, as a marker of genotoxicity, were measured in order to assess the effect of rTsCRT immunization on experimentally induced colitis. rTsCRT administration prior to TNBS instillation significantly reduced the inflammatory parameters, including the acute phase cytokines TNF-α, IL-1β and IL-6. Dampened inflammation was associated with increased local expression of IL-13 and systemic IL-10 and TGF-β production. Genotoxic damage produced by the inflammatory response was also precluded. Our results show that oral treatment with rTsCRT prevents excessive TNBS-induced inflammation in mice and suggest that rTsCRT has immunomodulatory properties associated with the expression of type 2 and regulatory cytokines commonly observed in other helminths. PMID:29036211

  2. Radiation induces an antitumour immune response to mouse melanoma.

    PubMed

    Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling

    2009-12-01

    Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.

  3. Elevated antinuclear antibodies and altered anti-Epstein-Barr virus immune responses.

    PubMed

    Cuomo, Laura; Cirone, Mara; Di Gregorio, Ana Oliva; Vitillo, Marina; Cattivelli, Marina; Magliocca, Vittoria; Maiorano, Silvana; Meledandri, Marcello; Scagnolari, Carolina; La Rocca, Sebastiano; Trivedi, Pankaj

    2015-01-02

    It has been shown that Epstein-Barr virus (EBV) is able to alter the immune response towards self-antigens and may enhance risk of autoimmune diseases such as systemic lupus erythematosus (SLE) in genetically predisposed individuals. In this study, we evaluated the specific antibody immune response against EBV in patients with anti-nuclear autoantibodies (ANA) in comparison with ANA-negative healthy controls. For this purpose, 92 patients with an high anti-ANA reactivity with or without concomitant extractable nuclear antigen (ENA) or double stranded DNA (dsDNA) positivity were selected and compared with 146 healthy donors. We found that anti-EBV-VCA and EA IgG concentrations were significantly higher in ANA-positive patients in comparison to the controls (VCA P<0.0001 and EA P<0,03) as well as in those ANA-positive patients that showed a concomitant ENA positivity (P=0.0002). Interestingly, elevated anti-EBNA-1 IgG was found in a group of patients who had anti SSA/Ro antibodies. Anti-VCA IgM Abs were more frequently found in those patients with a very high titer of ANA (P=0.06); moreover detection of anti-VCA IgM/IgG in absence of anti-EBNA-1 IgG was more frequent in the patient than in the control group. Both these conditions correlate with a recent EBV infection or reactivation. The data suggest that EBV, particularly during acute infection or in its reactivation phase, could be involved in the ANA and ENA autoantibody formation. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Adjuvant effects of saponins on animal immune responses*

    PubMed Central

    Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.

    2007-01-01

    Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426

  5. Ubiquitin enzymes in the regulation of immune responses.

    PubMed

    Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo

    2017-08-01

    Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.

  6. Interactions between negative energy balance, metabolic diseases, uterine health and immune response in transition dairy cows.

    PubMed

    Esposito, Giulia; Irons, Pete C; Webb, Edward C; Chapwanya, Aspinas

    2014-01-30

    The biological cycles of milk production and reproduction determine dairying profitability thus making management decisions dynamic and time-dependent. Diseases also negatively impact on net earnings of a dairy enterprise. Transition cows in particular face the challenge of negative energy balance (NEB) and/or disproportional energy metabolism (fatty liver, ketosis, subacute, acute ruminal acidosis); disturbed mineral utilization (milk fever, sub-clinical hypocalcemia); and perturbed immune function (retained placenta, metritis, mastitis). Consequently NEB and reduced dry matter intake are aggravated. The combined effects of all these challenges are reduced fertility and milk production resulting in diminishing profits. Risk factors such as NEB, inflammation and impairment of the immune response are highly cause-and-effect related. Thus, managing cows during the transition period should be geared toward reducing NEB or feeding specially formulated diets to improve immunity. Given that all cows experience a reduced feed intake and body condition, infection and inflammation of the uterus after calving, there is a need for further research on the immunology of transition dairy cows. Integrative approaches at the molecular, cellular and animal level may unravel the complex interactions between disturbed metabolism and immune function that predispose cows to periparturient diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Humoral immune responses to Pneumocystis jirovecii antigens in HIV-infected and uninfected young children with pneumocystis pneumonia.

    PubMed

    Djawe, Kpandja; Daly, Kieran R; Levin, Linda; Zar, Heather J; Walzer, Peter D

    2013-01-01

    Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP.

  8. Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response

    PubMed Central

    Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.

    2016-01-01

    Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed

  9. Virus-specific T cell responses in macaques acutely infected with SHIVsf162p3

    PubMed Central

    Pahar, Bapi; Wang, Xiaolei; Dufour, Jason; Lackner, Andrew A.; Veazey, Ronald S.

    2007-01-01

    CD4+ T helper and CD8+ cytotoxic T lymphocyte responses are believed to play an important role in the control of primary HIV and SIV infection. However, the role of these cells in macaques acutely infected with SHIVsf162p3 has not been well characterized. In this study, ten adult rhesus macaques were intravaginally infected with SHIVsf162p3, and antigen specific cytokine responses to SHIV-Tat, Nef, Gag and Env peptide pools were examined through 70 days post inoculation (p.i.) using ELISPOT and/or cytokine flow cytometry (CFC). Peak plasma viral replication occurred between 14 and 21 days p.i., followed by low to undetectable plasma viremia by 70 days of infection in most macaques. Although some animals had strong virus-specific cellular immune responses, many had weak or minimal responses that did not correlate with the post peak decline in plasma viremia. PMID:17307212

  10. Norcantharidin Facilitates LPS-Mediated Immune Responses by Up-Regulation of AKT/NF-κB Signaling in Macrophages

    PubMed Central

    Li, Ruimei; Tan, Binghe; Han, Honghui; Liu, Mingyao; Qian, Min; Du, Bing

    2012-01-01

    Norcantharidin (NCTD), a demethylated analog of cantharidin, is a common used clinical drug to inhibit proliferation and metastasis of cancer cells. But the role of NCTD in modulating immune responses remains unknown. Here, we investigated the function and mechanism of NCTD in regulation of TLR4 associated immune response in macrophages. We evaluated the influence of NCTD on host defense against invaded pathogens by acute peritonitis mouse model, ELISA, Q-PCR, nitrite quantification, phagocytosis assay and gelatin zymography assay. Our data showed that the survival and the serum concentrations of IL-6 and TNF-α were all enhanced by NCTD significantly in peritonitis mouse model. Accordingly, LPS-induced cytokine, nitric oxide and MMP-9 production as well as the phagocytosis of bacteria were all up-regulated by NCTD in a dose dependent manner in both RAW264.7 cells and bone marrow-derived macrophages (BMMs). Then we further analyzed TLR4 associated signaling pathway by Western blot, Immunofluorescence and EMSA in the presence or absence of LPS. The phosphorylation of AKT and p65 at serine 536 but not serine 468 was enhanced obviously by NCTD in a dose dependent manner, whereas the degradation of IκBα was little effected. Consequently, the nuclear translocation and DNA binding ability of NF-κB was also increased by NCTD obviously in RAW264.7 cells. Our results demonstrated that NCTD could facilitate LPS-mediated immune response through promoting the phosphorylation of AKT/p65 and transcriptional activity of NF-κB, thus reprofiling the traditional anti-tumor drug NCTD as a novel immune regulator in promoting host defense against bacterial infection. PMID:22984593

  11. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses

    PubMed Central

    Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765

  12. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.

    PubMed

    Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.

  13. A peripheral immune response to remembering trauma contributes to the maintenance of fear memory in mice.

    PubMed

    Young, Matthew B; Howell, Leonard L; Hopkins, Lauren; Moshfegh, Cassandra; Yu, Zhe; Clubb, Lauren; Seidenberg, Jessica; Park, Jeanie; Swiercz, Adam P; Marvar, Paul J

    2018-05-17

    Alterations in peripheral immune markers are observed in individuals with post-traumatic stress disorder (PTSD). PTSD is characterized in part by impaired extinction of fear memory for a traumatic experience. We hypothesized that fear memory extinction is regulated by immune signaling stimulated when fear memory is retrieved. The relationship between fear memory and the peripheral immune response was tested using auditory Pavlovian fear conditioning in mice. Memory for the association was quantified by the amount of conditioned freezing exhibited in response to the conditioned stimulus (CS), extinction and time-dependent changes in circulating inflammatory cytokines. Brief extinction training with 12 CS rapidly and acutely increased circulating levels of the cytokine interleukin-6 (IL-6), downstream IL-6 signaling, other IL-6 related pro-inflammatory cytokines. Transgenic manipulations or neutralizing antibodies that inhibit IL-6 activity did not affect conditioned freezing during the acquisition of fear conditioning or extinction but significantly reduced conditioned freezing 24 h after extinction training with 12 CS. Conversely, conditioned freezing after extinction training was unchanged by IL-6 inhibition when 40 CS were used during the extinction training session. In addition to effectively diminishing conditioned freezing, extinction training with 40 CS also diminished the subsequent IL-6 response to the CS. These data demonstrate that IL-6 released following fear memory retrieval contributes to the maintenance of that fear memory and that this effect is extinction dependent. These findings extend the current understanding for the role of the immune system in PTSD and suggest that IL-6 and other IL-6 related pro-inflammatory cytokines may contribute to the persistence of fear memory in PTSD where fear memory extinction is impaired. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Innate Immune Responses to Engineered Nanomaterials During Allergic Airway Inflammation

    NASA Astrophysics Data System (ADS)

    Shipkowski, Kelly Anne

    The field of nanotechnology is continually advancing, and increasing amounts of consumer goods are being produced using engineered nanomaterials (ENMs). The health risks of occupational and/or consumer exposure to ENMs are not completely understood, although significant research indicates that pulmonary exposure to nanomaterials induces toxic effects in the lungs of exposed animals. Multi-walled carbon nanotubes (MWCNTs) are a specific category of ENMs and consist of sheets of graphene rolled into cylinders that are multiple layers thick in order to strengthen their rigidity. MWCNTs have a fiber-like shape, similar to that of asbestos, which allows for a high aspect ratio and makes them difficult to clear from the lung. Studies with rodent models have demonstrated that pulmonary exposure to ENMs, in particular MWCNTs, results in acute lung inflammation and the subsequent development of chronic fibrosis, suggesting a potential human health risk to individuals involved in the manufacturing of products utilizing these nanomaterials. Induction of IL-1beta secretion via activation of the inflammasome is a prime mechanism of MWCNT-induced inflammation. The inflammasome is a multi-protein scaffold found in a variety of cell types that forms in response to a variety of immune signals, including particulates. Sensitization with allergens, such as house dust mite (HDM), increases levels of the T helper 2 (Th2) cytokines IL-4 and IL-13 in mice and in humans, and there is particular cause for concern in cases of MWCNT exposure in individuals with pre-existing allergic airway disease, such as asthma. MWCNT exposure exacerbates airway inflammation and fibrosis in animal models of pre-existing allergic asthma, suggesting that individuals suffering from asthma are more susceptible to the toxic pulmonary effects of MWCNT exposure. Asthma is an exceptionally prominent human disease, and therefore the goal of this research was to better understand how pre-existing allergic airway

  15. A Case of Human Lassa Virus Infection With Robust Acute T-Cell Activation and Long-Term Virus-Specific T-Cell Responses.

    PubMed

    McElroy, Anita K; Akondy, Rama S; Harmon, Jessica R; Ellebedy, Ali H; Cannon, Deborah; Klena, John D; Sidney, John; Sette, Alessandro; Mehta, Aneesh K; Kraft, Colleen S; Lyon, Marshall G; Varkey, Jay B; Ribner, Bruce S; Nichol, Stuart T; Spiropoulou, Christina F

    2017-06-15

    A nurse who acquired Lassa virus infection in Togo in the spring of 2016 was repatriated to the United States for care at Emory University Hospital. Serial sampling from this patient permitted the characterization of several aspects of the innate and cellular immune responses to Lassa virus. Although most of the immune responses correlated with the kinetics of viremia resolution, the CD8 T-cell response was of surprisingly high magnitude and prolonged duration, implying prolonged presentation of viral antigens. Indeed, long after viremia resolution, there was persistent viral RNA detected in the semen of the patient, accompanied by epididymitis, suggesting the male reproductive tract as 1 site of antigen persistence. Consistent with the magnitude of acute T-cell responses, the patient ultimately developed long-term, polyfunctional memory T-cell responses to Lassa virus. Published by Oxford University Press for the Infectious Diseases Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  16. Current views on the mechanisms of immune responses to trauma and infection

    PubMed Central

    Michalak, Grzegorz; Słotwiński, Robert

    2015-01-01

    According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036

  17. Sex-specific consequences of an induced immune response on reproduction in a moth.

    PubMed

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  18. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  19. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed Central

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936

  20. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-03-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  1. Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.

    PubMed

    Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon

    2018-01-01

    Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.

  2. The impact of acute stress on hormones and cytokines, and how their recovery is affected by music-evoked positive mood

    PubMed Central

    Koelsch, Stefan; Boehlig, Albrecht; Hohenadel, Maximilian; Nitsche, Ines; Bauer, Katrin; Sack, Ulrich

    2016-01-01

    Stress and recovery from stress significantly affect interactions between the central nervous system, endocrine pathways, and the immune system. However, the influence of acute stress on circulating immune-endocrine mediators in humans is not well known. Using a double-blind, randomized study design, we administered a CO2 stress test to n = 143 participants to identify the effects of acute stress, and recovery from stress, on serum levels of several mediators with immune function (IL-6, TNF-α, leptin, and somatostatin), as well as on noradrenaline, and two hypothalamic–pituitary–adrenal axis hormones (ACTH and cortisol). Moreover, during a 1 h-recovery period, we repeatedly measured these serum parameters, and administered an auditory mood-induction protocol with positive music and a neutral control stimulus. The acute stress elicited increases in noradrenaline, ACTH, cortisol, IL-6, and leptin levels. Noradrenaline and ACTH exhibited the fastest and strongest stress responses, followed by cortisol, IL-6 and leptin. The music intervention was associated with more positive mood, and stronger cortisol responses to the acute stressor in the music group. Our data show that acute (CO2) stress affects endocrine, immune and metabolic functions in humans, and they show that mood plays a causal role in the modulation of responses to acute stress. PMID:27020850

  3. A cognitive computational model inspired by the immune system response.

    PubMed

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.

  4. The innate immune response to uropathogenic Escherichia coli involves IL-17A in a murine model of urinary tract infection.

    PubMed

    Sivick, Kelsey E; Schaller, Matthew A; Smith, Sara N; Mobley, Harry L T

    2010-02-15

    Uropathogenic Escherichia coli is the causative agent for >80% of uncomplicated urinary tract infections (UTIs). Uropathogenic E. coli strains express a number of virulence and fitness factors that allow successful colonization of the mammalian bladder. To combat this, the host has distinct mechanisms to prevent adherence to the bladder wall and to detect and kill uropathogenic E. coli in the event of colonization. In this study, we investigated the role of IL-17A, an innate-adaptive immunomodulatory cytokine, during UTI using a murine model. Splenocytes isolated from mice infected by the transurethral route robustly expressed IL-17A in response to in vitro stimulation with uropathogenic E. coli Ags. Transcript expression of IL-17A in the bladders of infected mice correlated with a role in the innate immune response to UTI, and gammadelta cells seem to be a key source of IL-17A production. Although IL-17A seems to be dispensable for the generation of a protective response to uropathogenic E. coli, its importance in innate immunity is demonstrated by a defect in acute clearance of uropathogenic E. coli in IL-17A(-/-) mice. This clearance defect is likely a result of deficient cytokine and chemokine transcripts and impaired macrophage and neutrophil influx during infection. These results show that IL-17A is a key mediator for the innate immune response to UTIs.

  5. Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery

    NASA Astrophysics Data System (ADS)

    Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole

    2015-12-01

    Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized

  6. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization.

    PubMed

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M

    2004-03-01

    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  7. Induction of immune response in macaque monkeys infected with simian-human immunodeficiency virus having the TNF-{alpha} gene at an early stage of infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro

    2005-12-20

    TNF-{alpha} has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-{alpha} against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-{alpha} gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4{sup +} T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES andmore » by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-{alpha} contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection.« less

  8. Phenytoin promotes Th2 type immune response in mice

    PubMed Central

    Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U

    2001-01-01

    The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401

  9. Ubiquitin enzymes in the regulation of immune responses

    PubMed Central

    Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo

    2017-01-01

    Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749

  10. IL-2 infusion abrogates humoral immune responses in humans.

    PubMed Central

    Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K

    1992-01-01

    Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235

  11. Hepatitis C Virus Reveals a Novel Early Control in Acute Immune Response

    PubMed Central

    Arnaud, Noëlla; Dabo, Stéphanie; Akazawa, Daisuke; Fukasawa, Masayoshi; Shinkai-Ouchi, Fumiko; Hugon, Jacques; Wakita, Takaji; Meurs, Eliane F.

    2011-01-01

    Recognition of viral RNA structures by the intracytosolic RNA helicase RIG-I triggers induction of innate immunity. Efficient induction requires RIG-I ubiquitination by the E3 ligase TRIM25, its interaction with the mitochondria-bound MAVS protein, recruitment of TRAF3, IRF3- and NF-κB-kinases and transcription of Interferon (IFN). In addition, IRF3 alone induces some of the Interferon-Stimulated Genes (ISGs), referred to as early ISGs. Infection of hepatocytes with Hepatitis C virus (HCV) results in poor production of IFN despite recognition of the viral RNA by RIG-I but can lead to induction of early ISGs. HCV was shown to inhibit IFN production by cleaving MAVS through its NS3/4A protease and by controlling cellular translation through activation of PKR, an eIF2α-kinase containing dsRNA-binding domains (DRBD). Here, we have identified a third mode of control of IFN induction by HCV. Using HCVcc and the Huh7.25.CD81 cells, we found that HCV controls RIG-I ubiquitination through the di-ubiquitine-like protein ISG15, one of the early ISGs. A transcriptome analysis performed on Huh7.25.CD81 cells silenced or not for PKR and infected with JFH1 revealed that HCV infection leads to induction of 49 PKR-dependent genes, including ISG15 and several early ISGs. Silencing experiments revealed that this novel PKR-dependent pathway involves MAVS, TRAF3 and IRF3 but not RIG-I, and that it does not induce IFN. Use of PKR inhibitors showed that this pathway requires the DRBD but not the kinase activity of PKR. We then demonstrated that PKR interacts with HCV RNA and MAVS prior to RIG-I. In conclusion, HCV recruits PKR early in infection as a sensor to trigger induction of several IRF3-dependent genes. Among those, ISG15 acts to negatively control the RIG-I/MAVS pathway, at the level of RIG-I ubiquitination.These data give novel insights in the machinery involved in the early events of innate immune response. PMID:22022264

  12. Human physiological responses to cold exposure: Acute responses and acclimatization to prolonged exposure.

    PubMed

    Castellani, John W; Young, Andrew J

    2016-04-01

    Cold exposure in humans causes specific acute and chronic physiological responses. This paper will review both the acute and long-term physiological responses and external factors that impact these physiological responses. Acute physiological responses to cold exposure include cutaneous vasoconstriction and shivering thermogenesis which, respectively, decrease heat loss and increase metabolic heat production. Vasoconstriction is elicited through reflex and local cooling. In combination, vasoconstriction and shivering operate to maintain thermal balance when the body is losing heat. Factors (anthropometry, sex, race, fitness, thermoregulatory fatigue) that influence the acute physiological responses to cold exposure are also reviewed. The physiological responses to chronic cold exposure, also known as cold acclimation/acclimatization, are also presented. Three primary patterns of cold acclimatization have been observed, a) habituation, b) metabolic adjustment, and c) insulative adjustment. Habituation is characterized by physiological adjustments in which the response is attenuated compared to an unacclimatized state. Metabolic acclimatization is characterized by an increased thermogenesis, whereas insulative acclimatization is characterized by enhancing the mechanisms that conserve body heat. The pattern of acclimatization is dependent on changes in skin and core temperature and the exposure duration. Published by Elsevier B.V.

  13. [Immune response to live influenza vaccine].

    PubMed

    Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G

    2002-01-01

    Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.

  14. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    PubMed Central

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  15. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo

    2016-01-01

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  16. Immune responses to bioengineered organs

    PubMed Central

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.

    2017-01-01

    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545

  17. Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.

    PubMed

    Luu, L; Coombes, J L

    2015-03-01

    Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.

  18. The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides

    PubMed Central

    Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria

    2010-01-01

    The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388

  19. Immune response in asymptomatic smokers.

    PubMed

    Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H

    2002-09-01

    It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production

  20. CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL

    PubMed Central

    Zhu, Yuwen; Yao, Sheng; Chen, Lieping

    2011-01-01

    Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182

  1. Transmitted/Founder Viruses Rapidly Escape from CD8+ T Cell Responses in Acute Hepatitis C Virus Infection.

    PubMed

    Bull, Rowena A; Leung, Preston; Gaudieri, Silvana; Deshpande, Pooja; Cameron, Barbara; Walker, Melanie; Chopra, Abha; Lloyd, Andrew R; Luciani, Fabio

    2015-05-01

    the acute infection. This study was made possible through the availability of specimens from a unique cohort of asymptomatic primary infection cases in whom the first available viremic samples were collected approximately 3 weeks postinfection and at regular intervals thereafter. The study included detailed examination of both the evolution of the viral population and the host cellular immune responses against the T/F viruses. The findings here provide the first evidence of host cellular responses targeting T/F variants and imposing a strong selective force toward viral escape. The results of this study provide useful insight on how virus escapes the host response and consequently on future analysis of vaccine-induced immunity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Cytokines in the host response to Candida vaginitis: Identifying a role for non-classical immune mediators, S100 alarmins

    PubMed Central

    Yano, Junko; Noverr, Mairi C.; Fidel, Paul L.

    2011-01-01

    Vulvovaginal candidiasis (VVC), caused by Candida albicans, affects a significant number of women during their reproductive years. More than two decades of research have been focused on the mechanisms associated with susceptibility or resistance to symptomatic infection. Adaptive immunity by Th1-type CD4+ T cells and downstream cytokine responses are considered the predominant host defense mechanisms against mucosal Candida infections. However, numerous clinical and animal studies have indicated no or limited protective role of cells and cytokines of the Th1 or Th2 lineage against vaginal infection. The role for Th17 is only now begun to be investigated in-depth for VVC with results already showing significant controversy. On the other hand, a clinical live-challenge study and an established animal model have shown that a symptomatic condition is intimately associated with the vaginal infiltration of polymorphonuclear leukocytes (PMNs) but with no effect on vaginal fungal burden. Subsequent studies identified S100A8 and S100A9 Alarmins as key chemotactic mediators of the acute PMN response. These chemotactic danger signals appear to be secreted by vaginal epithelial cells upon interaction and early adherence of Candida. Thus, instead of a putative immunodeficiency against Candida involving classical immune cells and cytokines of the adaptive response, the pathological inflammation in VVC is now considered a consequence of a non-productive innate response initiated by non-classical immune mediators. PMID:22182685

  3. Male adolescent rats display blunted cytokine responses in the CNS after acute ethanol or lipopolysaccharide exposure

    PubMed Central

    Doremus-Fitzwater, Tamara L.; Gano, Anny; Paniccia, Jacqueline E.; Deak, Terrence

    2015-01-01

    Alcohol induces widespread changes in cytokine expression, with recent data from our laboratory having demonstrated that, during acute ethanol intoxication, adult rats exhibit consistent increases in interleukin (IL)-6 mRNA expression in several brain regions, while showing reductions in IL-1 and TNFα expression. Given evidence indicating that adolescence may be an ontogenetic period in which some neuroimmune processes and cells may not yet have fully matured, the purpose of the current experiments was to examine potential age differences in the central cytokine response of adolescent (P31–33 days of age) and adult (69–71 days of age) rats to either an acute immune (lipopolysaccharide; LPS) or non-immune challenge (ethanol). In Experiment 1, male Sprague-Dawley rats were given an intraperitoneal (i.p.) injection of either sterile saline, LPS (250 µg/kg), or ethanol (4-g/kg), and then trunk blood and brain tissue were collected 3 hr later for measurement of blood EtOH concentrations (BECs), plasma endotoxin, and central mRNA expression of several immune-related gene targets. In Experiment 2, the response to intragastrically (i.g.) administered ethanol was examined and compared to animals given tap water (i.g.). Results showed that LPS stimulated robust increases in expression of IL-1, IL-6, TNFα, and IκBα in the hippocampus, PVN, and amygdala, and that these increases were generally less pronounced in adolescents relative to adults. Following an i.p. EtOH challenge, IL-6 and IκBα expression were significantly increased in both ages in the PVN and amygdala, and adults exhibited even greater increases in IκBα than adolescents. I.g. administration of ethanol also increased IL-6 and IκBα expression in all three brain regions, with hippocampal IL-6 expression elevated even more so in adults compared to adolescents. Furthermore, assessment of plasma endotoxin concentrations revealed (i) whereas robust increases in plasma endotoxin were observed in adults

  4. Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA

    PubMed Central

    Mandadi, Kranthi K.; Scholthof, Karen-Beth G.

    2013-01-01

    Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626

  5. Immune response and immunopathology during toxoplasmosis1

    PubMed Central

    Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.

    2012-01-01

    Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326

  6. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less

  7. A modified live canine parvovirus vaccine. II. Immune response.

    PubMed

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  8. Mesenchymal stem cells: a double-edged sword in regulating immune responses

    PubMed Central

    Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y

    2012-01-01

    Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969

  9. Innate immunity, insulin resistance and type 2 diabetes.

    PubMed

    Fernández-Real, José Manuel; Pickup, John C

    2008-01-01

    Recent evidence has disclosed previously unrecognized links among insulin resistance, obesity, circulating immune markers, immunogenetic susceptibility, macrophage function and chronic infection. Genetic variations leading to altered production or function of circulating innate immune proteins, cellular pattern-recognition receptors and inflammatory cytokines have been linked with insulin resistance, type 2 diabetes, obesity and atherosclerosis. Cellular innate immune associations with obesity and insulin resistance include increased white blood cell count and adipose tissue macrophage numbers. The innate immune response is modulated possibly by both predisposition (genetic or fetal programming), perhaps owing to evolutionary pressures caused by acute infections at the population level (pandemics), and chronic low exposure to environmental products or infectious agents. The common characteristics shared among innate immunity activation, obesity and insulin resistance are summarized.

  10. Alcohol, aging, and innate immunity.

    PubMed

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  11. Immunology and immunity against infection: General rules

    NASA Astrophysics Data System (ADS)

    Zinkernagel, Rolf M.

    2005-12-01

    Simplified and generalizable rules of immune responses against infections or vaccines have been summarized into 20 statements previously (Scand. J. Immunol. 60 (2004) 9-13) and are restated in a slightly different form here. The key terms of immunology (e.g. specificity, tolerance and memory) are explained in terms of their co-evolutionary importance in the equilibrium between infectious agents and diseases with higher vertebrate hosts. Specificity is best defined by protective antibodies or protective activated T cells; e.g. serotype specific neutralizing antibodies against polio viruses represent the discriminatory power of an immune response very well indeed. Tolerance is reviewed in terms of reactivity rather than self-nonself discrimination. Immune respones are deleted against antigens expressed at sufficient levels within the lymphoheamopoetic system, but may well exist at both, the T and the B cell level against antigens strictly outside of secondary lymphatic organs. In this respect the immune system behaves identically against virus infections and against self antigens. Persistent virus infections delete responsive T cells, once eliminated immune T cell responses wane, if a virus keeps outside of secondary lymphatic tissues no immune response is induced. Immunological memory is usually defined as earlier and greater responses but this does not correlate with protective immunity stringently. It is summarized here that pre-existing titers of protective neutralizing antibodies or pre-existence of activated T cells are the correlates of protection acute cytopathic lethal infections and toxins or against intracellular parasites. It is concluded that many discrepancies and uncertainties in immunological research derive from model situations and experimental results that are correctly measured but cannot be related to co-evolutionary contexts, i.e. survival.

  12. In Vivo Immune Responses of Cross-Linked Electrospun Tilapia Collagen Membrane.

    PubMed

    Hassanbhai, Ammar Mansoor; Lau, Chau Sang; Wen, Feng; Jayaraman, Praveena; Goh, Bee Tin; Yu, Na; Teoh, Swee-Hin

    2017-10-01

    Collagen has been used extensively in tissue engineering applications. However, the source of collagen has been primarily bovine and porcine. In view of the potential risk of zoonotic diseases and religious constraints associated with bovine and porcine collagen, fish collagen was examined as an alternative. The aim of this study is to use tilapia fish collagen to develop a cross-linked electrospun membrane to be used as a barrier membrane in guided bone regeneration. As there is limited data available on the cytotoxicity and immunogenicity of cross-linked tilapia collagen, in vitro and in vivo tests were performed to evaluate this in comparison to the commercially available Bio-Gide ® membrane. In this study, collagen was extracted and purified from tilapia skin and electrospun into a nanofibrous membrane. The resultant membrane was cross-linked to obtain a cross-linked electrospun tilapia collagen (CETC) membrane, which was characterized by scanning electron microscopy (SEM), differential scanning calorimetry (DSC), degradation studies, cytotoxicity studies, and cell proliferation studies. The membranes were also implanted subcutaneously in rats and the host immune responses were examined. The DSC data showed that cross-linking increased the denaturation temperature of tilapia collagen to 58.3°C ± 1.4°C. The in vitro tests showed that CETC exhibited no cytotoxicity toward murine fibroblast L929 cells, and culture of murine preosteoblast MC3T3-E1 cells demonstrated better proliferation on CETC as compared to Bio-Gide. When implanted in rats, CETC caused a higher production of interleukin IL-6 at early time points as compared to Bio-Gide, but there was no long-term inflammatory responses after the acute inflammation phase. This finding was supported with histology data, which clearly illustrated that CETC has a decreased inflammatory response comparable to the benchmark control group. In all, this study demonstrated the viability for the use of CETC as a

  13. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.

    PubMed

    Fins, Joseph J

    2015-04-01

    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  14. A Cognitive Computational Model Inspired by the Immune System Response

    PubMed Central

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131

  15. Angiotensin converting enzyme over expression in myelocytes enhances the immune response

    PubMed Central

    Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.

    2015-01-01

    Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750

  16. Lipoxin A4, a 5-lipoxygenase pathway metabolite, modulates immune response during acute respiratory tularemia.

    PubMed

    Singh, Anju; Rahman, Tabassum; Bartiss, Rose; Arabshahi, Alireza; Prasain, Jeevan; Barnes, Stephen; Musteata, Florin Marcel; Sellati, Timothy J

    2017-02-01

    Respiratory infection with Francisella tularensis (Ft) is characterized by a muted, acute host response, followed by sepsis-like syndrome that results in death. Infection with Ft establishes a principally anti-inflammatory environment that subverts host-cell death programs to facilitate pathogen replication. Although the role of cytokines has been explored extensively, the role of eicosanoids in tularemia pathogenesis is not fully understood. Given that lipoxin A 4 (LXA 4 ) has anti-inflammatory properties, we investigated whether this lipid mediator affects host responses manifested early during infection. The addition of exogenous LXA 4 inhibits PGE 2 release by Ft-infected murine monocytes in vitro and diminishes apoptotic cell death. Tularemia pathogenesis was characterized in 5‑lipoxygenase-deficient (Alox5 -/- ) mice that are incapable of generating LXA 4 Increased release of proinflammatory cytokines and chemokines, as well as increased apoptosis, was observed in Alox5 -/- mice as compared with their wild-type counterparts. Alox5 -/- mice also exhibited elevated recruitment of neutrophils during the early phase of infection and increased resistance to lethal challenge. Conversely, administration of exogenous LXA 4 to Alox5 -/- mice made them more susceptible to infection thus mimicking wild-type animals. Taken together, our results suggest that 5-LO activity is a critical regulator of immunopathology observed during the acute phase of respiratory tularemia, regulating bacterial burden and neutrophil recruitment and production of proinflammatory modulators and increasing morbidity and mortality. These studies identify a detrimental role for the 5-LO-derived lipid mediator LXA 4 in Ft-induced immunopathology. Targeting this pathway may have therapeutic benefit as an adjunct to treatment with antibiotics and conventional antimicrobial peptides, which often have limited efficacy against intracellular bacteria. © Society for Leukocyte Biology.

  17. Induction of the immune response suppression in mice inoculated with Candida albicans.

    PubMed

    Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G

    1986-03-01

    There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).

  18. Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.

    PubMed

    West, A Phillip

    2017-11-01

    A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Evidence of functional cell-mediated immune responses to nontypeable Haemophilus influenzae in otitis-prone children

    PubMed Central

    Seppanen, Elke; Tan, Dino; Corscadden, Karli J.; Currie, Andrew J.; Richmond, Peter C.; Thornton, Ruth B.

    2018-01-01

    Otitis media (OM) remains a common paediatric disease, despite advances in vaccinology. Susceptibility to recurrent acute OM (rAOM) has been postulated to involve defective cell-mediated immune responses to common otopathogenic bacteria. We compared the composition of peripheral blood mononuclear cells (PBMC) from 20 children with a history of rAOM (otitis-prone) and 20 healthy non-otitis-prone controls, and assessed innate and cell-mediated immune responses to the major otopathogen nontypeable Haemophilus influenzae (NTHi). NTHi was a potent stimulator of inflammatory cytokine secretion from PBMC within 4 hours, with no difference in cytokine levels produced between PBMC from cases or controls. In the absence of antigen stimulation, otitis-prone children had more circulating Natural Killer (NK) cells (p<0.01), particularly NKdim (CD56lo) cells (p<0.01), but fewer CD4+ T cells (p<0.01) than healthy controls. NTHi challenge significantly increased the proportion of activated (CD107a+) NK cells in otitis-prone and non-otitis-prone children (p<0.01), suggesting that NK cells from otitis-prone children are functional and respond to NTHi. CD8+ T cells and NK cells from both cases and controls produced IFNγ in response to polyclonal stimulus (Staphylococcal enterotoxin B; SEB), with more IFNγ+ CD8+ T cells present in cases than controls (p<0.05) but similar proportions of IFNγ+ NK cells. Otitis-prone children had more circulating IFNγ-producing NK cells (p<0.05) and more IFNγ-producing CD4+ (p<0.01) or CD8+ T-cells (p<0.05) than healthy controls. In response to SEB, more CD107a-expressing CD8+ T cells were present in cases than controls (p<0.01). Despite differences in PBMC composition, PBMC from otitis-prone children mounted innate and T cell-mediated responses to NTHi challenge that were comparable to healthy children. These data provide evidence that otitis-prone children do not have impaired functional cell mediated immunity. PMID:29621281

  20. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    PubMed

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. Use of Recombinant Factor VIIa in a Pediatric Patient With Initial Presentation of Refractory Acute Immune Thrombocytopenic Purpura and Severe Bleeding

    PubMed Central

    Gurion, Reut; Siu, Anita; Weiss, Aaron R.; Masterson, Margaret

    2012-01-01

    Severe bleeding in acute immune thrombocytopenic purpura (ITP) is rare but can cause significant complications to the patient. Here we report the case of a pediatric patient with acute ITP and hematuria refractory to anti-D immune globulin, high dose intravenous immunoglobulin G, and high dose steroids. Her hematuria was successfully treated with recombinant factor VIIa (rFVIIa). While further investigation on the use of rFVIIa in ITP is warranted, this case report contributes to the pediatric literature for its use during the course of an initial presentation of ITP with hemorrhagic complications. PMID:23258971

  2. Surviving Sepsis: Taming a Deadly Immune Response

    MedlinePlus

    ... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...

  3. Humoral Immune Responses to Pneumocystis jirovecii Antigens in HIV-Infected and Uninfected Young Children with Pneumocystis Pneumonia

    PubMed Central

    Djawe, Kpandja; Daly, Kieran R.; Walzer, Peter D.

    2013-01-01

    Background Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Methods Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. Results 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Conclusions Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP. PMID:24386119

  4. Virus-specific T cell responses in macaques acutely infected with SHIV(sf162p3).

    PubMed

    Pahar, Bapi; Wang, Xiaolei; Dufour, Jason; Lackner, Andrew A; Veazey, Ronald S

    2007-06-20

    CD4(+) T helper and CD8(+) cytotoxic T lymphocyte responses are believed to play an important role in the control of primary HIV and SIV infection. However, the role of these cells in macaques acutely infected with SHIV(sf162p3) has not been well characterized. In this study, ten adult rhesus macaques were intravaginally infected with SHIV(sf162p3), and antigen-specific cytokine responses to SHIV-Tat, Nef, Gag and Env peptide pools were examined through 70 days post inoculation (p.i.) using ELISPOT and/or cytokine flow cytometry (CFC). Peak plasma viral replication occurred between 14 and 21 days p.i. followed by low to undetectable plasma viremia by 70 days of infection in most macaques. Although some animals had strong virus-specific cellular immune responses, many had weak or minimal responses that did not correlate with the post peak decline in plasma viremia.

  5. Neuronal overexpression of cyclooxygenase-2 does not alter the neuroinflammatory response during brain innate immune activation.

    PubMed

    Aid, Saba; Parikh, Nishant; Palumbo, Sara; Bosetti, Francesca

    2010-07-12

    Neuroinflammation is a critical component in the progression of several neurological and neurodegenerative diseases and cyclooxygenases (COX)-1 and -2 are key regulators of innate immune responses. We recently demonstrated that COX-1 deletion attenuates, whereas COX-2 deletion enhances, the neuroinflammatory response, blood-brain barrier permeability and leukocyte recruitment during lipopolysaccharide (LPS)-induced innate immune activation. Here, we used transgenic mice, which overexpressed human COX-2 via neuron-specific Thy-1 promoter (TgCOX-2), causing elevated prostaglandins (PGs) levels. We tested whether neuronal COX-2 overexpression affects the glial response to a single intracerebroventricular injection of LPS, which produces a robust neuroinflammatory reaction. Relative to non-transgenic controls (NTg), 7 month-old TgCOX-2 did not show any basal neuroinflammation, as assessed by gene expression of markers of inflammation and oxidative stress, neuronal damage, as assessed by Fluoro-JadeB staining, or systemic inflammation, as assessed by plasma levels of IL-1beta and corticosterone. Twenty-four hours after LPS injection, all mice showed increased microglial activation, as indicated by Iba1 immunostaining, neuronal damage, mRNA expression of cytokines (TNF-alpha, IL-6), reactive oxygen expressing enzymes (iNOS and NADPH oxidase subunits), endogenous COX-2, cPLA(2) and mPGES-1, and hippocampal and cortical IL-1beta levels. However, the increases were similar in TgCOX-2 and NTg. In NTg, LPS increased brain PGE(2) to the levels observed in TgCOX-2. These results suggest that PGs derived from neuronal COX-2 do not play a role in the neuroinflammatory response to acute activation of brain innate immunity. This is likely due to the direct effect of LPS on glial rather than neuronal cells. Published by Elsevier Ireland Ltd.

  6. The immune impact of mimic endoscopic retrograde appendicitis therapy and appendectomy on rabbits of acute appendicitis.

    PubMed

    Liu, Suqin; Pei, Fenghua; Wang, Xinhong; Li, Deliang; Zhao, Lixia; Song, Yanyan; Chen, Zhendong; Liu, Bingrong

    2017-09-12

    This study was conducted to evaluate the immune impact of mimic endoscopic retrograde appendicitis therapy and appendectomy on rabbits of acute suppurative appendicitis and to determine whether TLR4/MYD88/NF-κB signaling pathway was activated in this process. 48 rabbits were assigned into 4 groups: group I, the mimic endoscopic retrograde appendicitis therapy group; group II, the appendectomy group; group III, the model group; and group IV, the blank group. White blood cells decreased, while levels of C-reactive protein, tumor necrosis factor-α, interleukin-6, interleukin-4, and interleukin-10 increased on the 2 nd day in group I and II. IgA in feces decreased at 2 weeks, while fecal microbiota changed at 2 and 4 weeks after appendectomy. CD8 + cells in appendix of group I increased within 8 weeks. Upregulated expression of TLR4, MYD88, and nuclear NF-κB were detected on the 2 nd day in group I and II. Mimic endoscopic retrograde appendicitis therapy and appendectomy are effective ways for acute suppurative appendicitis. Mimic endoscopic retrograde appendicitis therapy was more preferable due to its advantage in maintaining intestinal immune function. TLR4/MYD88/NF-κB signaling pathway was activated in acute phase of appendicitis.

  7. The influence of the microbiota on the immune response to transplantation

    PubMed Central

    Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa

    2015-01-01

    Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985

  8. Respiratory tract immune response to microbial pathogens.

    PubMed

    Wilkie, B N

    1982-11-15

    Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.

  9. Arctigenin protects against liver injury from acute hepatitis by suppressing immune cells in mice.

    PubMed

    Cheng, Xixi; Wang, Huafeng; Yang, Jinlai; Cheng, Yingnan; Wang, Dan; Yang, Fengrui; Li, Yan; Zhou, Dongmei; Wang, Yanxia; Xue, Zhenyi; Zhang, Lijuan; Zhang, Qi; Yang, Luhong; Zhang, Rongxin; Da, Yurong

    2018-06-01

    As a phenylpropanoid and dibenzylbutyrolactone lignan present in medical plants, such as those used in traditional Chinese herbal medicine, including Arctium lappa (Niubang), arctigenin exhibits antimicrobial, anti-inflammatory, and anticancer activities. In this study, we investigated the protective role of arctigenin in Concanavalin A (ConA)-induced acute hepatitis in mice. Arctigenin remarkably reduced the congestion and necroinflammation of livers, and improved hepatic function (ALT and AST) in ConA-induced acute hepatitis in vivo. The infiltration of CD4 T, NKT and macrophages into the livers was found to be reduced with arctigenin treatment. Arctigenin suppressed ConA-induced T lymphocyte proliferations that might have resulted from enhanced IL-10 production by macrophages and CD4 T cells. These results suggested that arctigenin could be a powerful drug candidate for acute hepatitis through immune suppression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  10. Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza

    PubMed Central

    Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom

    2015-01-01

    The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761

  11. Selection for avian immune response: a commercial breeding company challenge.

    PubMed

    Fulton, J E

    2004-04-01

    Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.

  12. Distribution of IgA subclass response to Coxiella burnetii in patients with acute and chronic Q fever.

    PubMed

    Camacho, M T; Outschoorn, I; Echevarría, C; Kovácová, E; Yebra, M; Maté, I; Auffray, P; Téllez, A

    1998-07-01

    The progression of Coxiella burnetii infection to acute or chronic Q fever has been attributed to biological characteristics of the bacterium and to the host immune response. We measured whether serum levels of total and specific subclasses IgA1 and IgA2 could be correlated with the course of disease in acute and chronic Q fever infections, and with the occurrence of endocarditis. In patients with chronic infection, total IgA2 levels were significantly increased. Q-fever-specific IgA1 antibodies were detectable in both acute and chronic infections, but only patients with endocarditis had IgA2 antibodies to C. burnetii phase II antigens. These findings indicate that the measurement of IgA subclasses may be a useful aid in the serological diagnosis of Q fever. Our results reinforce the idea that immunologically mediated host factors are important in the pathogenesis of Q fever and in the disease outcome of this infection. Copyright 1998 Academic Press.

  13. Differential Immune Responses to New World and Old World Mammalian Arenaviruses

    PubMed Central

    Ly, Hinh

    2017-01-01

    Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311

  14. The eye: A window to the soul of the immune system.

    PubMed

    Perez, V L; Saeed, A M; Tan, Y; Urbieta, M; Cruz-Guilloty, F

    2013-09-01

    The eye is considered as an immune privileged site, and with good reason. It has evolved a variety of molecular and cellular mechanisms that limit immune responses to preserve vision. For example, the cornea is mainly protected from autoimmunity by the lack of blood and lymphatic vessels, whereas the retina-blood barrier is maintained in an immunosuppressive state by the retinal pigment epithelium. However, there are several scenarios in which immune privilege is altered and the eye becomes susceptible to immune attack. In this review, we highlight the role of the immune system in two clinical conditions that affect the anterior and posterior segments of the eye: corneal transplantation and age-related macular degeneration. Interestingly, crosstalk between the innate and adaptive immune systems is critical in both acute and chronic inflammatory responses in the eye, with T cells playing a central role in combination with neutrophils and macrophages. In addition, we emphasize the advantage of using the eye as a model for in vivo longitudinal imaging of the immune system in action. Through this technique, it has been possible to identify functionally distinct intra-graft motility patterns of responding T cells, as well as the importance of chemokine signaling in situ for T cell activation. The detailed study of ocular autoimmunity could provide novel therapeutic strategies for blinding diseases while also providing more general information on acute versus chronic inflammation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  16. Carotenoids buffer the acute phase response on fever, sickness behavior and rapid bill color change in zebra finches.

    PubMed

    George, Deanna B; Schneider, Brent C; McGraw, Kevin J; Ardia, Daniel R

    2017-08-15

    Carotenoids are finite resources that animals can allocate to self-maintenance, attractiveness or reproduction. Here we test how carotenoids affect the acute phase response (APR), an intense rapid systemic response characterized by fever, sickness behavior and production of acute phase proteins, which serves to reduce pathogen persistence. We conducted a 2×2 factorial design experiment in captive adult male and female zebra finches ( Taeniopygia guttata ) to determine the effects of carotenoid supplementation on the intensity of the APR. We measured changes in feeding rate, activity level and body temperature of the birds. We found that, relative to unsupplemented controls, carotenoid-supplemented birds exhibited less severe reductions in feeding and activity, smaller increases in body temperature and lower circulating levels of haptoglobin (an acute phase protein) 24 h after inducing an APR. Among supplemented individuals, those with higher blood carotenoid levels exhibited a lower reduction in activity rate after 24 h. Forty-eight hours after APR induction, birds exhibited a significant decrease in plasma carotenoid levels and a decrease in bill hue, with less reduction in hue in carotenoid-supplemented individuals. These results demonstrate that carotenoids can alleviate several important behavioral and physiological effects of an APR and that bill color can change rapidly following induction of the costly APR immune defense. In particular, immune activation may have caused birds to preferentially draw down carotenoids from the bloodstream, ostensibly for use in health. Rapid bill color changes over a 48-h period support growing evidence that bills may serve as short-term signals of health and condition. © 2017. Published by The Company of Biologists Ltd.

  17. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  18. Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine

    PubMed Central

    Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.

    1973-01-01

    The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112

  19. Modulation of Human Immune Response by Fungal Biocontrol Agents

    PubMed Central

    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane

    2017-01-01

    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107

  20. Work stress and innate immune response.

    PubMed

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  1. The acute phase response and exercise: court and field sports

    PubMed Central

    Fallon, K; Fallon, S; Boston, T

    2001-01-01

    Objective—To determine the presence or absence of an acute phase response after training for court and field sports. Participants—All members of the Australian women's soccer team (n = 18) and all members of the Australian Institute of Sport netball team (n = 14). Methods—Twelve acute phase reactants (white blood cell count, neutrophil count, platelet count, serum iron, ferritin, and transferrin, percentage transferrin saturation, α1 antitrypsin, caeruloplasmin, α2 acid glycoprotein, C reactive protein, and erythrocyte sedimentation rate) were measured during a rest period and after moderate and heavy training weeks in members of elite netball and women's soccer teams. Results—Responses consistent with an acute phase response were found in five of 24 tests in the soccer players, and in three of 24 tests in the netball players. Responses in the opposite direction were found in seven of 24 tests in the soccer players and two of 24 tests in the netballers. The most sensitive reactant measured, C reactive protein, did not respond in a manner typical of an acute phase response. Conclusion—An acute phase response does not seem to occur as a consequence of the levels of training typical of elite female netball and soccer teams. This has implications for the interpretation of biochemical variables in these groups. Key Words: acute phase response; iron; plasma proteins; inflammation PMID:11375875

  2. Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.

    PubMed

    Mack, Madison R; Kim, Brian S

    2016-07-19

    The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  4. Effect of rituximab on human in vivo antibody immune responses.

    PubMed

    Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana

    2011-12-01

    B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights

  5. Acute hypersensitivity reactions associated with administration of crotalidae polyvalent immune Fab antivenom.

    PubMed

    Cannon, Robert; Ruha, Anne-Michelle; Kashani, John

    2008-04-01

    Acute hypersensitivity reactions are well known to occur with the administration of the Antivenin (Crotalidae) Polyvalent (Wyeth Laboratories, Marietta, PA). Crotalidae polyvalent immune Fab (ovine) (CroFab; FabAV, Protherics, Inc., Brentwood, TN) was introduced in 2001, and early studies reported a hypersensitivity reaction rate up to 19%. We describe the incidence of acute hypersensitivity reactions to FabAV in patients bitten by rattlesnakes. This was a nonconcurrent observational cohort study, with data obtained by chart review of all patients admitted to our service for rattlesnake bites from July 2000 to June 2004. The study was conducted at an urban Level I trauma center and urban children's hospital. All patients treated with FabAV were included. Those who received no antivenom or who were treated with Antivenin (Crotalidae) Polyvalent were excluded. The main outcome variable was whether an acute hypersensitivity reaction developed. Ninety-three patients were included in the review (72 male and 21 female patients). The mean age was 34.5 years (range 16 months to 91 years), and the mean dose of antivenom was 12 vials (range 4 to 32 vials). The incidence of acute hypersensitivity reactions was 5 of 93, or 5.4%. Four patients developed a mild reaction that was easily treated and were able to finish the full course of antivenom. Only 1 patient developed a reaction that prevented further antivenom administration. FabAV appears to be associated with a lower incidence of acute hypersensitivity than initially reported. Most reactions are mild and easily treated and do not preclude further dosing of antivenom.

  6. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

    PubMed

    Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

    2017-12-11

    Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  7. Evaluation of mucosal adjuvants and immunization routes for the induction of systemic and mucosal humoral immune responses in macaques.

    PubMed

    Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J

    2015-01-01

    Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.

  8. The Role of the Immune Response in the Pathogenesis of Bronchiectasis.

    PubMed

    King, Paul T

    2018-01-01

    Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.

  9. A humoral immune response confers protection against Haemophilus ducreyi infection.

    PubMed

    Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H

    2003-12-01

    Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.

  10. Transcriptomic and Proteomic Analyses Reveal Key Innate Immune Signatures in the Host Response to the Gastrointestinal Pathogen Campylobacter concisus

    PubMed Central

    Deshpande, Nandan P.; Man, Si Ming; Burgos-Portugal, Jose A.; Khattak, Faisal A.; Raftery, Mark J.; Wilkins, Marc R.; Mitchell, Hazel M.

    2014-01-01

    Pathogenic species within the genus Campylobacter are responsible for a considerable burden on global health. Campylobacter concisus is an emergent pathogen that plays a role in acute and chronic gastrointestinal disease. Despite ongoing research on Campylobacter virulence mechanisms, little is known regarding the immunological profile of the host response to Campylobacter infection. In this study, we describe a comprehensive global profile of innate immune responses to C. concisus infection in differentiated THP-1 macrophages infected with an adherent and invasive strain of C. concisus. Using RNA sequencing (RNA-seq), quantitative PCR (qPCR), mass spectrometry, and confocal microscopy, we observed differential expression of pattern recognition receptors and robust upregulation of DNA- and RNA-sensing molecules. In particular, we observed IFI16 inflammasome assembly in C. concisus-infected macrophages. Global profiling of the transcriptome revealed the significant regulation of a total of 8,343 transcripts upon infection with C. concisus, which included the activation of key inflammatory pathways involving CREB1, NF-κB, STAT, and interferon regulatory factor signaling. Thirteen microRNAs and 333 noncoding RNAs were significantly regulated upon infection, including MIR221, which has been associated with colorectal carcinogenesis. This study represents a major advance in our understanding of host recognition and innate immune responses to infection by C. concisus. PMID:25486993

  11. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response.

    PubMed

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric

    2015-10-21

    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  12. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish.

    PubMed

    Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra

    2016-06-01

    Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.

  13. Maternal LAMP/p55gagHIV-1 DNA immunization induces in utero priming and a long-lasting immune response in vaccinated neonates.

    PubMed

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.

  14. Maternal LAMP/p55gagHIV-1 DNA Immunization Induces In Utero Priming and a Long-Lasting Immune Response in Vaccinated Neonates

    PubMed Central

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381

  15. Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection

    DTIC Science & Technology

    2000-01-01

    iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT

  16. How might infant and paediatric immune responses influence malaria vaccine efficacy?

    PubMed

    Moormann, A M

    2009-09-01

    Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.

  17. The Innate Immune System in Acute and Chronic Wounds

    PubMed Central

    MacLeod, Amanda S.; Mansbridge, Jonathan N.

    2016-01-01

    Significance: This review article provides an overview of the critical roles of the innate immune system to wound healing. It explores aspects of dysregulation of individual innate immune elements known to compromise wound repair and promote nonhealing wounds. Understanding the key mechanisms whereby wound healing fails will provide seed concepts for the development of new therapeutic approaches. Recent Advances: Our understanding of the complex interactions of the innate immune system in wound healing has significantly improved, particularly in our understanding of the role of antimicrobials and peptides and the nature of the switch from inflammatory to reparative processes. This takes place against an emerging understanding of the relationship between human cells and commensal bacteria in the skin. Critical Issues: It is well established and accepted that early local inflammatory mediators in the wound bed function as an immunological vehicle to facilitate immune cell infiltration and microbial clearance upon injury to the skin barrier. Both impaired and excessive innate immune responses can promote nonhealing wounds. It appears that the switch from the inflammatory to the proliferative phase is tightly regulated and mediated, at least in part, by a change in macrophages. Defining the factors that initiate the switch in such macrophage phenotypes and functions is the subject of multiple investigations. Future Directions: The review highlights processes that may be useful targets for further investigation, particularly the switch from M1 to M2 macrophages that appears to be critical as dysregulation of this switch occurs during defective wound healing. PMID:26862464

  18. Acquired immunity to amyloodiniosis is associated with an antibody response.

    PubMed

    Cobb, C S; Levy, M G; Noga, E J

    1998-10-08

    The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.

  19. Immunosuppressive activity of tilmicosin on the immune responses in mice.

    PubMed

    Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming

    2011-06-01

    Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.

  20. Reducing post-traumatic anxiety by immunization.

    PubMed

    Lewitus, Gil M; Cohen, Hagit; Schwartz, Michal

    2008-10-01

    Trafficking of T lymphocytes to specific organs, such as the skin and lungs, is part of the body's defense mechanism following acute psychological stress. Here we demonstrate that T lymphocytes are also trafficking to the brain in response to psychological stress and are needed to alleviate its negative behavioral consequences. We show that short exposure of mice to a stressor (predator odor) enhanced T-cell infiltration to the brain, especially to the choroid plexus, and that this infiltration was associated with increased ICAM-1 expression by choroid plexus cells. Systemic administration of corticosterone could mimic the effects of psychological stress on ICAM-1 expression. Furthermore, we found that the ability to cope with this stress is interrelated with T-cell trafficking and with the brain and hippocampal BDNF levels. Immunization with a CNS-related peptide reduced the stress-induced anxiety and the acoustic startle response, and restored levels of BDNF, shown to be important for stress resilience. These results identified T cells as novel players in coping with psychological stress, and offers immunization with a myelin-related peptide as a new therapeutic approach to alleviate chronic consequences of acute psychological trauma, such as those found in posttraumatic stress disorder.

  1. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    PubMed

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.

  2. Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani

    PubMed Central

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host

  3. Vaccination with a HSV-2 UL24 mutant induces a protective immune response in murine and guinea pig vaginal infection models.

    PubMed

    Visalli, Robert J; Natuk, Robert J; Kowalski, Jacek; Guo, Min; Blakeney, Susan; Gangolli, Seema; Cooper, David

    2014-03-10

    The rational design and development of genetically attenuated HSV-2 mutant viruses represent an attractive approach for developing both prophylactic and therapeutic vaccines for genital herpes. Previously, HSV-2 UL24 was shown to be a virulence determinant in both murine and guinea pig vaginal infection models. An UL24-βgluc insertion mutant produced syncytial plaques and replicated to nearly wild type levels in tissue culture, but induced little or no pathological effects in recipient mice or guinea pigs following vaginal infection. Here we report that immunization of mice or guinea pigs with high or low doses of UL24-βgluc elicited a highly protective immune response. UL24-βgluc immunization via the vaginal or intramuscular routes was demonstrated to protect mice from a lethal vaginal challenge with wild type HSV-2. Moreover, antigen re-stimulated splenic lymphocytes harvested from immunized mice exhibited both HSV-2 specific CTL activity and IFN-γ expression. Humoral anti-HSV-2 responses in serum were Th1-polarized (IgG2a>IgG1) and contained high-titer anti-HSV-2 neutralizing activity. Guinea pigs vaccinated subcutaneously with UL24-βgluc or the more virulent parental strain (186) were challenged with a heterologous HSV-2 strain (MS). Acute disease scores were nearly indistinguishable in guinea pigs immunized with either virus. Recurrent disease scores were reduced in UL24-βgluc immunized animals but not to the same extent as those immunized with strain 186. In addition, challenge virus was not detected in 75% of guinea pigs subcutaneously immunized with UL24-βgluc. In conclusion, disruption of the UL24 gene is a prime target for the development of a genetically attenuated live HSV-2 vaccine. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response

    PubMed Central

    Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.

    2013-01-01

    Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044

  5. Fasting suppresses T cell-mediated immunity in female Mongolian gerbils (Meriones unguiculatus).

    PubMed

    Xu, De-Li; Wang, De-Hua

    2010-01-01

    Immune defense is important for organisms' survival and fitness. Small mammals in temperate zone often face seasonal food shortages. Generally fasting can suppress immune function in laboratory rodents and little information is available for wild rodents. The present study tested the hypothesis that Mongolian gerbils (Meriones unguiculatus) could inhibit T cell-mediated immunity to adapt to acute fasting. Forty-two females were divided into the fed and fasted groups, in which the latter was deprived of food for 3days. After 66h fasting, half of the gerbils in each group were injected with phosphate buffered saline or phytohaemagglutinin (PHA) solution. T cell-mediated immunity assessed by PHA response was suppressed in the fasted gerbils compared with the fed gerbils. The fasted gerbils had lower body fat mass, wet and dry thymus mass, dry spleen mass, white blood cells, serum leptin and blood glucose concentrations, but higher corticosterone concentrations than those of the controls. Moreover, PHA response was positively correlated with body fat mass and serum leptin levels in the immunochallenged groups. Taken together, acute fasting leads to immunosuppression, which might be caused by low body fat mass and low serum leptin concentrations in female Mongolian gerbils.

  6. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  7. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  8. Ecosystem and immune systems: Hierarchial response provides resilience against invasions

    USGS Publications Warehouse

    Allen, Craig R.

    2001-01-01

    Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.

  9. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.

    PubMed

    Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori

    2017-11-04

    (1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  10. Suppression of secondary immune response by antilymphocyte serum: time relationship between immunization and administration of antilymphocyte serum.

    PubMed Central

    Reuben, C; Sundaram, K; Phondke, G P

    1979-01-01

    The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994

  11. Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.

    PubMed

    Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A

    2013-04-01

    A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.

  12. Bivalve immunity and response to infections: Are we looking at the right place?

    PubMed

    Allam, Bassem; Pales Espinosa, Emmanuelle

    2016-06-01

    Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Humoural immune response and pathological analysis in patients with false immune diagnosis of cystic echinococcosis

    PubMed Central

    Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S

    2014-01-01

    The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157

  14. A Recombinant HAV Expressing a Neutralization Epitope of HEV Induces Immune Response against HAV and HEV in Mice.

    PubMed

    Xiang, Kui; Kusov, Yuri; Ying, Guan; Yan, Wang; Shan, Yi; Jinyuan, Wu; Na, Yin; Yan, Zhou; Hongjun, Li; Maosheng, Sun

    2017-09-15

    Hepatitis A virus (HAV) and hepatitis E virus (HEV) are causative agents of acute viral hepatitis transmitted via the fecal-oral route. Both viruses place a heavy burden on the public health and economy of developing countries. To test the possibility that HAV could be used as an expression vector for the development of a combination vaccine against hepatitis A and E infections, recombinant HAV-HEp148 was created as a vector to express an HEV neutralization epitope (HEp148) located at aa 459-606 of the HEV capsid protein. The recombinant virus expressed the HEp148 protein in a partially dimerized state in HAV-susceptible cells. Immunization with the HAV-HEp148 virus induced a strong HAV- and HEV-specific immune response in mice. Thus, the present study demonstrates a novel approach to the development of a combined hepatitis A and E vaccine.

  15. A Recombinant HAV Expressing a Neutralization Epitope of HEV Induces Immune Response against HAV and HEV in Mice

    PubMed Central

    Kui, Xiang; Yuri, Kusov; Guan, Ying; Wang, Yan; Yi, Shan; Wu, Jinyuan; Yin, Na; Zhou, Yan; Li, Hongjun; Sun, Maosheng

    2017-01-01

    Hepatitis A virus (HAV) and hepatitis E virus (HEV) are causative agents of acute viral hepatitis transmitted via the fecal–oral route. Both viruses place a heavy burden on the public health and economy of developing countries. To test the possibility that HAV could be used as an expression vector for the development of a combination vaccine against hepatitis A and E infections, recombinant HAV-HEp148 was created as a vector to express an HEV neutralization epitope (HEp148) located at aa 459–606 of the HEV capsid protein. The recombinant virus expressed the HEp148 protein in a partially dimerized state in HAV-susceptible cells. Immunization with the HAV-HEp148 virus induced a strong HAV- and HEV-specific immune response in mice. Thus, the present study demonstrates a novel approach to the development of a combined hepatitis A and E vaccine. PMID:28914805

  16. How sex and age affect immune responses, susceptibility to infections, and response to vaccination

    PubMed Central

    Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix

    2015-01-01

    Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438

  17. Carotenoids, immune response and the expression of sexual ornaments in male greenfinches ( Carduelis chloris)

    NASA Astrophysics Data System (ADS)

    Aguilera, Eduardo; Amat, Juan A.

    2007-11-01

    Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.

  18. Interference of Aspergillus fumigatus with the immune response.

    PubMed

    Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A

    2015-03-01

    Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.

  19. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    PubMed

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  20. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*

    PubMed Central

    Zhang, Jie; Liu, Huan; Wei, Bin

    2017-01-01

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566

  1. Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes

    PubMed Central

    Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen

    2014-01-01

    Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463

  2. Antimicrobial autophagy: a conserved innate immune response in Drosophila.

    PubMed

    Moy, Ryan H; Cherry, Sara

    2013-01-01

    Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.

  3. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    PubMed Central

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979

  4. Molecular and cellular profiling of acute responses to total body radiation exposure in ovariectomized female cynomolgus macaques.

    PubMed

    DeBo, Ryne J; Register, Thomas C; Caudell, David L; Sempowski, Gregory D; Dugan, Gregory; Gray, Shauna; Owzar, Kouros; Jiang, Chen; Bourland, J Daniel; Chao, Nelson J; Cline, J Mark

    2015-06-01

    The threat of radiation exposure requires a mechanistic understanding of radiation-induced immune injury and recovery. The study objective was to evaluate responses to ionizing radiation in ovariectomized (surgically post-menopausal) female cynomolgus macaques. Animals received a single total-body irradiation (TBI) exposure at doses of 0, 2 or 5 Gy with scheduled necropsies at 5 days, 8 weeks and 24 weeks post-exposure. Blood and lymphoid tissues were evaluated for morphologic, cellular, and molecular responses. Irradiated animals developed symptoms of acute hematopoietic syndrome, and reductions in thymus weight, thymopoiesis, and bone marrow cellularity. Acute, transient increases in plasma monocyte chemoattractant protein 1 (MCP-1) were observed in 5 Gy animals along with dose-dependent alterations in messenger ribonucleic acid (mRNA) signatures in thymus, spleen, and lymph node. Expression of T cell markers was lower in thymus and spleen, while expression of macrophage marker CD68 (cluster of differentiation 68) was relatively elevated in lymphoid tissues from irradiated animals. Ovariectomized female macaques exposed to moderate doses of radiation experienced increased morbidity, including acute, dose-dependent alterations in systemic and tissue-specific biomarkers, and increased macrophage/T cell ratios. The effects on mortality exceeded expectations based on previous studies in males, warranting further investigation.

  5. The polyomavirus puzzle: is host immune response beneficial in controlling BK virus after adult hematopoietic cell transplantion?

    PubMed Central

    Satyanarayana, G.; Marty, F.M.; Tan, C.S.

    2014-01-01

    BK virus (BKV), an ubiquitous human polyomavirus, usually does not cause disease in healthy individuals. BKV reactivation and disease can occur in immunosuppressed individuals, such as those who have undergone renal transplantation or hematopoietic cell transplantation (HCT). Clinical manifestations of BKV disease include graft dysfunction and failure in renal transplant recipients; HCT recipients frequently experience hematuria, cystitis, hemorrhagic cystitis (HC), and renal dysfunction. Studies of HCT patients have identified several risk factors for the development of BKV disease including myeloablative conditioning, acute graft-versus-host disease, and undergoing an umbilical cord blood (uCB) HCT. Although these risk factors indicate that alterations in the immune system are necessary for BKV pathogenesis in HCT patients, few studies have examined the interactions between host immune responses and viral reactivation in BKV disease. Specifically, having BKV immunoglobulin-G before HCT does not protect against BKV infection and disease after HCT. A limited number of studies have demonstrated BKV- specific cytotoxic T-cells in healthy adults as well as in post-HCT patients who had experienced HC. New areas of research are required for a better understanding of this emerging infectious disease post HCT, including prospective studies examining BK viruria, viremia, and their relationship to clinical disease, a detailed analysis of urothelial histopathology, and laboratory evaluation of systemic and local cellular and humoral immune responses to BKV in patients receiving HCT from different sources, including uCB and haploidentical donors. PMID:24834968

  6. Kidney dendritic cells in acute and chronic renal disease.

    PubMed

    Hochheiser, Katharina; Tittel, André; Kurts, Christian

    2011-06-01

    Dendritic cells are not only the master regulators of adaptive immunity, but also participate profoundly in innate immune responses. Much has been learned about their basic immunological functions and their roles in various diseases. Comparatively little is still known about their role in renal disease, despite their obvious potential to affect immune responses in the kidney, and immune responses that are directed against renal components. Kidney dendritic cells form an abundant network in the renal tubulointerstitium and constantly survey the environment for signs of injury or infection, in order to alert the immune system to the need to initiate defensive action. Recent studies have identified a role for dendritic cells in several murine models of acute renal injury and chronic nephritis. Here we summarize the current knowledge on the role of kidney dendritic cells that has been obtained from the study of murine models of renal disease. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  7. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    PubMed

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  8. Stress-induced enhancement of leukocyte trafficking into sites of surgery or immune activation

    NASA Astrophysics Data System (ADS)

    Viswanathan, Kavitha; Dhabhar, Firdaus S.

    2005-04-01

    Effective immunoprotection requires rapid recruitment of leukocytes into sites of surgery, wounding, infection, or vaccination. In contrast to immunosuppressive chronic stressors, short-term acute stressors have immunoenhancing effects. Here, we quantify leukocyte infiltration within a surgical sponge to elucidate the kinetics, magnitude, subpopulation, and chemoattractant specificity of an acute stress-induced increase in leukocyte trafficking to a site of immune activation. Mice acutely stressed before sponge implantation showed 200-300% higher neutrophil, macrophage, natural killer cell, and T cell infiltration than did nonstressed animals. We also quantified the effects of acute stress on lymphotactin- (LTN; a predominantly lymphocyte-specific chemokine), and TNF-- (a proinflammatory cytokine) stimulated leukocyte infiltration. An additional stress-induced increase in infiltration was observed for neutrophils, in response to TNF-, macrophages, in response to TNF- and LTN, and natural killer cells and T cells in response to LTN. These results show that acute stress initially increases trafficking of all major leukocyte subpopulations to a site of immune activation. Tissue damage-, antigen-, or pathogen-driven chemoattractants subsequently determine which subpopulations are recruited more vigorously. Such stress-induced increases in leukocyte trafficking may enhance immunoprotection during surgery, vaccination, or infection, but may also exacerbate immunopathology during inflammatory (cardiovascular disease or gingivitis) or autoimmune (psoriasis, arthritis, or multiple sclerosis) diseases. chemokine | psychophysiological stress | surgical sponge | wound healing | lymphotactin

  9. Increased long-term immunity to Bacillus anthracis protective antigen in mice immunized with a CIA06B-adjuvanted anthrax vaccine.

    PubMed

    Wui, Seo Ri; Han, Ji Eun; Kim, Yeon Hee; Rhie, Gi-eun; Lee, Na Gyong

    2013-04-01

    Anthrax is an acute infectious disease caused by Bacillus anthracis. We previously reported that the adjuvant CIA06B, which consists of TLR4 agonist CIA05 and aluminum hydroxide (alum), enhanced the immune response to anthrax protective antigen (PA) in mice. This study was carried out to determine whether CIA06B can enhance long-term immune responses to PA in mice. BALB/c mice were immunized intramuscularly three times at 2-week intervals with recombinant PA alone or PA combined with alum or CIA06B. At 8 and 24 weeks post-immunization, the immunological responses including serum anti-PA IgG antibody titer, toxin-neutralizing antibody titer, splenic cytokine secretion and the frequency of PA-specific memory B cells were assessed. Compared with mice injected with PA alone or PA plus alum, mice injected with PA plus CIA06B had higher titers of serum anti-PA IgG antibodies, and higher frequencies of PA-specific memory B cells and interferon-γ secreting cells. Furthermore, anti-PA antibodies induced by CIA06B were more effective in neutralizing anthrax toxin. These results demonstrated that CIA06B is capable of providing long-term immunity when used as an adjuvant in a PA-based anthrax vaccine.

  10. Responses of innate immune cells to group A Streptococcus

    PubMed Central

    Fieber, Christina; Kovarik, Pavel

    2014-01-01

    Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020

  11. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy

    PubMed Central

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026

  12. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.

    PubMed

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.

  13. Comparison of the immune responses in BALB/c mice following immunization with DNA-based and live attenuated vaccines delivered via different routes.

    PubMed

    Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li

    2013-02-18

    The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions

    PubMed Central

    Glennon, Nicole B.; Jabado, Omar; Lo, Michael K.

    2015-01-01

    ABSTRACT Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. IMPORTANCE Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral

  15. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions.

    PubMed

    Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L

    2015-08-01

    Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research

  16. The impacts of invaders: basal and acute stress glucocorticoid profiles and immune function in native lizards threatened by invasive ants.

    PubMed

    Graham, Sean P; Freidenfelds, Nicole A; McCormick, Gail L; Langkilde, Tracy

    2012-05-01

    As anthropogenic stressors increase exponentially in the coming decades, native vertebrates will likely face increasing threats from these novel challenges. The success or failure of the primary physiological mediator of these stressors--the HPA axis--will likely involve numerous and chaotic outcomes. Among the most challenging of these new threats are invasive species. These have the capacity to simultaneously challenge the HPA axis and the immune system as they are often associated with, or the cause of, emerging infectious diseases, and energetic tradeoffs with the HPA response can have immunosuppressive effects. To determine the effects of invasive species on the vertebrate GC response to a novel stressor, and on immunity, we examined the effects of invasive fire ants on native lizards, comparing lizards from sites with long histories with fire ants to those outside the invasion zone. We demonstrated higher baseline and acute stress (captive restraint) CORT levels in lizards from within fire ant invaded areas; females are more strongly affected than males, suggesting context-specific effects of invasion. We found no effect of fire ant invasion on the immune parameters we measured (complement bacterial lysis and antibody hemagglutination) with the exception of ectoparasite infestation. Mites were far less prevalent on lizards within fire ant invaded sites, suggesting fire ants may actually benefit lizards in this regard. This study suggests that invasive species may impose physiological stress on native vertebrates, but that the consequences of this stress may be complicated and unpredictable. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Immune responses to implants - a review of the implications for the design of immunomodulatory biomaterials.

    PubMed

    Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C

    2011-10-01

    A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Deem, Michael

    2006-03-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.

  19. The acute-phase response impairs host defence against Enterococcus faecium peritonitis

    PubMed Central

    Leendertse, Masja; Willems, Rob J L; Giebelen, Ida A J; van den Pangaart, Petra S; Bonten, Marc J M; van der Poll, Tom

    2009-01-01

    Enterococcus faecium is an emerging pathogen that causes infections in hospitalized patients with various co-morbid diseases. These underlying diseases are often associated with an acute-phase response that renders patients vulnerable to nosocomial infections. To study the influence of the acute-phase response induced by sterile tissue injury on host defence against E. faecium, mice were injected subcutaneously with either turpentine or casein 1 day before intraperitoneal infection with E. faecium. Control mice were subcutaneously injected with saline or sodium bicarbonate, respectively. Turpentine and casein induced an acute-phase response as reflected by increases in the plasma concentrations of interleukin-6, serum amyloid P and C3. A pre-existent acute-phase response in mice was associated with a strongly reduced capacity to clear E. faecium, resulting in prolonged bacteraemia for several days. The inflammatory response to E. faecium was impaired in mice with an acute-phase response, as shown by reduced capacity to mount a neutrophilic leucocytosis in peripheral blood and by decreased local cytokine concentrations. These data indicate that the acute-phase response impairs host defence against E. faecium, suggesting that this condition may contribute to the increased vulnerability of critically ill patients to enterococcal infections. PMID:19175794

  20. Actinobacillus pleuropneumoniae Iron Transport and Urease Activity: Effects on Bacterial Virulence and Host Immune Response

    PubMed Central

    Baltes, Nina; Tonpitak, Walaiporn; Gerlach, Gerald-F.; Hennig-Pauka, Isabel; Hoffmann-Moujahid, Astrid; Ganter, Martin; Rothkötter, Hermann-J.

    2001-01-01

    Actinobacillus pleuropneumoniae, a porcine respiratory tract pathogen, has been shown to express transferrin-binding proteins and urease during infection. Both activities have been associated with virulence; however, their functional role for infection has not yet been elucidated. We used two isogenic A. pleuropneumoniae single mutants (ΔexbB and ΔureC) and a newly constructed A. pleuropneumoniae double (ΔureC ΔexbB) mutant in aerosol infection experiments. Neither the A. pleuropneumoniae ΔexbB mutant nor the double ΔureC ΔexbB mutant was able to colonize sufficiently long to initiate a detectable humoral immune response. These results imply that the ability to utilize transferrin-bound iron is required for multiplication and persistence of A. pleuropneumoniae in the porcine respiratory tract. The A. pleuropneumoniae ΔureC mutant and the parent strain both caused infections that were indistinguishable from one another in the acute phase of disease; however, 3 weeks postinfection the A. pleuropneumoniae ΔureC mutant, in contrast to the parent strain, could not be isolated from healthy lung tissue. In addition, the local immune response—as assessed by fluorescence-activated cell sorter and enzyme-linked immunosorbent spot analyses—revealed a significantly higher number of A. pleuropneumoniae-specific B cells in the bronchoalveolar lavage fluid (BALF) of pigs infected with the A. pleuropneumoniae ΔureC mutant than in the BALF of those infected with the parent strain. These results imply that A. pleuropneumoniae urease activity may cause sufficient impairment of the local immune response to slightly improve the persistence of the urease-positive A. pleuropneumoniae parent strain. PMID:11119539

  1. The nature of immune responses to urinary tract infections

    PubMed Central

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  2. RNA Editing, ADAR1, and the Innate Immune Response.

    PubMed

    Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy

    2017-01-18

    RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.

  3. Ubiquitination in the antiviral immune response.

    PubMed

    Davis, Meredith E; Gack, Michaela U

    2015-05-01

    Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  5. Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.

    PubMed

    Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura

    2011-10-13

    Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Immune responses of poultry to Newcastle disease virus.

    PubMed

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J

    2013-11-01

    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  7. Plant immunity: unravelling the complexity of plant responses to biotic stresses.

    PubMed

    Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne

    2017-03-01

    Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  8. Pulmonary immunity and extracellular matrix interactions.

    PubMed

    O'Dwyer, David N; Gurczynski, Stephen J; Moore, Bethany B

    2018-04-09

    The lung harbors a complex immune system composed of both innate and adaptive immune cells. Recognition of infection and injury by receptors on lung innate immune cells is crucial for generation of antigen-specific responses by adaptive immune cells. The extracellular matrix of the lung, comprising the interstitium and basement membrane, plays a key role in the regulation of these immune systems. The matrix consists of several hundred assembled proteins that interact to form a bioactive scaffold. This template, modified by enzymes, acts to facilitate cell function and differentiation and changes dynamically with age and lung disease. Herein, we explore relationships between innate and adaptive immunity and the lung extracellular matrix. We discuss the interactions between extracellular matrix proteins, including glycosaminoglycans, with prominent effects on innate immune signaling effectors such as toll-like receptors. We describe the relationship of extracellular matrix proteins with adaptive immunity and leukocyte migration to sites of injury within the lung. Further study of these interactions will lead to greater knowledge of the role of matrix biology in lung immunity. The development of novel therapies for acute and chronic lung disease is dependent on a comprehensive understanding of these complex matrix-immunity interactions. Copyright © 2017 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

  9. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

    PubMed Central

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-01-01

    BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

  10. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

    PubMed

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-12-01

    Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

  11. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    PubMed Central

    Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna

    2017-01-01

    Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are

  12. Inherent X-Linked Genetic Variability and Cellular Mosaicism Unique to Females Contribute to Sex-Related Differences in the Innate Immune Response.

    PubMed

    Spolarics, Zoltan; Peña, Geber; Qin, Yong; Donnelly, Robert J; Livingston, David H

    2017-01-01

    Females have a longer lifespan and better general health than males. Considerable number of studies also demonstrated that, after trauma and sepsis, females present better outcomes as compared to males indicating sex-related differences in the innate immune response. The current notion is that differences in the immuno-modulatory effects of sex hormones are the underlying causative mechanism. However, the field remains controversial and the exclusive role of sex hormones has been challenged. Here, we propose that polymorphic X-linked immune competent genes, which are abundant in the population are important players in sex-based immuno-modulation and play a key role in causing sex-related outcome differences following trauma or sepsis. We describe the differences in X chromosome (ChrX) regulation between males and females and its consequences in the context of common X-linked polymorphisms at the individual as well as population level. We also discuss the potential pathophysiological and immune-modulatory aspects of ChrX cellular mosaicism, which is unique to females and how this may contribute to sex-biased immune-modulation. The potential confounding effects of ChrX skewing of cell progenitors at the bone marrow is also presented together with aspects of acute trauma-induced de novo ChrX skewing at the periphery. In support of the hypothesis, novel observations indicating ChrX skewing in a female trauma cohort as well as case studies depicting the temporal relationship between trauma-induced cellular skewing and the clinical course are also described. Finally, we list and discuss a selected set of polymorphic X-linked genes, which are frequent in the population and have key regulatory or metabolic functions in the innate immune response and, therefore, are primary candidates for mediating sex-biased immune responses. We conclude that sex-related differences in a variety of disease processes including the innate inflammatory response to injury and infection may be

  13. Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.

    PubMed

    Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia

    2017-01-01

    During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.

  14. Characterization of the immune response to canine parvovirus induced by vaccination with chimaeric plant viruses.

    PubMed

    Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D

    2002-06-21

    NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.

  15. Effect of short-term, high-dose methylprednisolone on oxidative stress in children with acute immune thrombocytopenia.

    PubMed

    Cura, Musa; Koç, Ahmet; Aksoy, Nurten; Özdemir, Zeynep Canan

    2016-12-01

    Immune thrombocytopenia (ITP) is the most common cause of acquired childhood thrombocytopenia and is characterized by increased immune-mediated destruction of circulating thrombocytes. Oxidative damage may be involved in ITP pathogenesis; paraoxonase (PON) and arylesterase (ARE) enzymes are closely associated with the cellular antioxidant system. We investigated the effect of short-term high-dose methylprednisolone (HDMP) treatment on the total oxidant status (TOS), total antioxidant capacity (TAC), oxidative stress index (OSI), and PON and ARE enzymatic activity in children with acute ITP. Thirty children with acute ITP constituted the study group and 30 healthy children constituted the control group. Children with acute ITP were treated with HDMP: 30 mg/kg for 3 days, then 20 mg/kg for 4 days. The TOS, TAC, OSI, PON, and ARE levels were determined before and after 7 days of HDMP treatment. The TAC level ( P <0.001), and PON ( P <0.001) and ARE (P=0.001) activities were lower and the TOS ( P =0.003) and OSI ( P <0.001) levels were higher in children with acute ITP than those in healthy children in the control group. We also observed statistically significant increases in the TAC ( P <0.01), PON ( P <0.001) and ARE levels ( P =0.001) and decreases in the TOS ( P <0.05) and OSI levels ( P <0.05) with 7 days of HDMP treatment compared to their values before treatment. Our study demonstrated increased oxidative stress (OSI and TOC) and decreased antioxidant capacity (TAC), PON, and ARE in ITP patients and that steroid treatment could be effective in reducing the oxidative stress.

  16. Acquired immune response to oncogenic human papillomavirus associated with prophylactic cervical cancer vaccines.

    PubMed

    Einstein, Mark H

    2008-04-01

    Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.

  17. Difference in immune response in vaccinated and unvaccinated Swedish individuals after the 2009 influenza pandemic

    PubMed Central

    2014-01-01

    Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively

  18. Two Strategies for Response to 14°C Cold-Water Immersion: Is there a Difference in the Response of Motor, Cognitive, Immune and Stress Markers?

    PubMed Central

    Brazaitis, Marius; Eimantas, Nerijus; Daniuseviciute, Laura; Mickeviciene, Dalia; Steponaviciute, Rasa; Skurvydas, Albertas

    2014-01-01

    Here, we address the question of why some people have a greater chance of surviving and/or better resistance to cold-related-injuries in prolonged exposure to acute cold environments than do others, despite similar physical characteristics. The main aim of this study was to compare physiological and psychological reactions between people who exhibited fast cooling (FC; n = 20) or slow cooling (SC; n = 20) responses to cold water immersion. Individuals in whom the Tre decreased to a set point of 35.5°C before the end of the 170-min cooling time were indicated as the FC group; individuals in whom the Tre did not decrease to the set point of 35.5°C before the end of the 170-min cooling time were classified as the SC group. Cold stress was induced using intermittent immersion in bath water at 14°C. Motor (spinal and supraspinal reflexes, voluntary and electrically induced skeletal muscle contraction force) and cognitive (executive function, short term memory, short term spatial recognition) performance, immune variables (neutrophils, leucocytes, lymphocytes, monocytes, IL-6, TNF-α), markers of hypothalamic–pituitary–adrenal axis activity (cortisol, corticosterone) and autonomic nervous system activity (epinephrine, norepinephrine) were monitored. The data obtained in this study suggest that the response of the FC group to cooling vs the SC group response was more likely an insulative–hypothermic response and that the SC vs the FC group displayed a metabolic–insulative response. The observations that an exposure time to 14°C cold water—which was nearly twice as short (96-min vs 170-min) with a greater rectal temperature decrease (35.5°C vs 36.2°C) in the FC group compared with the SC group—induces similar responses of motor, cognitive, and blood stress markers were novel. The most important finding is that subjects with a lower cold-strain-index (SC group) showed stimulation of some markers of innate immunity and suppression of markers of

  19. Dissecting innate immune responses with the tools of systems biology.

    PubMed

    Smith, Kelly D; Bolouri, Hamid

    2005-02-01

    Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.

  20. Diet, exercise and gut mucosal immunity.

    PubMed

    Valdés-Ramos, Roxana; Martínez-Carrillo, Beatriz E; Aranda-González, Irma I; Guadarrama, Ana Laura; Pardo-Morales, Rosa Virgen; Tlatempa, Patricia; Jarillo-Luna, Rosa A

    2010-11-01

    Diet and exercise are primary strategies recommended for the control of the obesity epidemic. Considerable attention is being paid to the effect of both on the immune system. However, little research has been done on the effect of diet, nutrients or exercise on the mucosal immune system. The gastrointestinal tract (gut) is not only responsible for the entry of nutrients into the organism, but also for triggering the primary immune response to orally ingested antigens. The gut-associated lymphoid tissue contains a large amount of immune cells, disseminated all along the intestine in Peyer's patches and lamina propria. Specific nutrients or their combinations, as well as the microflora, are capable of modulating the immune system through cell activation, production of signalling molecules or gene expression. We have observed an increase in T-cells as well as a decrease in B-cells from Peyer's patches, induced by diets high in fats or carbohydrates in Balb/c mice. It has also been demonstrated that exercise modulates the immune system, where moderate levels may improve its function by increasing the proliferation of lymphocytes from various sites, including gut-associated lymphoid tissue, whereas exhaustive acute exercise may cause immunosuppression. High-fat diets combined with exercise are able to induce an increase in CD3+ lymphocytes due to increased CD8+ cells and a decrease in B-cells. Explanations and consequences of the effects of diet and exercise on the gut mucosal immunity are still being explored.