Science.gov

Sample records for acute murine cytomegalovirus

  1. Pathogenesis of acute murine cytomegalovirus infection in resistant and susceptible strains of mice.

    PubMed

    Mercer, J A; Spector, D H

    1986-02-01

    We have characterized the progress of acute murine cytomegalovirus (MCMV) infection in the spleen, liver, and salivary gland of susceptible (BALB/c) and resistant (C3H) strains of mice after intraperitoneal inoculation. Viral replication was analyzed by virus titration, infectious-center assays, and in situ cytohybridization with cloned subgenomic fragments of the MCMV genome. The most striking differences between strains were observed in the spleen. At 24 h postinfection (p.i.), both strains had a similar number of infected spleen cells. At 48 h p.i., BALB/c mice showed marked dissemination of the splenic infection which continued until 96 h p.i. In contrast, the number of infected C3H spleen cells did not increase from the 24-h level but declined later on. This early block in dissemination of MCMV infection in C3H mouse spleens was not a result of the H-2k haplotype, as BALB.K (H-2k) mice, which show an intermediate level of resistance to MCMV infection, exhibited dissemination of the infection between 24 and 48 h p.i., albeit at a reduced level. However, between 72 and 96 h p.i., we observed a decline in the number of infected spleen cells in BALB.K mice similar to that observed in C3H mice. We also demonstrated by Southern blot analysis of DNA from the infected spleen cells that the termini of the MCMV genome fuse after in vivo infection.

  2. Detection of murine cytomegalovirus DNA in circulating leukocytes harvested during acute infection of mice

    SciTech Connect

    Bale, J.F. Jr.; O'Neil, M.E. )

    1989-06-01

    The authors used virus assay and in situ hybridization with a cloned fragment of the murine cytomegalovirus (MCMV) genome to study MCMV infection of circulating leukocytes harvested from 3-week-old BALB/c, C57BL/6, and C3H mice infected with MCMV intraperitoneally. Infectious virus or MCMV DNA was detected in leukocytes on days 1 through 21 of infection in BALB/c mice and on days 3 through 7 in C57BL/6 mice. On days 5 and 7, MCMV DNA or infectious virus was detected in the leukocytes of 17 (94%) of 18 BALB/c mice and 10 (59%) of 17 C57BL/6 mice. In both strains infection peaked on days 5 and 7, when as many as 0.01 to 0.1% of the circulating leukocytes contained MCMV DNA. In C3H mice, however, infectious virus was rarely recovered from leukocyte fractions and MCMV DNA was detected in the circulating leukocytes of only one animal. Circulating leukocytes may have an important role in the dissemination of CMV infections in susceptible hosts.

  3. Acute cytomegalovirus (CMV) infection

    MedlinePlus

    CMV mononucleosis; Cytomegalovirus (CMV) ... Infection with cytomegalovirus (CMV) is very common. The infection is spread by: Blood transfusions Organ transplants Respiratory droplets Saliva Sexual contact ...

  4. Quantitative investigation of murine cytomegalovirus nucleocapsid interaction.

    PubMed

    Buser, Christopher; Fleischer, Frank; Mertens, Thomas; Michel, Detlef; Schmidt, Volker; Walther, Paul

    2007-10-01

    In this study, we quantitatively investigate the role of the M97 protein for viral morphogenesis in murine cytomegalovirus (MCMV)-infected fibroblast cells. For this purpose, a statistical analysis is performed for the spatial distribution of nuclear B-capsids (devoid of DNA, containing the scaffold) and C-capsids (filled with DNA). Cell nuclei infected with either wild-type or an M97 deletion mutant were compared. Univariate and multivariate point process characteristics (like Ripley's K-function, the L-function and the nearest neighbour distance distribution function) are investigated in order to describe and quantify the effects that the deletion of M97 causes to the process of DNA packaging into nucleocapsids. The estimation of the function L(r) -r reveals that with respect to the wild type there is an increased frequency of point pairs at a very short distance (less than approximately 100 nm) for both the B-capsids as well as for the C-capsids. For the M97 deletion mutant type this is no longer true. Here only the C-capsids show such a clustering behaviour, whereas for B-capsids it is almost nonexistant. Estimations of functionals such as the nearest neighbour distance distribution function confirmed these results. Thereby, a quantification is provided for the effect that the deletion of M97 leads to a loss of typical nucleocapsid clustering in MCMV-infected nuclei. PMID:17910700

  5. Comparison of serological tests for the detection of antibody to natural and experimental murine cytomegalovirus.

    PubMed

    Lussier, G; Guénette, D; Descôteaux, J P

    1987-04-01

    Three serological tests, i.e. complement fixation test, indirect immunofluorescent assay, and enzyme-linked immunosorbent assay (ELISA) were compared for sensitivity in the detection and titration of murine cytomegalovirus antibody. The three tests were compared using sera from experimentally inoculated and naturally infected mice bled at intervals from 3 to 140 days postinfection. In the acute infection, complement fixation and indirect immunofluorescent assay tests were of comparable sensitivity for early detection of antibody, whereas the ELISA was less sensitive. In persistent infection, higher titers were recorded with ELISA. Since murine cytomegalovirus has been shown to exert significant effects on the immune response of infected mice, this antigen should be included routinely in viral antibody screening programs.

  6. Lack of XBP-1 Impedes Murine Cytomegalovirus Gene Expression

    PubMed Central

    Drori, Adi; Messerle, Martin; Brune, Wolfram; Tirosh, Boaz

    2014-01-01

    The unfolded protein response (UPR) is an endoplasmic reticulum (ER)-to-nucleus signaling cascade induced in response to ER stress. The UPR aims at restoring homeostasis, but can also induce apoptosis if stress persists. Infection by human and murine cytomegaloviruses (CMVs) provokes ER stress and induces the UPR. However, both CMVs manipulate the UPR to promote its prosurvival activity and delay apoptosis. The underlying mechanisms remain largely unknown. Recently, we demonstrated that MCMV and HCMV encode a late protein to target IRE1 for degradation. However, the importance of its downstream effector, X Box binding protein 1 (XBP-1), has not been directly studied. Here we show that deletion of XBP-1 prior to or early after infection confers a transient delay in viral propagation in fibroblasts that can be overcome by increasing the viral dose. A similar phenotype was demonstrated in peritoneal macrophages. In vivo, acute infection by MCMV is reduced in the absence of XBP-1. Our data indicate that removal of XBP-1 confers a kinetic delay in early stages of MCMV infection and suggest that the late targeting of IRE1 is aimed at inhibiting activities other than the splicing of XBP-1 mRNA. PMID:25333725

  7. Thrombosis associated with acute cytomegalovirus infection: a narrative review

    PubMed Central

    Sherman, Shany; Eytan, Ori

    2014-01-01

    Thrombosis associated with acute cytomegalovirus infection has been reported many times in the literature since the mid 1980s – mainly in case reports and in small case series, but also in four controlled studies. Still, many physicians are unaware of this association although acute cytomegalovirus infection diagnosis in a thrombosis patient may warrant antiviral therapy and may affect anticoagulation therapy duration. Accordingly, the clinical characteristics of patients with thrombosis and acute cytomegalovirus infection are reviewed, and the current knowledge concerning this unique association is presented herein. We believe it is time to add acute cytomegalovirus infection to the list of thrombosis triggers. PMID:25624857

  8. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  9. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-12-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  10. Murine cytomegalovirus resistant to antivirals has genetic correlates with human cytomegalovirus.

    PubMed

    Scott, G M; Ng, H-L; Morton, C J; Parker, M W; Rawlinson, W D

    2005-08-01

    Human cytomegalovirus (HCMV) resistance to antivirals is a significant clinical problem. Murine cytomegalovirus (MCMV) infection of mice is a well-described animal model for in vivo studies of CMV pathogenesis, although the mechanisms of MCMV antiviral susceptibility need elucidation. Mutants resistant to nucleoside analogues aciclovir, adefovir, cidofovir, ganciclovir, penciclovir and valaciclovir, and the pyrophosphate analogue foscarnet were generated by in vitro passage of MCMV (Smith) in increasing concentrations of antiviral. All MCMV antiviral resistant mutants contained DNA polymerase mutations identical or similar to HCMV DNA polymerase mutations known to confer antiviral resistance. Mapping of the mutations onto an MCMV DNA polymerase three-dimensional model generated using the Thermococcus gorgonarius Tgo polymerase crystal structure showed that the DNA polymerase mutations potentially confer resistance through changes in regions surrounding a catalytic aspartate triad. The ganciclovir-, penciclovir- and valaciclovir-resistant isolates also contained mutations within MCMV M97 identical or similar to recognized GCV-resistant mutations of HCMV UL97 protein kinase, and demonstrated cross-resistance to antivirals of the same class. This strongly suggests that MCMV M97 has a similar role to HCMV UL97 in the phosphorylation of nucleoside analogue antivirals. All MCMV mutants demonstrated replication-impaired phenotypes, with the lowest titre and plaque size observed for isolates containing mutations in both DNA polymerase and M97. These findings indicate DNA polymerase and protein kinase regions of potential importance for antiviral susceptibility and replication. The similarities between MCMV and HCMV mutations that arise under antiviral selective pressure increase the utility of MCMV as a model for in vivo studies of CMV antiviral resistance. PMID:16033961

  11. Murine Cytomegalovirus Exploits Olfaction To Enter New Hosts

    PubMed Central

    Farrell, Helen E.; Lawler, Clara; Tan, Cindy S. E.; MacDonald, Kate; Bruce, Kimberley; Mach, Michael; Davis-Poynter, Nick

    2016-01-01

    ABSTRACT   Viruses transmit via the environmental and social interactions of their hosts. Herpesviruses have colonized mammals since their earliest origins, suggesting that they exploit ancient, common pathways. Cytomegaloviruses (CMVs) are assumed to enter new hosts orally, but no site has been identified. We show by live imaging that murine CMV (MCMV) infects nasally rather than orally, both after experimental virus uptake and during natural transmission. Replication-deficient virions revealed the primary target as olfactory neurons. Local, nasal replication by wild-type MCMV was not extensive, but there was rapid systemic spread, associated with macrophage infection. A long-term, transmissible infection was then maintained in the salivary glands. The viral m131/m129 chemokine homolog, which influences tropism, promoted salivary gland colonization after nasal entry but was not required for entry per se. The capacity of MCMV to transmit via olfaction, together with previous demonstrations of experimental olfactory infection by murid herpesvirus 4 (MuHV-4) and herpes simplex virus 1 (HSV-1), suggest that this is a common, conserved route of mammalian herpesvirus entry. PMID:27118588

  12. Natural killer cells regulate murine cytomegalovirus-induced sialadenitis and salivary gland disease.

    PubMed

    Carroll, Virginia A; Lundgren, Alyssa; Wei, Hairong; Sainz, Susan; Tung, Kenneth S; Brown, Michael G

    2012-02-01

    The transmission of herpesviruses depends on viral shedding at mucosal surfaces. The salivary gland represents a major site of persistent viral replication for many viruses, including cytomegalovirus. We established a mouse model of salivary gland dysfunction after acute viral infection and investigated the cellular requirements for the loss of secretion. Murine cytomegalovirus (MCMV) infection severely impaired saliva secretion independently of salivary gland virus levels. Lymphocytes or circulating monocytes/macrophages were not required for secretory dysfunction. Dysfunction occurred before glandular inflammation, suggesting that a soluble mediator initiated the disruption of acinar cell function. Despite genetic differences in innate resistance to MCMV, NK cells protected the host against acinar atrophy and the loss of secretions under conditions of an exceedingly low virus inoculum. NK cells also modulated the type of glandular inflammation after infection, as they prevented an influx of Siglec-F(+) polymorphonuclear leukocytes (PMNs). Therefore, beyond their recognized role in controlling MCMV replication, NK cells preserve organ integrity and function and regulate the innate inflammatory response within the gland.

  13. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model

    PubMed Central

    Slavuljica, Irena; Kveštak, Daria; Csaba Huszthy, Peter; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-01-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8+ T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed. PMID:25042632

  14. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model.

    PubMed

    Slavuljica, Irena; Kveštak, Daria; Huszthy, Peter Csaba; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-03-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8(+) T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed.

  15. Alveolar Macrophages Are a Prominent but Nonessential Target for Murine Cytomegalovirus Infecting the Lungs

    PubMed Central

    Farrell, Helen E.; Lawler, Clara; Oliveira, Martha T.; Davis-Poynter, Nick

    2015-01-01

    ABSTRACT Cytomegaloviruses (CMVs) infect the lungs and cause pathological damage there in immunocompromised hosts. How lung infection starts is unknown. Inhaled murine CMV (MCMV) directly infected alveolar macrophages (AMs) and type 2 alveolar epithelial cells (AEC2s) but not type 1 alveolar epithelial cells (AEC1s). In contrast, herpes simplex virus 1 infected AEC1s and murid herpesvirus 4 (MuHV-4) infected AEC1s via AMs. MCMV-infected AMs prominently expressed viral reporter genes from a human CMV IE1 promoter; but most IE1-positive cells were AEC2s, and CD11c-cre mice, which express cre in AMs, switched the fluorochrome expression of <5% of floxed MCMV in the lungs. In contrast, CD11C-cre mice exhibited fluorochrome switching in >90% of floxed MuHV-4 in the lungs and 50% of floxed MCMV in the blood. AM depletion increased MCMV titers in the lung during the acute phase of infection. Thus, the influence of AMs was more restrictive than permissive. Circulating monocytes entered infected lungs in large numbers and became infected, but not directly; infection occurred mainly via AEC2s. Mice infected with an MCMV mutant lacking its m131/m129 chemokine homolog, which promotes macrophage infection, showed levels of lung infection equivalent to those of wild-type MCMV-infected mice. The level of lung infiltration by Gr-1-positive cells infected with the MCMV m131/m129-null mutant was modestly different from that for wild-type MCMV-infected lungs. These results are consistent with myeloid cells mainly disseminating MCMV from the lungs, whereas AEC2s provide local amplification. IMPORTANCE Cytomegaloviruses (CMVs) chronically and systemically infect most mammals. Human CMV infection is usually asymptomatic but causes lung disease in people with poor immune function. As human infection is hard to analyze, studies with related animal viruses provide important insights. We show that murine CMV has two targets in the lungs: macrophages and surfactant-secreting epithelial cells

  16. Stability Determinants of Murine Cytomegalovirus Long Noncoding RNA7.2

    PubMed Central

    Schwarz, Toni M.

    2014-01-01

    Cytomegalovirus is a ubiquitous herpesvirus that persistently replicates in glandular epithelial tissue. Murine cytomegalovirus expresses a 7.2-kb-long noncoding RNA (RNA7.2) that is a determinant of viral persistence in the salivary gland. RNA7.2 is an extremely long-lived intron, yet the basis of its stability is unknown. We present data that localize key sequence determinants of RNA stability to the 3′ end of RNA7.2 and suggest that stability is a result of sustained lariat conformation. PMID:25056884

  17. Mechanism of tumor remission by cytomegalovirus in a murine lymphoma model: evidence for involvement of virally induced cellular interleukin-15.

    PubMed

    Erlach, Katja C; Reddehase, Matthias J; Podlech, Jürgen

    2015-06-01

    A murine model of B and T cell lymphomas in recipients after hematoablative conditioning for hematopoietic cell transplantation (HCT) has previously revealed a tumor-repressive, metastasis-inhibiting function of murine cytomegalovirus (mCMV). More recently, this prediction from the experimental model was put on trial in several clinical studies that indeed gave evidence for a lower incidence of tumor relapse associated with early reactivation of latent human cytomegalovirus (hCMV) after allogeneic HCT in patients treated against different types of hematopoietic malignancies, including lymphoma and acute as well as chronic leukemias. Due to the limitations inherent to clinical studies, the tumor-repressive role of hCMV remained observational with no approach to clarify mechanisms. Although the tumor-repressive mechanisms of mCMV and hCMV may differ and depend on the type of tumor, experimental approaches in the murine model might give valuable hints for concepts to follow in clinical research. We have previously shown for the liver-adapted A20-derived B cell lymphoma E12E that mCMV does not infect the lymphoma cells for causing cell death by viral cytopathogenicity but triggers tumor-selective apoptosis at a tissue site of tumor metastasis distant from a local site of infection. This finding suggested involvement of a cytokine that triggers apoptosis, directly or indirectly. Here we used a series of differential high-density microarray analyses to identify cellular genes whose expression is specifically upregulated at the site of virus entry only by viruses capable of triggering lymphoma cell apoptosis. This strategy identified interleukin-15 (IL-15) as most promising candidate, eventually confirmed by lymphoma repression with recombinant IL-15. PMID:25805565

  18. Lipschütz acute vulval ulcers associated with primary cytomegalovirus infection.

    PubMed

    Martín, José M; Godoy, Rosa; Calduch, Luis; Villalon, Guillermo; Jordá, Esperanza

    2008-01-01

    A previously healthy 16-year-old girl presented with painful acute genital ulcers that appeared in the context of a primary cytomegalovirus infection. Complementary examinations ruled out both venereal disease and other usual causes of genital ulcerations, and the lesions resolved in < 2 weeks with no sequelae or later recurrences. Cytomegalovirus disease should be considered in the screening of acute vulval ulcers.

  19. Replication of Murine Cytomegalovirus in Differentiated Macrophages as a Determinant of Viral Pathogenesis

    PubMed Central

    Hanson, Laura K.; Slater, Jacquelyn S.; Karabekian, Zaruhi; Virgin, Herbert W.; Biron, Christine A.; Ruzek, Melanie C.; van Rooijen, Nico; Ciavarra, Richard P.; Stenberg, Richard M.; Campbell, Ann E.

    1999-01-01

    Blood monocytes or tissue macrophages play a pivotal role in the pathogenesis of murine cytomegalovirus (MCMV) infection, providing functions beneficial to both the virus and the host. In vitro and in vivo studies have indicated that differentiated macrophages support MCMV replication, are target cells for MCMV infection within tissues, and harbor latent MCMV DNA. However, this cell type presumably initiates early, antiviral immune responses as well. In addressing this paradoxical role of macrophages, we provide evidence that the proficiency of MCMV replication in macrophages positively correlates with virulence in vivo. An MCMV mutant from which the open reading frames M139, M140, and M141 had been deleted (RV10) was defective in its ability to replicate in macrophages in vitro and was highly attenuated for growth in vivo. However, depletion of splenic macrophages significantly enhanced, rather than deterred, replication of both wild-type (WT) virus and RV10 in the spleen. The ability of RV10 to replicate in intact or macrophage-depleted spleens was independent of cytokine production, as this mutant virus was a poor inducer of cytokines compared to WT virus in both intact organs and macrophage-depleted organs. Macrophages were, however, a major contributor to the production of tumor necrosis factor alpha and gamma interferon in response to WT virus infection. Thus, the data indicate that tissue macrophages serve a net protective role and may function as “filters” in protecting other highly permissive cell types from MCMV infection. The magnitude of virus replication in tissue macrophages may dictate the amount of virus accessible to the other cells. Concomitantly, infection of this cell type initiates the production of antiviral immune responses to guarantee efficient clearance of acute MCMV infection. PMID:10364349

  20. The murine cytomegalovirus (MCMV) homolog of the HCMV phosphotransferase (UL97(pk)) gene.

    PubMed

    Rawlinson, W D; Zeng, F; Farrell, H E; Cunningham, A L; Scalzo, A A; Booth, T W; Scott, G M

    1997-07-01

    The murine cytomegalovirus (MCMV) M97 gene is homologous with both eukaryotic protein kinases and the phosphotransferases of herpesviruses. The gene conserves the domain structure of protein kinases and of the human cytomegalovirus UL97 (phosphotransferase) gene. An M97 transcript of 2.5 kb is present predominantly at late times, and much smaller quantities of the transcript are detected at early times postinfection. Comparison of the DNA sequences of the complete M97 genes from 12 ganciclovir-sensitive and aciclovir-sensitive strains of MCMV showed that the sensitive isolates strongly conserve the sequence of the catalytic domains, but have only moderate conservation of the sequence of the amino-terminal (regulatory) region. MCMV provides a useful model for studying the in vivo function of the phosphotransferase genes of the betatherpesviruses and has potential for use in studies of antiviral resistance. PMID:9217058

  1. Determinants of the source of cytomegalovirus in murine renal allograft recipients.

    PubMed

    Klotman, M E; Henry, S C; Hamilton, J D

    1987-11-01

    Cytomegalovirus is present in a latent state in renal allografts and may be reactivated in recipients. While human and murine strains are alike in that a primary infection occurs in seronegative recipients of a kidney from a seropositive donor, they may differ when the recipient is seropositive. In a murine transplant model, superinfection of a seropositive recipient with a second strain is unusual. Reports in human transplantation indicate that superinfection of a seropositive recipient does occur, however the frequency is unknown. Our studies examine the potential importance of specific viral strains in host and recipient, the contribution of prior humoral immunity in the recipient, and the technical ability to identify distinctive strains of virus in the presence of each other. Our results indicate that reversal of the viral strains in donor or recipient animals does not alter our previous observation that reactivation of the endogenous recipient viral strain predominates as the infecting strain in the posttransplant period. Further, the presence of antibody in nearly all donors and recipients confirms that all animals were originally infected prior to transplantation. Finally, we demonstrated the technical ability to detect one virus in the presence of the other, thus excluding this variable as possibly confounding. We conclude that the endogenous, latent recipient strain of cytomegalovirus in the murine model is preferentially reactivated in the posttransplant interval.

  2. Temporal Profiling of the Coding and Noncoding Murine Cytomegalovirus Transcriptomes▿†

    PubMed Central

    Lacaze, Paul; Forster, Thorsten; Ross, Alan; Kerr, Lorraine E.; Salvo-Chirnside, Eliane; Lisnic, Vanda Juranic; López-Campos, Guillermo H.; García-Ramírez, José J.; Messerle, Martin; Trgovcich, Joanne; Angulo, Ana; Ghazal, Peter

    2011-01-01

    The global transcriptional program of murine cytomegalovirus (MCMV), involving coding, noncoding, and antisense transcription, remains unknown. Here we report an oligonucleotide custom microarray platform capable of measuring both coding and noncoding transcription on a genome-wide scale. By profiling MCMV wild-type and immediate-early mutant strains in fibroblasts, we found rapid activation of the transcriptome by 6.5 h postinfection, with absolute dependency on ie3, but not ie1 or ie2, for genomic programming of viral gene expression. Evidence is also presented to show, for the first time, genome-wide noncoding and bidirectional transcription at late stages of MCMV infection. PMID:21471238

  3. Acute appendicitis due to Cytomegalovirus in an apparently immunocompetent patient: a case report

    PubMed Central

    2014-01-01

    Introduction In healthy subjects, Cytomegalovirus infection can be asymptomatic or manifest as mononucleosis syndrome, but organ disease has also been reported. However, in immunocompromised patients this infection can lead to its most significant and severe disease and even mortality. When Cytomegalovirus causes a gastrointestinal tract infection, it more commonly manifests with luminal tract disease and is usually characterized by ulcerative lesions. Appendicitis is a rare manifestation, and has been reported mainly in human immunodeficiency virus-infected patients or patients with other causes of immunocompromise. Case presentation The authors report on a case of acute primary Cytomegalovirus infection complicated with acute appendicitis due to Cytomegalovirus in an apparently immunocompetent 24-year-old Caucasian man also suffering from primary sclerosing cholangitis and ulcerative colitis. Diagnosis was based on clinical manifestations, serology results, as well as microbiological and histological findings. Treatment consisted of surgery and anti-Cytomegalovirus therapy. Conclusions Cytomegalovirus should be included among the etiologic agents of acute appendicitis in patients with primary sclerosing cholangitis and ulcerative colitis. Currently, there are no definitive data regarding the frequency of Cytomegalovirus appendicitis and the role of anti-Cytomegalovirus treatment in human immunodeficiency virus-negative and apparently immunocompetent subjects. PMID:24612821

  4. Investigation of the impact of the common animal facility contaminant murine norovirus on experimental murine cytomegalovirus infection.

    PubMed

    Doom, Carmen M; Turula, Holly M; Hill, Ann B

    2009-09-30

    Murine norovirus (MNV) is a recently discovered pathogen that has become a common contaminant of specific pathogen-free mouse colonies. MNV-1 induces a robust interferon-beta response and causes histopathology in some mouse strains, suggesting that it may impact other mouse models of infection. Despite many concerns about MNV-1 contamination, there is little information about its impact on immune responses to other infections. This study addresses whether MNV-1 infection has an effect on a model of murine cytomegalovirus (MCMV) infection. Exposure to MNV-1 resulted in a decreased CD8 T cell response to immunodominant MCMV epitopes in both BALB/c and C57BL/6 mice. However, MNV-1 did not impact MCMV titers in either mouse strain, nor did it stimulate reactivation of latent MCMV. These data suggest that while MNV-1 has a mild impact on the immune response to MCMV, it is not likely to affect most experimental outcomes in immunocompetent mice in the MCMV model.

  5. Role of Murine Cytomegalovirus US22 Gene Family Members in Replication in Macrophages

    PubMed Central

    Ménard, Carine; Wagner, Markus; Ruzsics, Zsolt; Holak, Karina; Brune, Wolfram; Campbell, Ann E.; Koszinowski, Ulrich H.

    2003-01-01

    The large cytomegalovirus (CMV) US22 gene family, found in all betaherpesviruses, comprises 12 members in both human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV). Conserved sequence motifs suggested a common ancestry and related functions for these gene products. Two members of this family, m140 and m141, were recently shown to affect MCMV replication on macrophages. To test the role of all US22 members in cell tropism, we analyzed the growth properties in different cell types of MCMV mutants carrying transposon insertions in all 12 US22 gene family members. When necessary, additional targeted mutants with gene deletions, ATG deletions, and ectopic gene revertants were constructed. Mutants with disruption of genes M23, M24, m25.1, m25.2, and m128 (ie2) showed no obvious growth phenotype, whereas growth of M43 mutants was reduced in a number of cell lines. Genes m142 and m143 were shown to be essential for virus replication. Growth of mutants with insertions into genes M36, m139, m140, and m141 in macrophages was severely affected. The common phenotype of the m139, m140, and m141 mutants was explained by an interaction at the protein level. The M36-dependent macrophage growth phenotype could be explained by the antiapoptotic function of the gene that was required for growth on macrophages but not for growth on other cell types. Together, the comprehensive set of mutants of the US22 gene family suggests that individual family members have diverged through evolution to serve a variety of functions for the virus. PMID:12719548

  6. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.

    PubMed

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  7. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  8. Murine cytomegalovirus protein pM79 is a key regulator for viral late transcription.

    PubMed

    Chapa, Travis J; Johnson, L Steven; Affolter, Christopher; Valentine, Mark C; Fehr, Anthony R; Yokoyama, Wayne M; Yu, Dong

    2013-08-01

    Herpesvirus genes are temporally expressed during permissive infections, but how their expression is regulated at late times is poorly understood. Previous studies indicate that the human cytomegalovirus (CMV) gene, UL79, is required for late gene expression. However, the mechanism remains to be fully elucidated, and UL79 homologues in other CMVs have not been studied. Here, we characterized the role of the conserved murine CMV (MCMV) gene M79. We showed that M79 encoded a protein (pM79) which was expressed with early-late kinetics and localized to nuclear viral replication compartments. M79 transcription was significantly decreased in the absence of viral DNA synthesis but markedly stimulated by pM79. To investigate its role, we created the recombinant virus SMin79, in which pM79 expression was disrupted. While marker-rescued virus grew efficiently in fibroblasts, SMin79 failed to produce infectious progeny but was rescued by pM79 expression in trans. During SMin79 infection, representative viral immediate-early and early gene products as well as viral DNA accumulated sufficiently. Formation of viral replication compartments also appeared normal. Pulsed-field gel electrophoresis analysis indicated that the overall structure of replicating viral DNA was indistinguishable between wild-type and SMin79 infection. Viral tiled array and quantitative PCR analysis revealed that many late transcripts sensitive to a viral DNA synthesis inhibitor (phosphonoacetic acid) were markedly reduced by pM79 mutation. This study indicates that cytomegaloviruses use a conserved mechanism to promote transcription at late stages of infection and that pM79 is a critical regulator for at least a subset of viral DNA synthesis-dependent transcripts. PMID:23760242

  9. Priming of immature thymocytes to CD3-mediated apoptosis by infection with murine cytomegalovirus.

    PubMed Central

    Koga, Y; Tanaka, K; Lu, Y Y; Oh-Tsu, M; Sasaki, M; Kimura, G; Nomoto, K

    1994-01-01

    Cytomegalovirus (CMV) causes severe clinical manifestations in immunocompromised hosts; however, it remains unclear whether the virus itself is a cause of immunosuppression or whether it is involved as an opportunistic bystander pathogen. This study was performed to elucidate the effect of CMV infection on the host's immune system. The double-positive thymocytes of BALB/c mice inoculated with a sublethal dose of murine CMV (MCMV) were extensively depleted by a 10-micrograms amount of anti-CD3 monoclonal antibody, while such an amount was unable to induce any apparent elimination of thymocytes in noninfected mice. In immature thymocytes of infected hosts, a markedly high level of susceptibility to apoptosis induction was found on treatment with anti-CD3 monoclonal antibody. Analysis of the signal transduction pathway of such double-positive thymocytes demonstrated a profound elevation of the intracellular Ca2+ level after anti-CD3 stimulation, implying that this aberrant mobilization of Ca2+ plays a crucial role in the signaling pathway leading these cells to an extensive apoptosis. Examination of the thymus by PCR was able to detect a low copy number of MCMV DNAs in thymic stromal cells but none at all in thymocytes. Therefore, it is suggested that a mechanism which is not associated with virus replication within the cells exerts a critical effect on rendering the thymocytes highly apoptosis sensitive in hosts infected with MCMV. Images PMID:8207807

  10. Evaluation of continuous cell lines in antiviral studies with murine cytomegalovirus.

    PubMed

    Smee, D F; Colletti, A; Alaghamandan, H A; Allen, L B

    1989-01-01

    Cell culture systems were developed for rapid antiviral drug screening, using murine cytomegalovirus (MCMV) as an alternative to the slower growing human CMV. Since previous assay methods with MCMV employed mouse embryo fibroblasts (MEF cells), which are labor intensive to prepare and die off after 3-4 passages from primary culture, identification of virus-susceptible continuous cell lines was desirable. Three cell lines were found useful for assaying MCMV: C127I, SC-1, and 3T3. The antiviral agents acyclovir, ganciclovir, 5-fluoroarabinofuranosylcytosine, and 2'-fluoro-2'-deoxy-5-iodoarabinofuranosylcytosine were evaluated in the 3 continuous cell lines and in MEF cells. The 50% virus- or cell-inhibitory concentration values determined for each compound did not vary much from cell to cell. MEF cells were 10-fold more sensitive than the other cell lines to quantify virus from mouse organs, however. Virus propagated in 3T3 and SC-1 cells were as virulent to mice as salivary gland virus, whereas virus from MEF and C127I cells was more attenuated. Overall, C127I cells were judged to be the best for large scale antiviral screening in vitro, but MEF was the cell type of choice for titration of viruses from mouse organs and tissues.

  11. Murine Cytomegalovirus Capsid Assembly Is Dependent on US22 Family Gene M140 in Infected Macrophages▿

    PubMed Central

    Hanson, Laura K.; Slater, Jacquelyn S.; Cavanaugh, Victoria J.; Newcomb, William W.; Bolin, Lisa L.; Nelson, Christine N.; Fetters, Lisa D.; Tang, Qiyi; Brown, Jay C.; Maul, Gerd G.; Campbell, Ann E.

    2009-01-01

    Macrophages are an important target cell for infection with cytomegalovirus (CMV). A number of viral genes that either are expressed specifically in this cell type or function to optimize CMV replication in this host cell have now been identified. Among these is the murine CMV (MCMV) US22 gene family member M140, a nonessential early gene whose deletion (RVΔ140) leads to significant impairment in virus replication in differentiated macrophages. We have now determined that the defect in replication is at the stage of viral DNA encapsidation. Although the rate of RVΔ140 genome replication and extent of DNA cleavage were comparable to those for revertant virus, deletion of M140 resulted in a significant reduction in the number of viral capsids in the nucleus, and the viral DNA remained sensitive to DNase treatment. These data are indicative of incomplete virion assembly. Steady-state levels of both the major capsid protein (M86) and tegument protein M25 were reduced in the absence of the M140 protein (pM140). This effect may be related to the localization of pM140 to an aggresome-like, microtubule organizing center-associated structure that is known to target misfolded and overexpressed proteins for degradation. It appears, therefore, that pM140 indirectly influences MCMV capsid formation in differentiated macrophages by regulating the stability of viral structural proteins. PMID:19458005

  12. Murine cytomegalovirus stimulates natural killer cell function but kills genetically resistant mice treated with radioactive strontium

    SciTech Connect

    Masuda, A.; Bennett, M.

    1981-12-01

    Treatment of C3H/St mice with 100 microCi of 89Sr weakened their genetic resistance to murine cytomegalovirus (MCMV) infection. The criteria utilized to detect increased susceptibility were: (i) survival of mice; (ii) numbers of MCMV-infected cells in the spleens and liver; and (iii) serum glutamic pyruvic transaminase levels. The natural killer (NK) cell activity of spleen cells from mice treated with 89Sr is very low. However, the NK activities of spleen cells of both normal and 89Sr-treated mice were greatly augmented 3 days after infection with MCMV. These NK cells lysed a variety of tumor cells and shared several features with conventional NK cells, but were not lysed by anti-Nk-1.2 serum (specific for NK cells) plus complement. Splenic adherent cells did not lyse tumor cells themselves but were necessary for the stimulation of NK cells by MCMV. The paradox of high NK cell function and poor survival in 89Sr-treated mice infected with MCMV was a surprise. We conclude that these augmented NK cells, of themselves, cannot account for the genetic resistance of C3H/St mice to infection with MCMV.

  13. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    SciTech Connect

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.

    2006-01-01

    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  14. Nitric oxide mediates murine cytomegalovirus-associated pneumonitis in lungs that are free of the virus.

    PubMed Central

    Tanaka, K; Nakazawa, H; Okada, K; Umezawa, K; Fukuyama, N; Koga, Y

    1997-01-01

    4 wk after intraperitoneal inoculation of 0.2 LD50 (50% lethal dose) of murine cytomegalovirus (MCMV) in adult BALB/c mice, MCMV remained detectable in the salivary glands, but not in the lungs or other organs. When the T cells of these mice were activated in vivo by a single injection of anti-CD3 monoclonal antibody, interstitial pneumonitis was induced in the lungs that were free of the virus with an excessive production of the cytokines. In the lungs of such mice persistently infected with MCMV, the mRNA of the cytokines such as IL-2, IL-6, TNF-alpha, and IFN-gamma were abundantly expressed 3 h after the anti-CD3 injection, and the elevated levels continued thereafter. A marked expression of inducible nitric oxide synthetase (iNOS) was then noted in the lungs, suggesting that such cytokines as TNF-alpha and IFN-gamma may have induced iNOS. Although the increase in NO formation was demonstrated by the significant elevation of the serum levels of nitrite and nitrate, the interstitial pneumonitis was not associated with either increased superoxide formation or peroxynitrite-induced tyrosine nitration. Nevertheless, the administration of an NO antagonist also alleviated the interstitial pneumonitis provoked by anti-CD3 mAb. Based on these findings, it was concluded that MCMV-associated pneumonitis is mediated by a molecule of cytokine-induced NO other than peroxynitrite. PMID:9312183

  15. Effective Inhibition of Kb- and Db-Restricted Antigen Presentation in Primary Macrophages by Murine Cytomegalovirus

    PubMed Central

    LoPiccolo, Diane M.; Gold, Marielle C.; Kavanagh, Daniel G.; Wagner, Markus; Koszinowski, Ulrich H.; Hill, Ann B.

    2003-01-01

    Macrophages play an important role in murine cytomegalovirus (MCMV) infection in vivo, both in disseminating infection and in harboring latent virus. MCMV encodes three immune evasion genes (m4, m6, and m152) that interfere with the ability of cytotoxic T cells (CTL) to detect virus-infected fibroblasts, but the efficacy of immune evasion in macrophages has been controversial. Here we show that MCMV immune evasion genes function in H-2b primary bone marrow macrophages (BMMφ) in the same way that they do in fibroblasts. Metabolic labeling experiments showed that class I is retained in the endoplasmic reticulum by MCMV infection and associates with m4/gp34 to a similar extent in fibroblasts and BMMφ. We tested a series of Kb- and Db-restricted CTL clones specific for MCMV early genes against a panel of MCMV wild-type virus and mutants lacking m152, m4, or m6. MCMV immune evasion genes effectively inhibited antigen presentation. m152 appeared sufficient to abolish Db-restricted presentation in infected macrophages, as has been previously observed in infected fibroblasts. However, for inhibition of recognition of infected macrophages by Kb-restricted CTL, m4, m6, and m152 were all required. The contribution of m4 to inhibition of recognition appeared much more important in macrophages than in fibroblasts. Thus, MCMV immune evasion genes function effectively in primary macrophages to prevent CTL recognition of early antigens and show the same pattern of major histocompatibility complex class I allele discrimination as is seen in fibroblasts. Furthermore, for inhibition of Kb-restricted presentation, a strong synergistic effect was noted among m152, m4, and m6. PMID:12477835

  16. Macrophage activation associated with chronic murine cytomegalovirus infection results in more severe experimental choroidal neovascularization.

    PubMed

    Cousins, Scott W; Espinosa-Heidmann, Diego G; Miller, Daniel M; Pereira-Simon, Simone; Hernandez, Eleut P; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  17. Macrophage Activation Associated with Chronic Murine Cytomegalovirus Infection Results in More Severe Experimental Choroidal Neovascularization

    PubMed Central

    Cousins, Scott W.; Espinosa-Heidmann, Diego G.; Miller, Daniel M.; Pereira-Simon, Simone; Hernandez, Eleut P.; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D.

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  18. The murine cytomegalovirus immunoevasin gp40 binds MHC class I molecules to retain them in the early secretory pathway.

    PubMed

    Janßen, Linda; Ramnarayan, Venkat Raman; Aboelmagd, Mohamed; Iliopoulou, Maro; Hein, Zeynep; Majoul, Irina; Fritzsche, Susanne; Halenius, Anne; Springer, Sebastian

    2016-01-01

    In the presence of the murine cytomegalovirus (mCMV) gp40 (m152) protein, murine major histocompatibility complex (MHC) class I molecules do not reach the cell surface but are retained in an early compartment of the secretory pathway. We find that gp40 does not impair the folding or high-affinity peptide binding of the class I molecules but binds to them, leading to their retention in the endoplasmic reticulum (ER), the ER-Golgi intermediate compartment (ERGIC) and the cis-Golgi, most likely by retrieval from the cis-Golgi to the ER. We identify a sequence in gp40 that is required for both its own retention in the early secretory pathway and for that of class I molecules.

  19. Propagation and titration of murine cytomegalovirus in a continuous bone marrow-derived stromal cell line (M2-10B4).

    PubMed

    Lutarewych, M A; Quirk, M R; Kringstad, B A; Li, W; Verfaillie, C M; Jordan, M C

    1997-11-01

    Murine cytomegalovirus (MCMV) can only be propagated effectively in mouse embryo fibroblast (MEF) cells. We demonstrate that MCMV replicates significantly better in M2-10B4 cells, a continuous line of murine bone marrow stromal cells. M2-10B4 cells were also comparable to MEF cells for detection of small amounts of MCMV reactivating from latently infected spleen explants. M2-10B4 cells will be very useful for studies of MCMV pathogenesis.

  20. Identification, analysis, and evolutionary relationships of the putative murine cytomegalovirus homologs of the human cytomegalovirus UL82 (pp71) and UL83 (pp65) matrix phosphoproteins.

    PubMed Central

    Cranmer, L D; Clark, C L; Morello, C S; Farrell, H E; Rawlinson, W D; Spector, D H

    1996-01-01

    We have identified three open reading frames (ORFs) in murine cytomegalovirus (MCMV), designated M82, M83, and M84, which likely encode homologs of the human cytomegalovirus (HCMV) UL82 and UL83 matrix phosphoproteins. These ORFs, in the HindIII C fragment of MCMV, are colinear with the UL82, UL83, and UL84 ORFs of HCMV. M82 encodes a 598-amino-acid (aa) protein with homology to UL82, M83 encodes an 809-aa protein with homology to UL82 and UL83, and M84 encodes a 587-aa protein with homology to UL83 and UL84. Analysis of transcription by Northern (RNA) blotting indicated that the M82 and M83 ORFs are transcribed as 2.2- and 5-kb mRNAs, respectively, at 24 to 48 h postinfection (p.i.), while M84 is transcribed as a 6.9-kb mRNA only at 8 h p.i. All transcripts appear to terminate at the same position 3' of the M82 ORF. Of the products of the three ORFs, only M83 is strongly recognized by hyperimmune mouse serum. The M83 protein is a virion-associated phosphoprotein with an apparent molecular mass of 125 kDa. In MCMV-infected cells, it is detectable by Western blotting (immunoblotting) only at 48 h p.i. in the absence of phosphonoacetic acid, consistent with late gene expression. The M83 ORF is also expressed at high levels in cells infected by a recombinant vaccinia virus and yields a protein which is serologically cross-reactive and comigrates with the authentic MCMV protein in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PMID:8892916

  1. Dual Analysis of the Murine Cytomegalovirus and Host Cell Transcriptomes Reveal New Aspects of the Virus-Host Cell Interface

    PubMed Central

    Juranic Lisnic, Vanda; Babic Cac, Marina; Lisnic, Berislav; Trsan, Tihana; Mefferd, Adam; Das Mukhopadhyay, Chitrangada; Cook, Charles H.; Jonjic, Stipan; Trgovcich, Joanne

    2013-01-01

    Major gaps in our knowledge of pathogen genes and how these gene products interact with host gene products to cause disease represent a major obstacle to progress in vaccine and antiviral drug development for the herpesviruses. To begin to bridge these gaps, we conducted a dual analysis of Murine Cytomegalovirus (MCMV) and host cell transcriptomes during lytic infection. We analyzed the MCMV transcriptome during lytic infection using both classical cDNA cloning and sequencing of viral transcripts and next generation sequencing of transcripts (RNA-Seq). We also investigated the host transcriptome using RNA-Seq combined with differential gene expression analysis, biological pathway analysis, and gene ontology analysis. We identify numerous novel spliced and unspliced transcripts of MCMV. Unexpectedly, the most abundantly transcribed viral genes are of unknown function. We found that the most abundant viral transcript, recently identified as a noncoding RNA regulating cellular microRNAs, also codes for a novel protein. To our knowledge, this is the first viral transcript that functions both as a noncoding RNA and an mRNA. We also report that lytic infection elicits a profound cellular response in fibroblasts. Highly upregulated and induced host genes included those involved in inflammation and immunity, but also many unexpected transcription factors and host genes related to development and differentiation. Many top downregulated and repressed genes are associated with functions whose roles in infection are obscure, including host long intergenic noncoding RNAs, antisense RNAs or small nucleolar RNAs. Correspondingly, many differentially expressed genes cluster in biological pathways that may shed new light on cytomegalovirus pathogenesis. Together, these findings provide new insights into the molecular warfare at the virus-host interface and suggest new areas of research to advance the understanding and treatment of cytomegalovirus-associated diseases. PMID:24086132

  2. Knockout of the Host Resistance Gene Pkr Fully Restores Replication of Murine Cytomegalovirus m142 and m143 Mutants In Vivo

    PubMed Central

    Ostermann, Eleonore; Warnecke, Gabriele; Waibler, Zoe

    2015-01-01

    Murine cytomegalovirus (MCMV) proteins m142 and m143 are essential for viral replication. They bind double-stranded RNA and prevent protein kinase R-induced protein synthesis shutoff. Whether the two viral proteins have additional functions such as their homologs in human cytomegalovirus do remained unknown. We show that MCMV m142 and m143 knockout mutants attain organ titers equivalent to those attained by wild-type MCMV in Pkr knockout mice, suggesting that these viral proteins do not encode additional PKR-independent functions relevant for pathogenesis in vivo. PMID:26512090

  3. Mast cells expedite control of pulmonary murine cytomegalovirus infection by enhancing the recruitment of protective CD8 T cells to the lungs.

    PubMed

    Ebert, Stefan; Becker, Marc; Lemmermann, Niels A W; Büttner, Julia K; Michel, Anastasija; Taube, Christian; Podlech, Jürgen; Böhm, Verena; Freitag, Kirsten; Thomas, Doris; Holtappels, Rafaela; Reddehase, Matthias J; Stassen, Michael

    2014-04-01

    The lungs are a noted predilection site of acute, latent, and reactivated cytomegalovirus (CMV) infections. Interstitial pneumonia is the most dreaded manifestation of CMV disease in the immunocompromised host, whereas in the immunocompetent host lung-infiltrating CD8 T cells confine the infection in nodular inflammatory foci and prevent viral pathology. By using murine CMV infection as a model, we provide evidence for a critical role of mast cells (MC) in the recruitment of protective CD8 T cells to the lungs. Systemic infection triggered degranulation selectively in infected MC. The viral activation of MC was associated with a wave of CC chemokine ligand 5 (CCL5) in the serum of C57BL/6 mice that was MC-derived as verified by infection of MC-deficient Kit(W-sh/W-sh) "sash" mutants. In these mutants, CD8 T cells were recruited less efficiently to the lungs, correlating with enhanced viral replication and delayed virus clearance. A causative role for MC was verified by MC reconstitution of "sash" mice restoring both, efficient CD8 T-cell recruitment and infection control. These results reveal a novel crosstalk axis between innate and adaptive immune defense against CMV, and identify MC as a hitherto unconsidered player in the immune surveillance at a relevant site of CMV disease. PMID:24763809

  4. Late-phase expression of a murine cytomegalovirus immediate-early antigen recognized by cytolytic T lymphocytes.

    PubMed Central

    Reddehase, M J; Fibi, M R; Keil, G M; Koszinowski, U H

    1986-01-01

    The cloned murine cytolytic T-lymphocyte line IE1-IL and several sublines detect a murine cytomegalovirus immediate-early (IE) membrane determinant in conjunction with Ld class I major histocompatibility glycoprotein. The lines retained cytolytic activity, strict antigen specificity, and self-restriction even when adapted to long-term, antigen-independent growth in the presence of interleukin-2 only (M. J. Reddehase, H.-J. Bühring, and U. H. Koszinowski, J. Virol. 57:408-412). These attributes allowed us to use IE1-IL as a stable, monospecific probe for tracing the expression of the IE membrane antigen throughout the viral replication cycle. Presentation of the antigen at the cell membrane proved to be most effective when expression of IE genes in infected mouse embryo fibroblasts was selectively enhanced by consecutive cycloheximide-actinomycin D treatment, whereas without enhancement high numbers of IE1-IL cytolytic T lymphocytes were required to demonstrate the antigen in the IE phase. In the early phase of infection when IE genes were no longer transcribed, cytolysis was not observed, although IE proteins were detectable in the nuclei of the infected cells. Without application of inhibitors IE membrane antigen expression was most prominent during the late phase of infection. Reinitiation of transcription from the genomic region encoding the major IE protein (pp89) and de novo synthesis of pp89 correlated with this reexpression of the IE membrane antigen. Images PMID:2431160

  5. Murine Cytomegalovirus Virion-Associated Protein M45 Mediates Rapid NF-κB Activation after Infection

    PubMed Central

    Krause, Eva; de Graaf, Miranda; Fliss, Patricia M.; Dölken, Lars

    2014-01-01

    ABSTRACT Murine cytomegalovirus (MCMV) rapidly induces activation of nuclear factor κB (NF-κB) upon infection of host cells. After a transient phase of activation, the MCMV M45 protein blocks all canonical NF-κB-activating pathways by inducing the degradation of the gamma subunit of the inhibitor of κB kinase complex (IKKγ; commonly referred to as the NF-κB essential modulator [NEMO]). Here we show that the viral M45 protein also mediates rapid NF-κB activation immediately after infection. MCMV mutants lacking M45 or expressing C-terminally truncated M45 proteins induced neither NF-κB activation nor transcription of NF-κB-dependent genes within the first 3 h of infection. Rapid NF-κB activation was absent in MCMV-infected NEMO-deficient fibroblasts, indicating that activation occurs at or upstream of the IKK complex. NF-κB activation was strongly reduced in murine fibroblasts lacking receptor-interacting protein 1 (RIP1), a known M45-interacting protein, but was restored upon complementation with murine RIP1. However, the ability of M45 to interact with RIP1 and NEMO was not sufficient to induce NF-κB activation upon infection. In addition, incorporation of the M45 protein into virions was required. This was dependent on a C-terminal region of M45, which is not required for interaction with RIP1 and NEMO. We propose a model in which M45 delivered by viral particles activates NF-κB, presumably involving an interaction with RIP1 and NEMO. Later in infection, expression of M45 induces the degradation of NEMO and the shutdown of canonical NF-κB activation. IMPORTANCE Transcription factor NF-κB is an important regulator of innate and adaptive immunity. Its activation can be beneficial or detrimental for viral pathogens. Therefore, many viruses interfere with NF-κB signaling by stimulating or inhibiting the activation of this transcription factor. Cytomegaloviruses, opportunistic pathogens that cause lifelong infections in their hosts, activate NF

  6. Osteopontin Is Upregulated in Human and Murine Acute Schistosomiasis Mansoni

    PubMed Central

    Pereira, Thiago Almeida; Syn, Wing-Kin; Amâncio, Frederico Figueiredo; Cunha, Pedro Henrique Diniz; Caporali, Julia Fonseca Morais; Trindade, Guilherme Vaz de Melo; Santos, Elisângela Trindade; Souza, Márcia Maria; Andrade, Zilton Araújo; Witek, Rafal P; Secor, William Evan; Pereira, Fausto Edmundo Lima; Lambertucci, José Roberto; Diehl, Anna Mae

    2016-01-01

    Background Symptomatic acute schistosomiasis mansoni is a systemic hypersensitivity reaction against the migrating schistosomula and mature eggs after a primary infection. The mechanisms involved in the pathogenesis of acute schistosomiasis are not fully elucidated. Osteopontin has been implicated in granulomatous reactions and in acute hepatic injury. Our aims were to evaluate if osteopontin plays a role in acute Schistosoma mansoni infection in both human and experimentally infected mice and if circulating OPN levels could be a novel biomarker of this infection. Methodology/Principal Findings Serum/plasma osteopontin levels were measured by ELISA in patients with acute (n = 28), hepatointestinal (n = 26), hepatosplenic (n = 39) schistosomiasis and in uninfected controls (n = 21). Liver osteopontin was assessed by immunohistochemistry in needle biopsies of 5 patients. Sera and hepatic osteopontin were quantified in the murine model of schistosomiasis mansoni during acute (7 and 8 weeks post infection, n = 10) and chronic (30 weeks post infection, n = 8) phase. Circulating osteopontin levels are increased in patients with acute schistosomiasis (p = 0.0001). The highest levels of OPN were observed during the peak of clinical symptoms (7–11 weeks post infection), returning to baseline level once the granulomas were modulated (>12 weeks post infection). The plasma levels in acute schistosomiasis were even higher than in hepatosplenic patients. The murine model mirrored the human disease. Macrophages were the major source of OPN in human and murine acute schistosomiasis, while the ductular reaction maintains OPN production in hepatosplenic disease. Soluble egg antigens from S. mansoni induced OPN expression in primary human kupffer cells. Conclusions/Significance S. mansoni egg antigens induce the production of OPN by macrophages in the necrotic-exudative granulomas characteristic of acute schistosomiasis mansoni. Circulating OPN levels are upregulated in human and

  7. Complex Formation among Murine Cytomegalovirus US22 Proteins Encoded by Genes M139, M140, and M141

    PubMed Central

    Karabekian, Zaruhi; Hanson, Laura K.; Slater, Jacquelyn S.; Krishna, Neel K.; Bolin, Lisa L.; Kerry, Julie A.; Campbell, Ann E.

    2005-01-01

    The murine cytomegalovirus (MCMV) proteins encoded by US22 genes M139, M140, and M141 function, at least in part, to regulate replication of this virus in macrophages. Mutant MCMV having one or more of these genes deleted replicates poorly in macrophages in culture and in the macrophage-dense environment of the spleen. In this report, we demonstrate the existence of stable complexes formed by the products of all three of these US22 genes, as well as a complex composed of the products of M140 and M141. These complexes form in the absence of other viral proteins; however, the pM140/pM141 complex serves as a requisite binding partner for the M139 gene products. Products from all three genes colocalize to a perinuclear region of the cell juxtaposed to or within the cis-Golgi region but excluded from the trans-Golgi region. Interestingly, expression of pM141 redirects pM140 from its predominantly nuclear residence to the perinuclear, cytoplasmic locale where these US22 proteins apparently exist in complex. Thus, complexing of these nonessential, early MCMV proteins likely confers a function(s) independent of each individual protein and important for optimal replication of MCMV in its natural host. PMID:15731247

  8. The roles of tumour necrosis factor-alpha, interleukin-1 and interleukin-12 in murine cytomegalovirus infection.

    PubMed Central

    Yerkovich, S T; Olver, S D; Lenzo, J C; Peacock, C D; Price, P

    1997-01-01

    The roles of the inflammatory cytokines tumour necrosis factor-alpha (TNF-alpha), interleukin-1 (IL-1) and IL-12, in murine cytomegalovirus (MCMV) disease were investigated in susceptible BALB/c and resistant C57BL/6 mice. MCMV infection induced IL-1 and TNF-alpha production by peritoneal cells from BALB/c mice, as demonstrated previously in C57BL/6 mice. Overt ill-health and viral replication in the spleens of BALB/c mice were increased by in vivo treatment with soluble TNF-alpha receptors to inhibit the activity of this cytokine, whilst antibodies to IL-12 had a similar but more restricted effect C57BL/6 mice were not affected by either treatment, suggesting TNF-alpha and IL-12 are not critical for natural killer cell-mediated restriction of viral replication in the spleen. Soluble TNF-alpha receptors and antibodies to IL-12 also enhanced MCMV titres and numbers of viral antigen-positive cells in the livers of BALB/c mice and TNF-alpha receptors have similar effects in C57BL/6 livers. In contrast, IL-1 receptors improved the health of MCMV-infected BALB/c mice and reduced viral replication and hepatitis at some time-points. Mechanisms which may underlie these changes are discussed. PMID:9203964

  9. γδ T Cells Confer Protection against Murine Cytomegalovirus (MCMV)

    PubMed Central

    Villacreces, Arnaud; Juzan, Marina; Rousseau, Benoît; Dulanto, Sara; Giese, Alban; Costet, Pierre; Praloran, Vincent; Moreau, Jean-François; Dubus, Pierre; Vermijlen, David

    2015-01-01

    Cytomegalovirus (CMV) is a leading infectious cause of morbidity in immune-compromised patients. γδ T cells have been involved in the response to CMV but their role in protection has not been firmly established and their dependency on other lymphocytes has not been addressed. Using C57BL/6 αβ and/or γδ T cell-deficient mice, we here show that γδ T cells are as competent as αβ T cells to protect mice from CMV-induced death. γδ T cell-mediated protection involved control of viral load and prevented organ damage. γδ T cell recovery by bone marrow transplant or adoptive transfer experiments rescued CD3ε−/− mice from CMV-induced death confirming the protective antiviral role of γδ T cells. As observed in humans, different γδ T cell subsets were induced upon CMV challenge, which differentiated into effector memory cells. This response was observed in the liver and lungs and implicated both CD27+ and CD27− γδ T cells. NK cells were the largely preponderant producers of IFNγ and cytotoxic granules throughout the infection, suggesting that the protective role of γδ T cells did not principally rely on either of these two functions. Finally, γδ T cells were strikingly sufficient to fully protect Rag−/−γc−/− mice from death, demonstrating that they can act in the absence of B and NK cells. Altogether our results uncover an autonomous protective antiviral function of γδ T cells, and open new perspectives for the characterization of a non classical mode of action which should foster the design of new γδ T cell based therapies, especially useful in αβ T cell compromised patients. PMID:25747674

  10. γδ T cells confer protection against murine cytomegalovirus (MCMV).

    PubMed

    Khairallah, Camille; Netzer, Sonia; Villacreces, Arnaud; Juzan, Marina; Rousseau, Benoît; Dulanto, Sara; Giese, Alban; Costet, Pierre; Praloran, Vincent; Moreau, Jean-François; Dubus, Pierre; Vermijlen, David; Déchanet-Merville, Julie; Capone, Myriam

    2015-03-01

    Cytomegalovirus (CMV) is a leading infectious cause of morbidity in immune-compromised patients. γδ T cells have been involved in the response to CMV but their role in protection has not been firmly established and their dependency on other lymphocytes has not been addressed. Using C57BL/6 αβ and/or γδ T cell-deficient mice, we here show that γδ T cells are as competent as αβ T cells to protect mice from CMV-induced death. γδ T cell-mediated protection involved control of viral load and prevented organ damage. γδ T cell recovery by bone marrow transplant or adoptive transfer experiments rescued CD3ε-/- mice from CMV-induced death confirming the protective antiviral role of γδ T cells. As observed in humans, different γδ T cell subsets were induced upon CMV challenge, which differentiated into effector memory cells. This response was observed in the liver and lungs and implicated both CD27+ and CD27- γδ T cells. NK cells were the largely preponderant producers of IFNγ and cytotoxic granules throughout the infection, suggesting that the protective role of γδ T cells did not principally rely on either of these two functions. Finally, γδ T cells were strikingly sufficient to fully protect Rag-/-γc-/- mice from death, demonstrating that they can act in the absence of B and NK cells. Altogether our results uncover an autonomous protective antiviral function of γδ T cells, and open new perspectives for the characterization of a non classical mode of action which should foster the design of new γδ T cell based therapies, especially useful in αβ T cell compromised patients.

  11. Murine cytomegalovirus with a deletion of genes spanning HindIII-J and -I displays altered cell and tissue tropism.

    PubMed

    Cavanaugh, V J; Stenberg, R M; Staley, T L; Virgin, H W; MacDonald, M R; Paetzold, S; Farrell, H E; Rawlinson, W D; Campbell, A E

    1996-03-01

    Murine cytomegalovirus (MCMV) gene products dispensable for growth in cell culture are likely to have important functions within the infected host, influencing tissue tropism, dissemination, or immunological responses against the virus. To identify such genes, our strategy was to delete large regions of the MCMV genome likely to contain genes nonessential for virus replication in NIH 3T3 cells. Mutant virus RV7 contained a deletion of 7.7 kb spanning portions of MCMV HindIII-J and -I. This virus grew comparably to wild-type (WT) virus in NIH 3T3 fibroblasts, primary embryo fibroblasts, and bone marrow macrophages. However, RV7 failed to replicate in target organs of immunocompetent BALB/c mice and severe combined immunodeficient mice, which are exquisitely sensitive to MCMV infection. This defect in vivo growth may be related to the observation that RV7 grew poorly in the peritoneal macrophage cell line IC-21, which is highly permissive for growth of WT MCMV. Two other mutant viruses with an insertion or smaller deletion in the region common to the RV7 deletion grew comparably to WT virus in the macrophage cell line and replicated in salivary gland tissue. The poor growth of RV7 in IC-21 cells was due to a block in immediate-early gene expression, as levels of RNA from immediate-early gene IE1 were reduced eightfold compared with levels for WT virus in macrophages infected with RV7. Consequently, levels of RNA from early and late genes were also reduced. The lower expression of IE1 in RV7-infected IC-21 macrophages was not due to defective entry of virus into the cells, as equal amounts of viral DNA were present in cells 3 h after infection with RV7 or WT MCMV. These studies demonstrate that deletion of sequences in HindIII-J and -I confer altered cell and tissue tropism. PMID:8627652

  12. Murine cytomegalovirus with a deletion of genes spanning HindIII-J and -I displays altered cell and tissue tropism.

    PubMed Central

    Cavanaugh, V J; Stenberg, R M; Staley, T L; Virgin, H W; MacDonald, M R; Paetzold, S; Farrell, H E; Rawlinson, W D; Campbell, A E

    1996-01-01

    Murine cytomegalovirus (MCMV) gene products dispensable for growth in cell culture are likely to have important functions within the infected host, influencing tissue tropism, dissemination, or immunological responses against the virus. To identify such genes, our strategy was to delete large regions of the MCMV genome likely to contain genes nonessential for virus replication in NIH 3T3 cells. Mutant virus RV7 contained a deletion of 7.7 kb spanning portions of MCMV HindIII-J and -I. This virus grew comparably to wild-type (WT) virus in NIH 3T3 fibroblasts, primary embryo fibroblasts, and bone marrow macrophages. However, RV7 failed to replicate in target organs of immunocompetent BALB/c mice and severe combined immunodeficient mice, which are exquisitely sensitive to MCMV infection. This defect in vivo growth may be related to the observation that RV7 grew poorly in the peritoneal macrophage cell line IC-21, which is highly permissive for growth of WT MCMV. Two other mutant viruses with an insertion or smaller deletion in the region common to the RV7 deletion grew comparably to WT virus in the macrophage cell line and replicated in salivary gland tissue. The poor growth of RV7 in IC-21 cells was due to a block in immediate-early gene expression, as levels of RNA from immediate-early gene IE1 were reduced eightfold compared with levels for WT virus in macrophages infected with RV7. Consequently, levels of RNA from early and late genes were also reduced. The lower expression of IE1 in RV7-infected IC-21 macrophages was not due to defective entry of virus into the cells, as equal amounts of viral DNA were present in cells 3 h after infection with RV7 or WT MCMV. These studies demonstrate that deletion of sequences in HindIII-J and -I confer altered cell and tissue tropism. PMID:8627652

  13. Specific Inhibition of the PKR-Mediated Antiviral Response by the Murine Cytomegalovirus Proteins m142 and m143▿

    PubMed Central

    Budt, Matthias; Niederstadt, Lars; Valchanova , Ralitsa S.; Jonjić, Stipan; Brune, Wolfram

    2009-01-01

    Double-stranded RNA (dsRNA) produced during viral infection activates several cellular antiviral responses. Among the best characterized is the shutoff of protein synthesis mediated by the dsRNA-dependent protein kinase (PKR) and the oligoadenylate synthetase (OAS)/RNase L system. As viral replication depends on protein synthesis, many viruses have evolved mechanisms for counteracting the PKR and OAS/RNase L pathways. The murine cytomegalovirus (MCMV) proteins m142 and m143 have been characterized as dsRNA binding proteins that inhibit PKR activation, phosphorylation of the translation initiation factor eIF2α, and a subsequent protein synthesis shutoff. In the present study we analyzed the contribution of the PKR- and the OAS-dependent pathways to the control of MCMV replication in the absence or presence of m142 and m143. We show that the induction of eIF2α phosphorylation during infection with an m142- and m143-deficient MCMV is specifically mediated by PKR, not by the related eIF2α kinases PERK or GCN2. PKR antagonists of vaccinia virus (E3L) or herpes simplex virus (γ34.5) rescued the replication defect of an MCMV strain with deletions of both m142 and m143. Moreover, m142 and m143 bound to each other and interacted with PKR. By contrast, an activation of the OAS/RNase L pathway by MCMV was not detected in the presence or absence of m142 and m143, suggesting that these viral proteins have little or no influence on this pathway. Consistently, an m142- and m143-deficient MCMV strain replicated to high titers in fibroblasts lacking PKR but did not replicate in cells lacking RNase L. Hence, the PKR-mediated antiviral response is responsible for the essentiality of m142 and m143. PMID:19019949

  14. The effect of cytomegalovirus infection on acute rejection in kidney transplanted patients

    PubMed Central

    Hasanzamani, Boshra; Hami, Maryam; Zolfaghari, Vajihe; Torkamani, Mahtab; Ghorban Sabagh, Mahin; Ahmadi Simab, Saiideh

    2016-01-01

    Introduction: It is known that cytomegalovirus (CMV) infection is a common problem among kidney transplant patients. This infection can be increased morbidity and decreased graft survival. This problem has been associated with acute rejection too. Patients and Methods: One hundred and thirty renal transplant patients were included in a prospective, case-control study. The renal transplant patients were divided into two groups; patients group with CMV infection and control group without CMV infection. Serum CMV-IgG in all patients was positive (donor and recipients). None of patients had received anti-thymocyte-globulin and thymoglobulin. CMV infection was diagnosed by quantitative CMV-PCR (polymerase chain reaction) test (more than 500 copies/μg). Rejection episode was defined by kidney isotope scan or biopsy. Results: In the group of 66 CMV infection patients (41 male [62.1%] and 25 female [37.9%]) the incidence of graft rejection was 36%, however in the group of 64 control patients the incidence of graft rejection was 9.4 % (P < 0.005). Conclusion: CMV infection is important predisposing factor for acute allograft rejection after kidney transplantation. The results of this study suggests that the control of CMV infection could decrease episodes of acute kidney rejection. PMID:27471740

  15. Genome-wide analysis reveals a highly diverse CD8 T cell response to murine cytomegalovirus.

    PubMed

    Munks, Michael W; Gold, Marielle C; Zajac, Allison L; Doom, Carmen M; Morello, Christopher S; Spector, Deborah H; Hill, Ann B

    2006-03-15

    Human CMV establishes a lifelong latent infection in the majority of people worldwide. Although most infections are asymptomatic, immunocompetent hosts devote an extraordinary amount of immune resources to virus control. To increase our understanding of CMV immunobiology in an animal model, we used a genomic approach to comprehensively map the C57BL/6 CD8 T cell response to murine CMV (MCMV). Responses to 27 viral proteins were detectable directly ex vivo, the most diverse CD8 T cell response yet described within an individual animal. Twenty-four peptide epitopes were mapped from 18 Ags, which together account for most of the MCMV-specific response. Most Ags were from genes expressed at early times, after viral genes that interfere with Ag presentation are expressed, consistent with the hypothesis that the CD8 T cell response to MCMV is largely driven by cross-presented Ag. Titration of peptide epitopes in a direct ex vivo intracellular cytokine staining assay revealed a wide range of functional avidities, with no obvious correlation between functional avidity and the strength of the response. The immunodominance hierarchy varied only slightly between mice and between experiments. However, H-2(b)-expressing mice with different genetic backgrounds responded preferentially to different epitopes, indicating that non-MHC-encoded factors contribute to immunodominance in the CD8 T cell response to MCMV.

  16. Animal cytomegaloviruses.

    PubMed Central

    Staczek, J

    1990-01-01

    Cytomegaloviruses are agents that infect a variety of animals. Human cytomegalovirus is associated with infections that may be inapparent or may result in severe body malformation. More recently, human cytomegalovirus infections have been recognized as causing severe complications in immunosuppressed individuals. In other animals, cytomegaloviruses are often associated with infections having relatively mild sequelae. Many of these sequelae parallel symptoms associated with human cytomegalovirus infections. Recent advances in biotechnology have permitted the study of many of the animal cytomegaloviruses in vitro. Consequently, animal cytomegaloviruses can be used as model systems for studying the pathogenesis, immunobiology, and molecular biology of cytomegalovirus-host and cytomegalovirus-cell interactions. PMID:2170830

  17. Murine Cytomegalovirus US22 Protein pM140 Protects Its Binding Partner, pM141, from Proteasome-Dependent but Ubiquitin-Independent Degradation ▿

    PubMed Central

    Bolin, Lisa L.; Hanson, Laura K.; Slater, Jacquelyn S.; Kerry, Julie A.; Campbell, Ann E.

    2010-01-01

    Stable assembly of murine cytomegalovirus (MCMV) virions in differentiated macrophages is dependent upon the expression of US22 family gene M140. The M140 protein (pM140) exists in complex with products of neighboring US22 genes. Here we report that pM140 protects its binding partner, pM141, from ubiquitin-independent proteasomal degradation. Protection is conferred by a stabilization domain mapping to amino acids 306 to 380 within pM140, and this domain is functionally independent from the region that confers binding of pM140 to pM141. The M140 protein thus contains multiple domains that collectively confer a structure necessary to function in virion assembly in macrophages. PMID:19955315

  18. Early Murine Cytomegalovirus (MCMV) Infection Induces Liver Natural Killer (NK) Cell Inflammation and Protection Through Macrophage Inflammatory Protein 1α (MIP-1α)–dependent Pathways

    PubMed Central

    Salazar-Mather, Thais P.; Orange, Jordan S.; Biron, Christine A.

    1998-01-01

    Natural killer (NK) cells mediate defense against early murine cytomegalovirus (MCMV) infections in liver. The chemokine, macrophage inflammatory protein 1α (MIP-1α), can promote inflammatory responses. Our studies evaluated contributions of NK cells to early MCMV-induced liver inflammation and MIP-1α requirements for inflammation and delivery of antiviral defenses. NK cells were shown to be responsible for focal inflammation, and to be induced to migrate at high levels, in MCMV-infected livers. MIP-1α gene expression was elevated at coinciding times, and mice deficient in MIP-1α function were dramatically inhibited in both inflammatory and protective liver responses. The results precisely define MIP-1α–dependent steps required to achieve NK cell inflammation during, and mechanisms promoting defense against, viral infections in tissues. PMID:9419206

  19. Attenuated murine cytomegalovirus binds to N-acetylglucosamine, and shift to virulence may involve recognition of sialic acids.

    PubMed Central

    Ravindranath, R M; Graves, M C

    1990-01-01

    Treatment of cells with lectins specific for N-acetylglucosamine (GlcNAc) blocked infection by mouse cytomegalovirus (MCMV), and GlcNAc pretreatment of the lectin blocked this effect. MCMV failed to infect N-acetylglucosaminidase (GlcNAcase)-treated mouse embryo fibroblasts (MEF). GlcNAc and GlcNAc-containing synthetic oligosaccharides directly inhibited viral infectivity. Ulex lectin inhibition of infection was shown to be due to inhibition of surface adsorption of 35S-labeled virus. Also, GlcNAcase eluted 35S-labeled virus adsorbed to MEF at 4 degrees C and inhibited plaque formation if added after adsorption at this temperature. These findings indicate that GlcNAc binding is involved in attachment rather than in some later step in infection. High-performance thin-layer chromatography overlay of [35S]MCMV indicated that it binds to a GlcNAc-containing asialoglycolipid. Analogous experiments indicated that MCMV made virulent by in vivo salivary gland passage binds to sialic acids in addition to GlcNAc. Treatment of MEF with sialic acid-binding lectins blocked infectivity. Incubation of virus with sialic acids also prevented infection. N-acetylneuraminic acid was 10(3)-fold more potent than N-glycolylneuraminic acid. Sialidase-treated target cells were not efficiently infected by the virus. Thus, MCMV binds to GlcNAc on the cell surface, and the shift to virulence (by in vivo salivary gland passage) correlates with viral recognition of sialic acids. Images PMID:2170680

  20. Antileukemic Efficacy of Continuous vs Discontinuous Dexamethasone in Murine Models of Acute Lymphoblastic Leukemia

    PubMed Central

    Ramsey, Laura B.; Janke, Laura J.; Payton, Monique A.; Cai, Xiangjun; Paugh, Steven W.; Karol, Seth E.; Kamdem, Landry Kamdem; Cheng, Cheng; Williams, Richard T.; Jeha, Sima; Pui, Ching-Hon; Evans, William E.; Relling, Mary V.

    2015-01-01

    Osteonecrosis is one of the most common, serious, toxicities resulting from the treatment of acute lymphoblastic leukemia. In recent years, pediatric acute lymphoblastic leukemia clinical trials have used discontinuous rather than continuous dosing of dexamethasone in an effort to reduce the incidence of osteonecrosis. However, it is not known whether discontinuous dosing would compromise antileukemic efficacy of glucocorticoids. Therefore, we tested the efficacy of discontinuous dexamethasone against continuous dexamethasone in murine models bearing human acute lymphoblastic leukemia xenografts (n = 8 patient samples) or murine BCR-ABL+ acute lymphoblastic leukemia. Plasma dexamethasone concentrations (7.9 to 212 nM) were similar to those achieved in children with acute lymphoblastic leukemia using conventional dosages. The median leukemia-free survival ranged from 16 to 59 days; dexamethasone prolonged survival from a median of 4 to 129 days in all seven dexamethasone-sensitive acute lymphoblastic leukemias. In the majority of cases (7 of 8 xenografts and the murine BCR-ABL model) we demonstrated equal efficacy of the two dexamethasone dosing regimens; whereas for one acute lymphoblastic leukemia sample, the discontinuous regimen yielded inferior antileukemic efficacy (log-rank p = 0.002). Our results support the clinical practice of using discontinuous rather than continuous dexamethasone dosing in patients with acute lymphoblastic leukemia. PMID:26252865

  1. Characterization of Murine Cytomegalovirus m157 from Infected Cells and Identification of Critical Residues Mediating Recognition by the NK Cell Receptor, Ly49H

    PubMed Central

    Davis, Aja H.; Guseva, Natalya V.; Ball, Brianne L.; Heusel, Jonathan W.

    2008-01-01

    Activated natural killer (NK) cells mediate potent cytolytic and secretory effector functions, and are vital components of the early antiviral immune response. NK cell activities are regulated by the assortment of inhibitory receptors that recognize major histocompatibility class I ligands expressed on healthy cells and activating receptors that recognize inducible host ligands or ligands that are not well characterized. The activating Ly49H receptor of mouse NK cells is unique in that it specifically recognizes a virally encoded ligand, the m157 glycoprotein of murine cytomegalovirus (MCMV). The Ly49H-m157 interaction underlies a potent resistance mechanism (Cmv1) in C57BL/6 mice, and serves as an excellent model in which to understand how NK cells are specifically activated in vivo, as similar receptor systems are operative for human NK cells. For transduced cells expressing m157 in isolation and for MCMV-infected cells, we show that m157 is expressed in multiple isoforms with marked differences in abundance between infected fibroblasts (high) and macrophages (low). At the cell surface m157 is exclusively a glycosylphosphatidylinositol-associated protein in MCMV-infected cells. Through random and site-directed mutagenesis of m157 we identify unique residues that provide for efficient cell surface expression of m157, but fail to activate Ly49H-expressing reporter cells. These m157 mutations are predicted to alter the conformation of a putative m157 interface with Ly49H, one that relies on the position of a critical α0-helix of m157. These findings support an emerging model for a novel interaction between this important NK cell receptor and its viral ligand. PMID:18566392

  2. Mechanisms for virus-induced liver disease: tumor necrosis factor-mediated pathology independent of natural killer and T cells during murine cytomegalovirus infection.

    PubMed Central

    Orange, J S; Salazar-Mather, T P; Opal, S M; Biron, C A

    1997-01-01

    The contribution of endogenous NK cells and cytokines to virus-induced liver pathology was evaluated during murine cytomegalovirus infections of mice. In immunocompetent C57BL/6 mice, the virus induced a self-limited liver disease characterized by hepatitis, with focal inflammation, and large grossly visible subcapsular necrotic foci. The inflammatory foci were most numerous and contained the greatest number of cells 3 days after infection; they colocalized with areas of viral antigen expression. The largest number of necrotic foci was found 2 days after infection. Overall hepatic damage, assessed as increased expression of liver enzymes in serum, accompanied the development of inflammatory and necrotic foci. Experiments with neutralizing antibodies demonstrated that although virus-induced tumor necrosis factor (TNF) can have antiviral effects, it also mediated significant liver pathology. TNF was required for development of hepatic necrotic foci and increased levels of liver enzymes in serum but not for increased numbers of inflammatory foci. The necrotic foci and liver enzyme indications of pathology occurred independently of NK and T cells, because mice rendered NK-cell deficient by treatment with antibodies, T- and B-cell-deficient Rag-/- mice, and NK- and T-cell-deficient E26 mice all manifested both parameters of disease. Development of necrotic foci and maximally increased levels of liver enzymes in serum also were TNF dependent in NK-cell-deficient mice. Moreover, in the immunodeficient E26 mice, virus-induced liver disease was progressive, with eventual death of the host, and neutralization of TNF significantly increased longevity. These results establish conditions separating hepatitis from significant liver damage and demonstrate a cytokine-mediated component to viral pathogenesis. PMID:9371583

  3. Resolving the titer of murine cytomegalovirus by plaque assay using the M2-10B4 cell line and a low viscosity overlay

    PubMed Central

    2014-01-01

    Background Murine cytomegalovirus (MCMV) is increasingly used as an infectious model to investigate host-pathogen interactions in mice. Detailed methods have been published for using primary murine embryonic fibroblasts (MEFs) for preparing stocks and determining viral titers of MCMV. For determining the titer of MCMV by plaque assay, these methods rely on a high viscosity media that restricts viral spreading through the supernatant of the culture, but is also usually too viscous to pipet. Moreover, MEFs must be repeatedly generated and can vary widely from batch-to-batch in purity, proliferation rates, and the development of senescence. In contrast, the M2-10B4 bone marrow stromal cell line (ATCC # CRL-1972), which is also permissive for MCMV, has been reported to produce high-titer stocks of MCMV and has the considerable advantages of growing rapidly and consistently. However, detailed methods using these cells have not been published. Methods We modified existing protocols to use M2-10B4 cells for measuring MCMV titers by plaque assay. Results We found that MCMV plaques could be easily resolved on monolayers of M2-10B4 cells. Moreover, plaques formed normally even when cultures of M2-10B4 cells were less than 50% confluent on the day of infection, as long as we also used a reduced viscosity overlay. Conclusions Overall, our protocol enabled us to use a consistent cell line to assess viral titers, rather than repeatedly producing primary MEFs. It also allowed us to start the assay with 4-fold fewer cells than would be required to generate a confluent monolayer, reducing the lead-time prior to the start of the assay. Finally, the reduced viscosity CMC could be handled by pipet and did not need to be pre-mixed with media, thus increasing its shelf-life and ease-of-use. We describe our results here, along with detailed protocols for the use of the M2-10B4 cell lines to determine the titer and grow stocks of MCMV. PMID:24742045

  4. Requirement for natural killer cell-produced interferon gamma in defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration

    PubMed Central

    1995-01-01

    The presence of natural killer (NK) cells contributes to early defense against murine cytomegalovirus (MCMV) infection. Although NK cells can mediate in vivo protection against MCMV, the mechanism by which they do so has not been defined. The studies presented here evaluate cytokine production by NK cells activated during MCMV infection and the role of NK cell-produced cytokines in early in vivo antiviral defenses. Experiments with normal C57BL/6, T cell-deficient C57BL/6 nude, and severe combined immunodeficient mice lacking T and B cells demonstrated that both interferon gamma (IFN-gamma) and tumor necrosis factor (TNF) production were induced at early times after infection with MCMV. Conditioned media samples prepared with cells from these mice, on day 2 after infection, produced 11-43 pg/million cells of IFN-gamma and 12-19 pg/million cells of TNF as evaluated by specific protein enzyme-linked immunosorbent assays. Studies in the NK- and T cell-deficient mouse line, E26, in mice that had been depleted in vivo of NK cells by treatment with antibodies eliminating NK cells, anti-asialo ganglio-N- tetraosylceramide or anti-NK1.1, and with populations of cells that had been depleted of NK cells by complement treatment with the anti-NK cell antibody, SW3A4, demonstrated that NK cells were solely responsible for the IFN-gamma but were not required for TNF production. The in vivo absence of NK cells was accompanied by increased viral hepatitis and viral replication in both immunocompetent and immunodeficient mice, as well as decreased survival time of immunodeficient mice. In vivo treatments with antibodies neutralizing IFN-gamma demonstrated that this factor contributed to the NK cell-mediated antiviral defense and reduced the measured parameters of viral defense to levels indistinguishable from those observed in NK cell-deficient mice. These effects appeared to be independent of cytolytic activity, as NK cells isolated from anti-IFN-gamma-treated mice mediated

  5. The Role of NKG2D Signaling in Inhibition of Cytotoxic T-Lymphocyte Lysis by the Murine Cytomegalovirus Immunoevasin m152/gp40▿

    PubMed Central

    Pinto, Amelia K.; Jamieson, Amanda M.; Raulet, David H.; Hill, Ann B.

    2007-01-01

    Three proteins encoded by murine cytomegalovirus (MCMV)— gp34, encoded by m04 (m04/gp34), gp48, encoded by m06 (m06/gp48), and gp40, encoded by m152 (m152/gp40)—act together to powerfully impact the ability of primed cytotoxic CD8 T lymphocytes (CTL) to kill virus-infected cells. Of these three, the impact of m152/gp40 on CTL lysis appears greater than would be expected based on its impact on cell surface major histocompatibility complex (MHC) class I. In addition to MHC class I, m152/gp40 also downregulates the RAE-1 family of NKG2D ligands, which can provide costimulation for CD8 T cells. We hypothesized that m152/gp40 may impact CTL lysis so profoundly because it inhibits both antigen presentation and NKG2D-mediated costimulation. We therefore tested the extent to which m152/gp40's ability to inhibit CTL lysis of MCMV-infected cells could be accounted for by its inhibition of NKG2D signaling. As was predictable from the results reported in the literature, NKG2D ligands were not detected by NKG2D tetramer staining of cells infected with wild-type MCMV, whereas those infected with MCMV lacking m152/gp40 displayed measurable levels of the NKG2D ligand. To determine whether NKG2D signaling contributed to the ability of CTL to lyse these cells, we used a blocking anti-NKG2D antibody. Blocking NKG2D signaling did affect the killing of MCMV-infected cells for some epitopes. However, for all epitopes, the impact of m152/gp40 on CTL lysis was much greater than the impact of inhibition of NKG2D signaling. We conclude that the downregulation of NKG2D ligands by MCMV makes only a small contribution to the impact of m152/gp40 on CTL lysis and only for a small subset of CTL. PMID:17855532

  6. Quantitative analysis of human herpesvirus-6 and human cytomegalovirus in blood and saliva from patients with acute leukemia.

    PubMed

    Nefzi, Faten; Ben Salem, Nabil Abid; Khelif, Abderrahim; Feki, Salma; Aouni, Mahjoub; Gautheret-Dejean, Agnès

    2015-03-01

    Human herpesvirus-6 (HHV-6) and human cytomegalovirus (HCMV) DNAs were quantified by real-time PCR assays in blood and saliva obtained from 50 patients with acute leukemia at the time of diagnosis (50 of each matrix), aplasia (65 of each matrix), remission (55 of each matrix), and relapse (20 of each matrix) to evaluate which biological matrix was more suitable to identify a viral reactivation, search for a possible link between HHV-6 and HCMV reactivations, and evaluate the relations between viral loads and count of different leukocyte types in blood. The median HHV-6 loads were 136; 219; 226, and 75 copies/million cells in blood at diagnosis, aplasia, remission and relapse, respectively. The HCMV loads were 193 and 317 copies/million cells in blood at diagnosis and remission. In the saliva samples, the HHV-6 loads were 22,165; 15,238; 30,214, and 17,454 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HCMV loads were 8,991; 1,461; 2,980, and 4,283 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HHV-6 load in the blood was correlated to the counts of polymorphonuclear leukocytes (R(2)  = 0.5; P < 0.0001) and lymphocytes (R(2)  = 0.4; P = 0.001) and was not correlated to the monocyte counts (R(2)  = 0.07; P = 0.7). Saliva appears to be a more sensitive biological matrix than whole blood in the detection of HHV-6 or HCMV reactivations. The HHV-6 and HCMV reactivations were linked only in saliva.

  7. Cytomegalovirus induces strong antileukemic effect in acute myeloid leukemia patients following sibling HSCT without ATG-containing regimen

    PubMed Central

    Bao, Xiebing; Zhu, Qian; Xue, Shengli; Hu, Xiaohui; Ma, Xiao; Chen, Feng; Chen, Suning; Sun, Aining; Wu, Depei; Yu, Jianhua; Wu, Xiaojin; Qiu, Huiying

    2016-01-01

    A considerable number of studies have demonstrated that cytomegalovirus (CMV) reactivation after allogeneic hematopoietic stem cell transplantation (Allo-HSCT) could enforce graft-versus leukemia (GVL) effect in acute myeloid leukemia (AML) patients. However, the use of antithymocyte globulin (ATG) as part of graft-versus-host disease (GVHD) prophylaxis may dampen this beneficial effect of CMV replication. In this context, we retrospectively analyzed the effect of CMV reactivation on relapse, survival and prognosis in a total of 227 AML patients who received a myeloablative (MA) conditioning regimen at a single research center between January 2010 and April 2013. Of these 227 patients, 110 cases received non-ATG-containing regimens and 117 cases received ATG-containing regimens. CMV reactivation occurred in 45 patients (41%) among non-ATG regimen group and 73 patients (62%) among ATG regimen group (P = 0.001). At a median time to follow-up of 27.5 months, a lower risk of cumulative relapse incidence associated with CMV reactivation was observed in non-ATG group in multivariate analyses (OR 0.28, 95% CI 0.10-0.79; P = 0.016). However, CMV reactivation after transplantation did not significantly decrease the cumulative incidence of relapse in our ATG group (OR 0.28, 95% CI 0.10-0.79; P = 0.016). Collectively, our results demonstrate that in AML patients following sibling HSCT, the CMV-induced beneficial effect on relapse occurs only in the MA regimens containing no ATG, although ATG promotes CMV reactivation. PMID:27158357

  8. Methods for Acute and Subacute Murine Hindlimb Ischemia.

    PubMed

    Padgett, Michael E; McCord, Timothy J; McClung, Joseph M; Kontos, Christopher D

    2016-01-01

    Peripheral artery disease (PAD) is a leading cause of cardiovascular morbidity and mortality in developed countries, and animal models that reliably reproduce the human disease are necessary to develop new therapies for this disease. The mouse hindlimb ischemia model has been widely used for this purpose, but the standard practice of inducing acute limb ischemia by ligation of the femoral artery can result in substantial tissue necrosis, compromising investigators' ability to study the vascular and skeletal muscle tissue responses to ischemia. An alternative approach to femoral artery ligation is the induction of gradual femoral artery occlusion through the use of ameroid constrictors. When placed around the femoral artery in the same or different locations as the sites of femoral artery ligation, these devices occlude the artery over 1 - 3 days, resulting in more gradual, subacute ischemia. This results in less substantial skeletal muscle tissue necrosis, which may more closely mimic the responses seen in human PAD. Because genetic background influences outcomes in both the acute and subacute ischemia models, consideration of the mouse strain being studied is important in choosing the best model. This paper describes the proper procedure and anatomical placement of ligatures or ameroid constrictors on the mouse femoral artery to induce subacute or acute hindlimb ischemia in the mouse. PMID:27403963

  9. Methods for Acute and Subacute Murine Hindlimb Ischemia

    PubMed Central

    Padgett, Michael E.; McCord, Timothy J.; McClung, Joseph M.; Kontos, Christopher D.

    2016-01-01

    Peripheral artery disease (PAD) is a leading cause of cardiovascular morbidity and mortality in developed countries, and animal models that reliably reproduce the human disease are necessary to develop new therapies for this disease. The mouse hindlimb ischemia model has been widely used for this purpose, but the standard practice of inducing acute limb ischemia by ligation of the femoral artery can result in substantial tissue necrosis, compromising investigators' ability to study the vascular and skeletal muscle tissue responses to ischemia. An alternative approach to femoral artery ligation is the induction of gradual femoral artery occlusion through the use of ameroid constrictors. When placed around the femoral artery in the same or different locations as the sites of femoral artery ligation, these devices occlude the artery over 1-3 days, resulting in more gradual, subacute ischemia. This results in less substantial skeletal muscle tissue necrosis, which may more closely mimic the responses seen in human PAD. Because genetic background influences outcomes in both the acute and subacute ischemia models, consideration of the mouse strain being studied is important in choosing the best model. This paper describes the proper procedure and anatomical placement of ligatures or ameroid constrictors on the mouse femoral artery to induce subacute or acute hindlimb ischemia in the mouse. PMID:27403963

  10. Antidepressant Effects of Mallotus oppositifolius in Acute Murine Models

    PubMed Central

    Kukuia, Kennedy K. E.; Mante, Priscilla K.; Ameyaw, Elvis O.; Adongo, Donatus W.

    2014-01-01

    Objective. Hydroalcoholic extract of leaves of Mallotus oppositifolius (MOE), a plant used for CNS conditions in Ghana, was investigated for acute antidepressant effects in the forced swimming (FST) and tail suspension tests (TST). Results. In both FST and TST, MOE (10, 30, and 100 mg kg−1) significantly decreased immobility periods and frequencies. A 3-day pretreatment with 200 mg kg−1, i.p., para-chlorophenylalanine (PCPA), a tryptophan hydroxylase inhibitor, reversed the decline in immobility and the increase of swimming score induced by MOE in the modified FST. Pretreatment with reserpine alone (1 mg kg−1), α-methyldopa alone (400 mg kg−1, i.p.), or a combination of both drugs failed to reverse the decline in immobility or the increase in swimming score caused by the extract in the modified FST. The extract potentiated the frequency of head twitch responses induced by 5-hydroxytryptamine. Pretreatment with d-serine (600 mg kg−1, i.p.), glycine/NMDA agonist, abolished the behavioural effects of MOE while d-cycloserine (2.5 mg kg−1, i.p.), a glycine/NMDA partial agonist, potentiated it in both TST and modified FST. Conclusion. The extract exhibited antidepressant effects in mice which is mediated by enhancement of serotoninergic neurotransmission and inhibition of glycine/NMDA receptor activation. PMID:25045543

  11. Cytomegalovirus Reactivation Induced Acute Hepatitis and Gastric Erosions in a Patient with Rheumatoid Arthritis under Treatment with an Anti-IL-6 Receptor Antibody, Tocilizumab.

    PubMed

    Komura, Takuya; Ohta, Hajime; Nakai, Ryotaro; Seishima, Jun; Yamato, Masatoshi; Miyazawa, Masaki; Kaji, Kiichiro; Marukawa, Yohei; Kagaya, Takashi; Kitagawa, Kiyoki; Kawashima, Atsuhiro; Kaneko, Shuichi; Unoura, Masashi

    2016-01-01

    Tocilizumab, an anti-human interleukin 6 receptor (IL-6R) monoclonal antibody, is widely used to treat rheumatoid arthritis (RA) and is expected to exhibit clinical efficacy when used to treat other autoimmune diseases. However, a risk of opportunistic infection is occasionally recognized. A 54-year-old woman had received an oral corticosteroid and methotrexate to treat RA. Despite receiving these treatments, she received additional treatment with tocilizumab due to poor control of the disease activity. She presented at our hospital with a high fever and epigastralgia 19 days after receiving this treatment. A laboratory evaluation revealed liver injury and cytomegalovirus (CMV) viremia. Abdominal ultrasonography and computed tomography (CT) revealed hepatosplenomegaly, but no ascites. Upper gastrointestinal endoscopy revealed gastric erosions induced by CMV, which were confirmed immunohistochemically. Hence, we diagnosed the patient with CMV reactivation-induced acute hepatitis and gastric erosions under tocilizumab treatment. She received an anti-cytomegalovirus drug, ganciclovir, for 14 days due to her viremia and impaired general condition, which was suggestive of a severe infection. Her general condition subsequently improved, the liver function test results normalized, and the gastric erosions disappeared. In conclusion, although tocilizumab is very useful for treating certain autoimmune and inflammatory diseases, and will be prescribed more widely in the future, associated CMV infections must be closely monitored, as these can be lethal. PMID:27432105

  12. Comparison between human cytomegalovirus pUL97 and murine cytomegalovirus (MCMV) pM97 expressed by MCMV and vaccinia virus: pM97 does not confer ganciclovir sensitivity.

    PubMed

    Wagner, M; Michel, D; Schaarschmidt, P; Vaida, B; Jonjic, S; Messerle, M; Mertens, T; Koszinowski, U

    2000-11-01

    The UL97 protein (pUL97) of human cytomegalovirus (HCMV) is a protein kinase that also phosphorylates ganciclovir (GCV), but its biological function is not yet clear. The M97 protein (pM97) of mouse cytomegalovirus (MCMV) is the homolog of pUL97. First, we studied the consequences of genetic replacement of M97 by UL97. Using the infectious bacterial plasmid clone of the full-length MCMV genome (M. Wagner, S. Jonjic, U. H. Koszinowski, and M. Messerle, J. Virol. 73:7056-7060, 1999), we replaced the M97 gene with the UL97 gene and constructed an MCMV M97 deletion mutant and a revertant virus. In addition, pUL97 and pM97 were expressed by recombinant vaccinia virus to compare both for known functions. Remarkably, pM97 proved not to be the reason for the GCV sensitivity of MCMV. When expressed by the recombinant MCMV, however, pUL97 was phosphorylated and endowed MCMV with the capacity to phosphorylate GCV, thereby rendering MCMV more susceptible to GCV. We found that deletion of pM97, although it is not essential for MCMV replication, severely affected virus growth. This growth deficit was only partially amended by pUL97 expression. When expressed by recombinant vaccinia viruses, both proteins were phosphorylated and supported phosphorylation of GCV, but pUL97 was about 10 times more effective than pM97. One hint of the functional differences between the proteins was provided by the finding that pUL97 accumulates in the nucleus, whereas pM97 is predominantly located in the cytoplasm of infected cells. In vivo testing revealed that the UL97-MCMV recombinant should allow evaluation of novel antiviral drugs targeted to the UL97 protein of HCMV in mice. PMID:11044117

  13. Acute and chronic exposure to Tyrophagus putrescentiae induces allergic pulmonary response in a murine model

    PubMed Central

    Nuñez, Nailê Karine; dos Santos Dutra, Moisés; Barbosa, Gustavo Leivas; Morassutti, Alessandra Loureiro; de Souza, Rodrigo Godinho; Vargas, Mauro Henrique Moraes; Antunes, Géssica Luana; Silveira, Josiane Silva; da Silva, Guilherme Liberato; Pitrez, Paulo Márcio

    2016-01-01

    Background Tyrophagus putrescentiae (Tp) is a source of aeroallergen that causes allergic diseases. Objective To describe an acute and chronic murine model of allergic asthma with Tp extract with no systemic sensitization and no use of adjuvant. Methods Mites from dust sample were cultured and a raw extract was produced. Female BALB/c mice (6-8 weeks) were challenged intranasally with Tp extract or Dulbecco's phosphate-buffered saline, for 10 consecutive days (acute protocol) or for 6 weeks (chronic protocol). Twenty-four hours after the last intranasal challenge, bronchoalveolar lavage fluid (BALF) was performed for total and differential cells count, cytokine analysis, and eosinophil peroxidase activity. Lung tissue was also removed for histopathologic analysis. Results Tp extract has shown a significant increase in total cells count from BALF as well as an increase in absolute eosinophils count, eosinophil peroxidase activity, interleukin (IL)-5 and IL-13 levels, in both acute and chronic protocols. Peribronchovascular infiltrate, goblet cells hyperplasia and collagen deposition were shown in the airways of acute and chronic Tp-exposed mice. Conclusion Our data suggest that the intranasal exposure to Tp extract, with no systemic sensitization and no use of adjuvants, induces a robust allergic inflammation in the lungs of mice, in both acute and chronic models. Our Tp extract seems to be a potent allergen extract which may be used in asthma model studies. PMID:26844220

  14. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  15. Artemisone and Artemiside Control Acute and Reactivated Toxoplasmosis in a Murine Model▿

    PubMed Central

    Dunay, Ildiko R.; Chan, Wing Chi; Haynes, Richard K.; Sibley, L. David

    2009-01-01

    Immunocompromised patients are at risk of developing toxoplasmosis, and although chemotherapy is available, standard treatments are often complicated by severe side effects. Artemisinin is a new highly potent antimalarial drug that has activity against Toxoplasma gondii in vitro. However, artemisinin derivatives have previously been ineffective in vivo using a rat model of toxoplasmosis. In the present study, the efficacy of several new artemisinin derivates was investigated for treatment of mice infected with the parasite Toxoplasma gondii. Artemiside and artemisone displayed better inhibition than either artemisinin or artesunate against the parasite in vitro. Artemiside and artemisone treatment controlled parasite replication in vivo, and mice survived the acute infection. In a murine model of reactivated toxoplasmosis, both drugs increased survival, although artemiside was more effective. These results indicate that these newer derivatives of artemisinin may have potential for treatment of toxoplasmosis. PMID:19635951

  16. Loss of n-6 fatty acid induced pediatric obesity protects against acute murine colitis

    PubMed Central

    Nagy-Szakal, Dorottya; Mir, Sabina A. V.; Harris, R. Alan; Dowd, Scot E.; Yamada, Takeshi; Lacorazza, H. Daniel; Tatevian, Nina; Smith, C. Wayne; de Zoeten, Edwin F.; Klein, John; Kellermayer, Richard

    2015-01-01

    Dietary influences may affect microbiome composition and host immune responses, thereby modulating propensity toward inflammatory bowel diseases (IBDs): Crohn disease (CD) and ulcerative colitis (UC). Dietary n-6 fatty acids have been associated with UC in prospective studies. However, the critical developmental period when (n-6) consumption may induce UC is not known. We examined the effects of transiently increased n-6 consumption during pediatric development on subsequent dextran-sulfate-sodium (DSS)-induced acute murine colitis. The animals transiently became obese then rapidly lost this phenotype. Interestingly, mice were protected against DSS colitis 40 days after n-6 consumption. The transient high n-6-induced protection against colitis was fat type- and dietary reversal-dependent and could be transferred to germ-free mice by fecal microbiota transplantation. We also detected decreased numbers of chemokine receptor (Cxcr)5+ CD4+ T cells in the mesenteric lymph nodes (MLNs) of transiently n-6-fed mice. Further experiments revealed that anti-chemokine ligand (Cxcl)13 (the ligand of Cxcr5) antibody treatment decreased DSS colitis severity, implicating the importance of the Cxcr5-Cxcl13 pathway in mammalian colitis. Consecutively, we found elevated CXCL13 concentrations (CD: 1.8-fold, P = 0.0077; UC: 1.9-fold, P = 0.056) in the serum of untreated pediatric IBD patients. The human serologic observations supported the translational relevance of our findings.—Nagy-Szakal, D., Mir, S. A. V., Harris, R. A., Dowd, S. E., Yamada, T., Lacorazza, H. D., Tatevian, N., Smith, C. W., de Zoeten, E. F., Klein, J., Kellermayer, R. Loss of n-6 fatty acid induced pediatric obesity protects against acute murine colitis. PMID:25903104

  17. Acute lethal toxicity following passive immunization for treatment of murine cryptococcosis.

    PubMed

    Savoy, A C; Lupan, D M; Manalo, P B; Roberts, J S; Schlageter, A M; Weinhold, L C; Kozel, T R

    1997-05-01

    Passive immunization with monoclonal antibodies (MAbs) specific for the major capsular polysaccharide of Cryptococcus neoformans alters the course of murine cryptococcosis. During studies of passive immunization for treatment of murine cryptococcosis, we noted the occurrence of an acute, lethal toxicity. Toxicity was characterized by scratching, lethargy, respiratory distress, collapse, and death within 20 to 60 min after injection of antibody. The toxic effect was observed only in mice with a cryptococcal infection and was reduced or absent in the early and late stages of disease. The clinical course and histopathology were consistent with those for shock. There was considerable variation between mouse strains in susceptibility to toxicity. Swiss Webster mice from the Charles River colony were most susceptible, followed by C3H/He, BALB/c, and C57BL/6 mice. DBA/2 mice and Swiss Webster mice from the Simonsen colony were resistant. Acute toxicity was mimicked by injection of preformed complexes of MAb and purified polysaccharide. The toxic effect was also produced by injection of MAbs into mice that were preloaded with polysaccharide. The toxic effect was not blocked by treatment of mice with chloropheniramine or anti-tumor necrosis factor alpha antibodies or by depletion of complement components via pretreatment with cobra venom factor. Toxicity was reduced by treatment of mice with high doses of epinephrine, dexamethasone, or chlorpromazine. Finally, the toxic effect was completely blocked by treatment of mice with the platelet-activating factor antagonist WEB 2170 BS or by pretreatment of mice with the liposome-encapsulated drug dichloromethylene diphosphonate, a procedure which depletes macrophages from the spleen and liver.

  18. Impact of cytomegalovirus reactivation on relapse and survival in patients with acute leukemia who received allogeneic hematopoietic stem cell transplantation in first remission

    PubMed Central

    Yoon, Jae-Ho; Lee, Seok; Kim, Hee-Je; Jeon, Young-Woo; Lee, Sung-Eun; Cho, Byung-Sik; Lee, Dong-Gun; Eom, Ki-Seong; Kim, Yoo-Jin; Min, Chang-Ki; Cho, Seok-Goo; Min, Woo-Sung; Lee, Jong Wook

    2016-01-01

    Cytomegalovirus (CMV)-reactivation is associated with graft-vs-leukemia (GVL) effect by stimulating natural-killer or T-cells, which showed leukemia relapse prevention after hematopoietic stem cell transplantation (HSCT). We enrolled patients with acute myeloid leukemia (n = 197) and acute lymphoid leukemia (n = 192) who underwent allogeneic-HSCT in first remission. We measured RQ-PCR weekly to detect CMV-reactivation and preemptively used ganciclovir (GCV) when the titer increased twice consecutively, but GCV was sometimes delayed in patients without significant graft-vs-host disease (GVHD) by reducing immunosuppressive agents. In the entire group, CMV-reactivation showed poor overall survival (OS). To evaluate subsequent effects of CMV-reactivation, we excluded early relapse and deaths within 100 days, during which most of the CMV-reactivation occurred. Untreated CMV-reactivated group (n = 173) showed superior OS (83.8% vs. 61.7% vs. 74.0%, p < 0.001) with lower relapse rate (10.1% vs 22.1% vs. 25.5%, p = 0.004) compared to GCV-treated CMV-reactivated group (n = 122) and CMV-undetected group (n = 42). After excluding chronic GVHD, untreated CMV-reactivated group still showed lower relapse rate (9.4% vs. 24.1% vs. 30.2%, p = 0.006). Multivariate analysis showed adverse-risk karyotype and patients in other than untreated CMV-reactivated group were independent factors for relapse prediction. Our data showed possible GVL effect of CMV-reactivation and minimizing antiviral therapy may benefit for relapse prevention in acute leukemia. PMID:26883100

  19. Interferon induced by UV-irradiated murine cytomegalovirus decreases type C virus expression in BALB/c cells treated by 5-iodo-deoxyuridine or cycloheximide

    SciTech Connect

    Sergiescu, D.

    1983-01-01

    UV-irradiated mouse cytomegalovirus (MCMV) activates at low incidence (2.0 X 10(-4) - 8.0 X 10(-4)) a xenotropic type C virus in Kirsten sarcoma virus-transformed nonproducer BALB 3T3 (KBALB) cells. When KBALB cells are treated with UV-MCMV and subsequently with potent chemical inducers, such as 5-Iododeoxyuridine (IdUrd) or cycloheximide, the activation frequencies of type C virus are significantly lower than in controls exposed to the chemical inducers alone: 60% for IdUrd and 44% for cycloheximide. This decrease of activation appears to be mediated by endogenous interferon (IFN) induced by UV-MCMV in KBALB cells, as could be proven by neutralization of the inhibitory activity. Indeed, after exposure of UV-MCMV-infected cells to anti-IFN gamma globulin, the level of C type virus increases, reaching values obtained with IdUrd or cycloheximide in the absence of UV-MCMV. The inhibitory activity associated with UV-MCMV is dose-dependent and the xenotropic type C virus appears to be more sensitive than the ecotropic (N-tropic) retrovirus of BALB/c cells.

  20. Clinical and Epidemiological Characteristics of Scrub Typhus and Murine Typhus among Hospitalized Patients with Acute Undifferentiated Fever in Northern Vietnam.

    PubMed

    Hamaguchi, Sugihiro; Cuong, Ngo Chi; Tra, Doan Thu; Doan, Yen Hai; Shimizu, Kenta; Tuan, Nguyen Quang; Yoshida, Lay-Myint; Mai, Le Quynh; Duc-Anh, Dang; Ando, Shuji; Arikawa, Jiro; Parry, Christopher M; Ariyoshi, Koya; Thuy, Pham Thanh

    2015-05-01

    A descriptive study on rickettsiosis was conducted at the largest referral hospital in Hanoi, Vietnam, to identify epidemiological and clinical characteristics of specific rickettsiosis. Between March 2001 and February 2003, we enrolled 579 patients with acute undifferentiated fever (AUF), excluding patients with malaria, dengue fever, and typhoid fever, and serologically tested for Orientia tsutsugamushi and Rickettsia typhi. Of the patients, 237 (40.9%) and 193 (33.3%) had scrub and murine typhus, respectively, and 149 (25.7%) had neither of them (non-scrub and murine typhus [non-ST/MT]). The proportion of murine typhus was highest among patients living in Hanoi whereas that of scrub typhus was highest in national or regional border areas. The presence of an eschar, dyspnea, hypotension, and lymphadenopathy was significantly associated with a diagnosis of scrub typhus (OR = 46.56, 10.90, 9.01, and 7.92, respectively). Patients with murine typhus were less likely to have these findings but more likely to have myalgia, rash, and relative bradycardia (OR = 1.60, 1.56, and 1.45, respectively). Scrub typhus and murine typhus were shown to be common causes of AUF in northern Vietnam although the occurrence of spotted fever group rickettsiae was not determined. Clinical and epidemiological information may help local clinicians make clinical diagnosis of specific rickettsioses in a resource-limited setting.

  1. An endocytic YXXΦ (YRRF) cargo sorting motif in the cytoplasmic tail of murine cytomegalovirus AP2 'adapter adapter' protein m04/gp34 antagonizes virus evasion of natural killer cells.

    PubMed

    Fink, Annette; Blaum, Franziska; Babic Cac, Marina; Ebert, Stefan; Lemmermann, Niels A W; Reddehase, Matthias J

    2015-06-01

    Viruses have evolved proteins that bind immunologically relevant cargo molecules at the cell surface for their downmodulation by internalization. Via a tyrosine-based sorting motif YXXΦ in their cytoplasmic tails, they link the bound cargo to the cellular adapter protein-2 (AP2), thereby sorting it into clathrin-triskelion-coated pits for accelerated endocytosis. Downmodulation of CD4 molecules by lentiviral protein NEF represents the most prominent example. Based on connecting cargo to cellular adapter molecules, such specialized viral proteins have been referred to as 'connectors' or 'adapter adapters.' Murine cytomegalovirus glycoprotein m04/gp34 binds stably to MHC class-I (MHC-I) molecules and suspiciously carries a canonical YXXΦ endocytosis motif YRRF in its cytoplasmic tail. Disconnection from AP2 by motif mutation ARRF should retain m04-MHC-I complexes at the cell surface and result in an enhanced silencing of natural killer (NK) cells, which recognize them via inhibitory receptors. We have tested this prediction with a recombinant virus in which the AP2 motif is selectively destroyed by point mutation Y248A, and compared this with the deletion of the complete protein in a Δm04 mutant. Phenotypes were antithetical in that loss of AP2-binding enhanced NK cell silencing, whereas absence of m04-MHC-I released them from silencing. We thus conclude that AP2-binding antagonizes NK cell silencing by enhancing endocytosis of the inhibitory ligand m04-MHC-I. Based on a screen for tyrosine-based endocytic motifs in cytoplasmic tail sequences, we propose here the new hypothesis that most proteins of the m02-m16 gene family serve as 'adapter adapters,' each selecting its specific cell surface cargo for clathrin-assisted internalization.

  2. Significance of murine retroviral mutagenesis for identification of disease genes in human acute myeloid leukemia.

    PubMed

    Erkeland, Stefan J; Verhaak, Roel G W; Valk, Peter J M; Delwel, Ruud; Löwenberg, Bob; Touw, Ivo P

    2006-01-15

    Retroviral insertion mutagenesis is considered a powerful tool to identify cancer genes in mice, but its significance for human cancer has remained elusive. Moreover, it has recently been debated whether common virus integrations are always a hallmark of tumor cells and contribute to the oncogenic process. Acute myeloid leukemia (AML) is a heterogeneous disease with a variable response to treatment. Recurrent cytogenetic defects and acquired mutations in regulatory genes are associated with AML subtypes and prognosis. Recently, gene expression profiling (GEP) has been applied to further risk stratify AML. Here, we show that mouse leukemia genes identified by retroviral insertion mutagenesis are more frequently differentially expressed in distinct subclasses of adult and pediatric AML than randomly selected genes or genes located more distantly from a virus integration site. The candidate proto-oncogenes showing discriminative expression in primary AML could be placed in regulatory networks mainly involved in signal transduction and transcriptional control. Our data support the validity of retroviral insertion mutagenesis in mice for human disease and indicate that combining these murine screens for potential proto-oncogenes with GEP in human AML may help to identify critical disease genes and novel pathogenetic networks in leukemia.

  3. A statistical analysis of murine incisional and excisional acute wound models

    PubMed Central

    Ansell, David M; Campbell, Laura; Thomason, Helen A; Brass, Andrew; Hardman, Matthew J

    2014-01-01

    Mice represent the most commonly used species for preclinical in vivo research. While incisional and excisional acute murine wound models are both frequently employed, there is little agreement on which model is optimum. Moreover, current lack of standardization of wounding procedure, analysis time point(s), method of assessment, and the use of individual wounds vs. individual animals as replicates makes it difficult to compare across studies. Here we have profiled secondary intention healing of incisional and excisional wounds within the same animal, assessing multiple parameters to determine the optimal methodology for future studies. We report that histology provides the least variable assessment of healing. Furthermore, histology alone (not planimetry) is able to detect accelerated healing in a castrated mouse model. Perhaps most importantly, we find virtually no correlation between wounds within the same animal, suggesting that use of wound (not animal) biological replicates is perfectly acceptable. Overall, these findings should guide and refine future studies, increasing the likelihood of detecting novel phenotypes while reducing the numbers of animals required for experimentation. PMID:24635179

  4. Protective effects of sirtuin 3 in a murine model of sepsis-induced acute kidney injury.

    PubMed

    Zhao, Wen-Yu; Zhang, Lei; Sui, Ming-Xing; Zhu, You-Hua; Zeng, Li

    2016-01-01

    Acute kidney injury (AKI) is a rapid loss of kidney function characterized by damage to renal tubular cells driven by mitochondrial dysregulation and oxidative stress. Here, we used a murine caecal ligation and puncture (CLP) model of sepsis-induced AKI to study the role of sirtuin 3 (SIRT3), a NAD(+) dependent deacetylase critical for the maintenance of mitochondrial viability, in AKI-related renal tubular cell damage and explored the underlying mechanisms. CLP induced alterations in kidney function and morphology were associated with SIRT3 downregulation, and SIRT3 deletion exacerbated CLP-induced kidney dysfunction, renal tubular cell injury and apoptosis, mitochondrial alterations, and ROS production in a knockout mouse model. SIRT3 deletion increased the CLP-induced upregulation of the NLRP3 inflammasome and apoptosis-associated speck-like protein, resulting in the activation of oxidative stress, increased production of the proinflammatory cytokines interleukin (IL)-1β and IL-18, and the enhancement of apoptosis, and these effects were reversed by antioxidant NAC. Our results suggest that SIRT3 plays a protective role against mitochondrial damage in the kidney by attenuating ROS production, inhibiting the NRLP3 inflammasome, attenuating oxidative stress, and downregulating IL-1β and IL-18. PMID:27620507

  5. Protective effects of sirtuin 3 in a murine model of sepsis-induced acute kidney injury

    PubMed Central

    Zhao, Wen-Yu; Zhang, Lei; Sui, Ming-Xing; Zhu, You-Hua; Zeng, Li

    2016-01-01

    Acute kidney injury (AKI) is a rapid loss of kidney function characterized by damage to renal tubular cells driven by mitochondrial dysregulation and oxidative stress. Here, we used a murine caecal ligation and puncture (CLP) model of sepsis-induced AKI to study the role of sirtuin 3 (SIRT3), a NAD+ dependent deacetylase critical for the maintenance of mitochondrial viability, in AKI-related renal tubular cell damage and explored the underlying mechanisms. CLP induced alterations in kidney function and morphology were associated with SIRT3 downregulation, and SIRT3 deletion exacerbated CLP-induced kidney dysfunction, renal tubular cell injury and apoptosis, mitochondrial alterations, and ROS production in a knockout mouse model. SIRT3 deletion increased the CLP-induced upregulation of the NLRP3 inflammasome and apoptosis-associated speck-like protein, resulting in the activation of oxidative stress, increased production of the proinflammatory cytokines interleukin (IL)-1β and IL-18, and the enhancement of apoptosis, and these effects were reversed by antioxidant NAC. Our results suggest that SIRT3 plays a protective role against mitochondrial damage in the kidney by attenuating ROS production, inhibiting the NRLP3 inflammasome, attenuating oxidative stress, and downregulating IL-1β and IL-18. PMID:27620507

  6. Expansion and Protection by a Virus-Specific NK Cell Subset Lacking Expression of the Inhibitory NKR-P1B Receptor during Murine Cytomegalovirus Infection.

    PubMed

    Rahim, Mir Munir A; Wight, Andrew; Mahmoud, Ahmad Bakur; Aguilar, Oscar A; Lee, Seung-Hwan; Vidal, Silvia M; Carlyle, James R; Makrigiannis, Andrew P

    2016-09-15

    NK cells play a major role in immune defense against human and murine CMV (MCMV) infection. Although the MCMV genome encodes for MHC class I-homologous decoy ligands for inhibitory NK cell receptors to evade detection, some mouse strains have evolved activating receptors, such as Ly49H, to recognize these ligands and initiate an immune response. In this study, we demonstrate that approximately half of the Ly49H-expressing (Ly49H(+)) NK cells in the spleen and liver of C57BL/6 mice also express the inhibitory NKR-P1B receptor. During MCMV infection, the NKR-P1B(-)Ly49H(+) NK cell subset proliferates to constitute the bulk of the NK cell population. This NK cell subset also confers better protection against MCMV infection compared with the NKR-P1B(+)Ly49H(+) subset. The two populations are composed of cells that differ in their surface expression of receptors such as Ly49C/I and NKG2A/C/E, as well as developmental markers, CD27 and CD11b, and the high-affinity IL-2R (CD25) following infection. Although the NKR-P1B(+) NK cells can produce effector molecules such as IFNs and granzymes, their proliferation is inhibited during infection. A similar phenotype in MCMV-infected Clr-b-deficient mice, which lack the ligand for NKR-P1B, suggests the involvement of ligands other than the host Clr-b. Most interestingly, genetic deficiency of the NKR-P1B, but not Clr-b, results in accelerated virus clearance and recovery from MCMV infection. This study is particularly significant because the mouse NKR-P1B:Clr-b receptor:ligand system represents the closest homolog of the human NKR-P1A:LLT1 system and may have a direct relevance to human CMV infection. PMID:27511735

  7. Establishing a murine model of the Hematopoietic Syndrome of the Acute Radiation Syndrome

    PubMed Central

    Plett, P. Artur; Sampson, Carol H.; Chua, Hui Lin; Joshi, Mandar; Booth, Catherine; Gough, Alec; Johnson, Cynthia S.; Katz, Barry P.; Farese, Ann M.; Parker, Jeffrey; MacVittie, Thomas J.; Orschell, Christie M.

    2012-01-01

    We have developed a murine model of the Hematopoietic Syndrome of the Acute Radiation Syndrome (H-ARS) for efficacy testing of medical countermeasures (MCM) against radiation according to the FDA Animal Rule. Ten to 12 week old male and female C57BL/6 mice were exposed to the LD50/30-LD70/30 dose of total body irradiation (TBI, 137Cs, 0.62-0.67 Gy min-1) in the morning hours when mice were determined to be most radiosensitive, and assessed for 30 day survival and mean survival time (MST). Antibiotics were delivered in the drinking water on days 4-30 post-TBI at a concentration based on the amount of water that lethally-irradiated mice were found to consume. The fluoroquinolones, ciprofloxacin and levofloxacin, and the tetracycline doxycycline and aminoglycoside neomycin, all significantly increased MST of decedent mice, while ciprofloxacin (p=0.061) and doxycycline + neomycin (p=0.005) showed at least some efficacy to increase 30 day survival. Blood sampling (30uL/mouse every 5th day) was found to negatively impact 30 day survival. Histopathology of tissues harvested from non-moribund mice showed expected effects of lethal irradiation, while moribund mice were largely septicemic with a preponderance of enteric organisms. Kinetics of loss and recovery of peripheral blood cells in untreated mice and those treated with two MCM, granulocyte-colony stimulating factor and Amifostine, further characterized and validated our model for use in screening studies and pivotal efficacy studies of candidate MCM for licensure to treat irradiated individuals suffering from H-ARS. PMID:22929467

  8. Human cytomegalovirus inhibits erythropoietin production.

    PubMed

    Butler, Lynn M; Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia

    2014-08-01

    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients.

  9. Antibody blockade of IL-17 family cytokines in immunity to acute murine oral mucosal candidiasis.

    PubMed

    Whibley, Natasha; Tritto, Elaine; Traggiai, Elisabetta; Kolbinger, Frank; Moulin, Pierre; Brees, Dominique; Coleman, Bianca M; Mamo, Anna J; Garg, Abhishek V; Jaycox, Jillian R; Siebenlist, Ulrich; Kammüller, Michael; Gaffen, Sarah L

    2016-06-01

    Antibodies targeting IL-17A or its receptor, IL-17RA, are approved to treat psoriasis and are being evaluated for other autoimmune conditions. Conversely, IL-17 signaling is critical for immunity to opportunistic mucosal infections caused by the commensal fungus Candida albicans, as mice and humans lacking the IL-17R experience chronic mucosal candidiasis. IL-17A, IL-17F, and IL-17AF bind the IL-17RA-IL-17RC heterodimeric complex and deliver qualitatively similar signals through the adaptor Act1. Here, we used a mouse model of acute oropharyngeal candidiasis to assess the impact of blocking IL-17 family cytokines compared with specific IL-17 cytokine gene knockout mice. Anti-IL-17A antibodies, which neutralize IL-17A and IL-17AF, caused elevated oral fungal loads, whereas anti-IL-17AF and anti-IL-17F antibodies did not. Notably, there was a cooperative effect of blocking IL-17A, IL-17AF, and IL-17F together. Termination of anti-IL-17A treatment was associated with rapid C. albicans clearance. IL-17F-deficient mice were fully resistant to oropharyngeal candidiasis, consistent with antibody blockade. However, IL-17A-deficient mice had lower fungal burdens than anti-IL-17A-treated mice. Act1-deficient mice were much more susceptible to oropharyngeal candidiasis than anti-IL-17A antibody-treated mice, yet anti-IL-17A and anti-IL-17RA treatment caused equivalent susceptibilities. Based on microarray analyses of the oral mucosa during infection, only a limited number of genes were associated with oropharyngeal candidiasis susceptibility. In sum, we conclude that IL-17A is the main cytokine mediator of immunity in murine oropharyngeal candidiasis, but a cooperative relationship among IL-17A, IL-17AF, and IL-17F exists in vivo. Susceptibility displays the following hierarchy: IL-17RA- or Act1-deficiency > anti-IL-17A + anti-IL-17F antibodies > anti-IL-17A or anti-IL-17RA antibodies > IL-17A deficiency.

  10. Enrichment of murine CD68+ CCR2+ and CD68+ CD206+ lung macrophages in acute pancreatitis-associated acute lung injury.

    PubMed

    Akbarshahi, Hamid; Menzel, Mandy; Posaric Bauden, Monika; Rosendahl, Ann; Andersson, Roland

    2012-01-01

    Acute lung injury (ALI) is an important cause of mortality in critically ill patients. Acute pancreatitis (AP) is one of the risk factors for developing this syndrome. Among the inflammatory cells, macrophages have a key role in determining the severity of the acute lung injury. In the lungs, macrophages constitute a heterogeneous cell population distributed in different compartments. Changes in not only the macrophage count, but also in their phenotype have been seen during the course of lung injury. A murine ductal ligation model of acute pancreatitis showed substantial morphological changes in the pancreas and lungs. Immunohistochemistry showed neutrophil recruitment into both organs after 9 hours and later on. F4/80(+) cells in the pancreas increased in the ligated animals, though there was not a significant difference in their number in the lungs as compared to sham operated animals. Flow cytometry analysis of lung macrophages demonstrated an enrichment of F4/80(-) CD68(+)CCR2(+) and F4/80(-) CD68(+)CD206(+) lung macrophages in ligated animals (AP) as compared to the sham operated group. The level of interleukin-6 in plasma increased 3 hours after ligation compared to the sham operated group, as a first indicator of a systemic inflammatory response.This study suggests a role for F4/80(-) CD68(+) macrophages in the pathogenesis of acute lung injury in acute pancreatitis. Studying lung macrophages for different phenotypic markers, their polarization, activation and recruitment, in the context of acute lung injury, is a novel area to potentially identify interventions which may improve the outcome of acute lung injury.

  11. Intravenous Immunoglobulin Prevents Murine Antibody-Mediated Acute Lung Injury at the Level of Neutrophil Reactive Oxygen Species (ROS) Production

    PubMed Central

    Semple, John W.; Kim, Michael; Hou, Jing; McVey, Mark; Lee, Young Jin; Tabuchi, Arata; Kuebler, Wolfgang M.; Chai, Zhong-Wei; Lazarus, Alan H.

    2012-01-01

    Transfusion-related acute lung injury (TRALI) is a leading cause of transfusion-associated mortality that can occur with any type of transfusion and is thought to be primarily due to donor antibodies activating pulmonary neutrophils in recipients. Recently, a large prospective case controlled clinical study of cardiac surgery patients demonstrated that despite implementation of male donors, a high incidence of TRALI still occurred and suggested a need for additional interventions in susceptible patient populations. To examine if intravenous immunoglobulin (IVIg) may be effective, a murine model of antibody-mediated acute lung injury that approximates human TRALI was examined. When BALB/c mice were injected with the anti-major histocompatibility complex class I antibody 34-1-2s, mild shock (reduced rectal temperature) and respiratory distress (dyspnea) were observed and pre-treatment of the mice with 2 g/kg IVIg completely prevented these symptoms. To determine IVIg's usefulness to affect severe lung damage, SCID mice, previously shown to be hypersensitive to 34-1-2s were used. SCID mice treated with 34-1-2s underwent severe shock, lung damage (increased wet/dry ratios) and 40% mortality within 2 hours. Treatment with 2 g/kg IVIg 18 hours before 34-1-2s administration completely protected the mice from all adverse events. Treatment with IVIg after symptoms began also reduced lung damage and mortality. While the prophylactic IVIg administration did not affect 34-1-2s-induced pulmonary neutrophil accumulation, bone marrow-derived neutrophils from the IVIg-treated mice displayed no spontaneous ROS production nor could they be stimulated in vitro with fMLP or 34-1-2s. These results suggest that IVIg prevents murine antibody-mediated acute lung injury at the level of neutrophil ROS production and thus, alleviating tissue damage. PMID:22363629

  12. [Mononucleosis caused by cytomegalovirus].

    PubMed

    Lajo Plaza, A; del Castillo Martín, F; Martínez Zapico, R

    1990-01-01

    Sixteen cases of mononucleosis due to cytomegalovirus, are presented. The selection of patients was based on clinical criteria. Symptoms are compared with another series of patients affected with mononucleosis by Epstein-Barr virus. We have not found differences comparing the fever, cervical adenopathies and faringoamigdalitis. Differences were significant in hepatomegaly. We conclude that the clinical picture of cytomegalovirus mononucleosis is very similar to those of the Epstein-Barr mononucleosis.

  13. Novel guggulsterone derivative GG-52 inhibits NF-kappaB signaling in intestinal epithelial cells and attenuates acute murine colitis.

    PubMed

    Kim, Jung Mogg; Kang, Hyoun Woo; Cha, Mi Yeon; Yoo, Doyoung; Kim, Nayoung; Kim, In-Kyoung; Ku, Jeounghun; Kim, Sunil; Ma, Sang-Ho; Jung, Hyun Chae; Song, In Sung; Kim, Joo Sung

    2010-07-01

    We already showed that the plant sterol guggulsterone has been reported to inhibit nuclear factor-kappaB (NF-kappaB) signaling in intestinal epithelial cells (IECs) and to attenuate dextran sulfate sodium (DSS)-induced colitis. This study investigates the anti-inflammatory effects of novel guggulsterone derivatives on IEC and preventive and therapeutic murine models of DSS-induced colitis. Novel guggulsterone derivates with high lipophilicity were designed and four derivates, including GG-46, GG-50B, GG-52, and GG-53, were synthesized. Two guggulsterone derivatives, GG-50B and GG-52, significantly inhibited the activated NF-kappaB signals and the upregulated expression of interleukin-8 (IL-8) in COLO 205 cells stimulated with tumor necrosis factor-alpha (TNF-alpha). Pretreatment with GG-50B and GG-52 attenuated the increased IkappaB kinase (IKK) and IkappaBalpha phsophorylation induced by TNF-alpha. In preventive and therapeutic models of murine colitis, administration of GG-52 significantly reduced the severity of DSS-induced colitis, as assessed by disease activity index, colon length, and histology. In contrast, GG-50B did not show a significant reduction in the colitis severity. Moreover, the efficacy on attenuating colitis by GG-52 was comparable to that by sulfasalazine or prednisolone. These results indicate that the novel guggulsterone derivative GG-52 blocks NF-kappaB activation in IEC and ameliorates DSS-induced acute murine colitis, which suggests that GG-52 is a potential therapeutic agent for the treatment of inflammatory bowel diseases.

  14. Murine B-1 B Cell Progenitors Initiate B-Acute Lymphoblastic Leukemia With Features of High Risk Disease1

    PubMed Central

    Montecino-Rodriguez, Encarnacion; Li, Katy; Fice, Michael; Dorshkind, Kenneth

    2014-01-01

    B-1 and B-2 B cells derive from distinct progenitors that emerge in overlapping waves of development. The number of murine B-1 progenitors peaks during fetal development while B-2 B cell production predominates in adult bone marrow. Many genetic mutations that underlie B-acute lymphoblastic leukemia (B-ALL) occur in the fetus, at which time B-1 progenitor numbers are high. However, whether B-ALL can initiate in B-1 progenitors is unknown. We now report that BCR-ABL transformed murine B-1 progenitors can be B-ALL cells of origin and demonstrate that they initiate disease more rapidly than oncogene expressing B-2 progenitors. We further demonstrate that B-1 progenitors exhibit relative resistance to apoptosis and undergo significant growth following oncogene expression and propose that these properties underlie the accelerated kinetics with which they initiate leukemia. These results provide a developmental perspective on the origin of B-ALL and indicate B cell lineage as a factor influencing disease progression. PMID:24752443

  15. Altered Lipid Composition of Surfactant and Lung Tissue in Murine Experimental Malaria-Associated Acute Respiratory Distress Syndrome.

    PubMed

    Scaccabarozzi, Diletta; Deroost, Katrien; Lays, Natacha; Omodeo Salè, Fausta; Van den Steen, Philippe E; Taramelli, Donatella

    2015-01-01

    Malaria-associated acute lung injury (MA-ALI) and its more severe form malaria-associated acute respiratory distress syndrome (MA-ARDS) are common, often fatal complications of severe malaria infections. However, little is known about their pathogenesis. In this study, biochemical alterations of the lipid composition of the lungs were investigated as possible contributing factors to the severity of murine MA-ALI/ARDS. C57BL/6J mice were infected with Plasmodium berghei NK65 to induce lethal MA-ARDS, or with Plasmodium chabaudi AS, a parasite strain that does not induce lung pathology. The lipid profile of the lung tissue from mice infected with Plasmodium berghei NK65 developing MA-ALI/ARDS, but not that from mice without lung pathology or controls, was characterized by high levels of phospholipids -mainly phosphatidylcholine- and esterified cholesterol. The high levels of polyunsaturated fatty acids and the linoleic/oleic fatty acid ratio of the latter reflect the fatty acid composition of plasma cholesterol esters. In spite of the increased total polyunsaturated fatty acid pool, which augments the relative oxidability of the lung membranes, and the presence of hemozoin, a known pro-oxidant, no excess oxidative stress was detected in the lungs of Plasmodium berghei NK65 infected mice. The bronchoalveolar lavage (BAL) fluid of Plasmodium berghei NK65 infected mice was characterized by high levels of plasma proteins. The phospholipid profile of BAL large and small aggregate fractions was also different from uninfected controls, with a significant increase in the amounts of sphingomyelin and lysophosphatidylcholine and the decrease in phosphatidylglycerol. Both the increase of proteins and lysophosphatidylcholine are known to decrease the intrinsic surface activity of surfactant. Together, these data indicate that an altered lipid composition of lung tissue and BAL fluid, partially ascribed to oedema and lipoprotein infiltration, is a characteristic feature of murine

  16. Induction of acute thrombocytopenia and infection of megakaryocytes by Rauscher murine leukemia virus reflect the genetic susceptibility to leukemogenesis

    PubMed Central

    1983-01-01

    Acute thrombocytopenia and megakaryocyte infection have been investigated during the preleukemic phase of the disease induced by the Rauscher murine leukemia virus (RMuLV) in mice. Injection of RMuLV, either intravenously or intraperitoneally, rapidly induced thrombocytopenia, possibly as a result of direct interaction between platelets and viral particles. The susceptibility to this acute thrombocytopenia was genetically controlled and was inherited as a dominant trait. Murine strains with H-2d or H-2k haplotype, which are susceptible to the induction of leukemia by RMuLV, developed thrombocytopenia, whereas leukemia-resistant H-2b and H-2q strains of mice failed to develop thrombocytopenia. Using B10 H-2-congenic and intra-H-2-recombinant mice, it was shown that the susceptibility to RMuLV-induced thrombocytopenia was controlled by gene(s) in or closely linked to the D region of the H-2 complex. Megakaryocytes may be one of the first sites for the replication of RMuLV. Indeed, among bone marrow cells, only megakaryocytes expressed viral antigens gp70 and p30 during the initial phase of RMuLV infection. In addition, megakaryocytes from infected mice were able to transfer preleukemic thrombocytopenia as well as leukemia in syngeneic mice. The infection of megakaryocytes by RMuLV appears to be genetically controlled in a manner similar to the induction of thrombocytopenia, since only the megakaryocytes from mice developing thrombocytopenia were infected by RMuLV. These results indicate that the gene(s) governing the induction of thrombocytopenia by RMuLV may be the same gene(s) (or closely linked to the gene) that controls the susceptibility to leukemogenesis, and would be consistent with the expression of the gene product, presumably a receptor-like molecule for RMuLV, on platelet and megakaryocyte membranes. PMID:6833948

  17. Altered Lipid Composition of Surfactant and Lung Tissue in Murine Experimental Malaria-Associated Acute Respiratory Distress Syndrome

    PubMed Central

    Scaccabarozzi, Diletta; Deroost, Katrien; Lays, Natacha; Taramelli, Donatella

    2015-01-01

    Malaria-associated acute lung injury (MA-ALI) and its more severe form malaria-associated acute respiratory distress syndrome (MA-ARDS) are common, often fatal complications of severe malaria infections. However, little is known about their pathogenesis. In this study, biochemical alterations of the lipid composition of the lungs were investigated as possible contributing factors to the severity of murine MA-ALI/ARDS. C57BL/6J mice were infected with Plasmodium berghei NK65 to induce lethal MA-ARDS, or with Plasmodium chabaudi AS, a parasite strain that does not induce lung pathology. The lipid profile of the lung tissue from mice infected with Plasmodium berghei NK65 developing MA-ALI/ARDS, but not that from mice without lung pathology or controls, was characterized by high levels of phospholipids -mainly phosphatidylcholine- and esterified cholesterol. The high levels of polyunsaturated fatty acids and the linoleic/oleic fatty acid ratio of the latter reflect the fatty acid composition of plasma cholesterol esters. In spite of the increased total polyunsaturated fatty acid pool, which augments the relative oxidability of the lung membranes, and the presence of hemozoin, a known pro-oxidant, no excess oxidative stress was detected in the lungs of Plasmodium berghei NK65 infected mice. The bronchoalveolar lavage (BAL) fluid of Plasmodium berghei NK65 infected mice was characterized by high levels of plasma proteins. The phospholipid profile of BAL large and small aggregate fractions was also different from uninfected controls, with a significant increase in the amounts of sphingomyelin and lysophosphatidylcholine and the decrease in phosphatidylglycerol. Both the increase of proteins and lysophosphatidylcholine are known to decrease the intrinsic surface activity of surfactant. Together, these data indicate that an altered lipid composition of lung tissue and BAL fluid, partially ascribed to oedema and lipoprotein infiltration, is a characteristic feature of murine

  18. MN1–Fli1 oncofusion transforms murine hematopoietic progenitor cells into acute megakaryoblastic leukemia cells

    PubMed Central

    Wenge, D V; Felipe-Fumero, E; Angenendt, L; Schliemann, C; Schmidt, E; Schmidt, L H; Thiede, C; Ehninger, G; Berdel, W E; Arteaga, M-F; Mikesch, J-H

    2015-01-01

    Long-term outcome of acute megakaryoblastic leukemia (AMKL) patients without Down's syndrome remains poor. Founding mutations and chimeric oncogenes characterize various AMKL subtypes. However, for around one third of all cases the underlying mechanisms of AMKL leukemogenesis are still largely unknown. Recently, an in-frame fusion of meningeoma 1–friend leukemia virus integration 1 (MN1–Fli1) gene was detected in a child with AMKL. We intended to investigate the potential role of this oncofusion in leukemogenesis of acute myeloid leukemia. Strikingly, expression of MN1–Fli1 in murine hematopoietic progenitor cells was sufficient to induce leukemic transformation generating immature myeloid cells with cytomorphology and expression of surface markers typical for AMKL. Systematic structure function analyses revealed FLS and 3′ETS domains of Fli1 as decisive domains for the AMKL phenotype. Our data highlight an important role of MN1–Fli1 in AMKL leukemogenesis and provide a basis for research assessing the value of this oncofusion as a future diagnostic marker and/or therapeutic target in AMKL patients. PMID:26690545

  19. Development of a non-invasive murine infection model for acute otitis media.

    PubMed

    Stol, K; van Selm, S; van den Berg, S; Bootsma, H J; Blokx, W A M; Graamans, K; Tonnaer, E L G M; Hermans, P W M

    2009-12-01

    Otitis media (OM) is one of the most frequent diseases in childhood, and Streptococcus pneumoniae is among the main causative bacterial agents. Since current experimental models used to study the bacterial pathogenesis of OM have several limitations, such as the invasiveness of the experimental procedures, we developed a non-invasive murine OM model. In our model, adapted from a previously developed rat OM model, a pressure cabin is used in which a 40 kPa pressure increase is applied to translocate pneumococci from the nasopharyngeal cavity into both mouse middle ears. Wild-type pneumococci were found to persist in the middle ear cavity for 144 h after infection, with a maximum bacterial load at 96 h. Inflammation was confirmed at 96 and 144 h post-infection by IL-1beta and TNF-alpha cytokine analysis and histopathology. Subsequently, we investigated the contribution of two surface-associated pneumococcal proteins, the streptococcal lipoprotein rotamase A (SlrA) and the putative proteinase maturation protein A (PpmA), to experimental OM in our model. Pneumococci lacking the slrA gene, but not those lacking the ppmA gene, were significantly reduced in virulence in the OM model. Importantly, pneumococci lacking both genes were significantly more attenuated than the DeltaslrA single mutant. This additive effect suggests that SlrA and PpmA exert complementary functions during experimental OM. In conclusion, we have developed a highly reproducible and non-invasive murine infection model for pneumococcal OM using a pressure cabin, which is very suitable to study pneumococcal pathogenesis and virulence in vivo.

  20. Hearing Loss and Cytomegalovirus.

    ERIC Educational Resources Information Center

    Strauss, Melvin

    1997-01-01

    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  1. Murine Models of Acute Alcoholic Hepatitis and Their Relevance to Human Disease.

    PubMed

    Wilkin, Richard J W; Lalor, Patricia F; Parker, Richard; Newsome, Philip N

    2016-04-01

    Alcohol-induced liver damage is a major burden for most societies, and murine studies can provide a means to better understand its pathogenesis and test new therapies. However, there are many models reported with widely differing phenotypes, not all of which fully regenerate the spectrum of human disease. Thus, it is important to understand the implications of these variations to efficiently model human disease. This review critically appraises key articles in the field, detailing the spectrum of liver damage seen in different models, and how they relate to the phenotype of disease seen in patients. A range of different methods of alcohol administration have been studied, ranging from ad libitum consumption of alcohol and water to modified diets (eg, Lieber deCarli liquid diet). Other feeding regimens have taken more invasive routes using intragastric feeding tubes to infuse alcohol directly into the stomach. Notably, models using wild-type mice generally produce a milder phenotype of liver damage than those using genetically modified mice, with the exception of the chronic binge-feeding model. We recommend panels of tests for consideration to standardize end points for the evaluation of the severity of liver damage-key for comparison of models of injury, testing of new therapies, and subsequent translation of findings into clinical practice. PMID:26835538

  2. The effect of intra-articular vanilloid receptor agonists on pain behavior measures in a murine model of acute monoarthritis

    PubMed Central

    Abdullah, Mishal; Mahowald, Maren L; Frizelle, Sandra P; Dorman, Christopher W; Funkenbusch, Sonia C; Krug, Hollis E

    2016-01-01

    Arthritis is the most common cause of disability in the US, and the primary manifestation of arthritis is joint pain that leads to progressive physical limitation, disability, morbidity, and increased health care utilization. Capsaicin (CAP) is a vanilloid agonist that causes substance P depletion by interacting with vanilloid receptor transient receptor potential V1 on small unmyelinated C fibers. It has been used topically for analgesia in osteoarthritis with variable success. Resiniferatoxin (RTX) is an ultra potent CAP analog. The aim of this study was to measure the analgesic effects of intra-articular (IA) administration of CAP and RTX in experimental acute inflammatory arthritis in mice. Evoked pain score (EPS) and a dynamic weight bearing (DWB) device were used to measure nociceptive behaviors in a murine model of acute inflammatory monoarthritis. A total of 56 C57B16 male mice underwent EPS and DWB testing – 24 nonarthritic controls and 32 mice with carrageenan-induced arthritis. The effects of pretreatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX were measured. Nociception was reproducibly demonstrated by increased EPS and reduced DWB measures in the affected limb of arthritic mice. Pretreatment with 0.001% RTX resulted in statistically significant improvement in EPS and DWB measures when compared with those observed in carrageenan-induced arthritis animals. Pretreatment with IA 0.0003% RTX and IA 0.01% CAP resulted in improvement in some but not all of these measures. The remaining 24 mice underwent evaluation following treatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX, and the results obtained were similar to that of naïve, nonarthritic mice. PMID:27574462

  3. The effect of intra-articular vanilloid receptor agonists on pain behavior measures in a murine model of acute monoarthritis.

    PubMed

    Abdullah, Mishal; Mahowald, Maren L; Frizelle, Sandra P; Dorman, Christopher W; Funkenbusch, Sonia C; Krug, Hollis E

    2016-01-01

    Arthritis is the most common cause of disability in the US, and the primary manifestation of arthritis is joint pain that leads to progressive physical limitation, disability, morbidity, and increased health care utilization. Capsaicin (CAP) is a vanilloid agonist that causes substance P depletion by interacting with vanilloid receptor transient receptor potential V1 on small unmyelinated C fibers. It has been used topically for analgesia in osteoarthritis with variable success. Resiniferatoxin (RTX) is an ultra potent CAP analog. The aim of this study was to measure the analgesic effects of intra-articular (IA) administration of CAP and RTX in experimental acute inflammatory arthritis in mice. Evoked pain score (EPS) and a dynamic weight bearing (DWB) device were used to measure nociceptive behaviors in a murine model of acute inflammatory monoarthritis. A total of 56 C57B16 male mice underwent EPS and DWB testing - 24 nonarthritic controls and 32 mice with carrageenan-induced arthritis. The effects of pretreatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX were measured. Nociception was reproducibly demonstrated by increased EPS and reduced DWB measures in the affected limb of arthritic mice. Pretreatment with 0.001% RTX resulted in statistically significant improvement in EPS and DWB measures when compared with those observed in carrageenan-induced arthritis animals. Pretreatment with IA 0.0003% RTX and IA 0.01% CAP resulted in improvement in some but not all of these measures. The remaining 24 mice underwent evaluation following treatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX, and the results obtained were similar to that of naïve, nonarthritic mice. PMID:27574462

  4. Pro-inflammatory potential of Escherichia coli strains K12 and Nissle 1917 in a murine model of acute ileitis.

    PubMed

    Bereswill, S; Fischer, A; Dunay, I R; Kühl, A A; Göbel, U B; Liesenfeld, O; Heimesaat, M M

    2013-06-01

    Non-pathogenic Escherichia coli (Ec) strains K12 (EcK12) and Nissle 1917 (EcN) are used for gene technology and probiotic treatment of intestinal inflammation, respectively. We investigated intestinal colonization and potential pro-inflammatory properties of EcK12, EcN, and commensal E. coli (EcCo) strains in Toxoplasma (T.) gondii-induced acute ileitis. Whereas gnotobiotic animals generated by quintuple antibiotic treatment were protected from ileitis, mice replenished with conventional microbiota suffered from small intestinal necrosis 7 days post-T. gondii infection (p.i.). Irrespective of the Ec strain, recolonized mice revealed mild to moderate histopathological changes in their ileal mucosa. Upon stable recolonization with EcK12, EcN, or EcCo, development of inflammation was accompanied by pro-inflammatory responses at day 7 p.i., including increased ileal T lymphocyte and apoptotic cell numbers compared to T. gondii-infected gnotobiotic controls. Strikingly, either Ec strain was capable to translocate to extra-intestinal locations, such as MLN, spleen, and liver. Taken together, Ec strains used in gene technology and probiotic treatment are able to exert inflammatory responses in a murine model of small intestinal inflammation. In conclusion, the therapeutic use of Ec strains in patients with broad-spectrum antibiotic treatment and/or intestinal inflammation should be considered with caution. PMID:24265929

  5. Acute Inhibition of MEK Suppresses Congenital Melanocytic Nevus Syndrome in a Murine Model Driven by Activated NRAS and Wnt Signaling.

    PubMed

    Pawlikowski, Jeffrey S; Brock, Claire; Chen, Sheau-Chiann; Al-Olabi, Lara; Nixon, Colin; McGregor, Fiona; Paine, Simon; Chanudet, Estelle; Lambie, Wendy; Holmes, William M; Mullin, James M; Richmond, Ann; Wu, Hong; Blyth, Karen; King, Ayala; Kinsler, Veronica A; Adams, Peter D

    2015-08-01

    Congenital melanocytic nevus (CMN) syndrome is the association of pigmented melanocytic nevi with extra-cutaneous features, classically melanotic cells within the central nervous system, most frequently caused by a mutation of NRAS codon 61. This condition is currently untreatable and carries a significant risk of melanoma within the skin, brain, or leptomeninges. We have previously proposed a key role for Wnt signaling in the formation of melanocytic nevi, suggesting that activated Wnt signaling may be synergistic with activated NRAS in the pathogenesis of CMN syndrome. Some familial pre-disposition suggests a germ-line contribution to CMN syndrome, as does variability of neurological phenotypes in individuals with similar cutaneous phenotypes. Accordingly, we performed exome sequencing of germ-line DNA from patients with CMN to reveal rare or undescribed Wnt-signaling alterations. A murine model harboring activated NRAS(Q61K) and Wnt signaling in melanocytes exhibited striking features of CMN syndrome, in particular neurological involvement. In the first model of treatment for this condition, these congenital, and previously assumed permanent, features were profoundly suppressed by acute post-natal treatment with a MEK inhibitor. These data suggest that activated NRAS and aberrant Wnt signaling conspire to drive CMN syndrome. Post-natal MEK inhibition is a potential candidate therapy for patients with this debilitating condition.

  6. Upregulation of ICOS on CD43+ CD4+ murine small intestinal intraepithelial lymphocytes during acute reovirus infection

    SciTech Connect

    Montufar-Solis, Dina; Garza, Tomas; Teng, B.-B.; Klein, John R. . E-mail: john.r.klein@uth.tmc.edu

    2006-04-14

    Murine intestinal intraepithelial lymphocytes (IELs) can be classified according to expression of a CD43 glycoform recognized by the S7 monoclonal antibody. In this study, we examined the response of S7+ and S7- IELs in mice during acute reovirus serotype 3 (Dearing strain) infection, which was confirmed by virus-specific real-time PCR. In vivo proliferation increased significantly for both S7- and S7+ IELs on day 4 post-infection as determined by BrdU incorporation; however, expression of the inducible costimulatory (ICOS) molecule, which peaked on day 7 post-infection, was upregulated on S7+ CD4+ T cells, most of which were CD4+8- IELs. In vitro ICOS stimulation by syngeneic peritoneal macrophages induced IFN-{gamma} secretion from IELs from day 7 infected mice, and was suppressed by treatment with anti-ICOS mAb. Additionally, IFN-{gamma} mRNA increased in CD4+ IELs on day 6 post-infection. These findings indicate that S7- and S7+ IELs are differentially mobilized during the immune response to reovirus infection; that the regulated expression of ICOS is associated with S7+ IELs; and that stimulation of IELs through ICOS enhances IFN-{gamma} synthesis during infection.

  7. Exploiting the antivirulence efficacy of an ajoene-ciprofloxacin combination against Pseudomonas aeruginosa biofilm associated murine acute pyelonephritis.

    PubMed

    Vadekeetil, Anitha; Saini, Hina; Chhibber, Sanjay; Harjai, Kusum

    2016-01-01

    The study investigated the in vitro, ex vivo and in vivo efficacy of ajoene and ciprofloxacin (CIP) alone and in combination against Pseudomonas aeruginosa biofilms and biofilm-associated murine acute pyelonephritis. The ajoene-CIP combination exhibited significant greater (p < 0.05) antimotility and biofilm inhibitory effects than those obtained when they were applied individually. The combined action of the agents resulted in a significant increase in serum sensitivity and phagocytic uptake and killing of P. aeruginosa (p < 0.001) compared to the untreated control. Mice groups treated with an ajoene (25 mg kg(-1)) and CIP (30 mg kg(-1) or 15 mg kg(-1)) combination showed a significantly (p < 0.001) reduced bacterial load in the kidney and bladder as compared to that of infected controls and mice treated with solo agents on the fifth day post-infection. The decreased levels of biomarkers and photomicrographs of the kidney tissue of the treated mice showed a reduced severity of damage. Hence, the study highlights the antivirulent and therapeutic efficacy of the ajoene-CIP combination at the minimal dosage of CIP.

  8. Identification of an acute-phase reactant in murine infections with Trypanosoma brucei.

    PubMed Central

    Shapiro, S Z; Black, S J

    1992-01-01

    A 42-kDa protein appeared at a much higher concentration in plasma from Trypanosoma brucei-resistant (C57BL/6) mice after infection than in plasma from trypanosome-susceptible (C3H/He) mice. This protein was purified by sequential steps of gel filtration, protein A-Sepharose affinity chromatography, isoelectric focusing, and ammonium sulfate precipitation. The purified protein was identified as a subunit of the acute-phase reactant haptoglobin. Causes of elevated plasma haptoglobin and its implications for resistance to trypanosomiasis are discussed. Images PMID:1500201

  9. Xenotransplantation and porcine cytomegalovirus.

    PubMed

    Denner, Joachim

    2015-01-01

    Porcine microorganisms may be transmitted to the human recipient when xenotransplantation with pig cells, tissues, and organs will be performed. Most of such microorganisms can be eliminated from the donor pig by specified or designated pathogen-free production of the animals. As human cytomegalovirus causes severe transplant rejection in allotransplantation, considerable concern is warranted on the potential pathogenicity of porcine cytomegalovirus (PCMV) in the setting of xenotransplantation. On the other hand, despite having a similar name, PCMV is different from HCMV. The impact of PCMV infection on pigs is known; however, the influence of PCMV on the human transplant recipient is unclear. However, first transplantations of pig organs infected with PCMV into non-human primates were associated with a significant reduction of the survival time of the transplants. Sensitive detection methods and strategies for elimination of PCMV from donor herds are required.

  10. Acute GVHD results in a severe DC defect that prevents T-cell priming and leads to fulminant cytomegalovirus disease in mice.

    PubMed

    Wikstrom, Matthew E; Fleming, Peter; Kuns, Rachel D; Schuster, Iona S; Voigt, Valentina; Miller, Gregory; Clouston, Andrew D; Tey, Siok-Keen; Andoniou, Christopher E; Hill, Geoffrey R; Degli-Esposti, Mariapia A

    2015-09-17

    Viral infection is a common, life-threatening complication after allogeneic bone marrow transplantation (BMT), particularly in the presence of graft-versus-host disease (GVHD). Using cytomegalovirus (CMV) as the prototypic pathogen, we have delineated the mechanisms responsible for the inability to mount protective antiviral responses in this setting. Although CMV infection was self-limiting after syngeneic BMT, in the presence of GVHD after allogeneic BMT, CMV induced a striking cytopathy resulting in universal mortality in conjunction with a fulminant necrotizing hepatitis. Critically, GVHD induced a profound dendritic cell (DC) defect that led to a failure in the generation of CMV-specific CD8(+) T-cell responses. This was accompanied by a defect in antiviral CD8(+) T cells. In combination, these defects dramatically limited antiviral T-cell responses. The transfer of virus-specific cells circumvented the DC defects and provided protective immunity, despite concurrent GVHD. These data demonstrate the importance of avoiding GVHD when reconstructing antiviral immunity after BMT, and highlight the mechanisms by which the adoptive transfer of virus-specific T cells overcome the endogenous defects in priming invoked by GVHD.

  11. Cytomegalovirus: the stealth virus.

    PubMed

    Robinson, Sharon

    2016-05-01

    Cytomegalovirus (CMV) is an infection, part of the herpes family of viruses which, if contracted during pregnancy, cancause devastating effects on the newborn baby. This article is written by the trustee of a volunteer-based charity, mostly run by mothers of CMV children, who are striving to raise awareness of this infection, which is more common than Down's syndrome, listeria and toxoplasmosis, and is theprimary preventable cause of childhood hearing loss.

  12. Abrogation of plasminogen activator inhibitor-1-vitronectin interaction ameliorates acute kidney injury in murine endotoxemia.

    PubMed

    Gupta, Kamlesh K; Donahue, Deborah L; Sandoval-Cooper, Mayra J; Castellino, Francis J; Ploplis, Victoria A

    2015-01-01

    Sepsis-induced acute kidney injury (AKI) contributes to the high mortality and morbidity in patients. Although the pathogenesis of AKI during sepsis is poorly understood, it is well accepted that plasminogen activator inhibitor-1 (PAI-1) and vitronectin (Vn) are involved in AKI. However, the functional cooperation between PAI-1 and Vn in septic AKI has not been completely elucidated. To address this issue, mice were utilized lacking either PAI-1 (PAI-1-/-) or expressing a PAI-1-mutant (PAI-1R101A/Q123K) in which the interaction between PAI-1 and Vn is abrogated, while other functions of PAI-1 are retained. It was found that both PAI-1-/- and PAI-1R101A/Q123K mice are associated with decreased renal dysfunction, apoptosis, inflammation, and ERK activation as compared to wild-type (WT) mice after LPS challenge. Also, PAI-1-/- mice showed attenuated fibrin deposition in the kidneys. Furthermore, a lack of PAI-1 or PAI-1-Vn interaction was found to be associated with an increase in activated Protein C (aPC) in plasma. These results demonstrate that PAI-1, through its interaction with Vn, exerts multiple deleterious mechanisms to induce AKI. Therefore, targeting of the PAI-1-Vn interaction in kidney represents an appealing therapeutic strategy for the treatment of septic AKI by not only altering the fibrinolytic capacity but also regulating PC activity.

  13. The nsp2 Replicase Proteins of Murine Hepatitis Virus and Severe Acute Respiratory Syndrome Coronavirus Are Dispensable for Viral Replication

    PubMed Central

    Graham, Rachel L.; Sims, Amy C.; Brockway, Sarah M.; Baric, Ralph S.; Denison, Mark R.

    2005-01-01

    The positive-stranded RNA genome of the coronaviruses is translated from ORF1 to yield polyproteins that are proteolytically processed into intermediate and mature nonstructural proteins (nsps). Murine hepatitis virus (MHV) and severe acute respiratory syndrome coronavirus (SARS-CoV) polyproteins incorporate 16 protein domains (nsps), with nsp1 and nsp2 being the most variable among the coronaviruses and having no experimentally confirmed or predicted functions in replication. To determine if nsp2 is essential for viral replication, MHV and SARS-CoV genome RNA was generated with deletions of the nsp2 coding sequence (MHVΔnsp2 and SARSΔnsp2, respectively). Infectious MHVΔnsp2 and SARSΔnsp2 viruses recovered from electroporated cells had 0.5 to 1 log10 reductions in peak titers in single-cycle growth assays, as well as a reduction in viral RNA synthesis that was not specific for any positive-stranded RNA species. The Δnsp2 mutant viruses lacked expression of both nsp2 and an nsp2-nsp3 precursor, but cleaved the engineered chimeric nsp1-nsp3 cleavage site as efficiently as the native nsp1-nsp2 cleavage site. Replication complexes in MHVΔnsp2-infected cells lacked nsp2 but were morphologically indistinguishable from those of wild-type MHV by immunofluorescence. nsp2 expressed in cells by stable retroviral transduction was specifically recruited to viral replication complexes upon infection with MHVΔnsp2. These results demonstrate that while nsp2 of MHV and SARS-CoV is dispensable for viral replication in cell culture, deletion of the nsp2 coding sequence attenuates viral growth and RNA synthesis. These findings also provide a system for the study of determinants of nsp targeting and function. PMID:16227261

  14. The nsp2 replicase proteins of murine hepatitis virus and severe acute respiratory syndrome coronavirus are dispensable for viral replication.

    PubMed

    Graham, Rachel L; Sims, Amy C; Brockway, Sarah M; Baric, Ralph S; Denison, Mark R

    2005-11-01

    The positive-stranded RNA genome of the coronaviruses is translated from ORF1 to yield polyproteins that are proteolytically processed into intermediate and mature nonstructural proteins (nsps). Murine hepatitis virus (MHV) and severe acute respiratory syndrome coronavirus (SARS-CoV) polyproteins incorporate 16 protein domains (nsps), with nsp1 and nsp2 being the most variable among the coronaviruses and having no experimentally confirmed or predicted functions in replication. To determine if nsp2 is essential for viral replication, MHV and SARS-CoV genome RNA was generated with deletions of the nsp2 coding sequence (MHVDeltansp2 and SARSDeltansp2, respectively). Infectious MHVDeltansp2 and SARSDeltansp2 viruses recovered from electroporated cells had 0.5 to 1 log10 reductions in peak titers in single-cycle growth assays, as well as a reduction in viral RNA synthesis that was not specific for any positive-stranded RNA species. The Deltansp2 mutant viruses lacked expression of both nsp2 and an nsp2-nsp3 precursor, but cleaved the engineered chimeric nsp1-nsp3 cleavage site as efficiently as the native nsp1-nsp2 cleavage site. Replication complexes in MHVDeltansp2-infected cells lacked nsp2 but were morphologically indistinguishable from those of wild-type MHV by immunofluorescence. nsp2 expressed in cells by stable retroviral transduction was specifically recruited to viral replication complexes upon infection with MHVDeltansp2. These results demonstrate that while nsp2 of MHV and SARS-CoV is dispensable for viral replication in cell culture, deletion of the nsp2 coding sequence attenuates viral growth and RNA synthesis. These findings also provide a system for the study of determinants of nsp targeting and function. PMID:16227261

  15. Cannabidiol, a non-psychotropic plant-derived cannabinoid, decreases inflammation in a murine model of acute lung injury: role for the adenosine A(2A) receptor.

    PubMed

    Ribeiro, Alison; Ferraz-de-Paula, Viviane; Pinheiro, Milena L; Vitoretti, Luana B; Mariano-Souza, Domenica P; Quinteiro-Filho, Wanderley M; Akamine, Adriana T; Almeida, Vinícius I; Quevedo, João; Dal-Pizzol, Felipe; Hallak, Jaime E; Zuardi, Antônio W; Crippa, José A; Palermo-Neto, João

    2012-03-01

    Acute lung injury is an inflammatory condition for which treatment is mainly supportive because effective therapies have not been developed. Cannabidiol, a non-psychotropic cannabinoid component of marijuana (Cannabis sativa), has potent immunosuppressive and anti-inflammatory properties. Therefore, we investigated the possible anti-inflammatory effect of cannabidiol in a murine model of acute lung injury. Analysis of total inflammatory cells and differential in bronchoalveolar lavage fluid was used to characterize leukocyte migration into the lungs; myeloperoxidase activity of lung tissue and albumin concentration in the bronchoalveolar lavage fluid were analyzed by colorimetric assays; cytokine/chemokine production in the bronchoalveolar lavage fluid was also analyzed by Cytometric Bead Arrays and Enzyme-Linked Immunosorbent Assay (ELISA). A single dose of cannabidiol (20mg/kg) administered prior to the induction of LPS (lipopolysaccharide)-induced acute lung injury decreases leukocyte (specifically neutrophil) migration into the lungs, albumin concentration in the bronchoalveolar lavage fluid, myeloperoxidase activity in the lung tissue, and production of pro-inflammatory cytokines (TNF and IL-6) and chemokines (MCP-1 and MIP-2) 1, 2, and 4days after the induction of LPS-induced acute lung injury. Additionally, adenosine A(2A) receptor is involved in the anti-inflammatory effects of cannabidiol on LPS-induced acute lung injury because ZM241385 (4-(2-[7-Amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5]triazin-5-ylamino]ethyl)phenol) (a highly selective antagonist of adenosine A(2A) receptor) abrogated all of the anti-inflammatory effects of cannabidiol previously described. Thus, we show that cannabidiol has anti-inflammatory effects in a murine model of acute lung injury and that this effect is most likely associated with an increase in the extracellular adenosine offer and signaling through adenosine A(2A) receptor.

  16. Upregulated Tim-3/galectin-9 expressions in acute lung injury in a murine malarial model.

    PubMed

    Liu, Jinfeng; Xiao, Siyu; Huang, Shiguang; Pei, Fuquan; Lu, Fangli

    2016-02-01

    Malaria is the most relevant parasitic disease worldwide, and severe malaria is characterized by cerebral edema, acute lung injury (ALI), and multiple organ dysfunctions; however, the mechanisms of lung damage need to be better clarified. In this study, we used Kunming outbred mice infected with Plasmodium berghei ANKA (PbANKA) to elucidate the profiles of T cell immunoglobulin and mucin domain-3 (Tim-3) and its ligand galecin-9 (Gal-9) in the development of ALI. Mice were injected intraperitoneally with 10(6) PbANKA-infected red blood cells. The lungs and mediastinal lymph nodes (MLNs) were harvested at days 5, 10, 15, and 20 post infections (p.i.). The grade of lung injury was histopathologically evaluated. Tim-3- and Gal-9-positive cells in the lungs and MLNs were stained by immunohistochemistry, and the messenger RNA (mRNA) expressions of Tim-3, Gal-9, and related cytokines were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Bronchoalveolar lavage fluid (BALF) analyses were performed from days 18 to 20 p.i. The results showed that the pathological severities in the lungs were increased with times and the total protein level in the BALFs was significantly elevated in PbANKA-infected mice. The numbers of Gal-9(+) and Tim-3(+) cells in the lungs were significantly increased, and the mRNA levels of both Gal-9 and Tim-3 in the lungs and MLNs were over-expressed in PbANKA-infected mice. In conclusion, our data suggested that Tim-3/Gal-9 may play a role in PbANKA-induced ALI. PMID:26494364

  17. Upregulated Tim-3/galectin-9 expressions in acute lung injury in a murine malarial model.

    PubMed

    Liu, Jinfeng; Xiao, Siyu; Huang, Shiguang; Pei, Fuquan; Lu, Fangli

    2016-02-01

    Malaria is the most relevant parasitic disease worldwide, and severe malaria is characterized by cerebral edema, acute lung injury (ALI), and multiple organ dysfunctions; however, the mechanisms of lung damage need to be better clarified. In this study, we used Kunming outbred mice infected with Plasmodium berghei ANKA (PbANKA) to elucidate the profiles of T cell immunoglobulin and mucin domain-3 (Tim-3) and its ligand galecin-9 (Gal-9) in the development of ALI. Mice were injected intraperitoneally with 10(6) PbANKA-infected red blood cells. The lungs and mediastinal lymph nodes (MLNs) were harvested at days 5, 10, 15, and 20 post infections (p.i.). The grade of lung injury was histopathologically evaluated. Tim-3- and Gal-9-positive cells in the lungs and MLNs were stained by immunohistochemistry, and the messenger RNA (mRNA) expressions of Tim-3, Gal-9, and related cytokines were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Bronchoalveolar lavage fluid (BALF) analyses were performed from days 18 to 20 p.i. The results showed that the pathological severities in the lungs were increased with times and the total protein level in the BALFs was significantly elevated in PbANKA-infected mice. The numbers of Gal-9(+) and Tim-3(+) cells in the lungs were significantly increased, and the mRNA levels of both Gal-9 and Tim-3 in the lungs and MLNs were over-expressed in PbANKA-infected mice. In conclusion, our data suggested that Tim-3/Gal-9 may play a role in PbANKA-induced ALI.

  18. Impact of acute undernutrition on growth, ileal morphology and nutrient transport in a murine model

    PubMed Central

    Sampaio, I.C.; Medeiros, P.H.Q.S.; Rodrigues, F.A.P.; Cavalcante, P.A.; Ribeiro, S.A.; Oliveira, J.S.; Prata, M.M.G.; Costa, D.V.S.; Fonseca, S.G.C.; Guedes, M.M.; Soares, A.M.; Brito, G.A.C.; Havt, A.; Moore, S.R.; Lima, A.A.M.

    2016-01-01

    Undernutrition represents a major public health challenge for middle- and low-income countries. This study aimed to evaluate whether a multideficient Northeast Brazil regional basic diet (RBD) induces acute morphological and functional changes in the ileum of mice. Swiss mice (∼25 g) were allocated into two groups: i) control mice were fed a standard diet and II) undernourished mice were fed the RBD. After 7 days, mice were killed and the ileum collected for evaluation of electrophysiological parameters (Ussing chambers), transcription (RT-qPCR) and protein expression (western blotting) of intestinal transporters and tight junctions. Body weight gain was significantly decreased in the undernourished group, which also showed decreased crypt depth but no alterations in villus height. Electrophysiology measurements showed a reduced basal short circuit current (I sc) in the undernourished group, with no differences in transepithelial resistance. Specific substrate-evoked I sc related to affinity and efficacy (glutamine and alanyl-glutamine) were not different between groups, except for the maximum I sc (efficacy) induced by glucose. Transcription of Sglt1 and Pept1 was significantly higher in the undernourished group, while SN-2 transcription was decreased. No changes were found in transcription of CAT-1 and CFTR, while claudin-2 and occludin transcriptions were significantly increased in the undernourished group. Despite mRNA changes, SGLT-1, PEPT-1, claudin-2 and occludin protein expression showed no difference between groups. These results demonstrate early effects of the RBD on mice, which include reduced body weight and crypt depth in the absence of significant alterations to villus morphology, intestinal transporters and tight junction expression. PMID:27737316

  19. Conflicting Physiological and Genomic Cardiopulmonary Effects of Recruitment Maneuvers in Murine Acute Lung Injury

    PubMed Central

    Mekontso Dessap, Armand; Voiriot, Guillaume; Zhou, Tong; Marcos, Elisabeth; Dudek, Steven M.; Jacobson, Jeff R.; Machado, Roberto; Adnot, Serge; Brochard, Laurent; Maitre, Bernard

    2012-01-01

    Low tidal volume ventilation, although promoting atelectasis, is a protective strategy against ventilator-induced lung injury. Deep inflation (DI) recruitment maneuvers restore lung volumes, but potentially compromise lung parenchymal and vascular function via repetitive overdistention. Our objective was to examine cardiopulmonary physiological and transcriptional consequences of recruitment maneuvers. C57/BL6 mice challenged with either PBS or LPS via aspiration were placed on mechanical ventilation (5 h) using low tidal volume inflation (TI; 8 μl/g) alone or in combination with intermittent DIs (0.75 ml twice/min). Lung mechanics during TI ventilation significantly deteriorated, as assessed by forced oscillation technique and pressure–volume curves. DI mitigated the TI-induced alterations in lung mechanics, but induced a significant rise in right ventricle systolic pressures and pulmonary vascular resistances, especially in LPS-challenged animals. In addition, DI exacerbated the LPS-induced genome-wide lung inflammatory transcriptome, with prominent dysregulation of a gene cluster involving vascular processes, as well as increases in cytokine concentrations in bronchoalveolar lavage fluid and plasma. Gene ontology analyses of right ventricular tissue expression profiles also identified inflammatory signatures, as well as apoptosis and membrane organization ontologies, as potential elements in the response to acute pressure overload. Our results, although confirming the improvement in lung mechanics offered by DI, highlight a detrimental impact in sustaining inflammatory response and exacerbating lung vascular dysfunction, events contributing to increases in right ventricle afterload. These novel insights should be integrated into the clinical assessment of the risk/benefit of recruitment maneuver strategies. PMID:22135358

  20. Mast cells modulate acute ozone-induced inflammation of the murine lung

    SciTech Connect

    Kleeberger, S.R.; Seiden, J.E.; Levitt, R.C.; Zhang, L.Y. )

    1993-11-01

    We hypothesized that mast cells modulate lung inflammation that develops after acute ozone (O3) exposure. Two tests were done: (1) genetically mast-cell-deficient (WBB6F1-W/Wv, WCB6F1-SI/SId) and bone-marrow-transplanted W/Wv mice were exposed to O3 or filtered air, and the inflammatory responses were compared with those of mast-cell-sufficient congenic mice (WBB6F1-(+)/+, WCB6F1-(+)/+); (2) genetically O3-susceptible C57BL/6J mice were treated pharmacologically with putative mast-cell modulators or vehicle, and the O3-induced inflammatory responses were compared. Mice were exposed to 1.75 ppm O3 or air for 3 h, and lung inflammation was assessed by bronchoalveolar lavage (BAL) 6 and 24 h after exposure. Relative to O3-exposed W/Wv and SI/SId mice, the mean numbers of lavageable polymorphonuclear leukocytes (PMNs) and total BAL protein concentration (a marker of permeability) were significantly greater in the respective O3-exposed normal congenic +/+ mice (p < 0.05). Mast cells were reconstituted in W/Wv mice by transplantation of bone marrow cells from congenic +/+ mice, and O3-induced lung inflammation was assessed in the mast-cell-replete W/Wv mice. After O3 exposure, the changes in lavageable PMNs and total protein of mast-cell-replete W/Wv mice were not different from age-matched normal +/+ control mice, and they were significantly greater than those of sham-transplanted W/Wv mice (p < 0.05). Genetically susceptible C57BL/6J mice were pretreated with a mast-cell stabilizer (nedocromil sodium), secretagogue (compound 48/80), or vehicle, and the mice were exposed to O3.

  1. Cytomegalovirus Immunoglobulin After Thoracic Transplantation

    PubMed Central

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-01-01

    Abstract Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R−). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  2. Thermoinactivation of human cytomegalovirus.

    PubMed

    Vonka, V; Benyeshmelnick, M

    1966-01-01

    Vonka, Vladimir (Baylor University College of Medicine, Houston, Tex.), and Matilda Benyesh-Melnick. Thermoinactivation of human cytomegalovirus. J. Bacteriol. 91:221-226. 1966.-The inactivation at 4 and 37 C of several strains of human cytomegalovirus was studied. The preliminary findings that freshly harvested cytomegalovirus was inactivated more rapidly at 4 C than at higher temperatures was confirmed. Intracellular virus still within infected cells was found to be more stable at 4 C than virus released by sonic treatment just before incubation at 4 C. The composition of the diluent played an important role. In tris(hydroxymethyl)-aminomethane buffer, virus was unstable at both 4 and 37 C, with the rate of inactivation faster at 4 than at 37 C. Similar results were obtained when bicarbonate-phosphate buffer or Eagle's medium when bicarbonate was used as virus diluent. Calf serum stabilized the virus at 37 C, but not at 4 C. The deletion of bicarbonate from Eagle's medium had a stabilizing effect at both temperatures. An even greater stabilizing effect at both 4 and 37 C was obtained when distilled water was used as virus diluent. Inactivation rates varied from one strain to the next at 4 C but not at 37 C. Differences were found also with virus progeny derived from a single strain, but harvested at different stages during virus multiplication. Virus harvested early was more labile at 4 than at 37 C, whereas the late virus was more labile at the higher temperature. Intracellular and extracellular virus preparations were inactivated at the same rates at either 4 or 37 C.

  3. A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus.

    PubMed

    Andreoni, M; Faircloth, M; Vugler, L; Britt, W J

    1989-02-01

    We have developed a murine monoclonal antibody reactive with a major immediate early 72,000 dalton protein of human cytomegalovirus and utilized this reagent in a rapid virus titration and microneutralization assay. Because of the early expression of this virus encoded protein, both assays could be accomplished within 16 h following virus inoculation. In addition, both assays resulted in considerable savings of reagents because the assays were carried out in 96-well microtiter plates. These assays should prove useful in the preparation and study of neutralizing antibodies directed against human cytomegalovirus.

  4. Cytomegalovirus Primary Envelopment Occurs at Large Infoldings of the Inner Nuclear Membrane▿

    PubMed Central

    Buser, Christopher; Walther, Paul; Mertens, Thomas; Michel, Detlef

    2007-01-01

    We have investigated the morphogenesis of human and murine cytomegalovirus by transmission electron microscopy after high-pressure freezing, freeze substitution, and plastic embedding. We observed large tubular infoldings of the inner nuclear membrane that were free of lamina and active in primary envelopment and subsequent transport of capsids to the nuclear periphery. Semiquantitative determinations of the enlarged inner nuclear membrane area and the location of the primary envelopment of nucleocapsids demonstrated that this structure represents a virus-induced specialized membrane domain at which the particles are preferentially enveloped. This is a previously undescribed structural element relevant in cytomegalovirus morphogenesis. PMID:17192309

  5. Cytomegalovirus infection improves immune responses to influenza

    PubMed Central

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai; Angel, Cesar J Lopez; Onengut-Gumuscu, Suna; Kidd, Brian; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-01-01

    Cytomegalovirus (CMV) is a beta-herpes virus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV serostatus. In contrast, CMV-infected young adults exhibited an overall up-regulation of immune components including enhanced antibody responses to influenza vaccination, increased CD8+ T cell sensitivity, and elevated levels of circulating IFN-γ compared to uninfected individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the continued coexistence of CMV and mammals throughout their evolution. PMID:25834109

  6. RNA Profiling in Human and Murine Transplanted Hearts: Identification and Validation of Therapeutic Targets for Acute Cardiac and Renal Allograft Rejection

    PubMed Central

    Van Aelst, L. N. L.; Summer, G.; Li, S.; Gupta, S. K.; Heggermont, W.; De Vusser, K.; Carai, P.; Naesens, M.; Van Cleemput, J.; Van de Werf, F.; Vanhaecke, J.; Thum, T.; Waer, M.; Papageorgiou, A.‐P.; Schroen, B.

    2015-01-01

    Acute cellular rejection (ACR) is the adverse response of the recipient's immune system against the allogeneic graft. Using human surveillance endomyocardial biopsies (EMBs) manifesting ACR and murine allogeneic grafts, we profiled implicated microRNAs (miRs) and mRNAs. MiR profiling showed that miR‐21, ‐142‐3p, ‐142‐5p, ‐146a, ‐146b, ‐155, ‐222, ‐223, and ‐494 increased during ACR in humans and mice, whereas miR‐149‐5p decreased. mRNA profiling revealed 70 common differentially regulated transcripts, all involved in immune signaling and immune‐related diseases. Interestingly, 33 of 70 transcripts function downstream of IL‐6 and its transcription factor spleen focus forming virus proviral integration oncogene (SPI1), an established target of miR‐155, the most upregulated miR in human EMBs manifesting rejection. In a mouse model of cardiac transplantation, miR‐155 absence and pharmacological inhibition attenuated ACR, demonstrating the causal involvement and therapeutic potential of miRs. Finally, we corroborated our miR signature in acute cellular renal allograft rejection, suggesting a nonorgan specific signature of acute rejection. We concluded that miR and mRNA profiling in human and murine ACR revealed the shared significant dysregulation of immune genes. Inflammatory miRs, for example miR‐155, and transcripts, in particular those related to the IL‐6 pathway, are promising therapeutic targets to prevent acute allograft rejection. PMID:26249758

  7. The triterpenoid CDDO-Me delays murine acute graft-versus-host disease with the preservation of graft-versus-tumor effects after allogeneic bone marrow transplantation

    PubMed Central

    Li, Minghui; Sun, Kai; Redelman, Doug; Welniak, Lisbeth A.; Murphy, William J.

    2010-01-01

    The occurrence of acute graft-versus-host disease (GVHD) and tumor relapse represent the two major obstacles impeding the efficacy of allogeneic bone marrow transplantation (BMT) in cancer. We have previously shown that the synthetic triterpenoid CDDO can inhibit murine early acute GVHD but anti-tumor effects were not assessed. In the current study, we found that a new derivative of CDDO, CDDO-Me, had an increased ability to inhibit allogeneic T cell responses and induce cell death of alloreactive T cells in vitro. Administration of CDDO-Me to mice following allogeneic BMT resulted in significant and increased protection from acute lethal GVHD compared to CDDO. This correlated with reduced TNF-α production, reduced donor T cell proliferation and decreased adhesion molecule (α4β7 integrin) expression on the donor T cells. CDDO-Me was also superior to CDDO in inhibiting leukemia growth in vitro. When CDDO-Me was administered following an allogeneic BMT to leukemia-bearing mice, significant increases in survival were observed. These findings suggest that CDDO-Me is superior to CDDO in delaying acute GVHD while preserving or possibly even augmenting GVT effects. PMID:20338256

  8. [Infection by human cytomegalovirus].

    PubMed

    Sanbonmatsu Gámez, Sara; Ruiz, Mercedes Pérez; Navarro Marí, José María

    2014-02-01

    Prevalence of human cytomegalovirus infection is very high worldwide. Following primary infection, the virus remains latent, being able to cause recurrences either by reinfection with a new strain or by reactivation of the replication of the latent virus. The most severe disease is seen in congenital infection and in immunosuppressed patients, in whom the virus act as an opportunistic pathogen. Serological techniques are the methods of choice in primary infection and to determine the immune status against CMV in organ donor and receptor. Although well-standardized studies are lacking, the recent commercial availability of methods that measure cellular immune response are promising to predict the risk of CMV disease in immunosuppressed individuals. Molecular assays, that have gradually been substituting viral culture and/or antigen detection, are the most widely used methods for the diagnosis and control of CMV infection.

  9. A crucial role of sialidase Neu1 in hyaluronan receptor function of CD44 in T helper type 2-mediated airway inflammation of murine acute asthmatic model.

    PubMed

    Katoh, S; Maeda, S; Fukuoka, H; Wada, T; Moriya, S; Mori, A; Yamaguchi, K; Senda, S; Miyagi, T

    2010-08-01

    CD44 is a highly glycosylated cell adhesion molecule that is involved in lymphocyte infiltration of inflamed tissues. We have demonstrated previously that sialic acid residues of CD44 negatively regulates its receptor function and CD44 plays an important role in the accumulation of T helper type 2 (Th2) cells in the airway of a murine model of acute asthma. Here we evaluated the role of sialidase in the hyaluronic acid (HA) receptor function of CD44 expressed on CD4+ T cells, as well as in the development of a mite antigen-induced murine model of acute asthma. Splenic CD4+ T cell binding of HA was examined with flow cytometry. Expression of sialidases (Neu1, Neu2, Neu3 and Neu4) in spleen cells was evaluated by quantitative real-time reverse transcription-polymerase chain reaction. Airway inflammation and airway hyperresponsiveness (AHR) were evaluated in the asthmatic Neu1-deficient mouse strain SM/J model. Splenic CD4+ T cells from asthmatic model mice displayed increased HA receptor activity of CD44 after culture with the antigen, along with characteristic parallel induction of sialidase (Neu1) expression. This induction of HA binding was suppressed significantly by a sialidase inhibitor and was not observed in SM/J mice. Th2 cytokine concentration and absolute number of Th2 cells in the bronchoalveolar lavage fluid, and AHR were decreased in SM/J mice. In conclusion, HA receptor activity of CD44 and acute asthmatic reactions, including Th2-mediated airway inflammation and AHR, are dependent upon Neu1 enzymatic activity. Our observation suggests that Neu1 may be a target molecule for the treatment of asthma.

  10. Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report

    PubMed Central

    Atzmony, Lihi; Saar, Nili; Chundadze, Tamar; Arbel, Yaron; Justo, Dan; Mashav, Noa

    2008-01-01

    Introduction Cytomegalovirus-associated thrombosis has rarely been reported in the medical literature, and if so, mainly in immunocompromized patients. Case presentation We report the case of a 36-year-old Caucasian woman with acute cytomegalovirus infection presenting with spontaneous splenic infarcts. Trans-esophageal echocardiography did not show any vegetations or mural thrombi. The patient was also found to be heterozygous for the Factor V Leiden mutation. Anticoagulation treatment was considered but ruled out since cytomegalovirus was the obvious trigger for thrombosis in this patient. To the best of our knowledge, this is only the third report to date of cytomegalovirus-associated splenic infarcts. Conclusion This case report serves as additional evidence for the role of cytomegalovirus in thrombosis. PMID:19087249

  11. Impact of cytomegalovirus on early immunosenescence of CD8+ T lymphocytes after solid organ transplantation.

    PubMed

    Cantisán, Sara; Torre-Cisneros, Julián; Lara, Rosario; Zarraga, Sofía; Montejo, Miguel; Solana, Rafael

    2013-01-01

    The increasing number of elderly people eligible for solid organ transplants has made it necessary to reevaluate how the decline in immune function associated to ageing (immunosenescence) affects solid organ transplants. Some immunosenescence biomarkers, such as the expansion of CD28(-)CD8+ T lymphocytes, have been associated to cytomegalovirus infection and are related to a form of accelerated immune senescence in transplant recipients. However, the impact of cytomegalovirus replication on downregulation of CD28 on total CD8+ T cells is independent of patients' age, whereas downregulation on cytomegalovirus-specific CD8+ T cells depends on patients' age, inducing early immunosenescence of cytomegalovirus-specific CD8+ T cells in young but not elderly solid organ transplants recipients. Although immunosenescence in transplant recipients should be considered a two-edged sword as it is a risk factor for the development of tumors after transplantation, it has a beneficial effect in attenuating acute allograft rejection and correlates with better clinical outcomes.

  12. The role of CD8+T cells in the acute and chronic phases of Theiler's murine encephalomyelitis virus-induced disease in mice.

    PubMed

    Borrow, P; Tonks, P; Welsh, C J; Nash, A A

    1992-07-01

    The technique of in vivo depletion with T cell subset-specific monoclonal antibodies was used to study the involvement of CD8+T cells in protection/pathogenesis during the acute and chronic demyelinating phases of Theiler's murine encephalomyelitis virus (TMEV)-induced disease. Mice rendered CD8-deficient prior to infection with TMEV were less efficient at clearing virus from the central nervous system compared to intact animals and also suffered demyelinating disease of earlier onset and increased severity. This indicates that CD8+ cells have a protective role in virus clearance at early times post-infection, and may also be involved in downregulating the severity of the chronic demyelinating disease. How CD8+ T cells function to produce these effects is discussed.

  13. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure.

    PubMed

    King, L M; Anderson, M B; Sikka, S C; George, W J

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 micromol/kg CdCl2). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 micromol/kg ZnAc), given 24 h prior to 20 micromol/kg CdCl2 administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  14. Systemic lupus erythematous revealed by cytomegalovirus infection

    PubMed Central

    Amel, Rezgui; Monia, Karmani; Anis, Mzabi; Fatma, Ben Fredj; Chadia, Laouani

    2016-01-01

    Cytomegalovirus (CMV) infection have been described as exacerbing systemic lupus erythematous (SLE). The role of CMV in starting off SLE remains object of debate. We report a severe presentation of SLE revealed by CMV infection with hemophogocytic syndrome. A 22 old women without a history of systemic disease developed a cutaneous eruption with fever and myalgia persistant for 2 weeks. Laboratory studies revealed a CMV serology supporting acute CMV infection, with positive antinuclear antidody, anti ds DNA, elevated liver functions tests, pancytopenia. Further exams revealed an hemophagocytic syndrome and a lupus nephritis. While receiving antiviral and corticosteroid therapy, the patient developed seizures related to a cerebral vasculitis. The outcome was favorable when intravenous immunoglobulins were associated. This observation showed that CMV infection in patients with SLE is often serious and difficult to diagnose and to treat, especially when SLE is not yet recognized. So we suggest all patients with recent SLE have routine testing for CMV immunity. PMID:27800096

  15. Congenital Cytomegalovirus Infection.

    PubMed

    Bale, James F.; Miner, Lonnie; Petheram, Susan J.

    2002-05-01

    Intrauterine infection with cytomegalovirus (CMV), a betaherpesvirus, remains the most frequent congenital virus infection in many regions of the world. Although most CMV-infected newborns lack signs of CMV infection, approximately 10% have signs that can consist of low birth weight, jaundice, hepatosplenomegaly, skin rash, microcephaly, and chorioretinitis. Neonates with signs of CMV infection at birth have high rates of audiologic and neurodevelopmental sequelae. Although postnatal therapy with ganciclovir transiently reduces virus shedding and may lessen the audiologic consequences of CMV in some infected infants, additional strategies are needed to prevent congenital CMV disease and to improve the neurodevelopmental prognosis of infants infected with CMV in utero. Some cases of intrauterine infections can be prevented in susceptible women by avoiding contact with the urine or saliva of young children who may be shedding CMV. Vaccines against CMV remain in the experimental stages of development. Termination of pregnancy can be offered to women whose infants have evidence of intrauterine CMV infection and sonographic signs of central nervous system damage. Infants who survive symptomatic intrauterine infections have high rates of neurodevelopmental sequelae and require comprehensive evaluation and therapy through center and home-based early intervention programs. PMID:11931729

  16. Human Cytomegalovirus Persistence

    PubMed Central

    Goodrum, Felicia; Caviness, Katie; Zagallo, Patricia

    2012-01-01

    Summary Viral persistence is the rule following infection with all herpesviruses. The β-herpesvirus, human cytomegalovirus (HCMV), persists through chronic and latent states of infection. Both the chronic and latent states of infection contribute to HCMV persistence and to the high HCMV seroprevalence worldwide. The chronic infection is poorly defined molecularly, but clinically manifests as low-level virus shedding over extended periods of time and often in the absence of symptoms. Latency requires long-term maintenance of viral genomes in a reversibly quiescent state in the immunocompetent host. In this review, we focus on recent advances in the biology of HCMV persistence, particularly with respect to the latent mode of persistence. Latently infected individuals harbor HCMV genomes in hematopoietic cells and maintain large subsets of HCMV-specific T-cells. In the last few years, impressive advances have been made in understanding virus-host interactions important to HCMV infection, many of which will profoundly impact latency and persistence. We discuss these advances and their known or potential impact on viral latency. As herpesviruses are met with similar challenges in achieving latency and often employ conserved strategies to persist, we discuss current and future directions of HCMV persistence in the context of the greater body of knowledge regarding α-and γ-herpesviruses persistence. PMID:22329758

  17. Cytomegalovirus keratitis after penetrating keratoplasty.

    PubMed

    Wehrly, S R; Manning, F J; Proia, A D; Burchette, J L; Foulks, G N

    1995-11-01

    We report the development of cytomegalovirus (CMV) keratitis in the penetrating keratoplasty of a 59-year-old human immunodeficiency virus-negative woman after uncomplicated corneal transplantation. Immunosuppression with topical cyclosporine A 2% in corn oil and topical prednisolone acetate 1% suspension was used postoperatively. The 15-month postoperative course was complicated by multiple episodes of endothelial rejection, medically controlled elevated intraocular pressure, polymicrobial bacterial (coagulase-negative staphlococcus and alpha-hemolytic streptococcus) keratitis, and endothelial plaque formation with associated hypopyon and epithelial defect. The graft failed and penetrating keratoplasty was repeated. Cytomegalovirus infection of superficial keratocytes in a region of scarring was identified in histological sections stained with hematoxylin and eosin and confirmed using mouse monoclonal anti-cytomegalovirus antibodies. Excision of the diseased corneal button with no additional treatment appears to have been curative. Low-grade keratitis was the only manifestation of the CMV infection, and it has not recurred 6 months postoperatively.

  18. Murine gamma interferon fails to inhibit Toxoplasma gondii growth in murine fibroblasts.

    PubMed Central

    Schwartzman, J D; Gonias, S L; Pfefferkorn, E R

    1990-01-01

    Although treatment of human macrophages or fibroblasts with human gamma interferon results in the inhibition of intracellular Toxoplasma gondii, murine gamma interferon stimulated only murine macrophages, not murine fibroblasts, to inhibit T. gondii. This species difference may be important in understanding the control of acute and chronic toxoplasmosis. PMID:2106497

  19. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation

    PubMed Central

    Cloarec, Robin; Bauer, Sylvian; Luche, Hervé; Buhler, Emmanuelle; Pallesi-Pocachard, Emilie; Salmi, Manal; Courtens, Sandra; Massacrier, Annick; Grenot, Pierre; Teissier, Natacha; Watrin, Françoise; Schaller, Fabienne; Adle-Biassette, Homa; Gressens, Pierre; Malissen, Marie; Stamminger, Thomas; Streblow, Daniel N.; Bruneau, Nadine; Szepetowski, Pierre

    2016-01-01

    Background Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells. Objectives and Methods In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15) and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments. Results Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b– lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1. Conclusion In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which

  20. Macrophages and galectin 3 play critical roles in CVB3-induced murine acute myocarditis and chronic fibrosis.

    PubMed

    Jaquenod De Giusti, Carolina; Ure, Agustín E; Rivadeneyra, Leonardo; Schattner, Mirta; Gomez, Ricardo M

    2015-08-01

    Macrophage influx and galectin 3 production have been suggested as major players driving acute inflammation and chronic fibrosis in many diseases. However, their involvement in the pathogenesis of viral myocarditis and subsequent cardiomyopathy are unknown. Our aim was to characterise the role of macrophages and galectin 3 on survival, clinical course, viral burden, acute pathology, and chronic fibrosis in coxsackievirus B3 (CVB3)-induced myocarditis. Our results showed that C3H/HeJ mice infected with CVB3 and depleted of macrophages by liposome-encapsulated clodronate treatment compared with infected untreated mice presented higher viral titres but reduced acute myocarditis and chronic fibrosis, compared with untreated infected mice. Increased galectin 3 transcriptional and translational expression levels correlated with CVB3 infection in macrophages and in non-depleted mice. Disruption of the galectin 3 gene did not affect viral titres but reduced acute myocarditis and chronic fibrosis compared with C57BL/6J wild-type mice. Similar results were observed after pharmacological inhibition of galectin 3 with N-acetyl-d-lactosamine in C3H/HeJ mice. Our results showed a critical role of macrophages and their galectin 3 in controlling acute viral-induced cardiac injury and the subsequent fibrosis. Moreover, the fact that pharmacological inhibition of galectin 3 induced similar results to macrophage depletion regarding the degree of acute cardiac inflammation and chronic fibrosis opens up the possibility of new pharmacological strategies for viral myocarditis.

  1. Cytomegalovirus infection in transplant recipients

    PubMed Central

    Azevedo*, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Filho, Helio Hehl Caiaffa; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; dos Santos, Vera Aparecida; da Cruz Gouveia Linardi, Camila; Yasuda, Maria Aparecida Shikanai; de Sousa Marques, Heloisa Helena

    2015-01-01

    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  2. Targeting IL-12/IL-23 by Employing a p40 Peptide-Based Vaccine Ameliorates TNBS-Induced Acute and Chronic Murine Colitis

    PubMed Central

    Guan, Qingdong; Ma, Yanbing; Hillman, China-Li; Qing, Gefei; Ma, Allan G; Weiss, Carolyn R; Zhou, Gang; Bai, Aiping; Warrington, Richard J; Bernstein, Charles N; Peng, Zhikang

    2011-01-01

    Interleukin (IL)-12 and IL-23 both share the p40 subunit and are key cytokines in the pathogenesis of Crohn’s disease. Previously, we have developed and identified three mouse p40 peptide-based and virus-like particle vaccines. Here, we evaluated the effects and immune mechanisms of the optimal vaccine in downregulating intestinal inflammation in murine acute and chronic colitis, induced by intrarectal administrations of trinitrobenzene sulfonic acid (TNBS). Mice were injected subcutaneously with vaccine, vaccine carrier or saline three times, and then intrarectally administered TNBS weekly for 2 wks (acute colitis) or 7 wks (chronic colitis). The severity of colitis was evaluated by body weight, histology and collagen and cytokine levels in colon tissue. Th1 and Th17 cells in mesenteric lymph nodes (MLN) were determined. Our results showed the vaccine induced high level and long-lasting specific IgG antibodies to p40, IL-12 and IL-23. After administrations of TNBS, vaccinated mice had significantly less body weight loss and a significant decrease of inflammatory scores, collagen deposition and expression of p40, IL-12, IL-23, IL-17, TNF, iNOS and Bcl-2 in colon tissues, compared with carrier and saline groups. Moreover, vaccinated mice exhibited a trend to lower percentages of Th1 cells in acute colitis and of Th17 cells in chronic colitis in MLN than in controls. In summary, administration of the vaccine induced specific antibodies to IL-12 and IL-23, which was associated with improvement of intestinal inflammation and fibrosis. This suggests that the vaccine may provide a potential approach for the long-term treatment of Crohn’s disease. PMID:21424108

  3. Delayed Effects of Acute Radiation Exposure in a Murine Model of the H-ARS: Multiple-Organ Injury Consequent to <10 Gy Total Body Irradiation.

    PubMed

    Unthank, Joseph L; Miller, Steven J; Quickery, Ariel K; Ferguson, Ethan L; Wang, Meijing; Sampson, Carol H; Chua, Hui Lin; DiStasi, Matthew R; Feng, Hailin; Fisher, Alexa; Katz, Barry P; Plett, P Artur; Sandusky, George E; Sellamuthu, Rajendran; Vemula, Sasidhar; Cohen, Eric P; MacVittie, Thomas J; Orschell, Christie M

    2015-11-01

    The threat of radiation exposure from warfare or radiation accidents raises the need for appropriate animal models to study the acute and chronic effects of high dose rate radiation exposure. The goal of this study was to assess the late development of fibrosis in multiple organs (kidney, heart, and lung) in survivors of the C57BL/6 mouse model of the hematopoietic-acute radiation syndrome (H-ARS). Separate groups of mice for histological and functional studies were exposed to a single uniform total body dose between 8.53 and 8.72 Gy of gamma radiation from a Cs radiation source and studied 1-21 mo later. Blood urea nitrogen levels were elevated significantly in the irradiated mice at 9 and 21 mo (from ∼22 to 34 ± 3.8 and 69 ± 6.0 mg dL, p < 0.01 vs. non-irradiated controls) and correlated with glomerosclerosis (29 ± 1.8% vs. 64 ± 9.7% of total glomeruli, p < 0.01 vs. non-irradiated controls). Glomerular tubularization and hypertrophy and tubular atrophy were also observed at 21 mo post-total body irradiation (TBI). An increase in interstitial, perivascular, pericardial and peribronchial fibrosis/collagen deposition was observed from ∼9-21 mo post-TBI in kidney, heart, and lung of irradiated mice relative to age-matched controls. Echocardiography suggested decreased ventricular volumes with a compensatory increase in the left ventricular ejection fraction. The results indicate that significant delayed effects of acute radiation exposure occur in kidney, heart, and lung in survivors of the murine H-ARS TBI model, which mirrors pathology detected in larger species and humans at higher radiation doses focused on specific organs.

  4. Efficacy of species-specific protein antibiotics in a murine model of acute Pseudomonas aeruginosa lung infection

    PubMed Central

    McCaughey, Laura C.; Ritchie, Neil. D.; Douce, Gillian R.; Evans, Thomas J.; Walker, Daniel

    2016-01-01

    Protein antibiotics, known as bacteriocins, are widely produced by bacteria for intraspecies competition. The potency and targeted action of bacteriocins suggests that they could be developed into clinically useful antibiotics against highly drug resistant Gram-negative pathogens for which there are few therapeutic options. Here we show that Pseudomonas aeruginosa specific bacteriocins, known as pyocins, show strong efficacy in a murine model of P. aeruginosa lung infection, with the concentration of pyocin S5 required to afford protection from a lethal infection at least 100-fold lower than the most commonly used inhaled antibiotic tobramycin. Additionally, pyocins are stable in the lung, poorly immunogenic at high concentrations and efficacy is maintained in the presence of pyocin specific antibodies after repeated pyocin administration. Bacteriocin encoding genes are frequently found in microbial genomes and could therefore offer a ready supply of highly targeted and potent antibiotics active against problematic Gram-negative pathogens. PMID:27444885

  5. History of the molecular biology of cytomegaloviruses.

    PubMed

    Stinski, Mark F

    2014-01-01

    The history of the molecular biology of cytomegaloviruses from the purification of the virus and the viral DNA to the cloning and expression of the viral genes is reviewed. A key genetic element of cytomegalovirus (the CMV promoter) contributed to our understanding of eukaryotic cell molecular biology and to the development of lifesaving therapeutic proteins. The study of the molecular biology of cytomegaloviruses also contributed to the development of antivirals to control the viral infection.

  6. Cytomegalovirus Infection in Ireland

    PubMed Central

    Hassan, Jaythoon; O’Neill, Derek; Honari, Bahman; De Gascun, Cillian; Connell, Jeff; Keogan, Mary; Hickey, David

    2016-01-01

    Abstract Cytomegalovirus (CMV) infections occur worldwide and primary infection usually occurs in early childhood and is often asymptomatic whereas primary infection in adults may result in symptomatic illness. CMV establishes a chronic latent infection with intermittent periods of reactivation. Primary infection or reactivation associate with increased mortality and morbidity in those who are immunocompromised. Transplacental transmission may result in significant birth defects or long-term sensorineural hearing loss. We performed a study to determine the CMV seroprevalence and the association between HLA Class I alleles and frequency of CMV infection in Ireland. The presence of CMV IgG, a marker of previous CMV infection, was determined for a cohort of 1849 HLA typed solid organ transplant donors between 1990 and 2013. The presence of CMV IgG was correlated with HLA type. The CMV seroprevalence in solid organ transplant donors was 33.4% (range 22–48% per annum) over the time period 1990 to 2013. Multivariate logistic regression analysis showed that both age and HLA alleles were associated with CMV seropositivity. A significant and positive relationship between age and CMV seropositivity was observed (OR = 1.013, P < 0.001, CI [1.007, 1.019]). Chi-square analysis revealed that the female gender was independently associated with CMV seropositivity (P < 0.01). Seroprevalence in women of reproductive age (20–39 years) was significantly higher than men of the same age (37% vs 26%, P < 0.01). The frequencies of HLA-A1, HLA-A2, and HLA-A3 in our cohort were 40.8%, 48.8%, and 25.9%, respectively. Logistic regression analysis showed that the presence of HLA-A1 but not HLA-A2 or HLA-A3 was independently associated with CMV seronegativity (P < 0.01). Interestingly, individuals who co-expressed HLA-A2 and HLA-A3 alleles were significantly more likely to be CMV seropositive (P < 0.02). The frequencies of HLA-B5, HLA-B7, and HLA-B8 in our cohort

  7. A murine model of acute myeloid leukemia with Evi1 overexpression and autocrine stimulation by an intracellular form of GM-CSF in DA-3 cells.

    PubMed

    Cardona, Maria E; Simonson, Oscar E; Oprea, Iulian I; Moreno, Pedro M D; Silva-Lara, Maria F; Mohamed, Abdalla J; Christensson, Birger; Gahrton, Gösta; Dilber, M Sirac; Smith, C I Edvard; Arteaga, H Jose

    2016-01-01

    The poor treatment response of acute myeloid leukemia (AML) overexpressing high-risk oncogenes such as EVI1, demands specific animal models for new treatment evaluations. Evi1 is a common site of activating integrations in murine leukemia virus (MLV)-induced AML and in retroviral and lentiviral gene-modified HCS. Still, a model of overt AML induced by Evi1 has not been generated. Cell lines from MLV-induced AML are growth factor-dependent and non-transplantable. Hence, for the leukemia maintenance in the infected animals, a growth factor source such as chronic immune response has been suggested. We have investigated whether these leukemias are transplantable if provided with growth factors. We show that the Evi1(+)DA-3 cells modified to express an intracellular form of GM-CSF, acquired growth factor independence and transplantability and caused an overt leukemia in syngeneic hosts, without increasing serum GM-CSF levels. We propose this as a general approach for modeling different forms of high-risk human AML using similar cell lines.

  8. Efficacy of JAK/STAT pathway inhibition in murine xenograft models of early T-cell precursor (ETP) acute lymphoblastic leukemia

    PubMed Central

    Maude, Shannon L.; Dolai, Sibasish; Delgado-Martin, Cristina; Vincent, Tiffaney; Robbins, Alissa; Selvanathan, Arthavan; Ryan, Theresa; Hall, Junior; Wood, Andrew C.; Tasian, Sarah K.; Hunger, Stephen P.; Loh, Mignon L.; Mullighan, Charles G.; Wood, Brent L.; Hermiston, Michelle L.; Grupp, Stephan A.; Lock, Richard B.

    2015-01-01

    Early T-cell precursor (ETP) acute lymphoblastic leukemia (ALL) is a recently described subtype of T-ALL characterized by a unique immunophenotype and genomic profile, as well as a high rate of induction failure. Frequent mutations in cytokine receptor and Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathways led us to hypothesize that ETP-ALL is dependent on JAK/STAT signaling. Here we demonstrate aberrant activation of the JAK/STAT pathway in ETP-ALL blasts relative to non-ETP T-ALL. Moreover, ETP-ALL showed hyperactivation of STAT5 in response to interleukin-7, an effect that was abrogated by the JAK1/2 inhibitor ruxolitinib. In vivo, ruxolitinib displayed activity in 6 of 6 patient-derived murine xenograft models of ETP-ALL, with profound single-agent efficacy in 5 models. Ruxolitinib treatment decreased peripheral blast counts relative to pretreatment levels and compared with control (P < .01) in 5 of 6 ETP-ALL xenografts, with marked reduction in mean splenic blast counts (P < .01) in 6 of 6 samples. Surprisingly, both JAK/STAT pathway activation and ruxolitinib efficacy were independent of the presence of JAK/STAT pathway mutations, raising the possibility that the therapeutic potential of ruxolitinib in ETP-ALL extends beyond those cases with JAK mutations. These findings establish the preclinical in vivo efficacy of ruxolitinib in ETP-ALL, a biologically distinct subtype for which novel therapies are needed. PMID:25645356

  9. Requirement of the Pseudomonas aeruginosa CbrA Sensor Kinase for Full Virulence in a Murine Acute Lung Infection Model

    PubMed Central

    Yeung, Amy T. Y.; Janot, Laure; Pena, Olga M.; Neidig, Anke; Kukavica-Ibrulj, Irena; Hilchie, Ashley; Levesque, Roger C.; Overhage, Joerg

    2014-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that is a major cause of respiratory tract and other nosocomial infections. The sensor kinase CbrA is a central regulator of carbon and nitrogen metabolism and in vitro also regulates virulence-related processes in P. aeruginosa. Here, we investigated the role of CbrA in two murine models of infection. In both peritoneal infections in leukopenic mice and lung infection models, the cbrA mutant was less virulent since substantially larger numbers of cbrA mutant bacteria were required to cause the same level of infection as wild-type or complemented bacteria. In contrast, in the chronic rat lung model the cbrA mutant grew and persisted as well as the wild type, indicating that the decrease of in vivo virulence of the cbrA mutant did not result from growth deficiencies on particular carbon substrates observed in vitro. In addition, a mutant in the cognate response regulator CbrB showed no defect in virulence in the peritoneal infection model, ruling out the involvement of certain alterations of virulence properties in the cbrA mutant including defective swarming motility, increased biofilm formation, and cytotoxicity, since these alterations are controlled through CbrB. Further investigations indicated that the mutant was more susceptible to uptake by phagocytes in vitro, resulting in greater overall bacterial killing. Consistent with the virulence defect, it took a smaller number of Dictyostelium discoideum amoebae to kill the cbrA mutant than to kill the wild type. Transcriptional analysis of the cbrA mutant during D. discoideum infection led to the conclusion that CbrA played an important role in the iron metabolism, protection of P. aeruginosa against oxidative stress, and the regulation of certain virulence factors. PMID:24379284

  10. Requirement of the Pseudomonas aeruginosa CbrA sensor kinase for full virulence in a murine acute lung infection model.

    PubMed

    Yeung, Amy T Y; Janot, Laure; Pena, Olga M; Neidig, Anke; Kukavica-Ibrulj, Irena; Hilchie, Ashley; Levesque, Roger C; Overhage, Joerg; Hancock, Robert E W

    2014-03-01

    Pseudomonas aeruginosa is an opportunistic pathogen that is a major cause of respiratory tract and other nosocomial infections. The sensor kinase CbrA is a central regulator of carbon and nitrogen metabolism and in vitro also regulates virulence-related processes in P. aeruginosa. Here, we investigated the role of CbrA in two murine models of infection. In both peritoneal infections in leukopenic mice and lung infection models, the cbrA mutant was less virulent since substantially larger numbers of cbrA mutant bacteria were required to cause the same level of infection as wild-type or complemented bacteria. In contrast, in the chronic rat lung model the cbrA mutant grew and persisted as well as the wild type, indicating that the decrease of in vivo virulence of the cbrA mutant did not result from growth deficiencies on particular carbon substrates observed in vitro. In addition, a mutant in the cognate response regulator CbrB showed no defect in virulence in the peritoneal infection model, ruling out the involvement of certain alterations of virulence properties in the cbrA mutant including defective swarming motility, increased biofilm formation, and cytotoxicity, since these alterations are controlled through CbrB. Further investigations indicated that the mutant was more susceptible to uptake by phagocytes in vitro, resulting in greater overall bacterial killing. Consistent with the virulence defect, it took a smaller number of Dictyostelium discoideum amoebae to kill the cbrA mutant than to kill the wild type. Transcriptional analysis of the cbrA mutant during D. discoideum infection led to the conclusion that CbrA played an important role in the iron metabolism, protection of P. aeruginosa against oxidative stress, and the regulation of certain virulence factors.

  11. Nasal IgA secretion in a murine model of acute stress. The possible role of catecholamines.

    PubMed

    Jarillo-Luna, Rosa Adriana; Rivera-Aguilar, Victor; Pacheco-Yépez, Judith; Godínez-Victoria, Marycarmen; Oros-Pantoja, Rigoberto; Miliar-García, Angel; Campos-Rodríguez, Rafael

    2015-01-15

    Stress stimuli affect the immune system of the mucosa, and in particular IgA secretion. It is well documented that intense psychological and physical stress can increase susceptibility to infection by diverse pathogens in the upper respiratory tract. Our workgroup reported that chronic stress caused by immobilization elicits a decrease in nasal IgA levels in mice. Here, we explore how acute stress (caused by 4h of immobilization) affects IgA secretion in the nasal mucosa, and the possible role of the sympathetic nervous system in this effect. Nine-week-old male CD1 mice were divided into four groups: control, chemical sympathectomy (with 6-OHDA) and treatment with nadolol (5mg/kg) or phentolamine (15mg/kg). All these groups were subdivided into stressed and unstressed animals. The parameters evaluated included plasma corticosterone and epinephrine (only in control groups), SIgA levels (by ELISA) and SIgA expression (by Western Blot) in nasal fluid, percentage of IgA+ plasma cells, and mRNA expression of heavy alpha chain, pIgR, TNFα and TGFβ in nasal mucosa. Acute stress reduced the percentage of IgA+ cells while increasing the levels of IgA, the two hormones, and the mRNA expression of heavy alpha chain, pIgR, TNFα and TGFβ, which resulted in greater synthesis and transport of IgA. The treatments with 6-OHDA and α- and β-adrenergic receptor blockers suggest that sympathetic innervation by both types of adrenergic receptors is important for the control of SIgA secretion in nasal mucosa during acute stress. The increase in this parameter depended on the cytokines involved in IgA synthesis and transport.

  12. Cytomegalovirus infection in renal transplantation: clinical aspects, management and the perspectives

    PubMed Central

    Requião-Moura, Lúcio Roberto; de Matos, Ana Cristina Carvalho; Pacheco-Silva, Alvaro

    2015-01-01

    Cytomegalovirus infection is one of most frequent infectious complications after renal transplantation, and can be classified as primo-infection, when the transmission occurs through the graft, or reactivation, when the recipient is cytomegalovirus seropositive. After transplantation, cytomegalovirus can appear as an infection, when the patient presents with evidence of viral replication without symptoms or disease, which has two clinical spectra: typical viral syndrome or invasive disease, which is a less common form. Their effects can be classified as direct, while the disease is developed, or indirect, with an increase of acute rejection and chronic allograft dysfunction risks. Diagnosis must be made based on viremia by one of the standardized methods: antigenemia or PCR, which is more sensitive. The risk factors related to infection after transplantation are the serologic matching (positive donor and negative recipient) and anti-lymphocyte antibody drugs. One of the strategies to reduce risk of disease should be chosen for patients at high risk: preemptive treatment or universal prophylaxis. Recent clinical research has described ganciclovir resistance as an emergent problem in management of cytomegalovirus infection. Two types of mutation that cause resistance were described: UL97 (most frequent) and UL54. Today, sophisticated methods of immunologic monitoring to detect specific T-cell clones against cytomegalovirus are used in clinical practice to improve the management of high-risk patients after renal transplantation. PMID:25993081

  13. Toxicity assessment of zinc oxide nanoparticles using sub-acute and sub-chronic murine inhalation models

    PubMed Central

    2014-01-01

    Background Although ZnO nanoparticles (NPs) are used in many commercial products and the potential for human exposure is increasing, few in vivo studies have addressed their possible toxic effects after inhalation. We sought to determine whether ZnO NPs induce pulmonary toxicity in mice following sub-acute or sub-chronic inhalation exposure to realistic exposure doses. Methods Mice (C57Bl/6) were exposed to well-characterized ZnO NPs (3.5 mg/m3, 4 hr/day) for 2 (sub-acute) or 13 (sub-chronic) weeks and necropsied immediately (0 wk) or 3 weeks (3 wks) post exposure. Toxicity was assessed by enumeration of total and differential cells, determination of total protein, lactate dehydrogenase activity and inflammatory cytokines in bronchoalveolar lavage (BAL) fluid as well as measurements of pulmonary mechanics. Generation of reactive oxygen species was assessed in the lungs. Lungs were evaluated for histopathologic changes and Zn content. Zn concentration in blood, liver, kidney, spleen, heart, brain and BAL fluid was measured. Results An elevated concentration of Zn2+ was detected in BAL fluid immediately after exposures, but returned to baseline levels 3 wks post exposure. Dissolution studies showed that ZnO NPs readily dissolved in artificial lysosomal fluid (pH 4.5), but formed aggregates and precipitates in artificial interstitial fluid (pH 7.4). Sub-acute exposure to ZnO NPs caused an increase of macrophages in BAL fluid and a moderate increase in IL-12(p40) and MIP-1α, but no other inflammatory or toxic responses were observed. Following both sub-acute and sub-chronic exposures, pulmonary mechanics were no different than sham-exposed animals. Conclusions Our ZnO NP inhalation studies showed minimal pulmonary inflammation, cytotoxicity or lung histopathologic changes. An elevated concentration of Zn in the lung and BAL fluid indicates dissolution of ZnO NPs in the respiratory system after inhalation. Exposure concentration, exposure mode and time post

  14. Platelets, acting in part via P-selectin, mediate cytomegalovirus-induced microvascular dysfunction.

    PubMed

    Khoretonenko, Mikhail V; Brunson, Jerry L; Senchenkov, Evgeny; Leskov, Igor L; Marks, Christian R; Stokes, Karen Y

    2014-12-15

    Cytomegalovirus (CMV) infects a majority of the population worldwide. It has been implicated in cardiovascular disease, induces microvascular dysfunction, and synergizes with hypercholesterolemia to promote leukocyte and platelet recruitment in venules. Although platelets and platelet-associated P-selectin contribute to cardiovascular disease inflammation, their role in CMV-induced vascular responses is unknown. We assessed the role of platelets in CMV-induced microvascular dysfunction by depleting platelets and developing bone marrow chimeric mice deficient in platelet P-selectin. Wild-type and chimeric mice received mock or murine (m)CMV intraperitoneally. Five weeks later, some mice were switched to a high-cholesterol diet (HC) to investigate the synergism between mCMV and HC. Arteriolar vasodilation and recruitment of leukocytes and donor platelets in venules were measured at 11wk. mCMV with or without HC caused significant endothelial dysfunction in arterioles. Platelet depletion restored normal vasodilation in mCMV-HC but not mCMV-ND mice, whereas protection was seen in both groups for platelet P-selectin chimeras. Only mCMV + HC elevated leukocyte and platelet recruitment in venules. Leukocyte adhesion was reduced to mock levels by acute platelet depletion but was only partially decreased in platelet P-selectin chimeras. Platelets from mCMV-HC mice and, to a lesser extent, mCMV-ND but not mock-HC mice showed significant adhesion in mCMV-HC recipients. Our findings implicate a role for platelets, acting through P-selectin, in CMV-induced arteriolar dysfunction and suggest that the addition of HC leads to a platelet-dependent, inflammatory infiltrate that is only partly platelet P-selectin dependent. CMV appeared to have a stronger activating influence than HC on platelets and may represent an additional therapeutic target in vulnerable patients.

  15. Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis.

    PubMed Central

    LaFleur, Andrew M; Lukacs, Nicholas W; Kunkel, Steven L; Matsukawa, Akihiro

    2004-01-01

    The aim of this study was to determine the role of CC chemokine CCL6/C10 in acute inflammation. Intraperitoneal injection of thioglycollate increased peritoneal CCL6, which peaked at 4 h and remained elevated at 48 h. Neutralization of CCL6 significantly inhibited the macrophage infiltration (34-48% reduction), but not other cell types, without decreasing the other CC chemokines known to attract monocytes/macrophages. CCL6 was expressed in peripheral eosinophils and elicited macrophages, but not in elicited neutrophils. Peritoneal CCL6 level was not decreased in granulocyte-depleted mice where eosinophil influx was significantly impaired. Thus, CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. Eosinophils pre-store CCL6, but do not release CCL6 in the peritoneum in this model of inflammation. PMID:15770051

  16. Carbohydrate-Binding Non-Peptidic Pradimicins for the Treatment of Acute Sleeping Sickness in Murine Models

    PubMed Central

    Castillo-Acosta, Víctor M.; Ruiz-Pérez, Luis M.; Reichardt, Niels C.; Igarashi, Yasuhiro; Liekens, Sandra; Balzarini, Jan

    2016-01-01

    Current treatments available for African sleeping sickness or human African trypanosomiasis (HAT) are limited, with poor efficacy and unacceptable safety profiles. Here, we report a new approach to address treatment of this disease based on the use of compounds that bind to parasite surface glycans leading to rapid killing of trypanosomes. Pradimicin and its derivatives are non-peptidic carbohydrate-binding agents that adhere to the carbohydrate moiety of the parasite surface glycoproteins inducing parasite lysis in vitro. Notably, pradimicin S has good pharmaceutical properties and enables cure of an acute form of the disease in mice. By inducing resistance in vitro we have established that the composition of the sugars attached to the variant surface glycoproteins are critical to the mode of action of pradimicins and play an important role in infectivity. The compounds identified represent a novel approach to develop drugs to treat HAT. PMID:27662652

  17. Oral glutamine supplementation improves intestinal permeability dysfunction in a murine acute graft-vs.-host disease model.

    PubMed

    Noth, Rainer; Häsler, Robert; Stüber, Eckhard; Ellrichmann, Mark; Schäfer, Heiner; Geismann, Claudia; Hampe, Jochen; Bewig, Burkhard; Wedel, Thilo; Böttner, Martina; Schreiber, Stefan; Rosenstiel, Philip; Arlt, Alexander

    2013-04-01

    Although a profound barrier dysfunction has been reported, little is known about the pathophysiological mechanism evoking gastrointestinal graft-vs.-host disease (GI-GvHD) and apparent therapeutic options. The aim of this study was to evaluate the influence of oral glutamine on the course of GI-GvHD in an acute semiallogenic graft-vs.-host disease (GvHD) in irradiated B6D2F1 mice. An acute semiallogenic GvHD was induced by intraperitoneal injection of lymphocytes from C57BL/6 mice to irradiated B6D2F1 mice. Half of the GvHD animals received oral glutamine supplementation for 6 days started at the time of lymphocyte transfer. Six days after induction of the semiallogenic GvHD, jejunum specimens were prepared. The expression of the proinflammatory cytokine TNF-α and the tight junction protein occludin was investigated by PCR. Histological changes along with the apoptotic response were evaluated and intestinal permeability was assessed. Animals with GvHD showed a strong increase in paracellular permeability as a sign of the disturbed barrier function. TNF-α expression was significantly increased and the expression of the tight junction protein occludin decreased. GvHD led to mucosal atrophy, crypt hyperplasia, crypt apoptosis, and a disintegration of the tight junctions. Glutamine-treated mice showed reduced expression of TNF-α, increased occludin expression, fewer histological changes in the jejunum, smaller number of apoptotic cells in the crypt, and reduced gastrointestinal permeability. In conclusion, oral glutamine seems to have beneficial effects on the severity of inflammatory changes in the course of GvHD and might be a therapeutic option.

  18. The Reg3α (HIP/PAP) Lectin Suppresses Extracellular Oxidative Stress in a Murine Model of Acute Liver Failure

    PubMed Central

    Moniaux, Nicolas; Darnaud, Marion; Garbin, Kévin; Dos Santos, Alexandre; Guettier, Catherine; Samuel, Didier; Amouyal, Gilles; Amouyal, Paul; Bréchot, Christian; Faivre, Jamila

    2015-01-01

    Background and Aims Acute liver failure (ALF) is a rapidly progressive heterogeneous illness with high mortality rate and no widely accessible cure. A promising drug candidate according to previous preclinical studies is the Reg3α (or HIP/PAP) lectin, which alleviates ALF through its free-radical scavenging activity. Here we study the therapeutic targets of Reg3α in order to gain information on the nature of the oxidative stress associated with ALF. Methods Primary hepatocytes stressed with the reactive oxygen species (ROS) inducers TNFα and H2O2 were incubated with a recombinant Reg3α protein. ALF was induced in C57BL/6J mice by an anti-CD95 antibody. Livers and primary hepatocytes were harvested for deoxycholate separation of cellular and extracellular fractions, immunostaining, immunoprecipitation and malondialdehyde assays. Fibrin deposition was studied by immunofluorescence in frozen liver explants from patients with ALF. Results Fibrin deposition occurs during experimental and clinical acute liver injuries. Reg3α bound the resulting transient fibrin network, accumulated in the inflammatory extracellular matrix (ECM), greatly reduced extracellular ROS levels, and improved cell viability. Hepatocyte treatment with ligands of death receptors, e.g. TNFα and Fas, resulted in a twofold increase of malondialdehyde (MDA) level in the deoxycholate-insoluble fractions. Reg3α treatment maintained MDA at a level similar to control cells and thereby increased hepatocyte survival by 35%. No antioxidant effect of Reg3α was noted in the deoxycholate-soluble fractions. Preventing fibrin network formation with heparin suppressed the prosurvival effect of Reg3α. Conclusions Reg3α is an ECM-targeted ROS scavenger that binds the fibrin scaffold resulting from hepatocyte death during ALF. ECM alteration is an important pathogenic factor of ALF and a relevant target for pharmacotherapy. PMID:25938566

  19. MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets

    PubMed Central

    Huynh-Thu, Vân Anh; Geurts, Pierre; Irrthum, Alexandre; Crahay, Céline; Arnould, Thierry; Deroanne, Christophe; Piette, Jacques; Cataldo, Didier; Colige, Alain

    2011-01-01

    Background miRNAs are now recognized as key regulator elements in gene expression. Although they have been associated with a number of human diseases, their implication in acute and chronic asthma and their association with lung remodelling have never been thoroughly investigated. Methodology/Principal Findings In order to establish a miRNAs expression profile in lung tissue, mice were sensitized and challenged with ovalbumin mimicking acute, intermediate and chronic human asthma. Levels of lung miRNAs were profiled by microarray and in silico analyses were performed to identify potential mRNA targets and to point out signalling pathways and biological processes regulated by miRNA-dependent mechanisms. Fifty-eight, 66 and 75 miRNAs were found to be significantly modulated at short-, intermediate- and long-term challenge, respectively. Inverse correlation with the expression of potential mRNA targets identified mmu-miR-146b, -223, -29b, -29c, -483, -574-5p, -672 and -690 as the best candidates for an active implication in asthma pathogenesis. A functional validation assay was performed by cotransfecting in human lung fibroblasts (WI26) synthetic miRNAs and engineered expression constructs containing the coding sequence of luciferase upstream of the 3′UTR of various potential mRNA targets. The bioinformatics analysis identified miRNA-linked regulation of several signalling pathways, as matrix metalloproteinases, inflammatory response and TGF-β signalling, and biological processes, including apoptosis and inflammation. Conclusions/Significance This study highlights that specific miRNAs are likely to be involved in asthma disease and could represent a valuable resource both for biological makers identification and for unveiling mechanisms underlying the pathogenesis of asthma. PMID:21305051

  20. Promising Efficacy of Benznidazole Nanoparticles in Acute Trypanosoma cruzi Murine Model: In-Vitro and In-Vivo Studies.

    PubMed

    Scalise, María L; Arrúa, Eva C; Rial, Marcela S; Esteva, Mónica I; Salomon, Claudio J; Fichera, Laura E

    2016-08-01

    The aim of this study was to evaluate the effectiveness of benznidazole nanoparticles (BNZ-nps) on trypomastigote forms and on intracellular infection in mammalian cells and primary cardiac myocyte cells. Its effectiveness was also evaluated on acute Trypanosoma cruzi Nicaragua mice infection. Trypomastigotes from culture were treated with different concentrations of BNZ-nps to determine the drug concentration that lyses 50% of trypomastigotes (LC50). Infected mammalian cells were incubated with different concentrations of BNZ-nps to determine the percentage of amastigote inhibition. C3H/HeN mice with lethal acute infection were treated with 10, 25, and 50 mg/kg/day of BNZ-nps for 30 and 15 days to control the survival rate of animals. BNZ-nps having a mean particle size of 63.3 nm, a size distribution of 3.35, and a zeta potential of -18.30 were successfully prepared using poloxamer 188 as a stabilizer. BNZ-nps 25 and 50 μg/mL showed no significant differences in the percentage of inhibition of infected mammalian cells. Infected mice treated with BNZ-nps (50, 25, and 10 mg/kg/day) for 30 days and with BNZ-nps (50 and 25 mg/kg/day) for 15 days presented a 100% survival, whereas the animals treated with 10 mg/kg/day for 15 days of BNZ-nps showed a 70% survival rate. The results obtained demonstrate, for the first time, that benznidazole nanoparticles are a useful and attractive approach to treat Chagas disease in infected mice. PMID:27246447

  1. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.

    PubMed

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-03-01

    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation.

  2. Temporal Analysis of Gene Expression in the Murine Schwann Cell Lineage and the Acutely Injured Postnatal Nerve

    PubMed Central

    Touahri, Yacine; Stratton, Jo Anne; Biernaskie, Jeff; Schuurmans, Carol

    2016-01-01

    Schwann cells (SCs) arise from neural crest cells (NCCs) that first give rise to SC precursors (SCPs), followed by immature SCs, pro-myelinating SCs, and finally, non-myelinating or myelinating SCs. After nerve injury, mature SCs ‘de-differentiate’, downregulating their myelination program while transiently re-activating early glial lineage genes. To better understand molecular parallels between developing and de-differentiated SCs, we characterized the expression profiles of a panel of 12 transcription factors from the onset of NCC migration through postnatal stages, as well as after acute nerve injury. Using Sox10 as a pan-glial marker in co-expression studies, the earliest transcription factors expressed in E9.0 Sox10+ NCCs were Sox9, Pax3, AP2α and Nfatc4. E10.5 Sox10+ NCCs coalescing in the dorsal root ganglia differed slightly, expressing Sox9, Pax3, AP2α and Etv5. E12.5 SCPs continued to express Sox10, Sox9, AP2α and Pax3, as well as initiating Sox2 and Egr1 expression. E14.5 immature SCs were similar to SCPs, except that they lost Pax3 expression. By E18.5, AP2α, Sox2 and Egr1 expression was turned off in the nerve, while Jun, Oct6 and Yy1 expression was initiated in pro-myelinating Sox9+/Sox10+ SCs. Early postnatal and adult SCs continued to express Sox9, Jun, Oct6 and Yy1 and initiated Nfatc4 and Egr2 expression. Notably, at all stages, expression of each marker was observed only in a subset of Sox10+ SCs, highlighting the heterogeneity of the SC pool. Following acute nerve injury, Egr1, Jun, Oct6, and Sox2 expression was upregulated, Egr2 expression was downregulated, while Sox9, Yy1, and Nfatc4 expression was maintained at similar frequencies. Notably, de-differentiated SCs in the injured nerve did not display a transcription factor profile corresponding to a specific stage in the SC lineage. Taken together, we demonstrate that uninjured and injured SCs are heterogeneous and distinct from one another, and de-differentiation recapitulates

  3. Temporal Analysis of Gene Expression in the Murine Schwann Cell Lineage and the Acutely Injured Postnatal Nerve.

    PubMed

    Balakrishnan, Anjali; Stykel, Morgan G; Touahri, Yacine; Stratton, Jo Anne; Biernaskie, Jeff; Schuurmans, Carol

    2016-01-01

    Schwann cells (SCs) arise from neural crest cells (NCCs) that first give rise to SC precursors (SCPs), followed by immature SCs, pro-myelinating SCs, and finally, non-myelinating or myelinating SCs. After nerve injury, mature SCs 'de-differentiate', downregulating their myelination program while transiently re-activating early glial lineage genes. To better understand molecular parallels between developing and de-differentiated SCs, we characterized the expression profiles of a panel of 12 transcription factors from the onset of NCC migration through postnatal stages, as well as after acute nerve injury. Using Sox10 as a pan-glial marker in co-expression studies, the earliest transcription factors expressed in E9.0 Sox10+ NCCs were Sox9, Pax3, AP2α and Nfatc4. E10.5 Sox10+ NCCs coalescing in the dorsal root ganglia differed slightly, expressing Sox9, Pax3, AP2α and Etv5. E12.5 SCPs continued to express Sox10, Sox9, AP2α and Pax3, as well as initiating Sox2 and Egr1 expression. E14.5 immature SCs were similar to SCPs, except that they lost Pax3 expression. By E18.5, AP2α, Sox2 and Egr1 expression was turned off in the nerve, while Jun, Oct6 and Yy1 expression was initiated in pro-myelinating Sox9+/Sox10+ SCs. Early postnatal and adult SCs continued to express Sox9, Jun, Oct6 and Yy1 and initiated Nfatc4 and Egr2 expression. Notably, at all stages, expression of each marker was observed only in a subset of Sox10+ SCs, highlighting the heterogeneity of the SC pool. Following acute nerve injury, Egr1, Jun, Oct6, and Sox2 expression was upregulated, Egr2 expression was downregulated, while Sox9, Yy1, and Nfatc4 expression was maintained at similar frequencies. Notably, de-differentiated SCs in the injured nerve did not display a transcription factor profile corresponding to a specific stage in the SC lineage. Taken together, we demonstrate that uninjured and injured SCs are heterogeneous and distinct from one another, and de-differentiation recapitulates

  4. [Historical outlook on cytomegalovirus research].

    PubMed

    Furukawa, T

    1998-01-01

    In historical point of view, cytomegalovirus (CMV) research could be divided into two phases, before and after discovery of the virus from a baby with severe jaundice. CMV is an ubiquitous virus which makes it difficult to diagnose CMV diseases. Therefore criteria for definite CMV disease has been proposed by the expert committee. Basic research is concentrating on analysis of functional map of the sequences, which helps to develop more genetically engineered vaccine and clarify the mechanism of latency of CMV. I hope increased awareness of CMV disease in organ transplantation advances the development of both chemotherapy and preventive method in near future. PMID:9465657

  5. Nobiletin protects against murine l-arginine-induced acute pancreatitis in association with downregulating p38MAPK and AKT.

    PubMed

    Liu, Bing; Huang, Jian; Zhang, Bin

    2016-07-01

    Acute pancreatitis (AP) is an inflammatory disease characterized by acinar cell damage, oxidative stress, and inflammation of the pancreas. Nobiletin (3',4',5,6,7,8-hexamethoxyflavone), a major polymethoxy flavone, has shown health-promoting properties in previous studies. Therefore, in this study, we investigated whether nobiletin protects against experimental AP induced with l-arginine. C57BL/6 mice were treated with 25 or 50mg/kg nobiletin by intraperitoneal injection once daily for 14 consecutive days. AP was then induced in the mice with two intraperitoneal injections of l-arginine (4g/kg). The nobiletin treatment significantly reduced the plasma amylase levels, pancreatic myeloperoxidase activity, percentage of pancreatic necrosis, plasma proinflammatory factors, the generation of reactive oxygen species, cell apoptosis, tissue damage, and the expression of phosphorylated p38MAPK (p-p38MAPK) and p-AKT. These results suggest that nobiletin is a new therapeutic method for l-arginine-induced AP in mice.

  6. IL-35 mitigates murine acute graft-versus-host disease with retention of graft-versus-leukemia effects.

    PubMed

    Liu, Y; Wu, Y; Wang, Y; Cai, Y; Hu, B; Bao, G; Fang, H; Zhao, L; Ma, S; Cheng, Q; Song, Y; Liu, Y; Zhu, Z; Chang, H; Yu, X; Sun, A; Zhang, Y; Vignali, D A A; Wu, D; Liu, H

    2015-04-01

    IL-35 is a newly discovered inhibitory cytokine secreted by regulatory T cells (Tregs) and may have therapeutic potential in several inflammatory disorders. Acute graft-versus-host disease (aGVHD) is a major complication of allogeneic hematopoietic stem cell transplantation and caused by donor T cells and inflammatory cytokines. The role of IL-35 in aGVHD is still unknown. Here we demonstrate that IL-35 overexpression suppresses CD4(+) effector T-cell activation, leading to a reduction in alloreactive T-cell responses and aGVHD severity. It also leads to the expansion of CD4(+)Foxp3(+) Tregs in the aGVHD target organs. Furthermore, IL-35 overexpression results in a selective decrease in the frequency of Th1 cells and an increase of IL-10-producing CD4(+) T cells in aGVHD target tissues. Serum levels of TNF-α, IFN-γ, IL-6, IL-22 and IL-23 decrease and IL-10 increases in response to IL-35. Most importantly, IL-35 preserves graft-versus-leukemia effect. Finally, aGVHD grade 2-4 patients have decreased serum IL-35 levels comparing with time-matched patients with aGVHD grade 0-1. Our findings indicate that IL-35 has an important role in reducing aGVHD through promoting the expansion of Tregs and repressing Th1 responses, and should be investigated as the therapeutic strategy for aGVHD.

  7. Metabolomics Investigation Reveals Metabolite Mediators Associated with Acute Lung Injury and Repair in a Murine Model of Influenza Pneumonia

    PubMed Central

    Cui, Liang; Zheng, Dahai; Lee, Yie Hou; Chan, Tze Khee; Kumar, Yadunanda; Ho, Wanxing Eugene; Chen, Jian Zhu; Tannenbaum, Steven R.; Ong, Choon Nam

    2016-01-01

    Influenza virus infection (IVI) can cause primary viral pneumonia, which may progress to acute lung injury (ALI) and respiratory failure with a potentially fatal outcome. At present, the interactions between host and influenza virus at molecular levels and the underlying mechanisms that give rise to IVI-induced ALI are poorly understood. We conducted a comprehensive mass spectrometry-based metabolic profiling of serum, lung tissue and bronchoalveolar lavage fluid (BALF) from a non-lethal mouse model with influenza A virus at 0, 6, 10, 14, 21 and 28 days post infection (dpi), representing the major stages of IVI. Distinct metabolite signatures were observed in mice sera, lung tissues and BALF, indicating the molecular differences between systematic and localized host responses to IVI. More than 100 differential metabolites were captured in mice sera, lung tissues and BALF, including purines, pyrimidines, acylcarnitines, fatty acids, amino acids, glucocorticoids, sphingolipids, phospholipids, etc. Many of these metabolites belonged to pulmonary surfactants, indicating IVI-induced aberrations of the pulmonary surfactant system might play an important role in the etiology of respiratory failure and repair. Our findings revealed dynamic host responses to IVI and various metabolic pathways linked to disease progression, and provided mechanistic insights into IVI-induced ALI and repair process. PMID:27188343

  8. Inhalation of glycopyrronium inhibits cigarette smoke-induced acute lung inflammation in a murine model of COPD.

    PubMed

    Shen, Liang-liang; Liu, Ya-nan; Shen, Hui-juan; Wen, Chong; Jia, Yong-liang; Dong, Xin-wei; Jin, Fang; Chen, Xiao-ping; Sun, Yun; Xie, Qiang-min

    2014-02-01

    Glycopyrronium bromide (GB) is a muscarinic receptor antagonist that has been used as a long-acting bronchodilator in chronic obstructive pulmonary disease (COPD) patients. The aim of this study was to investigate the anti-inflammatory activity of inhaled GB in a cigarette smoke-induced acute lung inflammation mouse model. We found that aerosol pre-treatment with GB suppresses the accumulation of neutrophils and macrophages in the bronchoalveolar lavage fluid (BALF) in cigarette smoke (CS)-exposed mice. GB at doses of 300 and 600 μg/ml significantly inhibited the CS-induced increases in the mRNA and protein expression levels of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, monocyte chemotactic protein (MCP)-1 and transforming growth factor (TGF)-β1 in lung tissues and the BALF. Moreover, GB at a dose of 600 μg/ml significantly inhibited the CS-induced changes in glutathione (GSH) and myeloperoxidase (MPO) activities in the BALF, decreased the CS-induced expression of matrix metalloproteinases (MMP)-9, and increased the CS-induced expression of tissue inhibitor of metalloproteinases (TIMP)-1, as determined through the immunohistochemical staining of lung tissue. Our results demonstrate the beneficial effects of inhaled GB on the inflammatory reaction in COPD. PMID:24389380

  9. Preclinical activity of the novel B-cell-specific Moloney murine leukemia virus integration site 1 inhibitor PTC-209 in acute myeloid leukemia: Implications for leukemia therapy.

    PubMed

    Nishida, Yuki; Maeda, Aya; Chachad, Dhruv; Ishizawa, Jo; Qiu, Yi Hua; Kornblau, Steven M; Kimura, Shinya; Andreeff, Michael; Kojima, Kensuke

    2015-12-01

    Curing patients with acute myeloid leukemia (AML) remains a therapeutic challenge. The polycomb complex protein B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) is required for the self-renewal and maintenance of leukemia stem cells. We investigated the prognostic significance of BMI-1 in AML and the effects of a novel small molecule selective inhibitor of BMI-1, PTC-209. BMI-1 protein expression was determined in 511 newly diagnosed AML patients together with 207 other proteins using reverse-phase protein array technology. Patients with unfavorable cytogenetics according to Southwest Oncology Group criteria had higher levels of BMI-1 compared to those with favorable (P = 0.0006) or intermediate cytogenetics (P = 0.0061), and patients with higher levels of BMI-1 had worse overall survival (55.3 weeks vs. 42.8 weeks, P = 0.046). Treatment with PTC-209 reduced protein level of BMI-1 and its downstream target mono-ubiquitinated histone H2A and triggered several molecular events consistent with the induction of apoptosis, this is, loss of mitochondrial membrane potential, caspase-3 cleavage, BAX activation, and phosphatidylserine externalization. PTC-209 induced apoptosis in patient-derived CD34(+)CD38(low/-) AML cells and, less prominently, in CD34(-) differentiated AML cells. BMI-1 reduction by PTC-209 directly correlated with apoptosis induction in CD34(+) primary AML cells (r = 0.71, P = 0.022). However, basal BMI-1 expression was not a determinant of AML sensitivity. BMI-1 inhibition, which targets a primitive AML cell population, might offer a novel therapeutic strategy for AML. PMID:26450753

  10. Gene silencing of TNF-alpha in a murine model of acute colitis using a modified cyclodextrin delivery system.

    PubMed

    McCarthy, J; O'Neill, M J; Bourre, L; Walsh, D; Quinlan, A; Hurley, G; Ogier, J; Shanahan, F; Melgar, S; Darcy, R; O'Driscoll, C M

    2013-05-28

    Inflammatory bowel disease (IBD) is a chronic relapsing inflammation of the gastrointestinal tract. The cytokine TNF-alpha (TNF-α) plays a pivotal role in mediating this inflammatory response. RNA interference (RNAi) holds great promise for the specific and selective silencing of aberrantly expressed genes, such as TNF-α in IBD. The aim of this study was to investigate the efficacy of an amphiphilic cationic cyclodextrin (CD) vector for effective TNF-α siRNA delivery to macrophage cells and to mice with induced acute-colitis. The stability of CD.siRNA was examined by gel electrophoresis in biorelevant media reflecting colonic fluids. RAW264.7 cells were transfected with CD.TNF-α siRNA, stimulated with lipopolysaccharide (LPS) and TNF-α and IL-6 responses were measured by PCR and ELISA. Female C57BL/6 mice were exposed to dextran sodium sulphate (DSS) and treated by intrarectal administration with either CD.siRNA TNF-α or a control solution. In vitro, siRNA in CD nanocomplexes remained intact and stable in both fed and fasted simulated colonic fluids. RAW264.7 cells transfected with CD.TNF-α siRNA and stimulated with LPS displayed a significant reduction in both gene and protein levels of TNF-α and IL-6. CD.TNF-α siRNA-treated mice revealed a mild amelioration in clinical signs of colitis, but significant reductions in total colon weight and colonic mRNA expression of TNF-α and IL-6 compared to DSS-control mice were detected. This data indicates the clinical potential of a local CD-based TNF-α siRNA delivery system for the treatment of IBD. PMID:23500058

  11. Physiological noise in murine solid tumours using T2*-weighted gradient-echo imaging: a marker of tumour acute hypoxia?

    NASA Astrophysics Data System (ADS)

    Baudelet, Christine; Ansiaux, Réginald; Jordan, Bénédicte F.; Havaux, Xavier; Macq, Benoit; Gallez, Bernard

    2004-08-01

    with no contrast enhancement as the result of vessel functional impairment. Furthermore, transient fluctuations appeared to occur preferentially in neoangiogenic hyperpermeable vessels. The present study suggests that spontaneous T2*-weighted GRE fluctuations are very likely to be related to the spontaneous fluctuations in blood flow and oxygenation associated with the pathophysiology of acute hypoxia in tumours. The disadvantage of the T2*-weighted GRE MRI technique is the complexity of signal interpretation with regard to pO2 changes. Compared to established techniques such as intravital microscopy or histological assessments, the major advantage of the MRI technique lies in its capacity to provide simultaneously both temporal and detailed spatial information on spontaneous fluctuations throughout the tumour.

  12. Cytomegalovirus infection enhances the immune response to influenza.

    PubMed

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-04-01

    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. PMID:25834109

  13. Cytomegalovirus: pathophysiological mechanisms of the cytomegalovirus-induced cellular responses

    SciTech Connect

    Nokta, M.A.

    1986-01-01

    Cytomegalovirus (CMV) infection of fibroblasts of human origin is associated with a cascade of morphologic cellular responses which in other systems have been associated with regulation of intracellular free (IF) (Ca/sup + +/). In the present study, the relationship of specific ion fluxes (Ca/sup + +/, Na/sup +/) to the development of cytomegalovirus (CMV)-induced morphologic cellular responses was investigated. An influx of Ca/sup + +/ was observed by the first hour after CMV infection (PI), and total calcium sequestered by infected cells was enhanced by 5 hr Pl. A gradual rise in intracellular free (IF) (Ca/sup + +/) was observed that continued through 48 hour postinfection (hr Pl). The IF (Ca/sup + +/) response to CMV infection was shown to be multiplicity dependent, require viable virus, and occur under conditions consistent with the expression of immediate early CMV genes. Development and progression of cytomegaly was found to be independent of CMV DNA synthesis and appeared to be dependent on the IF (Ca/sup + +/) response. Ca/sup + +/ influx blockers (e.g. verapamil) and cyclic nucleotide modulators (e.g. papaverine) inhibited both Ca/sup + +/ responses and cytomegaly. Quabain-sensitive /sup 86/Rb uptake and sequestering of Ca/sup + +/ increased in parallel with development of cytomegaly. There may be a relationship between Ca/sup + +/ influx, IF (Ca/sup + +/), activation of the Na/sup +//H/sup +/ exchanger, induction of Na/sup +/, Cl/sup -/, HCO/sub 3/ cotransport, Na/sup +/ entry, Na/sup +//K/sup +/ ATPase activity and development of CMV-induced morphologic cellular responses including cytomegaly.

  14. Expression of granzyme B during primary cytomegalovirus infection after renal transplantation.

    PubMed

    Wever, P C; Spaeny, L H; van der Vliet, H J; Rentenaar, R J; Wolbink, A M; Surachno, J; Wertheim, P M; Schellekens, P T; Hack, C E; ten Berge, I J

    1999-03-01

    CD8+ T cells employ granzyme B (GrB) to induce apoptosis in target cells. Increased expression of GrB has been put forward as a diagnostic marker in transplant rejection and viral infection. Three-color flow cytometric analysis revealed that peripheral blood CD8+ T lymphocytosis during primary cytomegalovirus infection after renal transplantation resulted from expansion of a CD8+GrB+CD62L+ T cell subset that was almost absent during stable transplant function or acute rejection. This expansion coincided with a temporary increase in systemic soluble GrB (sGrB) levels. No such increase was observed during stable transplant function or acute rejection. Thus, the primary immune response to cytomegalovirus infection is accompanied by appearance of CD8+GrB+CD62L+ T cells and increased sGrB levels in the peripheral blood compartment. Determination of the latter may provide a novel approach for monitoring viral infections.

  15. Evaluating an etiologically relevant platform for therapy development for temporal lobe epilepsy: effects of carbamazepine and valproic acid on acute seizures and chronic behavioral comorbidities in the Theiler's murine encephalomyelitis virus mouse model.

    PubMed

    Barker-Haliski, Melissa L; Dahle, E Jill; Heck, Taylor D; Pruess, Timothy H; Vanegas, Fabiola; Wilcox, Karen S; White, H Steve

    2015-05-01

    Central nervous system infections can underlie the development of epilepsy, and Theiler's murine encephalomyelitis virus (TMEV) infection in C57BL/6J mice provides a novel model of infection-induced epilepsy. Approximately 50-65% of infected mice develop acute, handling-induced seizures during the infection. Brains display acute neuropathology, and a high number of mice develop spontaneous, recurrent seizures and behavioral comorbidities weeks later. This study characterized the utility of this model for drug testing by assessing whether antiseizure drug treatment during the acute infection period attenuates handling-induced seizures, and whether such treatment modifies associated comorbidities. Male C57BL/6J mice infected with TMEV received twice-daily valproic acid (VPA; 200 mg/kg), carbamazepine (CBZ; 20 mg/kg), or vehicle during the infection (days 0-7). Mice were assessed twice daily during the infection period for handling-induced seizures. Relative to vehicle-treated mice, more CBZ-treated mice presented with acute seizures; VPA conferred no change. In mice displaying seizures, VPA, but not CBZ, reduced seizure burden. Animals were then randomly assigned to acute and long-term follow-up. VPA was associated with significant elevations in acute (day 8) glial fibrillary acidic protein (astrocytes) immunoreactivity, but did not affect NeuN (neurons) immunoreactivity. Additionally, VPA-treated mice showed improved motor performance 15 days postinfection (DPI). At 36 DPI, CBZ-treated mice traveled significantly less distance through the center of an open field, indicative of anxiety-like behavior. CBZ-treated mice also presented with significant astrogliosis 36 DPI. Neither CBZ nor VPA prevented long-term reductions in NeuN immunoreactivity. The TMEV model thus provides an etiologically relevant platform to evaluate potential treatments for acute seizures and disease modification.

  16. Virus Attenuation after Deletion of the Cytomegalovirus Fc Receptor Gene Is Not due to Antibody Control

    PubMed Central

    Crnković-Mertens, Irena; Messerle, Martin; Milotić, Irena; Szepan, Uwe; Kučić, Natalija; Krmpotić, Astrid; Jonjić, Stipan; Koszinowski, Ulrich H.

    1998-01-01

    The murine cytomegalovirus (MCMV) fcr-1 gene codes for a glycoprotein located at the surface of infected cells which strongly binds the Fc fragment of murine immunoglobulin G. To determine the biological significance of the fcr-1 gene during viral infection, we constructed MCMV fcr-1 deletion mutants and revertants. The fcr-1 gene was disrupted by insertion of the Escherichia coli lacZ gene. In another mutant, the marker gene was also deleted, by recombinase cre. As expected for its hypothetical role in immunoevasion, the infection of mice with fcr-1 deletion mutants resulted in significantly restricted replication in comparison with wild-type MCMV and revertant virus. In mutant mice lacking antibodies, however, the fcr-1 deletion mutants also replicated poorly. This demonstrated that the cell surface-expressed viral glycoprotein with FcR activity strongly modulates the virus-host interaction but that this biological function is not caused by the immunoglobulin binding property. PMID:9445038

  17. Murine Typhus

    PubMed Central

    Dzul-Rosado, Karla R; Zavala Velázquez, Jorge Ernesto; Zavala-Castro, Jorge

    2012-01-01

    Rickettsia typhi: is an intracellular bacteria who causes murine typhus. His importance is reflected in the high frequency founding specific antibodies against Rickettsia typhi in several worldwide seroepidemiological studies, the seroprevalence ranging between 3-36%. Natural reservoirs of R. typhi are rats (some species belonging the Rattus Genus) and fleas (Xenopsylla cheopis) are his vector. This infection is associated with overcrowding, pollution and poor hygiene. Typically presents fever, headache, rash on trunk and extremities, in some cases may occur organ-specific complications, affecting liver, kidney, lung or brain. Initially the disease is very similar to other diseases, is very common to confuse the murine typhus with Dengue fever, therefore, ignorance of the disease is a factor related to complications or non-specific treatments for the resolution of this infection. This paper presents the most relevant information to consider about the rickettsiosis caused by Rickettsia typhi. PMID:24893060

  18. Interferon γ-dependent migration of microglial cells in the retina after systemic cytomegalovirus infection.

    PubMed

    Zinkernagel, Martin S; Chinnery, Holly R; Ong, Monique L; Petitjean, Claire; Voigt, Valentina; McLenachan, Samuel; McMenamin, Paul G; Hill, Geoffrey R; Forrester, John V; Wikstrom, Matthew E; Degli-Esposti, Mariapia A

    2013-03-01

    Microglial cells are the resident macrophages of the central nervous system and participate in both innate and adaptive immune responses but can also lead to exacerbation of neurodegenerative pathologies after viral infections. Microglia in the outer layers of the retina and the subretinal space are thought to be involved in retinal diseases where low-grade chronic inflammation and oxidative stress play a role. This study investigated the effect of systemic infection with murine cytomegalovirus on the distribution and dynamics of retinal microglia cells. Systemic infection with murine cytomegalovirus elicited a significant increase in the number of microglia in the subretinal space and an accumulation of iris macrophages, along with morphological signs of activation. Interferon γ (IFN-γ)-deficient mice failed to induce changes in microglia distribution. Bone marrow chimera experiments confirmed that microglial cells in the subretinal space were not recruited from the circulating monocyte pool, but rather represented an accumulation of resident microglial cells from within the retina. Our results demonstrate that a systemic viral infection can lead to IFN-γ-mediated accumulation of microglia into the outer retinal layers and offer proof of concept that systemic viral infections alter the ocular microenvironment and therefore, may influence the course of diseases such as macular degeneration, diabetic retinopathy, or autoimmune uveitis, where low-grade inflammation is implicated.

  19. Rare presentations of cytomegalovirus infection in renal allograft recipients.

    PubMed

    Ardalan, Mohammadreza

    2012-01-01

    Cytomegalovirus is the most common viral infection after kidney transplantation. Clinical presentations of cytomegalovirus infection range from asymptomatic infection to organ-specific involvement. Most symptomatic infections manifest as fever and cytopenia. The gastrointestinal tract is the most common site of tissue-invasive infection, often presenting as diarrhea or gastrointestinal bleeding. Gastrointestinal obstruction, perforation, thrombosis of large gastrointestinal veins, splenic artery thrombosis, and pancreatitis are rare gastrointestinal presentations of cytomegalovirus infection. Renal-allograft ureteral stricture and skin involvement are other rare presentations of cytomegalovirus infection. hemophagocytic syndrome, thrombotic microangiopathy, adrenal insufficiency, and renal allograft artery stenosis are other rare symptoms of cytomegalovirus infection.

  20. Cytomegalovirus excretion in gnotobiotic pigs.

    PubMed Central

    Edington, N.; Watt, R. G.; Plowright, W.

    1976-01-01

    Germ-free piglets were infected intranasally with porcine cytomegalovirus (PCMV) at 1 day (group A) or 3 weeks of age (group B). Viraemia and virus excretion by the nasal, pharyngeal and conjunctival routes was studied up to the time of death or to 12 weeks. Virus was also sought in tissues at death or at slaughter, as well as in a few urine samples. Viraemia was detected in group A between days 5 and 19 after infection and in group B between days 14 and 16 inclusive. The chief route of virus excretion was the nasal mucosa, followed by the pharynx and conjunctiva; the maximal duration of excretion by these routes was 32, 25 and 14 days for pigs of group A and 9, 7 and 4 days for group B. The quantity of virus was also greater in the former group, of which died of generalized PCMV infection. A viruria was demonstrated in 2 animals. Antibody detectable in indirect immunofluorescence (IIF) tests appeared towards the end of the third week, reaching maximal titres at 5 to 7 weeks after infection. The mean peak titre of antibody in group B was lower than in group A. Corticosteroid treatment at days 56--62 after infection resulted in some recrudescence of virus excretion, accompanied in group B by about a twofold increase in IIF antibody. PCMV was isolated in cultures of lung macrophages from 4 of 7 animals killed at about 12 weeks after inoculation. PMID:185292

  1. The pathogenesis of human cytomegalovirus.

    PubMed

    Griffiths, Paul; Baraniak, Ilona; Reeves, Matt

    2015-01-01

    Human cytomegalovirus (HCMV) is a recognized cause of disease in the fetus, the allograft recipient and AIDS patients. More recently, it has been recognized as a pathogen for those admitted to intensive care units, for the elderly and for the general population. The epidemiology and molecular and cellular pathology of this virus are summarized to provide an overarching model of pathogenesis, able to account for these varying clinical presentations. In brief, HCMV has the potential to spread in the bloodstream to all organs, but only produces overt disease if the viral load increases to high levels. This is normally prevented by a robust immune response, so that the infected individual usually remains asymptomatic. However, this benefit comes at the cost of committing more and more immunological resources to controlling HCMV with time, so that the overall function of the immune system is impaired. Fortunately, recent progress in developing novel antiviral drugs and vaccines suggests the possibility that the diverse effects of HCMV may soon become controllable at the individual and population level, respectively.

  2. Cytomegalovirus infection accelerates epigenetic aging.

    PubMed

    Kananen, Laura; Nevalainen, Tapio; Jylhävä, Juulia; Marttila, Saara; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-12-01

    Epigenetic mechanisms such as DNA methylation (DNAm) have a central role in the regulation of gene expression and thereby in cellular differentiation and tissue homeostasis. It has recently been shown that aging is associated with profound changes in DNAm. Several of these methylation changes take place in a clock-like fashion, i.e. correlating with the calendar age of an individual. Thus, the epigenetic clock based on these kind of DNAm changes could provide a new biomarker for human aging process, i.e. being able to separate the calendar and biological age. Information about the correlation of the time indicated by this clock to the various aspects of immunosenescence is still missing. As chronic cytomegalovirus (CMV) infection is probably one of the major driving forces of immunosenescence, we now have analyzed the correlation of CMV seropositivity with the epigenetic age in the Vitality 90+cohort 1920 (122 nonagenarians and 21 young controls, CMV seropositivity rates 95% and 57%, respectively). The data showed that CMV seropositivity was associated with a higher epigenetic age in both of these age groups (median 26.5 vs. 24.0 (p < 0.02,Mann–Whitney U-test) in the young controls and 76.0 vs. 70.0 (p < 0.01) in the nonagenarians). Thus, these data provide a new aspect to the CMV associated pathological processes. PMID:26485162

  3. Fetal cytomegalovirus infection manifesting as transient pancytopenia.

    PubMed

    Kiyokoba, Ryo; Hidaka, Nobuhiro; Sakata, Yukiyo; Hachisuga, Kazuhisa; Fukushima, Kotaro; Kato, Kiyoko

    2015-08-01

    We encountered a patient with a fetal cytomegalovirus infection manifesting as pancytopenia and thoracic hypoplasia. The fetal anemia was treated by transfusion via the umbilical cord, and did not progress after 22 weeks' gestation. The neutropenia resolved spontaneously, and only thrombocytopenia was persistent at birth. The severe thoracic hypoplasia led to pulmonary hypertension and required intensive postnatal respiratory management. Our experience suggests that pancytopenia is a possible manifestation in fetuses infected with cytomegalovirus. This may be transient, resolving spontaneously during fetal life; however, caution should be taken with blood counts, particularly platelet counts, after delivery. In addition, clinicians should carefully follow the thoracic volume in cytomegalovirus-infected fetuses and consider the possibility of postnatal severe respiratory insufficiency.

  4. Antiviral Prevention of Sepsis Induced Cytomegalovirus Reactivation in Immunocompetent Mice

    PubMed Central

    Forster, Meghan R.; Trgovcich, Joanne; Zimmerman, Peter; Chang, Alexander; Miller, Cortland; Klenerman, Paul; Cook, Charles H.

    2009-01-01

    Introduction Immunocompetent patients can reactivate latent cytomegalovirus (CMV) during critical illness and reactivation is associated with significantly worse outcomes. Prior to clinical trials in humans to prove causality, we sought to determine an optimal antiviral treatment strategy. Methods Mice latently infected with murine CMV (MCMV) received a septic reactivation trigger and were randomized to receive one of four ganciclovir regimens or saline. Lungs were evaluated for viral transcriptional reactivation and fibrosis after each regimen. Influences of ganciclovir on early sepsis induced pulmonary inflammation and T-cell activation were studied after sepsis induction. Results All ganciclovir regimens reduced measurable MCMV transcriptional reactivation, and 10mg/day for 7 or 21 days was most effective. Lower dose (5mg/kg/day) or delayed therapy were associated with significant breakthrough reactivation. Higher doses of ganciclovir given early were associated with the lowest incidence of pulmonary fibrosis, and delay of therapy for 1 week was associated with significantly worse pulmonary fibrosis. Although bacterial sepsis induced activation of MCMV-specific pulmonary T-cells, this activation was not influenced by ganciclovir. Conclusion These results suggest that antiviral treatment trials in humans should use 10mg/kg/day ganciclovir administered as early as possible in at-risk patients to minimize reactivation events and associated pulmonary injury PMID:20004216

  5. Subclinical Congenital Cytomegalovirus Infection and Hearing Impairment

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1974-01-01

    When the hearing sensitivity of children with subclinical congenital cytomegalovirus infection was evaluated and compared with that of a group of matched control subjects, nine of the 18 infected subjects were found to have some hearing loss, ranging from slight high-frequency impairments to a severe-to-profound unilateral loss. (MYS)

  6. [Hemophagocytic syndrome associated with cytomegalovirus viral infection].

    PubMed

    Núñez Bacarreza, J J; Montiel López, L; Núñez del Prado Alcoreza, J R

    2011-04-01

    The clinical case of a 19-year old woman with the clinical criteria of Cytomegalovirus (CMV) viral associated with Hemophagocytic syndrome (VAHS) is presented. The clinical outcome was poor and rapidly progressive, ending in exitus letalis. The principal concepts and characteristics of the Hemophagocytic syndrome are discussed, stressing the current consensus rules and the variations in management according to international guidelines.

  7. Persistent and acute central nervous system infections are caused by Theiler's murine encephalomyelitis viruses which differ in RNA composition but code for only slightly different proteins.

    PubMed

    Lorch, Y; Kotler, M; Friedmann, A

    1984-12-01

    The RNA and proteins for four representatives of the two subgroups of Theiler's murine encephalomyelitis viruses were studied. The large RNase T1-resistant oligonucleotides, when mapped along the RNA molecules, were found to be differently distributed in the two subgroups. Replicative form RNAs of two representatives were partially denatured, and the denaturation maps obtained were found to be similar but not identical. In addition, the analysis of the tryptic maps of the capsid proteins of all four isolates revealed that only small differences in the peptide map patterns exist among these viruses. The correlation of these findings with the pathogenicity of Theiler's viruses is discussed.

  8. Rosmarinus officinalis L. extract ameliorates intestinal inflammation through MAPKs/NF-κB signaling in a murine model of acute experimental colitis.

    PubMed

    Medicherla, Kanakaraju; Ketkar, Avanee; Sahu, Bidya Dhar; Sudhakar, Godi; Sistla, Ramakrishna

    2016-07-13

    We investigated the anti-inflammatory and anti-colitis effects of Rosmarinus officinalis L. extract (RE) by using both in vitro LPS-activated mouse RAW 264.7 macrophages and in vivo dextran sulfate sodium (DSS)-induced experimental murine colitis and suggested the underlying possible mechanisms. Liquid Chromatography-Mass Spectrometry (LC-MS) analysis was performed to identify the major components present in the RE. The clinical signs, biochemistry, immunoblot, ELISA and histology in colon tissues were assessed in order to elucidate the beneficial effect of RE. RE suppressed the LPS-induced pro-inflammatory cytokine production and the expressions of inflammatory proteins in macrophages. Administration of RE (50 and 100 mg kg(-1)) also significantly reduced the severity of DSS-induced murine colitis, as assessed by the clinical symptoms, colon length and histology. RE administration prevented the DSS-induced activation of p38, ERK and JNK MAPKs, attenuated IκBα phosphorylation and subsequent nuclear translocation and DNA binding of NF-κB (p65). RE also suppressed the COX-2 and iNOS expressions, decreased the levels of TNF-α and IL-6 cytokines and the myeloperoxidase activity in the colon tissue. Histological observation revealed that RE administration alleviated mucosal damage and inflammatory cell infiltration induced by DSS in the colon tissue. Hence, RE could be used as a new preventive and therapeutic food ingredient or as a dietary supplement for inflammatory bowel disease. PMID:27349640

  9. Congenital cytomegalovirus infection. Is there a breakthrough?

    PubMed Central

    Bar-Oz, B.; Berkovitch, M.; Ford-Jones, L.; Koren, G.

    2001-01-01

    QUESTION: My 26-year-old patient is planning her first pregnancy in the coming month. She works in a day-care centre. Recently, two cases of cytomegalovirus (CMV) infection were diagnosed in her class. What tests should she have before and during the pregnancy, and how should I care for her? ANSWER: Cytomegalovirus infection, the most common congenital viral infection in humans, carries high risk of long-term morbidity and mortality. Seronegative mothers of children in day-care centres are at as high risk of acquiring the infection as day-care workers themselves. The immune status of at-risk patients should be evaluated as pregnancy progresses. Evidence of fetal infection does not necessarily mean fetal disease or damage. With a primary-infected fetus, termination of pregnancy might be discussed with the parents. PMID:11421042

  10. [Intravitreal ganciclovir in cytomegalovirus retinitis in AIDS].

    PubMed

    Olea, J L; Salvat, M; Mateos, J M; Vila, J; Villalonga, C; Riera, M

    1996-04-01

    A retrospective study was made of 26 patients with AIDS who initially presented with retinitis as the only clinical manifestation of cytomegalovirus infection (39 eyes). Sixty-five induction or re-induction therapeutic courses were administered with intravitreal ganciclovir. The efficiency rate of therapy was 93.8%. Thirty-eight maintenance therapeutic courses (200 micrograms/week) were evaluated. The non-compliance rate was 23%. Bilateral retinitis occurred in 44.4% of cases. The systemic administration of therapy had to be substituted for the intravitreal administration in 32% of patients during the clinical course of their conditions. The mean survival rate was 9.5 months. Both retinal detachment and vitreal hemorrhage occurred in 5% of patients. When retinitis is the first clinical manifestation of cytomegalovirus infection, therapy with intravitreal ganciclovir is efficacious to inactivate lesions. Although bilateral retinitis and extraocular dissemination are common, the mean survival rate is high.

  11. Failure in generating hemopoietic stem cells is the primary cause of death from cytomegalovirus disease in the immunocompromised host

    SciTech Connect

    Mutter, W.; Reddehase, M.J.; Busch, F.W.; Buehring, H.J.K.; Koszinowski, U.H.

    1988-05-01

    We have shown in a murine model system for cytomegalovirus (CMV) disease in the immunocompromised host that CMV infection interferes with the earliest detectable step in hemopoiesis, the generation of the stem cell CFU-S-I, and thereby prevents the autoreconstitution of bone marrow after sublethal irradiation. The antihemopoietic effect could not be ascribed to a direct infection of stem cells. The failure in hemopoiesis was prevented by adoptive transfer of antiviral CD8+ T lymphocytes and could be overcome by syngeneic bone marrow transplantation. CD8+ T lymphocytes and bone marrow cells both mediated survival, although only CD8+ T lymphocytes were able to limit virus multiplication in host tissues. We concluded that not the cytopathic effect of virus replication in host tissues, but the failure in hemopoiesis, is the primary cause of death in murine CMV disease.

  12. Cytomegalovirus Cutaneous Infection in an Immunocompromised Patient

    PubMed Central

    Pedersen, Faye T; Alhassan, Sulaiman; Adjapong, Opoku; Thirumala, Raghukumar

    2016-01-01

    Cytomegalovirus (CMV), a member of the Herpesviridae family, is an opportunistic infection with a typically benign course in the healthy host but has a more ominous course in the immunocompromised population. CMV infection commonly affects the visceral organs, particularly the respiratory and the gastrointestinal tract. CMV cutaneous lesions are rare and can be easily missed. We present a case of a 76-year-old woman presenting with a diffuse non-pruritic macular lesion with scattered vesicles and bullae, which was initially treated as a varicella zoster virus infection and herpes simplex viral infection, but was later found on biopsy to be due to cytomegalovirus. She has a history of Sjögren's syndrome, interstitial lung disease, and being on chronic immunosuppression therapy. This case highlights the importance of considering CMV infection in the differential diagnosis of vesicular skin lesions in immunocompromised patients. Based on a PubMed search for “cutaneous cytomegalovirus”, “cutaneous CMV”, “cytomegalovirus skin”, and “skin CMV” in material published in the last 20 years (from 1996 to 2016) and reviewing any applicable referenced material outside of those dates, cases of cutaneous CMV are not well documented. PMID:27335710

  13. Cytomegalovirus pneumonia in a patient with interstitial pneumonia and Nocardia asiatica presenting as cavitary lung lesions.

    PubMed

    Saraya, Takeshi; Ohkuma, Kosuke; Kikuchi, Ken; Tamura, Masaki; Honda, Kojiro; Yamada, Atsuko; Araki, Koji; Ishii, Haruyuki; Makino, Hiroshi; Takei, Hidefumi; Karita, Shin; Fujiwara, Masachika; Takizawa, Hajime; Goto, Hajime

    2013-01-01

    A 66-year-old man who suffered from an acute exacerbation of interstitial pneumonia developed a cavitary lesion after taking immunosuppressive drugs. He was diagnosed with cytomegalovirus (CMV) pneumonia. CMV was not thought to be the underlying cause of the cavitary lung lesions, as only six cases have been described thus far. However, this case clearly demonstrates that the development of cavitary lung lesions can be caused by CMV. Following CMV pneumonia, cavitary lesions again occurred in the patient's lungs that were thought to be the first case of cavitary lesions caused by Nocardia asiatica infection. PMID:23448771

  14. Murine schistosomiasis mansoni: process of blood coagulation at pre-patent, acute and chronic phases, and consequence of chemotherapeutic cure on the reversion of changes.

    PubMed

    Carvalho, Maria G; Mello, Rômulo T; Soares, Anna L; Bicalho, Rosilene S; Lima e Silva, Francisco C; Coelho, Paulo M Z

    2005-10-01

    The present study aims to elucidate in a sequential manner the changes of the blood coagulation process at different phases of experimental schistosomiasis, comprising the pre-patent, acute, intermediate and chronic phases, and the effect of chemotherapeutic cure, at the acute and chronic phases, on reversion of changes related to the coagulation factors. Mice were infected with Schistosoma mansoni cercariae, and were divided into four groups. Blood samples from these groups were collected 32, 70, 100, and 140 days after infection, corresponding to the pre-patent, acute, intermediate and chronic phases, respectively. Simultaneously, other infected groups were given oxamniquine, 70 and 140 days after infection. At the same time as blood collection from infected and/or treated animal groups, other uninfected control animal groups were punctured and maintained under the same conditions as the infected animals. The vitamin-K-dependent clotting factors were found to be more sensitive to infection at different phases, while factors VIII and XI presented hyperactivity. Results obtained 90 days after chemotherapeutic treatment with oxamniquine, administered at the acute and chronic phases, presented noticeable reversion of the main alterations in the coagulation mechanism. The present study provides unquestionable data on the development of hemostatic changes throughout the course of S. mansoni infection.

  15. Complete Genome Sequences of Mandrillus leucophaeus and Papio ursinus Cytomegaloviruses.

    PubMed

    Blewett, Earl Linwood; Sherrod, Carly J; Texier, Jordan R; Conrad, Tom M; Dittmer, Dirk P

    2015-01-01

    The complete genome sequences of Mandrillus leucophaeus and Papio ursinus cytomegaloviruses were determined. An isolate from a drill monkey, OCOM6-2, and an isolate from a chacma baboon, OCOM4-52, were subjected to pyrosequencing and assembled. Comparative alignment of published primate cytomegaloviruses (CMVs) showed variable sequence conservation between species.

  16. Dendritic cells in cytomegalovirus infection: viral evasion and host countermeasures.

    PubMed

    Rölle, Alexander; Olweus, Johanna

    2009-05-01

    Human cytomegalovirus (HCMV) is a beta-herpesvirus that infects the majority of the population during early childhood and thereafter establishes life-long latency. Primary infection as well as spontaneous reactivation usually remains asymptomatic in healthy hosts but can, in the context of systemic immunosuppression, result in substantial morbidity and mortality. HCMV counteracts the host immune response by interfering with the recognition of infected cells. A growing body of literature has also suggested that the virus evades the immune system by paralyzing the initiators of antiviral immune responses--the dendritic cells (DCs). In the current review, we discuss the effects of CMV (HCMV and murine CMV) on various DC subsets and the ensuing innate and adaptive immune responses. The impact of HCMV on DCs has mainly been investigated using monocyte-derived DCs, which are rendered functionally impaired by infection. In mouse models, DCs are targets of viral evasion as well, but the complex cross-talk between DCs and natural killer cells has, however, demonstrated an instrumental role for DCs in the control and clearance of viral infection. Fewer studies address the role of peripheral blood DC subsets, plasmacytoid DCs and CD11c+ myeloid DCs in the response against HCMV. These DCs, rather than being paralyzed by HCMV, are largely resistant to infection, mount a vigorous first-line defense and induce T-cell responses to the virus. This possibly provides a partial explanation for an intriguing conundrum: the highly efficient control of viral infection and reactivation in immunocompetent hosts in spite of multi-layered viral evasion mechanisms.

  17. High Expression of Human Homologue of Murine Double Minute 4 and the Short Splicing Variant, HDM4-S, in Bone Marrow in Patients With Acute Myeloid Leukemia or Myelodysplastic Syndrome.

    PubMed

    Han, Xin; Medeiros, L Jeffrey; Zhang, Yu Helen; You, M James; Andreeff, Michael; Konopleva, Marina; Bueso-Ramos, Carlos E

    2016-08-01

    The human homologue of murine double minute 2 (HDM2) and HDM4 negatively regulate p53. HDM4 has not been assessed in acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS). We examined the expression of HDM4 and the short splicing variant, HDM4-S, in bone marrow samples obtained from 85 and 23 patients with AML and MDS, respectively, and 18 negative tumor staging bone marrow samples (used as the control). Immunohistochemical staining showed that HDM4 was overexpressed in 78 AML cases (92%) and 12 MDS cases (52%) compared with 1 stressed bone marrow sample (6%). Quantitative reverse transcriptase-polymerase chain reaction analysis of 8 AML and 11 low-grade (LG)-MDS cases confirmed that HDM4 and HDM4-S mRNA expression were also elevated in all AML cases. HDM4 and HDM4-S mRNA expression was elevated in 3 (27%) and 10 (91%) LG-MDS cases, respectively. HDM4 and HDM4-S mRNA levels were higher in those with AML than in those with LG-MDS. In leukemia cell lines, HEL and U937 predominantly expressed HDM4-S. In contrast, NALM6 expressed HDM4 and HDM4-S. Downregulation of HDM4 expression by treatment with small interfering RNA in NALM6 and HEL cells induced p21 expression but not increased apoptotic activity. Our results indicate that HDM4 is a potential therapeutic target in patients with AML or MDS. PMID:27155969

  18. IL-22 promoted CD3+ T cell infiltration by IL-22R induced STAT3 phosphorylation in murine acute graft versus host disease target organs after allogeneic bone marrow transplantation.

    PubMed

    Zhao, Kai; Ruan, Suhong; Tian, Yu; Zhao, Dongmei; Chen, Chong; Pan, Bin; Yan, Zhiling; Yin, Lingling; Zhu, Shengyun; Xu, Kailin

    2016-10-01

    Graft versus host disease (GVHD) is a life threatening complication of bone marrow stem cell transplantation, in which considerable numbers of proinflammatory cytokines secreted by allo-reactive donor T cells are involved. We and other previous studies have found that interleukin-22 (IL-22) was able to aggravate the target organs damage of GVHD. However, the mechanism and the signal pathway of IL-22 in murine acute GVHD was not clear. Here, we observed that compared with GVHD group, more serious pathological damage and more CD3(+) T cells infiltrated in GVHD target organs were detected in the mice injected with IL-22. Meanwhile, transcription factor T-bet, RORγt and AhR respectively associated with Th1, Th17 and Th22 cells changed in varying degrees in different GVHD target organs. Furthermore, the increased expression of IL-22R and its downstream protein P-STAT3 were detected in GVHD mice with IL-22 treated. These results suggested that the pathological role of IL-22 in GVHD target organs contribute to exogenous injected IL-22 as well as secreted IL-22 from the infiltrated allo-reactive effector T cells. In addition, the IL-22R-STAT3 pathway may play important role in GVHD tissue injury and target this way may yield new approaches for reduction of GVHD. PMID:27551984

  19. Cytomegalovirus Hyper Immunoglobulin for CMV Prophylaxis in Thoracic Transplantation.

    PubMed

    Rea, Federico; Potena, Luciano; Yonan, Nizar; Wagner, Florian; Calabrese, Fiorella

    2016-03-01

    Cytomegalovirus (CMV) infection negatively influences both short- and long-term outcomes after cardiothoracic transplantation. In heart transplantation, registry analyses have shown that CMV immunoglobulin (CMVIG) with or without virostatic prophylaxis is associated with a significant reduction in mortality and graft loss versus no prophylaxis, particularly in high-risk donor (D)+/recipient (R)- transplants. Randomized comparative trials are lacking but retrospective data suggest that addition of CMVIG to antiviral prophylaxis may reduce rates of CMV-related events after heart transplantation, including the incidence of acute rejection or chronic allograft vasculopathy. However, available data consistently indicate that when CMVIG is used, it should be administered with concomitant antiviral therapy, and that evidence concerning preemptive management with CMVIG is limited, but promising. In lung transplantation, CMVIG should again only be used with concomitant antiviral therapy. Retrospective studies have shown convincing evidence that addition of CMVIG to antiviral prophylaxis lowers CMV endpoints and mortality. The current balance of evidence suggests that CMVIG prophylaxis reduces the risk of bronchiolitis obliterans syndrome, but a controlled trial is awaited. Overall, the relatively limited current data set suggests that prophylaxis with CMVIG in combination with antiviral therapy appears effective in D+/R- heart transplant patients, whereas in lung transplantation, addition of CMVIG in recipients of a CMV-positive graft may offer an advantage in terms of CMV infection and disease.

  20. Cytomegalovirus infection following liver transplantation: review of the literature.

    PubMed

    Kanj, S S; Sharara, A I; Clavien, P A; Hamilton, J D

    1996-03-01

    Cytomegalovirus (CMV) remains a major cause of problems following solid organ transplantation, accounting for a significant increase in morbidity and affiliated costs. Infection with CMV following orthotopic liver transplantation (OLT) is commonly seen as a result of marked cell-mediated immunosuppression and is an independent risk factor for opportunistic and fungal infections. The role of CMV infection in acute cellular or chronic rejection remains unclear. Recent advances in diagnostic modalities, particularly the use of the antigenemia assay and the polymerase chain reaction, have provided ways to quantitate viral load during infection or disease, as well as providing a useful marker of response to therapy. Ganciclovir remains the best antiviral agent for the treatment of CMV disease, but the use of combination therapy with other antivirals or CMV immunoglobulin may improve outcome for patients with severe disease. The ideal prophylactic therapy for patients undergoing OLT remains to be identified, as tested regimens have shown variable efficacy when analyzed with regard to defined risk groups. The use of risk group-specific prophylaxis may prove to be most successful, however, in terms of efficacy and cost savings. Future advances in basic CMV virology and transplant immunology will be essential in defining rational approaches to control and prevention of CMV infection and disease following liver transplantation. PMID:8852975

  1. In vivo efficacies of levofloxacin and ciprofloxacin in acute murine hematogenous pyelonephritis induced by methicillin-susceptible and-resistant Staphylococcus aureus strains.

    PubMed Central

    Frosco, M B; Melton, J L; Stewart, F P; Kulwich, B A; Licata, L; Barrett, J F

    1996-01-01

    Levofloxacin, the active L-isomer of ofloxacin, has demonstrated strong activity against Staphylococcus aureus both in vitro and in vivo. In a murine model of hematogenous pyelonephritis, the in vivo efficacies of levofloxacin and ciprofloxacin were evaluated against two methicillin-susceptible and two methicillin-resistant S. aureus strains. All four isolates had virtually identical susceptibilities to levofloxacin and ciprofloxacin. Pyelonephritis was induced in carrageenan-primed mice by an intravenous injection of 0.5 ml of 10(7) CFU of methicillin-susceptible S. aureus isolates per ml or 10(8) CFU of methicillin-resistant S. aureus isolates per ml. At 1 h postinfection, the mice were treated orally with levofloxacin or ciprofloxacin once a day or twice a day (total daily dose of 20 to 160 mg/kg of body weight) for 4 days. Mice were euthanized 24 h after the final treatment, and the kidneys were excised and weighed. The kidneys were prepared for histological examination or were homogenized to determine the numbers of CFU per gram of tissue quantitatively. The reduction in the mean log10 number of CFU per gram as a function of total daily dose was recorded. A dose-response analysis showed that levofloxacin was superior to ciprofloxacin for all four isolates at any dose or regimen tested, independent of the methicillin susceptibility of the isolates. By using an inverse prediction technique, the equivalent effective doses of levofloxacin (once a day) were less than those of ciprofloxacin (twice a day) by 5.2 and 3.2 times, respectively, for methicillin-susceptible S. aureus 9039 and 3087. For methicillin-resistant S. aureus 667 and 2878, the equivalent effective doses of levofloxacin (once a day) were less than those of ciprofloxacin (twice a day) by 4.1 and 6.4 times, respectively. In a separate study, histological examination of all infected, untreated mice showed moderate to marked hematogenous pyelonephritis. Levofloxacin-treated mice (40 mg/kg once a day

  2. The acute effects of light on murine sleep during the dark phase: importance of melanopsin for maintenance of light-induced sleep

    PubMed Central

    Muindi, Fanuel; Zeitzer, Jamie M.; Colas, Damien; Heller, H. Craig

    2016-01-01

    Light exerts a direct effect on sleep and wakefulness in nocturnal and diurnal animals, with a light pulse during the dark phase suppressing locomotor activity and promoting sleep in the former. In the present study, we investigated this direct effect of light on various sleep parameters by exposing mice to a broad range of illuminances (0.2–200 μW/cm2; equivalent to 1–1000 lux) for 1 h during the dark phase (zeitgeber time 13–14). Fitting the data with a three-parameter log model indicated that ~0.1 μW/cm2 can generate half the sleep response observed at 200 μW/cm2. We observed decreases in total sleep time during the 1 h following the end of the light pulse. Light reduced the latency to sleep from ~30 min in darkness (baseline) to ~10 min at the highest intensity, although this effect was invariant across the light intensities used. We then assessed the role of melanopsin during the rapid transition from wakefulness to sleep at the onset of a light pulse and the maintenance of sleep with a 6-h 20 μW/cm2 light pulse. Even though the melanopsin knockout mice had robust induction of sleep (~35 min) during the first hour of the pulse, it was not maintained. Total sleep decreased by almost 65% by the third hour in comparison with the first hour of the pulse in mice lacking melanopsin, whereas only an 8% decrease was observed in wild-type mice. Collectively, our findings highlight the selective effects of light on murine sleep, and suggest that melanopsin-based photoreception is primarily involved in sustaining light-induced sleep. PMID:23510299

  3. Strongyloides Hyperinfection Syndrome Combined with Cytomegalovirus Infection

    PubMed Central

    Alsaeed, Mohammed; Ballool, Sulafa; Attia, Ashraf

    2016-01-01

    The mortality in Strongyloides hyperinfection syndrome (SHS) is alarmingly high. This is particularly common in bone marrow, renal, and other solid organ transplant (SOT) patients, where figures may reach up to 50–85%. Immunosuppressives, principally corticosteroids, are the primary triggering factor. In general, the clinical features of Strongyloides stercoralis hyperinfection are nonspecific; therefore, a high index of suspicion is required for early diagnosis and starting appropriate therapy. Although recurrent Gram-negative sepsis and meningitis have been previously reported, the combination of both cytomegalovirus (CMV) and strongyloidiasis had rarely been associated. We here describe a patient who survived SHS with recurrent Escherichia coli (E. coli) urosepsis and CMV infection. PMID:27703835

  4. Human Cytomegalovirus Induces JC Virus DNA Replication in Human Fibroblasts

    NASA Astrophysics Data System (ADS)

    Heilbronn, Regine; Albrecht, Ingrid; Stephan, Sonja; Burkle, Alexander; Zur Hausen, Harald

    1993-12-01

    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML.

  5. Report from the second cytomegalovirus and immunosenescence workshop

    PubMed Central

    2011-01-01

    The Second International Workshop on CMV & Immunosenescence was held in Cambridge, UK, 2-4th December, 2010. The presentations covered four separate sessions: cytomegalovirus and T cell phenotypes; T cell memory frequency, inflation and immunosenescence; cytomegalovirus in aging, mortality and disease states; and the immunobiology of cytomegalovirus-specific T cells and effects of the virus on vaccination. This commentary summarizes the major findings of these presentations and references subsequently published work from the presenter laboratory where appropriate and draws together major themes that were subsequently discussed along with new areas of interest that were highlighted by this discussion. PMID:22035114

  6. Interactions of human cytomegalovirus with human fibroblasts.

    PubMed

    Vonka, V; Benyesh-Melnick, M

    1966-01-01

    Vonka, Vladimir (Baylor University College of Medicine, Houston, Tex.), and Matilda Benyesh-Melnick. Interactions of human cytomegalovirus with human fibroblasts. J. Bacteriol. 91:213-220. 1966.-Virus attachment of human cytomegalovirus to human embryo lung fibroblasts was found to be temperature-independent, from 4 to 37 C. Prolonged incubation at 4 C, however, resulted in inactivation of a high proportion of attached virus. Virus penetration seemed to be temperature-dependent, occurring at 37 C but not at 4 C. Detailed studies of the growth curve of the virus were made. Cell-associated virus preceded the appearance of virus in the fluid phase by 2 to 5 days. Complement-fixing antigen could be detected, but only when the cytopathic effect was advanced, and it was demonstrable only in the cell-associated fraction. Under methyl cellulose, decreasing the bicarbonate concentration in the overlay from 0.225 to 0.15% resulted in marked increase in plating efficiency with all strains tested. However, varying the concentration of bicarbonate from 0.3 to 0.15% in fluid medium did not influence the growth of virus.

  7. Effects of 28Si Ions, 56Fe Ions, and Protons on the Induction of Murine Acute Myeloid Leukemia and Hepatocellular Carcinoma

    PubMed Central

    Weil, Michael M.; Ray, F. Andrew; Genik, Paula C.; Yu, Yongjia; McCarthy, Maureen; Fallgren, Christina M.; Ullrich, Robert L.

    2014-01-01

    Estimates of cancer risks posed to space-flight crews by exposure to high atomic number, high-energy (HZE) ions are subject to considerable uncertainty because epidemiological data do not exist for human populations exposed to similar radiation qualities. We assessed the carcinogenic effects of 300 MeV/n 28Si or 600 MeV/n 56Fe ions in a mouse model for radiation-induced acute myeloid leukemia and hepatocellular carcinoma. C3H/HeNCrl mice were irradiated with 0.1, 0.2, 0.4, or 1 Gy of 300 MeV/n 28Si ions, 600 MeV/n 56Fe ions or 1 or 2 Gy of protons simulating the 1972 solar particle event (1972SPE) at the NASA Space Radiation Laboratory. Additional mice were irradiated with 137Cs gamma rays at doses of 1, 2, or 3 Gy. All groups were followed until they were moribund or reached 800 days of age. We found that 28Si or 56Fe ions do not appear to be substantially more effective than gamma rays for the induction of acute myeloid leukemia. However, 28Si or 56Fe ion irradiated mice had a much higher incidence of hepatocellular carcinoma than gamma ray irradiated or proton irradiated mice. These data demonstrate a clear difference in the effects of these HZE ions on the induction of leukemia compared to solid tumors, suggesting potentially different mechanisms of tumorigenesis. Also seen in this study was an increase in metastatic hepatocellular carcinoma in the 28Si and 56Fe ion irradiated mice compared with those exposed to gamma rays or 1972SPE protons, a finding with important implications for setting radiation exposure limits for space-flight crew members. PMID:25126721

  8. Preventive azithromycin treatment reduces noninfectious lung injury and acute graft-versus-host disease in a murine model of allogeneic hematopoietic cell transplantation.

    PubMed

    Radhakrishnan, Sabarinath Venniyil; Palaniyandi, Senthilnathan; Mueller, Gunnar; Miklos, Sandra; Hager, Max; Spacenko, Elena; Karlsson, Fridrik J; Huber, Elisabeth; Kittan, Nicolai A; Hildebrandt, Gerhard C

    2015-01-01

    Noninfectious lung injury and acute graft-versus-host disease (GVHD) after allogeneic hematopoietic cell transplantation (allo-HCT) are associated with significant morbidity and mortality. Azithromycin is widely used in allogeneic HCT recipients for pulmonary chronic GVHD, although current data appear controversial. We induced GVHD and noninfectious lung injury in lethally irradiated B6D2F1 mice by transplanting bone marrow and splenic T cells from allogeneic C57BL/6 mice. Experimental groups were treated with oral azithromycin starting on day 14 until the end of week 6 or week 14 after transplantation. Azithromycin treatment resulted in improved survival and decreased lung injury; the latter characterized by improved pulmonary function, reduced peribronchial and perivascular inflammatory cell infiltrates along with diminished collagen deposition, and a decrease in lung cytokine and chemokine expression. Azithromycin also improved intestinal GVHD but did not affect liver GVHD at week 6 early after transplantation. At week 14, azithromycin decreased liver GVHD but had no effect on intestinal GVHD. In vitro, allogeneic antigen-presenting cell (APC)- dependent T cell proliferation and cytokine production were suppressed by azithromycin and inversely correlated with relative regulatory T cell (Treg) expansion, whereas no effect was seen when T cell proliferation occurred APC independently through CD3/CD28-stimulation. Further, azithromycin reduced alloreactive T cell expansion but increased Treg expansion in vivo with corresponding downregulation of MHC II on CD11c(+) dendritic cells. These results demonstrate that preventive administration of azithromycin can reduce the severity of acute GVHD and noninfectious lung injury after allo-HCT, supporting further investigation in clinical trials.

  9. Mast cells: innate attractors recruiting protective CD8 T cells to sites of cytomegalovirus infection.

    PubMed

    Podlech, Jürgen; Ebert, Stefan; Becker, Marc; Reddehase, Matthias J; Stassen, Michael; Lemmermann, Niels A W

    2015-06-01

    Reactivation of latent cytomegalovirus (CMV) in the transient immunocompromised state after hematoablative treatment is a major concern in patients undergoing hematopoietic cell transplantation (HCT) as a therapy of hematopoietic malignancies. Timely reconstitution of antiviral CD8 T cells and their efficient recruitment to the lungs is crucial for preventing interstitial pneumonia, the most severe disease manifestation of CMV in HCT recipients. Here, we review recent work in a murine model, implicating mast cells (MC) in the control of pulmonary infection. Murine CMV (mCMV) productively infects MC in vivo and triggers their degranulation, resulting in the release of the CC chemokine ligand 5 (CCL5) that attracts CD8 T cells to infiltrate infected tissues. Comparing infection of MC-sufficient C57BL/6 mice and congenic MC-deficient Kit (W-sh/W-sh) "sash" mutants revealed an inverse relation between the number of lung-infiltrating CD8 T cells and viral burden in the lungs. Specifically, reduced lung infiltration by CD8 T cells in "sash" mutants was associated with an impaired infection control. The causal, though indirect, involvement of MC in antiviral control was confirmed by reversion of the deficiency phenotype in "sash" mutants reconstituted with MC. These recent findings predict that efficient MC reconstitution facilitates the control of CMV infection also in immunocompromised HCT recipients. PMID:25648117

  10. Post-exposure administration of diazepam combined with soluble epoxide hydrolase inhibition stops seizures and modulates neuroinflammation in a murine model of acute TETS intoxication

    SciTech Connect

    Vito, Stephen T.; Austin, Adam T.; Banks, Christopher N.; Inceoglu, Bora; Bruun, Donald A.; Zolkowska, Dorota; Tancredi, Daniel J.; Rogawski, Michael A.; Hammock, Bruce D.; Lein, Pamela J.

    2014-12-01

    Tetramethylenedisulfotetramine (TETS) is a potent convulsant poison for which there is currently no approved antidote. The convulsant action of TETS is thought to be mediated by inhibition of type A gamma-aminobutyric acid receptor (GABA{sub A}R) function. We, therefore, investigated the effects of post-exposure administration of diazepam, a GABA{sub A}R positive allosteric modulator, on seizure activity, death and neuroinflammation in adult male Swiss mice injected with a lethal dose of TETS (0.15 mg/kg, ip). Administration of a high dose of diazepam (5 mg/kg, ip) immediately following the second clonic seizure (approximately 20 min post-TETS injection) effectively prevented progression to tonic seizures and death. However, this treatment did not prevent persistent reactive astrogliosis and microglial activation, as determined by GFAP and Iba-1 immunoreactivity and microglial cell morphology. Inhibition of soluble epoxide hydrolase (sEH) has been shown to exert potent anti-inflammatory effects and to increase survival in mice intoxicated with other GABA{sub A}R antagonists. The sEH inhibitor TUPS (1 mg/kg, ip) administered immediately after the second clonic seizure did not protect TETS-intoxicated animals from tonic seizures or death. Combined administration of diazepam (5 mg/kg, ip) and TUPS (1 mg/kg, ip, starting 1 h after diazepam and repeated every 24 h) prevented TETS-induced lethality and influenced signs of neuroinflammation in some brain regions. Significantly decreased microglial activation and enhanced reactive astrogliosis were observed in the hippocampus, with no changes in the cortex. Combining an agent that targets specific anti-inflammatory mechanisms with a traditional antiseizure drug may enhance treatment outcome in TETS intoxication. - Highlights: • Acute TETS intoxication causes delayed and persistent neuroinflammation. • Diazepam given post-TETS prevents lethal tonic seizures but not neuroinflammation. • A soluble epoxide hydrolase

  11. Progressive Hearing Impairment in Children with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1979-01-01

    Audiological assessment of 86 children (mean age 38 months at last evaluation time) with congenital cytomegalovirus infection revealed progressive hearing loss in four of 12 Ss with sensorineural hearing impairments. Case descriptions documented the progression of the hearing loss. (Author)

  12. Late cytomegalovirus infection after hematopoietic stem cell transplantation: case reports

    PubMed Central

    Pinheiro, Sâmara Grapiuna; de Matos, Sócrates Bezerra; Botura, Mônica Borges; Meyer, Roberto; Lima, Fernanda Washington de Mendonça

    2013-01-01

    Cytomegalovirus is related to high rates of morbidity and mortality after hematopoietic stem cell transplantation. This report highlights the importance of adequate monitoring and management of this infection. We report on two cases of patients with late subclinical cytomegalovirus infection. These patients were monitored for antigenemia by indirect immunofluorescence assay. Active cytomegalovirus infection is most common in the first three months after transplantation however the cases reported herein show the importance of monitoring for active infection after Day +100 post-transplantation. Early detection of active infection enables quick preemptive therapy. In conclusion, we emphasize that patients with risk factors for developing severe or late cytomegalovirus disease should be monitored for more than 100 post-transplant days as late active infection is a reality. PMID:24478611

  13. Association of a murine leukaemia stem cell gene signature based on nucleostemin promoter activity with prognosis of acute myeloid leukaemia in patients.

    PubMed

    Ali, Mohamed A E; Naka, Kazuhito; Yoshida, Akiyo; Fuse, Kyoko; Kasada, Atsuo; Hoshii, Takayuki; Tadokoro, Yuko; Ueno, Masaya; Ohta, Kumiko; Kobayashi, Masahiko; Takahashi, Chiaki; Hirao, Atsushi

    2014-07-18

    Acute myeloid leukaemia (AML) is a heterogeneous neoplastic disorder in which a subset of cells function as leukaemia-initiating cells (LICs). In this study, we prospectively evaluated the leukaemia-initiating capacity of AML cells fractionated according to the expression of a nucleolar GTP binding protein, nucleostemin (NS). To monitor NS expression in living AML cells, we generated a mouse AML model in which green fluorescent protein (GFP) is expressed under the control of a region of the NS promoter (NS-GFP). In AML cells, NS-GFP levels were correlated with endogenous NS mRNA. AML cells with the highest expression of NS-GFP were very immature blast-like cells, efficiently formed leukaemia colonies in vitro, and exhibited the highest leukaemia-initiating capacity in vivo. Gene expression profiling analysis revealed that cell cycle regulators and nucleotide metabolism-related genes were highly enriched in a gene set associated with leukaemia-initiating capacity that we termed the 'leukaemia stem cell gene signature'. This gene signature stratified human AML patients into distinct clusters that reflected prognosis, demonstrating that the mouse leukaemia stem cell gene signature is significantly associated with the malignant properties of human AML. Further analyses of gene regulation in leukaemia stem cells could provide novel insights into diagnostic and therapeutic approaches to AML.

  14. Regulation of B cell linker protein transcription by PU.1 and Spi-B in murine B cell acute lymphoblastic leukemia.

    PubMed

    Xu, Li S; Sokalski, Kristen M; Hotke, Kathryn; Christie, Darah A; Zarnett, Oren; Piskorz, Jan; Thillainadesan, Gobi; Torchia, Joseph; DeKoter, Rodney P

    2012-10-01

    B cell acute lymphoblastic leukemia (B-ALL) is frequently associated with mutations or chromosomal translocations of genes encoding transcription factors. Conditional deletion of genes encoding the E26-transformation-specific transcription factors, PU.1 and Spi-B, in B cells (ΔPB mice) leads to B-ALL in mice at 100% incidence rate and with a median survival of 21 wk. We hypothesized that PU.1 and Spi-B may redundantly activate transcription of genes encoding tumor suppressors in the B cell lineage. Characterization of aging ΔPB mice showed that leukemia cells expressing IL-7R were found in enlarged thymuses. IL-7R-expressing B-ALL cells grew in culture in response to IL-7 and could be maintained as cell lines. Cultured ΔPB cells expressed reduced levels of B cell linker protein (BLNK), a known tumor suppressor gene, compared with controls. The Blnk promoter contained a predicted PU.1 and/or Spi-B binding site that was required for promoter activity and occupied by PU.1 and/or Spi-B as determined by chromatin immunoprecipitation. Restoration of BLNK expression in cultured ΔPB cells opposed IL-7-dependent proliferation and induced early apoptosis. We conclude that the tumor suppressor BLNK is a target of transcriptional activation by PU.1 and Spi-B in the B cell lineage.

  15. Congenital cytomegalovirus infection in San Luis Potosi, Mexico.

    PubMed

    Noyola, Daniel E; Mejía-Elizondo, Ana R; Canseco-Lima, Jesús M; Allende-Carrera, Ricardo; Hernánsez-Salinas, Alba E; Ramírez-Zacarías, José L

    2003-01-01

    The incidence of congenital cytomegalovirus infection in Mexico is unknown. We evaluated the presence of cytomegalovirus infection in 560 newborn infants at a public general hospital. There were five (0.89%) infected newborns. Infants with congenital infection were more likely to be born to primigravid mothers (P = 0.01) and were more often from rural areas (P = 0.058) than were noninfected newborns.

  16. Cytomegalovirus and Langerhans Cell Histiocytosis: Is There a Link?

    PubMed Central

    Khoddami, Maliheh; Nadji, Seyed-Alireza; Dehghanian, Paria; Vahdatinia, Mahsa; Shamshiri, Ahmad-Reza

    2016-01-01

    Background: Langerhans cell histiocytosis is a rare proliferative histiocytic disease of unknown etiology. Histologically, it is characterized by granuloma-like proliferation of Langerhans-type dendritic cells derived from bone marrow. Many investigators have suggested the possible role of viruses such as Epstein-Barr virus, human herpesvirus-6 (HHV-6), herpes simplex virus (HSV) types 1 and 2, and Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. Objectives: In this study, we have investigated the presence of Cytomegalovirus in Langerhans cell histiocytosis in Iranian children. Patients and Methods: In this retrospective study, we have investigated the presence of Cytomegalovirus DNA expression, using paraffin-embedded tissue samples of 30 patients with Langerhans cell histiocytosis and 30 age and site-matched controls by qualitative Polymerase Chain Reaction (PCR) method. Results: No significant difference in prevalence of Cytomegalovirus presence between patients and controls was found. Cytomegalovirus was found by qualitative PCR in only 2 (6.66%) out of 30 patients and in 1 (3.3%) of 30 control samples with a P value of 1 (1.00 > 0.05) using chi-square test with OR: 2.07; 95% CI of OR: 0.18 - 24.15. Conclusions: Our findings do not support the hypothesis of a possible role for Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. PMID:27307972

  17. Favorable impact of natural killer cell reconstitution on chronic graft-versus-host disease and cytomegalovirus reactivation after allogeneic hematopoietic stem cell transplantation.

    PubMed

    Kheav, Vissal David; Busson, Marc; Scieux, Catherine; Peffault de Latour, Régis; Maki, Guitta; Haas, Philippe; Mazeron, Marie-Christine; Carmagnat, Maryvonnick; Masson, Emeline; Xhaard, Aliénor; Robin, Marie; Ribaud, Patricia; Dulphy, Nicolas; Loiseau, Pascale; Charron, Dominique; Socié, Gérard; Toubert, Antoine; Moins-Teisserenc, Hélène

    2014-12-01

    Natural killer cells are the first lymphocyte subset to reconstitute, and play a major role in early immunity after allogeneic hematopoietic stem cell transplantation. Cells expressing the activating receptor NKG2C seem crucial in the resolution of cytomegalovirus episodes, even in the absence of T cells. We prospectively investigated natural killer-cell reconstitution in a cohort of 439 adult recipients who underwent non-T-cell-depleted allogeneic hematopoietic stem cell transplantation between 2005 and 2012. Freshly collected blood samples were analyzed 3, 6, 12 and 24 months after transplantation. Data were studied with respect to conditioning regimen, source of stem cells, underlying disease, occurrence of graft-versus-host disease, and profiles of cytomegalovirus reactivation. In multivariate analysis we found that the absolute numbers of CD56(bright) natural killer cells at month 3 were significantly higher after myeloablative conditioning than after reduced intensity conditioning. Acute graft-versus-host disease impaired reconstitution of total and CD56(dim) natural killer cells at month 3. In contrast, high natural killer cell count at month 3 was associated with a lower incidence of chronic graft-versus-host disease, independently of a previous episode of acute graft-versus-host disease and stem cell source. NKG2C(+)CD56(dim) and total natural killer cell counts at month 3 were lower in patients with reactivation of cytomegalovirus between month 0 and month 3, but expanded greatly afterwards. These cells were also less numerous in patients who experienced later cytomegalovirus reactivation between month 3 and month 6. Our results advocate a direct role of NKG2C-expressing natural killer cells in the early control of cytomegalovirus reactivation after allogeneic hematopoietic stem cell transplantation.

  18. Favorable impact of natural killer cell reconstitution on chronic graft-versus-host disease and cytomegalovirus reactivation after allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Kheav, Vissal David; Busson, Marc; Scieux, Catherine; de Latour, Régis Peffault; Maki, Guitta; Haas, Philippe; Mazeron, Marie-Christine; Carmagnat, Maryvonnick; Masson, Emeline; Xhaard, Aliénor; Robin, Marie; Ribaud, Patricia; Dulphy, Nicolas; Loiseau, Pascale; Charron, Dominique; Socié, Gérard; Toubert, Antoine; Moins-Teisserenc, Hélène

    2014-01-01

    Natural killer cells are the first lymphocyte subset to reconstitute, and play a major role in early immunity after allogeneic hematopoietic stem cell transplantation. Cells expressing the activating receptor NKG2C seem crucial in the resolution of cytomegalovirus episodes, even in the absence of T cells. We prospectively investigated natural killer-cell reconstitution in a cohort of 439 adult recipients who underwent non-T-cell-depleted allogeneic hematopoietic stem cell transplantation between 2005 and 2012. Freshly collected blood samples were analyzed 3, 6, 12 and 24 months after transplantation. Data were studied with respect to conditioning regimen, source of stem cells, underlying disease, occurrence of graft-versus-host disease, and profiles of cytomegalovirus reactivation. In multivariate analysis we found that the absolute numbers of CD56bright natural killer cells at month 3 were significantly higher after myeloablative conditioning than after reduced intensity conditioning. Acute graft-versus-host disease impaired reconstitution of total and CD56dim natural killer cells at month 3. In contrast, high natural killer cell count at month 3 was associated with a lower incidence of chronic graft-versus-host disease, independently of a previous episode of acute graft-versus-host disease and stem cell source. NKG2C+CD56dim and total natural killer cell counts at month 3 were lower in patients with reactivation of cytomegalovirus between month 0 and month 3, but expanded greatly afterwards. These cells were also less numerous in patients who experienced later cytomegalovirus reactivation between month 3 and month 6. Our results advocate a direct role of NKG2C-expressing natural killer cells in the early control of cytomegalovirus reactivation after allogeneic hematopoietic stem cell transplantation. PMID:25085354

  19. Overview: cytomegalovirus and the herpesviruses in transplantation.

    PubMed

    Fishman, J A

    2013-02-01

    Herpesviruses infect most animal species. Infections due to the eight human herpesviruses (HHV) are exacerbated by immunosuppression in organ transplantation. The special features of the herpesvirus life cycle include the ability to establish latent, nonproductive infection and the life-long capacity for reactivation to productive, lytic infection. Interactions between latent virus and the immune system determine the frequency and severity of symptomatic infections. The immunologic and cellular effects of herpesvirus infections contribute to risk for opportunistic infections and graft rejection. Among the most important advances in transplantation are laboratory assays for the diagnosis and monitoring of herpesvirus infections and antiviral agents with improved efficacy in prophylaxis and therapy. For herpes simplex virus, varicella zoster virus and cytomegalovirus, these advances have significantly reduced the morbidity of infection. The syndromes of EBV-associated posttransplant lymphoproliferative disorders (PTLD) and Kaposi's sarcoma remain important complications of immunosuppression. The epidemiology and essential biology of human herpesvirus is reviewed. PMID:23347210

  20. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  1. Cytomegalovirus myelitis in perinatally acquired HIV.

    PubMed Central

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W

    1993-01-01

    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, neurons, macrophages, ependymal, endothelial, and Schwann cells. Other organs had no signs of CMV infection. Central nervous spinal CMV infection was most probably due to insufficient penetration of the blood-brain barrier by the CMV hyper-immunoglobulin. In suspicious cases early spinal magnetic resonance imaging (1.5 tesla) combined with an examination of urine and cerebrospinal fluid for CMV is recommended. Images Figure 1 Figure 2 Figure 3 PMID:8385439

  2. Screening, prevention, and treatment of congenital cytomegalovirus.

    PubMed

    Johnson, Julie; Anderson, Brenna

    2014-12-01

    Congenital cytomegalovirus (CMV) is a leading cause of permanent disability in children. The main source of maternal infection is from contact with young children. Primary maternal infection is diagnosed with demonstration of seroconversion or a positive CMV IgM in combination with a low-avidity CMV IgG. Fetal infection may be diagnosed with amniotic fluid polymerase chain reaction and culture. CMV-specific hyperimmune globulin has shown promise as a possible means to prevent congenital infection; large randomized trials are ongoing. To date, the only effective means of prevention is through reducing exposure to the virus. Rates of maternal infection may be reduced through education regarding sources of infection and improved hygiene.

  3. The history of vaccination against cytomegalovirus.

    PubMed

    Plotkin, Stanley

    2015-06-01

    Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.

  4. Optimum treatment of congenital cytomegalovirus infection.

    PubMed

    Leruez-Ville, Marianne; Ville, Yves

    2016-01-01

    Congenital cytomegalovirus infection affects 0.7% of live births and is the leading cause of congenital neurological handicaps of infectious origin. However, systematic screening of this infection has not been implemented in pregnancy or at birth in any country. This apparent paradox has been justified by the unavailability of an efficient vaccine and by the scarcity of data available on the treatment of congenital CMV. However, in the last decade interesting new data on the management of this congenital infection has emerged including new results on both neonatal and postnatal treatments. This review provides an update on the potential benefits of antiviral treatment and on passive immunisation both in the neonatal and the antenatal periods. These suggest a benefit to a proactive approach for neonatal and prenatal congenital infections. PMID:27043943

  5. The S1P/S1PR2 axis regulates early airway T cell infiltration in murine mast cell-dependent acute allergic responses

    PubMed Central

    Oskeritzian, Carole A.; Hait, Nitai C.; Wedman, Piper; Chumanevich, Alena; Kolawole, Elizabeth M.; Price, Megan M.; Falanga, Yves T.; Harikumar, Kuzhuvelil B.; Ryan, John J.; Milstien, Sheldon; Sabbadini, Roger; Spiegel, Sarah

    2014-01-01

    Background Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid produced by mast cells (MC) upon cross-linking of their high affinity receptors for IgE by antigen (Ag) that can amplify MC responses by binding to its S1P receptors. Acute MC-dependent allergic reaction can lead to systemic shock but the early events of its development in lung tissues have not been investigated, and S1P functions in the onset of allergic processes remain to be examined. Objective We used a highly specific neutralizing anti-S1P antibody (mAb) and an S1P receptor 2 (S1PR2) antagonist, JTE-013, to study S1P and S1PR2 signaling contributions to MC- and IgE-dependent airway allergic responses in mice within minutes after Ag challenge. Methods Allergic reaction was triggered by a single intraperitoneal (i.p.) dose of Ag in sensitized mice pre-treated i.p. with anti-S1P or isotype control mAb, or JTE-013 or vehicle prior to Ag challenge. Results Kinetics experiments revealed early pulmonary infiltration of mostly T cells around blood vessels of sensitized mice 20 minutes post-Ag exposure. Pre-treatment with anti-S1P mAb inhibited in vitro MC activation, as well as in vivo development of airway infiltration and MC activation, reducing serum levels of histamine, cytokines and the chemokines MCP-1/CCL2, MIP-1α/CCL3 and RANTES/CCL5. S1PR2 antagonism or deficiency, or MC deficiency recapitulated these results. Both in vitro and in vivo experiments demonstrated MC S1PR2 dependency for chemokine release and the necessity for signal transducer and activator of transcription 3 (Stat3) activation. Conclusion Activation of S1PR2 by S1P and downstream Stat3 signaling in MC regulate early T cell recruitment to antigen-challenged lungs by chemokine production. PMID:25512083

  6. Pathogenesis of experimental rhesus cytomegalovirus infection.

    PubMed

    Lockridge, K M; Sequar, G; Zhou, S S; Yue, Y; Mandell, C P; Barry, P A

    1999-11-01

    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v. ), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  7. Late-onset cytomegalovirus infection complicated by Guillain-Barre syndrome in a kidney transplant recipient: case report and review of the literature.

    PubMed

    Shaban, E; Gohh, R; Knoll, B M

    2016-04-01

    Cytomegalovirus (CMV) infection remains a common infection after solid-organ transplantation. In the general population CMV disease is associated with Guillain-Barre syndrome (GBS), an autoimmune disease leading to an acute peripheral neuropathy, in 1 of 1000 cases. Interestingly, GBS is a rarely observed complication in solid-organ transplant recipients, possibly related to maintenance immunosuppression. We describe a case of CMV infection complicated by GBS in a kidney transplant recipient and review the literature.

  8. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant

    MedlinePlus

    ... Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a ... weakened by medicines that you must take after stem cell transplant and by the transplant itself. Your body ...

  9. Limitations of the murine nose in the development of nonviral airway gene transfer.

    PubMed

    Griesenbach, Uta; Sumner-Jones, Stephanie G; Holder, Emma; Munkonge, Felix M; Wodehouse, Theresa; Smith, Stephen N; Wasowicz, Marguerite Y; Pringle, Ian; Casamayor, Isabel; Chan, Mario; Coles, Rebecca; Cornish, Nikki; Dewar, Ann; Doherty, Ann; Farley, Raymond; Green, Anne-Marie; Jones, Bryony L; Larsen, Mia D B; Lawton, Anna E; Manvell, Michelle; Painter, Hazel; Singh, Charanjit; Somerton, Lucinda; Stevenson, Barbara; Varathalingam, Anusha; Siegel, Craig; Scheule, Ronald K; Cheng, Seng H; Davies, Jane C; Porteous, David J; Gill, Deborah R; Boyd, A Christopher; Hyde, Steve C; Alton, Eric W F W

    2010-07-01

    A clinical program to assess whether lipid GL67A-mediated gene transfer can ameliorate cystic fibrosis (CF) lung disease is currently being undertaken by the UK CF Gene Therapy Consortium. We have evaluated GL67A gene transfer to the murine nasal epithelium of wild-type and CF knockout mice to assess this tissue as a test site for gene transfer agents. The plasmids used were regulated by either (1) the commonly used short-acting cytomegalovirus promoter/enhancer or (2) the ubiquitin C promoter. In a study of approximately 400 mice with CF, vector-specific CF transmembrane conductance regulator (CFTR) mRNA was detected in nasal epithelial cells of 82% of mice treated with a cytomegalovirus-plasmid (pCF1-CFTR), and 62% of mice treated with an ubiquitin C-plasmid. We then assessed whether CFTR gene transfer corrected a panel of CFTR-specific endpoint assays in the murine nose, including ion transport, periciliary liquid height, and ex vivo bacterial adherence. Importantly, even with the comparatively large number of animals assessed, the CFTR function studies were only powered to detect changes of more than 50% toward wild-type values. Within this limitation, no significant correction of the CF phenotype was detected. At the current levels of gene transfer efficiency achievable with nonviral vectors, the murine nose is of limited value as a stepping stone to human trials. PMID:19648474

  10. A cyclooxygenase-2 homologue encoded by rhesus cytomegalovirus is a determinant for endothelial cell tropism.

    PubMed

    Rue, Cary A; Jarvis, Michael A; Knoche, Amber J; Meyers, Heather L; DeFilippis, Victor R; Hansen, Scott G; Wagner, Markus; Früh, Klaus; Anders, David G; Wong, Scott W; Barry, Peter A; Nelson, Jay A

    2004-11-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  11. A Cyclooxygenase-2 Homologue Encoded by Rhesus Cytomegalovirus Is a Determinant for Endothelial Cell Tropism

    PubMed Central

    Rue, Cary A.; Jarvis, Michael A.; Knoche, Amber J.; Meyers, Heather L.; DeFilippis, Victor R.; Hansen, Scott G.; Wagner, Markus; Früh, Klaus; Anders, David G.; Wong, Scott W.; Barry, Peter A.; Nelson, Jay A.

    2004-01-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  12. Cytomegalovirus Restructures Lipid Rafts via a US28/CDC42-Mediated Pathway, Enhancing Cholesterol Efflux from Host Cells.

    PubMed

    Low, Hann; Mukhamedova, Nigora; Cui, Huanhuan L; McSharry, Brian P; Avdic, Selmir; Hoang, Anh; Ditiatkovski, Michael; Liu, Yingying; Fu, Ying; Meikle, Peter J; Blomberg, Martin; Polyzos, Konstantinos A; Miller, William E; Religa, Piotr; Bukrinsky, Michael; Soderberg-Naucler, Cecilia; Slobedman, Barry; Sviridov, Dmitri

    2016-06-28

    Cytomegalovirus (HCMV) contains cholesterol, but how HCMV interacts with host cholesterol metabolism is unknown. We found that, in human fibroblasts, HCMV infection increased the efflux of cellular cholesterol, despite reducing the abundance of ABCA1. Mechanistically, viral protein US28 was acting through CDC42, rearranging actin microfilaments, causing association of actin with lipid rafts, and leading to a dramatic change in the abundance and/or structure of lipid rafts. These changes displaced ABCA1 from the cell surface but created new binding sites for apolipoprotein A-I, resulting in enhanced cholesterol efflux. The changes also reduced the inflammatory response in macrophages. HCMV infection modified the host lipidome profile and expression of several genes and microRNAs involved in cholesterol metabolism. In mice, murine CMV infection elevated plasma triglycerides but did not affect the level and functionality of high-density lipoprotein. Thus, HCMV, through its protein US28, reorganizes lipid rafts and disturbs cell cholesterol metabolism.

  13. Cytomegalovirus Infection After Intestinal Transplantation in Children

    PubMed Central

    Bueno, Javier; Green, Michael; Kocoshis, Samuel; Furukawa, Hiroyuki; Ahu-Elmagd, Kareem; Yunis, Eduardo; Irish, William; Todo, Satoru; Reyes, Jorge; Starzl, Thomas E.

    2010-01-01

    Sixteen episodes of cytomegalovirus (CMV) disease occurred in 10 of 41 children undergoing intestinal transplantation from 1990 to 1995. Stratification of CMV disease by donor (D)/recipient (R) serological status was as follows: 3 of 8, D+/R−; 3 of 9, D+/R+; 4 of 9, D−/R+; and 0 of 15, D−/R−. Treatment resulted in resolution of CMV disease in 93.3% of episodes. No deaths attributable to CMV disease occurred in this series. CMV in D+/R− children resulted in more extensive and persistent disease. However, patient and graft survival rates were similar in the different D/R subgroups and between children with and without CMV disease. Cumulative dose of steroid boluses (relative risk [RR]. 1.59; 95% confidence interval [CI]. 1.14–2.21) and history of steroid recycles (RR, 2.72; 95% CI, 1.21–6.13) were associated with CMV disease. These results suggest that although CMV-associated morbidity in pediatric intestinal transplant recipients was substantial, it was not associated with an increased rate of mortality or graft loss, even among high-risk D+/R− patients. PMID:9402361

  14. Experimental transplacental transmission of porcine cytomegalovirus.

    PubMed

    Edington, N; Watt, R G; Plowright, W

    1977-04-01

    Six serologically negative sows were infected by intranasal instillation of porcine cytomegalovirus (PCMV) between 31 and 85 days of pregnacy. Four sows showed an afebrile anorexia and lethargy 14-25 days after infection and all 6 developed significant increases in indirect immunofluorescent (IIF) antibody titres within 35 days. Virus was recovered from nasal and/or cervical swabs from 2 sows during life and from lung macrophage cultures after death. At term the sows were killed and their fetuses harvested by caesarean section. The number of mummified and stillborn fetuses increased from 4/63 in 6 previous litters to 18/60 in the 6 present litters. Nine of 43 fetuses born alive were reared in isolators for up to 6 weeks but the majority were killed for examination on the day of birth. Virus was isolated from 16 piglets from 4 of the 6 litters examined; it was isolated most frequently from lungs and liver but also from spleen, kidney, brain and nasal mucosa. Unsuckled day-old pigs had insignificant IIF titres, irrespective of whether they were excreting virus or not. The 5 congenital excretors which were reared all died within 7 days but no death occurred among their 4 litter-mates. Post-natal infection of 2 of these piglets reared in contact with congenitally infected pigs was suggested by the recovery of virus from nasal swabs 17 and 27 days after birth and the subsequent rise in IIF titre to 1/256 by day 42.

  15. Cytomegalovirus immune evasion of myeloid lineage cells.

    PubMed

    Brinkmann, Melanie M; Dağ, Franziska; Hengel, Hartmut; Messerle, Martin; Kalinke, Ulrich; Čičin-Šain, Luka

    2015-06-01

    Cytomegalovirus (CMV) evades the immune system in many different ways, allowing the virus to grow and its progeny to spread in the face of an adverse environment. Mounting evidence about the antiviral role of myeloid immune cells has prompted the research of CMV immune evasion mechanisms targeting these cells. Several cells of the myeloid lineage, such as monocytes, dendritic cells and macrophages, play a role in viral control, but are also permissive for CMV and are naturally infected by it. Therefore, CMV evasion of myeloid cells involves mechanisms that qualitatively differ from the evasion of non-CMV-permissive immune cells of the lymphoid lineage. The evasion of myeloid cells includes effects in cis, where the virus modulates the immune signaling pathways within the infected myeloid cell, and those in trans, where the virus affects somatic cells targeted by cytokines released from myeloid cells. This review presents an overview of CMV strategies to modulate and evade the antiviral activity of myeloid cells in cis and in trans.

  16. Cytomegalovirus and glioblastoma; controversies and opportunities.

    PubMed

    Lawler, Sean E

    2015-07-01

    One of the more polarized ongoing debates in the brain tumor field over recent years has centered on the association of cytomegalovirus (CMV) with glioblastoma. Several laboratories have reported the presence of CMV antigens in glioblastoma patient specimens, whereas others have failed to detect them. CMV genomic DNA and mRNAs have been detected by PCR, but not in next-generation sequencing studies. CMV promotes high grade glioma progression in a mouse genetic model, and many CMV proteins promote cancer hallmarks in vitro, but actively replicating virus has not been isolated from tumor samples. A consensus is gradually emerging in which the presence of CMV antigens in glioblastoma is increasingly accepted. However, it remains challenging to understand this mechanistically due to the low levels of CMV nucleic acids and the absence of viral replication observed in tumors thus far. Nonetheless, these observations have inspired the development of novel therapeutic approaches based on anti-viral drugs and immunotherapy. The potential benefit of valganciclovir in glioblastoma has generated great interest, but efficacy remains to be established in a randomized trial. Also, early stage immunotherapy trials targeting CMV have shown promise. In the near future we will know more answers to these questions, and although areas of controversy may remain, and the mechanisms and roles of CMV in tumor growth are yet to be clearly defined, this widespread virus may have created important new therapeutic concepts and opportunities for the treatment of glioblastoma. PMID:25682092

  17. Modeling cytomegalovirus infection in mouse tumor models.

    PubMed

    Price, Richard Lee; Chiocca, Ennio Antonio

    2015-01-01

    The hypothesis that cytomegalovirus (CMV) modulates cancer is evolving. Originally discovered in glioblastoma in 2002, the number of cancers, where intratumoral CMV antigen is detected, has increased in recent years suggesting that CMV actively affects the pathobiology of certain tumors. These findings are controversial as several groups have also reported inability to replicate these results. Regardless, several clinical trials for glioblastoma are underway or have been completed that target intratumoral CMV with anti-viral drugs or immunotherapy. Therefore, a better understanding of the possible pathobiology of CMV in cancer needs to be ascertained. We have developed genetic, syngeneic, and orthotopic malignant glioma mouse models to study the role of CMV in cancer development and progression. These models recapitulate for the most part intratumoral CMV expression as seen in human tumors. Additionally, we discovered that CMV infection in Trp53(-/+) mice promotes pleomorphic rhabdomyosarcomas. These mouse models are not only a vehicle for studying pathobiology of the viral-tumor interaction but also a platform for developing and testing cancer therapeutics. PMID:25853089

  18. Cytomegalovirus pneumonia in transplant patients: CT findings

    SciTech Connect

    Eun-Young Kang; Patz, E.F. Jr.; Mueller, N.L.

    1996-03-01

    Our goal was to assess the CT findings of cytomegalovirus (CMV) pneumonia in transplant patients. The study included 10 transplant patients who had chest CT scan and pathologically proven isolated pulmonary CMV infection. Five patients had bone marrow transplant and five had solid organ transplant. The CT scans were retrospectively reviewed for pattern and distribution of disease and the CT findings compared with the findings on open lung biopsy (n = 9) and autopsy (n = 1). Nine of 10 patients had parenchymal abnormalities apparent at CT and I had normal CT scans. The findings in the nine patients included small nodules (n = 6), consolidation (n = 4), ground-glass attenuation (n = 4), and irregular lines (n = 1). The nodules had a bilateral and symmetric distribution and involved all lung zones. The consolidation was most marked in the lower lung zones. The CT findings of CMV pneumonia in transplant patients are heterogeneous. The most common patterns include small nodules and areas of consolidation. 13 refs., 4 figs., 1 tab.

  19. Cytomegalovirus Uveitis with Hypopyon Mimicking Bacterial Endophthalmitis

    PubMed Central

    Kawashima, Hidetoshi

    2015-01-01

    We report an 83-year-old immune-competent female with unilateral endophthalmitis extraordinarily caused by cytomegalovirus (CMV). Since she was suspected of suffering possible bacterial endophthalmitis, she was referred to our hospital. At the first visit, hypopyon in the anterior chamber and the opacity of vitreous body were observed in the left eye. The best-corrected visual acuity (BCVA) of the left eye was counting fingers and the intraocular pressure (IOP) was 20 mmHg. Bacterial and fungus culture of the aqueous humor revealed no infection. However, the density of corneal endothelial cell was less than the measurable range and CMV was detected by PCR of the aqueous humor. She was immune-competent and the data indicated neither systemic infections nor diseases. Systemic valganciclovir and corticosteroid were administered. After that, hypopyon in the anterior chamber and the opacity of vitreous body of the left eye were improved, and the BCVA of the left eye was 20/200 one year after the first visit. However, the inflammation of the anterior chamber recurred accompanied by elevated IOP after the discontinuance of administering valganciclovir. CMV-induced uveitis accompanied with hypopyon is quite rare. Therefore, it can be easily misdiagnosed as bacterial endophthalmitis. PMID:26078897

  20. [Cytomegalovirus infection (CMV) in patients with acquired immunodeficiency syndrome].

    PubMed

    Stepanov, A; Feuermannová, A; Hejsek, L; Jirásková, N; Plíšek, S; Rozsíval, P

    2014-01-01

    Cytomegalovirus infection (CMV) in patients with acquired immunodeficiency syndrome (Acquired Immune Deficiency Syndrome, AIDS) is the most common opportunistic infection. This infection is harmless for healthy individuals, but for weakened individuals cause disease. The most common form of CMV-infection in patients with AIDS is cytomegalovirus retinitis, which occurs in 15% to 40% of cases. We report the case of aman twenty-five year old, treated for CMV retinitis and retinal vasculitis vessels. Prescribed Valcyte 900mg tbl. twice daily for 21 days with agood therapeutic effect. In patients with AIDS and decreased visual acuity is need be primarily thinking about the possible presence of CMV-infection and in time to start treatment.Key words: Cytomegalovirus (CMV) retinitis, AIDS, valganciklovir.

  1. Congenital cytomegalovirus infection: new prospects for prevention and therapy.

    PubMed

    Swanson, Elizabeth C; Schleiss, Mark R

    2013-04-01

    Cytomegalovirus is the commonest congenital viral infection in the developed world, with an overall prevalence of approximately 0.6%. Approximately 10% of congenitally infected infants have signs and symptoms of disease at birth, and these symptomatic infants have a substantial risk of subsequent neurologic sequelae. These include sensorineural hearing loss, mental retardation, microcephaly, development delay, seizure disorders, and cerebral palsy. Antiviral therapy for children with symptomatic congenital cytomegalovirus infection is effective at reducing the risk of long-term disabilities and should be offered to families with affected newborns. An effective preconceptual vaccine against CMV could protect against long-term neurologic sequelae and other disabilities.

  2. Shedding light on the elusive role of endothelial cells in cytomegalovirus dissemination.

    PubMed

    Sacher, Torsten; Andrassy, Joachim; Kalnins, Aivars; Dölken, Lars; Jordan, Stefan; Podlech, Jürgen; Ruzsics, Zsolt; Jauch, Karl-Walter; Reddehase, Matthias J; Koszinowski, Ulrich H

    2011-11-01

    Cytomegalovirus (CMV) is frequently transmitted by solid organ transplantation and is associated with graft failure. By forming the boundary between circulation and organ parenchyma, endothelial cells (EC) are suited for bidirectional virus spread from and to the transplant. We applied Cre/loxP-mediated green-fluorescence-tagging of EC-derived murine CMV (MCMV) to quantify the role of infected EC in transplantation-associated CMV dissemination in the mouse model. Both EC- and non-EC-derived virus originating from infected Tie2-cre(+) heart and kidney transplants were readily transmitted to MCMV-naïve recipients by primary viremia. In contrast, when a Tie2-cre(+) transplant was infected by primary viremia in an infected recipient, the recombined EC-derived virus poorly spread to recipient tissues. Similarly, in reverse direction, EC-derived virus from infected Tie2-cre(+) recipient tissues poorly spread to the transplant. These data contradict any privileged role of EC in CMV dissemination and challenge an indiscriminate applicability of the primary and secondary viremia concept of virus dissemination.

  3. Sustained CD8+ T cell memory inflation after infection with a single-cycle cytomegalovirus.

    PubMed

    Snyder, Christopher M; Cho, Kathy S; Bonnett, Elizabeth L; Allan, Jane E; Hill, Ann B

    2011-10-01

    Cytomegalovirus (CMV) is a β-herpesvirus that establishes a lifelong latent or persistent infection. A hallmark of chronic CMV infection is the lifelong persistence of large numbers of virus-specific CD8+ effector/effector memory T cells, a phenomenon called "memory inflation". How the virus continuously stimulates these T cells without being eradicated remains an enigma. The prevailing view is that CMV establishes a low grade "smoldering" infection characterized by tiny bursts of productive infection which are rapidly extinguished, leaving no detectable virus but replenishing the latent pool and leaving the immune system in a highly charged state. However, since abortive reactivation with limited viral gene expression is known to occur commonly, we investigated the necessity for virus reproduction in maintaining the inflationary T cell pool. We inhibited viral replication or spread in vivo using two different mutants of murine CMV (MCMV). First, famcyclovir blocked the replication of MCMV encoding the HSV Thymidine Kinase gene, but had no impact on the CD8+ T cell memory inflation once the infection was established. Second, MCMV that lacks the essential glycoprotein L, and thus is completely unable to spread from cell to cell, also drove memory inflation if the virus was administered systemically. Our data suggest that CMV which cannot spread from the cells it initially infects can repeatedly generate viral antigens to drive memory inflation without suffering eradication of the latent genome pool. PMID:21998590

  4. Antiviral Therapy Can Reverse the Development of Immune Senescence in Elderly Mice with Latent Cytomegalovirus Infection

    PubMed Central

    Pachnio, Annette; Lauder, Sarah N.; Sweet, Clive; Moss, Paul A.

    2013-01-01

    Cytomegalovirus (CMV) infection leads to the development of adaptive and humoral immune responses that are among the largest for any pathogen, and intriguingly, the magnitude of the immune response increases with age, a phenomenon termed “memory inflation.” Elevated CMV-specific immunity has been correlated with an increased mortality rate in elderly individuals and with impaired vaccination responses. The latent phase of CMV infection is characterized by intermittent episodes of subclinical viral reactivation and the production of immunogenic transcripts that may maintain memory inflation of virus-specific cytotoxic lymphocytes. However, the relative importance of CMV reactivation in the development of memory inflation is uncertain, as is the potential for antiviral treatment to reverse this effect. Here, we administered valaciclovir for up to 12 months in mice with established murine CMV (MCMV) infection. Treatment reduced the magnitude of the MCMV-specific CD8+ T-lymphocyte response by 80%, and the residual MCMV tetramer-specific lymphocytes exhibited a less differentiated phenotype. In addition, latent MCMV infection suppressed the proportion of naïve CD8+ T cells by 60% compared to antiviral-treated mice or MCMV-negative animals. Furthermore, treatment led to a reduction in influenza A viral loads following a challenge in elderly MCMV-infected animals and also reduced the differentiation of influenza virus-specific cytotoxic lymphocytes. These observations demonstrate that MCMV-specific memory inflation is maintained by viral replication and that therapeutic intervention could lead to improved immune function. PMID:23115277

  5. Electrochemical detection of a single cytomegalovirus at an ultramicroelectrode and its antibody anchoring

    PubMed Central

    Dick, Jeffrey E.; Hilterbrand, Adam T.; Boika, Aliaksei; Upton, Jason W.; Bard, Allen J.

    2015-01-01

    We report observations of stochastic collisions of murine cytomegalovirus (MCMV) on ultramicroelectrodes (UMEs), extending the observation of discrete collision events on UMEs to biologically relevant analytes. Adsorption of an antibody specific for a virion surface glycoprotein allowed differentiation of MCMV from MCMV bound by antibody from the collision frequency decrease and current magnitudes in the electrochemical collision experiments, which shows the efficacy of the method to size viral samples. To add selectivity to the technique, interactions between MCMV, a glycoprotein-specific primary antibody to MCMV, and polystyrene bead “anchors,” which were functionalized with a secondary antibody specific to the Fc region of the primary antibody, were used to affect virus mobility. Bead aggregation was observed, and the extent of aggregation was measured using the electrochemical collision technique. Scanning electron microscopy and optical microscopy further supported aggregate shape and extent of aggregation with and without MCMV. This work extends the field of collisions to biologically relevant antigens and provides a novel foundation upon which qualitative sensor technology might be built for selective detection of viruses and other biologically relevant analytes. PMID:25870261

  6. Cytomegalovirus-induced sensorineural hearing loss with persistent cochlear inflammation in neonatal mice.

    PubMed

    Schachtele, Scott J; Mutnal, Manohar B; Schleiss, Mark R; Lokensgard, James R

    2011-06-01

    Congenital cytomegalovirus (CMV) infection is the leading cause of sensorineural hearing loss (SNHL) in children. During murine (M)CMV-induced encephalitis, the immune response is important for both the control of viral dissemination and the clearance of virus from the brain. While the importance of CMV-induced SNHL has been described, the mechanisms surrounding its pathogenesis and the role of inflammatory responses remain unclear. This study presents a neonatal mouse model of profound SNHL in which MCMV preferentially infected both cochlear perilymphatic epithelial cells and spiral ganglion neurons. Interestingly, MCMV infection induced cochlear hair cell death by 21 days post-infection, despite a clear lack of direct infection of hair cells and the complete clearance of the virus from the cochlea by 14 dpi. Flow cytometric, immunohistochemical, and quantitative PCR analysis of MCMV-infected cochlea revealed a robust and chronic inflammatory response, including a prolonged increase in reactive oxygen species production by infiltrating macrophages. These data support a pivotal role for inflammation during MCMV-induced SNHL.

  7. Pathological spectrum of cytomegalovirus infection of renal allograft recipients-an autopsy study from north India.

    PubMed

    Joshi, Kusum; Nada, Ritambhra; Radotra, Bishan Das; Jha, Vivekanand; Sakhuja, Vinay

    2004-07-01

    This is a retrospective study of autopsy material to highlight the histo-morphological changes in cytomegalovirus (CMV) infection amongst renal allograft recipients. Nineteen out of 80 patients (23.75%) autopsied during a seventeen-year period (1985-2001) had CMV infection. Pulmonary infection was present in 14 out of 19 cases of which four had isolated lung involvement. Likewise, there were two cases each of isolated oesophageal and renal involvement; one case with isolated colonic involvement. The other 10 cases had multi-organ involvement and the organs involved were kidneys (4), esophagus (6), stomach (1), colon (5), adrenals (3), pancreas (3), liver (1) and spleen (1). Pulmonary infection with CMV was associated with acute pneumonitis in 3 cases and lymphocytic interstitial pneumonitis in 9 instances. Four out of 6 cases had acute tubulo-interstitial nephritis induced by CMV and only two cases had no significant inflammatory response. Glomerular involvement in the form of CMV inclusions in the glomeruli was present in only one case. Gastrointestinal CMV infection (15) presented as acute necrotizing ulceration because of predominant endothelial involvement. Post transplant survival period varied from one month to three years, with majority (14) of the patients having survived for less than one year.

  8. Infantile Spasms and Cytomegalovirus Infection: Antiviral and Antiepileptic Treatment

    ERIC Educational Resources Information Center

    Dunin-Wasowicz, Dorota; Kasprzyk-Obara, Jolanta; Jurkiewicz, Elzbieta; Kapusta, Monika; Milewska-Bobula, Bogumila

    2007-01-01

    From 1 January 1995 to 31 December 2004, 22 patients (13 males, nine females; age range 2-12mo) with infantile spasms and cytomegalovirus (CMV) infection were treated with intravenous ganciclovir (GCV) and antiepileptic drugs. GCV was given for 3 to 12 weeks with a 1-month interval (one, two, or three courses). Epileptic spasms occurred before…

  9. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  10. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  11. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  12. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  13. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  14. Autism in a Child with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Markowitz, Phillip I.

    1983-01-01

    A case study is described in which early infantile autism was diagnosed in a child with congenital cytomegalovirus (CMU) infection. It is suggested that congenital infection should be considered as an etiological agent in autism. The case's synergistic effect of CMU-induced brain damage, deafness, and maternal deprivation in noted. (CL)

  15. Brief Report: Autistic Disorder in Three Children with Cytomegalovirus Infection

    ERIC Educational Resources Information Center

    Sweeten, Thayne L.; Posey, David J.; McDougle, Christopher J.

    2004-01-01

    Previous research has identified a relationship between autistic disorder (autism) and specific congenital infections. Three cases of congenital or perinatal cytomegalovirus (CMV) infection occurring in association with autism are described. Hypothetical mechanisms relating congenital infection, such as CMV, to the development of autism are…

  16. Cytomegalovirus infection: its incidence and management in cytomegalovirus-seropositive living related liver transplant recipients: a single-center experience.

    PubMed

    Wadhawan, Manav; Gupta, Subash; Goyal, Neerav; Vasudevan, Karisangal R; Makki, Kausar; Dawar, Reetika; Sardana, Raman; Lal, Nand; Kumar, Ajay

    2012-12-01

    It is believed that antiviral prophylaxis decreases the incidence of cytomegalovirus (CMV) reactivation and disease. There are few data regarding weekly assays for CMV DNA after transplantation and the subsequent management of CMV. Here we report a cohort of living related liver transplantation (LRLT) patients who were treated for invasive CMV disease or for CMV infections if they were receiving steroids for rejection. Patients who underwent liver transplantation at our center between September 2006 and August 2010 and were recipient-positive/donor-positive (R(+) /D(+) ) were prospectively included. Patients were tested for CMV DNA 3 weeks after transplantation. CMV DNA-positive patients underwent weekly DNA monitoring until there were 2 consecutive negative reports. Those who developed CMV disease or had rising DNA titers while they were on treatment for rejection were treated. A Cox regression analysis was performed for factors predicting survival. Two hundred sixty-six of the 306 R(+) /D(+) patients were CMV DNA-negative 3 weeks after transplantation, and 40 had detectable DNA. One of the DNA-negative patients developed CMV disease after treatment for rejection with methylprednisolone. Thirty patients had <500 copies/mL, and 10 had ≥500 copies/mL. Two of the 30 patients with DNA levels < 500 copies/mL developed CMV disease. Six of the 10 patients with DNA levels ≥500 copies/mL developed disease. CMV disease occurred in 9 of the 306 patients (2.9%). One patient received treatment for a rise in DNA titers while he was receiving steroids. There was a significant correlation between steroid administration for acute cellular rejection (ACR) and CMV reactivation (P = 0.003) and disease (P = 0.002). A multivariate analysis showed that CMV reactivation/disease did not predict survival. There was no difference in survival between CMV DNA-positive patients and CMV DNA-negative patients (P = 0.68). In conclusion, CMV reactivation is common after LRLT (13%), but the

  17. Prevention of Primary Cytomegalovirus Infection in Pregnancy☆

    PubMed Central

    Revello, Maria Grazia; Tibaldi, Cecilia; Masuelli, Giulia; Frisina, Valentina; Sacchi, Alessandra; Furione, Milena; Arossa, Alessia; Spinillo, Arsenio; Klersy, Catherine; Ceccarelli, Manuela; Gerna, Giuseppe; Todros, Tullia

    2015-01-01

    Background Cytomegalovirus (CMV) is the leading infectious agent causing congenital sensorineural hearing loss and psychomotor retardation. CMV vaccine is currently unavailable and treatment options in pregnancy are limited. Susceptible pregnant women caring for children are at high risk for primary infection. CMV educational and hygienic measures have the potential to prevent primary maternal infection. Methods A mixed interventional and observational controlled study was conducted to investigate the effectiveness of hygiene information among pregnant women at risk for primary CMV infection for personal/occupational reasons. In the intervention arm, CMV-seronegative women, identified at the time of maternal serum screening for fetal aneuploidy at 11–12 weeks of gestation, were given hygiene information and prospectively tested for CMV until delivery. The comparison arm consisted of women enrolled at delivery who were neither tested for nor informed about CMV during pregnancy, and who had a serum sample stored at the screening for fetal aneuploidy. By design, groups were homogeneous for age, parity, education, and exposure to at least one risk factor. The primary outcome was CMV seroconversion. Acceptance of hygiene recommendations was a secondary objective and was measured by a self-report. Findings Four out of 331 (1.2%) women seroconverted in the intervention group compared to 24/315 (7.6%) in the comparison group (delta = 6.4%; 95% CI 3.2–9.6; P < 0.001). There were 3 newborns with congenital infection in the intervention group and 8 in the comparison group (1 with cerebral ultrasound abnormalities at birth). Ninety-three percent of women felt hygiene recommendations were worth suggesting to all pregnant women at risk for infection. Interpretation This controlled study provides evidence that an intervention based on the identification and hygiene counseling of CMV-seronegative pregnant women significantly prevents maternal infection. While waiting for

  18. Cutaneous involvement by cytomegalovirus in a renal transplant recipient as an indicator of severe systemic infection*

    PubMed Central

    Neumann, Antonielle Borges Faria; Daxbacher, Egon Luiz Rodrigues; Chiaratti, Francielle Chiavelli; Jeunon, Thiago

    2016-01-01

    Cytomegalovirus is an opportunistic virus that commonly affects immunosuppressed patients. Cutaneous involvement by this virus is rare and occurs in significantly immunocompromised hosts, with a poor prognosis. Skin ulcers may represent the first sign of systemic infection by cytomegalovirus in these patients. Herein, a case of a systemic infection by Cytomegalovirus presenting as genital and oral ulcers in a kidney-transplant recipient is reported. PMID:26982783

  19. Severe haemolytic anaemia due to cold anti-'i' antibodies associated with cytomegalovirus infection.

    PubMed Central

    Aguado, J. M.; Castrillo, J. M.; Sanz, J.; Serrano, J.

    1990-01-01

    A 66 year old patient with multiple myeloma and monoclonal cryoglobulinaemia who developed a severe haemolytic anaemia following a cytomegalovirus infection is reported. The presence of a high titre of anti-'i' cold antibody of IgM subclass is demonstrated. Anti-'i' antibody disappeared when complement-fixation antibody titres against cytomegalovirus decreased. Various pathogenetic mechanisms involved in the development of haemolytic anaemia associated with cytomegalovirus infection are discussed. To our knowledge, this is the first case described in the English language publications associating severe haemolytic anaemia with an anti-'i' antibody after a cytomegalovirus infection in an immunocompromised patient. PMID:2164663

  20. Severe haemolytic anaemia due to cold anti-'i' antibodies associated with cytomegalovirus infection.

    PubMed

    Aguado, J M; Castrillo, J M; Sanz, J; Serrano, J

    1990-05-01

    A 66 year old patient with multiple myeloma and monoclonal cryoglobulinaemia who developed a severe haemolytic anaemia following a cytomegalovirus infection is reported. The presence of a high titre of anti-'i' cold antibody of IgM subclass is demonstrated. Anti-'i' antibody disappeared when complement-fixation antibody titres against cytomegalovirus decreased. Various pathogenetic mechanisms involved in the development of haemolytic anaemia associated with cytomegalovirus infection are discussed. To our knowledge, this is the first case described in the English language publications associating severe haemolytic anaemia with an anti-'i' antibody after a cytomegalovirus infection in an immunocompromised patient.

  1. Molecular profiling of cytomegalovirus-induced human CD8+ T cell differentiation

    PubMed Central

    Hertoghs, Kirsten M.L.; Moerland, Perry D.; van Stijn, Amber; Remmerswaal, Ester B.M.; Yong, Sila L.; van de Berg, Pablo J.E.J.; van Ham, S. Marieke; Baas, Frank; ten Berge, Ineke J.M.; van Lier, René A.W.

    2010-01-01

    CD8+ T cells play a critical role in the immune response to viral pathogens. Persistent human cytomegalovirus (HCMV) infection results in a strong increase in the number of virus-specific, quiescent effector-type CD8+ T cells with constitutive cytolytic activity, but the molecular pathways involved in the induction and maintenance of these cells are unknown. We show here that HCMV infection induced acute and lasting changes in the transcriptomes of virus-reactive T cells collected from HCMV-seropositive patients at distinct stages of infection. Enhanced cell cycle and metabolic activity was restricted to the acute phase of the response, but at all stages, HCMV-specific CD8+ T cells expressed the Th1-associated transcription factors T-bet (TBX21) and eomesodermin (EOMES), in parallel with continuous expression of IFNG mRNA and IFN-γ–regulated genes. The cytolytic proteins granzyme B and perforin as well as the fractalkine-binding chemokine receptor CX3CR1 were found in virus-reactive cells throughout the response. During HCMV latency, virus-specific CD8+ T cells lacked the typical features of exhausted cells found in other chronic infections. Persistent effector cell traits together with the permanent changes in chemokine receptor usage of virus-specific, nonexhausted, long-lived CD8+ T cells may be crucial to maintain lifelong protection from HCMV reactivation. PMID:20921622

  2. Block of Death-Receptor Apoptosis Protects Mouse Cytomegalovirus from Macrophages and Is a Determinant of Virulence in Immunodeficient Hosts

    PubMed Central

    Ebermann, Linda; Ruzsics, Zsolt; Guzmán, Carlos A.; van Rooijen, Nico; Casalegno-Garduño, Rosaely; Koszinowski, Ulrich; Čičin-Šain, Luka

    2012-01-01

    The inhibition of death-receptor apoptosis is a conserved viral function. The murine cytomegalovirus (MCMV) gene M36 is a sequence and functional homologue of the human cytomegalovirus gene UL36, and it encodes an inhibitor of apoptosis that binds to caspase-8, blocks downstream signaling and thus contributes to viral fitness in macrophages and in vivo. Here we show a direct link between the inability of mutants lacking the M36 gene (ΔM36) to inhibit apoptosis, poor viral growth in macrophage cell cultures and viral in vivo fitness and virulence. ΔM36 grew poorly in RAG1 knockout mice and in RAG/IL-2-receptor common gamma chain double knockout mice (RAGγC−/−), but the depletion of macrophages in either mouse strain rescued the growth of ΔM36 to almost wild-type levels. This was consistent with the observation that activated macrophages were sufficient to impair ΔM36 growth in vitro. Namely, spiking fibroblast cell cultures with activated macrophages had a suppressive effect on ΔM36 growth, which could be reverted by z-VAD-fmk, a chemical apoptosis inhibitor. TNFα from activated macrophages synergized with IFNγ in target cells to inhibit ΔM36 growth. Hence, our data show that poor ΔM36 growth in macrophages does not reflect a defect in tropism, but rather a defect in the suppression of antiviral mediators secreted by macrophages. To the best of our knowledge, this shows for the first time an immune evasion mechanism that protects MCMV selectively from the antiviral activity of macrophages, and thus critically contributes to viral pathogenicity in the immunocompromised host devoid of the adaptive immune system. PMID:23271968

  3. Cytomegalovirus infection in preterm triplets transmitted via breast milk.

    PubMed

    Demirel, Gamze; Celik, Istemi Han; Canpolat, Fuat Emre; Dilmen, Ugur

    2014-04-01

    Cytomegalovirus (CMV) may transmit perinatally or from breast milk. The risk for development of symptomatic CMV disease in very-low-birth-weight premature infants after transmission from maternal breast milk is not clear. There are scarce data in the literature about congenital CMV infection in multiple pregnancies, being mostly with twin gestations. Here we present a unique case of triplets with CMV infection transmitted via breast milk.

  4. Atypical Presentation of Cytomegalovirus Infection in a Liver Transplant Patient

    PubMed Central

    Bansal, Naresh; Arora, Anil; Kumaran, Vinay; Mehta, Naimish; Varma, Vibha; Sharma, Praveen; Tyagi, Pankaj; Sachdeva, Munish; Kumar, Ashish

    2012-01-01

    Cytomegalovirus (CMV) is the most common viral infection in solid organ transplant recipients. Symptomatic infection usually presents with fever, pneumonia, colitis, or cytopenia. We describe a case of symptomatic CMV infection in a liver transplant recipient presenting with atypical symptoms of only persistent nausea and vomiting, in the absence of classical symptoms and signs; thus, highlighting the importance of high index of suspicion of CMV in immunocompromised patients, keeping in mind the high morbidity and mortality associated with this disease. PMID:25755388

  5. Cytomegalovirus-associated colitis causing diarrhea in an immunocompetent patient

    PubMed Central

    Carter, Dan; Olchovsky, David; Pokroy, Russell; Ezra, David

    2006-01-01

    Cytomegalovirus (CMV) colitis rarely occurs in immunocompetent patients. We report a case of disabling and life threatening diarrhea in an immunocompetent elderly woman due to CMV colitis. The diagnosis of CMV was based on histological examination of tissues biopsied at colonoscopy, positive CMV antigen and high CMV-IgM titer in peripheral blood samples and a good response to systemic gancyclovir treatment. We conclude that CMV should be considered in the differential diagnosis of colitis in elderly immunocompetent patients. PMID:17106945

  6. Correlation between infectivity and physical virus particles in human cytomegalovirus.

    PubMed

    Benyesh-Melnick, M; Probstmeyer, F; McCombs, R; Brunschwig, J P; Vonka, V

    1966-11-01

    Benyesh-Melnick, Matilda (Baylor University College of Medicine, Houston, Tex.), Fern Probstmeyer, Robert McCombs, Jean P. Brunschwig, and Vladimir Vonka. Correlation between infectivity and physical virus particles in human cyto-megalovirus. J. Bacteriol. 92:1555-1561. 1966.-Infectivity titers [measured as plaque-forming units (PFU)] and particle counts by the sedimentation pseudo-replication technique were determined for crude, unpurified, intracellular preparations of two different strains of human cytomegalovirus. Unlike the high particle-infectivity ratio of 10(6) to 10(8) previously reported for these viruses, the number of total particles per PFU ranged from 160 to 490 with strain AD-169 and from 176 to 1,050 for strain C-87. Interpretation of particle-PFU ratios of intracellular cytomegalovirus in terms of particle morphology is not conclusive at this time. The number of enveloped forms found varied between 0 and 34% of the total particles counted. However, the true proportion is probably greater, because envelopes were found to be destroyed by the enzyme treatment used in preparing the specimens for examination in the electron microscope. The number of full particles found ranged between 4 and 31% of the total particles counted. The particle per PFU ratio of extracellular virus was found to be three- to fivefold lower than that of intracellular virus.

  7. Role of Defective Thymic Function in Onset of Ganciclovir-Resistant Cytomegalovirus after Cord Blood Transplantation

    PubMed Central

    Martín, Carmen; Romero-Sánchez, María C.; Ferrando-Martínez, Sara; Martínez, Francisco; Rivero, Antonio; Torres, Antonio; Solana, Rafael; Torre-Cisneros, Julián

    2012-01-01

    A case of recurrent cytomegalovirus reactivations in a cytomegalovirus-seropositive woman who received allogeneic cord blood transplantation is described. Thirteen months posttransplantation, her CD3+ T cell count was extremely low whereas natural killer cells represented 66% of her total lymphocytes. She showed defective thymic function that might contribute to the onset of valganciclovir resistance. PMID:23054743

  8. Role of defective thymic function in onset of ganciclovir-resistant cytomegalovirus after cord blood transplantation.

    PubMed

    Cantisán, Sara; Martín, Carmen; Romero-Sánchez, María C; Ferrando-Martínez, Sara; Martínez, Francisco; Rivero, Antonio; Torres, Antonio; Solana, Rafael; Torre-Cisneros, Julián

    2012-12-01

    A case of recurrent cytomegalovirus reactivations in a cytomegalovirus-seropositive woman who received allogeneic cord blood transplantation is described. Thirteen months posttransplantation, her CD3(+) T cell count was extremely low whereas natural killer cells represented 66% of her total lymphocytes. She showed defective thymic function that might contribute to the onset of valganciclovir resistance.

  9. The role of decay accelerating factor in the immunopathogenesis of cytomegalovirus infection.

    PubMed

    Bani-Ahmad, M; El-Amouri, I S; Ko, C M; Lin, F; Tang-Feldman, Y; Oakley, O R

    2011-02-01

    A wide variety of the host immune elements play an influential role in the defence against cytomegalovirus (CMV) infection. However, the role of complement in the clearance of CMV infection is less well studied. Decay accelerating factor (DAF/CD55) is a membrane-bound complement regulatory protein that inhibits the formation and accelerates the decay of C3-convertase. Here we hypothesize that murine CMV (MCMV) utilizes DAF as an immunoevasive strategy through down-regulation of host adaptive responses against the virus. To test our hypothesis, DAF knock-out (DAF KO) C57BL/6 mice and wild-type (WT) littermates were infected with a sublethal dose of MCMV, and their immune responses were compared. WT mice lost 7·8% of their initial weight within the first 4 days after infection and quickly began to recover. This is in contrast to the DAF KO mice, that lost a total of 19·4% of their initial weight and did not start recovery until 6 days post-infection. Flow cytometric analysis of lung digests revealed that infected DAF KO mice had a significantly increased infiltration of inflammatory cells, the majority being CD8(+) T lymphocytes. Serum levels of tumour necrosis factor (TNF)-α and interferon (IFN)-γ were also increased markedly in the DAF KO mice compared to the infected WT mice. More interestingly, increased viral genome copies (DNA) in the splenocytes of DAF KO mice was accompanied with mRNA transcripts in the DAF KO mice, an indication of active viral replication. These data suggest an intriguing effect of reduced DAF expression on host responses following in vivo MCMV infection.

  10. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation.

    PubMed

    Reddehase, Matthias J

    2016-01-01

    Hematopoietic cell transplantation (HCT) is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a "window of opportunity" for latent Cytomegalovirus (CMV) by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A "window of opportunity" for the virus represents a "window of risk" for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8(+) T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP) representing the most severe clinical manifestation. Here, I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a preemptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing "proof of concept" for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8(+) T cells bridging the critical interim. However, CMV is not a "passive antigen" but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow (BM) stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected BM stroma and impaired colony growth and lineage differentiation can lead to "graft failure." In consequence, uncontrolled virus spread causes morbidity and

  11. Human cytomegalovirus neutralizing antibody-resistant phenotype is associated with reduced expression of glycoprotein H.

    PubMed Central

    Li, L; Coelingh, K L; Britt, W J

    1995-01-01

    We have characterized a neutralizing antibody-resistant mutant human cytomegalovirus (HCMV) obtained from a patient treated with a human monoclonal antiglycoprotein H (gH; unique long region 75) antibody. This virus exhibited resistance to several different neutralizing anti-gH murine monoclonal antibodies (MAbs), as well as to a polyvalent anti-gH serum. The resistant phenotype was unstable and could be maintained only by passage of plaque-purified virus under neutralizing MAb selection. In the absence of a MAb, the resistant phenotype reverted to a neutralizing antibody-sensitive phenotype within one passage. The predicted amino acid sequences of gH from the MAb-resistant and -susceptible parent viruses were identical. Biochemical analysis of the MAb-resistant and -susceptible parent viruses revealed a marked decrease of gH expression in the envelope of the MAb-resistant virus. Furthermore, propagation of the virus in various MAb concentrations resulted in the production of extracellular virions with various levels of resistance to the neutralizing activity of the MAb. These results suggest a mechanism for the generation of neutralizing antibody-resistant viruses which could evade host-derived antiviral antibody responses. In addition, our findings indicate that the stoichiometry of gH in the envelope of infectious HCMV virions is not rigidly fixed and therefore offer a simple explanation for production of phenotypic variants of HCMV through an assembly process in which the content of gH in the envelope of progeny virions varies randomly. PMID:7666509

  12. Diffuse periventricular calcification and brain atrophy: A case of neonatal central nervous system cytomegalovirus infection.

    PubMed

    Sanchez, Thomas R; Datlow, Mitchell D; Nidecker, Anna E

    2016-10-01

    TORCH refers to the most common congenitally acquired infections: toxoplasma, rubella, cytomegalovirus, and herpes simplex virus. Neonatal cytomegalovirus infection remains a common cause of congenital infection worldwide with effects ranging from hearing impairment to significant neurological morbidity. We report a case of a term neonate with ventriculomegaly on prenatal ultrasound who presented with low birth weight, small head circumference, hepatosplenomegaly, and purpuric rash on physical exam. Central nervous system cytomegalovirus infection typically shows periventricular calcifications and associated deep white matter damage and ventriculomegaly. Ultrasound, computed tomography, and magnetic resonance imaging have different roles in the diagnosis of congenital central nervous system cytomegalovirus infection. Many imaging features of congenital cytomegalovirus are distinctive, and can spur a diagnostic work-up as well as help provide a prognosis. PMID:27531861

  13. [Esophageal aspergillosis in a patient with acute myelogenous leukemia and febrile neutropenia].

    PubMed

    Besa, Santiago; Kattan, Eduardo; Cid, Ximena; Claro, Juan C

    2014-04-01

    Aspergillosis usually compromises the respiratory system, but can also affect others. We report a 46 yo female with acute myeloid leukemia, developed febrile neutropenia and dysphagia. Endoscopy revealed esophageal cytomegalovirus-like ulcers, but biopsies showed Aspergillus spp. It's important to consider aspergillosis in the differential diagnosis of esophageal lesions in high-risk patients.

  14. Perforation of the bowel due to cytomegalovirus infection in a man with AIDS: surgery is not always necessary!

    PubMed

    Yoganathan, Katie Tharshana; Morgan, Andrew Roger; Yoganathan, Kathir G

    2016-01-01

    Cytomegalovirus (CMV) infection is the most common viral opportunistic infection in immunocompromised patients and is a rare cause of bowel perforation. It invariably requires surgical intervention and is often fatal. We report a 50-year-old Caucasian man with AIDS, presented 3 weeks after developing abdominal pain and distension. He was treated for CMV retinitis in the past. His adherence to antiretroviral therapy was poor. Examination revealed a recurrence of active CMV retinitis. His abdomen was tender and distended. The plain X-ray of the abdomen revealed a double wall sign (Rigler's sign), indicating pneumoperitoneum due to the bowel perforation. The upper endoscopy was normal. His CD4 count was 30 cells/mm(3) He was treated with cidofovir infusion. He made a full recovery, without requiring any form of surgery. However, he died of adult respiratory distress syndrome 14 months later, due to iatrogenic acute pancreatitis. PMID:27440845

  15. Analysis of Mutations in the Gene Encoding Cytomegalovirus DNA Polymerase in a Phase 2 Clinical Trial of Brincidofovir Prophylaxis

    PubMed Central

    Lanier, E. Randall; Foster, Scott; Brundage, Tom; Chou, Sunwen; Prichard, Mark N.; Kleiboeker, Steven; Wilson, Chad; Colville, Donella; Mommeja-Marin, Herve

    2016-01-01

    Brincidofovir is an oral antiviral in development for prevention of cytomegalovirus disease. Cytomegalovirus genotyping results from a phase 2 trial comparing brincidofovir to placebo for prophylaxis against cytomegalovirus infection in hematopoietic cell transplant recipients provided initial data on the clinical resistance profile for brincidofovir. In this study, no known resistance-associated mutations were detected in brincidofovir-treated subjects; identified genotypic substitutions did not confer resistance to cytomegalovirus antivirals in vitro, suggesting that these changes represent polymorphisms unrelated to brincidofovir resistance. Lack of evidence for genotypic resistance during prophylaxis suggests that first-line use of brincidofovir for prevention of cytomegalovirus infection may preserve downstream options for patients. PMID:26941282

  16. Murine CMV-Induced Hearing Loss Is Associated with Inner Ear Inflammation and Loss of Spiral Ganglia Neurons

    PubMed Central

    Golemac, Mijo; Pugel, Ester Pernjak; Jonjic, Stipan; Britt, William J.

    2015-01-01

    Congenital human cytomegalovirus (HCMV) occurs in 0.5–1% of live births and approximately 10% of infected infants develop hearing loss. The mechanism(s) of hearing loss remain unknown. We developed a murine model of CMV induced hearing loss in which murine cytomegalovirus (MCMV) infection of newborn mice leads to hematogenous spread of virus to the inner ear, induction of inflammatory responses, and hearing loss. Characteristics of the hearing loss described in infants with congenital HCMV infection were observed including, delayed onset, progressive hearing loss, and unilateral hearing loss in this model and, these characteristics were viral inoculum dependent. Viral antigens were present in the inner ear as were CD3+ mononuclear cells in the spiral ganglion and stria vascularis. Spiral ganglion neuron density was decreased after infection, thus providing a mechanism for hearing loss. The lack of significant inner ear histopathology and persistence of inflammation in cochlea of mice with hearing loss raised the possibility that inflammation was a major component of the mechanism(s) of hearing loss in MCMV infected mice. PMID:25875183

  17. Prevalence and clinical management of cytomegalovirus retinitis in AIDS patients in shanghai, china

    PubMed Central

    2011-01-01

    Background Cytomegalovirus retinitis is a common AIDS-associated illness, leading to blindness in up to 30% of patients. This study was to investigate the prevalence and clinical management of the cytomegalovirus retinitis associated with AIDS in a large municipality of China. Methods Clinical and laboratory data from 23 cytomegalovirus retinitis patients (35 eyes) out of 303 hospitalized AIDS individuals in a single medical center were analyzed retrospectively. Two of 23 patients were diagnosed cytomegalovirus retinitis just before hospitalization without anti-CMV therapy. Ganciclovir combined with the high active anti-retroviral therapy was installed for treatment of cytomegalovirus retinitis after diagnosis was confirmed. The data were analyzed by specialists and statistics was also applied. Results The prevalence of cytomegalovirus retinitis in hospitalized AIDS patients was 7.6% in this study. The level of CD4+ T lymphocytes was correlated well with the occurrence of cytomegalovirus retinitis, showing 16.8% (19/113) (95% confidence interval: 10.4,25.0), 5.4% (3/56) (95% confidence interval: 1.1,14.9), and 1.4% (1/69) (95% confidence interval: 0.0,7.8) occurrence in the patients with CD4+ T lymphocyte counts < 50, 50~99, and 100~199 cells/μl, respectively. The mean CD4+ T lymphocyte counts was 31.7 ± 38.6 cells/μl in 23 AIDS patients with cytomegalovirus retinitis. Median CD4+ T lymphocyte count is 20 cells/μl with inter-quartile range as (5, 36). Seven patients died (11 eyes) and 16 patients (24 eyes) survived. The proportion of blindness and low vision in eyes infected with cytomegalovirus retinitis respectively was 20.8% (5/24) and 29.2% (7/24) when they were diagnosed in survivors. The ganciclovir therapy was effective in 16 patients (24 eyes). Clinical recovery of cytomegalovirus retinitis was 41.7% (10/24) and clinical improvement 58.3% (14/24). After anti-CMV treatment, the proportion of blindness or low vision was 16.7% (4/24). Conclusions The AIDS

  18. Herpetic (non-cytomegalovirus) retinal infections in patients with the acquired immunodeficiency syndrome.

    PubMed

    Stewart, Michael W

    2013-04-01

    Human herpes viruses cause significant morbidity in patients with the acquired immunodeficiency syndrome. Even after the introduction of highly active anti-retroviral therapy (HAART), herpes viruses remain the leading causes of blindness in AIDS patients. Cytomegalovirus (CMV) retinitis and the closely-related immune reconstitution uveitis syndrome are the most common causes of blindness, but progressive outer retinal necrosis and acute retinal necrosis due to varicella zoster and herpes simplex are also important causes of vision loss. Successful treatment of these conditions requires an aggressive approach with multi-drug intravenous therapy or repeated intravitreal antiviral injections. Since the rate of retinal detachment is alarmingly high despite successful antiviral therapy, internists and ophthalmologists must work closely together to recognize and treat complications as they arise. Fortunately, Epstein-Barr virus is a rare cause of retinal infection and human herpes virus (HHV)-6, HHV-7, and HHV-8 do not appear to be primary pathogens. However, increasing evidence suggests that HHV-6 and HHV-7 play important roles in modulating the immune system and potentiating infection by CMV.

  19. Mast cells as rapid innate sensors of cytomegalovirus by TLR3/TRIF signaling-dependent and -independent mechanisms.

    PubMed

    Becker, Marc; Lemmermann, Niels A W; Ebert, Stefan; Baars, Pamela; Renzaho, Angelique; Podlech, Jürgen; Stassen, Michael; Reddehase, Matthias J

    2015-03-01

    The succinct metaphor, 'the immune system's loaded gun', has been used to describe the role of mast cells (MCs) due to their storage of a wide range of potent pro-inflammatory and antimicrobial mediators in secretory granules that can be released almost instantly on demand to fight invaders. Located at host-environment boundaries and equipped with an arsenal of pattern recognition receptors, MCs are destined to be rapid innate sensors of pathogens penetrating endothelial and epithelial surfaces. Although the importance of MCs in antimicrobial and antiparasitic defense has long been appreciated, their role in raising the alarm against viral infections has been noted only recently. Work on cytomegalovirus (CMV) infection in the murine model has revealed MCs as players in a novel cross-talk axis between innate and adaptive immune surveillance of CMV, in that infection of MCs, which is associated with MC degranulation and release of the chemokine CCL5, enhances the recruitment of protective CD8 T cells to extravascular sites of virus replication, specifically to lung interstitium and alveolar epithelium. Here, we have expanded on these studies by investigating the conditions for MC activation and the consequent degranulation in response to host infection. Surprisingly, the data revealed two temporally and mechanistically distinct waves of MC activation: an almost instant indirect activation that depended on TLR3/TRIF signaling and delayed activation by direct infection of MCs that did not involve TLR3/TRIF signaling. Cell type-specific Cre-recombination that yielded eGFP-expressing reporter virus selectively originating from MCs identified MC as a new in vivo, first-hit target cell of productive murine CMV infection. PMID:25152077

  20. Guillain-Barré syndrome and cytomegalovirus infection during pregnancy.

    PubMed

    Lupo, Julien; Germi, Raphaële; Jean, Dominique; Baccard-Longère, Monique; Casez, Olivier; Besson, Gérard; Rougé, Alain; Boutonnat, Jean; Schwebel, Carole; Hoffmann, Pascale; Morand, Patrice

    2016-06-01

    Guillain-Barré syndrome (GBS) is an immune-mediated disorder which can be triggered by cytomegalovirus (CMV) infection. GBS following CMV primary infection is a rare event during pregnancy, which raises the question of maternal and fetal management. We describe an unusual case of GBS after CMV primary infection in a pregnant woman. The mother was successfully treated with standard immunoglobulins but in utero fetal death caused by CMV congenital infection unfortunately occurred. Similar cases have rarely been reported in the literature.

  1. Enterocolic fistula: A rare presentation of cytomegalovirus infection.

    PubMed

    Gill, Richdeep S; Taylor, Geoffrey; Penner, Robert M; Logsetty, Sarvesh

    2012-01-01

    In the present report, the first reported case of cytomegalovirus (CMV)-associated enterocolic fistula in an HIV/AIDS patient is described. CMV colitis is the second most common presentation of CMV infection in immunocompromised patients. CMV-associated enteric fistulae are an exceedingly rare complication, with only four previous cases described: a gastrocolic, an enterocutaneous, a rectovaginal and a colocutaneous fistula. Management of these patient demonstrates the importance of treating the precipitating viral infection before considering surgical intervention of the enterocolic fistula.

  2. Cytomegalovirus-mediated activation of pyrimidine biosynthesis drives UDP–sugar synthesis to support viral protein glycosylation

    PubMed Central

    DeVito, Stefanie Renee; Ortiz-Riaño, Emilio; Martínez-Sobrido, Luis; Munger, Joshua

    2014-01-01

    Human cytomegalovirus (HCMV) induces numerous changes to the host metabolic network that are critical for high-titer viral replication. We find that HCMV infection substantially induces de novo pyrimidine biosynthetic flux. This activation is important for HCMV replication because inhibition of pyrimidine biosynthetic enzymes substantially decreases the production of infectious virus, which can be rescued through medium supplementation with pyrimidine biosynthetic intermediates. Metabolomic analysis revealed that pyrimidine biosynthetic inhibition considerably reduces the levels of various UDP–sugar metabolites in HCMV-infected, but not mock-infected, cells. Further, UDP–sugar biosynthesis, which provides the sugar substrates required for glycosylation reactions, was found to be induced during HCMV infection. Pyrimidine biosynthetic inhibition also attenuated the glycosylation of the envelope glycoprotein B (gB). Both glycosylation of gB and viral growth were restored by medium supplementation with either UDP–sugar metabolites or pyrimidine precursors. These results indicate that HCMV drives de novo-synthesized pyrimidines to UDP–sugar biosynthesis to support virion protein glycosylation. The importance of this link between pyrimidine biosynthesis and UDP–sugars appears to be partially shared among diverse virus families, because UDP–sugar metabolites rescued the growth attenuation associated with pyrimidine biosynthetic inhibition during influenza A and vesicular stomatitis virus infection, but not murine hepatitis virus infection. In total, our results indicate that viruses can specifically modulate pyrimidine metabolic flux to provide the glycosyl subunits required for protein glycosylation and production of high titers of infectious progeny. PMID:25472841

  3. The UL97 protein kinase of human cytomegalovirus and homologues in other herpesviruses: impact on virus and host.

    PubMed

    Michel, Detlef; Mertens, Thomas

    2004-03-11

    The human herpesviruses, herpes simplex virus 1 (HSV-1), HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpesvirus 6A (HHV-6A), HHV-6B, HHV-7 and HHV-8, establish persistent infections with possible recurrence during immunosuppression. HCMV replication is inhibited by the nucleoside analogue ganciclovir (GCV), the compound of choice for the treatment of HCMV diseases and preemptive treatment of infections. The viral UL97 protein (pUL97) which shares homologies with protein kinases and bacterial phosphotransferases is able to monophosphorylate GCV. Homologues of pUL97 are found in HSV (UL13), VZV (ORF47), EBV (BGLF4), HHV-6 (U69), HHV-8 (ORF36) as well as in murine CMV (M97) or rat CMV (R97). Several indolocarbazoles have been reported to be specific inhibitors of pUL97. The protein is important for efficient replication of the virus. Autophosphorylation of pUL97 was observed using different experimental systems. Most recently, it has been shown that pUL97 interacts with the DNA polymerase processivity factor pUL44. Indolocarbazole protein kinase inhibitors are promising lead compounds for the development of more specific inhibitors of HCMV. PMID:15023359

  4. [Target Molecule for a Demyelinating Type of Guillain-Barré Syndrome, Acute Inflammatory Demyelinating Polyneuropathy].

    PubMed

    Mori, Masahiro

    2015-11-01

    Guillain-Barré syndrome is classified into demyelinating type, acute inflammatory demyelinating polyneuropathy (AIDP) and axonal form, acute axonal motor neuropathy (AMAN). It has been clearly established that the target molecule for the former is a ganglioside. In contrast, despite years of effort, the target molecule for the latter has not been identified. Recently, molecules around the nodes of Ranvier have entered the spotlight, and "moesin" was reported to be a target molecule for cytomegalovirus associated-AIDP.

  5. Expression of infectious woodchuck hepatitis virus in murine and avian fibroblasts.

    PubMed Central

    Seeger, C; Baldwin, B; Tennant, B C

    1989-01-01

    The liver is the primary site for replication of the hepadnavirus genome. We asked whether the posttranscriptional phase of the viral replication cycle would depend on hepatocyte-specific functions. For this purpose, we assayed a previously constructed chimera between sequences of the cytomegalovirus immediate-early promoter-enhancer region and woodchuck hepatitis virus (WHV) (C. Seeger and J. Maragos, J. Virol. 63:1907-1915, 1989) for its ability to direct the synthesis of infectious WHV in hepatoma cells and in murine and avian fibroblast cells. Viruslike particles containing WHV DNA were produced transiently in transfected hepatoma cells and in fibroblasts. Inoculation of woodchucks with culture medium from hepatoma cells or fibroblasts transfected with viral DNA led to productive WHV infection, as observed following infection of woodchucks with serum from WHV-infected animals. These results demonstrate that posttranscriptional events of the hepadnavirus replication cycle are not dependent on hepatocyte-specific functions. Images PMID:2795716

  6. Autoimmunity induced by human cytomegalovirus in patients with systemic lupus erythematosus

    PubMed Central

    2012-01-01

    Human cytomegalovirus is a common herpesvirus that is linked to autoimmunity, especially in genetically predisposed persons. The article by Hsieh and colleagues in a previous issue of Arthritis Research & Therapy suggests that a C-terminal peptide of the human cytomegalovirus protein pp65 is highly immunogenic in patients with systemic lupus erythematosus and that antibodies against this peptide cross-react with nuclear proteins and double-stranded DNA, which are highly frequent autoantibodies in systemic lupus erythematosus patients. These observations highlight the fact that immunization with one small cytomegalovirus-specific peptide results in multiple autoreactive antibodies, probably through molecular mimicry and epitope spreading, in genetically predisposed persons. PMID:22277352

  7. Human cytomegalovirus and transplantation: drug development and regulatory issues.

    PubMed

    McIntosh, Megan; Hauschild, Benjamin; Miller, Veronica

    2016-01-01

    Cytomegalovirus (CMV) infection is highly prevalent worldwide and can cause serious disease among immunocompromised individuals, including persons with HIV and transplant recipients on immunosuppressive therapies. It can also result in congenital cytomegalovirus when women are infected during pregnancy. Treatment and prevention of CMV in solid organ and haematopoietic stem cell transplant recipients is accomplished in one of three ways: (1) prophylactic therapy to prevent CMV viraemia; (2) pre-emptive therapy for those with low levels of replicating virus; and (3) treatment for established disease. Despite the high prevalence of CMV, there are few available approved drug therapies, and those that are available are hampered by toxicity and less-than-optimal efficacy. New therapies are being developed and tested; however, inconsistency in standardisation of virus levels and questions about potential endpoints in clinical trials present regulatory hurdles that must be addressed. This review covers the current state of CMV therapy, drugs currently under investigation, and clinical trial issues and questions that are in need of resolution. PMID:27482453

  8. Identification of the major capsid protein gene of human cytomegalovirus.

    PubMed Central

    Chee, M; Rudolph, S A; Plachter, B; Barrell, B; Jahn, G

    1989-01-01

    The coding region for the major capsid protein (MCP) of human cytomegalovirus (HCMV) was identified by comparing the protein sequence with the respective sequences of herpes simplex virus (HSV), Epstein-Barr virus, and varicella-zoster virus. The predicted length of the HCMV MCP was 1,370 amino acids. Comparison of the MCP sequences of the different human herpesviruses showed a homology of 25% to the MCP of HSV type 1, a homology of 29% to the MCP of Epstein-Barr virus, and a homology of 23% to the MCP of varicella-zoster virus. A subfragment of the HSV type 1 KpnI i fragment encoding the MCP VP5 cross-hybridized with the HCMV HindIII U fragment containing part of the MCP gene. Northern (RNA) blot analyses with subclones out of the coding region for the HCMV MCP detected one large transcript of about 8 kilobases. A portion of the open reading frame was expressed in Escherichia coli plasmid pBD2 IC2OH as a beta-galactosidase fusion protein and was used to generate polyclonal antibodies in New Zealand White rabbits. The obtained antisera reacted in Western immunoblots with the MCP of purified HCMV virions. A monoclonal antibody against the human MCP and a monospecific rabbit antiserum against strain Colburn of simian cytomegalovirus detected the fusion protein as well as the MCP of purified virions in immunoblots. Images PMID:2536837

  9. The granzyme B inhibitor SERPINB9 (protease inhibitor 9) circulates in blood and increases on primary cytomegalovirus infection after renal transplantation.

    PubMed

    Rowshani, Ajda T; Strik, Merel C M; Molenaar, Rosalie; Yong, Si-La; Wolbink, Angela M; Bemelman, Frederike J; Hack, C Erik; Ten Berge, Ineke J M

    2005-12-01

    SERPINB9 is the only known human intracellular inhibitor of granzyme B (GrB), the effector molecule in immunity against cytomegalovirus (CMV) and in renal allograft rejection. Therefore, using specific enzyme-linked immunosorbent assays, we addressed the presence of circulating SERPINB9 during primary CMV infection, subclinical rejection, acute rejection, and uncomplicated posttransplantation course. Soluble (s) SERPINB9 circulates in blood and increases on primary CMV infection. This increase was significantly higher in symptomatic than in asymptomatic patients. In contrast, sSERPINB9 levels did not change in response to subclinical or acute rejection. We demonstrated the presence of circulating sSERPINB9/sGrB complexes, which suggests that SERPINB9 has extracellular functions as well.

  10. Human cytomegalovirus induced pseudotumor of upper gastrointestinal tract mucosa: effects of long-term chronic disease?

    PubMed

    Reggiani Bonetti, Luca; Barresi, Valeria; Bertani, Angela; Maccio, Livia; Palmiere, Cristian

    2015-06-01

    Human cytomegalovirus-induced lesions resembling malignancies have been described in the gastrointestinal tract and include ulcerated or exophytic large masses. The aim of this study was to review the cases registered in the databases of two academic hospitals and formulate a hypothesis concerning the pathogenic mechanisms responsible for cytomegalovirus-induced pseudotumor development. All the diagnoses of human cytomegalovirus infections of the upper gastrointestinal tract recorded from 1991 to 2013 were reviewed. Cases of mucosal alterations misdiagnosed endoscopically as malignancies were selected. Large ulcers occurring in the stomach (three cases) and an irregular exophytic mass at the gastro-jejunal anastomosis were misdiagnosed endoscopically as malignancies (4 cases out of 53). Histologically, all lesions reflected hyperplastic mucosal changes with a prevalence of epithelial and stroma infected cells, without signs of cell atypia. The hypothesis presented is that the development of human cytomegalovirus-induced pseudotumors may be the morphological expression of chronic mucosa damage underlying long-term infection.

  11. [Clostridium difficile and cytomegalovirus involved in a case of pseudomembranous colitis].

    PubMed

    García, Coralith; Velarde, Juan; Cedron, Hugo; Ferrufino, Juan Carlos; Seas, Carlos; Bussalleu, Alejandro; Gotuzzo, E; Gotuzzo, Eduardo

    2007-01-01

    We report an unusual case of pseudomembranous colitis with fatal outcome where C. difficile and cytomegalovirus coexistense in a Peruvian patient with AIDS and gastrointestinal compromise by a mycobacterium.

  12. Cytomegalovirus Antibody in Cerebrospinal Fluid of Schizophrenic Patients Detected by Enzyme Immunoassay

    NASA Astrophysics Data System (ADS)

    Fuller Torrey, E.; Yolken, Robert H.; Winfrey, C. Jack

    1982-05-01

    By means of enzyme immunoassay techniques to detect the presence of antibody to cytomegalovirus, the cerebrospinal fluid of 178 patients with schizophrenia, 17 patients with bipolar disorders, and 11 other psychiatric patients was compared with that of 79 neurological patients and 41 normal control subjects. The cerebrospinal fluid of 20 of the schizophrenic patients and 3 of the patients with bipolar disorders showed significant increases in immunoglobulin M antibody to cytomegalovirus; no difference was found in patients on or off psychotropic medications.

  13. [Complications of systemic cytomegalovirus infection in therapy-resistant Hodgkin's lymphoma].

    PubMed

    Irsai, Gábor; Tampu-Kiss, Tatjana; Dezső, Balázs; Miltényi, Zsófia; Illés, Arpád; Méhes, Gábor

    2012-05-13

    Cytomegalovirus infection related changes frequently remain masked by local symptoms of tumor invasion or therapeutic side effects in cancer patients. The spectrum of cytomegalovirus manifestations, however, can be highly varied and may contribute to the failure of different organs with fatal outcome. The case of a 29-year-old female patient is presented who obtained polychemotherapy and allogenic stem cell transplantation following the diagnosis of classical Hodgkin's disease. Despite intensified treatment, only partial response could be achieved and the outcome of the disease was death. Postmortem examination revealed regressive lymph node infiltration as well as nodular liver and spleen manifestations of classical Hodgkin's disease. In addition, parenchymal tissues (lung, kidneys, small intestine, liver, pancreas and ovaries) showed the classical morphology of widespread cytomegalovirus infection. Bilateral enlargement of the ovaries was caused by a partially necrotic giant cell proliferation in the subepithelial cortex. CD30-negativity and cytomegalovirus antigen positivity of the large atypical cell infiltrate supported the diagnosis of cytomegalia oophoritis with morphological overlap between cytomegalovirus-infected giant cells and residual Hodgkin-Reed-Sternberg cells. Further to the cytopathic effect in multiple organs, significant hemophagocytosis was also observed in the spleen, liver and bone marrow. In summary, active cytomegalovirus infection may be a major cause of multi-organ failure in the immunosuppressed oncohematological patient. Careful postmortem analysis demonstrated both the activity of the viral infection and the efficacy of the anti-viral treatment, when applied.

  14. Human antibody technology and the development of antibodies against cytomegalovirus.

    PubMed

    Ohlin, Mats; Söderberg-Nauclér, Cecilia

    2015-10-01

    Cytomegalovirus (CMV) is a virus that causes chronic infections in a large set of the population. It may cause severe disease in immunocompromised individuals, is linked to immunosenescence and implied to play an important role in the pathogenesis of cardiovascular diseases and cancer. Modulation of the immune system's abilities to manage the virus represent a highly viable therapeutic option and passive immunotherapy with polyclonal antibody preparations is already in clinical use. Defined monoclonal antibodies offer many advantages over polyclonal antibodies purified from serum. Human CMV-specific monoclonal antibodies have consequently been thoroughly investigated with respect to their potential in the treatment of diseases caused by CMV. Recent advances in human antibody technology have substantially expanded the breadth of antibodies for such applications. This review summarizes the fundamental basis for treating CMV disease by use of antibodies, the basic technologies to be used to develop such antibodies, and relevant human antibody specificities available to target this virus.

  15. Properties and mechanisms of immunoglobulins for congenital cytomegalovirus disease.

    PubMed

    Parruti, Giustino; Polilli, Ennio; Ursini, Tamara; Tontodonati, Monica

    2013-12-01

    Immunoglobulins are one major component of adaptive immunity to external and resident microorganisms, evolving very early in phylogenesis. They help eukaryotes in controlling infections, mainly through their neutralizing activity, which quenches both the cytopathic and inflammatory potential of invading microorganisms. Cytomegalovirus (CMV)-related disease is generally blunted in seropositive subjects with conserved specific humoral responses. CMV-seropositive pregnant women, in accordance with such evidence, suffer little or no fetal damage when reexposed to CMV. Several seminal experiences and early experimental models confirmed that repeated infusions of immunoglobulins, either with hyperimmune or standard preparations, may help to reduce maternal-fetal CMV transmission, as well as to quench fetal disease upon transmission. This review focused on experimental evidence supporting the potential role of immunoglobulins as a tool to control fetal CMV-related disease in pregnant women.

  16. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  17. Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina

    PubMed Central

    Distéfano, Angélica Lidia; Alonso, Alicia; Martin, Fabián; Pardon, Fabián

    2004-01-01

    Background Human cytomegalovirus (CMV) is one of the most commonly found agents of congenital infections. Primary maternal infection is associated with risk of symptomatic congenital diseases, and high morbidity is frequently associated with very low birth weight. Neonates with asymptomatic infection develop various sequelae during infancy. This is the first Argentine study performed in neonates with congenital and postnatal HCMV infection. The purpose of this study was to evaluate the performance of the polymerase chain reaction (PCR) technique with different pairs of primers, to detect cytomegalovirus isolated in tissue cultures and directly in urine and dried blood spot (DBS) specimens. Results were compared with IgM detection. Methods The study was performed between 1999 and 2001 on routine samples in the Laboratory. A total of 61 urine and 56 serum samples were selected from 61 newborns/infants, 33 patients whose samples were analyzed during the first two to three weeks of life were considered congenital infections; the remaining 28 patients whose samples were taken later than the third week were grouped as perinatal infections, although only in 4 the perinatal transmission of infection was determined unequivocally Cytomegalovirus diagnosis was made by isolating the virus from urine samples in human foreskin fibroblast cells. Three different primer pairs directed to IE, LA and gB genes were used for the HCMV PCR assay in viral isolates. Subsequently, PCR and nested PCR (nPCR) assays with gB primers were performed directly in urine and in 11 samples of dried blood spot (DBS) on Guthrie Card, these results were then compared with serology. Results The main clinical manifestations of the 33 patients with congenital infection were purpura, jaundice, hepatomegaly and anaemia. Three patients presented low birth weight as single symptom, 10, intracranial calcifications, and 2, kidney failure. In the 28 patients grouped as with perinatal infection, anaemia

  18. [Fetal cytomegalovirus infection diagnosed on autopsy: a case report].

    PubMed

    Zribi, Malek; Makni, Salwa; Abid, Najla; Mnif, Hela; Ayedi, Lobna; Boudaouara, Tahia

    2013-10-01

    The cytomegalovirus (CMV) is the most common maternal-fetal transmission infectious disease. The diagnosis of this infection is rarely made on antenatal sonographic signs. Pathological examination could, in this case, make etiologic diagnosis. We report the case of a terminated pregnancy, at the term of 19 weeks of gestation, occurring in a 31-year-old woman. The sonography found a terminated pregnancy with anamnios. Histological examination of samples of fetal internal organs showed intranuclear inclusions, compatible with CMV infection. The main objective of our work is to emphasize the value of histological examination in the diagnosis of fetal death etiology. Moreover, we will discuss the benefit of antenatal screening of CMV maternal infection.

  19. Knowledge and Awareness of Congenital Cytomegalovirus Among Women

    DOE PAGES

    Jeon, Jiyeon; Victor, Marcia; Adler, Stuart P.; Arwady, Abigail; Demmler, Gail; Fowler, Karen; Goldfarb, Johanna; Keyserling, Harry; Massoudi, Mehran; Richards, Kristin; et al

    2006-01-01

    Bmore » ackground . Congenital cytomegalovirus (CMV) infection is a leading cause of disabilities in children, yet the general public appears to have little awareness of CMV. Methods . Women were surveyed about newborn infections at 7 different geographic locations. Results . Of the 643 women surveyed, 142 ( 22 % ) had heard of congenital CMV. Awareness increased with increasing levels of education ( P < .0001 ). Women who had worked as a healthcare professional had a higher prevalence of awareness of CMV than had other women ( 56 % versus 16 % , P < .0001 ). Women who were aware of CMV were most likely to have heard about it from a healthcare provider ( 54 % ), but most could not correctly identify modes of CMV transmission or prevention. Among common causes of birth defects and childhood illnesses, women's awareness of CMV ranked last. Conclusion . Despite its large public health burden, few women had heard of congenital CMV, and even fewer were aware of prevention strategies.« less

  20. Discovery of Potent, Orally Bioavailable Inhibitors of Human Cytomegalovirus.

    PubMed

    Fader, Lee; Brault, Martine; Desjardins, Jessica; Dansereau, Nathalie; Lamorte, Louie; Tremblay, Sonia; Bilodeau, François; Bordeleau, Josée; Duplessis, Martin; Gorys, Vida; Gillard, James; Gleason, James L; James, Clint; Joly, Marc-André; Kuhn, Cyrille; Llinas-Brunet, Montse; Luo, Laibin; Morency, Louis; Morin, Sébastien; Parisien, Mathieu; Poirier, Maude; Thibeault, Carl; Trinh, Thao; Sturino, Claudio; Srivastava, Sanjay; Yoakim, Christiane; Franti, Michael

    2016-05-12

    A high-throughput screen based on a viral replication assay was used to identify inhibitors of the human cytomegalovirus. Using this approach, hit compound 1 was identified as a 4 μM inhibitor of HCMV that was specific and selective over other herpes viruses. Time of addition studies indicated compound 1 exerted its antiviral effect early in the viral life cycle. Mechanism of action studies also revealed that this series inhibited infection of MRC-5 and ARPE19 cells by free virus and via direct cell-to-cell spread from infected to uninfected cells. Preliminary structure-activity relationships demonstrated that the potency of compound 1 could be improved to a low nanomolar level, but metabolic stability was a key optimization parameter for this series. A strategy focused on minimizing metabolic hydrolysis of the N1-amide led to an alternative scaffold in this series with improved metabolic stability and good pharmacokinetic parameters in rat. PMID:27190604

  1. Cytomegalovirus and HIV: A Dangerous Pas de Deux.

    PubMed

    Gianella, Sara; Letendre, Scott

    2016-10-01

    Human immunodeficiency virus (HIV)-infected adults who take stable antiretroviral therapy (ART) are at risk for early onset of age-related diseases. This is likely due to a complex interaction between traditional risk factors, HIV infection itself, and other factors, such as underlying immune dysfunction and persistent inflammation. HIV disrupts the balance between the host and coinfecting microbes, worsening control of these potential pathogens. For example, HIV-infected adults are more likely than the general population to have subclinical bursts of cytomegalovirus (CMV) replication at mucosal sites. Production of antigens can activate the immune system and stimulate HIV replication, and it could contribute to the pathogenesis of adverse outcomes of aging, like cardiovascular disease and neurocognitive impairment. Further investigation of the relationships between CMV, immune dysfunction, and unsuccessful aging during chronic HIV infection is warranted. PMID:27625433

  2. Human cytomegalovirus: bacterial artificial chromosome (BAC) cloning and genetic manipulation.

    PubMed

    Paredes, Anne M; Yu, Dong

    2012-02-01

    The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  3. Cytomegalovirus and inflammatory bowel disease: Is there a link?

    PubMed Central

    Criscuoli, Valeria; Rizzuto, Maria Rosa; Cottone, Mario

    2006-01-01

    The objective of this report is to give an overall view of the epidemiological, clinical, diagnostic and therapeutic features of Cytomegalovirus (CMV) infection in inflammatory bowel disease (IBD). A review of published reports on this topic was carried out, with particular attention paid to the selection of patients included in studies and the diagnostic methods employed. CMV is frequently associated with IBD. In some cases, CMV infection is associated with a poor outcome but it is not clear which patients are more likely to be affected and in which stage of the disease. The use of anti-viral therapy in IBD is controversial and an empirical study with controls is needed. The natural history of CMV infection related to the development and treatment of IBD has not been clarified but it is important to take it in consideration because of the possibility of viral persistence in the immunocompromised host and viral interaction with the immune system. PMID:16937462

  4. Cytomegalovirus UL103 controls virion and dense body egress.

    PubMed

    Ahlqvist, Jenny; Mocarski, Edward

    2011-05-01

    Human cytomegalovirus UL103 encodes a tegument protein that is conserved across herpesvirus subgroups. Mutant viruses lacking this gene product exhibit dramatically reduced accumulation of cell-free virus progeny and poor cell-to-cell spread. Given that viral proteins and viral DNA accumulate with normal kinetics in cells infected with mutant virus, UL103 appears to function during the late phase of replication, playing a critical role in egress of capsidless dense bodies and virions. Few dense bodies were observed in the extracellular space in mutant virus-infected cells in the presence or absence of the DNA encapsidation inhibitor 2-bromo-5,6-dichloro-1-(β-d-ribofuranosyl)benzimidazole. Upon reversal of encapsidation inhibition, UL103 had a striking impact on accumulation of cell-free virus, but not on accumulation of cell-associated virus. Thus, UL103 plays a novel and important role during maturation, regulating virus particle and dense body egress from infected cells.

  5. Reactivation and shedding of cytomegalovirus in astronauts during spaceflight

    NASA Technical Reports Server (NTRS)

    Mehta, S. K.; Stowe, R. P.; Feiveson, A. H.; Tyring, S. K.; Pierson, D. L.

    2000-01-01

    The reactivation of cytomegalovirus (CMV) in 71 astronauts was investigated, using polymerase chain reaction. A significantly greater (P<.0001) shedding frequency was found in urine samples from astronauts before spaceflight (10.6%) than in urine from the healthy control subject group (1.2%). Two of 4 astronauts studied during spaceflight shed CMV in urine. A significant increase (P<.0001) in CMV antibody titer, compared with baseline values, was also found 10 days before spaceflight. CMV antibody titer was further increased (P<.001) 3 days after landing, compared with 10 days before the mission. Significant increases in stress hormones were also found after landing. These results demonstrate that CMV reactivation occurred in astronauts before spaceflight and indicate that CMV may further reactivate during spaceflight.

  6. Human cytomegalovirus encoded microRNAs: hitting targets.

    PubMed

    Ng, Kiat Rui; Li, Jordan Y Z; Gleadle, Jonathan M

    2015-01-01

    Human cytomegalovirus (HCMV) infection is of particular concern in immunodeficient individuals notably transplant recipients, leading to increased morbidity and mortality. HCMV is predicted to encode multiple microRNAs (miRNAs) and several have been characterized in vitro. Furthermore, these miRNAs have been shown to target human and viral mRNAs. Pathways involved in human cellular targets have key roles in vesicle trafficking, immune evasion and cell cycle control. This demonstration of viral miRNA targets provides novel insights into viral pathogenesis. This review details the evidence for the existence of HCMV-encoded miRNA and their targets. HCMV miRNA in blood and other tissues is a potential diagnostic tool and blocking the effects of specific HCMV-encoded miRNA with sequence specific antagomirs is a potential new therapy.

  7. The interaction between cytomegalovirus and the human immune system.

    PubMed

    ten Berge, Ineke J M; van Lier, René A W

    2014-12-01

    Studies on antiviral immunity in man are hampered by the impossibility to standardize the infection as is done in experimental animal studies. An exception is the occurrence of cytomegalovirus infection transmitted by a donor organ into a transplant-recipient, where the time-point of infection is exactly known. Moreover, its strong interaction with the human immune system during evolution and the strong immunogenic properties of this persistent virus, as well as the need for intervention e.g. by vaccine development, all make studies towards the immune response against just this virus very attractive and relevant. In this work, we will present an overview of the studies on this topic that were performed in the departments of Experimental and Clinical Immunology in the AMC and Sanquin in Amsterdam.

  8. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  9. [Massive alveolar hemorrhage due to cytomegalovirus (CMV) and HIV infection].

    PubMed

    Cortés, A; Peña, E; Vega, R; Reyes, G; Bautista, E

    2011-03-01

    Alveolar hemorrhage may be a complication of diseases with local and systemic manifestations. Both share the same pathophysiological concept: damage to the alveolar microcirculation. It is a clinical entity that generates a diagnostic challenge for the physician. Early recognition favors aggressive treatment, which can improve the outcome. Despite the technological advances in its diagnosis and treatment, it is still a condition having high morbidity and mortality. We present the case of a 42-year old woman diagnosed of massive alveolar hemorrhage induced by cytomegalovirus (CMV) and HIV infection. Its presentation is atypical because most reported cases have occurred as a pneumonic process, episodes of massive hemorrhage being uncommon. The diagnosis was documented by bronchoscopy with bronchoalveolar lavage and etiological diagnosis with molecular techniques using reverse transcription polymerase chain reaction.

  10. Cytomegalovirus may mimic the presentation of intrahepatic cholestasis and hemolysis, elevated liver enzymes and low platelets in immunosuppressed pregnant women.

    PubMed

    Wander, Gurleen; Neuberger, Francesa; Dhanjal, Mandish K; Nelson-Piercy, Catherine; Soh, May Ching

    2016-09-01

    Most published cases of cytomegalovirus infection in pregnancy relate to congenital abnormalities in neonates infected in early pregnancy, while the mother remains asymptomatic. We describe a diagnostically challenging case of an immunosuppressed woman with scleroderma who developed deranged liver function tests attributed to intrahepatic cholestasis of pregnancy and haemolysis, elevated liver enzymes and low platelets syndrome but was ultimately found to have disseminated cytomegalovirus. Cytomegalovirus can present in a myriad of ways. Clinicians caring for immunocompromised pregnant women should consider cytomegalovirus as a possible differential diagnosis when reviewing abnormal liver function tests. PMID:27630751

  11. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation

    PubMed Central

    Reddehase, Matthias J.

    2016-01-01

    Hematopoietic cell transplantation (HCT) is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a “window of opportunity” for latent Cytomegalovirus (CMV) by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A “window of opportunity” for the virus represents a “window of risk” for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8+ T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP) representing the most severe clinical manifestation. Here, I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a preemptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing “proof of concept” for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8+ T cells bridging the critical interim. However, CMV is not a “passive antigen” but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow (BM) stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected BM stroma and impaired colony growth and lineage differentiation can lead to “graft failure.” In consequence, uncontrolled virus spread

  12. Murine norovirus infection does not cause major disruptions in the murine intestinal microbiota

    PubMed Central

    2013-01-01

    Background Murine norovirus (MNV) is the most common gastrointestinal pathogen of research mice and can alter research outcomes in biomedical mouse models of inflammatory bowel disease (IBD). Despite indications that an altered microbiota is a risk factor for IBD, the response of the murine intestinal microbiota to MNV infection has not been examined. Microbiota disruption caused by MNV infection could introduce the confounding effects observed in research experiments. Therefore, this study investigated the effects of MNV infection on the intestinal microbiota of wild-type mice. Results The composition of the intestinal microbiota was assessed over time in both outbred Swiss Webster and inbred C57BL/6 mice following MNV infection. Mice were infected with both persistent and non-persistent MNV strains and tissue-associated or fecal-associated microbiota was analyzed by 16S rRNA-encoding gene pyrosequencing. Analysis of intestinal bacterial communities in infected mice at the phylum and family level showed no major differences to uninfected controls, both in tissue-associated samples and feces, and also over time following infection, demonstrating that the intestinal microbiota of wild-type mice is highly resistant to disruption following MNV infection. Conclusions This is the first study to describe the intestinal microbiota following MNV infection and demonstrates that acute or persistent MNV infection is not associated with major disruptions of microbial communities in Swiss Webster and C57BL/6 mice. PMID:24451302

  13. Direct interaction of the mouse cytomegalovirus m152/gp40 immunoevasin with RAE-1 isoforms.

    PubMed

    Zhi, Li; Mans, Janet; Paskow, Michael J; Brown, Patrick H; Schuck, Peter; Jonjić, Stipan; Natarajan, Kannan; Margulies, David H

    2010-03-23

    Cytomegaloviruses (CMVs) are ubiquitous species-specific viruses that establish acute, persistent, and latent infections. Both human and mouse CMVs encode proteins that inhibit the activation of natural killer (NK) cells by downregulating cellular ligands for the NK cell activating receptor, NKG2D. The MCMV glycoprotein m152/gp40 downregulates the surface expression of RAE-1 to prevent NK cell control in vivo. So far, it is unclear if there is a direct interaction between m152 and RAE-1 and, if so, if m152 interacts differentially with the five identified RAE-1 isoforms, which are expressed as two groups in MCMV-susceptible or -resistant mouse strains. To address these questions, we expressed and purified the extracellular domains of RAE-1 and m152 and performed size exclusion chromatography binding assays as well as analytical ultracentrifugation and isothermal titration calorimetry to characterize these interactions quantitatively. We further evaluated the role of full-length and naturally glycosylated m152 and RAE-1 in cotransfected HEK293T cells. Our results confirmed that m152 binds RAE-1 directly, relatively tightly (K(d) < 5 microM), and with 1:1 stoichiometry. The binding is quantitatively different depending on particular RAE-1 isoforms, corresponding to the susceptibility to downregulation by m152. A PLWY motif found in RAE-1beta, although contributing to its affinity for m152, does not influence the affinity of RAE-1gamma or RAE-1delta, suggesting that other differences contribute to the RAE-1-m152 interaction. Molecular modeling of the different RAE-1 isoforms suggests a potential site for the m152 interaction.

  14. Effectiveness of PCR and Immunofluorescence Techniques for Detecting Human Cytomegalovirus in Blood and Bronchoalveolar Lavage Fluid.

    PubMed

    Roży, A; Duk, K; Szumna, B; Skrońska, P; Gawryluk, D; Chorostowska-Wynimko, J

    2016-01-01

    Current diagnostic methods allow a rapid and reliable detection of active human cytomegalovirus (hCMV) infection by identifying the presence of pp65 CMV antigen or CMV DNA in peripheral blood and affected organs. The goal of this study was to evaluate the effectiveness of CMV detection in blood and organ-specific biological material, such as bronchoalveolar lavage fluid (BALF), by comparing two standard diagnostic methods, immunofluorescence (IF) and the real-time polymerase chain reaction (PCR). We evaluated 25 patients with concomitant respiratory disease who were referred to our hospital for diagnosis due to suspected acute CMV infection. The presence of hCMV was concomitantly evaluated by IF and PCR in 16 peripheral blood samples. In two patients, we observed positive results for both IF and PCR, and in two other patients the results were discordant. Of 11 patients, CMV DNA was detected in six BALF samples, and in one blood plasma sample. Real-time PCR detected CMV DNA in 54.6 % of BALF samples and 12.0 % of blood samples, while indirect IF testing confirmed antigenemia in 12.5 % of blood samples. The results from our study suggest that the IF method is as effective as PCR for detecting an ongoing CMV infection in blood samples. However, real-time PCR was much more effective at detecting CMV DNA in BALF compared to blood samples. Our results suggest that the biological material being tested during CMV diagnosis should be derived directly from the virally infected organ(s).

  15. Cytomegalovirus prevention strategies in seropositive kidney transplant recipients: an insight into current clinical practice.

    PubMed

    Fernández-Ruiz, Mario; Arias, Manuel; Campistol, Josep M; Navarro, David; Gómez-Huertas, Ernesto; Gómez-Márquez, Gonzalo; Díaz, Juan Manuel; Hernández, Domingo; Bernal-Blanco, Gabriel; Cofan, Frederic; Jimeno, Luisa; Franco-Esteve, Antonio; González, Esther; Moreso, Francesc J; Gómez-Alamillo, Carlos; Mendiluce, Alicia; Luna-Huerta, Enrique; Aguado, José María

    2015-09-01

    There is notable heterogeneity in the implementation of cytomegalovirus (CMV) prevention practices among CMV-seropositive (R+) kidney transplant (KT) recipients. In this prospective observational study, we included 387 CMV R+ KT recipients from 25 Spanish centers. Prevention strategies (antiviral prophylaxis or preemptive therapy) were applied according to institutional protocols at each site. The impact on the 12-month incidence of CMV disease was assessed by Cox regression. Asymptomatic CMV infection, acute rejection, graft function, non-CMV infection, graft loss, and all-cause mortality were also analyzed (secondary outcomes). Models were adjusted for a propensity score (PS) analysis for receiving antiviral prophylaxis. Overall, 190 patients (49.1%) received preemptive therapy, 185 (47.8%) antiviral prophylaxis, and 12 (3.1%) no specific intervention. Twelve-month cumulative incidences of CMV disease and asymptomatic infection were 3.6% and 39.3%, respectively. Patients on prophylaxis had lower incidence of CMV disease [PS-adjusted HR (aHR): 0.10; 95% confidence interval (CI): 0.01-0.79] and asymptomatic infection (aHR: 0.46; 95% CI: 0.29-0.72) than those managed preemptively, with no significant differences according to the duration of prophylaxis. All cases of CMV disease in the prophylaxis group occurred after prophylaxis discontinuation. There were no differences in any of the secondary outcomes. In conclusion, antiviral prophylaxis was associated with a lower occurrence of CMV disease in CMV R+ KT recipients, although such benefit should be balanced with the risk of late-onset disease.

  16. Development of a quantitative real-time RT-PCR for kinetic analysis of immediate-early transcripts of rat cytomegalovirus.

    PubMed

    Loh, H S; Mohd-Azmi, M L

    2009-01-01

    One-step real-time RT-PCR assay was developed for quantification of the immediate-early (IE), namely IE1 and IE2 transcripts of Rat cytomegalovirus (RCMV), strain ALL-03 in rat embryonic fibroblast cells (REF). This in-house SYBR Green I based RT-PCR was shown to have higher amplification efficiency and detection limit as compared to a commercially available real-time RT-PCR kit in quantifying these two transcripts. The quantification histogram revealed the divergence of transcription activities of the two IE genes. The IE1 transcript had a concentration peak at 7 hrs post infection (p.i.), whereas IE2 transcript at 20 hrs p.i. Regulation of IE expression is critical for determination, whether the infection is going to be abortive, lytic or latent. Therefore, this in-house developed quantitative RT-PCR assay offers an alternative for diagnosis and monitoring of the acute cytomegalovirus (CMV) infection directed at IE transcript detection.

  17. Vaccine Therapy in Preventing Cytomegalovirus Infection in Patients With Hematological Malignancies Undergoing Donor Stem Cell Transplant

    ClinicalTrials.gov

    2016-05-27

    Accelerated Phase Chronic Myelogenous Leukemia; Adult Acute Lymphoblastic Leukemia in Remission; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Acute Promyelocytic Leukemia (M3); Adult Nasal Type Extranodal NK/T-cell Lymphoma; Adult Nodular Lymphocyte Predominant Hodgkin Lymphoma; Anaplastic Large Cell Lymphoma; B-cell Adult Acute Lymphoblastic Leukemia; Chronic Eosinophilic Leukemia; Chronic Myelomonocytic Leukemia; Chronic Phase Chronic Myelogenous Leukemia; Contiguous Stage II Adult Burkitt Lymphoma; Contiguous Stage II Adult Diffuse Large Cell Lymphoma; Contiguous Stage II Adult Lymphoblastic Lymphoma; Contiguous Stage II Grade 1 Follicular Lymphoma; Contiguous Stage II Grade 2 Follicular Lymphoma; Contiguous Stage II Grade 3 Follicular Lymphoma; Contiguous Stage II Mantle Cell Lymphoma; Contiguous Stage II Small Lymphocytic Lymphoma; Cytomegalovirus Infection; de Novo Myelodysplastic Syndromes; Essential Thrombocythemia; Extramedullary Plasmacytoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Isolated Plasmacytoma of Bone; Monoclonal Gammopathy of Undetermined Significance; Nodal Marginal Zone B-cell Lymphoma; Noncontiguous Stage II Adult Burkitt Lymphoma; Noncontiguous Stage II Adult Diffuse Large Cell Lymphoma; Noncontiguous Stage II Adult Lymphoblastic Lymphoma; Noncontiguous Stage II Grade 1 Follicular Lymphoma; Noncontiguous Stage II Grade 2 Follicular Lymphoma; Noncontiguous Stage II Grade 3 Follicular Lymphoma; Noncontiguous Stage II Mantle Cell Lymphoma; Noncontiguous Stage II Small Lymphocytic Lymphoma; Peripheral T-cell Lymphoma; Polycythemia Vera; Post-transplant Lymphoproliferative Disorder; Previously

  18. Macrophage specific delivery of TNF-α siRNA complexed with β-1,3-glucan inhibits LPS-induced cytokine production in a murine acute hepatitis model.

    PubMed

    Mochizuki, Shinichi; Morishita, Hiromi; Sakurai, Kazuo

    2013-05-01

    RNA interference therapy utilizes physiological gene silencing that is originally found as a defense function against foreign RNAs. To silence the target gene, short double stranded RNA has to be delivered to cytosol. However, lack of a suitable delivering carrier is the major obstacle to practical usage. In this study, we present a novel complex consisting of β-1,3-glucan and short interference RNA (siRNA) as a solution for the problem. We used a β-1,3-glucan schizophyllan (SPG) and a siRNA (dA-siTNFα) that is designed to suppress tumor necrosis factor alpha (TNF-α), where the sense strand of siRNA has (dA(40)) tail to induce complexation with SPG. The dA-siTNFα/SPG complex showed higher affinity to recombinant dectin-1 than SPG itself, where dectin-1 is a β-1,3-glucan receptor expressed on antigen presenting cells and can be a target for specific delivery. The complex suppressed lipopolysaccharide (LPS)-induced TNF-α secretion by peritoneal macrophages in vitro. When the complex was intravenously injected, the oligonucleotide accumulated in liver; especially distributed into Kupffer cells. The complex significantly decreased the serum TNF-α level for the mouse model of LPS-induced acute hepatitis. This new siRNA delivery system may overcome the problem for RNA interference therapy because of its non-toxicity and high target specificity. PMID:23523387

  19. Infections of neonatal and adult mice with murine CMV HaNa1 strain upon oronasal inoculation: New insights in the pathogenesis of natural primary CMV infections.

    PubMed

    Xiang, Jun; Zhang, Shunchuan; Nauwynck, Hans

    2016-01-01

    In healthy individuals, naturally acquired infections of human cytomegalovirus (HCMV) are generally asymptomatic. Animal models mimicking the natural primary HCMV infections in infants and adults are scarce. Here, neonatal and adult BALB/c mice were inoculated oronasally with a Belgian isolate HaNa1 of murine cytomegalovirus (MCMV). None of the mice showed clinical symptoms. In neonatal mice, a typical systemic infection occurred. In adult mice, viral replication was restricted to the nasal mucosa and submandibular glands. Infectious virus was not detected in trachea, oral mucosa, pharynx, esophagus, small intestines of both neonatal and adult mice at all time points. Nose was demonstrated to be the entry site. Double immunofluorescence staining showed that in nose infected cells were olfactory neurons and sustentacular cells in olfactory epithelium and were macrophages and dendritic cells in nasopharynx-associated lymphoid tissues (NALT). Neonatal and adult mice developed similar antibody response pattern, though former magnitude was lower. In summary, we have established intranasal (without anesthesia) infections of neonatal and adult mice with murine CMV HaNa1 strain, which mimic the range and extent of virus replication during natural primary HCMV infections in healthy infants and adults. These findings might bring new insights in the pathogenesis of natural primary CMV infections. PMID:26474525

  20. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  1. Systematic Evaluation of Different Nucleic Acid Amplification Assays for Cytomegalovirus Detection: Feasibility of Blood Donor Screening.

    PubMed

    Vollmer, T; Knabbe, C; Dreier, J

    2015-10-01

    Acute primary cytomegalovirus (CMV) infections, which commonly occur asymptomatically among blood donors, represent a significant risk for serious morbidity in immunocompromised patients (a major group of transfusion recipients). We implemented a routine CMV pool screening procedure for plasma for the identification of CMV DNA-positive donors, and we evaluated the sensitivities and performance of different CMV DNA amplification systems. Minipools (MPs) of samples from 18,405 individual donors (54,451 donations) were screened for CMV DNA using the RealStar CMV PCR assay (Altona Diagnostic Technologies), with a minimum detection limit of 11.14 IU/ml. DNA was extracted with a high-volume protocol (4.8 ml, Chemagic Viral 5K kit; PerkinElmer) for blood donor pool screening (MP-nucleic acid testing [NAT]) and with the Nuclisens easyMAG system (0.5 ml; bioMérieux) for individual donation (ID)-NAT. In total, six CMV DNA-positive donors (0.03%) were identified by routine CMV screening, with DNA concentrations ranging from 4.35 × 10(2) to 4.30 × 10(3) IU/ml. Five donors already showed seroconversion and detectable IgA, IgM, and/or IgG antibody titers (IgA(+)/IgM(+)/IgG(-) or IgA(+)/IgM(+)/IgG(+)), and one donor showed no CMV-specific antibodies. Comparison of three commercial assays, i.e., the RealStar CMV PCR kit, the Sentosa SA CMV quantitative PCR kit (Vela Diagnostics), and the CMV R-gene PCR kit (bioMérieux), for MP-NAT and ID-NAT showed comparably good analytical sensitivities, ranging from 10.23 to 11.14 IU/ml (MP-NAT) or from 37.66 to 57.94 IU/ml (ID-NAT). The clinical relevance of transfusion-associated CMV infections requires further investigation, and the evaluated methods present powerful basic tools providing sensitive possibilities for viral testing. The application of CMV MP-NAT facilitated the identification of one donor with a window-phase donation during acute primary CMV infection.

  2. Systematic Evaluation of Different Nucleic Acid Amplification Assays for Cytomegalovirus Detection: Feasibility of Blood Donor Screening

    PubMed Central

    Knabbe, C.; Dreier, J.

    2015-01-01

    Acute primary cytomegalovirus (CMV) infections, which commonly occur asymptomatically among blood donors, represent a significant risk for serious morbidity in immunocompromised patients (a major group of transfusion recipients). We implemented a routine CMV pool screening procedure for plasma for the identification of CMV DNA-positive donors, and we evaluated the sensitivities and performance of different CMV DNA amplification systems. Minipools (MPs) of samples from 18,405 individual donors (54,451 donations) were screened for CMV DNA using the RealStar CMV PCR assay (Altona Diagnostic Technologies), with a minimum detection limit of 11.14 IU/ml. DNA was extracted with a high-volume protocol (4.8 ml, Chemagic Viral 5K kit; PerkinElmer) for blood donor pool screening (MP-nucleic acid testing [NAT]) and with the Nuclisens easyMAG system (0.5 ml; bioMérieux) for individual donation (ID)-NAT. In total, six CMV DNA-positive donors (0.03%) were identified by routine CMV screening, with DNA concentrations ranging from 4.35 × 102 to 4.30 × 103 IU/ml. Five donors already showed seroconversion and detectable IgA, IgM, and/or IgG antibody titers (IgA+/IgM+/IgG− or IgA+/IgM+/IgG+), and one donor showed no CMV-specific antibodies. Comparison of three commercial assays, i.e., the RealStar CMV PCR kit, the Sentosa SA CMV quantitative PCR kit (Vela Diagnostics), and the CMV R-gene PCR kit (bioMérieux), for MP-NAT and ID-NAT showed comparably good analytical sensitivities, ranging from 10.23 to 11.14 IU/ml (MP-NAT) or from 37.66 to 57.94 IU/ml (ID-NAT). The clinical relevance of transfusion-associated CMV infections requires further investigation, and the evaluated methods present powerful basic tools providing sensitive possibilities for viral testing. The application of CMV MP-NAT facilitated the identification of one donor with a window-phase donation during acute primary CMV infection. PMID:26202109

  3. Cytomegalovirus and glioblastoma: a review of evidence for their association and indications for testing and treatment.

    PubMed

    Solomon, Isaac H; Ramkissoon, Shakti H; Milner, Danny A; Folkerth, Rebecca D

    2014-11-01

    Glioblastoma is the most common and most fatal primary malignant brain tumor in adults. Despite progress in characterizing the genetic and molecular mechanisms of glioblastomas, advances in treatment that translate into substantial improvement in prognosis have yet to be realized. A role for cytomegalovirus in glioblastoma pathogenesis was proposed more than a decade ago and has generated considerable debate as a possible therapeutic target. Independent groups have had variable success in detecting cytomegalovirus infection in tumor cells; the overall consensus is that very low levels of viral proteins and nucleic acids can be observed. Although cytomegalovirus has not been found to be oncogenic in this context, a possible oncomodulatory role has been suggested. A recent clinical trial evaluating valganciclovir as an adjuvant therapy for the treatment of glioblastoma did not demonstrate a beneficial effect on tumor growth or overall survival, although retrospective analysis subsequently indicted a significant survival benefit. In light of the publicity of that report, patients and neuro-oncologists are requesting cytomegalovirus testing to justify antiviral treatment. Based on questions on the significance of cytomegalovirus infection in glioblastomas and the lack of a clear clinical benefit of valganciclovir, we reviewed this topic and conclude that, at this time, there is insufficient evidence to recommend routine testing and treatment.

  4. Cyclin A Degradation by Primate Cytomegalovirus Protein pUL21a Counters Its Innate Restriction of Virus Replication

    PubMed Central

    Yu, Dong

    2013-01-01

    Cyclin A is critical for cellular DNA synthesis and S phase progression of the cell cycle. Human cytomegalovirus (HCMV) can reduce cyclin A levels and block cellular DNA synthesis, and cyclin A overexpression can repress HCMV replication. This interaction has only been previously observed in HCMV as murine CMV does not downregulate cyclin A, and the responsible viral factor has not been identified. We previously reported that the HCMV protein pUL21a disrupted the anaphase-promoting complex (APC), but a point mutant abrogating this activity did not phenocopy a UL21a-deficient virus, suggesting that pUL21a has an additional function. Here we identified a conserved arginine-x-leucine (RxL) cyclin-binding domain within pUL21a, which allowed pUL21a to interact with cyclin A and target it for proteasome degradation. Homologous pUL21a proteins from both chimpanzee and rhesus CMVs also contained the RxL domain and similarly degraded cyclin A, indicating that this function is conserved in primate CMVs. The RxL point mutation disabled the virus' ability to block cellular DNA synthesis and resulted in a growth defect similar to pUL21a-deficient virus. Importantly, knockdown of cyclin A rescued growth of UL21a-deficient virus. Together, these data show that during evolution, the pUL21a family proteins of primate CMVs have acquired a cyclin-binding domain that targets cyclin A for degradation, thus neutralizing its restriction on virus replication. Finally, the combined proteasome-dependent degradation of pUL21a and its cellular targets suggests that pUL21a may act as a novel suicide protein, targeting its protein cargos for destruction. PMID:24385906

  5. Cystitis - acute

    MedlinePlus

    Uncomplicated urinary tract infection; UTI - acute; Acute bladder infection; Acute bacterial cystitis ... International clinical practice guidelines for the treatment of acute uncomplicated cystitis and pyelonephritis in women: A 2010 ...

  6. Cloning and characterization of a murine SIL gene

    SciTech Connect

    Collazo-Garcia, N.; Scherer, P.; Aplan, P.D.

    1995-12-10

    The human SIL gene is disrupted by a site-specific interstitial deletion in 25% of children with T-cell acute lymphoblastic leukemia. Since transcriptionally active genes are prone to recombination events, the recurrent nature of this lesion suggests that the SIL gene product is transcriptionally active in the cell type that undergoes this interstitial deletion and that the SIL gene product may play a role in normal lymphoid development. To facilitate studies of SIL gene function, we have cloned and characterized a murine SIL gene. The predicted murine SIL protein is 75% identical to the human gene, with good homology throughout the open reading frame. An in vitro translated SIL cDNA generated a protein slightly larger than the predicted 139-kDa protein. Although a prior report detected SIL mRNA expression exclusively in hematopoietic tissues, a sensitive RT-PCR assay demonstrated SIL expression to be ubiquitous, detectable in all tissues examined. Since the RT-PCR assay suggested that SIL mRNA expression was higher in rapidly proliferating tissues, we assayed SIL mRNA expression using a murine erythroleukemia model of terminal differentiation and found it to be dramatically decreased in conjunction with terminal differentiation. These studies demonstrate that the human SIL gene product is quite well conserved in rodents and suggest that the SIL gene product may play a role in cell proliferation. 26 refs., 6 figs.

  7. Improved detection of mutated human cytomegalovirus UL97 by pyrosequencing.

    PubMed

    Schindele, Birgit; Apelt, Luise; Hofmann, Jörg; Nitsche, Andreas; Michel, Detlef; Voigt, Sebastian; Mertens, Thomas; Ehlers, Bernhard

    2010-12-01

    Ganciclovir (GCV) resistance frequently occurs upon prolonged treatment of ongoing active human cytomegalovirus (HCMV) infection in individuals with immature or compromised immune functions (e.g., recipients of solid-organ and hematopoietic stem cell transplants). Using pyrosequencing (PSQ), we established fast and sensitive detection of GCV resistance-associated mutations occurring in the HCMV open reading frame UL97. These mutations have been repeatedly associated with clinical treatment failure. We designed four PSQ assays and evaluated them by analyzing mixtures of plasmids or bacterial artificial chromosome-derived viruses containing UL97 wild-type and mutant sequences. A minimum level of 6% mutant sequence variants could be detected in these mixtures. In order to further evaluate the novel PSQ assays, we tested clinical specimens from patients with active HCMV infections. The results were compared with those obtained by conventional dideoxy chain terminator sequencing. As the PSQ method was more sensitive in detecting minor HCMV mutant fractions in a wild-type population, it is suggested that pyrosequencing is a useful tool for the early detection of emerging GCV-resistant HCMV in GCV-treated patients.

  8. Childhood environments and cytomegalovirus serostatus and reactivation in adults.

    PubMed

    Janicki-Deverts, Denise; Cohen, Sheldon; Doyle, William J; Marsland, Anna L; Bosch, Jos

    2014-08-01

    Childhood adversity, defined in terms of material hardship or physical or emotional maltreatment has been associated with risk for infection with cytomegalovirus (CMV) among children and adolescents, and with CMV reactivation in children and adults. The present study examined whether different dimensions of childhood experience-those pertaining to socioeconomic status (SES), physical environment, or family relationships-relate differentially to CMV serostatus and reactivation during adulthood. Participants were 140 healthy adults, aged 18-55years (41% female; 64% white). Childhood environments were assessed retrospectively and included family SES (parental housing tenure); childhood neighborhood environment (urban residence; physical conditions; safety; and social atmosphere); residential exposures (parental smoking and physical condition of home); and family relationships (parental divorce; warmth; harmony; dysfunction; parental bonding). Approximately 39% (n=53) of participants were CMV+. In individual analyses controlling for age, sex, race, body mass, current adult SES and smoking status, fewer years of parental home ownership, having a parent who smoked, and living in a poorly maintained or unsafe neighborhood each were associated with greater odds of infection with CMV. By comparison, in individual analyses limited to CMV+ participants, less family warmth, less harmony, greater dysfunction, and suboptimal parental bonding each were related to higher antibody levels, independent of the aforementioned covariates. Findings were not attributable to current adult perceptions of psychological stress or relative levels of emotional stability. These results suggest that different types of childhood adversity may be associated with differential effects on CMV infection and latency. PMID:24675032

  9. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  10. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    PubMed

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  11. Cytomegalovirus and Epstein-Barr Virus in Breast Cancer

    PubMed Central

    Richardson, Ann K.; Currie, Margaret J.; Robinson, Bridget A.; Morrin, Helen; Phung, Yen; Pearson, John F.; Anderson, Trevor P.; Potter, John D.; Walker, Logan C.

    2015-01-01

    Findings of polymerase chain reaction (PCR) studies of cytomegalovirus (CMV) and Epstein-Barr virus (EBV) and breast cancer vary, making it difficult to determine whether either, both, or neither virus is causally associated with breast cancer. We investigated CMV and EBV in paired samples of breast cancer and normal breast tissue from 70 women using quantitative PCR. A serum sample from each woman was tested for CMV and EBV IgG. To place our results in context, we reviewed the existing literature and performed a meta-analysis of our results together with previous PCR studies of EBV, CMV, and breast cancer. Of the serology samples, 67 of 70 (96%) were EBV IgG positive and 49 of 70 (70%) were CMV IgG positive. QPCR detected EBV in 24 (34%) of the tumour and 9 (13%) of the paired normal specimens and CMV in 0 (0%) of the tumour and 2 (3%) of the paired normal specimens. Our findings, together with earlier results summarised in the meta-analysis, suggest several possibilities: variable findings may be due to limitations of molecular analyses; ‘hit and run’ oncogenesis may lead to inconsistent results; one or both viruses has a role at a later stage in breast cancer development; infection with multiple viruses increases breast cancer risk; or neither virus has a role. Future studies should focus on ways to investigate these possibilities, and should include comparisons of breast cancer tissue samples with appropriate normal tissue samples. PMID:25723522

  12. Passive Immunization against Congenital Cytomegalovirus Infection: Current State of Knowledge.

    PubMed

    Jückstock, Julia; Rothenburger, Markus; Friese, Klaus; Traunmüller, Friederike

    2015-01-01

    Primary infection with the human cytomegalovirus (CMV) occurs in 1-4% of pregnancies. The rates of maternal-fetal CMV transmissions are around 25, 36, 41, and 66%, for infections occurring in the peri-conceptional weeks, first, second, and third trimester of pregnancy, respectively. On the other hand, the severity of fetal organ damage and dysfunction diminishes with increasing gestational age. Congenitally CMV-infected newborns may have neurosensory impairments like mental retardation, cerebral palsy, epilepsy, progressive hearing loss or visual defects, or even may have a fatal outcome. In in-vitro experiments, CMV specific neutralizing IgG antibodies - which are abundant in CMV specific hyperimmune globulin (HIG) products - inhibited the entry of the virus into target cells and hampered viral cell-to-cell spread. This article provides a brief overview on the epidemiology and diagnostic tools in congenital CMV infection. It also concisely summarizes the currently available study results on the safety and effectiveness of HIG treatment. Accordingly, in clinical studies HIG administration to expectant mothers following primary CMV infection (prophylactic use) was shown to lower the risk of maternal-fetal transmission of CMV compared to untreated controls. HIG was also able to ameliorate the disease sequelae in evidently infected fetuses (therapeutic use), as demonstrated by the regression or even resolution of sonographic pathologies including placental inflammation.

  13. Synthetic DNA approach to cytomegalovirus vaccine/immune therapy.

    PubMed

    Wu, Stephan J; Villarreal, Daniel O; Shedlock, Devon J; Weiner, David B

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60-95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem.

  14. Synthetic DNA Approach to Cytomegalovirus Vaccine/Immune Therapy

    PubMed Central

    Wu, Stephan J.; Villarreal, Daniel O.; Shedlock, Devon J.; Weiner, David B.

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60–95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem. PMID:25757619

  15. The Cell Biology of Cytomegalovirus: Implications for Transplantation.

    PubMed

    Kaminski, H; Fishman, J A

    2016-08-01

    Interpretation of clinical data regarding the impact of cytomegalovirus (CMV) infection on allograft function is complicated by the diversity of viral strains and substantial variability of cellular receptors and viral gene expression in different tissues. Variation also exists in nonspecific (monocytes and dendritic cells) and specific (NK cells, antibodies) responses that augment T cell antiviral activities. Innate immune signaling pathways and expanded pools of memory NK cells and γδ T cells also serve to amplify host responses to infection. The clinical impact of specific memory T cell anti-CMV responses that cross-react with graft antigens and alloantigens is uncertain but appears to contribute to graft injury and to the abrogation of allograft tolerance. These responses are modified by diverse immunosuppressive regimens and by underlying host immune deficits. The impact of CMV infection on the transplant recipient reflects cellular changes and corresponding host responses, the convergence of which has been termed the "indirect effects" of CMV infection. Future studies will clarify interactions between CMV infection and allograft injury and will guide interventions that may enhance clinical outcomes in transplantation.

  16. Human cytomegalovirus (CMV) in Africa: a neglected but important pathogen.

    PubMed

    Bates, Matthew; Brantsaeter, Arne Broch

    2016-01-01

    In Africa, human cytomegalovirus (CMV) is an important pathogen in a diverse range of patient groups. Congenital CMV infection is common, and most children undergo primary infection during the first year of life. Preliminary studies suggest that these early primary CMV infections could have population-wide effects on growth and development. In most studies of adults, CMV seroprevalence is close to 100%, but some studies have found that significant minorities of adults are seronegative. CMV is a common cause of pneumonia and meningitis in hospitalised immunosuppressed patient groups, and CMV DNAemia may be an important marker of rapid progression and poor outcomes of HIV infection, despite roll-out of antiretroviral therapy (ART). Diagnosis and treatment of CMV-related disease is broadly neglected in Africa, and no randomised clinical trials of anti-CMV drugs have been conducted to date. Autopsy is rarely performed in Africa, but identifies CMV as a frequent pathogen when it is carried out. Here we review the available literature on CMV in Africa, primarily in adult patients, and discuss this in the context of contemporary understanding of CMV as a human pathogen. PMID:27482452

  17. Seroprevalence to cytomegalovirus in the Portuguese population, 2002-2003.

    PubMed

    Lopo, S; Vinagre, E; Palminha, P; Paixao, M T; Nogueira, P; Freitas, M G

    2011-01-01

    The prevalence of cytomegalovirus (CMV) infections ranges between 50% and 85% in adults in the United States, and its epidemiology varies in different regions of the world and between socioeconomic and age groups. In Portugal, no study has been carried out to date to determine the prevalence of CMV in the general population. Under the second National Serological Survey conducted in continental Portugal in 2001–2002, we estimated the prevalence of individuals with antibodies to CMV using indirect immunofluorescence to detect virus-specific IgG. The population sample included 2,143 individuals of both sexes and different ages from all 18 districts in Portugal. The national seroprevalence of CMV was determined as 77%. We analysed the proportion of CMV IgG by sex, age group and district of residence. This was the first nationally representative study of seroprevalence of CMV in Portugal. The results of the study indicate that CMV infection is highly prevalent in the population and occurs mainly in the first years of life. PMID:21722611

  18. Synthetic DNA approach to cytomegalovirus vaccine/immune therapy.

    PubMed

    Wu, Stephan J; Villarreal, Daniel O; Shedlock, Devon J; Weiner, David B

    2015-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpes virus that infects 60-95 % of adults worldwide. Infection is a major cause of congenital abnormalities in newborns, contributes to development of childhood cerebral palsy and medulloblastoma, can result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. While CMV has been increasingly associated with numerous inflammatory diseases and cancers, only recently has it been correlated with increased risk of heart disease in adults, the number-one killer in the USA. These data, among others, suggest that subclinical CMV infection, or microinfection, in healthy individuals may play more of a causative role than an epiphenomenon in development of CMV-associated pathologies. Due to the myriad of diseases and complications associated with CMV, an efficacious vaccine would be highly valuable in reducing human morbidity and mortality as well as saving billions of dollars in annual health-care costs and disability adjusted life years (DALY) in the developing world. Therefore, the development of a safe efficacious CMV vaccine or immune therapy is paramount to the public health. This review aims to provide a brief overview on aspects of CMV infection and disease and focuses on current vaccine strategies. The use of new synthetic DNA vaccines might offer one such approach to this difficult problem. PMID:25757619

  19. [Giant gastric ulcer by cytomegalovirus in infection VIH/SIDA].

    PubMed

    Pérez-Pereyra, Julia; Morales, Domingo; Díaz, Ramiro; Yoza, Max; Frisancho, Oscar

    2008-01-01

    Cytomegalovirus infection is an important cause of morbidity in immunosupressed patients with Human Immunodeficiency Virus (HIV). In this paper we present a 43 years old man with renal failure under hemodialysis, several blood transfusions because of anemia and three months of disease characterized by epigastric pain, specially at nights, ameliorated with antacid drugs. Other symptoms were early satisfy, vomits and weigh loss (18Kg). At clinical exam, the patient was pallid, presented adenopathies at cervical and inguinal regions and had a pain at epigastric region in profound touch palpation. The most important exams were HB: 10mg/dl, CMV: 83.5, leukocytes 7000, lymphocytes: 1715, erythrocyte sedimentation rate 49mm/h, the venon test (-), and Giardia lamblia trophozoites in stools. The studies demonstrated the patient was seropositive for HIV and the tests for IgG CMV and IgG Herpes virus resulted seropositives too. At endoscopy the esophagus mucosa was covered by a white plaque which suggests candida infection. In the stomach, over the body gastric, we found a big and deep ulcerated lesion (45 x 41mm), with defined rims and white fund. Biopsy from the edges of the gastric ulcer had the characteristic CMV intranuclear and intracytoplasmic inclusions; we confirmed the diagnosis by immunohystochemistry. The patient receives ganciclovir an then HAART and is getting well.

  20. Cytomegalovirus infection in immunosuppressed patients after kidney transplantation

    PubMed Central

    LUSCALOV, SIMONA; LOGA, LUMINITA; DICAN, LUCIA; JUNIE, LIA MONICA

    2016-01-01

    The first kidney transplantation was performed in 1951 and ever since then living donor transplantation became a more and more important solution for patients with end-stage renal disease (ESRD). Renal transplantation is a life-saving procedure. Morbidity and mortality on waiting-lists are strongly correlated with the time of dialysis and end-stage renal disease is one of the most important causes of death; this is the reason why transplantation has to be performed as soon as possible in order to reduce the time of dialysis. Once the transplantation is performed, a number of complications may occur in post-transplant evolution, the most important of which is rejection. The rejection may appear through several mechanisms, but one of the most frequent causes of rejection is cytomegalovirus (CMV) infection. It is very important to have a precocious and fast diagnosis of CMV infection in order to maintain the functionality and survival of the graft. PP65 CMV antigenemia has proven its effectiveness in detecting and monitoring the CMV infection in transplanted patients. In the laboratory of the Clinical Institute of Urology and Renal Transplantation (ICUTR) of Cluj Napoca the CMV infection is evidenced by two methods: PP65antigenemia and IgM antibody identification by chemiluminiscence. PMID:27547053

  1. Design of cocktail peptide vaccine against Cytomegalovirus infection

    PubMed Central

    Tabaei, Samira; Mashkani, Baratali; Esmaili, Arezoo; Karimi, Reza; Jamehdar, Saeid Amel

    2016-01-01

    Objective(s): Human Cytomegalovirus (HCMV) remains a major morbidity and mortality cause in immuno suppressed patients. Therefore, significant effort has been made towards the development of a vaccine. In this study, the expression of the pp65 and gB fusion peptides and Fc domain of mouse IgG2a as a novel delivery system for selective uptake of antigens by antigen-presenting cells (APCs) in Pichia pastoris yeast system were studied. Materials and Method: In this study, four immune dominant sequences in pp65 protein and 3 immuno dominant sequences in gB protein were selected according to literature review. Peptide linker -GGGGS- was used for construction of fusion peptide. This fusion peptide was cloned in the pPICZαA expression vector and transfected into P. pastoris host cells. Results: Dot blot and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) techniques showed that a high level of pp65-gB-Fc fusion peptide was expressed. Conclusion: This CMV pp65-gB-Fc fusion peptide could be a promising candidate for the development of a novel peptide vaccine. PMID:27279990

  2. Cytomegalovirus Antivirals and Development of Improved Animal Models

    PubMed Central

    McGregor, Alistair; Choi, K. Yeon

    2015-01-01

    Introduction Cytomegalovirus (CMV) is a ubiquitous pathogen that establishes a life long asymptomatic infection in healthy individuals. Infection of immunesuppressed individuals causes serious illness. Transplant and AIDS patients are highly susceptible to CMV leading to life threatening end organ disease. Another vulnerable population is the developing fetus in utero, where congenital infection can result in surviving newborns with long term developmental problems. There is no vaccine licensed for CMV and current antivirals suffer from complications associated with prolonged treatment. These include drug toxicity and emergence of resistant strains. There is an obvious need for new antivirals. Candidate intervention strategies are tested in controlled pre-clinical animal models but species specificity of HCMV precludes the direct study of the virus in an animal model. Areas covered This review explores the current status of CMV antivirals and development of new drugs. This includes the use of animal models and the development of new improved models such as humanized animal CMV and bioluminescent imaging of virus in animals in real time. Expert Opinion Various new CMV antivirals are in development, some with greater spectrum of activity against other viruses. Although the greatest need is in the setting of transplant patients there remains an unmet need for a safe antiviral strategy against congenital CMV. This is especially important since an effective CMV vaccine remains an elusive goal. In this capacity greater emphasis should be placed on suitable pre-clinical animal models and greater collaboration between industry and academia. PMID:21883024

  3. Antineurofilament and antiretinal antibodies in AIDS patients with cytomegalovirus retinitis.

    PubMed Central

    Rosberger, D F; Tshering, S L; Polsky, B; Heinemann, M H; Klein, R F; Cunningham-Rundles, S

    1994-01-01

    Sera obtained from AIDS patients with cytomegalovirus (CMV) retinitis before and after treatment with foscarnet, AIDS patients with human immunodeficiency virus (HIV) retinopathy, AIDS patients without retinal disease, and normal healthy controls with and without positive CMV serologies were assayed for the presence of antibodies against the 200-kDa outer, 160-kDa middle, and 68-kDa core subunits of the neurofilament triplet. Additional studies were performed to determine the presence of antibodies reactive with proteins extracted from crude human retinal antigen preparations. Antibodies against the 200-, 260-, and 68-kDa proteins of the neurofilament triplet were detected in 15 of 15 AIDS patients with CMV retinitis. The expression of these antibodies was unaffected, qualitatively, by successful treatment with foscarnet. In contrast, only 30% of patients with HIV retinopathy unrelated to CMV, fewer than 35% of AIDS patients with positive CMV titers but without evident retinitis, and fewer than 25% of healthy controls with positive or negative CMV titers possessed antibodies against any of the triplet proteins (P < 0.001). Antibodies against several clusters of retinal antigens were also identified in the sera of patients with CMV retinitis. In summary, the data indicate that retinal elements damaged by CMV infection induce an antibody response against the 200-, 160-, and 68kDa components of the neurofilament triplet as well as other, as yet undefined retinal antigens. Images PMID:8556483

  4. Analysis of human cytomegalovirus using the polymerase chain reaction.

    PubMed

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  5. Human cytomegalovirus replicates in gamma-irradiated fibroblasts

    SciTech Connect

    Shanley, J.D.

    1986-12-01

    Because of the unique interdependence of human cytomegalovirus (HCMV) and the physiological state of the host cell, we evaluated the ability of human foreskin fibroblasts (HFF), exposed to gamma radiation, to support HCMV growth. Irradiation of HFF with 2,500 rADS prevented cellular proliferation and suppressed cellular DNA, but not RNA or protein synthesis. Treatment of HFF cells with 2,500 rADS 6 or 48 hours prior to infection did not alter the time course or virus yield during HCMV replication. Virus plaquing efficiency in irradiated cells was comparable to that of nonirradiated cells. As judged by thymidine incorporation and BUdR inhibition of virus replication, HCMV infection induced both thymidine kinase activity and host cell DNA synthesis in irradiated cells. In addition, virus could be recovered from HFF exposed to radiation 0-2 days after infection with HCMV. These studies indicate that the damage to cells by gamma irradiation does not alter the capacity of host cells to support HCMV replication.

  6. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    SciTech Connect

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, with levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.

  7. Perivascular Stromal Cells as a Potential Reservoir of Human Cytomegalovirus

    PubMed Central

    Soland, M. A.; Keyes, L. R.; Bayne, R.; Moon, J.; Porada, C. D.; St. Jeor, S.; Almeida-Porada, G.

    2014-01-01

    Human cytomegalovirus (HCMV) infection is an important cause of morbidity and mortality among both solid organ and hematopoietic stem cell transplant recipients. Identification of cells throughout the body that can potentially serve as a viral reservoir is essential to dissect mechanisms of cell tropism and latency and to develop novel therapies. Here, we tested and compared the permissivity of liver-, brain-, lung (LNG)- and bone marrow (BM)-derived perivascular mesenchymal stromal cells (MSC) to HCMV infection and their ability to propagate and produce infectious virus. Perivascular MSC isolated from the different organs have in common the expression of CD146 and Stro-1. While all these cells were permissive to HCMV infection, the highest rate of HCMV infection was seen with LNG-MSC, as determined by viral copy number and production of viral particles by these cells. In addition, we showed that, although the supernatants from each of the HCMV-infected cultures contained infectious virus, the viral copy number and the quantity and timing of virus production varied among the various organ-specific MSC. Furthermore, using quantitative polymerase chain reaction, we were able to detect HCMV DNA in BM-MSC isolated from 7 out of 19 healthy, HCMV-seropositive adults, suggesting that BM-derived perivascular stromal cells may constitute an unrecognized natural HCMV reservoir. PMID:24592822

  8. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  9. Identification and expression of a human cytomegalovirus early glycoprotein.

    PubMed Central

    Chang, C P; Vesole, D H; Nelson, J; Oldstone, M B; Stinski, M F

    1989-01-01

    A human cytomegalovirus early gene which possesses three temporally regulated promoters is located in the large unique component of the viral genome between 0.054 and 0.064 map units (C.-P. Chang, C.L. Malone, and M.F. Stinski, J. Virol. 63:281-290, 1989). This gene contains a major open reading frame (ORF) located 233 bases downstream of the cap site of an early unspliced RNA. The major ORF predicts a polypeptide of 17 kilodaltons (kDa) which contains a glycoproteinlike signal and anchor domains as well as potential N-glycosylation sites. Antisera were prepared against synthetic peptides derived from amino acid sequences within the major ORF. The antisera detected a viral glycoprotein of 48 kDa in infected cells and recognized the in vitro-translated 17-kDa protein early-gene product. The viral glycoprotein, designated gp48, was modified by N-linked glycans and possibly O-linked glycans. The synthesis of gp48 occurred in the absence of viral DNA replication but accumulated to the highest levels at late times after infection. Since gp48 was found in the virion, it is considered an early structural glycoprotein. Images PMID:2545908

  10. Current and new cytomegalovirus antivirals and novel animal model strategies.

    PubMed

    McGregor, Alistair

    2010-09-01

    Cytomegalovirus (CMV) is a significant health problem among immunosuppressed individuals. In particular, transplant and AIDS patients and the developing fetus in utero are highly susceptible to CMV. In these vulnerable populations, infection leads to life threatening end organ viral disease or in surviving newborn babies to deafness or to mental retardation. Currently, the most effective way to control CMV infection, given the lack of an effective vaccine, is by antiviral therapy. However, available antivirals suffer from complications associated with prolonged use, such as drug toxicity as well as the emergence of resistant strains of virus. Additionally, since CMV has multiple complex immune evasion strategies, to avoid innate and adaptive immune responses, there is a need for new antiviral development. Any antiviral should be tested in a controlled animal model but species specificity of HCMV precludes the direct study of the virus in an animal model. Consequently, animal CMV in their respective animal host are used to study intervention strategies. In this review, both current and new antiviral strategies are discussed as are the various animal models and strategies to improve existing antiviral animal models by humanizing animal CMV.

  11. Roles and regulation of microRNAs in cytomegalovirus infection.

    PubMed

    Tuddenham, Lee; Pfeffer, Sébastien

    2011-01-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression post-transcriptionally via binding to complementary sites typically located in the 3' untranslated regions (UTRs) of their target mRNAs. This ancient regulatory system has been conserved in eukaryotes throughout evolution, and it is therefore unsurprising that certain viruses have evolved to express their own miRNAs. Since the initial discovery of Epstein-Barr virus (EBV) derived miRNAs in 2004, over 230 viral miRNAs have been identified, the majority arising from herpesviruses. Although the functions of most viral miRNAs remain to be elucidated, an increasing number of their cellular and viral targets have been experimentally validated. Due to their non-immunogenic nature, viral miRNAs represent an elegant tool for the virus to evade the host immune system, and likely play a key role in the latent/lytic switch during the viral lifecycle. In this review, we will focus on the interactions of cytomegaloviruses with cellular and viral miRNAs during infection. This article is part of a Special Issue entitled: MicroRNAs in viral gene regulation.

  12. Childhood environments and cytomegalovirus serostatus and reactivation in adults.

    PubMed

    Janicki-Deverts, Denise; Cohen, Sheldon; Doyle, William J; Marsland, Anna L; Bosch, Jos

    2014-08-01

    Childhood adversity, defined in terms of material hardship or physical or emotional maltreatment has been associated with risk for infection with cytomegalovirus (CMV) among children and adolescents, and with CMV reactivation in children and adults. The present study examined whether different dimensions of childhood experience-those pertaining to socioeconomic status (SES), physical environment, or family relationships-relate differentially to CMV serostatus and reactivation during adulthood. Participants were 140 healthy adults, aged 18-55years (41% female; 64% white). Childhood environments were assessed retrospectively and included family SES (parental housing tenure); childhood neighborhood environment (urban residence; physical conditions; safety; and social atmosphere); residential exposures (parental smoking and physical condition of home); and family relationships (parental divorce; warmth; harmony; dysfunction; parental bonding). Approximately 39% (n=53) of participants were CMV+. In individual analyses controlling for age, sex, race, body mass, current adult SES and smoking status, fewer years of parental home ownership, having a parent who smoked, and living in a poorly maintained or unsafe neighborhood each were associated with greater odds of infection with CMV. By comparison, in individual analyses limited to CMV+ participants, less family warmth, less harmony, greater dysfunction, and suboptimal parental bonding each were related to higher antibody levels, independent of the aforementioned covariates. Findings were not attributable to current adult perceptions of psychological stress or relative levels of emotional stability. These results suggest that different types of childhood adversity may be associated with differential effects on CMV infection and latency.

  13. Recovery of cytomegalovirus and Chlamydia trachomatis from vaginal tampons.

    PubMed

    Larew, M S; Myers, M G

    1982-01-01

    Herpes simplex virus (HSV), cytomegalovirus (CMV), and Chlamydia trachomatis are important agents in venereal and neonatal disease. Vaginal tampon culture for HSV has previously been demonstrated to be a simple and effective technique for quantitative culture of cervical secretions. We have evaluated the tampon culture as a means of performing quantitative cultures for CMV and C trachomatis. Cell-free and cell-associated CMV were quantitatively recovered from vaginal tampons when extraction was performed within one hour of tampon inoculation. However, when tampons were stored, there was a rapid loss of infectivity over time at all storage temperatures except -70 degrees C. C trachomatis was quantitatively recovered from tampons stored at less than or equal to 4 degrees C for four days. When stored at -70 degrees C, C trachomatis was stable on tampons for more than one week. Because HSV, CMV, and C trachomatis are stable in a single transport medium, a tampon stored at 4 degrees C briefly or at -70 degrees C for one week could be utilized for the detection of all three agents.

  14. Experimental primary cytomegalovirus infection in pregnancy: timing and fetal outcome.

    PubMed

    Kumar, M L; Prokay, S L

    1983-01-01

    In contrast to intrauterine rubella infection, the relationship between timing of maternal cytomegalovirus (CMV) infection and fetal outcome has not been clearly defined. In order to investigate this relationship, a guinea pig model was utilized to assess the fetal consequences of maternal CMV infection during the first, second, or third trimester of pregnancy. Congenital infection occurred in 24 of 35 newborn guinea pigs (69%) delivered to mothers infected during the third trimester, with localization of virus to salivary gland in 17 of the 24 infected newborn guinea pigs. In contrast, only one of 28 (5%) progeny sacrificed following first-trimester maternal infection was congenitally infected (p less than 0.01). Second-trimester maternal infection was associated with an intermediate risk of intrauterine infection with transmission of virus to 17 of 54 progeny (33%) (p less than 0.01). Eight of the 10 fetuses delivered after second-trimester infection had virus in multiple organs including the brain. These data suggest that timing of maternal CMV infection is an important variable affecting fetal outcome, with increased risk of intrauterine infection when maternal infection occurs late in pregnancy. However, if fetal infection occurs earlier in pregnancy, it appears to present a greater threat to the fetus, with the potential for dissemination of virus in multiple fetal tissues, including the brain. PMID:6295164

  15. Identification of binary interactions between human cytomegalovirus virion proteins.

    PubMed

    Phillips, Stacia L; Bresnahan, Wade A

    2011-01-01

    Human cytomegalovirus (HCMV) virions are composed of a DNA-containing nucleocapsid surrounded by a tegument layer and host-derived lipid envelope studded with virally encoded glycoproteins. These complex virions are estimated to be composed of more than 50 viral proteins. Assembly of HCMV virions is poorly understood, especially with respect to acquisition of the tegument; however, it is thought to involve the stepwise addition of virion components through protein-protein interactions. We sought to identify interactions among HCMV virion proteins using yeast two-hybrid analysis. Using 33 known capsid and tegument proteins, we tested 1,089 pairwise combinations for binary interaction in the two-hybrid assay. We identified 24 interactions among HCMV virion proteins, including 13 novel interactions among tegument proteins and one novel interaction between capsid proteins. Several of these novel interactions were confirmed by coimmunoprecipitation of protein complexes from transfected cells. In addition, we demonstrate three of these interactions in the context of HCMV infection. This study reveals several new protein-protein interactions among HCMV tegument proteins, some of which are likely important for HCMV replication and pathogenesis. PMID:20962080

  16. Viperin Regulates Cellular Lipid Metabolism during Human Cytomegalovirus Infection

    PubMed Central

    Seo, Jun-Young; Cresswell, Peter

    2013-01-01

    Human cytomegalovirus (HCMV) has been shown to induce increased lipogenesis in infected cells, and this is believed to be required for proper virion envelopment. We show here that this increase is a consequence of the virus-induced redistribution of the host protein viperin to mitochondria and its capacity to interact with and block the function of the mitochondrial trifunctional protein (TFP), the enzyme that mediates fatty acid-β-oxidation. The resulting decrease in cellular ATP levels activates the enzyme AMP-activated protein kinase (AMPK), which induces expression of the glucose transporter GLUT4, resulting in increased glucose import and translocation to the nucleus of the glucose-regulated transcription factor ChREBP. This induces increased transcription of genes encoding lipogenic enzymes, increased lipid synthesis and lipid droplet accumulation, and generation of the viral envelope. Viperin-dependent lipogenesis is required for optimal production of infectious virus. We show that all of these metabolic outcomes can be replicated by direct targeting of viperin to mitochondria in the absence of HCMV infection, and that the motif responsible for Fe-S cluster binding by viperin is essential. The data indicate that viperin is the major effector underlying the ability of HCMV to regulate cellular lipid metabolism. PMID:23935494

  17. Cytomegalovirus immune evasion by perturbation of endosomal trafficking

    PubMed Central

    Lučin, Pero; Mahmutefendić, Hana; Blagojević Zagorac, Gordana; Ilić Tomaš, Maja

    2015-01-01

    Cytomegaloviruses (CMVs), members of the herpesvirus family, have evolved a variety of mechanisms to evade the immune response to survive in infected hosts and to establish latent infection. They effectively hide infected cells from the effector mechanisms of adaptive immunity by eliminating cellular proteins (major histocompatibility Class I and Class II molecules) from the cell surface that display viral antigens to CD8 and CD4 T lymphocytes. CMVs also successfully escape recognition and elimination of infected cells by natural killer (NK) cells, effector cells of innate immunity, either by mimicking NK cell inhibitory ligands or by downregulating NK cell-activating ligands. To accomplish these immunoevasion functions, CMVs encode several proteins that function in the biosynthetic pathway by inhibiting the assembly and trafficking of cellular proteins that participate in immune recognition and thereby, block their appearance at the cell surface. However, elimination of these proteins from the cell surface can also be achieved by perturbation of their endosomal route and subsequent relocation from the cell surface into intracellular compartments. Namely, the physiological route of every cellular protein, including immune recognition molecules, is characterized by specific features that determine its residence time at the cell surface. In this review, we summarize the current understanding of endocytic trafficking of immune recognition molecules and perturbations of the endosomal system during infection with CMVs and other members of the herpesvirus family that contribute to their immune evasion mechanisms. PMID:25263490

  18. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.

    2016-01-01

    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  19. Cytomegalovirus in the parotid gland of a slow loris, Nyctecibus coucang.

    PubMed

    Tandler, B

    1997-07-01

    Sporadic enlarged cells with both nuclear and cytoplasmic viruses were found in the intralobular ducts of the parotid salivary gland of an adult female slow loris; these ducts are homologous to striated ducts in the salivary glands of other primates. The duct cell nuclei contained reticular inclusions and virions in all stages of development. Cytoplasmic virions were, in almost every case, confined to vacuoles; only a very few were free in the cytosol. The viruses conformed in ultrastructure to that of cytomegaloviruses described in other species. This may be the first observation by electron microscopy of in situ cytomegaloviruses in the salivary glands of a nonhuman primate.

  20. Cytomegalovirus Replicates in Differentiated but not in Undifferentiated Human Embryonal Carcinoma Cells

    NASA Astrophysics Data System (ADS)

    Gonczol, Eva; Andrews, Peter W.; Plotkin, Stanley A.

    1984-04-01

    To study the mode of action of human cytomegalovirus, an important teratogenic agent in human populations, the susceptibility of a pluripotent human embryonal carcinoma cell line to the virus was investigated. Viral antigens were not expressed nor was infectious virus produced by human embryonal carcinoma cells after infection, although the virus was able to penetrate these cells. In contrast, retinoic acid-induced differentiated derivatives of embryonal carcinoma cells were permissive for antigen expression and infectious virus production. Replication of human cytomegalovirus in human teratocarcinoma cells may therefore depend on cellular functions associated with differentiation.

  1. Cytomegalovirus infection associated with clonal proliferation of T-cell large granular lymphocytes: causal or casual?

    PubMed

    Wong, K F; Yip, S F; So, C C; Lau, G T C; Yeung, Y M

    2003-04-01

    Clonal proliferation of T-cell large granular lymphocytes (LGL) is an indolent disorder characterized by splenomegaly, lymphocytosis and frequent manifestations of immune disturbances. The LGL are CD3(+) CD4(-) CD8(+) CD56(-). The clonality of the tumor cell population is often only demonstrable by T-cell receptor (TCR) gene rearrangement study because chromosomal abnormality is distinctly rare. We describe a case of T-cell LGL leukemia that presented initially as cytomegalovirus infection. The leukemic LGL are shown to be clonal by both TCR gene rearrangement and chromosomal studies. They persist after subsidence of the cytomegalovirus infection. PMID:12660039

  2. Effect of desferrioxamine (DFO) and calcium trinatrium diethylenetriaminepentaacetic acid (DTPA) on rat cytomegalovirus replication in vitro and in vivo.

    PubMed

    Kloover, J S; Scholz, M; Cinatl, J; Lautenschlager, I; Grauls, G E; Bruggeman, C A

    1999-11-01

    Cytomegalovirus (CMV) infection is a major problem in the immunosuppressed patient. It is thought that besides direct CMV induced cell lysis, immunological damage is part of CMV pathogenesis. New antiviral drugs, which combine immunomodulating and antiviral qualities, could be beneficial. Recently, it has been described that desferrioxamine (DFO) and calcium trinatrium diethylenetriaminepentaacetic acid (DTPA) exhibit both properties. In this report the antiviral effects of both compounds against rat CMV (RCMV) are described in vitro and in vivo using a generalised and local infection model. In vitro, both compounds exhibited a significant antiviral effect, DTPA being more potent than DFO. However, in the generalised infection model no effect was seen on mortality, morbidity or presence of virus in internal organs. In rats infected subcutaneously in the hind paw, no effect was seen locally on paw thickness, presence of viral antigens and inflammatory response. In addition, these rats suffered from a generalised infection of low magnitude at 15 days post infection, although both DFO and DTPA were able to lower the level of viral replication. In conclusion, our data indicate that despite in vitro activity, in vivo usage of DFO or DTPA for acute CMV infection is not warranted.

  3. Cytomegalovirus-induced Hemorrhagic Colitis in a Patient with Chronic Myeloid Leukemia (Chronic Phase) on Dasatinib as an Upfront Therapy

    PubMed Central

    Yassin, Mohamed A; Nashwan, Abdulqadir J; Soliman, Ashraf T; Yousif, Anil; Moustafa, Afra; AlBattah, Afaf; Mohamed, Shehab F; Mudawi, Deena S; Elkourashy, Sarah; Asaari, Deena-Raiza; Gutierrez, Hope-Love G; Almusharaf, Mohamed; Hussein, Radwa M; Moustafa, Abbas H; Derhoubi, Hatim El; Boukhris, Sarra; Kohla, Samah; AlDewik, Nader

    2015-01-01

    Dasatinib is a kinase inhibitor indicated for the treatment of newly diagnosed adults with Philadelphia chromosome–positive (Ph+) chronic myeloid leukemia (CML) in chronic phase and accelerated (myeloid or lymphoid blast) phase, and CML with resistance or intolerance to prior therapy including imatinib and in adults with Ph+ acute lymphoblastic leukemia1 The most common adverse reactions (≥15%) in patients with newly diagnosed chronic-phase (CP) CML include myelosuppression, fluid retention, and diarrhea, whereas in patients with resistance or intolerance to prior imatinib therapy, side effects include myelosuppression, fluid retention, diarrhea, headache, dyspnea, skin rash, fatigue, nausea, and hemorrhage. We report a 39-year-old Ethiopian female patient who received dasatinib as upfront therapy for the treatment of CP-CML who experienced chronic diarrhea for two months, which progressed to hemorrhagic colitis due to cytomegalovirus (CMV) infection of the colon. To our knowledge, this is the first case of CMV colitis in a patient receiving dasatinib as upfront therapy. PMID:26379451

  4. Detection of cytomegalovirus and human herpesvirus-6 DNA in liver biopsy specimens and their correlation with rejection after liver transplantation.

    PubMed

    Guardia-Silva, A C; Stucchi, R S B; Sampaio, A M; Milan, A; Costa, S C B; Boin, I F S F

    2012-10-01

    Cytomegalovirus (CMV) and human herpesvirus-6 (HHV-6) reactivation after transplantation put patients at an increased risk of graft rejection mainly among those who receive organs that are positive in their donor biopsies. The aim of this study was to investigate the presence of CMV and HHV-6 DNA in liver biopsy specimens from the donors and from their grafts for correlation with rejection after transplantation. We followed 41 liver transplantation patients whose samples were evaluated using nested-polymerase chain reactions (N-PCR). Twenty-one (51%) of the 41 studied patients experienced rejection; 4/21 (19%) were CMV positive in the donor biopsy specimens and remained positive; another 5 subjects became positive. The patients who received organs from donors with biopsies positive for CMV demonstrated a trend to develop graft rejection after transplantation (Fisher's exact test [P = .0591] with significant results on univariate and multivariate analysis [P = .042]). Eight of the 21 who experienced rejection episodes were HHV-6 positive in the donor biopsy but there was no statistical significance CMV DNA diagnosed in liver donor biopsies remained positive posttransplantation in liver biopsy recipients; it was considered a tendency to develop acute cellular rejection after transplantation.

  5. Principles for studying in vivo attenuation of virus mutants: defining the role of the cytomegalovirus gH/gL/gO complex as a paradigm.

    PubMed

    Podlech, Jürgen; Reddehase, Matthias J; Adler, Barbara; Lemmermann, Niels A W

    2015-06-01

    Initial virus entry into cells of host organs and subsequent spread of viral progeny between tissue cells are events fundamental to viral pathogenesis. Glycoprotein complexes inserted in the virion envelope are critically involved in the cell entry process. Here we review and discuss recent work that has shed light on the in vivo role of the trimeric glycoprotein complex gH/gL/gO of murine cytomegalovirus (mCMV) as a model to propose the role of the corresponding complex of human CMV, for which experimental studies in vivo are not feasible due to the host species specificity of CMVs and evident ethical constraints. A novel approach combining gO transcomplementation of a genetically gO-deficient virus and a mathematical log-linear regression analysis of the viral multiplication kinetics in host tissues revealed a critical role of mCMV gH/gL/gO only in first target cell entry of virions arriving with the circulation, whereas intra-tissue spread proceeded unaffected also in the absence of gH/gL/gO. These findings predict that targeting gO for an antiviral intervention may be of prophylactic value in preventing the seeding of virus to organs, but will likely fail to interfere with an established primary organ infection or with recurrent infection after virus reactivation from latency within tissue cells. The demonstration in the murine model of alternative gH/gL complexes gH/gL/gO and gH/gL/MCK-2, substituting one another in a redundant fashion for securing viral spread in tissues, has the medically interesting bearing that targeting the gH/gL core complex directly may be a promising approach to preventing primary, established, and recurrent CMV infections.

  6. Cytomegalovirus Colitis and Subsequent New Diagnosis of Inflammatory Bowel Disease in an Immunocompetent Host: A Case Study and Literature Review

    PubMed Central

    Khan, Tipu V.; Toms, Carla

    2016-01-01

    Patient: Male, 40 Final Diagnosis: CMV colitis Symptoms: Abdominal pain • diarrhea • jaundice Medication: — Clinical Procedure: Flexible sigmoidoscopy • colonoscopy Specialty: Family Medicine Objective: Rare co-existance of disease or pathology Background: Infection with gastrointestinal cytomegalovirus in an immunocompetent host is a rather rare occurrence in the literature. There are a few reports of gastrointestinal infection in the immunocompetent who are then subsequently given a new diagnosis of inflammatory bowel disease. It is speculated that the initial cytomegalovirus colitis infection triggers the onset of inflammatory bowel disease. Case Report: Herein we report a case of cytomegalovirus colitis and new diagnosis of inflammatory bowel disease identified in a 40-year-old immunocompetent adult man who presented with gastrointestinal symptoms and disseminated cytomegalovirus infection requiring anti-viral therapy, which successfully treated the episode of cytomegalovirus infection. He then went on to have persistent symptomatic inflammatory bowel disease confirmed by pathology. Conclusions: In this paper we will review the literature and explore the rare case of cytomegalovirus colitis in the immunocompetent host and discuss the pathology, physiology, diagnosis, and treatment of cytomegalovirus colitis. PMID:27460032

  7. The Salivary Gland Acts as a Sink for Tissue-Resident Memory CD8(+) T Cells, Facilitating Protection from Local Cytomegalovirus Infection.

    PubMed

    Thom, Jenny Tosca; Weber, Thomas Christian; Walton, Senta Maria; Torti, Nicole; Oxenius, Annette

    2015-11-10

    Tissue-resident memory T cells (TRM) reside in barrier tissues and provide local immediate protective immunity. Here, we show that the salivary gland (SG) most-effectively induces CD8(+) and CD4(+) TRM cells against murine cytomegalovirus (MCMV), which persists in and spreads from this organ. TRM generation depended on local antigen for CD4(+), but not CD8(+), TRM cells, highlighting major differences in T cell subset-specific demands for TRM development. CMV-specific CD8(+) T cells fail to control virus replication upon primary infection in the SG due to CMV-induced MHC I downregulation in glandular epithelial cells. Using intraglandular infection, we challenge this notion and demonstrate that memory CD8(+) T cells confer immediate protection against locally introduced MCMV despite active viral immune evasion, owing to early viral tropism to cells that largely withstand MHC I downregulation. Thus, we unravel a yet-unappreciated role for memory CD8(+) T cells in protecting mucosal tissues against CMV infection.

  8. Absence of cross-presenting cells in the salivary gland and viral immune evasion confine cytomegalovirus immune control to effector CD4 T cells.

    PubMed

    Walton, Senta M; Mandaric, Sanja; Torti, Nicole; Zimmermann, Albert; Hengel, Hartmut; Oxenius, Annette

    2011-08-01

    Horizontal transmission of cytomegaloviruses (CMV) occurs via prolonged excretion from mucosal surfaces. We used murine CMV (MCMV) infection to investigate the mechanisms of immune control in secretory organs. CD4 T cells were crucial to cease MCMV replication in the salivary gland (SG) via direct secretion of IFNγ that initiated antiviral signaling on non-hematopoietic cells. In contrast, CD4 T cell helper functions for CD8 T cells or B cells were dispensable. Despite SG-resident MCMV-specific CD8 T cells being able to produce IFNγ, the absence of MHC class I molecules on infected acinar glandular epithelial cells due to viral immune evasion, and the paucity of cross-presenting antigen presenting cells (APCs) prevented their local activation. Thus, local activation of MCMV-specific T cells is confined to the CD4 subset due to exclusive presentation of MCMV-derived antigens by MHC class II molecules on bystander APCs, resulting in IFNγ secretion interfering with viral replication in cells of non-hematopoietic origin.

  9. Identification of a 1.6 kb genome locus of guinea pig cytomegalovirus required for efficient viral growth in animals but not in cell culture.

    PubMed

    Nozawa, Naoki; Yamamoto, Yumiko; Fukui, Yoshiko; Katano, Harutaka; Tsutsui, Yoshihiro; Sato, Yuko; Yamada, Souichi; Inami, Yuhki; Nakamura, Kohnosuke; Yokoi, Masayuki; Kurane, Ichiro; Inoue, Naoki

    2008-09-15

    Guinea pig cytomegalovirus (GPCMV) provides a useful model for studies of congenital CMV infection. During characterization of the GPCMV genome sequence, we identified two types of strains in a virus stock purchased from ATCC. One of them, GPCMV/del, lacks a 1.6 kb locus that positionally corresponds to murine CMV (MCMV) M129-M133. Growth of GPCMV/del in cell culture was marginally better than that of the other strain, GPCMV/full, which harbors the 1.6 kb locus. However, in animals infected intraperitoneally with virus stocks containing both strains, GPCMV/full disseminated more efficiently than GPCMV/del, including 200-fold greater viral load in salivary glands. Viral DNA, transcripts of the immediate-early 2 gene homolog, and viral antigens were more abundant in animals infected with GPCMV/full than in those infected with GPCMV/del. Although the observed phenomena have some similarity with the growth properties of MCMV strains defective in mck-1/mck-2(M129/131) and those defective in sgg(M132), no M129-M132 homologs were found in the 1.6 kb locus. Since one of the ORFs in the locus has a weak sequence similarity with HCMV UL130, which relates to cell tropism, further studies will be required to learn the mechanism for efficient GPCMV growth in animal. PMID:18656220

  10. Human fetal inner ear involvement in congenital cytomegalovirus infection

    PubMed Central

    2013-01-01

    Background Congenital cytomegalovirus (CMV) infection is a leading cause of sensorineural hearing loss (SNHL). The mechanisms of pathogenesis of CMV-related SNHL are still unclear. The aim is to study congenital CMV-related damage in the fetal inner ear, in order to better understand the underlying pathophysiology behind CMV-SNHL. Results We studied inner ears and brains of 20 human fetuses, all at 21 week gestational age, with a high viral load in the amniotic fluid, with and without ultrasound (US) brain abnormalities. We evaluated histological brain damage, inner ear infection, local inflammatory response and tissue viral load. Immunohistochemistry revealed that CMV was positive in 14/20 brains (70%) and in the inner ears of 9/20 fetuses (45%). In the cases with inner ear infection, the marginal cell layer of the stria vascularis was always infected, followed by infection in the Reissner’s membrane. The highest tissue viral load was observed in the inner ear with infected Organ of Corti. Vestibular labyrinth showed CMV infection of sensory cells in the utricle and in the crista ampullaris. US cerebral anomalies were detected in 6 cases, and in all those cases, the inner ear was always involved. In the other 14 cases with normal brain scan, histological brain damage was present in 8 fetuses and 3 of them presented inner ear infection. Conclusions CMV-infection of the marginal cell layer of the stria vascularis may alter potassium and ion circulation, dissipating the endocochlear potential with consequent SNHL. Although abnormal cerebral US is highly predictive of brain and inner ear damage, normal US findings cannot exclude them either. PMID:24252374

  11. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    PubMed Central

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-01-01

    The most abundantly produced virion protein in human cytomegalovirus (HCMV) is the immunodominant phosphoprotein 65 (pp65), which is frequently included in CMV vaccines. Although it is nonessential for in vitro CMV growth, pp65 displays immunomodulatory functions that support a potential role in primary and/or persistent infection. To determine the contribution of pp65 to CMV infection and immunity, we generated a rhesus CMV lacking both pp65 orthologs (RhCMVΔpp65ab). While deletion of pp65ab slightly reduced growth in vitro and increased defective particle formation, the protein composition of secreted virions was largely unchanged. Interestingly, pp65 was not required for primary and persistent infection in animals. Immune responses induced by RhCMVΔpp65ab did not prevent reinfection with rhesus CMV; however, reinfection with RhCMVΔUS2-11, which lacks viral-encoded MHC-I antigen presentation inhibitors, was prevented. Unexpectedly, induction of pp65b-specific T cells alone did not protect against RhCMVΔUS2-11 challenge, suggesting that T cells targeting multiple CMV antigens are required for protection. However, pp65-specific immunity was crucial for controlling viral dissemination during primary infection, as indicated by the marked increase of RhCMVΔpp65ab genome copies in CMV-naive, but not CMV-immune, animals. Our data provide rationale for inclusion of pp65 into CMV vaccines but also demonstrate that pp65-induced T cell responses alone do not recapitulate the protective effect of natural infection. PMID:24691437

  12. Diagnostic Utility of Ocular Symptoms and Vision for Cytomegalovirus Retinitis

    PubMed Central

    Chen, Alexander S.; Kamphaengkham, Siripim; Leenasirimakul, Prattana; Jirawison, Choeng; Ausayakhun, Somsanguan; Margolis, Todd P.; Keenan, Jeremy D.

    2016-01-01

    Purpose Cytomegalovirus (CMV) retinitis remains a leading cause of blindness in countries with a high burden of AIDS. Although dilated fundus examinations are recommended for those with CD4 counts below 100 cells/μL, in practice only those with poor vision and/or symptoms are routinely referred for screening. Therefore, the predictive value of this common practice should be assessed. Methods This is a prospective cross-sectional study. Patients with known HIV and a CD4 count of less than 100 cells/μL attending an HIV clinic in Chiang Mai, Thailand completed a standardized questionnaire about visual symptoms and underwent visual acuity testing and dilated fundus examination. Participants without CMV retinitis were invited for repeated examinations every 3 months until their CD4 count exceeded 100 cells/μL. Patient-level statistical analyses were conducted to calculate diagnostic test characteristics, with bootstrapping to account for correlated data. Results Of 103 study participants, 16 had CMV retinitis diagnosed at some point during the study. Participants with CMV retinitis were more likely to complain of visual symptoms compared to those without CMV retinitis (p = 0.01), including scotoma (p = 0.0002), itchy or watery eyes (p < 0.0001), and eye pain (p = 0.003); they were also more likely to have visual acuity worse than Counting Fingers (p = 0.0003). However, the absence of eye symptoms and the absence of poor vision did not strongly affect the probability that a patient did not have disease (negative likelihood ratio 0.56 and 0.76, respectively). Conclusions Ocular symptoms and poor visual acuity were poor diagnostic indicators for the presence of CMV retinitis. Systematic screening of HIV patients with CD4 counts below 100 cells/μl should be carried out to detect disease at an early stage, when blindness can still be prevented. PMID:27788232

  13. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.

    PubMed

    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg

    2016-09-06

    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity.

  14. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.

    2015-01-01

    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  15. [Cytomegalovirus isolation by conventional cell culture and shell vial assay].

    PubMed

    Galiano, M C; Videla, C M; Sánchez Puch, S; Carballal, G

    2001-01-01

    In immunocompromised patients, diagnosis of Cytomegalovirus (CMV) active infection is of utmost importance for the initiation, monitoring and ending of antiviral therapy. Therefore, the presence of viral replication should be demonstrated. Isolation in tissue culture is one of the standard methods. The objective of the present paper was to compare two isolation procedures for CMV: conventional cell culture (CC) and rapid shell vial (SV) assay in human fibroblasts. A total of 584 clinical samples were studied between 1991 and 1998. CMV was isolated in 14.4% of the samples, 11.8% of which were positive by SV and 7.7% by CC. Out of 84 positive samples, concordance between both methods was observed in 36% of the cases. We found that 46% of the samples were positive only by SV, while 18% were positive only by CC. The average time required for obtaining the results by CC was 22.6 +/- 2.3 days. Out of the 69 samples positive by SV, 43% were already positive after 24 hours and the rest after 48 hours. These results indicate that SV was more sensitive and rapid than CC. The main advantage of CC, despite its time-consuming process, is the ability to recover the viral strain for both antiviral susceptibility phenotypical tests and strain characterization. Furthermore, in this study, absence of CC would have resulted in the loss of 18% of the positive diagnoses. In conclusion, simultaneous use of both methods is suggested in order to obtain a rapid result and the highest sensitivity.

  16. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  17. Current concepts on cytomegalovirus infection after liver transplantation

    PubMed Central

    Lee, Sang-Oh; Razonable, Raymund R

    2010-01-01

    Cytomegalovirus (CMV) is the most common viral pathogen that negatively impacts on the outcome of liver transplantation. CMV cause febrile illness often accompanied by bone marrow suppression, and in some cases, invades tissues including the transplanted allograft. In addition, CMV has been significantly associated with an increased predisposition to allograft rejection, accelerated hepatitis C recurrence, and other opportunistic infections, as well as reduced overall patient and allograft survival. To negate the adverse effects of CMV on outcome, its prevention, whether through antiviral prophylaxis or preemptive therapy, is regarded as an essential component to the medical management of liver transplant patients. Two recent guidelines have suggested that antiviral prophylaxis or preemptive therapy are similarly effective in preventing CMV disease in modest-risk CMV-seropositive liver transplant recipients, while antiviral prophylaxis is the preferred strategy over preemptive therapy for the prevention of CMV disease in high-risk recipients [CMV-seronegative recipients of liver allografts from CMV-seropositive donors (D+/R-)]. However, antiviral prophylaxis has only delayed the onset of CMV disease in many CMV D+/R- liver transplant recipients, and at least in one study, such occurrence of late-onset primary CMV disease was significantly associated with increased mortality after liver transplantation. Therefore, optimized strategies for prevention are needed, and aggressive treatment of CMV infection and disease should be pursued. The standard treatment of CMV disease consists of intravenous ganciclovir or oral valganciclovir, and if feasible, one should also reduce the degree of immunosuppression. In one recent controlled clinical trial, valganciclovir was found to be as effective and safe as intravenous ganciclovir for the treatment of mild to moderate CMV disease in solid organ (including liver) transplant recipients. In this article, the authors review the

  18. Non-cytomegalovirus ocular opportunistic infections in patients with AIDS

    PubMed Central

    Gangaputra, Sapna; Drye, Lea; Vaidya, Vijay; Thorne, Jennifer E.; Jabs, Douglas A; Lyon, Alice T.

    2014-01-01

    Purpose To report the incidence and clinical outcomes of non-cytomegalovirus (non-CMV) ocular opportunistic infections in patients with AIDS in the era of highly active antiretroviral therapy (HAART). Design Multicenter, prospective, observational study of patients with AIDS Methods Medical history, ophthalmologic examination, and laboratory tests were performed at enrollment and every 6 months subsequently. Once an ocular opportunistic infection was diagnosed, patients were seen every 3 months for outcomes. Results At enrollment, 37 non-CMV ocular opportunistic infections were diagnosed: 16 patients, herpetic retinitis; 11 patients, toxoplasmic retinitis; and 10 patients, choroiditis. During the follow-up period, the estimated incidences (and 95% confidence intervals [CI]) of these were: herpetic retinitis, 0.007/100 person-years (PY) (95% CI 0.0004, 0.039); toxoplasmic retinitis, 0.007/100 PY (95% CI 0.004, 0.039); and choroiditis 0.014/100 PY (95% CI 0.0025, 0.050). The mortality rates appeared higher among those patients with newly diagnosed or incident herpetic retinitis and choroiditis (rates=21.7 deaths/100 PY [P=0.02] and 12.8 deaths/100 PY [P=0.04]) respectively, than that for patients with AIDS without an ocular opportunistic infection (4.1 deaths/100 PY); Toxoplasmic retinitis did not appear to be associated with greater mortality (6.4/100 PY, P=0.47). Eyes with newly-diagnosed herpetic retinitis appeared to have a poor visual prognosis with high rates of visual impairment (37.9/100 PY) and blindness (17.5/100 PY), whereas those outcomes in eyes with choroiditis appeared to be lower (2.3/100 PY and 0/100 PY, respectively). Conclusions Although uncommon, non-CMV ocular opportunistic infections may be associated with high rates of visual loss and/or mortality. PMID:23068916

  19. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.

    PubMed

    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg

    2016-01-01

    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity. PMID:27595792

  20. Desirability and feasibility of a vaccine against cytomegalovirus.

    PubMed

    Griffiths, Paul; Plotkin, Stanley; Mocarski, Edward; Pass, Robert; Schleiss, Mark; Krause, Philip; Bialek, Stephanie

    2013-04-18

    Publication of a report from the Institute of Medicine in 2000 showing that a vaccine against cytomegalovirus (CMV) would likely be cost saving was very influential and encouraged the clinical evaluation of candidate vaccines. The major objective of a CMV vaccination program would be to reduce disease caused by congenital CMV infection, which is the leading viral cause of sensorineural hearing loss and neurodevelopmental delay. CMV has challenges as a vaccine target because it is a herpesvirus, it persists lifelong despite host immunity, infected individuals can be reinfected with new strains, overt disease occurs in those with immature or impaired immune systems and persons with this infection do not usually report symptoms. Nevertheless, natural immunity against CMV provides some protection against infection and disease, natural history studies have defined the serological and molecular biological techniques needed for endpoints in future clinical trials of vaccines and CMV is not highly communicable, suggesting that it may not be necessary to achieve very high levels of population immunity through vaccination in order to affect transmission. Three phase 2 CMV vaccine studies have been completed in the last 3 years and all report encouraging outcomes. A key international meeting was organized by the Food and Drug Administration in January 2012 at which interested parties from regulatory bodies, industry and academia discussed and prioritised designs for phase 2 and phase 3 clinical trials. Vaccines able to prevent primary infection with CMV and to boost the immune response of those already infected are desirable. The major target populations for a CMV vaccine include women of childbearing age and adolescents. Toddlers represent another potential population, since an effect of vaccine in this age group could potentially decrease transmission to adults. In addition, prospective recipients of transplants and patients with AIDS would be expected to benefit.

  1. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  2. Commutability of Cytomegalovirus WHO International Standard in Different Matrices

    PubMed Central

    Jones, Sara; Webb, Erika M.; Barry, Catherine P.; Choi, Won S.; Abravaya, Klara B.; Schneider, George J.

    2016-01-01

    Commutability of quantitative standards allows patient results to be compared across molecular diagnostic methods and laboratories. This is critical to establishing quantitative thresholds for use in clinical decision-making. A matrix effect associated with the 1st cytomegalovirus (CMV) WHO international standard (IS) was identified using the Abbott RealTime CMV assay. A commutability study was performed to compare the CMV WHO IS and patient specimens diluted in plasma and whole blood. Patient specimens showed similar CMV DNA quantitation values regardless of the diluent or extraction procedure used. The CMV WHO IS, on the other hand, exhibited a matrix effect. The CMV concentration reported for the WHO IS diluted in plasma was within the 95% prediction interval established with patient samples. In contrast, the reported DNA concentration of the CMV WHO IS diluted in whole blood was reduced approximately 0.4 log copies/ml, and values fell outside the 95% prediction interval. Calibrating the assay by using the CMV WHO IS diluted in whole blood would introduce a bias for CMV whole-blood quantitation; samples would be reported as having higher measured concentrations, by approximately 0.4 log IU/ml. Based on the commutability study with patient samples, the RealTime CMV assay was standardized based on the CMV WHO IS diluted in plasma. A revision of the instructions for use of the CMV WHO IS should be considered to alert users of the potential impact from the diluent matrix. The identification of a matrix effect with the CMV WHO IS underscores the importance of assessing commutability of the IS in order to achieve consistent results across methods. PMID:27030491

  3. Anti-Cytomegalovirus Activity of the Anthraquinone Atanyl Blue PRL

    PubMed Central

    Alam, Zohaib; Al-Mahdi, Zainab; Zhu, Yali; McKee, Zachary; Parris, Deborah S.; Parikh, Hardik I.; Kellogg, Glen E.; Kuchta, Alison; McVoy, Michael A.

    2014-01-01

    Human cytomegalovirus (CMV) causes significant disease in immunocompromised patients and serious birth defects if acquired in utero. Available CMV antivirals target the viral DNA polymerase, have significant toxicities, and suffer from resistance. New drugs targeting different pathways would be beneficial. The anthraquinone emodin is proposed to inhibit herpes simplex virus by blocking the viral nuclease. Emodin and related anthraquinones are also reported to inhibit CMV. In the present study, emodin reduced CMV infectious yield with an EC50 of 4.9 μM but was cytotoxic at concentrations only two-fold higher. Related anthraquinones acid blue 40 and alizarin violet R inhibited CMV at only high concentrations (238–265 μM) that were also cytotoxic. However, atanyl blue PRL inhibited infectious yield of CMV with an EC50 of 6.3 μM, significantly below its 50% cytotoxic concentration of 216 μM. Atanyl blue PRL reduced CMV infectivity and inhibited spread. When added up to one h after infection, it dramatically reduced CMV immediate early protein expression and blocked viral DNA synthesis. However, it had no antiviral activity when added 24 h after infection. Interestingly, atanyl blue PRL inhibited nuclease activities of purified CMV UL98 protein with IC50 of 4.5 and 9.3 μM. These results indicate that atanyl blue PRL targets very early post-entry events in CMV replication and suggest it may act through inhibition of UL98, making it a novel CMV inhibitor. This compound may provide valuable insights into molecular events that occur at the earliest times post-infection and serve as a lead structure for antiviral development. PMID:25499125

  4. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  5. Relationship between cytomegalovirus (CMV) reactivation, CMV-driven immunity, overall immune recovery and graft-versus-leukaemia effect in children.

    PubMed

    Jeljeli, Mohamed; Guérin-El Khourouj, Valérie; Porcher, Raphael; Fahd, Mony; Leveillé, Sandrine; Yakouben, Karima; Ouachée-Chardin, Marie; LeGoff, Jerome; Cordeiro, Debora Jorge; Pédron, Beatrice; Baruchel, Andre; Dalle, Jean-Hugues; Sterkers, Ghislaine

    2014-07-01

    The interplay between immune recovery, cytomegalovirus (CMV)-reactivation, CMV-driven immunity and graft-versus-leukaemia effect (GVL) was analysed in 108 children (median age: 8 years) who underwent haematopoietic-stem cell transplantation (HSCT) for acute leukaemia. Follow-up was 2 years unless death or relapse occurred. CMV-polymerase chain reaction (PCR) was programmed weekly until month +3 post-HSCT. Immunomonitoring consisted of sequential lymphocyte subset enumerations and analyses of T-cell proliferative and γ-interferon responses to CMV and to adenovirus. In the 108 recipients, the 2-year relapse rate (RR) was 25% (median time to onset 4·5 months; range: 24 d-17 months). CMV reactivation occurrence was 31% (median time to onset 26 d). Donor/recipient CMV serostatus did not influence RR. Among the 89 recipients disease-free after day +120, i) early CMV-reactivation before day +30 was more frequent (P = 0·01) in the relapse recipient group opposed to the non-relapse group. ii) CD8(+) /CD28(-) and CD4(+) CD45RA(-) T-cell expansions induced by CMV did not influence RR, iii) Recovery of anti-CMV and also anti-adenovirus immunity and of naïve CD4(+) T-cells was faster in the non-relapse group (P = 0·008; 0·009 and 0·002 respectively). In contrast to adult acute myeloid leukaemia, CMV reactivation was associated with increased RR in this paediatric series. Accelerated overall immune recovery rather than CMV-driven immunity had a favourable impact on RR.

  6. Early cytomegalovirus reactivation remains associated with increased transplant-related mortality in the current era: a CIBMTR analysis.

    PubMed

    Teira, Pierre; Battiwalla, Minoo; Ramanathan, Muthalagu; Barrett, A John; Ahn, Kwang Woo; Chen, Min; Green, Jaime S; Saad, Ayman; Antin, Joseph H; Savani, Bipin N; Lazarus, Hillard M; Seftel, Matthew; Saber, Wael; Marks, David; Aljurf, Mahmoud; Norkin, Maxim; Wingard, John R; Lindemans, Caroline A; Boeckh, Michael; Riches, Marcie L; Auletta, Jeffery J

    2016-05-19

    Single-center studies have reported an association between early (before day 100) cytomegalovirus (CMV) reactivation and decreased incidence of relapse for acute myeloid leukemia (AML) following allogeneic hematopoietic cell transplantation. To substantiate these preliminary findings, the Center for International Blood and Marrow Transplant Research (CIBMTR) Database was interrogated to analyze the impact of CMV reactivation on hematologic disease relapse in the current era. Data from 9469 patients transplanted with bone marrow or peripheral blood between 2003 and 2010 were analyzed according to 4 disease categories: AML (n = 5310); acute lymphoblastic leukemia (ALL, n = 1883); chronic myeloid leukemia (CML, n = 1079); and myelodysplastic syndrome (MDS, n = 1197). Median time to initial CMV reactivation was 41 days (range, 1-362 days). CMV reactivation had no preventive effect on hematologic disease relapse irrespective of diagnosis. Moreover, CMV reactivation was associated with higher nonrelapse mortality [relative risk [RR] among disease categories ranged from 1.61 to 1.95 and P values from .0002 to <.0001; 95% confidence interval [CI], 1.14-2.61). As a result, CMV reactivation was associated with lower overall survival for AML (RR = 1.27; 95% CI, 1.17-1.38; P <.0001), ALL (RR = 1.46; 95% CI, 1.25-1.71; P <.0001), CML (RR = 1.49; 95% CI, 1.19-1.88; P = .0005), and MDS (RR = 1.31; 95% CI, 1.09-1.57; P = .003). In conclusion, CMV reactivation continues to remain a risk factor for poor posttransplant outcomes and does not seem to confer protection against hematologic disease relapse.

  7. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    SciTech Connect

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.; Balkin, Ethan R.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Frayo, Shani; Hylarides, Mark; Green, Damian J.; Gopal, Ajay K.; Press, Oliver W.; Pagel, John M.

    2013-05-15

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  8. Expression of the Human Cytomegalovirus UL97 Gene in a Chimeric Guinea Pig Cytomegalovirus (GPCMV) Results in Viable Virus with Increased Susceptibility to Ganciclovir and Maribavir

    PubMed Central

    McGregor, Alistair; Choi, K. Yeon; Cui, Xiaohong; McVoy, Michael A.; Schleiss, Mark R.

    2009-01-01

    In lieu of a licensed vaccine, antivirals are being considered as an intervention to prevent congenital human cytomegalovirus (HCMV) infection. Ideally, antiviral therapies should undergo pre-clinical evaluation in an animal model prior to human use. Guinea pig cytomegalovirus (GPCMV) is the only small animal model for congenital CMV. However, GPCMV is not susceptible to the most commonly used HCMV antiviral, ganciclovir (GCV), rendering in vivo study of this agent problematic in the guinea pig model. Human cytomegalovirus (HCMV) susceptibility to GCV is linked to the UL97 gene. We hypothesized that GPCMV susceptibility to GCV could be improved by inserting the HCMV (Towne) UL97 gene into the GPCMV genome in place of the homolog, GP97. A chimeric GPCMV (GPCMV::UL97) expressed UL97 protein, and replicated efficiently in cell culture, with kinetics similar to wild-type GPCMV. In contrast, deletion of GP97 resulted in a virus (GPCMVdGP97) that grew poorly in culture. GPCMV::UL97 had substantially improved susceptibility to the inhibitory effects of GCV in comparison to wild-type GPCMV. Additionally, GPCMV::UL97 exhibited improved susceptibility to another antiviral undergoing clinical trials, maribavir (MBV; benzimidazole riboside 1263W94), which also acts through UL97. PMID:18325607

  9. Acute Bronchitis

    MedlinePlus

    ... tightness. There are two main types of bronchitis: acute and chronic. Most cases of acute bronchitis get better within several days. But your ... that cause colds and the flu often cause acute bronchitis. These viruses spread through the air when ...

  10. Horizontal In Utero Acquisition of Cytomegalovirus Infection in a Twin Pregnancy

    PubMed Central

    Gabrielli, Liliana; Lazzarotto, Tiziana; Foschini, Maria Pia; Lanari, Marcello; Guerra, Brunella; Eusebi, Vincenzo; Landini, Maria Paola

    2003-01-01

    It is generally accepted that viral infections can be transmitted horizontally by direct or indirect contact with virus-excreting persons, and some viral infections can be transmitted vertically, either prenatally or perinatally, from mother to child. This report presents data strongly supporting a prenatal horizontal acquisition of human cytomegalovirus infection in a twin pregnancy. PMID:12624079

  11. Child Care Provider Awareness and Prevention of Cytomegalovirus and Other Infectious Diseases

    ERIC Educational Resources Information Center

    Thackeray, Rosemary; Magnusson, Brianna M.

    2016-01-01

    Background: Child care facilities are prime locations for the transmission of infectious and communicable diseases. Children and child care providers are at high risk for cytomegalovirus (CMV) infection which causes severe birth defects and developmental delays. Objective: The goals of study were: (1) to determine the level of cytomegalovirus…

  12. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela

    2016-01-01

    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  13. Congenital Cytomegalovirus Infection: A Significant Cause of Deafness and Mental Deficiency.

    ERIC Educational Resources Information Center

    Eichhorn, Sarah K.

    1982-01-01

    Research on cytomegalovirus (CMV), a herpes virus causing neurological damage (hearing problems and/or mental retardation) in 10 percent of infants born with the condition, is reviewed. Incidence of hearing and retardation in CMV cases is reported and current treatment described. (CL)

  14. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands.

  15. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands. PMID:24185855

  16. Molecular and Culture-Based Bronchoalveolar Lavage Fluid Testing for the Diagnosis of Cytomegalovirus Pneumonitis.

    PubMed

    Tan, Susanna K; Burgener, Elizabeth B; Waggoner, Jesse J; Gajurel, Kiran; Gonzalez, Sarah; Chen, Sharon F; Pinsky, Benjamin A

    2016-01-01

    Background.  Cytomegalovirus (CMV) is a major cause of morbidity and mortality in immunocompromised patients, with CMV pneumonitis among the most severe manifestations of infection. Although bronchoalveolar lavage (BAL) samples are frequently tested for CMV, the clinical utility of such testing remains uncertain. Methods.  Retrospective analysis of adult patients undergoing BAL testing via CMV polymerase chain reaction (PCR), shell vial culture, and conventional viral culture between August 2008 and May 2011 was performed. Cytomegalovirus diagnostic methods were compared with a comprehensive definition of CMV pneumonitis that takes into account signs and symptoms, underlying host immunodeficiency, radiographic findings, and laboratory results. Results.  Seven hundred five patients underwent 1077 bronchoscopy episodes with 1090 BAL specimens sent for CMV testing. Cytomegalovirus-positive patients were more likely to be hematopoietic cell transplant recipients (26% vs 8%, P < .0001) and less likely to have an underlying condition not typically associated with lung disease (3% vs 20%, P < .0001). Histopathology was performed in only 17.3% of CMV-positive bronchoscopy episodes. When CMV diagnostic methods were evaluated against the comprehensive definition, the sensitivity and specificity of PCR, shell vial culture, and conventional culture were 91.3% and 94.6%, 54.4% and 97.4%, and 28.3% and 96.5%, respectively. Compared with culture, PCR provided significantly higher sensitivity and negative predictive value (P ≤ .001), without significantly lower positive predictive value. Cytomegalovirus quantitation did not improve test performance, resulting in a receiver operating characteristic curve with an area under the curve of 0.53. Conclusions.  Cytomegalovirus PCR combined with a comprehensive clinical definition provides a pragmatic approach for the diagnosis of CMV pneumonitis.

  17. Molecular and Culture-Based Bronchoalveolar Lavage Fluid Testing for the Diagnosis of Cytomegalovirus Pneumonitis

    PubMed Central

    Tan, Susanna K.; Burgener, Elizabeth B.; Waggoner, Jesse J.; Gajurel, Kiran; Gonzalez, Sarah; Chen, Sharon F.; Pinsky, Benjamin A.

    2016-01-01

    Background. Cytomegalovirus (CMV) is a major cause of morbidity and mortality in immunocompromised patients, with CMV pneumonitis among the most severe manifestations of infection. Although bronchoalveolar lavage (BAL) samples are frequently tested for CMV, the clinical utility of such testing remains uncertain. Methods. Retrospective analysis of adult patients undergoing BAL testing via CMV polymerase chain reaction (PCR), shell vial culture, and conventional viral culture between August 2008 and May 2011 was performed. Cytomegalovirus diagnostic methods were compared with a comprehensive definition of CMV pneumonitis that takes into account signs and symptoms, underlying host immunodeficiency, radiographic findings, and laboratory results. Results. Seven hundred five patients underwent 1077 bronchoscopy episodes with 1090 BAL specimens sent for CMV testing. Cytomegalovirus-positive patients were more likely to be hematopoietic cell transplant recipients (26% vs 8%, P < .0001) and less likely to have an underlying condition not typically associated with lung disease (3% vs 20%, P < .0001). Histopathology was performed in only 17.3% of CMV-positive bronchoscopy episodes. When CMV diagnostic methods were evaluated against the comprehensive definition, the sensitivity and specificity of PCR, shell vial culture, and conventional culture were 91.3% and 94.6%, 54.4% and 97.4%, and 28.3% and 96.5%, respectively. Compared with culture, PCR provided significantly higher sensitivity and negative predictive value (P ≤ .001), without significantly lower positive predictive value. Cytomegalovirus quantitation did not improve test performance, resulting in a receiver operating characteristic curve with an area under the curve of 0.53. Conclusions. Cytomegalovirus PCR combined with a comprehensive clinical definition provides a pragmatic approach for the diagnosis of CMV pneumonitis. PMID:26885542

  18. Murine Typhus, Reunion, France, 2011–2013

    PubMed Central

    Camuset, Guillaume; Socolovschi, Cristina; Moiton, Marie-Pierre; Kuli, Barbara; Foucher, Aurélie; Poubeau, Patrice; Borgherini, Gianandrea; Wartel, Guillaume; Audin, Héla; Raoult, Didier; Filleul, Laurent; Parola, Philippe; Pagès, Fréderic

    2015-01-01

    Murine typhus case was initially identified in Reunion, France, in 2012 in a tourist. Our investigation confirmed 8 autochthonous cases that occurred during January 2011–January 2013 in Reunion. Murine typhus should be considered in local patients and in travelers returning from Reunion who have fevers of unknown origin. PMID:25625653

  19. Washing our hands of the congenital cytomegalovirus disease epidemic

    PubMed Central

    Cannon, Michael J; Davis, Katherine Finn

    2005-01-01

    Background Each year in the United States, an estimated 40,000 children are born with congenital cytomegalovirus (CMV) infection, causing an estimated 400 deaths and leaving approximately 8000 children with permanent disabilities such as hearing or vision loss, or mental retardation. More children are affected by serious CMV-related disabilities than by several better-known childhood maladies, including Down syndrome, fetal alcohol syndrome, and spina bifida. Discussion Congenital CMV is a prime target for prevention not only because of its substantial disease burden but also because the biology and epidemiology of CMV suggest that there are ways to reduce viral transmission. Because exposure to the saliva or urine of young children is a major cause of CMV infection among pregnant women, it is likely that good personal hygiene, especially hand-washing, can reduce the risk of CMV acquisition. Experts agree that such measures are likely to be efficacious (i.e., they will work if consistently followed) and the American College of Obstetricians and Gynecologists recommends that physicians counsel pregnant women about preventing CMV acquisition through careful attention to hygiene. However, because of concerns about effectiveness (i.e., Will women consistently follow hygienic practices as the result of interventions?), the medical and public health communities appear reluctant to embrace primary CMV prevention via improved hygienic practices, and educational interventions are rare. Current data on the effectiveness of such measures in preventing CMV infection are promising, but limited. There is strong evidence, however, that educational interventions can prevent other infectious diseases with similar transmission modes, suggesting that effective interventions can also be found for CMV. Until a CMV vaccine becomes available, effective educational interventions are needed to inform women about congenital CMV prevention. Summary Perhaps no single cause of birth defects

  20. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    SciTech Connect

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  1. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  2. Simian cytomegalovirus encodes five rapidly evolving chemokine receptor homologues.

    PubMed

    Sahagun-Ruiz, Alfredo; Sierra-Honigmann, Ana Maria; Krause, Philip; Murphy, Philip M

    2004-01-01

    Many herpesviruses, poxviruses and retroviruses encode proteins related to chemokines and chemokine receptors. The first one discovered, US28 of human cytomegalovirus (HCMV), is a 7-transmembrane domain G protein-coupled chemokine receptor able to activate diverse cellular responses, including cell migration and gene expression. A related ORF named US27 is adjacent to US28, but no functions have been defined yet. Recently ORFs 3-7, a cluster of five concatenated ORFs with highest homology to US28 and mammalian chemokine receptors, were sequenced from a prototype "stealth virus", an African green monkey simian CMV (SCMV)-related entity with unusual fungal, bacterial and mammalian gene homologues. Stealth viruses have not yet been independently replicated in tissue culture, and therefore their biological significance remains unclear. ORF3, ORF4, ORF5 and ORF6 are complete ORFs whereas the sequence of ORF7 is incomplete. In the present study, we identified five corresponding ORFs in the genome of a clinical isolate of bonafide simian CMV (SCMV), strain 9610. We found substantial differences between the SCMV and "stealth virus" ORFs, especially for ORF5 where there are 31% non-identities at the amino acid level. Four conserved genes unrelated to chemokines (64K/CAP, DNBI, UL32, and IE2) in SCMV and HCMV had on average 52% identity at the deduced amino acid level, whereas the corresponding values for the SCMV ORFs versus US28 ranged from 21% to 30%, suggesting rapid gene diversification in this cluster. Consistent with this, the amino acid identity for any pairwise comparison among the SCMV ORFs is only 21-52%. The chemokine receptor homologues are estimated to comprise approximately 2-3% of the SCMV genome. HCMV US27 and US28 homologues have also been identified in the chimpanzee CMV genome, whereas mouse and rat CMV lack chemokine receptor homologues. This genomic analysis indicates that SCMV has an unusually high concentration of US28-related chemokine receptor

  3. The immunological underpinnings of vaccinations to prevent cytomegalovirus disease.

    PubMed

    McCormick, A Louise; Mocarski, Edward S

    2015-03-01

    A universal cytomegalovirus (CMV) vaccination promises to reduce the burden of the developmental damage that afflicts up to 0.5% of live births worldwide. An effective vaccination that prevents transplacental transmission would reduce CMV congenital disease and CMV-associated still births and leave populations less susceptible to opportunistic CMV disease. Thus, a vaccination against this virus has long been recognized for the potential of enormous health-care savings because congenital damage is life-long and existing anti-viral options are limited. Vaccine researchers, industry leaders, and regulatory representatives have discussed the challenges posed by clinical efficacy trials that would lead to a universal CMV vaccine, reviewing the links between infection and disease, and identifying settings where disrupting viral transmission might provide a surrogate endpoint for disease prevention. Reducing the complexity of such trials would facilitate vaccine development. Children and adolescents are the targets for universal vaccination, with the expectation of protecting the offspring of immunized women. Given that a majority of females worldwide experience CMV infection during childhood, a universal vaccine must boost natural immunity and reduce transmission due to reactivation and re-infection as well as primary infection during pregnancy. Although current vaccine strategies recognize the value of humoral and cellular immunity, the precise mechanisms that act at the placental interface remain elusive. Immunity resulting from natural infection appears to limit rather than prevent reactivation of latent viruses and susceptibility to re-infection, leaving a challenge for universal vaccination to improve upon natural immunity levels. Despite these hurdles, early phase clinical trials have achieved primary end points in CMV seronegative subjects. Efficacy studies must be expanded to mixed populations of CMV-naive and naturally infected subjects to understand the overall

  4. The immunological underpinnings of vaccinations to prevent cytomegalovirus disease

    PubMed Central

    Louise McCormick, A.; Mocarski, Edward S.

    2015-01-01

    A universal cytomegalovirus (CMV) vaccination promises to reduce the burden of the developmental damage that afflicts up to 0.5% of live births worldwide. An effective vaccination that prevents transplacental transmission would reduce CMV congenital disease and CMV-associated still births and leave populations less susceptible to opportunistic CMV disease. Thus, a vaccination against this virus has long been recognized for the potential of enormous health-care savings because congenital damage is life-long and existing anti-viral options are limited. Vaccine researchers, industry leaders, and regulatory representatives have discussed the challenges posed by clinical efficacy trials that would lead to a universal CMV vaccine, reviewing the links between infection and disease, and identifying settings where disrupting viral transmission might provide a surrogate endpoint for disease prevention. Reducing the complexity of such trials would facilitate vaccine development. Children and adolescents are the targets for universal vaccination, with the expectation of protecting the offspring of immunized women. Given that a majority of females worldwide experience CMV infection during childhood, a universal vaccine must boost natural immunity and reduce transmission due to reactivation and re-infection as well as primary infection during pregnancy. Although current vaccine strategies recognize the value of humoral and cellular immunity, the precise mechanisms that act at the placental interface remain elusive. Immunity resulting from natural infection appears to limit rather than prevent reactivation of latent viruses and susceptibility to re-infection, leaving a challenge for universal vaccination to improve upon natural immunity levels. Despite these hurdles, early phase clinical trials have achieved primary end points in CMV seronegative subjects. Efficacy studies must be expanded to mixed populations of CMV-naive and naturally infected subjects to understand the overall

  5. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  6. Murine Model of Hindlimb Ischemia

    PubMed Central

    Niiyama, Hiroshi; Huang, Ngan F.; Rollins, Mark D.; Cooke, John P.

    2009-01-01

    In the United States, peripheral arterial disease (PAD) affects about 10 million individuals, and is also prevalent worldwide. Medical therapies for symptomatic relief are limited. Surgical or endovascular interventions are useful for some individuals, but long-term results are often disappointing. As a result, there is a need for developing new therapies to treat PAD. The murine hindlimb ischemia preparation is a model of PAD, and is useful for testing new therapies. When compared to other models of tissue ischemia such as coronary or cerebral artery ligation, femoral artery ligation provides for a simpler model of ischemic tissue. Other advantages of this model are the ease of access to the femoral artery and low mortality rate. In this video, we demonstrate the methodology for the murine model of unilateral hindimb ischemia. The specific materials and procedures for creating and evaluating the model will be described, including the assessment of limb perfusion by laser Doppler imaging. This protocol can also be utilized for the transplantation and non-invasive tracking of cells, which is demonstrated by Huang et al.1. PMID:19229179

  7. Murine model of wound healing.

    PubMed

    Dunn, Louise; Prosser, Hamish C G; Tan, Joanne T M; Vanags, Laura Z; Ng, Martin K C; Bursill, Christina A

    2013-05-28

    Wound healing and repair are the most complex biological processes that occur in human life. After injury, multiple biological pathways become activated. Impaired wound healing, which occurs in diabetic patients for example, can lead to severe unfavorable outcomes such as amputation. There is, therefore, an increasing impetus to develop novel agents that promote wound repair. The testing of these has been limited to large animal models such as swine, which are often impractical. Mice represent the ideal preclinical model, as they are economical and amenable to genetic manipulation, which allows for mechanistic investigation. However, wound healing in a mouse is fundamentally different to that of humans as it primarily occurs via contraction. Our murine model overcomes this by incorporating a splint around the wound. By splinting the wound, the repair process is then dependent on epithelialization, cellular proliferation and angiogenesis, which closely mirror the biological processes of human wound healing. Whilst requiring consistency and care, this murine model does not involve complicated surgical techniques and allows for the robust testing of promising agents that may, for example, promote angiogenesis or inhibit inflammation. Furthermore, each mouse acts as its own control as two wounds are prepared, enabling the application of both the test compound and the vehicle control on the same animal. In conclusion, we demonstrate a practical, easy-to-learn, and robust model of wound healing, which is comparable to that of humans.

  8. Plaque assay for murine norovirus.

    PubMed

    Gonzalez-Hernandez, Mariam B; Bragazzi Cunha, Juliana; Wobus, Christiane E

    2012-01-01

    Murine norovirus (MNV) is the only member of the Norovirus genus that efficiently grows in tissue culture. Cell lysis and cytopathic effect (CPE) are observed during MNV-1 infection of murine dendritic cells or macrophages. This property of MNV-1 can be used to quantify the number of infectious particles in a given sample by performing a plaque assay. The plaque assay relies on the ability of MNV-1 to lyse cells and to form holes in a confluent cell monolayer, which are called plaques. Multiple techniques can be used to detect viral infections in tissue culture, harvested tissue, clinical, and environmental samples, but not all measure the number of infectious particles (e.g. qRT-PCR). One way to quantify infectious viral particles is to perform a plaque assay, which will be described in detail below. A variation on the MNV plaque assay is the fluorescent focus assay, where MNV antigen is immunostained in cell monolayers. This assay can be faster, since viral antigen expression precedes plaque formation. It is also useful for titrating viruses unable to form plaques. However, the fluorescent focus assay requires additional resources beyond those of the plaque assay, such as antibodies and a microscope to count focus-forming units. Infectious MNV can also be quantified by determining the 50% Tissue Culture Infective Dose (TCID50). This assay measures the amount of virus required to produce CPE in 50% of inoculated tissue culture cells by endpoint titration. However, its limit of detection is higher compared to a plaque assay. In this article, we describe a plaque assay protocol that can be used to effectively determine the number of infectious MNV particles present in biological or environmental samples. This method is based on the preparation of 10-fold serial dilutions of MNV-containing samples, which are used to inoculate a monolayer of permissive cells (RAW 264.7 murine macrophage cells). Virus is allowed to attach to the cell monolayer for a given period of

  9. Gain of Virulence Caused by Loss of a Gene in Murine Cytomegalovirus‡

    PubMed Central

    Bubić, Ivan; Wagner, Markus; Krmpotić, Astrid; Saulig, Tanja; Kim, Sungjin; Yokoyama, Wayne M.; Jonjić, Stipan; Koszinowski, Ulrich H.

    2004-01-01

    Mouse strains are either resistant or susceptible to murine cytomegalovirus (MCMV). Resistance is determined by the Cmv1r (Ly49h) gene, which encodes the Ly49H NK cell activation receptor. The protein encoded by the m157 gene of MCMV has been defined as a ligand for Ly49H. To find out whether the m157 protein is the only Ly49H ligand encoded by MCMV, we constructed the m157 deletion mutant and a revertant virus. Viruses were tested for susceptibility to NK cell control in Ly49H+ and Ly49H− mouse strains. Deletion of the m157 gene abolished the viral activation of Ly49H+ NK cells, resulting in higher virus virulence in vivo. Thus, in the absence of m157, Ly49H+ mice react like susceptible strains. 129/SvJ mice lack the Ly49H activation NK cell receptor but express the inhibitory Ly49I NK cell receptor that binds to the m157 protein. The Δm157 inhibitory phenotype was weak because MCMV encodes a number of proteins that mediate NK inhibition, whose contribution could be shown by another mutant. PMID:15220428

  10. Angelica acutiloba Kitagawa Extract Attenuates DSS-Induced Murine Colitis

    PubMed Central

    Jang, Jong-Chan; Lee, Kang Min

    2016-01-01

    We examined the protective effects of Angelica acutiloba Kitagawa (AAK) extract on a murine model of acute experimental colitis. Colitis was induced by 4% dextran sulfate sodium (DSS) in the drinking water of male C57BL/6 mice, for 7 consecutive days. Oral administration of AAK extract (500 mg/kg/day) significantly alleviated DSS-induced symptoms such as anorexia, weight loss, events of diarrhea or bloody stools, and colon shortening. Histological damage was also ameliorated, as evidenced by the architectural preservation and suppression of inflammatory cell infiltration in colonic samples. Treatment improved the colonic mRNA expression of different inflammatory markers: cytokines, inducible enzymes, matrix metalloproteinases, and tight junction-related proteins. In the isolated serum, IgE levels were downregulated. Collectively, these findings indicate the therapeutic potentials of AAK as an effective complementary or alternative modality for the treatment of ulcerative colitis. PMID:27293323

  11. Angelica acutiloba Kitagawa Extract Attenuates DSS-Induced Murine Colitis.

    PubMed

    Jang, Jong-Chan; Lee, Kang Min; Ko, Seong-Gyu

    2016-01-01

    We examined the protective effects of Angelica acutiloba Kitagawa (AAK) extract on a murine model of acute experimental colitis. Colitis was induced by 4% dextran sulfate sodium (DSS) in the drinking water of male C57BL/6 mice, for 7 consecutive days. Oral administration of AAK extract (500 mg/kg/day) significantly alleviated DSS-induced symptoms such as anorexia, weight loss, events of diarrhea or bloody stools, and colon shortening. Histological damage was also ameliorated, as evidenced by the architectural preservation and suppression of inflammatory cell infiltration in colonic samples. Treatment improved the colonic mRNA expression of different inflammatory markers: cytokines, inducible enzymes, matrix metalloproteinases, and tight junction-related proteins. In the isolated serum, IgE levels were downregulated. Collectively, these findings indicate the therapeutic potentials of AAK as an effective complementary or alternative modality for the treatment of ulcerative colitis.

  12. Cytomegalovirus-specific CD8+ T cells do not develop in all renal transplant patients at risk of virus infection.

    PubMed

    Christmas, Stephen E; Halliday, Deborah; Lawton, Nichola; Wang, Haiyi; Abdalla, Ibrahim; Masters, James; Hassan, Rebecca L; Hart, Ian J; Khan, Naeem; Smith, Jane; Hammad, Abdul; Bakran, Ali

    2009-12-01

    Cytomegalovirus (CMV) is an important pathogen in immunosuppressed renal transplant patients. At greatest risk are CMV IgG seronegative recipients (R-) of kidneys from CMV IgG seropositive donors (D+), although not all develop CMV disease. The aims of the study were to determine whether D+/R- patients who do or do not go on to develop CMV disease differ in their CD8+ T cell responses to CMV. Responses to the immunodominant NLVPMVATV peptide from the CMV structural protein pp65 in HLA-A2+ renal transplant patients were quantified using HLA tetramers/pentamers. Most D+/R+ patients had detectable tetramer+ cells while most D-/R- patients did not. Around 50% of D+/R- patients had some CD8+ tetramer+ cells and there was a strong correlation between % tetramer+ cells and the occurrence of a CMV infection post-transplantation (P<0.005). 18/41 (44%) of CMV negative patients receiving a kidney from a CMV+ donor failed to develop a detectable CMV infection, or significant numbers of tetramer+ cells. There was no relationship between CMV infection and acute cellular rejection. There was a tendency for patients who were given pre-emptive antiviral therapy to have lower levels of tetramer+ cells but this was not statistically significant. Hence the results show that CMV- patients receiving a kidney from a CMV+ donor do not inevitably acquire CMV infection. Those without CMV disease did not show any T cell response while most patients with detectable CMV developed specific CD8+ T cells.

  13. Fatal pulmonary co-infection with pneumocystis and cytomegalovirus in a patient with acquired immunodeficiency syndrome.

    PubMed

    Chuganji, Eri; Abe, Toshikazu; Kobayashi, Hiroyuki; Nakano, Noriyuki; Kanai, Takao; Ohara, Gen; Takayashiki, Norio; Noguchi, Masayuki; Morishita, Yukio; Aoki, Makoto; Tokuda, Yasuharu

    2014-01-01

    A 33-year-old homosexual Japanese man who admitted to having sex with men presented with a two-week history of dyspnea and fever. Chest imaging showed diffuse pulmonary frosted-glass-like shadows. A blood test revealed positive HIV antibodies with a CD4 cell count of 66/μL. Bronchoalveolar lavage identified pneumocystis. Although the patient exhibited a transient response to anti-pneumocystis treatment and mega-dose steroid pulse therapy, he eventually died from respiratory failure. An autopsy suggested massive cytomegalovirus and pneumocystis pneumonitis. The pulmonary co-infection with cytomegalovirus may have been worsened by the use of mega-dose steroids, and such therapy should be avoided in patients with a high HIV viral load and low CD4 count.

  14. Localization of cytomegalovirus DNA in plastic-embedded sections by in situ hybridization. A methodologic study.

    PubMed Central

    Cao, M.; Beckstead, J. H.

    1989-01-01

    The use of in situ hybridization for the identification of specific nucleic acid sequences in tissue sections has the potential for broad application in pathology. Although this technique has been successfully applied to routine paraffin sections, there have been few studies of the application of in situ hybridization to plastic-embedded tissue sections. The authors adapted techniques developed for paraffin sections to take advantage of the potential for improved morphology and more precise localization inherent in the plastic sections. A commercially available biotinylated DNA probe specific for the cytomegalovirus to develop a practical method for detection of nucleic acid sequences in plastic-embedded tissues was used. Using plastic sections, cytomegalovirus DNA sequences could readily be identified with precise localization of the virus and superb histology. Images Figure 2 Figure 3 Figure 1 Figure 4 PMID:2537020

  15. Fetal Brain Magnetic Resonance Imaging Findings In Congenital Cytomegalovirus Infection With Postnatal Imaging Correlation.

    PubMed

    Averill, Lauren W; Kandula, Vinay V R; Akyol, Yakup; Epelman, Monica

    2015-12-01

    Fetal brain magnetic resonance imaging (MRI) is a powerful tool in the diagnosis of symptomatic congenital cytomegalovirus infection, requiring a detailed search for specific features. A combination of anterior temporal lobe abnormalities, white matter lesions, and polymicrogyria is especially predictive. Fetal MRI may provide a unique opportunity to detect anterior temporal cysts and occipital horn septations, as dilation of these areas may decrease later in development. Cortical migration abnormalities, white matter abnormalities, cerebellar dysplasia, and periventricular calcifications are often better depicted on postnatal imaging but can also be detected on fetal MRI. We present the prenatal brain MRI findings seen in congenital cytomegalovirus infection and provide postnatal imaging correlation, highlighting the evolution of findings at different times in prenatal and postnatal developments. PMID:26614131

  16. Dataset of aqueous humor cytokine profile in HIV patients with Cytomegalovirus (CMV) retinitis.

    PubMed

    Iyer, Jayant Venkatramani; Agrawal, Rupesh; Yeo, Tun Kuan; Gunasekeran, Dinesh V; Balne, Praveen Kumar; Lee, Bernett; Au, Veonice Bijin; Connolly, John; Teoh, Stephen C B

    2016-09-01

    The data shows the aqueous humor cytokine profiling results acquired in a small cohort of 17 HIV patients clinically diagnosed with Cytomegalovirus retinitis using the FlexMAP 3D (Luminex®) platform using the Milliplex Human Cytokine® kit. Aqueous humor samples were collected from these patients at different time points (pre-treatment and at 4-weekly intervals through the 12-week course of intravitreal ganciclovir treatment) and 41 cytokine levels were analyzed at each time point. CMV DNA viral load was assessed in 8 patients at different time points throughout the course of ganciclovir treatment. The data described herein is related to the research article entitled "Aqueous humor immune factors and cytomegalovirus (CMV) levels in CMV retinitis through treatment - The CRIGSS study" (Iyer et al., 2016) [1]. Cytokine levels against the different time points which indicate the response to the given treatment and against the CMV viral load were analyzed. PMID:27547803

  17. [Ménétrieŕs disease associated with cytomegalovirus infection].

    PubMed

    Fernández Caamaño, B; Ramos Boluda, E; Martínez-Ojinaga Nodal, E; Molina Arias, M; Sarría Osés, J; Prieto Bozano, G

    2015-01-01

    Menetrier's disease is a rare entity in children, characterized by a protein-losing gastroenteropathy with thickening of the gastric mucosa and generalized edema. The most common etiology is viral, and cytomegalovirus is the agent most frequently implicated. Unlike in the adult, it is a self-limited disorder with a good prognosis in children. Four patients (three boys and one girl) diagnosed with Ménétrier disease in the past five years were reviewed. The mean age at presentation was 28.7 months (range: 10-48 months). The most common clinical symptoms were fever, vomiting, and edema. Endoscopy showed thickened gastric folds and erosions in several stages. All patients had an associated gastric cytomegalovirus infection, and a favorable outcome, with resolution of the disorder,was observed within a few weeks.

  18. Massive Alimentary Tract Bleeding due to Cytomegalovirus Infection in an Elderly Patient.

    PubMed

    Koc, Bora; Bircan, Huseyin Yuce; Altaner, Semsi; Cinar, Ozlem; Ozcelik, Umit; Yavuz, Alpaslan; Kemik, Ozgur

    2014-08-13

    In recent years, cytomegalovirus (CMV) has been recognized as an important common pathogen in immunocompromized patients. This is due to the increasing number of immunosuppressive medications, intensive cancer chemotherapy use, recurrent transplantations, progressively aging population, and the higher number of human immunodeficiency virus infections. Cytomegalovirus infection especially interests the gastrointestinal tract, anywhere, from the mouth to the anus. Namely, the most commonly affected area is the colon, followed by duodenum, stomach, esophagus and small intestine. The most frequent manifestations of CMV colitis are: diarrhea, fever, gastrointestinal bleeding and abdominal pain. We report here the case of an 82-year-old woman, who was treated for non-Hodgkin lymphoma; she was admitted to the emergency department for abdominal pain and diffuse arthralgia, following massive upper- and lower- gastrointestinal bleeding, due to duodenal and colonic ulcers related to CMV infection. PMID:25276331

  19. A Supraglottic Pseudotumor in an Immunocompromised Patient with Nephrotic Syndrome, Herpes Zoster, and a Cytomegalovirus Infection.

    PubMed

    Akimoto, Tetsu; Yamazaki, Tomoyuki; Saito, Osamu; Muto, Shigeaki; Kusano, Eiji; Nagata, Daisuke

    2016-01-01

    Several viral infections may occasionally induce supraglottic mass lesions, resulting in an obstructive airway emergency. We herein report one such case in a 63-year-old male immunocompromised patient with nephrotic syndrome due to membranous nephropathy who also had ophthalmic herpes zoster with a laryngeal mass, which required urgent intubation and mechanical ventilation. The patient was initially treated with acyclovir; however, because a serological analysis revealed a concurrent cytomegalovirus infection, we discontinued the administration of acyclovir and gave priority to the simultaneous treatment of the cytomegalovirus and varicella-zoster virus infections with ganciclovir. The clinical course was favorable, and he was weaned from the ventilator 10 days later when a serial imaging analysis revealed no signs of the supraglottic mass, leading us to conclude that these two viral infections could have additively or synergistically contributed to the development of the local pseudotumor. The diagnostic and therapeutic concerns arising in the current case are also discussed. PMID:27547043

  20. A Supraglottic Pseudotumor in an Immunocompromised Patient with Nephrotic Syndrome, Herpes Zoster, and a Cytomegalovirus Infection

    PubMed Central

    Akimoto, Tetsu; Yamazaki, Tomoyuki; Saito, Osamu; Muto, Shigeaki; Kusano, Eiji; Nagata, Daisuke

    2016-01-01

    Several viral infections may occasionally induce supraglottic mass lesions, resulting in an obstructive airway emergency. We herein report one such case in a 63-year-old male immunocompromised patient with nephrotic syndrome due to membranous nephropathy who also had ophthalmic herpes zoster with a laryngeal mass, which required urgent intubation and mechanical ventilation. The patient was initially treated with acyclovir; however, because a serological analysis revealed a concurrent cytomegalovirus infection, we discontinued the administration of acyclovir and gave priority to the simultaneous treatment of the cytomegalovirus and varicella-zoster virus infections with ganciclovir. The clinical course was favorable, and he was weaned from the ventilator 10 days later when a serial imaging analysis revealed no signs of the supraglottic mass, leading us to conclude that these two viral infections could have additively or synergistically contributed to the development of the local pseudotumor. The diagnostic and therapeutic concerns arising in the current case are also discussed. PMID:27547043

  1. Cytomegalovirus implicated in a case of progressive outer retinal necrosis (PORN).

    PubMed

    Sfeir, Maroun

    2015-08-01

    Progressive outer retinal necrosis, also known as PORN, has been described as a variant of necrotizing herpetic retinopathy, occurring particularly in patients with acquired immune deficiency syndrome (AIDS). Although the etiologic organism has been reported to be Varicella-zoster virus, cytomegalovirus (CMV) can be an etiologic agent. Our case illustrates the occurrence of two opportunistic infections: PORN associated with CMV and Mycobacterium avium intracellulare duodenitis in a patient with uncontrolled HIV infection. PMID:26209386

  2. Is Pulmonary non-Tuberculous Mycobacterial Disease Linked with a High Burden of Latent Cytomegalovirus?

    PubMed

    Amran, Fathiah S; Kim, Kyungchul; Lim, Andrew; Thomson, Rachel; Lee, Silvia; Waterer, Grant; Price, Patricia

    2016-02-01

    Cytomegalovirus (CMV) establishes lifelong infections with episodes of active replication. We hypothesized that recurrent CMV replication in older individuals may suppress protective immune responses to non-tuberculous mycobacteria (NTM) and so potentiate pulmonary disease. Accordingly, levels of antibodies to three CMV antigen preparations were higher in NTM patients than in age-matched controls. This did not reflect broad-spectrum B cell activation as total immunoglobulin levels were not equivalently increased. PMID:26759253

  3. Detection of human cytomegalovirus and epstein-barr virus in coronary atherosclerotic tissue.

    PubMed

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-07-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

  4. Cytomegalovirus implicated in a case of progressive outer retinal necrosis (PORN).

    PubMed

    Sfeir, Maroun

    2015-08-01

    Progressive outer retinal necrosis, also known as PORN, has been described as a variant of necrotizing herpetic retinopathy, occurring particularly in patients with acquired immune deficiency syndrome (AIDS). Although the etiologic organism has been reported to be Varicella-zoster virus, cytomegalovirus (CMV) can be an etiologic agent. Our case illustrates the occurrence of two opportunistic infections: PORN associated with CMV and Mycobacterium avium intracellulare duodenitis in a patient with uncontrolled HIV infection.

  5. International consensus guidelines on the management of cytomegalovirus in solid organ transplantation.

    PubMed

    Kotton, Camille N; Kumar, Deepali; Caliendo, Angela M; Asberg, Anders; Chou, Sunwen; Snydman, David R; Allen, Upton; Humar, Atul

    2010-04-15

    Cytomegalovirus (CMV) remains one of the most common infections after solid organ transplantation, resulting in significant morbidity, graft loss, and occasional mortality. Management of CMV varies considerably among transplant centers. A panel of experts on CMV and solid organ transplant was convened by The Infectious Diseases Section of The Transplantation Society to develop evidence and expert opinion-based consensus guidelines on CMV management including diagnostics, immunology, prevention, treatment, drug resistance, and pediatric issues.

  6. Strain Variation and Disease Severity in Congenital Cytomegalovirus Infection: In Search of a Viral Marker.

    PubMed

    Arav-Boger, Ravit

    2015-09-01

    The wide spectrum of congenital cytomegalovirus (CMV) disease and known differences in the biology and in vitro growth of CMV strains continue to drive studies in search for specific viral genetic determinants that may predict severity of congenital CMV disease. Several CMV genes have been studied in detail in congenitally infected children, but the complexity of the viral genome and differences in the definition of symptomatic disease versus asymptomatic CMV infection continue to raise questions related to what constitutes a pathogenic CMV strain.

  7. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  8. Cytomegalovirus shapes long-term immune reconstitution after allogeneic stem cell transplantation

    PubMed Central

    Itzykson, Raphael; Robin, Marie; Moins-Teisserenc, Helene; Delord, Marc; Busson, Marc; Xhaard, Aliénor; de Fontebrune, Flore Sicre; de Latour, Régis Peffault; Toubert, Antoine; Socié, Gérard

    2015-01-01

    Immune reconstitution after allogeneic stem cell transplantation is a dynamic and complex process depending on the recipient and donor characteristics, on the modalities of transplantation, and on the occurrence of graft-versus-host disease. Multivariate methods widely used for gene expression profiling can simultaneously analyze the patterns of a great number of biological variables on a heterogeneous set of patients. Here we use these methods on flow cytometry assessment of up to 25 lymphocyte populations to analyze the global pattern of long-term immune reconstitution after transplantation. Immune patterns were most distinct from healthy controls at six months, and had not yet fully recovered as long as two years after transplant. The two principal determinants of variability were linked to the balance of B and CD8+ T cells and of natural killer and B cells, respectively. Recipient’s cytomegalovirus serostatus, cytomegalovirus replication, and chronic graft-versus-host disease were the main factors shaping the immune pattern one year after transplant. We identified a complex signature of under- and over-representation of immune populations dictated by recipient’s cytomegalovirus seropositivity. Finally, we identified dimensions of variance in immune patterns as significant predictors of long-term non-relapse mortality, independently of chronic graft-versus-host disease. PMID:25261095

  9. Colonic perforation in a patient with systemic lupus erythematosus accompanied by cytomegalovirus infection: A case report

    PubMed Central

    Tachikawa, Yuichi; Nozawa, Hiroaki; Tanaka, Junichiro; Nishikawa, Takeshi; Tanaka, Toshiaki; Kiyomatsu, Tomomichi; Hata, Keisuke; Kawai, Kazushige; Kazama, Shinsuke; Yamaguchi, Hironori; Ishihara, Soichiro; Sunami, Eiji; Kitayama, Joji; Fujisawa, Madoka; Takahashi, Katutoshi; Sakaguchi, Yoshiki; Ushiku, Tetsuo; Fukayama, Masashi; Watanabe, Toshiaki

    2016-01-01

    Introduction Cytomegalovirus (CMV) infection of the gastrointestinal tract is an uncommon illness, but can be observed in immunocompromised patients. Systemic lupus erythematosus (SLE) patients are generally at high risk of CMV infection. Here we report a subacute progressive case of colitis in SLE accompanied by cytomegalovirus infection. Presentation of case The patient, a 79-year-old woman, was hospitalized complaining of fever, polyarthritis, and skin ulcer that had lasted seven days. She additionally manifested vomiting, high fever, and right abdominal pain within two weeks thereafter, and was diagnosed with perforation of the intestine. Emergency operation was carried out for panperitonitis due to perforation of one of the multiple colon ulcers. Multidisciplinary postoperative treatment could not save her life. Pathological examination suggested that cytomegalovirus infection as well as cholesterin embolization contributed to the rapid progression of colitis. Discussion There have been only a limited number of case reports of CMV enteritis in SLE. Moreover, only two SLE patients on multiple medications have been reported to experience gastrointestinal perforation. Viral infections, including CMV, can induce clinical manifestations resembling SLE and for this reason we suspect that there are potentially many more patients misdiagnosed and/or unreported. Conclusion Our case underscores the importance of exploring the possibility of CMV infection as a differential diagnosis in SLE patients with obvious gastrointestinal symptoms who were treated by immunosuppressive drugs. PMID:27093690

  10. Opossums and Cat Fleas: New Insights in the Ecology of Murine Typhus in Galveston, Texas.

    PubMed

    Blanton, Lucas S; Idowu, Boluwatife M; Tatsch, Tyler N; Henderson, Joshua M; Bouyer, Donald H; Walker, David H

    2016-08-01

    Murine typhus is an acute undifferentiated febrile illness caused by Rickettsia typhi The classic reservoir (Rattus spp.) and flea vector (Xenopsylla cheopis) were once culprits of murine typhus in the United States. Vector and rodent control efforts have drastically decreased the prevalence of disease, except in a few endemic foci where opossums and cat fleas play a role in transmission. Since 2012, there has been a reemergence of murine typhus in Galveston, TX. We hypothesize that opossums and cat fleas are involved in the transmission of R. typhi in Galveston. To explore this, we sought to find the seroprevalence of typhus group antibodies from opossums. We also sought to find the prevalence of R. typhi in fleas parasitizing these animals. We collected blood from 12 opossums and found that eight (66.7%) had the presence of anti-R. typhi antibodies. All opossums were infested with fleas; a total of 250 Ctenocephalides felis fleas were collected from these animals. Seven opossums (53.8%) were infested with fleas that had molecular evidence of R. typhi infection, while six (46.2%) were infested with fleas that contained Candidatus Rickettsia senegalensis, an organism closely related to R. felis The minimum flea infection rate for R. typhi was 7.0%. The minimum infection rate for Candidatus R. senegalensis was 6.1%. Our study demonstrates that fleas infected with R. typhi parasitize opossums in Galveston. It is therefore likely that opossums and their fleas play a role in the city's recent reemergence of murine typhus.

  11. Quantitative Proteomic Analyses of Human Cytomegalovirus-Induced Restructuring of Endoplasmic Reticulum-Mitochondrial Contacts at Late Times of Infection*

    PubMed Central

    Zhang, Aiping; Williamson, Chad D.; Wong, Daniel S.; Bullough, Matthew D.; Brown, Kristy J.; Hathout, Yetrib; Colberg-Poley, Anamaris M.

    2011-01-01

    Endoplasmic reticulum-mitochondrial contacts, known as mitochondria-associated membranes, regulate important cellular functions including calcium signaling, bioenergetics, and apoptosis. Human cytomegalovirus is a medically important herpesvirus whose growth increases energy demand and depends upon continued cell survival. To gain insight into how human cytomegalovirus infection affects endoplasmic reticulum-mitochondrial contacts, we undertook quantitative proteomics of mitochondria-associated membranes using differential stable isotope labeling by amino acids in cell culture strategy and liquid chromatography-tandem MS analysis. This is the first reported quantitative proteomic analyses of a suborganelle during permissive human cytomegalovirus infection. Human fibroblasts were uninfected or human cytomegalovirus-infected for 72 h. Heavy mitochondria-associated membranes were isolated from paired unlabeled, uninfected cells and stable isotope labeling by amino acids in cell culture-labeled, infected cells and analyzed by liquid chromatography-tandem MS analysis. The results were verified by a reverse labeling experiment. Human cytomegalovirus infection dramatically altered endoplasmic reticulum-mitochondrial contacts by late times. Notable is the increased abundance of several fundamental networks in the mitochondria-associated membrane fraction of human cytomegalovirus-infected fibroblasts. Chaperones, including HSP60 and BiP, which is required for human cytomegalovirus assembly, were prominently increased at endoplasmic reticulum-mitochondrial contacts after infection. Minimal translational and translocation machineries were also associated with endoplasmic reticulum-mitochondrial contacts and increased after human cytomegalovirus infection as were glucose regulated protein 75 and the voltage dependent anion channel, which can form an endoplasmic reticulum-mitochondrial calcium signaling complex. Surprisingly, mitochondrial metabolic enzymes and cytosolic

  12. Pathobiology of human RH strain induced experimental toxoplasmosis in murine model.

    PubMed

    Sudan, Vikrant; Tewari, A K; Singh, Harkirat; Singh, R

    2016-09-01

    Of late, toxoplasmosis has gained immense importance as an opportunist parasite in immunocompromised patients. In immunocompromised subjects, the disease is supposed to occur in acute form and causes acute toxoplasmic encephalitis. However, the exact pathogenesis of other vital organs, particularly in acute form of infection, is still a matter of debate. Therefore, an attempt was made to study the pathogenesis of acute form of toxoplasmosis using cryopreserved human RH strain of the parasite in murine models. For this, 100 tachyzoites were given to individual mice and upon the setup of acute form of infection, the mice were euthanized and the organs were processed for histopathology. Histopathology revealed tachyzoites in liver only while severe necrosis due to multiplication of tachyzoites were visible in liver, spleen, lungs and brain. Kidneys and heart appeared more or less normal. Finally, the pathology of disease in these organs is described in detail. The present research has generated some vital information regarding necrotic changes in tissues due to acute toxoplasmosis and will defiantly help the researchers in the better understanding of disease particularly in humans and putting up of suitable treatment regime for human subjects infected with acute toxoplasmosis. PMID:27605794

  13. Apoptosis in irradiated murine tumors.

    PubMed

    Stephens, L C; Ang, K K; Schultheiss, T E; Milas, L; Meyn, R E

    1991-09-01

    Early radiation responses of transplantable murine ovarian (OCaI) and hepatocellular (HCaI) carcinomas were examined at 6, 24, 48, 96, and 144 h after single photon doses of 25, 35, or 45 Gy. Previous studies using tumor growth delay and tumor radiocurability assays had shown OCaI tumors to be relatively radiosensitive and HCaI tumors to be radioresistant. At 6 h, approximately 20% of nuclei in OCaI tumors showed aberrations characteristic of cell death by apoptosis. This contrasted to an incidence of 3% in HCaI tumors. Mitotic activity was eliminated in OCaI tumors but was only transiently suppressed in HCaI tumors. At 24-96 h, OCaI tumors continued to display apoptosis and progressive necrosis, whereas HCaI tumors responded by exhibiting marked pleomorphism. Factors other than mitotic activity may influence tumor radiosensitivity, and one of these may be susceptibility to induction of apoptosis (programmed cell death), because this was a prominent early radiation response by the radiosensitive OCaI tumors.

  14. Apoptosis in irradiated murine tumors.

    PubMed

    Stephens, L C; Ang, K K; Schultheiss, T E; Milas, L; Meyn, R E

    1991-09-01

    Early radiation responses of transplantable murine ovarian (OCaI) and hepatocellular (HCaI) carcinomas were examined at 6, 24, 48, 96, and 144 h after single photon doses of 25, 35, or 45 Gy. Previous studies using tumor growth delay and tumor radiocurability assays had shown OCaI tumors to be relatively radiosensitive and HCaI tumors to be radioresistant. At 6 h, approximately 20% of nuclei in OCaI tumors showed aberrations characteristic of cell death by apoptosis. This contrasted to an incidence of 3% in HCaI tumors. Mitotic activity was eliminated in OCaI tumors but was only transiently suppressed in HCaI tumors. At 24-96 h, OCaI tumors continued to display apoptosis and progressive necrosis, whereas HCaI tumors responded by exhibiting marked pleomorphism. Factors other than mitotic activity may influence tumor radiosensitivity, and one of these may be susceptibility to induction of apoptosis (programmed cell death), because this was a prominent early radiation response by the radiosensitive OCaI tumors. PMID:1886987

  15. Comparative murine norovirus studies reveal a lack of correlation between intestinal virus titers and enteric pathology

    PubMed Central

    Kahan, Shannon M.; Liu, Guangliang; Reinhard, Mary K.; Hsu, Charlie C.; Livingston, Robert S.; Karst, Stephanie M.

    2011-01-01

    Human noroviruses are significant emerging pathogens, causing the majority of non-bacterial gastroenteritis outbreaks worldwide. The recent discovery of 30 murine norovirus strains is beginning to facilitate a detailed investigation of norovirus pathogenesis. Here, we have performed an in vivo comparative analysis of two murine norovirus strains, MNV-1 and MNV-3. In immunocompetent mice, MNV-1 caused modest intestinal pathology whereas MNV-3 was attenuated compared to MNV-1. Surprisingly though, MNV-3 reached higher titers in intestinal tissue than MNV-1. MNV-3 also displayed attenuation in mice deficient in the critical interferon signaling molecule STAT-1, demonstrating that MNV-3 attenuation is not a result of increased interferon sensitivity. Importantly, MNV-3-infected mice lost weight and developed gastric bloating and diarrhea in STAT1−/− mice, from which all animals recovered. This disease profile recapitulates several key features of acute gastroenteritis experienced by people infected with a human norovirus. PMID:22018636

  16. Persistence of intestinal antibody response to heterologous rotavirus infection in a murine model beyond 1 year.

    PubMed Central

    Shaw, R D; Merchant, A A; Groene, W S; Cheng, E H

    1993-01-01

    We used an ELISPOT (enzyme-linked immunosorbent spot) assay to quantitate the long-term rotavirus-specific intestinal antibody response in a murine model. The frequency of murine intestinal antibody-secreting cells (ASCs) was followed for a period of 1 year after a single dose of rhesus rotavirus (10(6) PFU) was administered at 10 days of age. Some animals were boosted at that time with a second dose. One year after infection, virus-specific ASCs declined from acute-phase levels, but they were still present at significant levels (1.32 x 10(4) virus-specific ASCs per 10(6) intestinal mononuclear cells; approximately 17% of the previously reported response at 1 month after infection). A booster dose 1 year after the primary infection produced a 100% increase in virus-specific ASCs but did not restore the response to that of the primary infection. PMID:8381806

  17. Can microbiota transplantation abrogate murine colonization resistance against Campylobacter jejuni?

    PubMed Central

    Plickert, R.; Fischer, A.; Göbel, U. B.; Bereswill, S.

    2013-01-01

    Enterocolitis caused by Campylobacter jejuni represents an important socioeconomic burden worldwide. The host-specific intestinal microbiota is essential for maintaining colonization resistance (CR) against C. jejuni in conventional mice. Notably, CR is abrogated by shifts of the intestinal microbiota towards overgrowth with commensal E. coli during acute ileitis. Thus, we investigated whether oral transplantation (TX) of ileal microbiota derived from C. jejuni susceptible mice with acute ileitis overcomes CR of healthy conventional animals. Four days following ileitis microbiota TX or ileitis induction and right before C. jejuni infection, mice displayed comparable loads of main intestinal bacterial groups as shown by culture. Eight days following ileitis induction, but not ileal microbiota TX, however, C. jejuni could readily colonize the gastrointestinal tract of conventional mice and also translocate to extra-intestinal tissue sites such as mesenteric lymph nodes, spleen, liver, and blood within 4 days following oral infection. Of note, C. jejuni did not further deteriorate histopathology following ileitis induction. Lack of C. jejuni colonization in TX mice was accompanied by a decrease of commensal E. coli loads in the feces 4 days following C. jejuni infection. In summary, oral ileal microbiota TX from susceptible donors is not sufficient to abrogate murine CR against C. jejuni. PMID:24265916

  18. Dipeptidyl Peptidase IV Is a Human and Murine Neutrophil Chemorepellent

    PubMed Central

    Herlihy, Sarah E.; Pilling, Darrell; Maharjan, Anu S.; Gomer, Richard H.

    2013-01-01

    In Dictyostelium discoideum, AprA is a secreted protein that inhibits proliferation and causes chemorepulsion of Dictyostelium cells, yet AprA has little sequence similarity to any human proteins. We found that a predicted structure of AprA has similarity to human dipeptidyl peptidase IV (DPPIV). DPPIV is a serine protease present in extracellular fluids that cleaves peptides with a proline or alanine in the second position. In Insall chambers, DPPIV gradients below, similar to, and above the human serum DPPIV concentration cause movement of human neutrophils away from the higher concentration of DPPIV. A 1% DPPIV concentration difference between the front and back of the cell is sufficient to cause chemorepulsion. Neutrophil speed and viability are unaffected by DPPIV. DPPIV inhibitors block DPPIV-mediated chemorepulsion. In a murine model of acute respiratory distress syndrome, aspirated bleomycin induces a significant increase in the number of neutrophils in the lungs after 3 d. Oropharyngeal aspiration of DPPIV inhibits the bleomycin-induced accumulation of mouse neutrophils. These results indicate that DPPIV functions as a chemorepellent of human and mouse neutrophils, and they suggest new mechanisms to inhibit neutrophil accumulation in acute respiratory distress syndrome. PMID:23677473

  19. Retino-hypothalamic regulation of light-induced murine sleep

    PubMed Central

    Muindi, Fanuel; Zeitzer, Jamie M.; Heller, Horace Craig

    2014-01-01

    The temporal organization of sleep is regulated by an interaction between the circadian clock and homeostatic processes. Light indirectly modulates sleep through its ability to phase shift and entrain the circadian clock. Light can also exert a direct, circadian-independent effect on sleep. For example, acute exposure to light promotes sleep in nocturnal animals and wake in diurnal animals. The mechanisms whereby light directly influences sleep and arousal are not well understood. In this review, we discuss the direct effect of light on sleep at the level of the retina and hypothalamus in rodents. We review murine data from recent publications showing the roles of rod-, cone- and melanopsin-based photoreception on the initiation and maintenance of light-induced sleep. We also present hypotheses about hypothalamic mechanisms that have been advanced to explain the acute control of sleep by light. Specifically, we review recent studies assessing the roles of the ventrolateral preoptic area (VLPO) and the suprachiasmatic nucleus (SCN). We also discuss how light might differentially promote sleep and arousal in nocturnal and diurnal animals respectively. Lastly, we suggest new avenues for research on this topic which is still in its early stages. PMID:25140132

  20. Titration of murine leukemia viruses with rat cell line RFL.

    PubMed

    Koga, M

    1977-08-01

    Normal rat embryo cell (RFL) from syncytia after infection with murine leukemia virus. The assay for counting the number of syncytium foci produced in RFL cells is a sensitive method for a direct infectivity assay of murine leukemia virus.

  1. Murine Norovirus: Propagation, Quantification and Genetic Manipulation

    PubMed Central

    Hwang, Seungmin; Alhatlani, Bader; Arias, Armando; Caddy, Sarah L; Christodoulou, Constantina; Cunha, Juliana; Emmott, Ed; Gonzalez-Hernandez, Marta; Kolawole, Abimbola; Lu, Jia; Rippinger, Christine; Sorgeloos, Frédéric; Thorne, Lucy; Vashist, Surender; Goodfellow, Ian

    2014-01-01

    Murine norovirus (MNV) is a positive-sense, plus-stranded RNA virus in the Caliciviridae family. It is the most common pathogen in biomedical research colonies. MNV is also related to the human noroviruses, which cause the majority of non-bacterial gastroenteritis worldwide. Like the human noroviruses, MNV is an enteric virus that replicates in the intestine and is transmitted by the fecal-oral route. MNV replicates in murine macrophages and dendritic cells in cells in culture and in the murine host. This virus is often used to study mechanisms in norovirus biology, because the human noroviruses are refractory to growth in cell culture. MNV combines the availability of a cell culture and reverse genetics system with the ability to study infection in the native host. Herein, we describe a panel of techniques that are commonly used to study MNV biology. PMID:24789596

  2. Potential Contribution of Cytomegalovirus Infection to Prenatal and Early Neonatal Mortality of Monkeys in the Adler Breeding Center.

    PubMed

    Shamsutdinova, O A; Agumava, A A; Chikobava, M G; Vyshemirsky, O I

    2015-11-01

    Scrapings from the cervical canals and uterine cavities of females with a history of miscarriages, pathological deliveries, and stillbirths were tested for the cytomegalovirus DNA. The incidence of the agent in the females with a history of gestosis and abnormal deliveries was significantly higher than in females without anamnesis of this kind. Parenchymatous organs of stillborn neonates and animals dead during the first month of life were studied. This analysis and studies of the umbilical cords and placentas showed generalized cytomegalovirus infection in 22% dead animals, which objectively proved intrauterine infection.

  3. The Breadth of Synthetic Long Peptide Vaccine-Induced CD8+ T Cell Responses Determines the Efficacy against Mouse Cytomegalovirus Infection

    PubMed Central

    Panagioti, Eleni; Redeker, Anke; van Duikeren, Suzanne; Franken, Kees LMC; Drijfhout, Jan Wouter; van der Burg, Sjoerd H.

    2016-01-01

    There is an ultimate need for efficacious vaccines against human cytomegalovirus (HCMV), which causes severe morbidity and mortality among neonates and immunocompromised individuals. In this study we explored synthetic long peptide (SLP) vaccination as a platform modality to protect against mouse CMV (MCMV) infection in preclinical mouse models. In both C57BL/6 and BALB/c mouse strains, prime-booster vaccination with SLPs containing MHC class I restricted epitopes of MCMV resulted in the induction of strong and polyfunctional (i.e., IFN-γ+, TNF+, IL-2+) CD8+ T cell responses, equivalent in magnitude to those induced by the virus itself. SLP vaccination initially led to the formation of effector CD8+ T cells (KLRG1hi, CD44hi, CD127lo, CD62Llo), which eventually converted to a mixed central and effector-memory T cell phenotype. Markedly, the magnitude of the SLP vaccine-induced CD8+ T cell response was unrelated to the T cell functional avidity but correlated to the naive CD8+ T cell precursor frequency of each epitope. Vaccination with single SLPs displayed various levels of long-term protection against acute MCMV infection, but superior protection occurred after vaccination with a combination of SLPs. This finding underlines the importance of the breadth of the vaccine-induced CD8+ T cell response. Thus, SLP-based vaccines could be a potential strategy to prevent CMV-associated disease. PMID:27637068

  4. The Breadth of Synthetic Long Peptide Vaccine-Induced CD8+ T Cell Responses Determines the Efficacy against Mouse Cytomegalovirus Infection.

    PubMed

    Panagioti, Eleni; Redeker, Anke; van Duikeren, Suzanne; Franken, Kees Lmc; Drijfhout, Jan Wouter; van der Burg, Sjoerd H; Arens, Ramon

    2016-09-01

    There is an ultimate need for efficacious vaccines against human cytomegalovirus (HCMV), which causes severe morbidity and mortality among neonates and immunocompromised individuals. In this study we explored synthetic long peptide (SLP) vaccination as a platform modality to protect against mouse CMV (MCMV) infection in preclinical mouse models. In both C57BL/6 and BALB/c mouse strains, prime-booster vaccination with SLPs containing MHC class I restricted epitopes of MCMV resulted in the induction of strong and polyfunctional (i.e., IFN-γ+, TNF+, IL-2+) CD8+ T cell responses, equivalent in magnitude to those induced by the virus itself. SLP vaccination initially led to the formation of effector CD8+ T cells (KLRG1hi, CD44hi, CD127lo, CD62Llo), which eventually converted to a mixed central and effector-memory T cell phenotype. Markedly, the magnitude of the SLP vaccine-induced CD8+ T cell response was unrelated to the T cell functional avidity but correlated to the naive CD8+ T cell precursor frequency of each epitope. Vaccination with single SLPs displayed various levels of long-term protection against acute MCMV infection, but superior protection occurred after vaccination with a combination of SLPs. This finding underlines the importance of the breadth of the vaccine-induced CD8+ T cell response. Thus, SLP-based vaccines could be a potential strategy to prevent CMV-associated disease. PMID:27637068

  5. Rapid and combined detection of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus using AllGlo quadruplex quantitative PCR.

    PubMed

    Chen, Yi; He, Hui; Pan, Ping; He, Songzhe; Dong, Xueyan; Chen, Yueming; Wang, Shuying; Yu, Daojun

    2016-07-01

    Acute respiratory infections (ARIs) cause substantial morbidity and mortality worldwide. The causes of ARI are dynamic, and co-infections of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus are recently developed causes of ARI. Here, we established a quadruplex quantitative PCR (qPCR) method to rapidly identify and simultaneously detect a single infection or co-infection of these three pathogens and an internal control in a single tube using AllGlo probes. The analysis demonstrated a wide linear range of detection from 101 to 108 copies per test and a low coefficient of variation of less than 5 %. The amplification efficiencies were all close to 1, and the correlation coefficients (r2) were all greater than 0.99. We found no significant difference in a comparative reagent test (P >0.05). Moreover, the results of tests on clinical samples using AllGlo quadruplex qPCR and TaqMan uniplex qPCR were in near-perfect agreement (κ =0.97). Clinically, the availability of this method will enable better differential diagnosis, disease surveillance and controlled outcomes. PMID:27093597

  6. A dual role for endothelial cells in cytomegalovirus infection? A study of cytomegalovirus infection in a series of rat endothelial cell lines.

    PubMed

    Vossen, R C; Derhaag, J G; Slobbe-van Drunen, M E; Duijvestijn, A M; van Dam-Mieras, M C; Bruggeman, C A

    1996-12-01

    Several clinical findings point to the involvement of microvascular endothelial cells in cytomegalovirus-related pathology. In this study the interactions of cytomegalovirus (CMV) with microvascular endothelial cells was investigated in an in vitro rat model. A series of rat endothelial cell lines, considered representative for the heterogeneity of heart microvascular endothelium in vivo, were infected with rat CMV (RCMV). The course of infection and production of infectious virus were examined using immunofluorescence staining and plaque titration assays, and was compared with infection of fully permissive rat fibroblasts. These endothelial cell lines displayed differences in susceptibility to CMV infection. Two endothelial cell lines (RHEC 50 and 191) were practically non-permissive, while four endothelial cell lines (RHEC 3, 10, 11 and 116) were partly permissive for CMV infection. In contrast to CMV infection in fibroblasts, only limited infection of the permissive endothelial cell lines was observed without spreading of CMV infection through the monolayer, although infectious virus was produced. Detachment of infected endothelial cells and recovery of the monolayer with time was observed. The detached endothelial cells were able to transmit CMV infection to fibroblast monolayers, but not to endothelial monolayers. Our in vitro results demonstrate differences in permissiveness for RCMV between the series of rat endothelial cell lines, which is suggestive for endothelial heterogeneity to CMV infection in vivo. Our findings indicate that endothelial cells are relatively resistant to CMV infection and that, upon infection, the endothelial monolayer may dispose of the virus via detachment of the infected cells. This points to a dual role for the endothelium in CMV infection in vivo: a barrier for CMV infection (by the endothelial monolayer) on the one hand and spreading of CMV infection (by detached infected cells) on the other hand.

  7. Comparison of cytomegalovirus viral load measure by real-time PCR with pp65 antigenemia for the diagnosis of cytomegalovirus disease in solid organ transplant patients.

    PubMed

    Hernando, S; Folgueira, L; Lumbreras, C; San Juan, R; Maldonado, S; Prieto, C; Babiano, M J; Delgado, J; Andres, A; Moreno, E; Aguado, J M; Otero, J R

    2005-11-01

    Cytomegalovirus (CMV) infection is the most frequent complication in solid organ transplant recipients. Currently, the antigenemia assay is widely used to detect this infection, although its success is being questioned to a great extent nowadays. The aim of our study is to compare a quantitative real time PCR to measure CMV DNA to the antigenemia assay, for the diagnosis to CMV disease. For our research, we prospectively processed 1198 samples (plasma and peripheral blood leukocytes [PBMC]), which belonged to 158 transplant recipients. In every sample the detection of the pp65 antigen in PBMC was carried out, as well as the quantification of CMV DNA by PCR (Light Cycler, LC-PCR). For this process, FRET probes, which detect a 254-bp fragment from the CMV gB gene, were used. The dynamic range of the LC-PCR was 500 to 5.10(7) copies/mL plasma and from 62 to 6.10(6) copies/10(6) PBMC. Twenty-three episodes of cytomegalovirus (CMV) disease occurred in 22 out of 158 patients and PCR displayed levels of sensitivity and specificity of 100% and 67%, respectively. The antigenemia assay obtained values of 91% and 57%. We established a cutoff value of 10(3) copies/mL plasma and 315 copies/10(6) cells. According to these cutoff values, PCR showed levels of sensitivity, specificity, VPN and VPP of 95.6%, 81.6%, 99%, and 53% respectively. Moreover, the LC-PCR assay anticipated the antigenemia assay in 10 patients out of 22 who developed CMV disease and the appearance of any clinical symptoms in 12 out of 22 patients. In conclusion, we believe that the quantification of CMV DNA by LC-PCR is a superior assay to pp65 antigenemia test regarding the early diagnosis of CMV disease in solid organ transplant recipients.

  8. [Diagnosis of congenital cytomegalovirus infection in newborn dried blood spots on Guthrie cards. A promissory technique].

    PubMed

    Distéfano, Angélica L; González, Cecilia A; Pardón, Fabián; Sarubi, María A; Canero Velazco, Cristina

    2008-04-01

    Laboratories play a crucial role in the diagnosis of congenital and perinatal cytomegalovirus infection, considering that other viral infections in newborn infants have similar clinical characteristics. The objectives of this work are to compare the results of the polymerase reaction in blood spots and urine as well as point out the relevance of the result in the Guthrie cards to differentiate congenital from perinatal infection. A total of 148 patients suspicious of CMVH infections were studied in the Congenital Perinatal Infections and Sexual Transmission Laboratory, at the National Institute "Carlos G. Malbrán". The dry blood samples (Guthrie cards) and urine of all patients were studied through the polymerase chain reaction. From the 148 patients, 3 presented other infections, 95 tested negative and 50 positive for cytomegalovirus: 35 had congenital infection and 15 perinatal. In the congenital cases, the polymerase reaction in dry blood was positive (sensitivity 100%, specificity 98.9%, VPP 98% and VPN 100%). Four of them with tardive symptoms were studied retrospectively. The urine specimens from the remaining 15 patients that were taken 15 days after birth were analyzed through the same methods, showing a sensitivity of 100%, the retrospective analysis of this dry blood group yielded negative results, so the infection was considered perinatal. Thus, the dry blood polymerase reaction of the newborn infants makes it a reliable assay for diagnosing congenital cytomegalovirus infection and could be used as an alternative method to urine polymerase reaction. In addition, this test is able to reveal whether the infection is congenital or perinatal in those cases of late symptom or other cases of controversial origin.

  9. Cytomegalovirus Myocarditis Required Extracorporeal Membrane Oxygenation Support Followed by Ganciclovir Treatment in Infant

    PubMed Central

    Kim, Bong Jun; Jung, Jo Won; Shin, Yu Rim; Park, Han Ki; Park, Young Hwan; Shin, Hong Ju

    2016-01-01

    A 7-month-old girl with no medical history was treated with mechanical circulatory support due to myocarditis. Her cardiac contractility did not improve despite more than one week of extracorporeal membrane oxygenation treatment. Thus, we planned a heart transplant. However, a high level of cytomegalovirus was found in blood laboratory results by quantitative polymerase chain reaction. The patient’s heart contractility recovered to normal range four days after ganciclovir treatment. She was discharged with slightly decreased cardiac contractility with a left ventricular ejection fraction of 45%. PMID:27298799

  10. Management of cytomegalovirus infection in solid organ transplant recipients: SET/GESITRA-SEIMC/REIPI recommendations.

    PubMed

    Torre-Cisneros, J; Aguado, J M; Caston, J J; Almenar, L; Alonso, A; Cantisán, S; Carratalá, J; Cervera, C; Cordero, E; Fariñas, M C; Fernández-Ruiz, M; Fortún, J; Frauca, E; Gavaldá, J; Hernández, D; Herrero, I; Len, O; Lopez-Medrano, F; Manito, N; Marcos, M A; Martín-Dávila, P; Monforte, V; Montejo, M; Moreno, A; Muñoz, P; Navarro, D; Pérez-Romero, P; Rodriguez-Bernot, A; Rumbao, J; San Juan, R; Vaquero, J M; Vidal, E

    2016-07-01

    Cytomegalovirus (CMV) infection remains a major complication of solid organ transplantation. Because of management of CMV is variable among transplant centers, in 2011 the Spanish Transplantation Infection Study Group (GESITRA) of the Spanish Society of Infectious Diseases and Clinical Microbiology (SEIMC) developed consensus guidelines for the prevention and treatment of CMV infection in solid organ transplant recipients. Since then, new publications have clarified or questioned the aspects covered in the previous document. For that reason, a panel of experts revised the evidence on CMV management, including immunological monitoring, diagnostics, prevention, vaccines, indirect effects, treatment, drug resistance, immunotherapy, investigational drugs, and pediatric issues. This document summarizes the recommendations. PMID:27132815

  11. [Ureterostomy cytomegalovirus infection presenting as stoma ulceration in a kidney allograft receptor: a case report].

    PubMed

    Rico, J E; Cardona, X; Rodelo, J; Reino, A; Arias, L F; Arbeláez, M

    2008-06-01

    Cytomegalovirus (CMV) is the most common viral infection affecting transplant patients, but urinary tract involvement has been rare. Only a few cases of symptomatic ureteritis have been reported in renal transplant recipients. In previous reports the presentation of CMV ureteritis is obstructive nephropathy, often in the absence of systemic illness, or rarely it may also mimic allograft rejection with minimal obstructive symptoms. We describe an additional case of CMV ureteritis in a patient with cutaneous ureterostomy. The unusual clinical presentation with urinary infection symptoms and ureterostomy stoma ulceration constitute a very particular presentation. The increasing report cases with CMV ureteritis suggest an increase of this post-transplant complication.

  12. Cutaneous cytomegalovirus infection on multi dermatomal herpes zoster scars: an isotopic immune response.

    PubMed

    Katibi, O S; Dlova, N C; Mosam, A

    2015-01-01

    As more patients with human immunodeficiency virus (HIV) are surviving, despite severe immune suppression, clinicians are faced with atypical manifestations of both common and uncommon dermatoses. A 30-year-old black South African woman presented with a 10-month history of multiple chronic ulcers appearing on a multidermatomal herpes zoster (HZ) scar. The woman was infected with HIV, and her CD4 count was 45 cells/μL. Histology and PCR revealed cytomegalovirus (CMV) infection. This case highlights an unusual presentation of cutaneous CMV occurring as an isotopic immune response on a pre-existing multidermatomal HZ scar. PMID:25266481

  13. Guillain-Barré syndrome associated with resistant cytomegalovirus infection after face transplantation.

    PubMed

    Alhefzi, M; Aycart, M A; Bueno, E M; Kueckelhaus, M; Fischer, S; Snook, R J; Sharfuddin, A A; Hadad, I; Malla, P; Amato, A A; Pomahac, B; Marty, F M

    2016-04-01

    A 39-year-old male, who received a facial allograft (cytomegalovirus [CMV] donor-seropositive, recipient-seronegative), developed multidrug-resistant CMV infection despite valganciclovir prophylaxis (900 mg/day) 6 months post transplantation. Lower extremity weakness with upper and lower extremity paresthesias developed progressively 11 months post transplantation, coinciding with immune control of CMV. An axonal form of Guillain-Barré syndrome was diagnosed, based on electrophysiological evidence of a generalized, non-length-dependent, sensorimotor axonal polyneuropathy. Treatment with intravenous immunoglobulin led to complete recovery without recurrence after 6 months.

  14. Case of cytomegalovirus-associated direct anti-globulin test-negative autoimmune hemolytic anemia.

    PubMed

    Kaneko, Saeko; Sato, Masanori; Sasaki, Goro; Eguchi, Hiroyuki; Oishi, Tsutomu; Kamesaki, Toyomi; Kawaguchi, Hiroyuki

    2013-12-01

    A 1-year-old boy developed autoimmune hemolytic anemia after a negative direct anti-globulin test. The concentration of erythrocyte membrane-associated immunoglobulin G, determined using an immunoradiometric assay, correlated with disease activity. He was positive for cytomegalovirus (CMV) both serologically and by quantitative real-time polymerase chain reaction, indicating that his autoimmune hemolytic anemia was directly caused by CMV infection. Since anti-CMV immunoglobulin G was not absorbed by the patient's erythrocytes, cross-reaction between erythrocyte antigens and CMV was not likely a causative factor for hemolysis.

  15. Association between Cytomegalovirus Antibody Levels and Cognitive Functioning in Non-Elderly Adults

    PubMed Central

    Dickerson, Faith; Stallings, Cassie; Origoni, Andrea; Katsafanas, Emily; Schweinfurth, Lucy A. B.; Savage, Christina L. G.; Yolken, Robert

    2014-01-01

    Background Elevated levels of antibodies to Cytomegalovirus (CMV) have been associated with cognitive impairment, but the quantitative relationship between CMV antibody levels and domains of cognitive functioning in younger adults has not been established. Methods We measured IgG class antibodies to Cytomegalovirus in 521 individuals, mean age 32.8 years. Participants were selected for the absence of psychiatric disorder and of a serious medical condition that could affect brain functioning. Cognitive functioning was measured with the Repeatable Battery for the Assessment of Neuropsychological Status (RBANS), the Wisconsin Card Sorting Test, Trail Making Test part A, and the WAIS III Letter Number Sequencing subtest. Linear regression analyses were used to measure the quantitative association between cognitive scores and Cytomegalovirus IgG antibody level. Logistic regression analyses were used to measure the odds of low cognitive scores and elevated antibody levels defined as an antibody level > = 50th, 75th, and 90th percentile of the group. Results Higher levels of CMV antibodies were associated with lower performance on RBANS Total (coefficient −1.03, p<.0002), Delayed Memory (coefficient −0.94, p<.001), Visuospatial/Constructional (coefficient −1.77, p<5×10−7), and Letter Number Sequencing (coefficient −0.15, p<.03). There was an incremental relationship between the level of CMV antibody elevation and the odds of a low RBANS Total score. The odds of a low total cognitive score were 1.63 (95th % CI 1.01, 2.64; p<.045), 2.22 (95th % CI 1.33, 3.70; p<.002), and 2.46 (95th % CI 1.24, 4.86; p<.010) with a CMV antibody level greater than or equal to the 50th, 75th, and 90th percentile respectively. Conclusions Higher levels of Cytomegalovirus antibodies are associated with lower levels of cognitive functioning in non-elderly adults. Methods for the prevention and treatment of CMV infection should be evaluated to determine if they result in an

  16. Updated international consensus guidelines on the management of cytomegalovirus in solid-organ transplantation.

    PubMed

    Kotton, Camille N; Kumar, Deepali; Caliendo, Angela M; Asberg, Anders; Chou, Sunwen; Danziger-Isakov, Lara; Humar, Atul

    2013-08-27

    Cytomegalovirus (CMV) continues to be one of the most common infections after solid-organ transplantation, resulting in significant morbidity, graft loss, and adverse outcomes. Management of CMV varies considerably among transplant centers but has been become more standardized by publication of consensus guidelines by the Infectious Diseases Section of The Transplantation Society. An international panel of experts was reconvened in October 2012 to revise and expand evidence and expert opinion-based consensus guidelines on CMV management, including diagnostics, immunology, prevention, treatment, drug resistance, and pediatric issues. The following report summarizes the recommendations.

  17. Human cytomegalovirus latency-associated protein LUNA is expressed during HCMV infections in vivo.

    PubMed

    Bego, Mariana G; Keyes, Lisa R; Maciejewski, Jarek; St Jeor, Stephen C

    2011-10-01

    Human cytomegalovirus (HCMV) latency is poorly understood. We previously described a novel HCMV latency-associated transcript, UL81-82ast, coding for a protein designated LUNA (latency unique natural antigen). The aim of this study was to confirm the presence of LUNA in HCMV-seropositive donors. Standard co-immunoprecipitation and ELISA assays were used to detect antibodies against the LUNA protein in the sera of HCMV-seropositive donors. Specific antibodies against LUNA were detected in all HCMV-seropositive donors but in none of the seronegative donors. These data confirm that LUNA is expressed during in vivo infections and is capable of eliciting an immune response.

  18. Isolation and partial chemical characterization of a 64,000-dalton glycoprotein of human cytomegalovirus

    SciTech Connect

    Clark, B.R.; Zaia, J.A.; Balce-Directo, L.; Ting, Y.P.

    1984-01-01

    A guanidinium chloride extract of (/sup 3/H)glucosamine- and (/sup 35/S)methionine-labeled virions plus dense bodies of human cytomegalovirus (Towne) was separated by reverse-phase high-pressure liquid chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the eluate revealed the major peak to be a glycoprotein with a relative mass of 64,000. This glycoprotein (HCMVgp64) was characterized by amino acid analysis and a high-pressure liquid chromatographic map of its tryptic peptides.

  19. Characterization of membrane antigens on human cytomegalovirus-infected fibroblasts recognized by human antibodies

    SciTech Connect

    van der Voort, L.H.M.; de Leij, L.F.M.H.; The T.H.

    1989-03-01

    The antigens on the surface of human cytomegalovirus (HCMV)-infected fibroblasts which are recognized by human HCMV antibody-positive sera were characterized. Three HCMV-induced polypeptides, with apparent molecular masses of 53 to 63, 94, and 94 to 120 kilodaltons, were precipitated from /sup 125/I-surface-labeled cell extracts with different sera obtained from healthy individuals. Renal transplant recipients who were suffering from active HCMV infections recognized the same set of antigens. By the use of monoclonal antibodies, these antigens were identified as polypeptides belonging to the gcI and gcIII families of HCMV glycoproteins.

  20. Detection of Human Cytomegalovirus and Epstein-Barr Virus in Coronary Atherosclerotic Tissue

    PubMed Central

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-01-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples. PMID:24031529

  1. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.

    2016-01-01

    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  2. Role of myeloid human cytomegalovirus infection in children's idiopathic thrombocytopenic purpura.

    PubMed

    Ding, Yan; Zhao, Lei; Mei, Hong; Zhang, Shu-Ling; Huang, Zhi-Hua

    2007-01-01

    This project explores the specificity of myeloid human cytomegalovirus (HCMV) infection in pathogenesis of idiopathic thrombocytopenic purpura (ITP). Eighty-one subjects with ITP were observed. HCMV early antigen and related myeloid cells in bone marrow, and platelet, HCMV IgM, and IgG in blood were tested. The results presented potent evidence that myeloid HCMV infection is a specific factor in children's ITP: patients of ITP with myeloid HCMV infection had a tendency for exacerbation, refractoriness, and chronic advance. However, HCMV did not affect the quantity of megakaryocyte, which showed the complicated relationships between HCMV and ITP.

  3. No Epstein Barr and cytomegalovirus DNA found in salivary gland tumours.

    PubMed

    Kärjä, V; Syrjänen, K; Syrjänen, S

    1997-01-01

    A series of 219 (106 malignant and 113 benign) salivary gland tumours was investigated by in situ hybridisation (ISH) to detect Epstein-Barr-virus (EBV) and cytomegalovirus (CMV) DNA. Normal salivary gland did not show hybridisation signals for these viruses. Tumours presenting hybridisation signals in ductal and myoepithelial cells and 17 Warthin's tumours were further studied by PCR, but none of these tumours contained EBV or CMV DNA. Our series did not contain lymphoepithelial carcinomas, which are EBV-associated tumours. The results suggest that factors other than EBV or CMV are involved in carcinogenesis of primary salivary gland tumours.

  4. SuperSILAC Quantitative Proteome Profiling of Murine Middle Ear Epithelial Cell Remodeling with NTHi

    PubMed Central

    Val, Stéphanie; Burgett, Katelyn; Brown, Kristy J.; Preciado, Diego

    2016-01-01

    Background Chronic Otitis Media with effusion (COME) develops after sustained inflammation and is characterized by secretory middle ear epithelial metaplasia and effusion, most frequently mucoid. Non-typeable Haemophilus influenzae (NTHi), the most common acute Otitis Media (OM) pathogen, is postulated to promote middle ear epithelial remodeling in the progression of OM from acute to chronic. The goals of this study were to examine histopathological and quantitative proteomic epithelial effects of NTHi challenge in a murine middle ear epithelial cell line. Methods NTHi lysates were generated and used to stimulate murine epithelial cells (mMEEC) cultured at air-liquid interface over 48 hours– 1 week. Conditional quantitative Stable Isotope Labeling with Amino Acids in Cell Culture (SILAC) of cell lysates was performed to interrogate the global protein production in the cells, using the SuperSILAC technique. Histology of the epithelium over time was done to measure bacterial dependent remodeling. Results Mass spectrometry analysis identified 2,565 proteins across samples, of which 74 exhibited differential enrichment or depletion in cell lysates (+/-2.0 fold-change; p value<0.05). The key molecular functions regulated by NTHi lysates exposure were related to cell proliferation, death, migration, adhesion and inflammation. Finally, chronic exposure induced significant epithelial thickening of cells grown at air liquid interface. Conclusions NTHi lysates drive pathways responsible of cell remodeling in murine middle ear epithelium which likely contributes to observed epithelial hyperplasia in vitro. Further elucidation of these mediators will be critical in understanding the progression of OM from acute to chronic at the molecular level. PMID:26859300

  5. Infectious cDNA clones of the DA strain of Theiler's murine encephalomyelitis virus.

    PubMed Central

    Roos, R P; Stein, S; Ohara, Y; Fu, J L; Semler, B L

    1989-01-01

    The DA strain and other members of the TO subgroup of Theiler's murine encephalomyelitis viruses cause a persistent demyelinating infection, whereas the GDVII strain and other GDVII subgroup strains cause an acute lethal polioencephalomyelitis. We generated an infectious DA cDNA clone inserted into a transcription vector. Virus derived from transfection of transcripts produced a demyelinating disease indistinguishable from that of wild-type virus. The infectious clone provides a critical reagent for the production of interstrain recombinant viruses to help identify genetic loci responsible for the biological activities of the strains. Images PMID:2555569

  6. Expansion of CD8+CD57+ T Cells in an Immunocompetent Patient with Acute Toxoplasmosis

    PubMed Central

    García-Muñoz, R.; Rodríguez-Otero, P.; Galar, A.; Merino, J.; Beunza, J. J.; Páramo, J. A.; Lecumberri, R.

    2009-01-01

    CD57+ T cells increase in several viral infections like cytomegalovirus, herpesvirus, parvovirus, HIV and hepatitis C virus and are associated with several clinical conditions related to immune dysfunction and ageing. We report for the first time an expansion of CD8+ CD57+ T cells in a young patient with an acute infection with Toxoplasma gondii. Our report supports the concept that CD8+ CD57+ T cells could be important in the control of chronic phase of intracellular microorganisms and that the high numbers of these cells may reflect the continuing survey of the immune system, searching for parasite proliferation in the tissues. PMID:19946421

  7. Expansion of CD8+CD57+ T Cells in an Immunocompetent Patient with Acute Toxoplasmosis.

    PubMed

    García-Muñoz, R; Rodríguez-Otero, P; Galar, A; Merino, J; Beunza, J J; Páramo, J A; Lecumberri, R

    2009-01-01

    CD57+ T cells increase in several viral infections like cytomegalovirus, herpesvirus, parvovirus, HIV and hepatitis C virus and are associated with several clinical conditions related to immune dysfunction and ageing. We report for the first time an expansion of CD8+ CD57+ T cells in a young patient with an acute infection with Toxoplasma gondii. Our report supports the concept that CD8+ CD57+ T cells could be important in the control of chronic phase of intracellular microorganisms and that the high numbers of these cells may reflect the continuing survey of the immune system, searching for parasite proliferation in the tissues.

  8. Intravitreal foscarnet for cytomegalovirus retinitis in a patient with acquired immunodeficiency syndrome.

    PubMed

    Díaz-Llopis, M; Chipont, E; Sanchez, S; España, E; Navea, A; Menezo, J L

    1992-12-15

    We treated a patient who had acquired immunodeficiency syndrome and cytomegalovirus retinitis of the left eye. After anesthetic had been topically administered, the patient received intravitreal injections of 1,200 micrograms of foscarnet. Plasma and vitreous foscarnet levels were measured by high-performance liquid chromatography. Systemic absorption of the drug was not evident. Elimination half-life from the vitreous after one injection was 54.0 hours. Vitreous levels remained above the mean 50% inhibition value for cytomegalovirus for approximately 56 hours and above the mean inhibition value for human immunodeficiency virus for approximately 241 hours. The patient's visual acuity improved from 20/30 to 20/25 in the left eye. Ophthalmoscopy showed the retinal lesion to have become inactive, and no reactivation occurred during the follow-up period of more than four months. The drug was well tolerated and no retinal toxicity was evident. We suggest an induction treatment regimen of two injections weekly for three weeks, followed by a maintenance treatment regimen of one injection weekly.

  9. Auditory steady state response in hearing assessment in infants with cytomegalovirus

    PubMed Central

    Silva, Daniela Polo C.; Lopez, Priscila Suman; Montovani, Jair Cortez

    2013-01-01

    OBJECTIVE: To report an infant with congenital cytomegalovirus and progressive sensorineural hearing loss, who was assessed by three methods of hearing evaluation. CASE DESCRIPTION: In the first audiometry, at four months of age, the infant showed abnormal response in Otoacoustic Emissions and normal Auditory Brainstem Response (ABR), with electrophysiological threshold in 30dBnHL, in both ears. With six months of age, he showed bilateral absence of the ABR at 100dBnHL. The behavioral observational audiometry was impaired due to the delay in neuropsychomotor development. At eight months of age, he was submitted to Auditory Steady State Response (ASSR) and the thresholds were 50, 70, absent in 110 and in 100dB, respectively for 500, 1,000, 2,000 and 4,000Hz in the right ear, and 70, 90, 90 and absent in 100dB, respectively for 500, 1,000, 2,000 and 4,000Hz in the left ear. COMMENTS: In the first evaluation, the infant had abnormal Otoacoustic Emission and normal ABR, which became altered at six months of age. The hearing loss severity could be identified only by the ASSR, which allowed the best procedure for hearing aids adaptation. The case description highlights the importance of the hearing status follow-up for children with congenital cytomegalovirus. PMID:24473963

  10. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  11. Does cytomegalovirus infection contribute to socioeconomic disparities in all-cause mortality?

    PubMed

    Feinstein, Lydia; Douglas, Christian E; Stebbins, Rebecca C; Pawelec, Graham; Simanek, Amanda M; Aiello, Allison E

    2016-09-01

    The social patterning of cytomegalovirus (CMV) and its implication in aging suggest that the virus may partially contribute to socioeconomic disparities in mortality. We used Cox regression and inverse odds ratio weighting to quantify the proportion of the association between socioeconomic status (SES) and all-cause mortality that was attributable to mediation by CMV seropositivity. Data were from the National Health and Nutrition Examination Survey (NHANES) III (1988-1994), with mortality follow-up through December 2011. SES was assessed as household income (income-to-poverty ratio ≤1.30;>1.30 to≤1.85;>1.85 to≤3.50;>3.50) and education (high school). We found strong associations between low SES and increased mortality: hazard ratio (HR) 1.80; 95% confidence interval (CI): 1.57, 2.06 comparing the lowest versus highest income groups and HR 1.29; 95% CI: 1.13, 1.48 comparing high school education. 65% of individuals were CMV seropositive, accounting for 6-15% of the SES-mortality associations. Age modified the associations between SES, CMV, and mortality, with CMV more strongly associated with mortality in older individuals. Our findings suggest that cytomegalovirus may partially contribute to persistent socioeconomic disparities in mortality, particularly among older individuals. PMID:27268074

  12. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection.

  13. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus

    PubMed Central

    Sturgill, Elizabeth R.; Malouli, Daniel; Hansen, Scott G.; Burwitz, Benjamin J.; Schneider, Christine L.; Womack, Jennie L.; Verweij, Marieke C.; Ventura, Abigail B.; Bhusari, Amruta; Jeffries, Krystal M.; Legasse, Alfred W.; Axthelm, Michael K.; Hudson, Amy W.; Sacha, Jonah B.; Picker, Louis J.; Früh, Klaus

    2016-01-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  14. Structural analysis of the major immediate early gene of human cytomegalovirus

    SciTech Connect

    Stenberg, R.M.; Thomsen, D.R.; Stinski, M.F.

    1984-01-01

    The most abundant species of human cytomegalovirus (Towne) immediate early polysome-associated RNA originates from a region of ca. 2.8 kilobases within the XbaI-E DNA fragment. These sequences code for a 1.95-kilobase mRNA and are referred to as immediate early coding region one. The authors have utilized the nuclease mapping technique of Berk and Sharp to examine this gene in detail. Cloned fragments of human cytomegalovirus DNA, either labeled with /sup 32/P in vivo or end labeled in vitro at the 5' or 3' termini, were hybridized to immediate early polysome-associated RNA. The hybrids were treated with single-strand-specific nuclease and subjected to electrophoresis in either neutral or denaturing gels. The major transcript was shown to be spliced molecule containing a 3' terminal exon of 1341 nucleotides. The sequence of the exons as well as the locations of the intro-exon splice junctions were determined. The predicted molecular weight of the polypeptide originating from this region was estimated to be 64,000. The properties of the viral gene and its protein product are discussed.

  15. Malignant transformation of guinea pig cells after exposure to ultraviolet-irradiated guinea pig cytomegalovirus

    SciTech Connect

    Isom, H.C.; Mummaw, J.; Kreider, J.W.

    1983-04-30

    Guinea pig cells were malignantly transformed in vitro by ultraviolet (uv)-irradiated guinea pig cytomegalovirus (GPCMV). When guinea pig hepatocyte monolayers were infected with uv-irradiated GPCMV, three continuous epithelioid cell lines which grew in soft agarose were established. Two independently derived GPCMV-transformed liver cells and a cell line derived from a soft agarose clone of one of these lines induced invasive tumors when inoculated subcutaneously or intraperitoneally into nude mice. The tumors were sarcomas possibly derived from hepatic stroma or sinusoid. Transformed cell lines were also established after infection of guinea pig hepatocyte monolayers with human cytomegalovirus (HCMV) or simian virus 40 (SV40). These cell lines also formed colonies in soft agarose and induced sarcomas in nude mice. It is concluded that (i) GPCMV can malignantly transform guinea pig cells; (ii) cloning of GPCMV-transformed cells in soft agarose produced cells that induced tumors with a shorter latency period but with no alteration in growth rate or final tumor size; and (iii) the tumors produced by GPCMV-and HCMV-transformed guinea pig cells were more similar to each other in growth rate than to those induced by SV40-transformed guinea pig cells.

  16. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  17. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  18. Acute gastroenteritis.

    PubMed

    Graves, Nancy S

    2013-09-01

    Acute gastroenteritis is a common infectious disease syndrome, causing a combination of nausea, vomiting, diarrhea, and abdominal pain. There are more than 350 million cases of acute gastroenteritis in the United States annually and 48 million of these cases are caused by foodborne bacteria. Traveler's diarrhea affects more than half of people traveling from developed countries to developing countries. In adult and pediatric patients, the prevalence of Clostridium difficile is increasing. Contact precautions, public health education, and prudent use of antibiotics are necessary goals in decreasing the prevalence of Clostridium difficle. Preventing dehydration or providing appropriate rehydration is the primary supportive treatment of acute gastroenteritis.

  19. Receptor expression and responsiveness of human peripheral blood mononuclear cells to a human cytomegalovirus encoded CC chemokine.

    PubMed

    Zheng, Qi; Xu, Jun; Gao, Huihui; Tao, Ran; Li, Wei; Shang, Shiqiang; Gu, Weizhong

    2015-01-01

    Human cytomegalovirus is a ubiquitous pathogen that infects the majority of the world's population. After long period of time co-evolving with human being, this pathogen has developed several strategies to evade host immune surveillance. One of the major trick is encoding homologous to those of the host organism or stealing host cellular genes that have significant functions in immune system. To date, we have found several viral immune analogous which include G protein coupled receptor, class I major histocompatibility complex and chemokine. Chemokine is a small group of molecules which is defined by the presence of four cysteines in highly conserved region. The four kinds of chemokines (C, CC, CXC, and CX3C) are classified based on the arrangement of 1 or 2 N-terminal cysteine residues. UL128 protein is one of the analogous that encoded by human cytomegalovirus that has similar amino acid sequences to the human CC chemokine. It has been proved to be one of the essential particles that involved in human cytomegalovirus entry into epithelial/endothelial cells as well as macrophages. It is also the target of potent neutralizing antibodies in human cytomegalovirus-seropositive individuals. We had demonstrated the chemotactic trait of UL128 protein in our previous study. Recombinant UL128 in vitro has the ability to attract monocytes to the infection region and enhances peripheral blood mononuclear cell proliferation by activating the MAPK/ERK signaling pathway. However, the way that this viral encoded chemokine interacting with peripheral blood mononuclear cells and the detailed mechanism that involving the virus entry into host cells keeps unknown. Here we performed in vitro investigation into the effects of UL128 protein on peripheral blood mononuclear cell's activation and receptor binding, which may help us further understand the immunomodulatory function of UL128 protein as well as human cytomegalovirus diffusion mechanism.

  20. Acute Bronchitis

    MedlinePlus

    ... bronchitis? Acute bronchitis is almost always caused by viruses that attack the lining of the bronchial tree ... infection. As your body fights back against these viruses, more swelling occurs and more mucus is produced. ...

  1. Acute Pericarditis

    MedlinePlus

    ... large pericardial effusions). Acute pericarditis usually responds to colchicine or NSAIDs (such as aspirin and ibuprofen ) taken ... reduce pain but relieves it by reducing inflammation. Colchicine also decreases the chance of pericarditis returning later. ...

  2. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  3. Opossums and Cat Fleas: New Insights in the Ecology of Murine Typhus in Galveston, Texas.

    PubMed

    Blanton, Lucas S; Idowu, Boluwatife M; Tatsch, Tyler N; Henderson, Joshua M; Bouyer, Donald H; Walker, David H

    2016-08-01

    Murine typhus is an acute undifferentiated febrile illness caused by Rickettsia typhi The classic reservoir (Rattus spp.) and flea vector (Xenopsylla cheopis) were once culprits of murine typhus in the United States. Vector and rodent control efforts have drastically decreased the prevalence of disease, except in a few endemic foci where opossums and cat fleas play a role in transmission. Since 2012, there has been a reemergence of murine typhus in Galveston, TX. We hypothesize that opossums and cat fleas are involved in the transmission of R. typhi in Galveston. To explore this, we sought to find the seroprevalence of typhus group antibodies from opossums. We also sought to find the prevalence of R. typhi in fleas parasitizing these animals. We collected blood from 12 opossums and found that eight (66.7%) had the presence of anti-R. typhi antibodies. All opossums were infested with fleas; a total of 250 Ctenocephalides felis fleas were collected from these animals. Seven opossums (53.8%) were infested with fleas that had molecular evidence of R. typhi infection, while six (46.2%) were infested with fleas that contained Candidatus Rickettsia senegalensis, an organism closely related to R. felis The minimum flea infection rate for R. typhi was 7.0%. The minimum infection rate for Candidatus R. senegalensis was 6.1%. Our study demonstrates that fleas infected with R. typhi parasitize opossums in Galveston. It is therefore likely that opossums and their fleas play a role in the city's recent reemergence of murine typhus. PMID:27273642

  4. Murine and epidemic typhus rickettsiae: how close is their relationship?

    PubMed

    Woodward, T E

    1982-01-01

    Typhus fever has occurred globally as epidemic and endemic disorders. In 1910, Brill reported a typhus-like illness which Zinsser and others determined to be recurrent epidemic typhus fever. Maxcy, in 1926, proposed rodents and fleas as reservoir and vector, respectively, of endemic typhus, which Dyer confirmed in 1930. Animals experimentally infected with epidemic typhus (Rickettsia prowazeki) are immune to murine typhus (Rickettsia typhi) and vice versa. Similar solid cross-immunity exists for humans. The two diseases are clinically similar in pathologic and serologic reactions. Human epidemic typhus presumably involved a man-louse-man cycle without an animal reservoir. This concept is now questioned. Antibodies to R. prowazeki have been reported in livestock in Africa, rats in Manila, and from flying squirrels and humans in the United States. R. prowazeki was recovered from blood specimens of goats, sheep, from ixodid ticks, louse, and flea-ectoparasites of flying squirrels, and tissues of flying squirrels. More than 20 cases of squirrel-related acute epidemic typhus have been reported in the United States. R. prowazeki has not been recovered from human cases. Chemical studies of R. prowazeki and R. typhi show genetic similarities but differences in genome size and degree of hybridization suggest that interconversions between the two agents do not occur rapidly in nature. It is proposed that, with time, their relatedness will become even closer. PMID:6817526

  5. A rapid DNA extraction method from culture and clinical samples. Suitable for the detection of human cytomegalovirus by the polymerase chain reaction.

    PubMed

    Zandotti, C; De Lamballerie, X; Guignole-Vignoli, C; Bollet, C; De Micco, P

    1993-02-01

    We propose an one-step DNA extraction method suitable for the polymerase chain reaction. This procedure utilizes Chelex 100, a chelating in exchange resin. This technique was compared with a traditional technique (proteinase K lysis, phenol-chloroform extraction and ethanol precipitation) for isolation of human cytomegalovirus DNA from clinical samples. The procedure using Chelex 100 appeared to be a simple and fast extraction method for human cytomegalovirus DNA.

  6. Safety and antidiarrheal activity of Priva adhaerens aqueous leaf extract in a murine model

    PubMed Central

    Nansunga, Miriam; Barasa, Ambrose; Abimana, Justus; Alele, Paul E.; Kasolo, Josephine

    2014-01-01

    Ethnopharmacological relevance Priva adhaerens (Forssk.) Chiov., a wildly growing plant, is reported in central Uganda to be an effective traditional remedy for diarrhea. The objective of this study was to provide a scientific basis for the ethnopharmacological utility of this plant whose aqueous leaf and shoot extract was evaluated for acute toxicity and antidiarrheal activity using a murine model. Materials and methods Acute toxicity of the aqueous leaf and shoot extract was assessed after determining the major phytochemicals present in the extract. The aqueous leaf and shoot extract was assayed against castor oil-induced diarrhea, transit time, and enteropooling, in comparison to loperamide, a standard drug. Results The oral LD50 value obtained for Priva adhaerens aqueous extract was greater than 5000 mg/kg in rats; the aqueous leaf and shoot extract possessed several important phytochemicals. Furthermore, the aqueous extract significantly, and dose-dependently, reduced frequency of stooling in castor oil-induced diarrhea, intestinal motility, and castor oil-induced enteropooling in rats. Conclusion This murine model shows that it is relatively safe to orally use the aqueous leaf and shoot extract of Priva adhaerens . The aqueous extract contains phytochemicals that are active for the treatment of diarrhea in a rat model. PMID:25304198

  7. Distribution of Cytomegalovirus Genotypes among Neonates Born to Infected Mothers in Islamabad, Pakistan

    PubMed Central

    Mujtaba, Ghulam; Khurshid, Adnan; Sharif, Salmaan; Alam, Muhammad Masroor; Aamir, Uzma Bashir; Shaukat, Shahzad; Angez, Mehar; Rana, Muhammad Suleman; Umair, Massab; Shah, Aamer Ali; Zaidi, Syed Sohail Zahoor

    2016-01-01

    Background Congenital cytomegalovirus (cCMV) infection contributes to considerable long-term sequelae in neonates and children all over the world. The association between viral genotypes and severity of clinical cytomegalovirus (CMV) infection is yet to be defined. The objective of this study was to find the impact of active CMV infection during pregnancy and the clinical significance of genotypes in neonates with congenital cytomegalovirus infections in Pakistan. Methods A total of 409 blood samples from pregnant women seeking health care services at the two antenatal hospitals of Islamabad during January to December 2012 were tested by ELISA and nested-PCR. Pregnant women with active infection (detected as IgM positive, PCR positive or positive on both assays) were followed until delivery, to detect the outcome of overt cCMV infection in neonates. Genetic characterization of CMV strains was performed by sequence analysis of envelope glycoproteins: gB, gN and gH to detect the contributing CMV genotypes. Results The seroprevalence of anti-CMV IgG and IgM was 97.5% (399 out of 409) and 12.7% (52 out of 409), respectively, while 20% (82/409) pregnant women were found positive for CMV DNA by PCR. Logistic regression analysis showed a significant association of active infection with parity [OR = 2.56, 95% CI = 1.82–2.62, p = 0.04], febrile illness [OR = 1.84, 95% CI = 1.76–3.65, p = 0.01] and jaundice [OR = 22.5, 95% CI = 4.53–85.02, p = 0.002]. We were able to isolate virus in 41 out of 70 neonates; 36.6% (15 out of 41) of them were symptomatic at birth while 63.4% (26 out of 41) were asymptomatic. The most prominent clinical feature observed in symptomatic neonates was hepatosplenomegaly (26.6%; 4 out of 15). All three genotypes gB, gN and gH were found with the highest frequency of gB1 genotype, found in 75% infants with hepatic damage. Phylogenetic analysis of Pakistani strains showed 96%-100% homology to their prototype strains. Conclusions Active CMV

  8. Killer-cell immunoglobulin-like receptors and cytomegalovirus reactivation during late pregnancy.

    PubMed

    Alvarado-Hernández, D L; Benítez-Sánchez, A; Rodríguez-Cuevas, J S; Rosales-Saavedra, T; Guerra-Palomares, S E; Comas-García, A; Noyola, D E; García-Sepúlveda, C A

    2016-08-01

    Human cytomegalovirus (CMV) represents an important public health concern as it is associated with severe morbidity and mortality in transplant recipients, HIV-infected individuals and pregnant women given the risk of congenital infection. Congenital CMV is a leading cause of neurological sequelae, developmental delay and birth defects worldwide. Cytomegalovirus can be transmitted to the foetus following maternal infection or reactivation. NK cells expressing killer-cell immunoglobulin-like receptors (KIR) are part of the innate immune system and the first line of defence against viral incursions. Previous reports have shown that KIR genes are associated with CMV infections in the post-transplant setting. In this study, we set out to determine whether a protective effect of KIR genes over CMV infection is seen in Mexican pregnant women. Cytomegalovirus infection was assessed through nucleic acid testing in 200 pregnant women and 600 healthy blood donors comprising the Mexican mestizo reference population. Killer-cell immunoglobulin-like receptors and HLA-C genotypes were obtained from 200 pregnant women and 300 reference samples using a comprehensive PCR-SSP approach. We observed statistically lower carrier frequencies of cB03|tA01 gene-content haplotype, of cB03 haplotype motif, of the KIR2DL5 + 2DS3/2DS5 gene pair and of KIR2DL5 amongst CMV-positive pregnant women in comparison with those CMV negative. None of these were associated with CMV status in the reference population. Logistic regression analysis revealed that the most important factor determining CMV status during third-trimester pregnancies was the KIR2DL5 + 2DS3/2DS5 gene pair (OR 0.376 (95%CI 0.174, 0.811, P = 0.013). Our results indicate that CMV-protective KIR gene associations described in Caucasoid populations are also present in the genetically distinct Mexican mestizo population. Our results suggest that certain KIR gene combinations provide protection against CMV infections occurring

  9. Murine models of vaginal trichomonad infections.

    PubMed

    Cobo, Eduardo R; Eckmann, Lars; Corbeil, Lynette B

    2011-10-01

    Trichomonas vaginalis and Tritrichomonas foetus cause common sexually transmitted infections in humans and cattle, respectively. Mouse models of trichomoniasis are important for pathogenic and therapeutic studies. Here, we compared murine genital infections with T. vaginalis and T. foetus. Persistent vaginal infection with T. foetus was established with 100 parasites but T. vaginalis infection required doses of 10(6), perhaps because of greater susceptibility to killing by mouse vaginal polymorphonuclear leukocytes. Infection with T. vaginalis persisted longest after combined treatment of mice with estrogen and dexamethasone, whereas infection was only short-lived when mice were given estrogen or dexamethasone alone, co-infected with Lactobacillus acidophilus, and/or pretreated with antibiotics. Infection rates were similar with metronidazole-resistant (MR) and metronidazole-sensitive (MS) T. vaginalis. High dose but not low dose metronidazole treatment controlled infection with MS better than MR T. vaginalis. These murine models will be valuable for investigating the pathogenesis and treatment of trichomoniasis. PMID:21976570

  10. Immunodetection of Murine Lymphotoxins in Eukaryotic Cells.

    PubMed

    Boitchenko, Veronika E.; Korobko, Vyacheslav G.; Prassolov, Vladimir S.; Kravchenko, Vladimir V.; Kuimov, Alexander N.; Turetskaya, Regina L.; Kuprash, Dmitry V.; Nedospasov, Sergei A.

    2000-10-01

    Lymphotoxins alpha and beta (LTalpha and LTbeta) are members of tumor necrosis factor superfamily. LT heterotrimers exist on the surface of lymphocytes and signal through LTbeta receptor while soluble LTalpha homotrimer can signal through TNF receptors p55 and p75. LT-, as well as TNF-mediated signaling are important for the organogenesis and maintenance of microarchitecture of secondary lymphoid organs in mice and has been implicated in the mechanism of certain inflammatory syndromes in humans. In this study we describe the generation of eukaryotic expression plasmids encoding murine LTalpha and LTbeta genes and a prokaryotic expression construct for murine LTalpha. Using recombinant proteins expressed by these vectors as tools for antisera selection, we produced and characterized several polyclonal antibodies capable of detecting LT proteins in eukaryotic cells.

  11. Retroviral Transduction of Murine Primary T Lymphocytes

    PubMed Central

    Lee, James; Sadelain, Michel; Brentjens, Renier

    2016-01-01

    Summary In comparison to human T cells, efficient retroviral gene transfer and subsequent expansion of murine primary T cells is more difficult to achieve. Herein, we describe an optimized gene transfer protocol utilizing an ecotropic viral vector to transduce primary murine T cells activated with magnetic beads coated with agonistic anti-CD3 and CD28 antibodies. Activated T cells are subsequently centrifuged (spinoculated) on RetroNectin-coated tissue culture plates in the context of retroviral supernatant. Variables found to be critical to high gene transfer and subsequent efficient T cell expansion included CD3/CD28 magnetic bead to cell ratio, time from T cell activation to initial spinoculation, frequency of T cell spinoculation, interleukin-2 concentration in the medium, and the initial purity of the T cell preparation. PMID:19110621

  12. Enhanced Cultivation Of Stimulated Murine B Cells

    NASA Technical Reports Server (NTRS)

    Sammons, David W.

    1994-01-01

    Method of in vitro cultivation of large numbers of stimulated murine B lymphocytes. Cells electrofused with other cells to produce hybridomas and monoclonal antibodies. Offers several advantages: polyclonally stimulated B-cell blasts cultivated for as long as 14 days, hybridomas created throughout culture period, yield of hybridomas increases during cultivation, and possible to expand polyclonally in vitro number of B cells specific for antigenic determinants first recognized in vivo.

  13. Murine models of human wound healing.

    PubMed

    Chen, Jerry S; Longaker, Michael T; Gurtner, Geoffrey C

    2013-01-01

    In vivo wound healing experiments remain the most predictive models for studying human wound healing, allowing an accurate representation of the complete wound healing environment including various cell types, environmental cues, and paracrine interactions. Small animals are economical, easy to maintain, and allow researchers to take advantage of the numerous transgenic strains that have been developed to investigate the specific mechanisms involved in wound healing and regeneration. Here we describe three reproducible murine wound healing models that recapitulate the human wound healing process.

  14. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions.

    PubMed

    Walzer, Sascha A; Egerer-Sieber, Claudia; Sticht, Heinrich; Sevvana, Madhumati; Hohl, Katharina; Milbradt, Jens; Muller, Yves A; Marschall, Manfred

    2015-11-13

    Nuclear replication of cytomegalovirus relies on elaborate mechanisms of nucleocytoplasmic egress of viral particles. Thus, the role of two essential and conserved viral nuclear egress proteins, pUL50 and pUL53, is pivotal. pUL50 and pUL53 heterodimerize and form a core nuclear egress complex (NEC), which is anchored to the inner nuclear membrane and provides a scaffold for the assembly of a multimeric viral-cellular NEC. Here, we report the crystal structure of the pUL50-pUL53 heterodimer (amino acids 1-175 and 50-292, respectively) at 2.44 Å resolution. Both proteins adopt a globular fold with mixed α and β secondary structure elements. pUL53-specific features include a zinc-binding site and a hook-like N-terminal extension, the latter representing a hallmark element of the pUL50-pUL53 interaction. The hook-like extension (amino acids 59-87) embraces pUL50 and contributes 1510 Å(2) to the total interface area (1880 Å(2)). The pUL50 structure overall resembles the recently published NMR structure of the murine cytomegalovirus homolog pM50 but reveals a considerable repositioning of the very C-terminal α-helix of pUL50 upon pUL53 binding. pUL53 shows structural resemblance with the GHKL domain of bacterial sensory histidine kinases. A close examination of the crystal structure indicates partial assembly of pUL50-pUL53 heterodimers to hexameric ring-like structures possibly providing additional scaffolding opportunities for NEC. In combination, the structural information on pUL50-pUL53 considerably improves our understanding of the mechanism of HCMV nuclear egress. It may also accelerate the validation of the NEC as a unique target for developing a novel type of antiviral drug and improved options of broad-spectrum antiherpesviral therapy.

  15. Maternal CD4+ T cells protect against severe congenital cytomegalovirus disease in a novel nonhuman primate model of placental cytomegalovirus transmission

    PubMed Central

    Bialas, Kristy M.; Tanaka, Takayuki; Tran, Dollnovan; Varner, Valerie; Cisneros De La Rosa, Eduardo; Chiuppesi, Flavia; Wussow, Felix; Kattenhorn, Lisa; Macri, Sheila; Kunz, Erika L.; Estroff, Judy A.; Kirchherr, Jennifer; Yue, Yujuan; Fan, Qihua; Lauck, Michael; O’Connor, David H.; Hall, Allison H. S.; Xavier, Alvarez; Diamond, Don J.; Barry, Peter A.; Kaur, Amitinder; Permar, Sallie R.

    2015-01-01

    Elucidation of maternal immune correlates of protection against congenital cytomegalovirus (CMV) is necessary to inform future vaccine design. Here, we present a novel rhesus macaque model of placental rhesus CMV (rhCMV) transmission and use it to dissect determinants of protection against congenital transmission following primary maternal rhCMV infection. In this model, asymptomatic intrauterine infection was observed following i.v. rhCMV inoculation during the early second trimester in two of three rhCMV-seronegative pregnant females. In contrast, fetal loss or infant CMV-associated sequelae occurred in four rhCMV-seronegative pregnant macaques that were CD4+ T-cell depleted at the time of inoculation. Animals that received the CD4+ T-cell–depleting antibody also exhibited higher plasma and amniotic fluid viral loads, dampened virus-specific CD8+ T-cell responses, and delayed production of autologous neutralizing antibodies compared with immunocompetent monkeys. Thus, maternal CD4+ T-cell immunity during primary rhCMV infection is important for controlling maternal viremia and inducing protective immune responses that prevent severe CMV-associated fetal disease. PMID:26483473

  16. Maternal CD4+ T cells protect against severe congenital cytomegalovirus disease in a novel nonhuman primate model of placental cytomegalovirus transmission.

    PubMed

    Bialas, Kristy M; Tanaka, Takayuki; Tran, Dollnovan; Varner, Valerie; Cisneros De La Rosa, Eduardo; Chiuppesi, Flavia; Wussow, Felix; Kattenhorn, Lisa; Macri, Sheila; Kunz, Erika L; Estroff, Judy A; Kirchherr, Jennifer; Yue, Yujuan; Fan, Qihua; Lauck, Michael; O'Connor, David H; Hall, Allison H S; Xavier, Alvarez; Diamond, Don J; Barry, Peter A; Kaur, Amitinder; Permar, Sallie R

    2015-11-01

    Elucidation of maternal immune correlates of protection against congenital cytomegalovirus (CMV) is necessary to inform future vaccine design. Here, we present a novel rhesus macaque model of placental rhesus CMV (rhCMV) transmission and use it to dissect determinants of protection against congenital transmission following primary maternal rhCMV infection. In this model, asymptomatic intrauterine infection was observed following i.v. rhCMV inoculation during the early second trimester in two of three rhCMV-seronegative pregnant females. In contrast, fetal loss or infant CMV-associated sequelae occurred in four rhCMV-seronegative pregnant macaques that were CD4(+) T-cell depleted at the time of inoculation. Animals that received the CD4(+) T-cell-depleting antibody also exhibited higher plasma and amniotic fluid viral loads, dampened virus-specific CD8(+) T-cell responses, and delayed production of autologous neutralizing antibodies compared with immunocompetent monkeys. Thus, maternal CD4(+) T-cell immunity during primary rhCMV infection is important for controlling maternal viremia and inducing protective immune responses that prevent severe CMV-associated fetal disease. PMID:26483473

  17. Review of autoimmune (lupus-like) glomerulonephritis in murine models.

    PubMed

    Hicks, John; Bullard, Daniel C

    2006-01-01

    While murine models of autoimmune (lupus-like) glomerulonephritis have been available for sometime, it is only recently that immune and inflammatory mechanisms and molecular genetics have been extensively investigated. Genes involved in murine and human lupus nephritis have been discovered and provide insight into this disease process and provide avenues for molecular-targeted therapy. Immune modulation of murine nephritis has provided insight into novel therapy that may attenuate this disease or halt disease progression. With the advances in understanding the pathogenesis of lupus nephritis using translational research modalities, including electron microscopy, and molecular genetics, many "designer" therapies have become available for clinical use and for clinical investigational trials. This paper reviews autoimmune (lupus-like) glomerulonephritis in murine models, candidate genes involved in lupus nephritis, adhesion molecules implicated in murine lupus-like nephritis, immune modulation of murine lupus-like nephritis, and novel and potential therapy for immune complex glomerulonephritis.

  18. Unilateral Ischemic Maculopathy Associated with Cytomegalovirus Retinitis in Patients with AIDS: Optical Coherence Tomography Findings

    PubMed Central

    Arevalo, J. Fernando; Garcia, Reinaldo A.; Arevalo, Fernando A.; Fernandez, Carlos F.

    2015-01-01

    To describe the clinical and optical coherence tomography (OCT) characteristics of ischemic maculopathy in two patients with acquired immunodeficiency syndrome (AIDS). Two patients with AIDS and cytomegalovirus (CMV) retinitis developed ischemic maculopathy. Both patients presented with central visual loss and active granular CMV retinitis. The presence of opacification of the superficial retina in the macular area and intraretinal edema suggested the diagnosis. Fluorescein angiography changes were similar in the two cases with enlargement of the foveal avascular zone and late staining of juxtafoveal vessels. OCT changes were suggestive of retinal ischemia: Increased reflectivity from the inner retinal layer and decreased backscattering from the retinal photoreceptors due to fluid and retinal edema. Ischemic maculopathy may cause a severe and permanent decrease in vision in AIDS patients. Fluorescein angiography and OCT should be considered in any patient with AIDS and unexplained visual loss. The mechanism of ischemic maculopathy may be multifactorial. PMID:27051496

  19. [HUMAN CYTOMEGALOVIRUS INFECTION AND SPONTANEOUS ABORTION IN PREGNANT WOMEN OF I AND II TRIMESTER].

    PubMed

    Cheshik, S G; Kisteneva, L B

    2016-01-01

    The goal of this work was the evaluation of the frequency of human CMV infection among the women, whose pregnancy ended in miscarriage, detection of active forms of infection and treatment before pregnancy. Virological and sero-immunological techniques were used. A total of 116 women who had miscarriages before the 28 week of pregnancy were submitted to the CMV test. 109 women (94.0%) demonstrated positive results. 49 women (42.2%) had active form of the cytomegalovirus infection. 13 women (26.5%) had the recurrent form and 36 patients (73.5%) had the persistent form of CMV infection (stage of productive replication). All the women with active CMVI were treated before the next pregnancy. Immunomodulatory therapy for the treatment was used. PMID:27451499

  20. Severe gastrointestinal cytomegalovirus disease in two patients with renal vasculitis after immunosuppression.

    PubMed

    Lee, Kian-Guan; Teo, Su-Hooi; Lim, Cynthia; Loh, Alwin; Chidambaram, Viswanath; Choo, Jason

    2016-09-01

    Although the use of current immunosuppressive regimens has significantly improved the outcomes of autoimmune renal diseases, infectious complications remain an important clinical concern. Cytomegalovirus (CMV) infection has been shown to be one of the major causes of mortality in this group of patients. We report two cases of renal vasculitis (Granulomatosis with polyangiitis (GPA) and microscopic polyangiitis (MPA)) that developed into severe gastrointestinal CMV disease and manifested with massive small bowel bleeding, resulting in an eventual fatal outcome for one of the patients. Risk factors, pathogenesis, role of immunosuppression in the development of CMV infection, and antiviral treatment are discussed in this review. These cases highlight the need for further research to evaluate the complex mechanisms between immunosuppression and CMV occurrence as well as the role of antiviral prophylaxis in high-risk patients undergoing immunosuppressive therapies.
. PMID:27443566