Science.gov

Sample records for acute murine cytomegalovirus

  1. EFFECTS OF IMMUNOSUPPRESSION WITH CYCLOPHOSPHAMIDE ON ACUTE MURINE CYTOMEGALOVIRUS INFECTION AND VIRUS-AUGMENTED NATURAL KILLER CELL ACTIVITY

    EPA Science Inventory

    The effects of cyclophosphamide (CY) treatment on acute murine cytomegalovirus (MCMV) infection were studied to explore the potential usefulness of MCMV as a means of detecting immune dysfunction and to identify host defense mechanisms important for protection against MCMV.

  2. Immunosuppressive effect of murine cytomegalovirus.

    PubMed Central

    Loh, L; Hudson, J B

    1980-01-01

    Murine cytomegalovirus suppressed the ability of spleen cells to respond to mitogens in vitro. The degree of suppression was proportional to the multiplicity of infection. This effect could not be explained by cytolysis of lymphocytes, an alteration in the kinetics of the response to mitogen, or a direct competition between virions and mitogen molecules for cell-surface receptors. Nor was it due to simple contact between cell and virus, since ultraviolet-inactivated murine cytomegalovirus failed to suppress the response to mitogens. Reconstitution experiments were performed which involved mixing various combinations of infected and uninfected macrophages and lymphocytes. Under these conditions, it was found that the infected macrophages and lymphocytes. Under these conditions, it was found that the infected macrophages had an impaired capacity to mediate the response ot T lymphocytes to concanavalin A. This suggests that murine cytomegalovirus may cause immunosuppression indirectly by interfering with macrophage function. PMID:6244228

  3. MURINE CYTOMEGALOVIRUS HOST RESISTANCE MODELS

    EPA Science Inventory

    Mouse cytomegalovirus (MCMV) is a well developed and extremely useful and relevant host resistance model for immunotoxicity testing. at cytomegalovirus (RCMV) is currently under development and may have similar applications. ytomegaloviruses are species specific; RCMV is a distin...

  4. INCREASED SUSCEPTIBILITY TO PARATHION POISONING FOLLOWING MURINE CYTOMEGALOVIRUS INFECTION

    EPA Science Inventory

    Increased Susceptibility to Parathion Poisoning Following Murine Cytomegalovirus Infection. Fifty to 100 percent mortality occurred in mice treated with ordinarily sublethal doses of parathion 2 to 5 days post infection with murine cytomegalovirus (MCMV). These mortalities appear...

  5. Mucosal and Parenteral Vaccination against Acute and Latent Murine Cytomegalovirus (MCMV) Infection by Using an Attenuated MCMV Mutant

    PubMed Central

    MacDonald, Margaret R.; Li, Xi-Yang; Stenberg, Richard M.; Campbell, Ann E.; Virgin, Herbert W.

    1998-01-01

    We used a live attenuated murine cytomegalovirus (MCMV) mutant to analyze mechanisms of vaccination against acute and latent CMV infection. We selected MCMV mutant RV7 as a vaccine candidate since this virus grows well in tissue culture but is profoundly attenuated for growth in normal and severe combined immunodeficient (SCID) mice (V. J. Cavanaugh et al., J. Virol. 70:1365–1374, 1996). BALB/c mice were immunized twice (0 and 14 days) subcutaneously (s.c.) with tissue culture-passaged RV7 and then challenged with salivary gland-passaged wild-type MCMV (sgMCMV) intraperitoneally (i.p.) on day 28. RV7 vaccination protected mice against challenge with 105 PFU of sgMCMV, a dose that killed 100% of mock-vaccinated mice. RV7 vaccination reduced MCMV replication 100- to 500-fold in the spleen between 1 and 8 days after challenge. We used the capacity to control replication of MCMV in the spleen 4 days after challenge as a surrogate for protection. Protection was antigen specific and required both live RV7 and antigen-specific lymphocytes. Interestingly, RV7 was effective when administered s.c., i.p., perorally, intranasally, and intragastrically, demonstrating that attenuated CMV applied to mucosal surfaces can elicit protection against parenteral virus challenge. B cells and immunoglobulin G were not essential for RV7-induced immunity since B-cell-deficient mice were effectively vaccinated by RV7. CD8 T cells, but not CD4 T cells, were critical for RV7-induced protection. Depletion of CD8 T cells by passive transfer of monoclonal anti-CD8 (but not anti-CD4) antibody abrogated RV7-mediated protection, and RV7 vaccination was less efficient in CD8 T-cell-deficient mice with a targeted mutation in the β2-microglobulin gene. Although gamma interferon is important for innate resistance to MCMV, it was not essential for RV7 vaccination since gamma interferon receptor-deficient mice were protected by RV7 vaccination. Establishment of and/or reactivation from latency by sg

  6. Lymph Node Macrophages Restrict Murine Cytomegalovirus Dissemination

    PubMed Central

    Farrell, Helen E.; Davis-Poynter, Nick; Bruce, Kimberley; Lawler, Clara; Dolken, Lars; Mach, Michael

    2015-01-01

    ABSTRACT Cytomegaloviruses (CMVs) establish chronic infections that spread from a primary entry site to secondary vascular sites, such as the spleen, and then to tertiary shedding sites, such as the salivary glands. Human CMV (HCMV) is difficult to analyze, because its spread precedes clinical presentation. Murine CMV (MCMV) offers a tractable model. It is hypothesized to spread from peripheral sites via vascular endothelial cells and associated monocytes. However, viral luciferase imaging showed footpad-inoculated MCMV first reaching the popliteal lymph nodes (PLN). PLN colonization was rapid and further spread was slow, implying that LN infection can be a significant bottleneck. Most acutely infected PLN cells were CD169+ subcapsular sinus macrophages (SSM). Replication-deficient MCMV also reached them, indicating direct infection. Many SSM expressed viral reporter genes, but few expressed lytic genes. SSM expressed CD11c, and MCMV with a cre-sensitive fluorochrome switch showed switched infected cells in PLN of CD11c-cre mice but yielded little switched virus. SSM depletion with liposomal clodronate or via a CD169-diphtheria toxin receptor transgene shifted infection to ER-TR7+ stromal cells, increased virus production, and accelerated its spread to the spleen. Therefore, MCMV disseminated via LN, and SSM slowed this spread by shielding permissive fibroblasts and poorly supporting viral lytic replication. IMPORTANCE HCMV chronically infects most people, and it can cause congenital disability and harm the immunocompromised. A major goal of vaccination is to prevent systemic infection. How this is established is unclear. Restriction to humans makes HCMV difficult to analyze. We show that peripheral MCMV infection spreads via lymph nodes. Here, MCMV infected filtering macrophages, which supported virus replication poorly. When these macrophages were depleted, MCMV infected susceptible fibroblasts and spread faster. The capacity of filtering macrophages to limit

  7. Lack of XBP-1 Impedes Murine Cytomegalovirus Gene Expression

    PubMed Central

    Drori, Adi; Messerle, Martin; Brune, Wolfram; Tirosh, Boaz

    2014-01-01

    The unfolded protein response (UPR) is an endoplasmic reticulum (ER)-to-nucleus signaling cascade induced in response to ER stress. The UPR aims at restoring homeostasis, but can also induce apoptosis if stress persists. Infection by human and murine cytomegaloviruses (CMVs) provokes ER stress and induces the UPR. However, both CMVs manipulate the UPR to promote its prosurvival activity and delay apoptosis. The underlying mechanisms remain largely unknown. Recently, we demonstrated that MCMV and HCMV encode a late protein to target IRE1 for degradation. However, the importance of its downstream effector, X Box binding protein 1 (XBP-1), has not been directly studied. Here we show that deletion of XBP-1 prior to or early after infection confers a transient delay in viral propagation in fibroblasts that can be overcome by increasing the viral dose. A similar phenotype was demonstrated in peritoneal macrophages. In vivo, acute infection by MCMV is reduced in the absence of XBP-1. Our data indicate that removal of XBP-1 confers a kinetic delay in early stages of MCMV infection and suggest that the late targeting of IRE1 is aimed at inhibiting activities other than the splicing of XBP-1 mRNA. PMID:25333725

  8. Thrombosis associated with acute cytomegalovirus infection: a narrative review

    PubMed Central

    Sherman, Shany; Eytan, Ori

    2014-01-01

    Thrombosis associated with acute cytomegalovirus infection has been reported many times in the literature since the mid 1980s – mainly in case reports and in small case series, but also in four controlled studies. Still, many physicians are unaware of this association although acute cytomegalovirus infection diagnosis in a thrombosis patient may warrant antiviral therapy and may affect anticoagulation therapy duration. Accordingly, the clinical characteristics of patients with thrombosis and acute cytomegalovirus infection are reviewed, and the current knowledge concerning this unique association is presented herein. We believe it is time to add acute cytomegalovirus infection to the list of thrombosis triggers. PMID:25624857

  9. Bone marrow atrophy induced by murine cytomegalovirus infection.

    PubMed Central

    Gibbons, A E; Price, P; Shellam, G R

    1994-01-01

    Acute, sublethal infection of mice with murine cytomegalovirus (MCMV) resulted in up to 80% decreases in the number of cells recoverable from the bone marrow, and a decrease in peripheral blood leucocyte counts during the first week of infection. Depopulation of the leucopoietic areas of the marrow was evident from examination of histological sections. The severity of bone marrow atrophy in MCMV-infected mice of different strains correlated with previously described genetically determined sensitivity to MCMV disease. Although the phenomenon only occurred when mice were inoculated with infectious virus preparations, fewer than one in 10(5) marrow cells were productively infected, suggesting that atrophy was not due to lytic infection of large numbers of bone marrow cells. Interestingly, increases in serum colony-stimulating activity were observed and these were proportional to the severity of bone marrow atrophy. After MCMV infection, we observed increases in the proportions of cells expressing some B-cell and myeloid cell markers and a decrease in the proportion of cells expressing an erythroid cell marker. There was no change in the frequency of marrow cells expressing mature T-cell markers. The numbers of myeloid lineage-committed progenitor cells (GM-CFU) in the marrow decreased 10- to 20-fold in BALB/c nu/+ mice, while there was a threefold decrease in their numbers in BALB/c nu/nu mice. In addition, increases in serum colony-stimulating activity were greater in BALB/c nu/+ mice than in BALB/c nu/nu mice. Our results suggest that growth factors produced after MCMV infection may accelerate the maturation and migration of cells from the marrow to sites of virus replication and inflammation, thus accounting for the depletion in numbers of marrow cells observed soon after MCMV infection. Images Figure 3 Figure 4 PMID:7959876

  10. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  11. Molecular cloning and physical mapping of murine cytomegalovirus DNA.

    PubMed Central

    Ebeling, A; Keil, G M; Knust, E; Koszinowski, U H

    1983-01-01

    Murine cytomegalovirus (MCMV) Smith strain DNA is cleaved by restriction endonuclease HindIII into 16 fragments, ranging in size from 0.64 to 22.25 megadaltons. Of the 16 HindIII fragments, 15 were cloned in plasmid pACYC177 in Escherichia coli HB101 (recA). The recombinant plasmid clones were characterized by cleavage with the enzymes XbaI and EcoRI. In addition, fragments generated by double digestion of cloned fragments with HindIII and XbaI were inserted into the plasmid vector pACYC184. The results obtained after hybridization of 32P-labeled cloned fragments to Southern blots of MCMV DNA cleaved with HindIII, XbaI, EcoRI, BamHI, ApaI, ClaI, EcoRV, or KpnI allowed us to construct complete physical maps of the viral DNA for the restriction endonucleases HindIII, XbaI, and EcoRI. On the basis of the cloning and mapping experiments, it was calculated that the MCMV genome spans about 235 kilobase pairs, corresponding to a molecular weight of 155,000,000. All fragments were found to be present in equimolar concentrations, and no cross-hybridization between any of the fragments was seen. We conclude that the MCMV DNA molecule consists of a long unique sequence without large terminal or internal repeat regions. Thus, the structural organization of the MCMV genome is fundamentally different from that of the human cytomegalovirus or herpes simplex virus genome. Images PMID:6312075

  12. Disruption of Murine Cardiac Allograft Acceptance by Latent Cytomegalovirus

    PubMed Central

    Cook, Charles H.; Bickerstaff, Alice A.; Wang, Jiao-Jing; Zimmerman, Peter D.; Forster, Meghan R.; Nadasdy, Tibor; Colvin, Robert B.; Hadley, Gregg A.; Orosz, Charles G.

    2008-01-01

    Cytomegalovirus (CMV) reactivation is a well described complication of solid organ transplantation. These studies were performed to 1.) determine if cardiac allograft transplantation of latently infected recipients results in reactivation of CMV, and 2.) determine what impact CMV might have on development of graft acceptance/tolerance. BALB/c cardiac allografts were transplanted into C57BL/6 mice with/without latent murine CMV (MCMV). Recipients were treated with gallium nitrate induction and monitored for graft survival, viral immunity, and donor reactive DTH responses. Latently infected allograft recipients had ∼80% graft loss by 100 days after transplant, compared with ∼8% graft loss in naïve recipients. PCR evaluation demonstrated that MCMV was transmitted to cardiac grafts in all latently infected recipients, and 4/8 allografts had active viral transcription compared to 0/6 isografts. Latently infected allograft recipients showed intragraft IFN-α expression consistent with MCMV reactivation, but MCMV did not appear to negatively influence regulatory gene expression. Infected allograft recipients had disruption of splenocyte DTH regulation, but recipient splenocytes remained unresponsive to donor antigen even after allograft losses. These data suggest that transplantation in an environment of latent CMV infection may reactivate virus, and that intragraft responses disrupt development of allograft acceptance. PMID:18976295

  13. Murine Cytomegalovirus Exploits Olfaction To Enter New Hosts

    PubMed Central

    Farrell, Helen E.; Lawler, Clara; Tan, Cindy S. E.; MacDonald, Kate; Bruce, Kimberley; Mach, Michael; Davis-Poynter, Nick

    2016-01-01

    ABSTRACT   Viruses transmit via the environmental and social interactions of their hosts. Herpesviruses have colonized mammals since their earliest origins, suggesting that they exploit ancient, common pathways. Cytomegaloviruses (CMVs) are assumed to enter new hosts orally, but no site has been identified. We show by live imaging that murine CMV (MCMV) infects nasally rather than orally, both after experimental virus uptake and during natural transmission. Replication-deficient virions revealed the primary target as olfactory neurons. Local, nasal replication by wild-type MCMV was not extensive, but there was rapid systemic spread, associated with macrophage infection. A long-term, transmissible infection was then maintained in the salivary glands. The viral m131/m129 chemokine homolog, which influences tropism, promoted salivary gland colonization after nasal entry but was not required for entry per se. The capacity of MCMV to transmit via olfaction, together with previous demonstrations of experimental olfactory infection by murid herpesvirus 4 (MuHV-4) and herpes simplex virus 1 (HSV-1), suggest that this is a common, conserved route of mammalian herpesvirus entry. PMID:27118588

  14. HUMORAL ANTIBODY RESPONSE TO INDIVIDUAL VIRAL PROTEINS AFTER MURINE CYTOMEGALOVIRUS INFECTION

    EPA Science Inventory

    The purpose of this study was to identify viral proteins that played an important role in the humoral immune response to murine cytomegalovirus (MCMV). Viral proteins were separated from a purified virus preparation on polyacrylamide gels, were blotted onto nitrocellulose strips,...

  15. COMPARISON OF THE PATHOGENESIS OF MURINE CYTOMEGALOVIRUS IN LUNG AND LIVER FOLLOWING INTRAPERITONEAL OR INTRATRACHEAL INFECTION

    EPA Science Inventory

    This study compares the pathogenesis of murine cytomegalovirus (MCMV) infections following intraperitoneal (I.P.) and intratracheal (I.T.) inoculation. No deaths were seen in mice given 1,000,000 pfu MCMV I.T., whereas 52% mortality occurred among animals given this dose I.P. Thi...

  16. Stability Determinants of Murine Cytomegalovirus Long Noncoding RNA7.2

    PubMed Central

    Schwarz, Toni M.

    2014-01-01

    Cytomegalovirus is a ubiquitous herpesvirus that persistently replicates in glandular epithelial tissue. Murine cytomegalovirus expresses a 7.2-kb-long noncoding RNA (RNA7.2) that is a determinant of viral persistence in the salivary gland. RNA7.2 is an extremely long-lived intron, yet the basis of its stability is unknown. We present data that localize key sequence determinants of RNA stability to the 3′ end of RNA7.2 and suggest that stability is a result of sustained lariat conformation. PMID:25056884

  17. Pulmonary embolism in an immunocompetent patient with acute cytomegalovirus colitis

    PubMed Central

    Chou, Jen-Wei

    2016-01-01

    Acute cytomegalovirus (CMV) infection occurs commonly in immunocompromised and immunocompetent patients, but is usually asymptomatic in the latter. Vascular events associated with acute CMV infection have been described, but are rare. Hence, such events are rarely reported in the literature. We report a case of pulmonary embolism secondary to acute CMV colitis in an immunocompetent 78-year-old man. The patient presented with fever and diarrhea. Colonic ulcers were diagnosed based on colonoscopy findings, and CMV was the proven etiology on pathological examination. The patient subsequently experienced acute respiratory failure. Pulmonary embolism was diagnosed based on the chest radiography and computed tomography findings. A diagnosis of acute CMV colitis complicated by pulmonary embolism was made. The patient was successfully treated with intravenous administration of unfractionated heparin and intravenous ganciclovir. PMID:27175121

  18. Acute Cytomegalovirus Infection as a Cause of Venous Thromboembolism

    PubMed Central

    Rinaldi, Francesca; Lissandrin, Raffaella; Mojoli, Francesco; Baldanti, Fausto; Brunetti, Enrico; Pascarella, Michela; Giordani, Maria Teresa

    2014-01-01

    Acute Human Cytomegalovirus (HCMV) infection is an unusual cause of venous thromboembolism, a potentially life-threatening condition. Thrombus formation can occur at the onset of the disease or later during the recovery and may also occur in the absence of acute HCMV hepatitis. It is likely due to both vascular endothelium damage caused by HCMV and impairment of the clotting balance caused by the virus itself. Here we report on two immunocompetent women with splanchnic thrombosis that occurred during the course of acute HCMV infection. Although the prevalence of venous thrombosis in patients with acute HCMV infection is unknown, physicians should be aware of its occurrence, particularly in immunocompetent patients presenting with fever and unexplained abdominal pain. PMID:24959338

  19. Replication of Murine Cytomegalovirus in Differentiated Macrophages as a Determinant of Viral Pathogenesis

    PubMed Central

    Hanson, Laura K.; Slater, Jacquelyn S.; Karabekian, Zaruhi; Virgin, Herbert W.; Biron, Christine A.; Ruzek, Melanie C.; van Rooijen, Nico; Ciavarra, Richard P.; Stenberg, Richard M.; Campbell, Ann E.

    1999-01-01

    Blood monocytes or tissue macrophages play a pivotal role in the pathogenesis of murine cytomegalovirus (MCMV) infection, providing functions beneficial to both the virus and the host. In vitro and in vivo studies have indicated that differentiated macrophages support MCMV replication, are target cells for MCMV infection within tissues, and harbor latent MCMV DNA. However, this cell type presumably initiates early, antiviral immune responses as well. In addressing this paradoxical role of macrophages, we provide evidence that the proficiency of MCMV replication in macrophages positively correlates with virulence in vivo. An MCMV mutant from which the open reading frames M139, M140, and M141 had been deleted (RV10) was defective in its ability to replicate in macrophages in vitro and was highly attenuated for growth in vivo. However, depletion of splenic macrophages significantly enhanced, rather than deterred, replication of both wild-type (WT) virus and RV10 in the spleen. The ability of RV10 to replicate in intact or macrophage-depleted spleens was independent of cytokine production, as this mutant virus was a poor inducer of cytokines compared to WT virus in both intact organs and macrophage-depleted organs. Macrophages were, however, a major contributor to the production of tumor necrosis factor alpha and gamma interferon in response to WT virus infection. Thus, the data indicate that tissue macrophages serve a net protective role and may function as “filters” in protecting other highly permissive cell types from MCMV infection. The magnitude of virus replication in tissue macrophages may dictate the amount of virus accessible to the other cells. Concomitantly, infection of this cell type initiates the production of antiviral immune responses to guarantee efficient clearance of acute MCMV infection. PMID:10364349

  20. Replication of murine cytomegalovirus in differentiated macrophages as a determinant of viral pathogenesis.

    PubMed

    Hanson, L K; Slater, J S; Karabekian, Z; Virgin, H W; Biron, C A; Ruzek, M C; van Rooijen, N; Ciavarra, R P; Stenberg, R M; Campbell, A E

    1999-07-01

    Blood monocytes or tissue macrophages play a pivotal role in the pathogenesis of murine cytomegalovirus (MCMV) infection, providing functions beneficial to both the virus and the host. In vitro and in vivo studies have indicated that differentiated macrophages support MCMV replication, are target cells for MCMV infection within tissues, and harbor latent MCMV DNA. However, this cell type presumably initiates early, antiviral immune responses as well. In addressing this paradoxical role of macrophages, we provide evidence that the proficiency of MCMV replication in macrophages positively correlates with virulence in vivo. An MCMV mutant from which the open reading frames M139, M140, and M141 had been deleted (RV10) was defective in its ability to replicate in macrophages in vitro and was highly attenuated for growth in vivo. However, depletion of splenic macrophages significantly enhanced, rather than deterred, replication of both wild-type (WT) virus and RV10 in the spleen. The ability of RV10 to replicate in intact or macrophage-depleted spleens was independent of cytokine production, as this mutant virus was a poor inducer of cytokines compared to WT virus in both intact organs and macrophage-depleted organs. Macrophages were, however, a major contributor to the production of tumor necrosis factor alpha and gamma interferon in response to WT virus infection. Thus, the data indicate that tissue macrophages serve a net protective role and may function as "filters" in protecting other highly permissive cell types from MCMV infection. The magnitude of virus replication in tissue macrophages may dictate the amount of virus accessible to the other cells. Concomitantly, infection of this cell type initiates the production of antiviral immune responses to guarantee efficient clearance of acute MCMV infection. PMID:10364349

  1. Acute cervicitis and vulvovaginitis may be associated with Cytomegalovirus.

    PubMed

    Abou, Magali; Dällenbach, Patrick

    2013-01-01

    Cytomegalovirus (CMV) infection in immunocompetent hosts is generally asymptomatic or may present as a mononucleosic syndrome. Its association with acute cervicitis and vulvovaginitis has rarely been reported. A 24-year-old woman presented with pelvic pain, vulvodynia, abnormal vaginal discharge, burning with urination, fatigue, fever, vomiting and diarrhoea. The vulva and cervix were red with vesicular lesions on the cervix. Genital herpes simplex infection (HSV) was suspected and valacyclovir was given orally. However, serial viral cultures performed 7 weeks apart did not isolate HSV as suspected, but CMV was confirmed by immunofluorescence and early antigen research. Blood tests confirmed an acute CMV infection. Typical inclusions were found at histology. Symptoms resolved slowly with persistence of cervical lesions at 7 weeks from diagnosis. The frequency of CMV genital infection is probably underestimated. The infection is not always asymptomatic and might be confused with genital HSV infection. The clinical course is longer. PMID:23606387

  2. Acute appendicitis due to Cytomegalovirus in an apparently immunocompetent patient: a case report

    PubMed Central

    2014-01-01

    Introduction In healthy subjects, Cytomegalovirus infection can be asymptomatic or manifest as mononucleosis syndrome, but organ disease has also been reported. However, in immunocompromised patients this infection can lead to its most significant and severe disease and even mortality. When Cytomegalovirus causes a gastrointestinal tract infection, it more commonly manifests with luminal tract disease and is usually characterized by ulcerative lesions. Appendicitis is a rare manifestation, and has been reported mainly in human immunodeficiency virus-infected patients or patients with other causes of immunocompromise. Case presentation The authors report on a case of acute primary Cytomegalovirus infection complicated with acute appendicitis due to Cytomegalovirus in an apparently immunocompetent 24-year-old Caucasian man also suffering from primary sclerosing cholangitis and ulcerative colitis. Diagnosis was based on clinical manifestations, serology results, as well as microbiological and histological findings. Treatment consisted of surgery and anti-Cytomegalovirus therapy. Conclusions Cytomegalovirus should be included among the etiologic agents of acute appendicitis in patients with primary sclerosing cholangitis and ulcerative colitis. Currently, there are no definitive data regarding the frequency of Cytomegalovirus appendicitis and the role of anti-Cytomegalovirus treatment in human immunodeficiency virus-negative and apparently immunocompetent subjects. PMID:24612821

  3. Wild isolates of murine cytomegalovirus induce myocarditis and antibodies that cross-react with virus and cardiac myosin.

    PubMed Central

    Fairweather, D; Lawson, C M; Chapman, A J; Brown, C M; Booth, T W; Papadimitriou, J M; Shellam, G R

    1998-01-01

    The laboratory-adapted K181 strain of murine cytomegalovirus (MCMV) induces both acute and chronic myocarditis, associated with autoantibodies to cardiac myosin, in susceptible BALB/c mice. However, the K181 MCMV strain has been maintained in the laboratory for many years and may not resemble naturally occurring strains of MCMV in its ability to induce myocarditis. Accordingly, six different isolates of MCMV from wild Mus domesticus were compared with K181 MCMV for their ability to induce myocarditis and autoantibodies to cardiac myosin in BALB/c mice. These isolates were shown to induce acute myocarditis similar to K181 MCMV, with associated focal and diffuse myocardial inflammation. However, the levels of myocarditis induced by the wild isolates during the chronic phase of the disease (days 32-56 post-infection) were low in contrast to the K181 strain. Interestingly, 30% of wild-trapped mice showed histological evidence of myocarditis and all were sero-positive to MCMV. Sera from BALB/c mice infected with wild MCMV isolates and from wild-trapped mice contained antibodies that cross-reacted with MCMV and cardiac myosin (S2 region). The cross-reactive region of MCMV was found to be a 50,000-55,000 MW viral polypeptide. These findings suggest that molecular mimicry may be involved in the pathogenesis of autoimmune myocarditis following infection with both laboratory and wild MCMV strains. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:9741351

  4. Role of Murine Cytomegalovirus US22 Gene Family Members in Replication in Macrophages

    PubMed Central

    Ménard, Carine; Wagner, Markus; Ruzsics, Zsolt; Holak, Karina; Brune, Wolfram; Campbell, Ann E.; Koszinowski, Ulrich H.

    2003-01-01

    The large cytomegalovirus (CMV) US22 gene family, found in all betaherpesviruses, comprises 12 members in both human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV). Conserved sequence motifs suggested a common ancestry and related functions for these gene products. Two members of this family, m140 and m141, were recently shown to affect MCMV replication on macrophages. To test the role of all US22 members in cell tropism, we analyzed the growth properties in different cell types of MCMV mutants carrying transposon insertions in all 12 US22 gene family members. When necessary, additional targeted mutants with gene deletions, ATG deletions, and ectopic gene revertants were constructed. Mutants with disruption of genes M23, M24, m25.1, m25.2, and m128 (ie2) showed no obvious growth phenotype, whereas growth of M43 mutants was reduced in a number of cell lines. Genes m142 and m143 were shown to be essential for virus replication. Growth of mutants with insertions into genes M36, m139, m140, and m141 in macrophages was severely affected. The common phenotype of the m139, m140, and m141 mutants was explained by an interaction at the protein level. The M36-dependent macrophage growth phenotype could be explained by the antiapoptotic function of the gene that was required for growth on macrophages but not for growth on other cell types. Together, the comprehensive set of mutants of the US22 gene family suggests that individual family members have diverged through evolution to serve a variety of functions for the virus. PMID:12719548

  5. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H

    1992-01-01

    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  6. TNF-α Signaling is not Required for in vivo Transcriptional Reactivation of Latent Murine Cytomegalovirus1

    PubMed Central

    Zhang, Zheng; Li, Zhigao; Yan, Shixian; Wang, Xueqiong; Abecassis, Michael

    2009-01-01

    Background Reactivation of Cytomegalovirus (CMV) is frequently observed in recipients of solid organs and bone marrow transplants and is associated with increased risk of acute and chronic allograft rejection, opportunistic infection, graft failure, and patient mortality. The molecular mechanisms by which reactivation occurs are not well understood. Previous studies have suggested that Tumor Necrosis Factor alpha (TNF-α), which is induced by allogeneic transplantation, may have a role in reactivation of CMV through activation of NF-κB and subsequent transcriptional reactivation of Immediate Early (ie) gene expression. Methods and Results We have tested the role TNF-α in reactivation of CMV directly by testing whether TNF-α is required to initiate transcription of ie gene expression in a murine model of allogeneic transplantation of kidneys latently infected with mouse CMV (MCMV). Conclusions Our studies show that although TNF-α seems to be sufficient, it is not required for initiating transcription of ie gene expression in this model suggesting that both TNF-α-dependent and TNF-α-independent pathways play an important role in reactivation of latent CMV infection. PMID:19741460

  7. Effect of acute cytomegalovirus infection on drug-induced SLE.

    PubMed Central

    Schattner, A.; Sthoeger, Z.; Geltner, D.

    1994-01-01

    A 58 year old woman developed systemic symptoms, interstitial lung disease, splenomegaly, leukopenia and anti-histone and anti-nuclear antibodies (ANA), while treated with hydralazine for hypertension. Five months after presentation she was admitted with high fever, skin rash and atypical lymphocytosis due to acute cytomegalovirus (CMV) infection. Worsening leukopenia and increased ANA were found, and high titres of anti-DNA antibodies, anti-cardiolipin antibodies and rheumatoid factors appeared. Hydralazine was stopped and the patient gradually became asymptomatic. All autoantibodies spontaneously disappeared (over 16 weeks), and the white cell count and spleen size became normal. The patient was found to be a slow acetylator and to have both HLA-DR4 and selective IgA deficiency. Thus, a multifactorial genetic susceptibility to develop drug-induced lupus was brought out in stages first by hydralazine and then by CMV, yet all manifestations and autoantibodies resolved spontaneously, demonstrating the complex interplay of varied environmental factors with a genetic predisposition in the pathogenesis of autoimmunity. PMID:7831173

  8. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  9. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.

    PubMed

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  10. Cytomegalovirus in Plasma of Acute Coronary Syndrome Patients

    PubMed Central

    Nikitskaya, E. A.; Grivel, J.C.; Maryukhnich, E. V.; Lebedeva, A. M.; Ivanova, O. I.; Savvinova, P. P.; Shpektor, A. V.; Margolis, L. B.; Vasilieva, E. Yu.

    2016-01-01

    The relationship between acute coronary syndrome (ACS) and local and systemic inflammation, including accumulation of macrophages in atherosclerotic plaques and upregulation of blood cytokines (e.g., C-reactive protein (CRP)), has been known for more than 100 years. The atherosclerosis-associated inflammatory response has been traditionally considered as an immune system reaction to low-density lipoproteins. At the same time, some data have indicated a potential involvement of cytomegalovirus (CMV) in the activation and progression of atherosclerosis-associated inflammation, leading to ACS. However, these data have been tangential and mainly concerned the relationship between a coronary artery disease (CAD) prognosis and the anti-CMV antibody titer. We assumed that ACS might be associated with CMV reactivation and virus release into the bloodstream. The study’s aim was to test this assumption through a comparison of the plasma CMV DNA level in patients with various CAD forms and in healthy subjects. To our knowledge, no similar research has been undertaken yet. A total of 150 subjects (97 CAD patients and 53 healthy subjects) were examined. Real- time polymerase chain reaction (RT-PCR) was used to determine the number of plasma CMV DNA copies. We demonstrated that the number of plasma CMV genome copies in ACS patients was significantly higher than that in healthy subjects (p = 0.01). The CMV genome copy number was correlated with the plasma CRP level (p = 0.002). These findings indicate a potential relationship between CMV activation and atherosclerosis exacerbation that, in turn, leads to the development of unstable angina and acute myocardial infarction. Monitoring of the CMV plasma level in CAD patients may be helpful in the development of new therapeutic approaches to coronary atherosclerosis treatment. PMID:27437144

  11. Acute Cytomegalovirus Hepatitis in an Immunocompetent Host as a Reason for Upper Right Abdominal Pain

    PubMed Central

    Jensen, Kai Oliver; Angst, Eliane; Hetzer, Franc Heinrich; Gingert, Christian

    2016-01-01

    Cytomegalovirus infections are widely distributed with a seroprevalence of up to 100%. The majority of the cases take a silent course or deal with unspecific clinical symptoms. Complications in immunocompetent patients are rare but may affect the liver and lead up to an acute organ failure. In this case report, we describe a 35-year-old immunocompetent female with an acute cytomegalovirus infection presenting as acute hepatitis with ongoing upper right abdominal pain after cholecystectomy. Upper right abdominal pain is a common symptom with a wide range of differential diagnoses. If common reasons can be excluded, we want to sensitize for cytomegalovirus infection as a minor differential diagnosis even in immunocompetent patients. PMID:27403100

  12. Murine Cytomegalovirus Capsid Assembly Is Dependent on US22 Family Gene M140 in Infected Macrophages▿

    PubMed Central

    Hanson, Laura K.; Slater, Jacquelyn S.; Cavanaugh, Victoria J.; Newcomb, William W.; Bolin, Lisa L.; Nelson, Christine N.; Fetters, Lisa D.; Tang, Qiyi; Brown, Jay C.; Maul, Gerd G.; Campbell, Ann E.

    2009-01-01

    Macrophages are an important target cell for infection with cytomegalovirus (CMV). A number of viral genes that either are expressed specifically in this cell type or function to optimize CMV replication in this host cell have now been identified. Among these is the murine CMV (MCMV) US22 gene family member M140, a nonessential early gene whose deletion (RVΔ140) leads to significant impairment in virus replication in differentiated macrophages. We have now determined that the defect in replication is at the stage of viral DNA encapsidation. Although the rate of RVΔ140 genome replication and extent of DNA cleavage were comparable to those for revertant virus, deletion of M140 resulted in a significant reduction in the number of viral capsids in the nucleus, and the viral DNA remained sensitive to DNase treatment. These data are indicative of incomplete virion assembly. Steady-state levels of both the major capsid protein (M86) and tegument protein M25 were reduced in the absence of the M140 protein (pM140). This effect may be related to the localization of pM140 to an aggresome-like, microtubule organizing center-associated structure that is known to target misfolded and overexpressed proteins for degradation. It appears, therefore, that pM140 indirectly influences MCMV capsid formation in differentiated macrophages by regulating the stability of viral structural proteins. PMID:19458005

  13. Murine Cytomegalovirus Influences Foxj1 Expression, Ciliogenesis, and Mucus Plugging in Mice with Allergic Airway Disease

    PubMed Central

    Wu, Carol A.; Peluso, John J.; Shanley, John D.; Puddington, Lynn; Thrall, Roger S.

    2008-01-01

    We have followed throughout time the development of allergic airway disease (AAD) in both uninfected mice and mice infected intranasally with murine cytomegalovirus (MCMV). Histological evaluation of lung tissue from uninfected mice with AAD demonstrated mucus plugging after 14 and 21 days of ovalbumin-aerosol challenge, with resolution of mucus plugging occurring by 42 days. In MCMV/AAD mice, mucus plugging was observed after 7 days of ovalbumin-aerosol challenge and remained present at 42 days. The level of interleukin-13 in bronchoalveolar lavage fluid from MCMV/AAD mice was decreased compared with AAD mice and was accompanied by increased levels of interferon-γ. Levels of Muc5A/C, Muc5B, or Muc2 mucin mRNA in the lungs of MCMV/AAD mice were not elevated compared with AAD mice. MCMV was able to infect the airway epithelium, resulting in decreased expression of Foxj1, a transcription factor critical for ciliogenesis, and a loss of ciliated epithelial cells. In addition, an increase in the number of epithelial cells staining positive for periodic acid-Schiff was observed in MCMV/AAD airways. Together, these findings suggest that MCMV infection of the airway epithelium enhances goblet cell metaplasia and diminishes efficient mucociliary clearance in mice with AAD, resulting in increased mucus plugging. PMID:18258850

  14. Murine cytomegalovirus stimulates natural killer cell function but kills genetically resistant mice treated with radioactive strontium.

    PubMed Central

    Masuda, A; Bennett, M

    1981-01-01

    Treatment of C3H/St mice with 100 microCi of 89Sr weakened their genetic resistance to murine cytomegalovirus (MCMV) infection. The criteria utilized to detect increased susceptibility were: (i) survival of mice; (ii) numbers of MCMV-infected cells in the spleens and liver; and (iii) serum glutamic pyruvic transaminase levels. The natural killer (NK) cell activity of spleen cells from mice treated with 89Sr is very low. However, the NK activities of spleen cells of both normal and 89Sr-treated mice were greatly augmented 3 days after infection with MCMV. These NK cells lysed a variety of tumor cells and shared several features with conventional NK cells, but were not lysed by anti-Nk-1.2 serum (specific for NK cells) plus complement. Splenic adherent cells did not lyse tumor cells themselves but were necessary for the stimulation of NK cells by MCMV. The paradox of high NK cell function and poor survival in 89Sr-treated mice infected with MCMV was a surprise. We conclude that these augmented NK cells, of themselves, cannot account for the genetic resistance of C3H/St mice to infection with MCMV. Images PMID:6277794

  15. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    SciTech Connect

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.

    2006-01-01

    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  16. Effective Inhibition of Kb- and Db-Restricted Antigen Presentation in Primary Macrophages by Murine Cytomegalovirus

    PubMed Central

    LoPiccolo, Diane M.; Gold, Marielle C.; Kavanagh, Daniel G.; Wagner, Markus; Koszinowski, Ulrich H.; Hill, Ann B.

    2003-01-01

    Macrophages play an important role in murine cytomegalovirus (MCMV) infection in vivo, both in disseminating infection and in harboring latent virus. MCMV encodes three immune evasion genes (m4, m6, and m152) that interfere with the ability of cytotoxic T cells (CTL) to detect virus-infected fibroblasts, but the efficacy of immune evasion in macrophages has been controversial. Here we show that MCMV immune evasion genes function in H-2b primary bone marrow macrophages (BMMφ) in the same way that they do in fibroblasts. Metabolic labeling experiments showed that class I is retained in the endoplasmic reticulum by MCMV infection and associates with m4/gp34 to a similar extent in fibroblasts and BMMφ. We tested a series of Kb- and Db-restricted CTL clones specific for MCMV early genes against a panel of MCMV wild-type virus and mutants lacking m152, m4, or m6. MCMV immune evasion genes effectively inhibited antigen presentation. m152 appeared sufficient to abolish Db-restricted presentation in infected macrophages, as has been previously observed in infected fibroblasts. However, for inhibition of recognition of infected macrophages by Kb-restricted CTL, m4, m6, and m152 were all required. The contribution of m4 to inhibition of recognition appeared much more important in macrophages than in fibroblasts. Thus, MCMV immune evasion genes function effectively in primary macrophages to prevent CTL recognition of early antigens and show the same pattern of major histocompatibility complex class I allele discrimination as is seen in fibroblasts. Furthermore, for inhibition of Kb-restricted presentation, a strong synergistic effect was noted among m152, m4, and m6. PMID:12477835

  17. Macrophage activation associated with chronic murine cytomegalovirus infection results in more severe experimental choroidal neovascularization.

    PubMed

    Cousins, Scott W; Espinosa-Heidmann, Diego G; Miller, Daniel M; Pereira-Simon, Simone; Hernandez, Eleut P; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  18. Macrophage Activation Associated with Chronic Murine Cytomegalovirus Infection Results in More Severe Experimental Choroidal Neovascularization

    PubMed Central

    Cousins, Scott W.; Espinosa-Heidmann, Diego G.; Miller, Daniel M.; Pereira-Simon, Simone; Hernandez, Eleut P.; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D.

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  19. A murine cytomegalovirus-neutralizing monoclonal antibody exhibits autoreactivity and induces tissue damage in vivo.

    PubMed Central

    Chapman, A J; Farrell, H E; Thomas, J A; Papadimitriou, J M; Garlepp, M J; Scalzo, A A; Shellam, G R

    1994-01-01

    The autoreactivity of murine cytomegalovirus (MCMV)-neutralizing monoclonal antibody (mAb) AC1 was examined in vitro and in vivo. Both mAb AC1 and a human antiserum reactive with U1-small nuclear ribonucleoprotein (U1-snRNP) stained uninfected mouse embryo fibroblasts (MEF) in a speckled nuclear pattern and reacted with 70,000 molecular weight (MW) MEF nuclear antigens by immunoblotting, suggesting that mAb AC1 cross-reacted with the 70,000 MW component of U1-snRNP. However, only mAb AC1 cross-reacted with an additional epithelial cytoplasmic autoantigen present in cultured HEp2 cells. On tissue sections from uninfected mice, mAb AC1 predominantly reacted with a component of central and peripheral nervous systems, although cross-reactivity with the stratum spinosum of the skin and the outer sheath of hair follicles was also observed. Immunoblotting revealed that mAb AC1 reacted with phosphorylated epitopes present on a 98,000 MW MCMV structural protein and the 200,000 MW mouse neurofilament protein (NFP). Treatment of uninfected mice with mAb AC1 resulted in a severe interstitial pneumonia with greatly thickened and congested alveolar septa. Severe oedema of the hypodermis and a mild mesangial proliferative glomerulonephritis were also observed. These results demonstrate that a mAb reacting with a MCMV structural phosphoprotein which can protect mice against the dissemination of MCMV, can also promote the development of autoimmune disease. Therefore, the production of such cross-reactive antibodies may be an important mechanism in the development of autoimmunity following viral infection. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7515848

  20. EFFECTS OF NICL2 AND CDCL2 ON SUSCEPTIBILITY TO MURINE CYTOMEGALOVIRUS AND VIRUS-AUGMENTED NATURAL KILLER CELL AND INTERFERON RESPONSES

    EPA Science Inventory

    Female C3H/HeJ or CD-1 mice were infected with a sublethal dose of murine cytomegalovirus (MCMV) and then exposed to nickel chloride NiCl2 or cadmium chloride (CdCl2), intramuscularly (im) or by inhalation. Effects of these treatments on disease susceptibility, virus-augmented an...

  1. Induction of protective cytotoxic T cells to murine cytomegalovirus by using a nonapeptide and a human-compatible adjuvant (Montanide ISA 720).

    PubMed Central

    Scalzo, A A; Elliott, S L; Cox, J; Gardner, J; Moss, D J; Suhrbier, A

    1995-01-01

    The use of synthetic peptides representing cytotoxic T-cell (CTL) epitopes for human vaccination requires the identification of a suitable adjuvant formulation. A single immunization with Montanide ISA720/tetanus toxoid/YPHFMPTNL protected mice against murine cytomegalovirus and induced epitope-specific CTL. Such formulations will find application in peptide-based CTL anti-viral vaccines. PMID:7815511

  2. Acute Human Cytomegalovirus Infection with Bleeding in Iran

    PubMed Central

    Pourhossein, Behzad; Yaghmaei, Farhad; Esmaeili, Saber; Banafshi, Omid; Afrasiabian, Shahla; Shirzadi, Mohammad Reza; Schleiss, Mark; Mostafavi, Ehsan

    2014-01-01

    In December 2011, a 42-year-old male farmer was admitted to a hospital in Sanandaj (Western Iran) with fever and anemia in order to check whether he suffered from some infectious diseases. During the first 3 days after admission, the patient gradually developed progressive oliguria, fever, abdominal pain in the right upper quadrant, leukocytosis with toxic granulation, petechiae and ecchymosis, oral bleeding, and vomiting. The sonographic findings revealed splenomegaly and an increase in the thickness of the gall bladder wall. In order to manage the patient and taking into consideration the most probable differential diagnoses, diagnostic tests were performed on two blood samples collected from him, and real-time polymerase chain reaction for human cytomegalovirus was positive. PMID:25562049

  3. Acute ulcerative proctocolitis associated with primary cytomegalovirus infection.

    PubMed

    Diepersloot, R J; Kroes, A C; Visser, W; Jiwa, N M; Rothbarth, P H

    1990-08-01

    The case is reported of a 39-year-old pregnant woman who presented with fever, abdominal complaints, and diarrhea. Laboratory investigation revealed mononucleosis in the peripheral blood. All microbiological studies were negative, with the exception of finding cytomegalovirus (CMV). Seroconversion was documented; the virus was cultured from urine and subsequently was demonstrated to be present in the inflamed mucosa of the rectum and distal sigmoid, which was found at sigmoidoscopy. This woman was delivered of a neonate with congenital CMV infection but without apparent malformations. The patient experienced recurrences of the bowel disease, in the first of which CMV could still be cultured from a biopsy specimen. In the follow-up period, an otherwise aspecific chronic inflammatory bowel disease remained present. No immunological abnormalities were found, and antibodies to human immunodeficiency virus were negative. This case demonstrates that inflammatory bowel disease can develop as a result of primary infection with CMV. PMID:2166491

  4. Pulmonary embolism and acute cytomegalovirus infection in an immunocompetent patient.

    PubMed

    Del Borgo, Cosmo; Gianfreda, Romina; Belvisi, Valeria; Citton, Rita; Soscia, Fabrizio; Notarianni, Ermanno; Tieghi, Tiziana; Mastroianni, Claudio Maria

    2010-12-01

    A case of an immunocompetent man with acute CMV infection associated with a pulmonary embolism is described. Acute CMV infection could be a risk factor for developing thromboembolism. Pulmonary embolism should be included in differential diagnosis in patients with acute CMV infections and pulmonary opacities. PMID:21196823

  5. Dual Analysis of the Murine Cytomegalovirus and Host Cell Transcriptomes Reveal New Aspects of the Virus-Host Cell Interface

    PubMed Central

    Juranic Lisnic, Vanda; Babic Cac, Marina; Lisnic, Berislav; Trsan, Tihana; Mefferd, Adam; Das Mukhopadhyay, Chitrangada; Cook, Charles H.; Jonjic, Stipan; Trgovcich, Joanne

    2013-01-01

    Major gaps in our knowledge of pathogen genes and how these gene products interact with host gene products to cause disease represent a major obstacle to progress in vaccine and antiviral drug development for the herpesviruses. To begin to bridge these gaps, we conducted a dual analysis of Murine Cytomegalovirus (MCMV) and host cell transcriptomes during lytic infection. We analyzed the MCMV transcriptome during lytic infection using both classical cDNA cloning and sequencing of viral transcripts and next generation sequencing of transcripts (RNA-Seq). We also investigated the host transcriptome using RNA-Seq combined with differential gene expression analysis, biological pathway analysis, and gene ontology analysis. We identify numerous novel spliced and unspliced transcripts of MCMV. Unexpectedly, the most abundantly transcribed viral genes are of unknown function. We found that the most abundant viral transcript, recently identified as a noncoding RNA regulating cellular microRNAs, also codes for a novel protein. To our knowledge, this is the first viral transcript that functions both as a noncoding RNA and an mRNA. We also report that lytic infection elicits a profound cellular response in fibroblasts. Highly upregulated and induced host genes included those involved in inflammation and immunity, but also many unexpected transcription factors and host genes related to development and differentiation. Many top downregulated and repressed genes are associated with functions whose roles in infection are obscure, including host long intergenic noncoding RNAs, antisense RNAs or small nucleolar RNAs. Correspondingly, many differentially expressed genes cluster in biological pathways that may shed new light on cytomegalovirus pathogenesis. Together, these findings provide new insights into the molecular warfare at the virus-host interface and suggest new areas of research to advance the understanding and treatment of cytomegalovirus-associated diseases. PMID:24086132

  6. Knockout of the Host Resistance Gene Pkr Fully Restores Replication of Murine Cytomegalovirus m142 and m143 Mutants In Vivo

    PubMed Central

    Ostermann, Eleonore; Warnecke, Gabriele; Waibler, Zoe

    2015-01-01

    Murine cytomegalovirus (MCMV) proteins m142 and m143 are essential for viral replication. They bind double-stranded RNA and prevent protein kinase R-induced protein synthesis shutoff. Whether the two viral proteins have additional functions such as their homologs in human cytomegalovirus do remained unknown. We show that MCMV m142 and m143 knockout mutants attain organ titers equivalent to those attained by wild-type MCMV in Pkr knockout mice, suggesting that these viral proteins do not encode additional PKR-independent functions relevant for pathogenesis in vivo. PMID:26512090

  7. Mast cells expedite control of pulmonary murine cytomegalovirus infection by enhancing the recruitment of protective CD8 T cells to the lungs.

    PubMed

    Ebert, Stefan; Becker, Marc; Lemmermann, Niels A W; Büttner, Julia K; Michel, Anastasija; Taube, Christian; Podlech, Jürgen; Böhm, Verena; Freitag, Kirsten; Thomas, Doris; Holtappels, Rafaela; Reddehase, Matthias J; Stassen, Michael

    2014-04-01

    The lungs are a noted predilection site of acute, latent, and reactivated cytomegalovirus (CMV) infections. Interstitial pneumonia is the most dreaded manifestation of CMV disease in the immunocompromised host, whereas in the immunocompetent host lung-infiltrating CD8 T cells confine the infection in nodular inflammatory foci and prevent viral pathology. By using murine CMV infection as a model, we provide evidence for a critical role of mast cells (MC) in the recruitment of protective CD8 T cells to the lungs. Systemic infection triggered degranulation selectively in infected MC. The viral activation of MC was associated with a wave of CC chemokine ligand 5 (CCL5) in the serum of C57BL/6 mice that was MC-derived as verified by infection of MC-deficient Kit(W-sh/W-sh) "sash" mutants. In these mutants, CD8 T cells were recruited less efficiently to the lungs, correlating with enhanced viral replication and delayed virus clearance. A causative role for MC was verified by MC reconstitution of "sash" mice restoring both, efficient CD8 T-cell recruitment and infection control. These results reveal a novel crosstalk axis between innate and adaptive immune defense against CMV, and identify MC as a hitherto unconsidered player in the immune surveillance at a relevant site of CMV disease. PMID:24763809

  8. An atypical case of acute disseminated encephalomyelitis associated with cytomegalovirus infection.

    PubMed

    De Fino, Chiara; Nociti, Viviana; Modoni, Anna; Bizzarro, Alessandra; Mirabella, Massimiliano

    2016-01-01

    We present the case of a young man admitted to our hospital for persistent headache associated with fever, retrorbitary pain and vomiting, who rapidly developed encephalopathy with drowsiness, paraplegia, hypoesthesia with a D6 sensory level and urinary retention. Brain and spinal cord MRI revealed findings compatible with acute disseminated encephalomyelitis (ADEM) and microbiological tests documented a cytomegalovirus (CMV) infection. CMV infection is extraordinarily associated with ADEM, but must be included in microbiological tests, because early diagnosis and treatment ameliorate the neurological outcome. PMID:26856946

  9. Murine Cytomegalovirus Virion-Associated Protein M45 Mediates Rapid NF-κB Activation after Infection

    PubMed Central

    Krause, Eva; de Graaf, Miranda; Fliss, Patricia M.; Dölken, Lars

    2014-01-01

    ABSTRACT Murine cytomegalovirus (MCMV) rapidly induces activation of nuclear factor κB (NF-κB) upon infection of host cells. After a transient phase of activation, the MCMV M45 protein blocks all canonical NF-κB-activating pathways by inducing the degradation of the gamma subunit of the inhibitor of κB kinase complex (IKKγ; commonly referred to as the NF-κB essential modulator [NEMO]). Here we show that the viral M45 protein also mediates rapid NF-κB activation immediately after infection. MCMV mutants lacking M45 or expressing C-terminally truncated M45 proteins induced neither NF-κB activation nor transcription of NF-κB-dependent genes within the first 3 h of infection. Rapid NF-κB activation was absent in MCMV-infected NEMO-deficient fibroblasts, indicating that activation occurs at or upstream of the IKK complex. NF-κB activation was strongly reduced in murine fibroblasts lacking receptor-interacting protein 1 (RIP1), a known M45-interacting protein, but was restored upon complementation with murine RIP1. However, the ability of M45 to interact with RIP1 and NEMO was not sufficient to induce NF-κB activation upon infection. In addition, incorporation of the M45 protein into virions was required. This was dependent on a C-terminal region of M45, which is not required for interaction with RIP1 and NEMO. We propose a model in which M45 delivered by viral particles activates NF-κB, presumably involving an interaction with RIP1 and NEMO. Later in infection, expression of M45 induces the degradation of NEMO and the shutdown of canonical NF-κB activation. IMPORTANCE Transcription factor NF-κB is an important regulator of innate and adaptive immunity. Its activation can be beneficial or detrimental for viral pathogens. Therefore, many viruses interfere with NF-κB signaling by stimulating or inhibiting the activation of this transcription factor. Cytomegaloviruses, opportunistic pathogens that cause lifelong infections in their hosts, activate NF

  10. Complex Formation among Murine Cytomegalovirus US22 Proteins Encoded by Genes M139, M140, and M141

    PubMed Central

    Karabekian, Zaruhi; Hanson, Laura K.; Slater, Jacquelyn S.; Krishna, Neel K.; Bolin, Lisa L.; Kerry, Julie A.; Campbell, Ann E.

    2005-01-01

    The murine cytomegalovirus (MCMV) proteins encoded by US22 genes M139, M140, and M141 function, at least in part, to regulate replication of this virus in macrophages. Mutant MCMV having one or more of these genes deleted replicates poorly in macrophages in culture and in the macrophage-dense environment of the spleen. In this report, we demonstrate the existence of stable complexes formed by the products of all three of these US22 genes, as well as a complex composed of the products of M140 and M141. These complexes form in the absence of other viral proteins; however, the pM140/pM141 complex serves as a requisite binding partner for the M139 gene products. Products from all three genes colocalize to a perinuclear region of the cell juxtaposed to or within the cis-Golgi region but excluded from the trans-Golgi region. Interestingly, expression of pM141 redirects pM140 from its predominantly nuclear residence to the perinuclear, cytoplasmic locale where these US22 proteins apparently exist in complex. Thus, complexing of these nonessential, early MCMV proteins likely confers a function(s) independent of each individual protein and important for optimal replication of MCMV in its natural host. PMID:15731247

  11. Dual Requirement of Cytokine and Activation Receptor Triggering for Cytotoxic Control of Murine Cytomegalovirus by NK Cells

    PubMed Central

    Pak-Wittel, Melissa A.; Yang, Liping; Schreiber, Robert D.; Yokoyama, Wayne M.

    2015-01-01

    Natural killer (NK) cells play a critical role in controlling murine cytomegalovirus (MCMV) and can mediate both cytokine production and direct cytotoxicity. The NK cell activation receptor, Ly49H, is responsible for genetic resistance to MCMV in C57BL/6 mice. Recognition of the viral m157 protein by Ly49H is sufficient for effective control of MCMV infection. Additionally, during the host response to infection, distinct immune and non-immune cells elaborate a variety of pleiotropic cytokines which have the potential to impact viral pathogenesis, NK cells, and other immune functions, both directly and indirectly. While the effects of various immune deficiencies have been examined for general antiviral phenotypes, their direct effects on Ly49H-dependent MCMV control are poorly understood. To specifically interrogate Ly49H-dependent functions, herein we employed an in vivo viral competition approach to show Ly49H-dependent MCMV control is specifically mediated through cytotoxicity but not IFNγ production. Whereas m157 induced Ly49H-dependent degranulation, efficient cytotoxicity also required either IL-12 or type I interferon (IFN-I) which acted directly on NK cells to produce granzyme B. These studies demonstrate that both of these distinct NK cell-intrinsic mechanisms are integrated for optimal viral control by NK cells. PMID:26720279

  12. The effect of cytomegalovirus infection on acute rejection in kidney transplanted patients

    PubMed Central

    Hasanzamani, Boshra; Hami, Maryam; Zolfaghari, Vajihe; Torkamani, Mahtab; Ghorban Sabagh, Mahin; Ahmadi Simab, Saiideh

    2016-01-01

    Introduction: It is known that cytomegalovirus (CMV) infection is a common problem among kidney transplant patients. This infection can be increased morbidity and decreased graft survival. This problem has been associated with acute rejection too. Patients and Methods: One hundred and thirty renal transplant patients were included in a prospective, case-control study. The renal transplant patients were divided into two groups; patients group with CMV infection and control group without CMV infection. Serum CMV-IgG in all patients was positive (donor and recipients). None of patients had received anti-thymocyte-globulin and thymoglobulin. CMV infection was diagnosed by quantitative CMV-PCR (polymerase chain reaction) test (more than 500 copies/μg). Rejection episode was defined by kidney isotope scan or biopsy. Results: In the group of 66 CMV infection patients (41 male [62.1%] and 25 female [37.9%]) the incidence of graft rejection was 36%, however in the group of 64 control patients the incidence of graft rejection was 9.4 % (P < 0.005). Conclusion: CMV infection is important predisposing factor for acute allograft rejection after kidney transplantation. The results of this study suggests that the control of CMV infection could decrease episodes of acute kidney rejection. PMID:27471740

  13. γδ T Cells Confer Protection against Murine Cytomegalovirus (MCMV)

    PubMed Central

    Villacreces, Arnaud; Juzan, Marina; Rousseau, Benoît; Dulanto, Sara; Giese, Alban; Costet, Pierre; Praloran, Vincent; Moreau, Jean-François; Dubus, Pierre; Vermijlen, David

    2015-01-01

    Cytomegalovirus (CMV) is a leading infectious cause of morbidity in immune-compromised patients. γδ T cells have been involved in the response to CMV but their role in protection has not been firmly established and their dependency on other lymphocytes has not been addressed. Using C57BL/6 αβ and/or γδ T cell-deficient mice, we here show that γδ T cells are as competent as αβ T cells to protect mice from CMV-induced death. γδ T cell-mediated protection involved control of viral load and prevented organ damage. γδ T cell recovery by bone marrow transplant or adoptive transfer experiments rescued CD3ε−/− mice from CMV-induced death confirming the protective antiviral role of γδ T cells. As observed in humans, different γδ T cell subsets were induced upon CMV challenge, which differentiated into effector memory cells. This response was observed in the liver and lungs and implicated both CD27+ and CD27− γδ T cells. NK cells were the largely preponderant producers of IFNγ and cytotoxic granules throughout the infection, suggesting that the protective role of γδ T cells did not principally rely on either of these two functions. Finally, γδ T cells were strikingly sufficient to fully protect Rag−/−γc−/− mice from death, demonstrating that they can act in the absence of B and NK cells. Altogether our results uncover an autonomous protective antiviral function of γδ T cells, and open new perspectives for the characterization of a non classical mode of action which should foster the design of new γδ T cell based therapies, especially useful in αβ T cell compromised patients. PMID:25747674

  14. Murine cytomegalovirus with a deletion of genes spanning HindIII-J and -I displays altered cell and tissue tropism.

    PubMed

    Cavanaugh, V J; Stenberg, R M; Staley, T L; Virgin, H W; MacDonald, M R; Paetzold, S; Farrell, H E; Rawlinson, W D; Campbell, A E

    1996-03-01

    Murine cytomegalovirus (MCMV) gene products dispensable for growth in cell culture are likely to have important functions within the infected host, influencing tissue tropism, dissemination, or immunological responses against the virus. To identify such genes, our strategy was to delete large regions of the MCMV genome likely to contain genes nonessential for virus replication in NIH 3T3 cells. Mutant virus RV7 contained a deletion of 7.7 kb spanning portions of MCMV HindIII-J and -I. This virus grew comparably to wild-type (WT) virus in NIH 3T3 fibroblasts, primary embryo fibroblasts, and bone marrow macrophages. However, RV7 failed to replicate in target organs of immunocompetent BALB/c mice and severe combined immunodeficient mice, which are exquisitely sensitive to MCMV infection. This defect in vivo growth may be related to the observation that RV7 grew poorly in the peritoneal macrophage cell line IC-21, which is highly permissive for growth of WT MCMV. Two other mutant viruses with an insertion or smaller deletion in the region common to the RV7 deletion grew comparably to WT virus in the macrophage cell line and replicated in salivary gland tissue. The poor growth of RV7 in IC-21 cells was due to a block in immediate-early gene expression, as levels of RNA from immediate-early gene IE1 were reduced eightfold compared with levels for WT virus in macrophages infected with RV7. Consequently, levels of RNA from early and late genes were also reduced. The lower expression of IE1 in RV7-infected IC-21 macrophages was not due to defective entry of virus into the cells, as equal amounts of viral DNA were present in cells 3 h after infection with RV7 or WT MCMV. These studies demonstrate that deletion of sequences in HindIII-J and -I confer altered cell and tissue tropism. PMID:8627652

  15. Murine cytomegalovirus with a deletion of genes spanning HindIII-J and -I displays altered cell and tissue tropism.

    PubMed Central

    Cavanaugh, V J; Stenberg, R M; Staley, T L; Virgin, H W; MacDonald, M R; Paetzold, S; Farrell, H E; Rawlinson, W D; Campbell, A E

    1996-01-01

    Murine cytomegalovirus (MCMV) gene products dispensable for growth in cell culture are likely to have important functions within the infected host, influencing tissue tropism, dissemination, or immunological responses against the virus. To identify such genes, our strategy was to delete large regions of the MCMV genome likely to contain genes nonessential for virus replication in NIH 3T3 cells. Mutant virus RV7 contained a deletion of 7.7 kb spanning portions of MCMV HindIII-J and -I. This virus grew comparably to wild-type (WT) virus in NIH 3T3 fibroblasts, primary embryo fibroblasts, and bone marrow macrophages. However, RV7 failed to replicate in target organs of immunocompetent BALB/c mice and severe combined immunodeficient mice, which are exquisitely sensitive to MCMV infection. This defect in vivo growth may be related to the observation that RV7 grew poorly in the peritoneal macrophage cell line IC-21, which is highly permissive for growth of WT MCMV. Two other mutant viruses with an insertion or smaller deletion in the region common to the RV7 deletion grew comparably to WT virus in the macrophage cell line and replicated in salivary gland tissue. The poor growth of RV7 in IC-21 cells was due to a block in immediate-early gene expression, as levels of RNA from immediate-early gene IE1 were reduced eightfold compared with levels for WT virus in macrophages infected with RV7. Consequently, levels of RNA from early and late genes were also reduced. The lower expression of IE1 in RV7-infected IC-21 macrophages was not due to defective entry of virus into the cells, as equal amounts of viral DNA were present in cells 3 h after infection with RV7 or WT MCMV. These studies demonstrate that deletion of sequences in HindIII-J and -I confer altered cell and tissue tropism. PMID:8627652

  16. Effects of cell source, mouse strain, and immunosuppressive treatment on production of virulent and attenuated murine cytomegalovirus.

    PubMed Central

    Selgrade, M K; Nedrud, J G; Collier, A M; Gardner, D E

    1981-01-01

    Murine cytomegalovirus pools from various in vitro and in vivo sources were compared for virulence in suckling mice in an effort to identify the conditions which were necessary for the production of virulent and attenuated viruses. Virus passaged in tracheal ring and salivary gland organ cultures, where virus is produced primarily by epithelial cells, was even more attenuated than virus passaged in mouse embryo fibroblasts. The attenuation observed after passage in all three of these in vitro systems did not appear to be due to defective interfering particles. We also found that virus produced in vivo in salivary glands became attenuated with time after infection. Virus harvested from salivary glands 5 to 6 weeks after infection was highly attenuated compared with both salivary gland-passaged virus harvested 2 to 3 weeks after infection and tissue culture-passaged virus. The attenuation of salivary gland-passaged virus with time was reversed when animals were treated with cyclophosphamide before the virus was harvested. A comparison of virus pools harvested from susceptible and resistant mouse strains indicated that the mouse strain had little effect on the virulence of the virus produced. When the various sources of virus tested in this study were ranked in terms of the virulence of the virus produced, salivary glands in intact mice either 2 to 3 weeks after infection or after cyclophosphamide treatment produced the most virulent virus, followed by mouse embryo fibroblast cultures, tracheal ring and salivary gland organ cultures, and, finally, salivary glands in intact mice 5 to 6 weeks after infection. PMID:6270000

  17. Murine cytomegalovirus perturbs endosomal trafficking of major histocompatibility complex class I molecules in the early phase of infection.

    PubMed

    Tomas, Maja Ilić; Kucić, Natalia; Mahmutefendić, Hana; Blagojević, Gordana; Lucin, Pero

    2010-11-01

    Murine cytomegalovirus (MCMV) functions interfere with protein trafficking in the secretory pathway. In this report we used Δm138-MCMV, a recombinant virus with a deleted viral Fc receptor, to demonstrate that MCMV also perturbs endosomal trafficking in the early phase of infection. This perturbation had a striking impact on cell surface-resident major histocompatibility complex class I (MHC-I) molecules due to the complementary effect of MCMV immunoevasins, which block their egress from the secretory pathway. In infected cells, constitutively endocytosed cell surface-resident MHC-I molecules were arrested and retained in early endosomal antigen 1 (EEA1)-positive and lysobisphosphatidic acid (LBPA)-negative perinuclear endosomes together with clathrin-dependent cargo (transferrin receptor, Lamp1, and epidermal growth factor receptor). Their progression from these endosomes into recycling and degradative routes was inhibited. This arrest was associated with a reduction of the intracellular content of Rab7 and Rab11, small GTPases that are essential for the maturation of recycling and endolysosomal domains of early endosomes. The reduced recycling of MHC-I in Δm138-MCMV-infected cells was accompanied by their accelerated loss from the cell surface. The MCMV function that affects cell surface-resident MHC-I was activated in later stages of the early phase of viral replication, after the expression of known immunoevasins. MCMV without the three immunoevasins (the m04, m06, and m152 proteins) encoded a function that affects endosomal trafficking. This function, however, was not sufficient to reduce the cell surface expression of MHC-I in the absence of the transport block in the secretory pathway. PMID:20719942

  18. Protective role of murine norovirus against Pseudomonas aeruginosa acute pneumonia.

    PubMed

    Thépaut, Marion; Grandjean, Teddy; Hober, Didier; Lobert, Pierre-Emmanuel; Bortolotti, Perrine; Faure, Karine; Dessein, Rodrigue; Kipnis, Eric; Guery, Benoit

    2015-01-01

    The murine norovirus (MNV) is a recently discovered mouse pathogen, representing the most common contaminant in laboratory mouse colonies. Nevertheless, the effects of MNV infection on biomedical research are still unclear. We tested the hypothesis that MNV infection could alter immune response in mice with acute lung infection. Here we report that co-infection with MNV increases survival of mice with Pseudomonas aeruginosa acute lung injury and decreases in vivo production of pro-inflammatory cytokines. Our results suggest that MNV infection can deeply modify the parameters studied in conventional models of infection and lead to false conclusions in experimental models. PMID:26338794

  19. Ligand Induction of Retinoic Acid Receptors Alters an Acute Infection by Murine Cytomegalovirus†

    PubMed Central

    Angulo, Ana; Chandraratna, Roshantha A. S.; LeBlanc, James F.; Ghazal, Peter

    1998-01-01

    Here we report that administration of retinoids can alter the outcome of an acute murine cytomegalovirus (MCMV) infection. We show that a crucial viral control element, the major immediate-early enhancer, can be activated by retinoic acid (RA) via multiple RA-responsive elements (DR2) that bind retinoid X receptor-retinoic acid receptor (RAR) heterodimers with apparent dissociation constants ranging from 15 to 33 nM. Viral growth is dramatically increased upon RA treatment of infected tissue culture cells. Using synthetic retinoid receptor-specific agonists and antagonists, we provide evidence that RAR activation in cells is required for mediating the response of MCMV to RA. Oral administration of RA to infected immunocompetent mice selectively exacerbates an infection by MCMV, while cotreatment with an RAR antagonist protects against the adverse effects of RA on MCMV infection. In conclusion, these chemical genetic experiments provide evidence that an RAR-mediated pathway can modulate in vitro and in vivo infections by MCMV. PMID:9573222

  20. Cytomegalovirus-associated acute hydramnios treated by amniocentesis and maternal indomethacin.

    PubMed

    Suzumori, Nobuhiro; Hattori, Yukio; Kaneko, Saori; Suzuki, Yoshikatsu; Sugiura-Ogasawara, Mayumi

    2009-12-01

    A 22-year-old pregnant woman noticed a rapid increase of abdominal growth, uterine tenderness and irregular contraction, for which she hospitalized at 25 weeks of gestation. An ultrasound examination demonstrated a single fetus with normal anatomy and massive hydramnios. Serial therapeutic amniocentesis was performed for relief of maternal symptoms and indomethacin compress was initiated. Both the maternal and amniotic fluid IgM were positive for cytomegalovirus (CMV). Maternal compress indomethacin was discontinued at 32 weeks. Cesarean section was performed due to fetal distress at 34 weeks of gestation. A female infant was delivered and the neonatal examination was within normal limits with urine culture positive for CMV. At 1 year of age the child was developing normally with normal hearing and no clinical sequelae of intrauterine CMV infection. We postulate that serial and large volume reduction of amniotic fluid by amniocentesis and compress indomethacin in our case interrupted the natural course and provided sufficient time for the fetus to recover from the acute phase of viral infection. PMID:20021488

  1. Animal cytomegaloviruses.

    PubMed Central

    Staczek, J

    1990-01-01

    Cytomegaloviruses are agents that infect a variety of animals. Human cytomegalovirus is associated with infections that may be inapparent or may result in severe body malformation. More recently, human cytomegalovirus infections have been recognized as causing severe complications in immunosuppressed individuals. In other animals, cytomegaloviruses are often associated with infections having relatively mild sequelae. Many of these sequelae parallel symptoms associated with human cytomegalovirus infections. Recent advances in biotechnology have permitted the study of many of the animal cytomegaloviruses in vitro. Consequently, animal cytomegaloviruses can be used as model systems for studying the pathogenesis, immunobiology, and molecular biology of cytomegalovirus-host and cytomegalovirus-cell interactions. PMID:2170830

  2. Murine Cytomegalovirus US22 Protein pM140 Protects Its Binding Partner, pM141, from Proteasome-Dependent but Ubiquitin-Independent Degradation ▿

    PubMed Central

    Bolin, Lisa L.; Hanson, Laura K.; Slater, Jacquelyn S.; Kerry, Julie A.; Campbell, Ann E.

    2010-01-01

    Stable assembly of murine cytomegalovirus (MCMV) virions in differentiated macrophages is dependent upon the expression of US22 family gene M140. The M140 protein (pM140) exists in complex with products of neighboring US22 genes. Here we report that pM140 protects its binding partner, pM141, from ubiquitin-independent proteasomal degradation. Protection is conferred by a stabilization domain mapping to amino acids 306 to 380 within pM140, and this domain is functionally independent from the region that confers binding of pM140 to pM141. The M140 protein thus contains multiple domains that collectively confer a structure necessary to function in virion assembly in macrophages. PMID:19955315

  3. The Viral Chemokine MCK-2 of Murine Cytomegalovirus Promotes Infection as Part of a gH/gL/MCK-2 Complex

    PubMed Central

    Prager, Adrian; Trsan, Tihana; Arapovic, Maja; Lemmermann, Niels A. W.; Podlech, Jürgen; Reddehase, Matthias J.; Lemnitzer, Frederic; Bosse, Jens Bernhard; Gimpfl, Martina; Marcinowski, Lisa; MacDonald, Margaret; Adler, Heiko; Koszinowski, Ulrich H.; Adler, Barbara

    2013-01-01

    Human cytomegalovirus (HCMV) forms two gH/gL glycoprotein complexes, gH/gL/gO and gH/gL/pUL(128,130,131A), which determine the tropism, the entry pathways and the mode of spread of the virus. For murine cytomegalovirus (MCMV), which serves as a model for HCMV, a gH/gL/gO complex functionally homologous to the HCMV gH/gL/gO complex has been described. Knock-out of MCMV gO does impair, but not abolish, virus spread indicating that also MCMV might form an alternative gH/gL complex. Here, we show that the MCMV CC chemokine MCK-2 forms a complex with the glycoprotein gH, a complex which is incorporated into the virion. We could additionally show that mutants lacking both, gO and MCK-2 are not able to produce infectious virus. Trans-complementation of these double mutants with either gO or MCK-2 showed that both proteins can promote infection of host cells, although through different entry pathways. MCK-2 has been extensively studied in vivo by others. It has been shown to be involved in attracting cells for virus dissemination and in regulating antiviral host responses. We now show that MCK-2, by forming a complex with gH, strongly promotes infection of macrophages in vitro and in vivo. Thus, MCK-2 may play a dual role in MCMV infection, as a chemokine regulating the host response and attracting specific target cells and as part of a glycoprotein complex promoting entry into cells crucial for virus dissemination. PMID:23935483

  4. Cytomegalovirus retinitis

    MedlinePlus

    ... to prevent its return. Alternative Names Cytomegalovirus retinitis Images Eye CMV retinitis CMV (cytomegalovirus) References Crumpacker CS. ... 5. Read More Antibody HIV/AIDS Immune response Retinal detachment Systemic WBC count Update Date 12/10/ ...

  5. CD73 Is Dispensable for the Regulation of Inflationary CD8+ T-Cells after Murine Cytomegalovirus Infection and Adenovirus Immunisation

    PubMed Central

    Sims, Stuart; Colston, Julia; Emery, Vince; Klenerman, Paul

    2014-01-01

    The ecto-5'-nucleotidase (CD73) is expressed by T-cell subsets, myeloid derived suppressive cells and endothelial cells. It works in conjunction with CD39 to regulate the formation and degradation of adenosine in vivo. Adenosine has previously been shown to suppress the proliferation and cytokine secretion of T-cells and recent evidence suggests that inhibition of CD73 has the potential to enhance T-cell directed therapies. Here we utilised a CD73 knockout mouse model to assess the suppressive ability of CD73 on CD8+ T-cell classical memory and memory “inflation”, induced by murine cytomegalovirus (MCMV) infection and adenovirus immunisation. We show that CD73 is dispensable for normal CD8+ T-cell differentiation and function in both models. Thus CD73 as a suppressor of CD8+ T-cells is unlikely to play a deterministic role in the generation and functional characteristics of antiviral memory in these settings. PMID:25490556

  6. Attenuated murine cytomegalovirus binds to N-acetylglucosamine, and shift to virulence may involve recognition of sialic acids.

    PubMed Central

    Ravindranath, R M; Graves, M C

    1990-01-01

    Treatment of cells with lectins specific for N-acetylglucosamine (GlcNAc) blocked infection by mouse cytomegalovirus (MCMV), and GlcNAc pretreatment of the lectin blocked this effect. MCMV failed to infect N-acetylglucosaminidase (GlcNAcase)-treated mouse embryo fibroblasts (MEF). GlcNAc and GlcNAc-containing synthetic oligosaccharides directly inhibited viral infectivity. Ulex lectin inhibition of infection was shown to be due to inhibition of surface adsorption of 35S-labeled virus. Also, GlcNAcase eluted 35S-labeled virus adsorbed to MEF at 4 degrees C and inhibited plaque formation if added after adsorption at this temperature. These findings indicate that GlcNAc binding is involved in attachment rather than in some later step in infection. High-performance thin-layer chromatography overlay of [35S]MCMV indicated that it binds to a GlcNAc-containing asialoglycolipid. Analogous experiments indicated that MCMV made virulent by in vivo salivary gland passage binds to sialic acids in addition to GlcNAc. Treatment of MEF with sialic acid-binding lectins blocked infectivity. Incubation of virus with sialic acids also prevented infection. N-acetylneuraminic acid was 10(3)-fold more potent than N-glycolylneuraminic acid. Sialidase-treated target cells were not efficiently infected by the virus. Thus, MCMV binds to GlcNAc on the cell surface, and the shift to virulence (by in vivo salivary gland passage) correlates with viral recognition of sialic acids. Images PMID:2170680

  7. Antileukemic Efficacy of Continuous vs Discontinuous Dexamethasone in Murine Models of Acute Lymphoblastic Leukemia

    PubMed Central

    Ramsey, Laura B.; Janke, Laura J.; Payton, Monique A.; Cai, Xiangjun; Paugh, Steven W.; Karol, Seth E.; Kamdem, Landry Kamdem; Cheng, Cheng; Williams, Richard T.; Jeha, Sima; Pui, Ching-Hon; Evans, William E.; Relling, Mary V.

    2015-01-01

    Osteonecrosis is one of the most common, serious, toxicities resulting from the treatment of acute lymphoblastic leukemia. In recent years, pediatric acute lymphoblastic leukemia clinical trials have used discontinuous rather than continuous dosing of dexamethasone in an effort to reduce the incidence of osteonecrosis. However, it is not known whether discontinuous dosing would compromise antileukemic efficacy of glucocorticoids. Therefore, we tested the efficacy of discontinuous dexamethasone against continuous dexamethasone in murine models bearing human acute lymphoblastic leukemia xenografts (n = 8 patient samples) or murine BCR-ABL+ acute lymphoblastic leukemia. Plasma dexamethasone concentrations (7.9 to 212 nM) were similar to those achieved in children with acute lymphoblastic leukemia using conventional dosages. The median leukemia-free survival ranged from 16 to 59 days; dexamethasone prolonged survival from a median of 4 to 129 days in all seven dexamethasone-sensitive acute lymphoblastic leukemias. In the majority of cases (7 of 8 xenografts and the murine BCR-ABL model) we demonstrated equal efficacy of the two dexamethasone dosing regimens; whereas for one acute lymphoblastic leukemia sample, the discontinuous regimen yielded inferior antileukemic efficacy (log-rank p = 0.002). Our results support the clinical practice of using discontinuous rather than continuous dexamethasone dosing in patients with acute lymphoblastic leukemia. PMID:26252865

  8. Characterization of Murine Cytomegalovirus m157 from Infected Cells and Identification of Critical Residues Mediating Recognition by the NK Cell Receptor, Ly49H

    PubMed Central

    Davis, Aja H.; Guseva, Natalya V.; Ball, Brianne L.; Heusel, Jonathan W.

    2008-01-01

    Activated natural killer (NK) cells mediate potent cytolytic and secretory effector functions, and are vital components of the early antiviral immune response. NK cell activities are regulated by the assortment of inhibitory receptors that recognize major histocompatibility class I ligands expressed on healthy cells and activating receptors that recognize inducible host ligands or ligands that are not well characterized. The activating Ly49H receptor of mouse NK cells is unique in that it specifically recognizes a virally encoded ligand, the m157 glycoprotein of murine cytomegalovirus (MCMV). The Ly49H-m157 interaction underlies a potent resistance mechanism (Cmv1) in C57BL/6 mice, and serves as an excellent model in which to understand how NK cells are specifically activated in vivo, as similar receptor systems are operative for human NK cells. For transduced cells expressing m157 in isolation and for MCMV-infected cells, we show that m157 is expressed in multiple isoforms with marked differences in abundance between infected fibroblasts (high) and macrophages (low). At the cell surface m157 is exclusively a glycosylphosphatidylinositol-associated protein in MCMV-infected cells. Through random and site-directed mutagenesis of m157 we identify unique residues that provide for efficient cell surface expression of m157, but fail to activate Ly49H-expressing reporter cells. These m157 mutations are predicted to alter the conformation of a putative m157 interface with Ly49H, one that relies on the position of a critical α0-helix of m157. These findings support an emerging model for a novel interaction between this important NK cell receptor and its viral ligand. PMID:18566392

  9. Mechanisms for virus-induced liver disease: tumor necrosis factor-mediated pathology independent of natural killer and T cells during murine cytomegalovirus infection.

    PubMed Central

    Orange, J S; Salazar-Mather, T P; Opal, S M; Biron, C A

    1997-01-01

    The contribution of endogenous NK cells and cytokines to virus-induced liver pathology was evaluated during murine cytomegalovirus infections of mice. In immunocompetent C57BL/6 mice, the virus induced a self-limited liver disease characterized by hepatitis, with focal inflammation, and large grossly visible subcapsular necrotic foci. The inflammatory foci were most numerous and contained the greatest number of cells 3 days after infection; they colocalized with areas of viral antigen expression. The largest number of necrotic foci was found 2 days after infection. Overall hepatic damage, assessed as increased expression of liver enzymes in serum, accompanied the development of inflammatory and necrotic foci. Experiments with neutralizing antibodies demonstrated that although virus-induced tumor necrosis factor (TNF) can have antiviral effects, it also mediated significant liver pathology. TNF was required for development of hepatic necrotic foci and increased levels of liver enzymes in serum but not for increased numbers of inflammatory foci. The necrotic foci and liver enzyme indications of pathology occurred independently of NK and T cells, because mice rendered NK-cell deficient by treatment with antibodies, T- and B-cell-deficient Rag-/- mice, and NK- and T-cell-deficient E26 mice all manifested both parameters of disease. Development of necrotic foci and maximally increased levels of liver enzymes in serum also were TNF dependent in NK-cell-deficient mice. Moreover, in the immunodeficient E26 mice, virus-induced liver disease was progressive, with eventual death of the host, and neutralization of TNF significantly increased longevity. These results establish conditions separating hepatitis from significant liver damage and demonstrate a cytokine-mediated component to viral pathogenesis. PMID:9371583

  10. [Cytomegalovirus reactivation after allogeneic stem cell transplantation reduces the risk of relapse in patients with acute myeloid leukemia].

    PubMed

    Takenaka, Katsuto

    2015-07-01

    Cytomegalovirus (CMV) infection is still a major infectious complication after allogeneic hematopoietic cell transplantation (HCT). Recently, CMV reactivation was reported to be associated with a decreased risk of relapse in patients with acute myeloid leukemia (AML). We herein retrospectively evaluated the impact of early CMV reactivation on the incidence of disease relapse after allo-HCT using the database of the Transplant Registry Unified Management Program (TRUMP) at the JSHCT. Patients who underwent their first allo-HCT from HLA-matched related or unrelated donors between 2000 and 2009, and who survived without disease relapse until day 100 after transplantation, were analyzed. CMV reactivation was associated with a decreased cumulative incidence of relapse among patients with AML, but not in patients with other hematological malignancies in our study. However, this benefit was nullified by the increased rate of non-relapse mortality. The underlying mechanism is unclear, but the immunological reaction against CMV reactivation plays an essential role in this association. Thus, immune augmentation treatment options including vaccination and adoptive T-cell transfer might be useful for taking advantage of the efficacy of CMV reactivation while minimizing the increase in non-relapse mortality. PMID:26251145

  11. The Role of NKG2D Signaling in Inhibition of Cytotoxic T-Lymphocyte Lysis by the Murine Cytomegalovirus Immunoevasin m152/gp40▿

    PubMed Central

    Pinto, Amelia K.; Jamieson, Amanda M.; Raulet, David H.; Hill, Ann B.

    2007-01-01

    Three proteins encoded by murine cytomegalovirus (MCMV)— gp34, encoded by m04 (m04/gp34), gp48, encoded by m06 (m06/gp48), and gp40, encoded by m152 (m152/gp40)—act together to powerfully impact the ability of primed cytotoxic CD8 T lymphocytes (CTL) to kill virus-infected cells. Of these three, the impact of m152/gp40 on CTL lysis appears greater than would be expected based on its impact on cell surface major histocompatibility complex (MHC) class I. In addition to MHC class I, m152/gp40 also downregulates the RAE-1 family of NKG2D ligands, which can provide costimulation for CD8 T cells. We hypothesized that m152/gp40 may impact CTL lysis so profoundly because it inhibits both antigen presentation and NKG2D-mediated costimulation. We therefore tested the extent to which m152/gp40's ability to inhibit CTL lysis of MCMV-infected cells could be accounted for by its inhibition of NKG2D signaling. As was predictable from the results reported in the literature, NKG2D ligands were not detected by NKG2D tetramer staining of cells infected with wild-type MCMV, whereas those infected with MCMV lacking m152/gp40 displayed measurable levels of the NKG2D ligand. To determine whether NKG2D signaling contributed to the ability of CTL to lyse these cells, we used a blocking anti-NKG2D antibody. Blocking NKG2D signaling did affect the killing of MCMV-infected cells for some epitopes. However, for all epitopes, the impact of m152/gp40 on CTL lysis was much greater than the impact of inhibition of NKG2D signaling. We conclude that the downregulation of NKG2D ligands by MCMV makes only a small contribution to the impact of m152/gp40 on CTL lysis and only for a small subset of CTL. PMID:17855532

  12. Cytomegalovirus induces strong antileukemic effect in acute myeloid leukemia patients following sibling HSCT without ATG-containing regimen.

    PubMed

    Bao, Xiebing; Zhu, Qian; Xue, Shengli; Hu, Xiaohui; Ma, Xiao; Chen, Feng; Chen, Suning; Sun, Aining; Wu, Depei; Yu, Jianhua; Wu, Xiaojin; Qiu, Huiying

    2016-01-01

    A considerable number of studies have demonstrated that cytomegalovirus (CMV) reactivation after allogeneic hematopoietic stem cell transplantation (Allo-HSCT) could enforce graft-versus leukemia (GVL) effect in acute myeloid leukemia (AML) patients. However, the use of antithymocyte globulin (ATG) as part of graft-versus-host disease (GVHD) prophylaxis may dampen this beneficial effect of CMV replication. In this context, we retrospectively analyzed the effect of CMV reactivation on relapse, survival and prognosis in a total of 227 AML patients who received a myeloablative (MA) conditioning regimen at a single research center between January 2010 and April 2013. Of these 227 patients, 110 cases received non-ATG-containing regimens and 117 cases received ATG-containing regimens. CMV reactivation occurred in 45 patients (41%) among non-ATG regimen group and 73 patients (62%) among ATG regimen group (P = 0.001). At a median time to follow-up of 27.5 months, a lower risk of cumulative relapse incidence associated with CMV reactivation was observed in non-ATG group in multivariate analyses (OR 0.28, 95% CI 0.10-0.79; P = 0.016). However, CMV reactivation after transplantation did not significantly decrease the cumulative incidence of relapse in our ATG group (OR 0.28, 95% CI 0.10-0.79; P = 0.016). Collectively, our results demonstrate that in AML patients following sibling HSCT, the CMV-induced beneficial effect on relapse occurs only in the MA regimens containing no ATG, although ATG promotes CMV reactivation. PMID:27158357

  13. Cytomegalovirus induces strong antileukemic effect in acute myeloid leukemia patients following sibling HSCT without ATG-containing regimen

    PubMed Central

    Bao, Xiebing; Zhu, Qian; Xue, Shengli; Hu, Xiaohui; Ma, Xiao; Chen, Feng; Chen, Suning; Sun, Aining; Wu, Depei; Yu, Jianhua; Wu, Xiaojin; Qiu, Huiying

    2016-01-01

    A considerable number of studies have demonstrated that cytomegalovirus (CMV) reactivation after allogeneic hematopoietic stem cell transplantation (Allo-HSCT) could enforce graft-versus leukemia (GVL) effect in acute myeloid leukemia (AML) patients. However, the use of antithymocyte globulin (ATG) as part of graft-versus-host disease (GVHD) prophylaxis may dampen this beneficial effect of CMV replication. In this context, we retrospectively analyzed the effect of CMV reactivation on relapse, survival and prognosis in a total of 227 AML patients who received a myeloablative (MA) conditioning regimen at a single research center between January 2010 and April 2013. Of these 227 patients, 110 cases received non-ATG-containing regimens and 117 cases received ATG-containing regimens. CMV reactivation occurred in 45 patients (41%) among non-ATG regimen group and 73 patients (62%) among ATG regimen group (P = 0.001). At a median time to follow-up of 27.5 months, a lower risk of cumulative relapse incidence associated with CMV reactivation was observed in non-ATG group in multivariate analyses (OR 0.28, 95% CI 0.10-0.79; P = 0.016). However, CMV reactivation after transplantation did not significantly decrease the cumulative incidence of relapse in our ATG group (OR 0.28, 95% CI 0.10-0.79; P = 0.016). Collectively, our results demonstrate that in AML patients following sibling HSCT, the CMV-induced beneficial effect on relapse occurs only in the MA regimens containing no ATG, although ATG promotes CMV reactivation. PMID:27158357

  14. Methods for Acute and Subacute Murine Hindlimb Ischemia.

    PubMed

    Padgett, Michael E; McCord, Timothy J; McClung, Joseph M; Kontos, Christopher D

    2016-01-01

    Peripheral artery disease (PAD) is a leading cause of cardiovascular morbidity and mortality in developed countries, and animal models that reliably reproduce the human disease are necessary to develop new therapies for this disease. The mouse hindlimb ischemia model has been widely used for this purpose, but the standard practice of inducing acute limb ischemia by ligation of the femoral artery can result in substantial tissue necrosis, compromising investigators' ability to study the vascular and skeletal muscle tissue responses to ischemia. An alternative approach to femoral artery ligation is the induction of gradual femoral artery occlusion through the use of ameroid constrictors. When placed around the femoral artery in the same or different locations as the sites of femoral artery ligation, these devices occlude the artery over 1 - 3 days, resulting in more gradual, subacute ischemia. This results in less substantial skeletal muscle tissue necrosis, which may more closely mimic the responses seen in human PAD. Because genetic background influences outcomes in both the acute and subacute ischemia models, consideration of the mouse strain being studied is important in choosing the best model. This paper describes the proper procedure and anatomical placement of ligatures or ameroid constrictors on the mouse femoral artery to induce subacute or acute hindlimb ischemia in the mouse. PMID:27403963

  15. Methods for Acute and Subacute Murine Hindlimb Ischemia

    PubMed Central

    Padgett, Michael E.; McCord, Timothy J.; McClung, Joseph M.; Kontos, Christopher D.

    2016-01-01

    Peripheral artery disease (PAD) is a leading cause of cardiovascular morbidity and mortality in developed countries, and animal models that reliably reproduce the human disease are necessary to develop new therapies for this disease. The mouse hindlimb ischemia model has been widely used for this purpose, but the standard practice of inducing acute limb ischemia by ligation of the femoral artery can result in substantial tissue necrosis, compromising investigators' ability to study the vascular and skeletal muscle tissue responses to ischemia. An alternative approach to femoral artery ligation is the induction of gradual femoral artery occlusion through the use of ameroid constrictors. When placed around the femoral artery in the same or different locations as the sites of femoral artery ligation, these devices occlude the artery over 1-3 days, resulting in more gradual, subacute ischemia. This results in less substantial skeletal muscle tissue necrosis, which may more closely mimic the responses seen in human PAD. Because genetic background influences outcomes in both the acute and subacute ischemia models, consideration of the mouse strain being studied is important in choosing the best model. This paper describes the proper procedure and anatomical placement of ligatures or ameroid constrictors on the mouse femoral artery to induce subacute or acute hindlimb ischemia in the mouse. PMID:27403963

  16. Mast Cells Modulate Acute Toxoplasmosis in Murine Models

    PubMed Central

    Chen, Ying; Zheng, Huanqin; Shen, Jilong; Lun, Zhao-Rong; Wang, Yong; Kasper, Lloyd H.; Lu, Fangli

    2013-01-01

    The role of mast cells (MCs) in Toxoplasma gondii infection is poorly known. Kunming outbred mice were infected intraperitoneally with RH strain T. gondii, either treated with compound 48/80 (C48/80, MC activator) or disodium cromoglycate (DSCG, MC inhibitor). Compared with infected controls, infected mice treated with C48/80 exhibited significantly increased inflammation in the liver (P < 0.01), spleen (P < 0.05), and mesentery (P < 0.05) tissues, higher parasite burden in the peritoneal lavage fluids (P < 0.01), and increased levels of mRNA transcripts of T. gondii tachyzoite surface antigen 1 (SAG1) gene in the spleen and liver tissues (P < 0.01), accompanied with significantly increased Th1 cytokine (IFN-γ, IL-12p40, and TNF-α) (P < 0.01) and decreased IL-10 (P < 0.01) mRNA expressions in the liver, and increased IFN-γ (P < 0.01) and IL-12p40 (P < 0.01) but decreased TNF-α (P < 0.01) and IL-4 (P < 0.01) in the spleens of infected mice treated with C48/80 at day 9-10 p.i. Whereas mice treated with DSCG had significantly decreased tissue lesions (P < 0.01), lower parasite burden in the peritoneal lavage fluids (P < 0.01) and decreased SAG1 expressions in the spleen and liver tissues (P < 0.01), accompanied with significantly increased IFN-γ (P < 0.01) and IL-12p40 (P < 0.05) in the liver, and decreased IFN-γ (P < 0.05) and TNF-α (P < 0.01) in the spleens; IL-4 and IL-10 expressions in both the spleen and liver were significantly increased (P < 0.01) in the infected mice treated with DSCG. These findings suggest that mediators associated with the MC activation may play an important role in modulating acute inflammatory pathogenesis and parasite clearance during T. gondii infection in this strain of mice. Thus, MC activation/inhibition mechanisms are potential novel targets for the prevention and control of T. gondii infection. PMID:24146978

  17. Mast cells modulate acute toxoplasmosis in murine models.

    PubMed

    Huang, Bo; Huang, Shiguang; Chen, Ying; Zheng, Huanqin; Shen, Jilong; Lun, Zhao-Rong; Wang, Yong; Kasper, Lloyd H; Lu, Fangli

    2013-01-01

    The role of mast cells (MCs) in Toxoplasma gondii infection is poorly known. Kunming outbred mice were infected intraperitoneally with RH strain T. gondii, either treated with compound 48/80 (C48/80, MC activator) or disodium cromoglycate (DSCG, MC inhibitor). Compared with infected controls, infected mice treated with C48/80 exhibited significantly increased inflammation in the liver (P < 0.01), spleen (P < 0.05), and mesentery (P < 0.05) tissues, higher parasite burden in the peritoneal lavage fluids (P < 0.01), and increased levels of mRNA transcripts of T. gondii tachyzoite surface antigen 1 (SAG1) gene in the spleen and liver tissues (P < 0.01), accompanied with significantly increased Th1 cytokine (IFN-γ, IL-12p40, and TNF-α) (P < 0.01) and decreased IL-10 (P < 0.01) mRNA expressions in the liver, and increased IFN-γ (P < 0.01) and IL-12p40 (P < 0.01) but decreased TNF-α (P < 0.01) and IL-4 (P < 0.01) in the spleens of infected mice treated with C48/80 at day 9-10 p.i. Whereas mice treated with DSCG had significantly decreased tissue lesions (P < 0.01), lower parasite burden in the peritoneal lavage fluids (P < 0.01) and decreased SAG1 expressions in the spleen and liver tissues (P < 0.01), accompanied with significantly increased IFN-γ (P < 0.01) and IL-12p40 (P < 0.05) in the liver, and decreased IFN-γ (P < 0.05) and TNF-α (P < 0.01) in the spleens; IL-4 and IL-10 expressions in both the spleen and liver were significantly increased (P < 0.01) in the infected mice treated with DSCG. These findings suggest that mediators associated with the MC activation may play an important role in modulating acute inflammatory pathogenesis and parasite clearance during T. gondii infection in this strain of mice. Thus, MC activation/inhibition mechanisms are potential novel targets for the prevention and control of T. gondii infection. PMID:24146978

  18. Acute cytomegalovirus (CMV) infection

    MedlinePlus

    ... by: Blood transfusions Organ transplants Respiratory droplets Saliva Sexual contact Urine Most people come into contact with ... with another person. You should avoid kissing and sexual contact with an infected person. The virus may ...

  19. Acute and chronic exposure to Tyrophagus putrescentiae induces allergic pulmonary response in a murine model

    PubMed Central

    Nuñez, Nailê Karine; dos Santos Dutra, Moisés; Barbosa, Gustavo Leivas; Morassutti, Alessandra Loureiro; de Souza, Rodrigo Godinho; Vargas, Mauro Henrique Moraes; Antunes, Géssica Luana; Silveira, Josiane Silva; da Silva, Guilherme Liberato; Pitrez, Paulo Márcio

    2016-01-01

    Background Tyrophagus putrescentiae (Tp) is a source of aeroallergen that causes allergic diseases. Objective To describe an acute and chronic murine model of allergic asthma with Tp extract with no systemic sensitization and no use of adjuvant. Methods Mites from dust sample were cultured and a raw extract was produced. Female BALB/c mice (6-8 weeks) were challenged intranasally with Tp extract or Dulbecco's phosphate-buffered saline, for 10 consecutive days (acute protocol) or for 6 weeks (chronic protocol). Twenty-four hours after the last intranasal challenge, bronchoalveolar lavage fluid (BALF) was performed for total and differential cells count, cytokine analysis, and eosinophil peroxidase activity. Lung tissue was also removed for histopathologic analysis. Results Tp extract has shown a significant increase in total cells count from BALF as well as an increase in absolute eosinophils count, eosinophil peroxidase activity, interleukin (IL)-5 and IL-13 levels, in both acute and chronic protocols. Peribronchovascular infiltrate, goblet cells hyperplasia and collagen deposition were shown in the airways of acute and chronic Tp-exposed mice. Conclusion Our data suggest that the intranasal exposure to Tp extract, with no systemic sensitization and no use of adjuvants, induces a robust allergic inflammation in the lungs of mice, in both acute and chronic models. Our Tp extract seems to be a potent allergen extract which may be used in asthma model studies. PMID:26844220

  20. Complete Protection of Mice against Lethal Murine Cytomegalovirus Challenge by Immunization with DNA Vaccines Encoding Envelope Glycoprotein Complex III Antigens gH, gL and gO

    PubMed Central

    Wang, Huadong; Huang, Chaoyang; Dong, Jinrong; Yao, Yanfeng; Xie, Zhenyuan; Liu, Xueying; Zhang, Wenjie; Fang, Fang; Chen, Ze

    2015-01-01

    Human cytomegalovirus infects the majority of humanity which may lead to severe morbidity and mortality in newborns and immunocompromised adults. Humoral and cellular immunity are critical for controlling CMV infection. HCMV envelope glycoprotein complexes (gC I, II, III) represent major antigenic targets of antiviral immune responses. The gCIII complex is comprised of three glycoproteins, gH, gL, and gO. In the present study, DNA vaccines expressing the murine cytomegalovirus homologs of the gH, gL, and gO proteins were evaluated for protection against lethal MCMV infection in the mouse model. The results demonstrated that gH, gL, or gO single gene immunization could not yet offer good protection, whereas co-vaccination strategy apparently showed effects superior to separate immunization. Twice immunization with gH/gL/gO pDNAs could provide mice complete protection against lethal salivary gland-derived MCMV (SG-MCMV) challenge, while thrice immunization with pgH/pgL, pgH/pgO or pgL/pgO could not provide full protection. Co-vaccination with gH, gL and gO pDNAs elicited robust neutralizing antibody and cellular immune responses. Moreover, full protection was also achieved by simply passive immunization with anti-gH/gL/gO sera. These data demonstrated that gCIII complex antigens had fine immunogenicity and might be a promising candidate for the development of HCMV vaccines. PMID:25803721

  1. Control of Murine Cytomegalovirus in the Lungs: Relative but Not Absolute Immunodominance of the Immediate-Early 1 Nonapeptide during the Antiviral Cytolytic T-Lymphocyte Response in Pulmonary Infiltrates

    PubMed Central

    Holtappels, Rafaela; Podlech, Jürgen; Geginat, Gernot; Steffens, Hans-Peter; Thomas, Doris; Reddehase, Matthias J.

    1998-01-01

    The lungs are a major organ site of cytomegalovirus (CMV) infection, pathogenesis, and latency. Interstitial CMV pneumonia represents a critical manifestation of CMV disease, in particular in recipients of bone marrow transplantation (BMT). We have employed a murine model for studying the immune response to CMV in the lungs in the specific scenario of immune reconstitution after syngeneic BMT. Control of pulmonary infection was associated with a vigorous infiltration of the lungs, which was characterized by a preferential recruitment and massive expansion of the CD8 subset of α/β T cells. The infiltrate provided a microenvironment in which the CD8 T cells differentiated into mature effector cells, that is, into functionally active cytolytic T lymphocytes (CTL). This gave us the opportunity for an ex vivo testing of the antigen specificities of CTL present at a relevant organ site of viral pathogenesis. The contribution of the previously identified immediate-early 1 (IE1) nonapeptide of murine CMV was evaluated by comparison with the CD3ɛ-redirected cytolytic activity used as a measure of the overall CTL response in the lungs. The IE1 peptide was detected by pulmonary CTL, but it accounted for a minor part of the response. Interestingly, no additional viral or virus-induced antigenic peptides were detectable among naturally processed peptides derived from infected lungs, even though infected fibroblasts were recognized in a major histocompatibility complex-restricted manner. We conclude that the antiviral pulmonary immune response is a collaborative function that involves many antigenic peptides, among which the IE1 peptide is immunodominant in a relative sense. PMID:9696814

  2. Further studies on the role of the residue 890 cysteine to tyrosine mutation in the M70 primase ORF of the temperature-sensitive mutant (tsm5) of murine cytomegalovirus.

    PubMed

    Al-Ali, Abdulaziz Taher; Sweet, Clive

    2016-09-01

    A mutation (C890Y) introduced into the M70 primase gene of murine cytomegalovirus (MCMV) resulted in reduced viral replication in murine embryo fibroblasts at 40°C and the mutant was severely attenuated in vivo. The attenuated replication of the M70 mutant was also observed in Raw 264.7 macrophages at 37°C, demonstrating that the mutation produced a defective rather than an unstable protein possibly reducing the amount of functional protein under different environmental conditions. Many synonymous mutations were introduced into this ORF by changing codon preferences that should reduce the efficiency of gene translation, but not change protein sequence or structure. Two Bacterial Artificial Chromosome (BAC) constructs were produced with 155 codons (at the distal third of the M70 gene) changed to MCMV less preferred codons and with either cysteine (BAC70(155Cys) ) or tyrosine (BAC70(155Tyr) ) at residue 890. Upon transfection of these BACs into NIH 3T3 cells, only BAC70(155Cys) produced virus and this mutant Mt70(155Cys) replicated similarly to its revertant and the wt MCMV K181 (Perth) variant. A metagenomic analysis of the protein structure of the primase using PredictProtein showed that the change from cysteine (M70Cys) to tyrosine (M70Tyr) has a marked effect on protein structure. However, when the cysteine residue was replaced by serine (M70Ser) or methionine (M70Met), which produced mutant viruses with a wild-type phenotype, the predicted structure was similar to the wild-type structure. J. Med. Virol. 88:1613-1621, 2016. © 2016 Wiley Periodicals, Inc. PMID:26919386

  3. Murine models of acute leukemia: important tools in current pediatric leukemia research.

    PubMed

    Jacoby, Elad; Chien, Christopher D; Fry, Terry J

    2014-01-01

    Leukemia remains the most common diagnosis in pediatric oncology and, despite dramatic progress in upfront therapy, is also the most common cause of cancer-related death in children. Much of the initial improvement in outcomes for acute lymphoblastic leukemia (ALL) was due to identification of cytotoxic agents that are active against leukemia followed by the recognition that combination of these cytotoxic agents and prolonged therapy are essential for cure. Recent data demonstrating lack of progress in patients for whom standard chemotherapy fails suggests that the ability to improve outcome for these children will not be dramatically impacted through more intensive or newer cytotoxic agents. Thus, much of the recent research focus has been in the area of improving our understanding of the genetics and the biology of leukemia. Although in vitro studies remain critical, given the complexity of a living system and the increasing recognition of the contribution of leukemia extrinsic factors such as the bone marrow microenvironment, in vivo models have provided important insights. The murine systems that are used can be broadly categorized into syngeneic models in which a murine leukemia can be studied in immunologically intact hosts and xenograft models where human leukemias are studied in highly immunocompromised murine hosts. Both of these systems have limitations such that neither can be used exclusively to study all aspects of leukemia biology and therapeutics for humans. This review will describe the various ALL model systems that have been developed as well as discuss the advantages and disadvantages inherent to these systems that make each particularly suitable for specific types of studies. PMID:24847444

  4. Murine Models of Acute Leukemia: Important Tools in Current Pediatric Leukemia Research

    PubMed Central

    Jacoby, Elad; Chien, Christopher D.; Fry, Terry J.

    2014-01-01

    Leukemia remains the most common diagnosis in pediatric oncology and, despite dramatic progress in upfront therapy, is also the most common cause of cancer-related death in children. Much of the initial improvement in outcomes for acute lymphoblastic leukemia (ALL) was due to identification of cytotoxic agents that are active against leukemia followed by the recognition that combination of these cytotoxic agents and prolonged therapy are essential for cure. Recent data demonstrating lack of progress in patients for whom standard chemotherapy fails suggests that the ability to improve outcome for these children will not be dramatically impacted through more intensive or newer cytotoxic agents. Thus, much of the recent research focus has been in the area of improving our understanding of the genetics and the biology of leukemia. Although in vitro studies remain critical, given the complexity of a living system and the increasing recognition of the contribution of leukemia extrinsic factors such as the bone marrow microenvironment, in vivo models have provided important insights. The murine systems that are used can be broadly categorized into syngeneic models in which a murine leukemia can be studied in immunologically intact hosts and xenograft models where human leukemias are studied in highly immunocompromised murine hosts. Both of these systems have limitations such that neither can be used exclusively to study all aspects of leukemia biology and therapeutics for humans. This review will describe the various ALL model systems that have been developed as well as discuss the advantages and disadvantages inherent to these systems that make each particularly suitable for specific types of studies. PMID:24847444

  5. The Acute Exposure Effects of Inhaled Nickel Nanoparticles on Murine Endothelial Progenitor Cells

    PubMed Central

    Liberda, Eric N; Cuevas, Azita K; Qu, Qingshan; Chen, Lung Chi

    2014-01-01

    Introduction The discovery of endothelial progenitor cells (EPCs) may help to explain observed cardiovascular effects associated with inhaled nickel nanoparticle exposures such as increases in vascular inflammation, generate reactive oxygen species, alter vasomotor tone, and potentiated atherosclerosis in murine species. Methods Following an acute whole body inhalation exposure to 500μg/m3 of nickel nanoparticles for 5 hrs, bone marrow EPCs from C57BL/6 mice were isolated. EPCs were harvested for their RNA or used in a variety of assays including chemotaxis, tube formation, and proliferation. Gene expression was assessed for important receptors involved in EPC mobilization and homing using RT-PCR methods. EPCs, circulating endothelial progenitor cells (CEPCs), circulating endothelial cells (CECs), and endothelial microparticles (EMPs) were quantified on a BD FACSCalibur to examine endothelial damage and repair associated with the exposure. Results and Conclusions Acute exposure to inhaled nickel nanoparticles significantly increased both bone marrow EPCs as well as their levels in circulation (CEPCs). CECs were significantly elevated indicating that endothelial damage occurred due to the exposure. There was no significant difference in EMPs between the two groups. Tube formation and chemotaxis, but not proliferation, of bone marrow EPCs was impaired in the nickel nanoparticle exposed group. These results coincided with a decrease in the mRNA of receptors involved in EPC mobilization and homing. This data provides new insight into how an acute nickel nanoparticle exposure to half of the current Occupational Safety & Health Administration permissible exposure limit may adversely affect EPCs. PMID:25144474

  6. In vivo studies of 5-arylethenylbenzofuroxans in acute murine models of Chagas' disease.

    PubMed

    Boiani, Lucía; Davies, Carolina; Arredondo, Carolina; Porcal, Williams; Merlino, Alicia; Gerpe, Alejandra; Boiani, Mariana; Pacheco, José Pedro; Basombrío, Miguel Angel; Cerecetto, Hugo; González, Mercedes

    2008-10-01

    5-arylethenylbenzofuroxan derivatives with high in vitro anti-Trypanosoma cruzi activity were studied in vivo using acute murine models of Chagas' disease. The selected compounds, as pure isomeric forms, 1, 2, 3 and 4, or as equimolecular mixture of geometric isomers, 1:2, 3:4, 5:6 were studied against different T. cruzi strains. Consequently, Tulahuen 2 strain, Colombiana strain (resistant to Nifurtimox and Benznidazole), and two different wild strains, one isolated from the wild reservoir Didelphis marsupialis and another one from Uruguayan patients, were selected. No relevant signs of in vivo toxicity were observed with the benzofuroxans orally administered. Compound 1 and the mixture of isomers 1:2 were the best for treating infection against the four studied strains. PMID:18255195

  7. Impact of cytomegalovirus reactivation on relapse and survival in patients with acute leukemia who received allogeneic hematopoietic stem cell transplantation in first remission.

    PubMed

    Yoon, Jae-Ho; Lee, Seok; Kim, Hee-Je; Jeon, Young-Woo; Lee, Sung-Eun; Cho, Byung-Sik; Lee, Dong-Gun; Eom, Ki-Seong; Kim, Yoo-Jin; Min, Chang-Ki; Cho, Seok-Goo; Min, Woo-Sung; Lee, Jong Wook

    2016-03-29

    Cytomegalovirus (CMV)-reactivation is associated with graft-vs-leukemia (GVL) effect by stimulating natural-killer or T-cells, which showed leukemia relapse prevention after hematopoietic stem cell transplantation (HSCT). We enrolled patients with acute myeloid leukemia (n = 197) and acute lymphoid leukemia (n = 192) who underwent allogeneic-HSCT in first remission. We measured RQ-PCR weekly to detect CMV-reactivation and preemptively used ganciclovir (GCV) when the titer increased twice consecutively, but GCV was sometimes delayed in patients without significant graft-vs-host disease (GVHD) by reducing immunosuppressive agents. In the entire group, CMV-reactivation showed poor overall survival (OS). To evaluate subsequent effects of CMV-reactivation, we excluded early relapse and deaths within 100 days, during which most of the CMV-reactivation occurred. Untreated CMV-reactivated group (n = 173) showed superior OS (83.8% vs. 61.7% vs. 74.0%, p < 0.001) with lower relapse rate (10.1% vs 22.1% vs. 25.5%, p = 0.004) compared to GCV-treated CMV-reactivated group (n = 122) and CMV-undetected group (n = 42). After excluding chronic GVHD, untreated CMV-reactivated group still showed lower relapse rate (9.4% vs. 24.1% vs. 30.2%, p = 0.006). Multivariate analysis showed adverse-risk karyotype and patients in other than untreated CMV-reactivated group were independent factors for relapse prediction. Our data showed possible GVL effect of CMV-reactivation and minimizing antiviral therapy may benefit for relapse prevention in acute leukemia. PMID:26883100

  8. Impact of cytomegalovirus reactivation on relapse and survival in patients with acute leukemia who received allogeneic hematopoietic stem cell transplantation in first remission

    PubMed Central

    Yoon, Jae-Ho; Lee, Seok; Kim, Hee-Je; Jeon, Young-Woo; Lee, Sung-Eun; Cho, Byung-Sik; Lee, Dong-Gun; Eom, Ki-Seong; Kim, Yoo-Jin; Min, Chang-Ki; Cho, Seok-Goo; Min, Woo-Sung; Lee, Jong Wook

    2016-01-01

    Cytomegalovirus (CMV)-reactivation is associated with graft-vs-leukemia (GVL) effect by stimulating natural-killer or T-cells, which showed leukemia relapse prevention after hematopoietic stem cell transplantation (HSCT). We enrolled patients with acute myeloid leukemia (n = 197) and acute lymphoid leukemia (n = 192) who underwent allogeneic-HSCT in first remission. We measured RQ-PCR weekly to detect CMV-reactivation and preemptively used ganciclovir (GCV) when the titer increased twice consecutively, but GCV was sometimes delayed in patients without significant graft-vs-host disease (GVHD) by reducing immunosuppressive agents. In the entire group, CMV-reactivation showed poor overall survival (OS). To evaluate subsequent effects of CMV-reactivation, we excluded early relapse and deaths within 100 days, during which most of the CMV-reactivation occurred. Untreated CMV-reactivated group (n = 173) showed superior OS (83.8% vs. 61.7% vs. 74.0%, p < 0.001) with lower relapse rate (10.1% vs 22.1% vs. 25.5%, p = 0.004) compared to GCV-treated CMV-reactivated group (n = 122) and CMV-undetected group (n = 42). After excluding chronic GVHD, untreated CMV-reactivated group still showed lower relapse rate (9.4% vs. 24.1% vs. 30.2%, p = 0.006). Multivariate analysis showed adverse-risk karyotype and patients in other than untreated CMV-reactivated group were independent factors for relapse prediction. Our data showed possible GVL effect of CMV-reactivation and minimizing antiviral therapy may benefit for relapse prevention in acute leukemia. PMID:26883100

  9. Protective effect of cytomegalovirus reactivation on relapse after allogeneic hematopoietic cell transplantation in acute myeloid leukemia patients is influenced by conditioning regimen.

    PubMed

    Manjappa, Shivaprasad; Bhamidipati, Pavan Kumar; Stokerl-Goldstein, Keith E; DiPersio, John F; Uy, Geoffrey L; Westervelt, Peter; Liu, Jingxia; Schroeder, Mark A; Vij, Ravi; Abboud, Camille N; Fehniger, Todd A; Cashen, Amanda F; Pusic, Iskra; Jacoby, Meagan; Meera, Srinidhi J; Romee, Rizwan

    2014-01-01

    Cytomegalovirus (CMV) reactivation after allogeneic hematopoietic cell transplant (allo-HCT) has been associated with a reduced risk of relapse in patients with acute myeloid leukemia (AML). However, the influence of the conditioning regimen on this protective effect of CMV reactivation after allo-HCT is relatively unexplored. To address this, we evaluated the risk of relapse in 264 AML patients who received T cell-replete, 6/6 HLA matched sibling or 10/10 HLA matched unrelated donor transplantation at a single institution between 2006 and 2011. Of these 264 patients, 206 received myeloablative (MA) and 58 received reduced-intensity conditioning (RIC) regimens. CMV reactivation was observed in 88 patients with MA conditioning and 37 patients with RIC. At a median follow-up of 299 days, CMV reactivation was associated with significantly lower risk of relapse in patients who received MA conditioning both in univariate (P = .01) and multivariate analyses (hazard ratio, .5246; P = .006); however, CMV reactivation did not significantly affect the risk of relapse in our RIC cohort. These results confirm the protective effect of CMV reactivation on relapse in AML patients after allo-HCT reported by previous studies but suggest this protective effect of CMV reactivation on relapse is influenced by the conditioning regimen used with the transplant. PMID:24120526

  10. Human Cardiac-Derived Adherent Proliferating Cells Reduce Murine Acute Coxsackievirus B3-Induced Myocarditis

    PubMed Central

    Miteva, Kapka; Haag, Marion; Peng, Jun; Savvatis, Kostas; Becher, Peter Moritz; Seifert, Martina; Warstat, Katrin; Westermann, Dirk; Ringe, Jochen; Sittinger, Michael; Schultheiss, Heinz-Peter

    2011-01-01

    Background Under conventional heart failure therapy, inflammatory cardiomyopathy typically has a progressive course, indicating a need for alternative therapeutic strategies to improve long-term outcomes. We recently isolated and identified novel cardiac-derived cells from human cardiac biopsies: cardiac-derived adherent proliferating cells (CAPs). They have similarities with mesenchymal stromal cells, which are known for their anti-apoptotic and immunomodulatory properties. We explored whether CAPs application could be a novel strategy to improve acute Coxsackievirus B3 (CVB3)-induced myocarditis. Methodology/Principal Findings To evaluate the safety of our approach, we first analyzed the expression of the coxsackie- and adenovirus receptor (CAR) and the co-receptor CD55 on CAPs, which are both required for effective CVB3 infectivity. We could demonstrate that CAPs only minimally express both receptors, which translates to minimal CVB3 copy numbers, and without viral particle release after CVB3 infection. Co-culture of CAPs with CVB3-infected HL-1 cardiomyocytes resulted in a reduction of CVB3-induced HL-1 apoptosis and viral progeny release. In addition, CAPs reduced CD4 and CD8 T cell proliferation. All CAPs-mediated protective effects were nitric oxide- and interleukin-10-dependent and required interferon-γ. In an acute murine model of CVB3-induced myocarditis, application of CAPs led to a decrease of cardiac apoptosis, cardiac CVB3 viral load and improved left ventricular contractility parameters. This was associated with a decline in cardiac mononuclear cell activity, an increase in T regulatory cells and T cell apoptosis, and an increase in left ventricular interleukin-10 and interferon-γ mRNA expression. Conclusions We conclude that CAPs are a unique type of cardiac-derived cells and promising tools to improve acute CVB3-induced myocarditis. PMID:22174827

  11. PU.1 downregulation in murine radiation-induced acute myeloid leukaemia (AML): from molecular mechanism to human AML

    PubMed Central

    Verbiest, Tom; Bouffler, Simon; Nutt, Stephen L.; Badie, Christophe

    2015-01-01

    The transcription factor PU.1, encoded by the murine Sfpi1 gene (SPI1 in humans), is a member of the Ets transcription factor family and plays a vital role in commitment and maturation of the myeloid and lymphoid lineages. Murine studies directly link primary acute myeloid leukaemia (AML) and decreased PU.1 expression in specifically modified strains. Similarly, a radiation-induced chromosome 2 deletion and subsequent Sfpi1 point mutation in the remaining allele lead to murine radiation-induced AML. Consistent with murine data, heterozygous deletion of the SPI1 locus and mutation of the −14kb SPI1 upstream regulatory element were described previously in human primary AML, although they are rare events. Other mechanisms linked to PU.1 downregulation in human AML include TP53 deletion, FLT3-ITD mutation and the recurrent AML1-ETO [t(8;21)] and PML-RARA [t(15;17)] translocations. This review provides an up-to-date overview on our current understanding of the involvement of PU.1 in the initiation and development of radiation-induced AML, together with recommendations for future murine and human studies. PMID:25750172

  12. Clinical and Epidemiological Characteristics of Scrub Typhus and Murine Typhus among Hospitalized Patients with Acute Undifferentiated Fever in Northern Vietnam.

    PubMed

    Hamaguchi, Sugihiro; Cuong, Ngo Chi; Tra, Doan Thu; Doan, Yen Hai; Shimizu, Kenta; Tuan, Nguyen Quang; Yoshida, Lay-Myint; Mai, Le Quynh; Duc-Anh, Dang; Ando, Shuji; Arikawa, Jiro; Parry, Christopher M; Ariyoshi, Koya; Thuy, Pham Thanh

    2015-05-01

    A descriptive study on rickettsiosis was conducted at the largest referral hospital in Hanoi, Vietnam, to identify epidemiological and clinical characteristics of specific rickettsiosis. Between March 2001 and February 2003, we enrolled 579 patients with acute undifferentiated fever (AUF), excluding patients with malaria, dengue fever, and typhoid fever, and serologically tested for Orientia tsutsugamushi and Rickettsia typhi. Of the patients, 237 (40.9%) and 193 (33.3%) had scrub and murine typhus, respectively, and 149 (25.7%) had neither of them (non-scrub and murine typhus [non-ST/MT]). The proportion of murine typhus was highest among patients living in Hanoi whereas that of scrub typhus was highest in national or regional border areas. The presence of an eschar, dyspnea, hypotension, and lymphadenopathy was significantly associated with a diagnosis of scrub typhus (OR = 46.56, 10.90, 9.01, and 7.92, respectively). Patients with murine typhus were less likely to have these findings but more likely to have myalgia, rash, and relative bradycardia (OR = 1.60, 1.56, and 1.45, respectively). Scrub typhus and murine typhus were shown to be common causes of AUF in northern Vietnam although the occurrence of spotted fever group rickettsiae was not determined. Clinical and epidemiological information may help local clinicians make clinical diagnosis of specific rickettsioses in a resource-limited setting. PMID:25778504

  13. Protective effects of sirtuin 3 in a murine model of sepsis-induced acute kidney injury.

    PubMed

    Zhao, Wen-Yu; Zhang, Lei; Sui, Ming-Xing; Zhu, You-Hua; Zeng, Li

    2016-01-01

    Acute kidney injury (AKI) is a rapid loss of kidney function characterized by damage to renal tubular cells driven by mitochondrial dysregulation and oxidative stress. Here, we used a murine caecal ligation and puncture (CLP) model of sepsis-induced AKI to study the role of sirtuin 3 (SIRT3), a NAD(+) dependent deacetylase critical for the maintenance of mitochondrial viability, in AKI-related renal tubular cell damage and explored the underlying mechanisms. CLP induced alterations in kidney function and morphology were associated with SIRT3 downregulation, and SIRT3 deletion exacerbated CLP-induced kidney dysfunction, renal tubular cell injury and apoptosis, mitochondrial alterations, and ROS production in a knockout mouse model. SIRT3 deletion increased the CLP-induced upregulation of the NLRP3 inflammasome and apoptosis-associated speck-like protein, resulting in the activation of oxidative stress, increased production of the proinflammatory cytokines interleukin (IL)-1β and IL-18, and the enhancement of apoptosis, and these effects were reversed by antioxidant NAC. Our results suggest that SIRT3 plays a protective role against mitochondrial damage in the kidney by attenuating ROS production, inhibiting the NRLP3 inflammasome, attenuating oxidative stress, and downregulating IL-1β and IL-18. PMID:27620507

  14. Murine patellar tendon biomechanical properties and regional strain patterns during natural tendon-to-bone healing after acute injury

    PubMed Central

    Gilday, Steven D.; Casstevens, E. Chris; Kenter, Keith; Shearn, Jason T.; Butler, David L.

    2014-01-01

    Tendon-to-bone healing following acute injury is generally poor and often fails to restore normal tendon biomechanical properties. In recent years, the murine patellar tendon (PT) has become an important model system for studying tendon healing and repair due to its genetic tractability and accessible location within the knee. However, the mechanical properties of native murine PT, specifically the regional differences in tissue strains during loading, and the biomechanical outcomes of natural PT-to-bone healing have not been well characterized. Thus, in this study, we analyzed the global biomechanical properties and regional strain patterns of both normal and naturally healing murine PT at three time points (2, 5, and 8 weeks) following acute surgical rupture of the tibial enthesis. Normal murine PT exhibited distinct regional variations in tissue strain, with the insertion region experiencing approximately 2.5 times greater strain than the midsubstance at failure (10.80 ± 2.52% vs. 4.11 ± 1.40%; mean ± SEM). Injured tendons showed reduced structural (ultimate load and linear stiffness) and material (ultimate stress and linear modulus) properties compared to both normal and contralateral sham-operated tendons at all healing time points. Injured tendons also displayed increased local strain in the insertion region compared to contralateral shams at both physiologic and failure load levels. 93.3% of injured tendons failed at the tibial insertion, compared to only 60% and 66.7% of normal and sham tendons, respectively. These results indicate that 8 weeks of natural tendon-to-bone healing does not restore normal biomechanical function to the murine PT following injury. PMID:24210849

  15. Mesenchymal stromal cell therapy is associated with increased adenovirus-associated but not cytomegalovirus-associated mortality in children with severe acute graft-versus-host disease.

    PubMed

    Calkoen, Friso G J; Vervat, Carly; van Halteren, Astrid G S; Welters, Marij J P; Veltrop-Duits, Louise A; Lankester, Arjan C; Egeler, R Maarten; Ball, Lynne M; van Tol, Maarten J D

    2014-08-01

    Beneficial effects of mesenchymal stromal cells (MSCs) in patients with severe steroid-refractory acute graft-versus-host disease (aGvHD) have been reported. However, controversy exists about the effect of MSCs on virus-specific T cells. We evaluated 56 patients with grade II-IV aGvHD who responded to steroids (n = 21) or were steroid refractory receiving either MSCs (n = 22) or other second-line therapy (n = 13). Although the overall incidence of cytomegalovirus (CMV), Epstein-Barr virus, and human adenovirus (HAdV) infections was not significantly increased, HAdV infection was associated with decreased survival in children treated with MSCs. Thus, we investigated in vitro the effects of MSCs on virus-specific T cells. Both CMV-specific and, to a lesser extent, HAdV-specific T-cell activation and proliferation were negatively affected by MSCs either after induction of a response in peripheral blood mononuclear cells (PBMCs) or after restimulation of virus-specific T-cell lines. In patient-derived PBMCs, CMV-specific proliferative responses were greatly decreased on first-line treatment of aGvHD with systemic steroids and slowly recovered after MSC administration and tapering of steroids. HAdV-specific T-cell proliferation could not be detected. In contrast, the proportion of CMV- and HAdV-specific effector T cells, measured as interferon-γ-secreting cells, remained stable or increased after treatment with MSCs. In conclusion, although in vitro experimental conditions indicated a negative impact of MSCs on CMV- and HAdV-specific T-cell responses, no solid evidence was obtained to support such an effect of MSCs on T-cell responses in vivo. Still, the susceptibility of steroid-refractory severe aGvHD patients to viral reactivation warrants critical viral monitoring during randomized controlled trials on second-line treatment including MSCs. PMID:24904175

  16. Memory T cells specific for murine cytomegalovirus re-emerge after multiple challenges and recapitulate immunity in various adoptive transfer scenarios.

    PubMed

    Quinn, Michael; Turula, Holly; Tandon, Mayank; Deslouches, Berthony; Moghbeli, Toktam; Snyder, Christopher M

    2015-02-15

    Reconstitution of CMV-specific immunity after transplant remains a primary clinical objective to prevent CMV disease, and adoptive immunotherapy of CMV-specific T cells can be an effective therapeutic approach. Because of viral persistence, most CMV-specific CD8(+) T cells become terminally differentiated effector phenotype CD8(+) T cells (TEFF). A minor subset retains a memory-like phenotype (memory phenotype CD8(+) T cells [TM]), but it is unknown whether these cells retain memory function or persist over time. Interestingly, recent studies suggest that CMV-specific CD8(+) T cells with different phenotypes have different abilities to reconstitute sustained immunity after transfer. The immunology of human CMV infections is reflected in the murine CMV (MCMV) model. We found that human CMV- and MCMV-specific T cells displayed shared genetic programs, validating the MCMV model for studies of CMV-specific T cells in vivo. The MCMV-specific TM population was stable over time and retained a proliferative capacity that was vastly superior to TEFF. Strikingly, after transfer, TM established sustained and diverse T cell populations even after multiple challenges. Although both TEFF and TM could protect Rag(-/-) mice, only TM persisted after transfer into immune replete, latently infected recipients and responded if recipient immunity was lost. Interestingly, transferred TM did not expand until recipient immunity was lost, supporting that competition limits the Ag stimulation of TM. Ultimately, these data show that CMV-specific TM retain memory function during MCMV infection and can re-establish CMV immunity when necessary. Thus, TM may be a critical component for consistent, long-term adoptive immunotherapy success. PMID:25595792

  17. Expansion and Protection by a Virus-Specific NK Cell Subset Lacking Expression of the Inhibitory NKR-P1B Receptor during Murine Cytomegalovirus Infection.

    PubMed

    Rahim, Mir Munir A; Wight, Andrew; Mahmoud, Ahmad Bakur; Aguilar, Oscar A; Lee, Seung-Hwan; Vidal, Silvia M; Carlyle, James R; Makrigiannis, Andrew P

    2016-09-15

    NK cells play a major role in immune defense against human and murine CMV (MCMV) infection. Although the MCMV genome encodes for MHC class I-homologous decoy ligands for inhibitory NK cell receptors to evade detection, some mouse strains have evolved activating receptors, such as Ly49H, to recognize these ligands and initiate an immune response. In this study, we demonstrate that approximately half of the Ly49H-expressing (Ly49H(+)) NK cells in the spleen and liver of C57BL/6 mice also express the inhibitory NKR-P1B receptor. During MCMV infection, the NKR-P1B(-)Ly49H(+) NK cell subset proliferates to constitute the bulk of the NK cell population. This NK cell subset also confers better protection against MCMV infection compared with the NKR-P1B(+)Ly49H(+) subset. The two populations are composed of cells that differ in their surface expression of receptors such as Ly49C/I and NKG2A/C/E, as well as developmental markers, CD27 and CD11b, and the high-affinity IL-2R (CD25) following infection. Although the NKR-P1B(+) NK cells can produce effector molecules such as IFNs and granzymes, their proliferation is inhibited during infection. A similar phenotype in MCMV-infected Clr-b-deficient mice, which lack the ligand for NKR-P1B, suggests the involvement of ligands other than the host Clr-b. Most interestingly, genetic deficiency of the NKR-P1B, but not Clr-b, results in accelerated virus clearance and recovery from MCMV infection. This study is particularly significant because the mouse NKR-P1B:Clr-b receptor:ligand system represents the closest homolog of the human NKR-P1A:LLT1 system and may have a direct relevance to human CMV infection. PMID:27511735

  18. Differential acute and chronic effects of burn trauma on murine skeletal muscle bioenergetics.

    PubMed

    Porter, Craig; Herndon, David N; Bhattarai, Nisha; Ogunbileje, John O; Szczesny, Bartosz; Szabo, Csaba; Toliver-Kinsky, Tracy; Sidossis, Labros S

    2016-02-01

    Altered skeletal muscle mitochondrial function contributes to the pathophysiological stress response to burns. However, the acute and chronic impact of burn trauma on skeletal muscle bioenergetics remains poorly understood. Here, we determined the temporal relationship between burn trauma and mitochondrial function in murine skeletal muscle local to and distal from burn wounds. Male BALB/c mice (8-10 weeks old) were burned by submersion of the dorsum in water (∼ 95 °C) to create a full thickness burn on ∼ 30% of the body. Skeletal muscle was harvested spinotrapezius underneath burn wounds (local) and the quadriceps (distal) of sham and burn treated mice at 3h, 24h, 4d and 10d post-injury. Mitochondrial respiration was determined in permeabilized myofiber bundles by high-resolution respirometry. Caspase 9 and caspase 3 protein concentration were determined by western blot. In muscle local to burn wounds, respiration coupled to ATP production was significantly diminished at 3h and 24h post-injury (P<0.001), as was mitochondrial coupling control (P<0.001). There was a 5- (P<0.05) and 8-fold (P<0.001) increase in respiration in response to cytochrome at 3h and 24h post burn, respectively, indicating damage to the outer mitochondrial membranes. Moreover, we also observed greater active caspase 9 and caspase 3 in muscle local to burn wounds, indicating the induction of apoptosis. Distal muscle mitochondrial function was unaltered by burn trauma until 10d post burn, where both respiratory capacity (P<0.05) and coupling control (P<0.05) were significantly lower than sham. These data highlight a differential response in muscle mitochondrial function to burn trauma, where the timing, degree and mode of dysfunction are dependent on whether the muscle is local or distal to the burn wound. PMID:26615714

  19. Establishing a murine model of the Hematopoietic Syndrome of the Acute Radiation Syndrome

    PubMed Central

    Plett, P. Artur; Sampson, Carol H.; Chua, Hui Lin; Joshi, Mandar; Booth, Catherine; Gough, Alec; Johnson, Cynthia S.; Katz, Barry P.; Farese, Ann M.; Parker, Jeffrey; MacVittie, Thomas J.; Orschell, Christie M.

    2012-01-01

    We have developed a murine model of the Hematopoietic Syndrome of the Acute Radiation Syndrome (H-ARS) for efficacy testing of medical countermeasures (MCM) against radiation according to the FDA Animal Rule. Ten to 12 week old male and female C57BL/6 mice were exposed to the LD50/30-LD70/30 dose of total body irradiation (TBI, 137Cs, 0.62-0.67 Gy min-1) in the morning hours when mice were determined to be most radiosensitive, and assessed for 30 day survival and mean survival time (MST). Antibiotics were delivered in the drinking water on days 4-30 post-TBI at a concentration based on the amount of water that lethally-irradiated mice were found to consume. The fluoroquinolones, ciprofloxacin and levofloxacin, and the tetracycline doxycycline and aminoglycoside neomycin, all significantly increased MST of decedent mice, while ciprofloxacin (p=0.061) and doxycycline + neomycin (p=0.005) showed at least some efficacy to increase 30 day survival. Blood sampling (30uL/mouse every 5th day) was found to negatively impact 30 day survival. Histopathology of tissues harvested from non-moribund mice showed expected effects of lethal irradiation, while moribund mice were largely septicemic with a preponderance of enteric organisms. Kinetics of loss and recovery of peripheral blood cells in untreated mice and those treated with two MCM, granulocyte-colony stimulating factor and Amifostine, further characterized and validated our model for use in screening studies and pivotal efficacy studies of candidate MCM for licensure to treat irradiated individuals suffering from H-ARS. PMID:22929467

  20. Human Cytomegalovirus Inhibits Erythropoietin Production

    PubMed Central

    Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia

    2014-01-01

    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients. PMID:24722450

  1. Efficient Replication of Severe Acute Respiratory Syndrome Coronavirus in Mouse Cells Is Limited by Murine Angiotensin-Converting Enzyme 2

    PubMed Central

    Li, Wenhui; Greenough, Thomas C.; Moore, Michael J.; Vasilieva, Natalya; Somasundaran, Mohan; Sullivan, John L.; Farzan, Michael; Choe, Hyeryun

    2004-01-01

    Replication of viruses in species other than their natural hosts is frequently limited by entry and postentry barriers. The coronavirus that causes severe acute respiratory syndrome (SARS-CoV) utilizes the receptor angiotensin-converting enzyme 2 (ACE2) to infect cells. Here we compare human, mouse, and rat ACE2 molecules for their ability to serve as receptors for SARS-CoV. We found that, compared to human ACE2, murine ACE2 less efficiently bound the S1 domain of SARS-CoV and supported less-efficient S protein-mediated infection. Rat ACE2 was even less efficient, at near background levels for both activities. Murine 3T3 cells expressing human ACE2 supported SARS-CoV replication, whereas replication was less than 10% as efficient in the same cells expressing murine ACE2. These data imply that a mouse transgenically expressing human ACE2 may be a useful animal model of SARS. PMID:15452268

  2. Molecular characterisation of murine acute myeloid leukaemia induced by 56Fe ion and 137Cs gamma ray irradiation.

    PubMed

    Steffen, Leta S; Bacher, Jeffery W; Peng, Yuanlin; Le, Phuong N; Ding, Liang-Hao; Genik, Paula C; Ray, F Andrew; Bedford, Joel S; Fallgren, Christina M; Bailey, Susan M; Ullrich, Robert L; Weil, Michael M; Story, Michael D

    2013-01-01

    Exposure to sparsely ionising gamma- or X-ray irradiation is known to increase the risk of leukaemia in humans. However, heavy ion radiotherapy and extended space exploration will expose humans to densely ionising high linear energy transfer (LET) radiation for which there is currently no understanding of leukaemia risk. Murine models have implicated chromosomal deletion that includes the hematopoietic transcription factor gene, PU.1 (Sfpi1), and point mutation of the second PU.1 allele as the primary cause of low-LET radiation-induced murine acute myeloid leukaemia (rAML). Using array comparative genomic hybridisation, fluorescence in situ hybridisation and high resolution melt analysis, we have confirmed that biallelic PU.1 mutations are common in low-LET rAML, occurring in 88% of samples. Biallelic PU.1 mutations were also detected in the majority of high-LET rAML samples. Microsatellite instability was identified in 42% of all rAML samples, and 89% of samples carried increased microsatellite mutant frequencies at the single-cell level, indicative of ongoing instability. Instability was also observed cytogenetically as a 2-fold increase in chromatid-type aberrations. These data highlight the similarities in molecular characteristics of high-LET and low-LET rAML and confirm the presence of ongoing chromosomal and microsatellite instability in murine rAML. PMID:22987027

  3. Molecular characterisation of murine acute myeloid leukaemia induced by 56Fe ion and 137Cs gamma ray irradiation

    PubMed Central

    Bacher, Jeffery W.

    2013-01-01

    Exposure to sparsely ionising gamma- or X-ray irradiation is known to increase the risk of leukaemia in humans. However, heavy ion radiotherapy and extended space exploration will expose humans to densely ionising high linear energy transfer (LET) radiation for which there is currently no understanding of leukaemia risk. Murine models have implicated chromosomal deletion that includes the hematopoietic transcription factor gene, PU.1 (Sfpi1), and point mutation of the second PU.1 allele as the primary cause of low-LET radiation-induced murine acute myeloid leukaemia (rAML). Using array comparative genomic hybridisation, fluorescence in situ hybridisation and high resolution melt analysis, we have confirmed that biallelic PU.1 mutations are common in low-LET rAML, occurring in 88% of samples. Biallelic PU.1 mutations were also detected in the majority of high-LET rAML samples. Microsatellite instability was identified in 42% of all rAML samples, and 89% of samples carried increased microsatellite mutant frequencies at the single-cell level, indicative of ongoing instability. Instability was also observed cytogenetically as a 2-fold increase in chromatid-type aberrations. These data highlight the similarities in molecular characteristics of high-LET and low-LET rAML and confirm the presence of ongoing chromosomal and microsatellite instability in murine rAML. PMID:22987027

  4. Antibody blockade of IL-17 family cytokines in immunity to acute murine oral mucosal candidiasis.

    PubMed

    Whibley, Natasha; Tritto, Elaine; Traggiai, Elisabetta; Kolbinger, Frank; Moulin, Pierre; Brees, Dominique; Coleman, Bianca M; Mamo, Anna J; Garg, Abhishek V; Jaycox, Jillian R; Siebenlist, Ulrich; Kammüller, Michael; Gaffen, Sarah L

    2016-06-01

    Antibodies targeting IL-17A or its receptor, IL-17RA, are approved to treat psoriasis and are being evaluated for other autoimmune conditions. Conversely, IL-17 signaling is critical for immunity to opportunistic mucosal infections caused by the commensal fungus Candida albicans, as mice and humans lacking the IL-17R experience chronic mucosal candidiasis. IL-17A, IL-17F, and IL-17AF bind the IL-17RA-IL-17RC heterodimeric complex and deliver qualitatively similar signals through the adaptor Act1. Here, we used a mouse model of acute oropharyngeal candidiasis to assess the impact of blocking IL-17 family cytokines compared with specific IL-17 cytokine gene knockout mice. Anti-IL-17A antibodies, which neutralize IL-17A and IL-17AF, caused elevated oral fungal loads, whereas anti-IL-17AF and anti-IL-17F antibodies did not. Notably, there was a cooperative effect of blocking IL-17A, IL-17AF, and IL-17F together. Termination of anti-IL-17A treatment was associated with rapid C. albicans clearance. IL-17F-deficient mice were fully resistant to oropharyngeal candidiasis, consistent with antibody blockade. However, IL-17A-deficient mice had lower fungal burdens than anti-IL-17A-treated mice. Act1-deficient mice were much more susceptible to oropharyngeal candidiasis than anti-IL-17A antibody-treated mice, yet anti-IL-17A and anti-IL-17RA treatment caused equivalent susceptibilities. Based on microarray analyses of the oral mucosa during infection, only a limited number of genes were associated with oropharyngeal candidiasis susceptibility. In sum, we conclude that IL-17A is the main cytokine mediator of immunity in murine oropharyngeal candidiasis, but a cooperative relationship among IL-17A, IL-17AF, and IL-17F exists in vivo. Susceptibility displays the following hierarchy: IL-17RA- or Act1-deficiency > anti-IL-17A + anti-IL-17F antibodies > anti-IL-17A or anti-IL-17RA antibodies > IL-17A deficiency. PMID:26729813

  5. Assessing structural and functional responses of murine hearts to acute and sustained β-adrenergic stimulation in vivo

    PubMed Central

    Puhl, Sarah-Lena; Weeks, Kate L.; Ranieri, Antonella; Avkiran, Metin

    2016-01-01

    Introduction Given the importance of β-adrenoceptor signalling in regulating cardiac structure and function, robust protocols are required to assess potential alterations in such regulation in murine models in vivo. Methods Echocardiography was performed in naïve and stressed (isoprenaline; 30 μg/g/day s.c. for up to 14 days) mice, in the absence or presence of acute β-adrenergic stimulation (dobutamine 0.75 μg/g, i.p.). Controls received saline infusion and/or injection. Hearts were additionally analysed gravimetrically, histologically and biochemically. Results In naïve mice, acute β-adrenoceptor stimulation with dobutamine increased heart rate, left ventricular (LV) fractional shortening (LVFS), ejection fraction (LVEF) and wall thickness and decreased LV diameter (p < 0.05). In stressed mice, dobutamine failed to induce further inotropic and chronotropic responses. Furthermore, following dobutamine injection, these mice exhibited lower LVEF and LVFS at identical heart rates, relative to corresponding controls. Sustained isoprenaline infusion induced LV hypertrophy (increased heart weight, heart weight/body weight ratio, heart weight/tibia length ratio and LV wall thickness (p < 0.05)) by 3 days, with little further change at 14 days. In contrast, increases in LVEF and LVFS were seen only at 14 days (p < 0.05). Discussion We describe protocols for and illustrative data from the assessment of murine cardiac responses to acute and sustained β-adrenergic stimulation in vivo, which would be of value in determining the impact of genetic or pharmacological interventions on such responses. Additionally, our data indicate that acute dobutamine stimulation unmasks early signs of LV dysfunction in the remodelled heart, even at a stage when basal function is enhanced. PMID:26836145

  6. Intravenous Immunoglobulin Prevents Murine Antibody-Mediated Acute Lung Injury at the Level of Neutrophil Reactive Oxygen Species (ROS) Production

    PubMed Central

    Semple, John W.; Kim, Michael; Hou, Jing; McVey, Mark; Lee, Young Jin; Tabuchi, Arata; Kuebler, Wolfgang M.; Chai, Zhong-Wei; Lazarus, Alan H.

    2012-01-01

    Transfusion-related acute lung injury (TRALI) is a leading cause of transfusion-associated mortality that can occur with any type of transfusion and is thought to be primarily due to donor antibodies activating pulmonary neutrophils in recipients. Recently, a large prospective case controlled clinical study of cardiac surgery patients demonstrated that despite implementation of male donors, a high incidence of TRALI still occurred and suggested a need for additional interventions in susceptible patient populations. To examine if intravenous immunoglobulin (IVIg) may be effective, a murine model of antibody-mediated acute lung injury that approximates human TRALI was examined. When BALB/c mice were injected with the anti-major histocompatibility complex class I antibody 34-1-2s, mild shock (reduced rectal temperature) and respiratory distress (dyspnea) were observed and pre-treatment of the mice with 2 g/kg IVIg completely prevented these symptoms. To determine IVIg's usefulness to affect severe lung damage, SCID mice, previously shown to be hypersensitive to 34-1-2s were used. SCID mice treated with 34-1-2s underwent severe shock, lung damage (increased wet/dry ratios) and 40% mortality within 2 hours. Treatment with 2 g/kg IVIg 18 hours before 34-1-2s administration completely protected the mice from all adverse events. Treatment with IVIg after symptoms began also reduced lung damage and mortality. While the prophylactic IVIg administration did not affect 34-1-2s-induced pulmonary neutrophil accumulation, bone marrow-derived neutrophils from the IVIg-treated mice displayed no spontaneous ROS production nor could they be stimulated in vitro with fMLP or 34-1-2s. These results suggest that IVIg prevents murine antibody-mediated acute lung injury at the level of neutrophil ROS production and thus, alleviating tissue damage. PMID:22363629

  7. Acute Administration of n-3 Rich Triglyceride Emulsions Provides Cardioprotection in Murine Models after Ischemia-Reperfusion

    PubMed Central

    Zirpoli, Hylde; Abdillahi, Mariane; Quadri, Nosirudeen; Ananthakrishnan, Radha; Wang, Lingjie; Rosario, Rosa; Zhu, Zhengbin; Deckelbaum, Richard J.; Ramasamy, Ravichandran

    2015-01-01

    Dietary n-3 fatty acids (FAs) may reduce cardiovascular disease risk. We questioned whether acute administration of n-3 rich triglyceride (TG) emulsions could preserve cardiac function and decrease injury after ischemia/reperfusion (I/R) insult. We used two different experimental models: in vivo, C57BL/6 mice were exposed to acute occlusion of the left anterior descending coronary artery (LAD), and ex-vivo, C57BL/6 murine hearts were perfused using Langendorff technique (LT). In the LAD model, mice treated with n-3 TG emulsion (1.5g/kg body weight), immediately after ischemia and 1h later during reperfusion, significantly reduced infarct size and maintained cardiac function (p<0.05). In the LT model, administration of n-3 TG emulsion (300mgTG/100ml) during reperfusion significantly improved functional recovery (p<0.05). In both models, lactate dehydrogenase (LDH) levels, as a marker of injury, were significantly reduced by n-3 TG emulsion. To investigate the mechanisms by which n-3 FAs protects hearts from I/R injury, we investigated changes in key pathways linked to cardioprotection. In the ex-vivo model, we showed that n-3 FAs increased phosphorylation of AKT and GSK3β proteins (p<0.05). Acute n-3 TG emulsion treatment also increased Bcl-2 protein level and reduced an autophagy marker, Beclin-1 (p<0.05). Additionally, cardioprotection by n-3 TG emulsion was linked to changes in PPARγ protein expression (p<0.05). Rosiglitazone and p-AKT inhibitor counteracted the positive effect of n-3 TG; GSK3β inhibitor plus n-3 TG significantly inhibited LDH release. We conclude that acute n-3 TG injection during reperfusion provides cardioprotection. This may prove to be a novel acute adjunctive reperfusion therapy after treating patients with myocardial infarction. PMID:25559887

  8. Epiplakin Deficiency Aggravates Murine Caerulein-Induced Acute Pancreatitis and Favors the Formation of Acinar Keratin Granules

    PubMed Central

    Wögenstein, Karl L.; Szabo, Sandra; Lunova, Mariia; Wiche, Gerhard; Haybaeck, Johannes; Strnad, Pavel; Boor, Peter; Wagner, Martin; Fuchs, Peter

    2014-01-01

    Epiplakin, a member of the plakin protein family, is exclusively expressed in epithelial tissues and was shown to bind to keratins. Epiplakin-deficient (EPPK−/−) mice showed no obvious spontaneous phenotype, however, EPPK−/− keratinocytes displayed faster keratin network breakdown in response to stress. The role of epiplakin in pancreas, a tissue with abundant keratin expression, was not yet known. We analyzed epiplakin’s expression in healthy and inflamed pancreatic tissue and compared wild-type and EPPK−/− mice during caerulein-induced acute pancreatitis. We found that epiplakin was expressed primarily in ductal cells of the pancreas and colocalized with apicolateral keratin bundles in murine pancreatic acinar cells. Epiplakin’s diffuse subcellular localization in keratin filament-free acini of K8-deficient mice indicated that its filament-associated localization in acinar cells completely depends on its binding partner keratin. During acute pancreatitis, epiplakin was upregulated in acinar cells and its redistribution closely paralleled keratin reorganization. EPPK−/− mice suffered from aggravated pancreatitis but showed no obvious regeneration phenotype. At the most severe stage of the disease, EPPK−/− acinar cells displayed more keratin aggregates than those of wild-type mice. Our data propose epiplakin to be a protective protein during acute pancreatitis, and that its loss causes impaired disease-associated keratin reorganization. PMID:25232867

  9. Altered Lipid Composition of Surfactant and Lung Tissue in Murine Experimental Malaria-Associated Acute Respiratory Distress Syndrome

    PubMed Central

    Scaccabarozzi, Diletta; Deroost, Katrien; Lays, Natacha; Taramelli, Donatella

    2015-01-01

    Malaria-associated acute lung injury (MA-ALI) and its more severe form malaria-associated acute respiratory distress syndrome (MA-ARDS) are common, often fatal complications of severe malaria infections. However, little is known about their pathogenesis. In this study, biochemical alterations of the lipid composition of the lungs were investigated as possible contributing factors to the severity of murine MA-ALI/ARDS. C57BL/6J mice were infected with Plasmodium berghei NK65 to induce lethal MA-ARDS, or with Plasmodium chabaudi AS, a parasite strain that does not induce lung pathology. The lipid profile of the lung tissue from mice infected with Plasmodium berghei NK65 developing MA-ALI/ARDS, but not that from mice without lung pathology or controls, was characterized by high levels of phospholipids -mainly phosphatidylcholine- and esterified cholesterol. The high levels of polyunsaturated fatty acids and the linoleic/oleic fatty acid ratio of the latter reflect the fatty acid composition of plasma cholesterol esters. In spite of the increased total polyunsaturated fatty acid pool, which augments the relative oxidability of the lung membranes, and the presence of hemozoin, a known pro-oxidant, no excess oxidative stress was detected in the lungs of Plasmodium berghei NK65 infected mice. The bronchoalveolar lavage (BAL) fluid of Plasmodium berghei NK65 infected mice was characterized by high levels of plasma proteins. The phospholipid profile of BAL large and small aggregate fractions was also different from uninfected controls, with a significant increase in the amounts of sphingomyelin and lysophosphatidylcholine and the decrease in phosphatidylglycerol. Both the increase of proteins and lysophosphatidylcholine are known to decrease the intrinsic surface activity of surfactant. Together, these data indicate that an altered lipid composition of lung tissue and BAL fluid, partially ascribed to oedema and lipoprotein infiltration, is a characteristic feature of murine

  10. Altered Lipid Composition of Surfactant and Lung Tissue in Murine Experimental Malaria-Associated Acute Respiratory Distress Syndrome.

    PubMed

    Scaccabarozzi, Diletta; Deroost, Katrien; Lays, Natacha; Omodeo Salè, Fausta; Van den Steen, Philippe E; Taramelli, Donatella

    2015-01-01

    Malaria-associated acute lung injury (MA-ALI) and its more severe form malaria-associated acute respiratory distress syndrome (MA-ARDS) are common, often fatal complications of severe malaria infections. However, little is known about their pathogenesis. In this study, biochemical alterations of the lipid composition of the lungs were investigated as possible contributing factors to the severity of murine MA-ALI/ARDS. C57BL/6J mice were infected with Plasmodium berghei NK65 to induce lethal MA-ARDS, or with Plasmodium chabaudi AS, a parasite strain that does not induce lung pathology. The lipid profile of the lung tissue from mice infected with Plasmodium berghei NK65 developing MA-ALI/ARDS, but not that from mice without lung pathology or controls, was characterized by high levels of phospholipids -mainly phosphatidylcholine- and esterified cholesterol. The high levels of polyunsaturated fatty acids and the linoleic/oleic fatty acid ratio of the latter reflect the fatty acid composition of plasma cholesterol esters. In spite of the increased total polyunsaturated fatty acid pool, which augments the relative oxidability of the lung membranes, and the presence of hemozoin, a known pro-oxidant, no excess oxidative stress was detected in the lungs of Plasmodium berghei NK65 infected mice. The bronchoalveolar lavage (BAL) fluid of Plasmodium berghei NK65 infected mice was characterized by high levels of plasma proteins. The phospholipid profile of BAL large and small aggregate fractions was also different from uninfected controls, with a significant increase in the amounts of sphingomyelin and lysophosphatidylcholine and the decrease in phosphatidylglycerol. Both the increase of proteins and lysophosphatidylcholine are known to decrease the intrinsic surface activity of surfactant. Together, these data indicate that an altered lipid composition of lung tissue and BAL fluid, partially ascribed to oedema and lipoprotein infiltration, is a characteristic feature of murine

  11. Differential plasma clearance of murine acute-phase serum amyloid A proteins SAA1 and SAA2.

    PubMed Central

    Kluve-Beckerman, B; Yamada, T; Hardwick, J; Liepnieks, J J; Benson, M D

    1997-01-01

    Serum amyloid A (SAA) proteins SAA1 and SAA2 are prominent acute-phase reactants which circulate in association with the high-density-lipoprotein (HDL) fraction of plasma. Plasma levels of SAA1 and SAA2 increase dramatically, by as much as 1000-fold, within 24 h of tissue injury and then rapidly decrease with cessation of the inflammatory stimulus, suggesting that SAA clearance and/or catabolism is important to the re-establishment of homoeostasis. In this context, aberrant SAA catabolism has long been considered a potential factor in the pathogenesis of reactive amyloidosis. To initiate studies aimed at understanding the differential regulation of SAA metabolism, we have produced 35S-labelled murine SAA1 and SAA2 in Escherichia coli, bound them individually to HDL, and then compared the plasma-clearance characteristics of SAA1 and SAA2 under normal and acute-phase conditions. When bound to normal HDL, SAA2 [half-life (t1/2) = 30 min] was cleared significantly faster than SAA1 (t1/2 = 75 min). Clearance of SAA1 and SAA2 was significantly slower when each was bound to acute-phase HDL as opposed to normal HDL, when clearance rates were determined in acute-phase mice versus normal mice, and when normal HDL was remodelled to contain both recombinant isotypes rather than just one of the isotypes. Thus it appears that an increased amount of SAA on HDL, or possibly the combined presence of both isotypes on HDL, is associated with a prolongation in the plasma half-life of SAA. PMID:9065791

  12. Heme Oxygenase-1 Ameliorates Dextran Sulfate Sodium-induced Acute Murine Colitis by Regulating Th17/Treg Cell Balance*

    PubMed Central

    Zhang, Liya; Zhang, Yanjie; Zhong, Wenwei; Di, Caixia; Lin, Xiaoliang; Xia, Zhenwei

    2014-01-01

    Inflammatory bowel disease (IBD), including ulcerative colitis and Crohn's disease, is a group of autoimmune diseases characterized by nonspecific inflammation in the gastrointestinal tract. Recent investigations suggest that activation of Th17 cells and/or deficiency of regulatory T cells (Treg) is involved in the pathogenesis of IBD. Heme oxygenase (HO)-1 is a protein with a wide range of anti-inflammatory and immune regulatory function, which exerts significantly protective roles in various T cell-mediated diseases. In this study, we aim to explore the immunological regulation of HO-1 in the dextran sulfate sodium-induced model of experimental murine colitis. BALB/c mice were administered 4% dextran sulfate sodium orally; some mice were intraperitoneally pretreated with HO-1 inducer hemin or HO-1 inhibitor stannum protoporphyrin IX. The results show that hemin enhances the colonic expression of HO-1 and significantly ameliorates the symptoms of colitis with improved histological changes, accompanied by a decreased proportion of Th17 cells and increased number of Tregs in mesenteric lymph node and spleen. Moreover, induction of HO-1 down-regulates retinoic acid-related orphan receptor γt expression and IL-17A levels, while promoting Treg-related forkhead box p3 (Foxp3) expression and IL-10 levels in colon. Further study in vitro revealed that up-regulated HO-1 switched the naive T cells to Tregs when cultured under a Th17-inducing environment, which involved in IL-6R blockade. Therefore, HO-1 may exhibit anti-inflammatory activity in the murine model of acute experimental colitis via regulating the balance between Th17 and Treg cells, thus providing a possible novel therapeutic target in IBD. PMID:25112868

  13. Development of a non-invasive murine infection model for acute otitis media.

    PubMed

    Stol, K; van Selm, S; van den Berg, S; Bootsma, H J; Blokx, W A M; Graamans, K; Tonnaer, E L G M; Hermans, P W M

    2009-12-01

    Otitis media (OM) is one of the most frequent diseases in childhood, and Streptococcus pneumoniae is among the main causative bacterial agents. Since current experimental models used to study the bacterial pathogenesis of OM have several limitations, such as the invasiveness of the experimental procedures, we developed a non-invasive murine OM model. In our model, adapted from a previously developed rat OM model, a pressure cabin is used in which a 40 kPa pressure increase is applied to translocate pneumococci from the nasopharyngeal cavity into both mouse middle ears. Wild-type pneumococci were found to persist in the middle ear cavity for 144 h after infection, with a maximum bacterial load at 96 h. Inflammation was confirmed at 96 and 144 h post-infection by IL-1beta and TNF-alpha cytokine analysis and histopathology. Subsequently, we investigated the contribution of two surface-associated pneumococcal proteins, the streptococcal lipoprotein rotamase A (SlrA) and the putative proteinase maturation protein A (PpmA), to experimental OM in our model. Pneumococci lacking the slrA gene, but not those lacking the ppmA gene, were significantly reduced in virulence in the OM model. Importantly, pneumococci lacking both genes were significantly more attenuated than the DeltaslrA single mutant. This additive effect suggests that SlrA and PpmA exert complementary functions during experimental OM. In conclusion, we have developed a highly reproducible and non-invasive murine infection model for pneumococcal OM using a pressure cabin, which is very suitable to study pneumococcal pathogenesis and virulence in vivo. PMID:19762437

  14. Hearing Loss and Cytomegalovirus.

    ERIC Educational Resources Information Center

    Strauss, Melvin

    1997-01-01

    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  15. NMR based metabolomics reveals acute hippocampal metabolic fluctuations during cranial irradiation in murine model.

    PubMed

    Rana, Poonam; Gupta, Mamta; Khan, Ahmad Raza; Hemanth Kumar, B S; Roy, Raja; Khushu, Subash

    2014-07-01

    Cranial irradiation is widely used as a treatment modality or prophylactic treatment in cancer patients, but it is frequently related to neurocognitive impairment in cancer survivors. Though most of radiation-induced changes occur during early and late delayed phase of radiation sickness, recent reports have supported the evidence of impaired neurogenesis within 24-48 h of radiation exposure that may implicate changes in acute phase as well. Inspection of these acute changes could be considered important as they may have long lasting effect on cognitive development and functions. In the present study, (1)H NMR spectroscopy based metabolomic approach was used to obtain comprehensive information of hippocampus metabolic physiology during acute phase of radiation sickness in a mouse model for single dose 8 Gy cranial irradiation. The analysis demonstrated reduced metabolic activity in irradiated animals compared to controls, typically evident in citric acid cycle intermediates, glutamine/glutamate and ketone bodies metabolism thus providing strong indication that the hippocampus is metabolically responsive to radiation exposure. The data suggested reduced glucose utilization, altered intermediary and neurotransmitter metabolism in hippocampus tissue extract. To the best of our knowledge this is the first metabolomic study to document cranial irradiation induced acute metabolic changes using in vitro(1)H NMR spectroscopy. PMID:24787771

  16. Murine Models of Acute Alcoholic Hepatitis and Their Relevance to Human Disease.

    PubMed

    Wilkin, Richard J W; Lalor, Patricia F; Parker, Richard; Newsome, Philip N

    2016-04-01

    Alcohol-induced liver damage is a major burden for most societies, and murine studies can provide a means to better understand its pathogenesis and test new therapies. However, there are many models reported with widely differing phenotypes, not all of which fully regenerate the spectrum of human disease. Thus, it is important to understand the implications of these variations to efficiently model human disease. This review critically appraises key articles in the field, detailing the spectrum of liver damage seen in different models, and how they relate to the phenotype of disease seen in patients. A range of different methods of alcohol administration have been studied, ranging from ad libitum consumption of alcohol and water to modified diets (eg, Lieber deCarli liquid diet). Other feeding regimens have taken more invasive routes using intragastric feeding tubes to infuse alcohol directly into the stomach. Notably, models using wild-type mice generally produce a milder phenotype of liver damage than those using genetically modified mice, with the exception of the chronic binge-feeding model. We recommend panels of tests for consideration to standardize end points for the evaluation of the severity of liver damage-key for comparison of models of injury, testing of new therapies, and subsequent translation of findings into clinical practice. PMID:26835538

  17. The effect of intra-articular vanilloid receptor agonists on pain behavior measures in a murine model of acute monoarthritis

    PubMed Central

    Abdullah, Mishal; Mahowald, Maren L; Frizelle, Sandra P; Dorman, Christopher W; Funkenbusch, Sonia C; Krug, Hollis E

    2016-01-01

    Arthritis is the most common cause of disability in the US, and the primary manifestation of arthritis is joint pain that leads to progressive physical limitation, disability, morbidity, and increased health care utilization. Capsaicin (CAP) is a vanilloid agonist that causes substance P depletion by interacting with vanilloid receptor transient receptor potential V1 on small unmyelinated C fibers. It has been used topically for analgesia in osteoarthritis with variable success. Resiniferatoxin (RTX) is an ultra potent CAP analog. The aim of this study was to measure the analgesic effects of intra-articular (IA) administration of CAP and RTX in experimental acute inflammatory arthritis in mice. Evoked pain score (EPS) and a dynamic weight bearing (DWB) device were used to measure nociceptive behaviors in a murine model of acute inflammatory monoarthritis. A total of 56 C57B16 male mice underwent EPS and DWB testing – 24 nonarthritic controls and 32 mice with carrageenan-induced arthritis. The effects of pretreatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX were measured. Nociception was reproducibly demonstrated by increased EPS and reduced DWB measures in the affected limb of arthritic mice. Pretreatment with 0.001% RTX resulted in statistically significant improvement in EPS and DWB measures when compared with those observed in carrageenan-induced arthritis animals. Pretreatment with IA 0.0003% RTX and IA 0.01% CAP resulted in improvement in some but not all of these measures. The remaining 24 mice underwent evaluation following treatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX, and the results obtained were similar to that of naïve, nonarthritic mice. PMID:27574462

  18. The effect of intra-articular vanilloid receptor agonists on pain behavior measures in a murine model of acute monoarthritis.

    PubMed

    Abdullah, Mishal; Mahowald, Maren L; Frizelle, Sandra P; Dorman, Christopher W; Funkenbusch, Sonia C; Krug, Hollis E

    2016-01-01

    Arthritis is the most common cause of disability in the US, and the primary manifestation of arthritis is joint pain that leads to progressive physical limitation, disability, morbidity, and increased health care utilization. Capsaicin (CAP) is a vanilloid agonist that causes substance P depletion by interacting with vanilloid receptor transient receptor potential V1 on small unmyelinated C fibers. It has been used topically for analgesia in osteoarthritis with variable success. Resiniferatoxin (RTX) is an ultra potent CAP analog. The aim of this study was to measure the analgesic effects of intra-articular (IA) administration of CAP and RTX in experimental acute inflammatory arthritis in mice. Evoked pain score (EPS) and a dynamic weight bearing (DWB) device were used to measure nociceptive behaviors in a murine model of acute inflammatory monoarthritis. A total of 56 C57B16 male mice underwent EPS and DWB testing - 24 nonarthritic controls and 32 mice with carrageenan-induced arthritis. The effects of pretreatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX were measured. Nociception was reproducibly demonstrated by increased EPS and reduced DWB measures in the affected limb of arthritic mice. Pretreatment with 0.001% RTX resulted in statistically significant improvement in EPS and DWB measures when compared with those observed in carrageenan-induced arthritis animals. Pretreatment with IA 0.0003% RTX and IA 0.01% CAP resulted in improvement in some but not all of these measures. The remaining 24 mice underwent evaluation following treatment with 0.1% CAP, 0.0003% RTX, or 0.001% RTX, and the results obtained were similar to that of naïve, nonarthritic mice. PMID:27574462

  19. Immunovirotherapy with vesicular stomatitis virus and PD-L1 blockade enhances therapeutic outcome in murine acute myeloid leukemia.

    PubMed

    Shen, Weiwei; Patnaik, Mrinal M; Ruiz, Autumn; Russell, Stephen J; Peng, Kah-Whye

    2016-03-17

    Patients with relapsed acute myeloid leukemia (AML) have limited therapeutic options. Vesicular stomatitis virus (VSV)-interferon β (IFNβ)-sodium iodide symporter (NIS) is an oncolytic VSV encoding IFNβ and the NIS reporter. Syngeneic AML C1498 tumors responded to IV therapy with VSV-murine IFNβ (mIFNβ)-NIS in a dose-dependent manner. Imaging for NIS expression showed robust virus infection within the tumors. Virus infection did not increase programmed death ligand 1 (PD-L1) on tumor cells. Combining VSV-mIFNβ-NIS with anti-PD-L1 antibody (Ab) therapy enhanced antitumor activity compared with treatment with virus alone or Ab alone; this enhancement was not significant at higher VSV-mIFNβ-NIS doses. Systemic VSV therapy reduced systemic C1498-green fluorescent protein (GFP) tumor burden in the blood, bone marrow, spleen, and liver of mice with AML. Combination VSV-mIFNβ-NIS and anti-PD-L1 Ab therapy significantly enhanced the survival of these mice with no evidence of toxicity, compared with isotype control, anti-PD-L1, or virus alone. There was an increase in tumor-infiltrating CD4 and CD8 cells. Single-agent VSV-mIFNβ-NIS virotherapy induced both VSV-specific and GFP-specific CD8 T cells as determined by IFN-γ enzyme-linked immunospot, pentamer, and intracellular IFN-γ staining assays. Both of these responses were further enhanced by addition of anti-PD-L1 Ab. Depletion of CD8 or natural killer cells, but not CD4 cells, resulted in loss of antitumor activity in the VSV/anti-PD-L1 group. Clinical samples from chronic myelomonocytic leukemia and acute myelomonocytic leukemia appear to be especially susceptible to VSV. Overall, our studies show that oncolytic virotherapy combined with immune checkpoint blockade is a promising approach to AML therapy. PMID:26712908

  20. Pro-inflammatory potential of Escherichia coli strains K12 and Nissle 1917 in a murine model of acute ileitis.

    PubMed

    Bereswill, S; Fischer, A; Dunay, I R; Kühl, A A; Göbel, U B; Liesenfeld, O; Heimesaat, M M

    2013-06-01

    Non-pathogenic Escherichia coli (Ec) strains K12 (EcK12) and Nissle 1917 (EcN) are used for gene technology and probiotic treatment of intestinal inflammation, respectively. We investigated intestinal colonization and potential pro-inflammatory properties of EcK12, EcN, and commensal E. coli (EcCo) strains in Toxoplasma (T.) gondii-induced acute ileitis. Whereas gnotobiotic animals generated by quintuple antibiotic treatment were protected from ileitis, mice replenished with conventional microbiota suffered from small intestinal necrosis 7 days post-T. gondii infection (p.i.). Irrespective of the Ec strain, recolonized mice revealed mild to moderate histopathological changes in their ileal mucosa. Upon stable recolonization with EcK12, EcN, or EcCo, development of inflammation was accompanied by pro-inflammatory responses at day 7 p.i., including increased ileal T lymphocyte and apoptotic cell numbers compared to T. gondii-infected gnotobiotic controls. Strikingly, either Ec strain was capable to translocate to extra-intestinal locations, such as MLN, spleen, and liver. Taken together, Ec strains used in gene technology and probiotic treatment are able to exert inflammatory responses in a murine model of small intestinal inflammation. In conclusion, the therapeutic use of Ec strains in patients with broad-spectrum antibiotic treatment and/or intestinal inflammation should be considered with caution. PMID:24265929

  1. Upregulation of ICOS on CD43+ CD4+ murine small intestinal intraepithelial lymphocytes during acute reovirus infection

    SciTech Connect

    Montufar-Solis, Dina; Garza, Tomas; Teng, B.-B.; Klein, John R. . E-mail: john.r.klein@uth.tmc.edu

    2006-04-14

    Murine intestinal intraepithelial lymphocytes (IELs) can be classified according to expression of a CD43 glycoform recognized by the S7 monoclonal antibody. In this study, we examined the response of S7+ and S7- IELs in mice during acute reovirus serotype 3 (Dearing strain) infection, which was confirmed by virus-specific real-time PCR. In vivo proliferation increased significantly for both S7- and S7+ IELs on day 4 post-infection as determined by BrdU incorporation; however, expression of the inducible costimulatory (ICOS) molecule, which peaked on day 7 post-infection, was upregulated on S7+ CD4+ T cells, most of which were CD4+8- IELs. In vitro ICOS stimulation by syngeneic peritoneal macrophages induced IFN-{gamma} secretion from IELs from day 7 infected mice, and was suppressed by treatment with anti-ICOS mAb. Additionally, IFN-{gamma} mRNA increased in CD4+ IELs on day 6 post-infection. These findings indicate that S7- and S7+ IELs are differentially mobilized during the immune response to reovirus infection; that the regulated expression of ICOS is associated with S7+ IELs; and that stimulation of IELs through ICOS enhances IFN-{gamma} synthesis during infection.

  2. Improved BM212 MmpL3 Inhibitor Analogue Shows Efficacy in Acute Murine Model of Tuberculosis Infection

    PubMed Central

    Alfonso, Salvatore; Cocozza, Martina; Porretta, Giulio Cesare; Ballell, Lluís; Rullas, Joaquin; Ortega, Fátima; De Logu, Alessandro; Agus, Emanuela; La Rosa, Valentina; Pasca, Maria Rosalia; De Rossi, Edda; Wae, Baojie; Franzblau, Scott G.; Manetti, Fabrizio; Botta, Maurizio; Biava, Mariangela

    2013-01-01

    1,5-Diphenyl pyrroles were previously identified as a class of compounds endowed with high in vitro efficacy against M. tuberculosis. To improve the physical chemical properties and drug-like parameters of this class of compounds, a medicinal chemistry effort was undertaken. By selecting the optimal substitution patterns for the phenyl rings at N1 and C5 and by replacing the thiomorpholine moiety with a morpholine one, a new series of compounds was produced. The replacement of the sulfur with oxygen gave compounds with lower lipophilicity and improved in vitro microsomal stability. Moreover, since the parent compound of this family has been shown to target MmpL3, mycobacterial mutants resistant to two compounds have been isolated and characterized by sequencing the mmpL3 gene; all the mutants showed point mutations in this gene. The best compound identified to date was progressed to dose-response studies in an acute murine TB infection model. The resulting ED99 of 49 mg/Kg is within the range of commonly employed tuberculosis drugs, demonstrating the potential of this chemical series. The in vitro and in vivo target validation evidence presented here adds further weight to MmpL3 as a druggable target of interest for anti-tubercular drug discovery. PMID:23437287

  3. Identification of an acute-phase reactant in murine infections with Trypanosoma brucei.

    PubMed Central

    Shapiro, S Z; Black, S J

    1992-01-01

    A 42-kDa protein appeared at a much higher concentration in plasma from Trypanosoma brucei-resistant (C57BL/6) mice after infection than in plasma from trypanosome-susceptible (C3H/He) mice. This protein was purified by sequential steps of gel filtration, protein A-Sepharose affinity chromatography, isoelectric focusing, and ammonium sulfate precipitation. The purified protein was identified as a subunit of the acute-phase reactant haptoglobin. Causes of elevated plasma haptoglobin and its implications for resistance to trypanosomiasis are discussed. Images PMID:1500201

  4. Broncholaveolar lavage to detect cytomegalovirus infection, latency, and reactivation in immune competent hosts.

    PubMed

    Mansfield, Sara; Dwivedi, Varun; Byrd, Sara; Trgovcich, Joanne; Griessl, Marion; Gutknecht, Michael; Cook, Charles H

    2016-08-01

    Roughly 1/3rd of immune competent patients will reactivate latent cytomegalovirus (CMV) during critical illness. There are no standard methods to detect reactivation, and some investigators have postulated that presence of DNA in BAL fluid is indicative of viral replication. To test this hypothesis, we used a murine model that allows inclusion of matched healthy controls which is not possible in human studies. BALB/c mice infected with Smith-murine CMV or PBS (mock) had BAL evaluated 7, 14, or 21 days after acute infections, during latency, or during bacterial sepsis. Plaque assay, PCR, and rtPCR were performed on BALs and concomitantly obtained lung tissue. BAL cellular compositions, including tetramer evaluation of CMV-specific T cells were evaluated by flow cytometry. CMV DNA were detected in BAL at all time-points during acute infection, becoming undetectable in all mice during latency, then were detected again during bacterial sepsis, peaking 3 weeks after onset. mCMV specific T-cells were most numerous in BAL after acute viral infections, decreasing to low levels during latency, then fluctuating during bacterial sepsis. Specifically, mCMV-specific T-cells contracted at sepsis onset, expanding 2-4 weeks post-sepsis, presumably in response to increased viral loads at that time point. Altogether, our results support the use of BAL PCR for the diagnosis of CMV replication in immune competent hosts. Additionally, we demonstrate dynamic changes in CMV-specific T cells that occur in BAL during CMV infection and during sepsis induced viral reactivation. J. Med. Virol. 88:1408-1416, 2016. © 2016 Wiley Periodicals, Inc. PMID:26762116

  5. Cytomegalovirus-associated splenic infarcts in an adult immune-competent man: a case report and review of the literature

    PubMed Central

    2014-01-01

    Introduction Cytomegalovirus-associated thrombosis has been extensively reported in the medical literature, mainly in immune-compromised patients. However, the association with splenic infarcts has been rarely mentioned. Case presentation We report the case of a 38-year-old Caucasian man of Hellenic origin with acute cytomegalovirus infection presenting with spontaneous splenic infarcts. Echocardiography did not show any vegetations or mural thrombi. Anticoagulation treatment was not considered due to implication of minor vessels and since cytomegalovirus was the probable trigger for thrombosis in this patient. Conclusions This case report serves as additional evidence for the role of cytomegalovirus in thrombosis. PMID:24594283

  6. Elimination of complement interference can improve the diagnostic performance of the VIDAS CMV IgG assay in acute cytomegalovirus infections.

    PubMed

    Berth, Mario; Willaert, Sofie

    2016-05-01

    In this study we showed that complement factors are responsible for assay interference in the VIDAS cytomegalovirus (CMV) immunoglobulin G (IgG) assay. Three different serum treatments were applied to show the cause of interference: heat treatment (56 °C), adding cobra venom factor, and adding EDTA. Elimination of complement interference by EDTA treatment of serum was prospectively evaluated on 215 CMV IgM positive samples and a sensitivity increase of the VIDAS CMV IgG assay was noticed. On average the CMV IgG level increased 100% after EDTA treatment of the serum. In paired serum samples from 38 patients we could show that serum treatment with EDTA can make the CMV IgG level changes more obvious in recent CMV infections. Since the CMV IgG avidity II assay on VIDAS depends on the determination of CMV IgG, the CMV IgG avidity was also evaluated in this study but only a limited effect of the complement interference was observed. PMID:26971633

  7. Influence of Acute High Glucose on Protein Abundance Changes in Murine Glomerular Mesangial Cells

    PubMed Central

    Barati, Michelle T.; Gould, James C.; Salyer, Sarah A.; Isaacs, Susan; Wilkey, Daniel W.; Merchant, Michael L.

    2016-01-01

    The effects of acute exposure to high glucose levels as experienced by glomerular mesangial cells in postprandial conditions and states such as in prediabetes were investigated using proteomic methods. Two-dimensional gel electrophoresis and matrix assisted laser desorption ionization time of flight mass spectrometry methods were used to identify protein expression patterns in immortalized rat mesangial cells altered by 2 h high glucose (HG) growth conditions as compared to isoosmotic/normal glucose control (NG⁎) conditions. Unique protein expression changes at 2 h HG treatment were measured for 51 protein spots. These proteins could be broadly grouped into two categories: (1) proteins involved in cell survival/cell signaling and (2) proteins involved in stress response. Immunoblot experiments for a protein belonging to both categories, prohibitin (PHB), supported a trend for increased total expression as well as significant increases in an acidic PHB isoform. Additional studies confirmed the regulation of proteasomal subunit alpha-type 2 and the endoplasmic reticulum chaperone and oxidoreductase PDI (protein disulfide isomerase), suggesting altered ER protein folding capacity and proteasomal function in response to acute HG. We conclude that short term high glucose induces subtle changes in protein abundances suggesting posttranslational modifications and regulation of pathways involved in proteostasis. PMID:26839892

  8. Influence of Acute High Glucose on Protein Abundance Changes in Murine Glomerular Mesangial Cells.

    PubMed

    Barati, Michelle T; Gould, James C; Salyer, Sarah A; Isaacs, Susan; Wilkey, Daniel W; Merchant, Michael L

    2016-01-01

    The effects of acute exposure to high glucose levels as experienced by glomerular mesangial cells in postprandial conditions and states such as in prediabetes were investigated using proteomic methods. Two-dimensional gel electrophoresis and matrix assisted laser desorption ionization time of flight mass spectrometry methods were used to identify protein expression patterns in immortalized rat mesangial cells altered by 2 h high glucose (HG) growth conditions as compared to isoosmotic/normal glucose control (NG(⁎)) conditions. Unique protein expression changes at 2 h HG treatment were measured for 51 protein spots. These proteins could be broadly grouped into two categories: (1) proteins involved in cell survival/cell signaling and (2) proteins involved in stress response. Immunoblot experiments for a protein belonging to both categories, prohibitin (PHB), supported a trend for increased total expression as well as significant increases in an acidic PHB isoform. Additional studies confirmed the regulation of proteasomal subunit alpha-type 2 and the endoplasmic reticulum chaperone and oxidoreductase PDI (protein disulfide isomerase), suggesting altered ER protein folding capacity and proteasomal function in response to acute HG. We conclude that short term high glucose induces subtle changes in protein abundances suggesting posttranslational modifications and regulation of pathways involved in proteostasis. PMID:26839892

  9. Cytomegalovirus: the stealth virus.

    PubMed

    Robinson, Sharon

    2016-05-01

    Cytomegalovirus (CMV) is an infection, part of the herpes family of viruses which, if contracted during pregnancy, cancause devastating effects on the newborn baby. This article is written by the trustee of a volunteer-based charity, mostly run by mothers of CMV children, who are striving to raise awareness of this infection, which is more common than Down's syndrome, listeria and toxoplasmosis, and is theprimary preventable cause of childhood hearing loss. PMID:27295757

  10. Acthar gel treatment suppresses acute exacerbations in a murine model of relapsing-remitting multiple sclerosis.

    PubMed

    Cusick, Matthew F; Libbey, Jane E; Oh, Luke; Jordan, Shaun; Fujinami, Robert S

    2015-06-01

    Acthar gel is indicated for the treatment of acute exacerbations of multiple sclerosis (MS) in adults. Its effects on immune cells during a relapse are unknown. This study investigated the effects of Acthar in an animal model of relapsing-remitting MS, using SJL/J mice sensitized with myelin peptide. All animal studies were reviewed and approved by the University of Utah Institutional Animal Care and Use Committee and conducted in accordance with the guidelines prepared by the Committee on Care and Use of Laboratory Animals, Institute of Laboratory Animals Resources, National Research Council. Mice injected with Acthar to treat the second attack had a significantly lower mean clinical score during relapse and a significantly reduced cumulative disease burden compared to Placebo gel-treated mice. Furthermore, Acthar treatment ameliorated inflammation/demyelination in the spinal cord and markedly suppressed ex vivo myelin peptide-induced CD4(+) T cell proliferation. PMID:25410153

  11. Responses of the murine esophageal microcirculation to acute exposure to alkali, acid, or hypochlorite

    PubMed Central

    Osman, M.; Russell, J.; Shukla, D.; Moghadamfalahi, M.; Granger, D.N.

    2008-01-01

    Background/Purpose Although ingestion of alkali- and/or hypochlorite-based household cleaners as well as strong acids remain a major cause of esophageal wall injury, little is known about the mechanisms that underlie the injury response to these toxic agents. This study examined the roles of vascular dysfunction and inflammation to the esophageal injury response to different caustic substances in mice. Methods The esophageal responses to NaOH (10%, 5% & 2.5%), KOH (10%, 5%, & 2.5%), NaOCl (5.25%), and HCl (10%, pH=2) were evaluated by intravital videomicroscopy, and histopathology. Intravital microscopy was used to monitor changes in the diameter of arterioles and venules, the adhesion and movement of leukocytes in venules, and time of cessation of arteriolar blood flow in mouse esophagus. The esophageal mucosa was exposed to caustic substances for 0–60 minutes prior to evaluation. Results The higher concentrations of NaOH and KOH elicited rapid stasis in both arterioles and venules, which was accompanied by arteriolar constriction and thrombosis. An accumulation of adherent leukocytes in venules was not observed with any agent. Histopathologic evaluation revealed marked cellular and interstitial edema in the mucosa with alkali, while HCl and NaOCl decreased the thickness epithelial layer. Conclusion These findings suggest that ischemia and thrombosis are dominant processes, while inflammation is less important, in the pathogenesis of acute corrosive injury to the esophageal mucosa. PMID:18779005

  12. Abrogation of Plasminogen Activator Inhibitor-1-Vitronectin Interaction Ameliorates Acute Kidney Injury in Murine Endotoxemia

    PubMed Central

    Gupta, Kamlesh K.; Donahue, Deborah L.; Sandoval-Cooper, Mayra J.; Castellino, Francis J.; Ploplis, Victoria A.

    2015-01-01

    Sepsis-induced acute kidney injury (AKI) contributes to the high mortality and morbidity in patients. Although the pathogenesis of AKI during sepsis is poorly understood, it is well accepted that plasminogen activator inhibitor-1 (PAI-1) and vitronectin (Vn) are involved in AKI. However, the functional cooperation between PAI-1 and Vn in septic AKI has not been completely elucidated. To address this issue, mice were utilized lacking either PAI-1 (PAI-1−/−) or expressing a PAI-1-mutant (PAI-1R101A/Q123K) in which the interaction between PAI-1 and Vn is abrogated, while other functions of PAI-1 are retained. It was found that both PAI-1−/− and PAI-1R101A/Q123K mice are associated with decreased renal dysfunction, apoptosis, inflammation, and ERK activation as compared to wild-type (WT) mice after LPS challenge. Also, PAI-1−/− mice showed attenuated fibrin deposition in the kidneys. Furthermore, a lack of PAI-1 or PAI-1-Vn interaction was found to be associated with an increase in activated Protein C (aPC) in plasma. These results demonstrate that PAI-1, through its interaction with Vn, exerts multiple deleterious mechanisms to induce AKI. Therefore, targeting of the PAI-1-Vn interaction in kidney represents an appealing therapeutic strategy for the treatment of septic AKI by not only altering the fibrinolytic capacity but also regulating PC activity. PMID:25799354

  13. Diet-induced obesity accelerates acute lymphoblastic leukemia progression in two murine models*

    PubMed Central

    Yun, Jason P.; Behan, James W.; Heisterkamp, Nora; Butturini, Anna; Klemm, Lars; Ji, Lingyun; Groffen, John; Müschen, Markus; Mittelman, Steven D.

    2010-01-01

    Obesity is associated with an increased incidence of many cancers, including leukemia, though it is unknown whether leukemia incidence is increased directly by obesity, or rather by associated genetic, lifestyle, health, or socio-economic factors. We developed animal models of obesity and leukemia to test whether obesity could directly accelerate acute lymphoblastic leukemia (ALL) using BCR/ABL transgenic and AKR/J mice weaned onto a high-fat diet. Mice were observed until development of progressive ALL. Although obese and control BCR/ABL mice had similar median survival, older obese mice had accelerated ALL onset, implying a time-dependent effect of obesity on ALL. Obese AKR mice developed ALL significantly earlier than controls. The effect of obesity was not explained by WBC count, thymus/spleen weight, or ALL phenotype. However, obese AKR mice had higher leptin, insulin, and IL-6 levels than controls, and these obesity-related hormones all have potential roles in leukemia pathogenesis. In conclusion, obesity directly accelerates presentation of ALL, likely by increasing the risk of an early event in leukemogenesis. This is the first study to demonstrate that obesity can directly accelerate the progression of ALL. Thus, the observed associations between obesity and leukemia incidence are likely to be directly related to biological effects of obesity. PMID:20823291

  14. A murine model of obesity implicates the adipokine milieu in the pathogenesis of severe acute pancreatitis.

    PubMed

    Zyromski, Nicholas J; Mathur, Abhishek; Pitt, Henry A; Lu, Debao; Gripe, John T; Walker, Julia J; Yancey, Kyle; Wade, Terence E; Swartz-Basile, Deborah A

    2008-09-01

    Obesity is clearly an independent risk factor for increased severity of acute pancreatitis (AP), although the mechanisms underlying this association are unknown. Adipokines (including leptin and adiponectin) are pleiotropic molecules produced by adipocytes that are important regulators of the inflammatory response. We hypothesized that the altered adipokine milieu observed in obesity contributes to the increased severity of pancreatitis. Lean (C57BL/6J), obese leptin-deficient (LepOb), and obese hyperleptinemic (LepDb) mice were subjected to AP by six hourly intraperitoneal injections of cerulein (50 microg/kg). Severity of AP was assessed by histology and by measuring pancreatic concentration of the proinflammatory cytokines IL-1beta and IL-6, the chemokine MCP-1, and the marker of neutrophil activation MPO. Both congenitally obese strains of mice developed significantly more severe AP than wild-type lean animals. Severity of AP was not solely related to adipose tissue volume: LepOb mice were heaviest; however, LepDb mice developed the most severe AP both histologically and biochemically. Circulating adiponectin concentrations inversely mirrored the severity of pancreatitis. These data demonstrate that congenitally obese mice develop more severe AP than lean animals when challenged by cerulein hyperstimulation and suggest that alteration of the adipokine milieu exacerbates the severity of AP in obesity. PMID:18583460

  15. The nsp2 Replicase Proteins of Murine Hepatitis Virus and Severe Acute Respiratory Syndrome Coronavirus Are Dispensable for Viral Replication

    PubMed Central

    Graham, Rachel L.; Sims, Amy C.; Brockway, Sarah M.; Baric, Ralph S.; Denison, Mark R.

    2005-01-01

    The positive-stranded RNA genome of the coronaviruses is translated from ORF1 to yield polyproteins that are proteolytically processed into intermediate and mature nonstructural proteins (nsps). Murine hepatitis virus (MHV) and severe acute respiratory syndrome coronavirus (SARS-CoV) polyproteins incorporate 16 protein domains (nsps), with nsp1 and nsp2 being the most variable among the coronaviruses and having no experimentally confirmed or predicted functions in replication. To determine if nsp2 is essential for viral replication, MHV and SARS-CoV genome RNA was generated with deletions of the nsp2 coding sequence (MHVΔnsp2 and SARSΔnsp2, respectively). Infectious MHVΔnsp2 and SARSΔnsp2 viruses recovered from electroporated cells had 0.5 to 1 log10 reductions in peak titers in single-cycle growth assays, as well as a reduction in viral RNA synthesis that was not specific for any positive-stranded RNA species. The Δnsp2 mutant viruses lacked expression of both nsp2 and an nsp2-nsp3 precursor, but cleaved the engineered chimeric nsp1-nsp3 cleavage site as efficiently as the native nsp1-nsp2 cleavage site. Replication complexes in MHVΔnsp2-infected cells lacked nsp2 but were morphologically indistinguishable from those of wild-type MHV by immunofluorescence. nsp2 expressed in cells by stable retroviral transduction was specifically recruited to viral replication complexes upon infection with MHVΔnsp2. These results demonstrate that while nsp2 of MHV and SARS-CoV is dispensable for viral replication in cell culture, deletion of the nsp2 coding sequence attenuates viral growth and RNA synthesis. These findings also provide a system for the study of determinants of nsp targeting and function. PMID:16227261

  16. The nsp2 replicase proteins of murine hepatitis virus and severe acute respiratory syndrome coronavirus are dispensable for viral replication.

    PubMed

    Graham, Rachel L; Sims, Amy C; Brockway, Sarah M; Baric, Ralph S; Denison, Mark R

    2005-11-01

    The positive-stranded RNA genome of the coronaviruses is translated from ORF1 to yield polyproteins that are proteolytically processed into intermediate and mature nonstructural proteins (nsps). Murine hepatitis virus (MHV) and severe acute respiratory syndrome coronavirus (SARS-CoV) polyproteins incorporate 16 protein domains (nsps), with nsp1 and nsp2 being the most variable among the coronaviruses and having no experimentally confirmed or predicted functions in replication. To determine if nsp2 is essential for viral replication, MHV and SARS-CoV genome RNA was generated with deletions of the nsp2 coding sequence (MHVDeltansp2 and SARSDeltansp2, respectively). Infectious MHVDeltansp2 and SARSDeltansp2 viruses recovered from electroporated cells had 0.5 to 1 log10 reductions in peak titers in single-cycle growth assays, as well as a reduction in viral RNA synthesis that was not specific for any positive-stranded RNA species. The Deltansp2 mutant viruses lacked expression of both nsp2 and an nsp2-nsp3 precursor, but cleaved the engineered chimeric nsp1-nsp3 cleavage site as efficiently as the native nsp1-nsp2 cleavage site. Replication complexes in MHVDeltansp2-infected cells lacked nsp2 but were morphologically indistinguishable from those of wild-type MHV by immunofluorescence. nsp2 expressed in cells by stable retroviral transduction was specifically recruited to viral replication complexes upon infection with MHVDeltansp2. These results demonstrate that while nsp2 of MHV and SARS-CoV is dispensable for viral replication in cell culture, deletion of the nsp2 coding sequence attenuates viral growth and RNA synthesis. These findings also provide a system for the study of determinants of nsp targeting and function. PMID:16227261

  17. Mast cells modulate acute ozone-induced inflammation of the murine lung

    SciTech Connect

    Kleeberger, S.R.; Seiden, J.E.; Levitt, R.C.; Zhang, L.Y. )

    1993-11-01

    We hypothesized that mast cells modulate lung inflammation that develops after acute ozone (O3) exposure. Two tests were done: (1) genetically mast-cell-deficient (WBB6F1-W/Wv, WCB6F1-SI/SId) and bone-marrow-transplanted W/Wv mice were exposed to O3 or filtered air, and the inflammatory responses were compared with those of mast-cell-sufficient congenic mice (WBB6F1-(+)/+, WCB6F1-(+)/+); (2) genetically O3-susceptible C57BL/6J mice were treated pharmacologically with putative mast-cell modulators or vehicle, and the O3-induced inflammatory responses were compared. Mice were exposed to 1.75 ppm O3 or air for 3 h, and lung inflammation was assessed by bronchoalveolar lavage (BAL) 6 and 24 h after exposure. Relative to O3-exposed W/Wv and SI/SId mice, the mean numbers of lavageable polymorphonuclear leukocytes (PMNs) and total BAL protein concentration (a marker of permeability) were significantly greater in the respective O3-exposed normal congenic +/+ mice (p < 0.05). Mast cells were reconstituted in W/Wv mice by transplantation of bone marrow cells from congenic +/+ mice, and O3-induced lung inflammation was assessed in the mast-cell-replete W/Wv mice. After O3 exposure, the changes in lavageable PMNs and total protein of mast-cell-replete W/Wv mice were not different from age-matched normal +/+ control mice, and they were significantly greater than those of sham-transplanted W/Wv mice (p < 0.05). Genetically susceptible C57BL/6J mice were pretreated with a mast-cell stabilizer (nedocromil sodium), secretagogue (compound 48/80), or vehicle, and the mice were exposed to O3.

  18. Upregulated Tim-3/galectin-9 expressions in acute lung injury in a murine malarial model.

    PubMed

    Liu, Jinfeng; Xiao, Siyu; Huang, Shiguang; Pei, Fuquan; Lu, Fangli

    2016-02-01

    Malaria is the most relevant parasitic disease worldwide, and severe malaria is characterized by cerebral edema, acute lung injury (ALI), and multiple organ dysfunctions; however, the mechanisms of lung damage need to be better clarified. In this study, we used Kunming outbred mice infected with Plasmodium berghei ANKA (PbANKA) to elucidate the profiles of T cell immunoglobulin and mucin domain-3 (Tim-3) and its ligand galecin-9 (Gal-9) in the development of ALI. Mice were injected intraperitoneally with 10(6) PbANKA-infected red blood cells. The lungs and mediastinal lymph nodes (MLNs) were harvested at days 5, 10, 15, and 20 post infections (p.i.). The grade of lung injury was histopathologically evaluated. Tim-3- and Gal-9-positive cells in the lungs and MLNs were stained by immunohistochemistry, and the messenger RNA (mRNA) expressions of Tim-3, Gal-9, and related cytokines were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Bronchoalveolar lavage fluid (BALF) analyses were performed from days 18 to 20 p.i. The results showed that the pathological severities in the lungs were increased with times and the total protein level in the BALFs was significantly elevated in PbANKA-infected mice. The numbers of Gal-9(+) and Tim-3(+) cells in the lungs were significantly increased, and the mRNA levels of both Gal-9 and Tim-3 in the lungs and MLNs were over-expressed in PbANKA-infected mice. In conclusion, our data suggested that Tim-3/Gal-9 may play a role in PbANKA-induced ALI. PMID:26494364

  19. Mechanisms of decreased intestinal epithelial proliferation and increased apoptosis in murine acute lung injury

    PubMed Central

    Husain, Kareem D.; Stromberg, Paul E.; Woolsey, Cheryl A.; Turnbull, Isaiah R.; Dunne, W. Michael; Javadi, Pardis; Buchman, Timothy G.; Karl, Irene E.; Hotchkiss, Richard S.; Coopersmith, Craig M.

    2005-01-01

    Objectives The aim of this study was to determine the effects of acute lung injury (ALI) on the gut epithelium and examine mechanisms underlying changes in crypt proliferation and apoptosis. The relationship between severity and timing of lung injury to intestinal pathology was also examined. Design Randomized, controlled study. Setting University research laboratory. Subjects Genetically inbred mice. Interventions Following induction of ALI, gut epithelial proliferation and apoptosis was assessed in a) C3H/HeN wild type and C3H/HeJ mice, that lack functional toll-like receptor 4 (TLR4, n=17), b) C57Bl/6 mice that received monoclonal anti-tumor necrosis factor-α (TNFα) or control antibody (n=22) and c) C57Bl/6 wild type and transgenic mice that overexpress Bcl-2 in their gut epithelium (n=21). Intestinal epithelial proliferation and death were also examined in animals with differing degrees of lung inflammation (n=24) as well as in a timecourse analysis following a fixed injury (n=18). Measurements and Main Results ALI caused decreased proliferation and increased apoptosis in crypt epithelial cells in all animals studied. C3H/HeJ mice had higher levels of proliferation than C3H/HeN animals without additional changes in apoptosis. Anti-TNFα antibody had no effect on gut epithelial proliferation or death. Overexpression of Bcl-2 did not change proliferation despite decreasing gut apoptosis. Proliferation and apoptosis were not correlated to severity of lung injury, as gut alterations were lost in mice with more severe ALI. Changes in both gut epithelial proliferation and death were apparent within 12 hours, but proliferation was decreased 36 hours following ALI while apoptosis returned to normal. Conclusions ALI causes disparate effects on crypt proliferation and apoptosis, which occur, at least in part, through differing mechanisms involving TLR4 and Bcl-2. Severity of lung injury does not correlate with perturbations in proliferation or death in the gut

  20. Cytomegalovirus Immunoglobulin After Thoracic Transplantation

    PubMed Central

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-01-01

    Abstract Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R−). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  1. Valvular Cytomegalovirus Endocarditis.

    PubMed

    Stear, Timothy J; Shersher, David; Kim, George J; Smego, Douglas R

    2016-08-01

    Endocarditis is a rare presentation for cytomegalovirus (CMV) infection. We present the case of a 49-year-old man who underwent mitral and tricuspid valve replacement for valvular CMV endocarditis. The patient's past medical history was significant for human immunodeficiency virus, intravenous drug abuse, and chronic hepatitis B. During his clinical course, he was found to have tricuspid and mitral valve vegetations. After progressive valvular destruction despite antibiotic therapy, he underwent successful mitral and tricuspid valve replacement. Pathologic analysis of the culture-negative valve specimens were found to contain inclusion bodies consistent with CMV, and quantitative serum polymerase chain reaction returned a highly elevated CMV DNA count. PMID:27449440

  2. Cytomegalovirus Primary Envelopment Occurs at Large Infoldings of the Inner Nuclear Membrane▿

    PubMed Central

    Buser, Christopher; Walther, Paul; Mertens, Thomas; Michel, Detlef

    2007-01-01

    We have investigated the morphogenesis of human and murine cytomegalovirus by transmission electron microscopy after high-pressure freezing, freeze substitution, and plastic embedding. We observed large tubular infoldings of the inner nuclear membrane that were free of lamina and active in primary envelopment and subsequent transport of capsids to the nuclear periphery. Semiquantitative determinations of the enlarged inner nuclear membrane area and the location of the primary envelopment of nucleocapsids demonstrated that this structure represents a virus-induced specialized membrane domain at which the particles are preferentially enveloped. This is a previously undescribed structural element relevant in cytomegalovirus morphogenesis. PMID:17192309

  3. Acute exercise preferentially redeploys NK-cells with a highly-differentiated phenotype and augments cytotoxicity against lymphoma and multiple myeloma target cells. Part II: impact of latent cytomegalovirus infection and catecholamine sensitivity.

    PubMed

    Bigley, Austin B; Rezvani, Katayoun; Pistillo, Mira; Reed, Justin; Agha, Nadia; Kunz, Hawley; O'Connor, Daniel P; Sekine, Takuya; Bollard, Catherine M; Simpson, Richard J

    2015-10-01

    We showed previously that acute exercise is associated with a preferential redeployment of highly-differentiated NK-cells and increased cytotoxicity against HLA-expressing tumor cell lines during exercise recovery. In this part II study, we retrospectively analyzed these findings in the context of latent cytomegalovirus (CMV) infection and performed additional experiments to explore potential mechanisms underpinning the marked reduction in NK-cell redeployment with exercise in CMV-seropositive individuals. We show here that latent CMV infection impairs NK-cell mobilization with exercise, only when the intensity of the exercise bout exceeds the individual blood lactate threshold (BLT). This impaired mobilization is associated with increased proportions of poorly exercise-responsive NK-cell subsets (NKG2C+/KIR-, NKG2C+/NKG2A-, and NKG2C+/CD57+) and decreased NK-cell β(2)-adrenergic receptor (AR) expression in those with CMV. As a result, NK-cell production of cyclic AMP (cAMP) in response to in vitro isoproterenol (synthetic β-agonist) stimulation was drastically lower in those with CMV (6.0 vs. 20.3pmol/mL, p<0.001) and correlated highly with the proportion of NKG2C+/CD57+ NK-cells (R(2)=0.97). Moreover, NK-cell cytotoxic activity (NKCA) against the K562 (36.6% vs. 22.7%, p<0.05), U266 (23.6% vs. 15.9%, p<0.05), and 221.AEH (41.3% vs. 13.3%, p<0.001) cell lines was increased at baseline in those infected with CMV; however, latent CMV infection abated the post-exercise increase in NKCA as a result of decreased NK-cell mobilization. Additionally, NKCA per cell against the U266 (0.24 vs. 0.12, p<0.01), RPMI-8226 (0.17 vs. 0.11, p<0.05), and 221.AEH (0.18 vs. 0.11, p<0.05) cell lines was increased 1h post-exercise (relative to baseline) in CMV-seronegative subjects, but not in those infected with CMV. Collectively, these data indicate that latent CMV infection may compromise NK-cell mediated immunosurveillance after acute exercise due to an increased proportion of

  4. Cytomegalovirus as nosocomial infection.

    PubMed

    Román González, J; Colón, M; Ramírez-Ronda, C H

    1991-08-01

    Nosocomial infections with cytomegalovirus are an area of great concern and controversy within the medical community. With the advent of organ transplantation there have been an increased number of susceptible individuals. In the past most cases were confined to newborn nurseries and the neonatal intensive care unit. It is of great interest that recent evidence suggests that health care providers are at no greater risk of acquiring CMV infection inside the hospital setting when compared to a representative control group within the same community. This paper will review some of the literature that deals with the nosocomial transmission of CMV. We will try to emphasize transmission, diagnosis, prevention, and treatment of CMV infection. PMID:1667848

  5. The triterpenoid CDDO-Me delays murine acute graft-versus-host disease with the preservation of graft-versus-tumor effects after allogeneic bone marrow transplantation

    PubMed Central

    Li, Minghui; Sun, Kai; Redelman, Doug; Welniak, Lisbeth A.; Murphy, William J.

    2010-01-01

    The occurrence of acute graft-versus-host disease (GVHD) and tumor relapse represent the two major obstacles impeding the efficacy of allogeneic bone marrow transplantation (BMT) in cancer. We have previously shown that the synthetic triterpenoid CDDO can inhibit murine early acute GVHD but anti-tumor effects were not assessed. In the current study, we found that a new derivative of CDDO, CDDO-Me, had an increased ability to inhibit allogeneic T cell responses and induce cell death of alloreactive T cells in vitro. Administration of CDDO-Me to mice following allogeneic BMT resulted in significant and increased protection from acute lethal GVHD compared to CDDO. This correlated with reduced TNF-α production, reduced donor T cell proliferation and decreased adhesion molecule (α4β7 integrin) expression on the donor T cells. CDDO-Me was also superior to CDDO in inhibiting leukemia growth in vitro. When CDDO-Me was administered following an allogeneic BMT to leukemia-bearing mice, significant increases in survival were observed. These findings suggest that CDDO-Me is superior to CDDO in delaying acute GVHD while preserving or possibly even augmenting GVT effects. PMID:20338256

  6. Expansion of a unique CD57⁺NKG2Chi natural killer cell subset during acute human cytomegalovirus infection.

    PubMed

    Lopez-Vergès, Sandra; Milush, Jeffrey M; Schwartz, Brian S; Pando, Marcelo J; Jarjoura, Jessica; York, Vanessa A; Houchins, Jeffrey P; Miller, Steve; Kang, Sang-Mo; Norris, Phillip J; Nixon, Douglas F; Lanier, Lewis L

    2011-09-01

    During human CMV infection, there is a preferential expansion of natural killer (NK) cells expressing the activating CD94-NKG2C receptor complex, implicating this receptor in the recognition of CMV-infected cells. We hypothesized that NK cells expanded in response to pathogens will be marked by expression of CD57, a carbohydrate antigen expressed on highly mature cells within the CD56(dim)CD16(+) NK cell compartment. Here we demonstrate the preferential expansion of a unique subset of NK cells coexpressing the activating CD94-NKG2C receptor and CD57 in CMV(+) donors. These CD57(+)NKG2C(hi) NK cells degranulated in response to stimulation through their NKG2C receptor. Furthermore, CD57(+)NKG2C(hi) NK cells preferentially lack expression of the inhibitory NKG2A receptor and the inhibitory KIR3DL1 receptor in individuals expressing its HLA-Bw4 ligand. Moreover, in solid-organ transplant recipients with active CMV infection, the percentage of CD57(+)NKG2C(hi) NK cells in the total NK cell population preferentially increased. During acute CMV infection, the NKG2C(+) NK cells proliferated, became NKG2C(hi), and finally acquired CD57. Thus, we propose that CD57 might provide a marker of "memory" NK cells that have been expanded in response to infection. PMID:21825173

  7. Effects of bone marrow mesenchymal stem cells on hematopoietic recovery and acute graft-versus-host disease in murine allogeneic umbilical cord blood transplantation model.

    PubMed

    Li, Zhen Yu; Wang, Chun Qing; Lu, Guang; Pan, Xiu Ying; Xu, Kai Lin

    2014-09-01

    To investigate the effect of bone marrow mesenchymal stem cells (MSC) on hematopoietic recovery and acute graft-versus-host disease (GVHD) in a murine allogeneic umbilical cord blood transplantation (allo-UCBT) model. MSCs were obtained from C57/BL mouse bone marrow. The MSC phenotypes were identified by flow cytometry (FCM), and their ability to differentiate into osteoblasts and adipocytes was tested. Once murine allo-UCBT and aGVHD models were established, mice were divided into five groups: (1) total body irradiation (TBI) group, each mouse receiving 0.3 ml sterile saline infusion after TBI and used as control; (2) UCB group, receiving 2 × 10(6) umbilical cord blood mononuclear cells (UCB-MNC) after TBI; (3) UCB+MSC group, receiving 2 × 10(6) UCB-MNC and 2 × 10(7) MSC after TBI; (4) UCB+SC group, receiving 2 × 10(6) UCB-MNC and 2 × 10(6) spleen cells after TBI; and (5) UCB+SC+MSC group, receiving 2 × 10(6) UCB-MNC, 2 × 10(7) MSC and 2 × 10(6) spleen cells after TBI. To evaluate the engraftment of HSC, the white blood cells, red blood cells, and platelets counts were tested at different time points after transplantation, and the ratio of chimerism was identified by FCM. The acute GVHD clinical scores, recipient mice survival, and the histopathological analyses were used to evaluate the effect of MSC on acute GVHD. MSCs were successfully obtained in vitro and FCM analysis showed that these cells are highly positive for CD90.2, CD44, and negative for CD34, CD45, and they are capable to differentiate into osteoblasts and adipocytes after being induced. Compared to UCB group, the UCB+MSC mice had shorter duration of myelosuppression and higher percentage of donor-derived cells which was up to 22.87 ± 4.3 % and the white blood cell (WBC), red blood cell (RBC), and platelet counts started to increase by day 6 after transplantation. Moreover, the average survival time for UCB+MSC mice was 25.0 ± 10.55 days, while for the UCB group it was 15.5 ± 12.50 days

  8. The effects of age and latent cytomegalovirus infection on the redeployment of CD8+ T cell subsets in response to acute exercise in humans.

    PubMed

    Spielmann, Guillaume; Bollard, Catherine M; Bigley, Austin B; Hanley, Patrick J; Blaney, James W; LaVoy, Emily C P; Pircher, Hanspeter; Simpson, Richard J

    2014-07-01

    Dynamic exercise evokes a rapid redeployment of cytotoxic T cell subsets with high expression of β2 adrenergic receptors, presumably to enhance immunosurveillance during acute stress. As this response is affected by age and infection history, this study examined latent CMV infection as a potential confounder to age-related differences in blood CD8+ T-cell responses to exercise. Healthy young (n=16) and older (n=16) humans counterbalanced by CMV IgG serostatus (positive or negative) exercised for 30-min at ∼80% peak cycling power. Those with CMV redeployed ∼2-times more CD8+ T-cells and ∼6-times more KLRG1+/CD28- and CD45RA+/CCR7- CD8+ subsets than non-infected exercisers. Seronegative older exercisers had an impaired redeployment of total CD8+ T-cells, CD45RA+/CCR7+ and KLRG1-/CD28+ CD8+ subsets compared to young. Redeployed CD8+ T-cell numbers were similar between infected young and old. CMVpp65 specific CD8+ cells in HLA/A2(∗) subjects increased ∼2.7-fold after exercise, a response that was driven by the KLRG1+/CD28-/CD8+ subset. Stimulating PBMCs before and after exercise with CMVpp65 and CMV IE-1 antigens and overlapping peptide pools revealed a 2.1 and 4.4-fold increases in CMVpp65 and CMV IE-1 IFN-γ secreting cells respectively. The breadth of the T cell response was maintained after exercise with the magnitude of the response being amplified across the entire epitope repertoire. To conclude, latent CMV infection overrides age-related impairments in CD8+ T-cell redeployment with exercise. We also show for the first time that many T-cells redeployed with exercise are specific to CMVpp65 and CMV IE-1 antigens, have broad epitope specificity, and are mostly of a high-differentiated effector memory phenotype. PMID:23684819

  9. A LAT-associated function reduces productive-cycle gene expression during acute infection of murine sensory neurons with herpes simplex virus type 1.

    PubMed Central

    Garber, D A; Schaffer, P A; Knipe, D M

    1997-01-01

    Herpes simplex virus (HSV) persists in the human population by establishing long-term latent infections followed by periodic reactivation and transmission. Latent infection of sensory neurons is characterized by repression of viral productive-cycle gene expression, with abundant transcription limited to a single locus that encodes the latency-associated transcripts (LATs). We have observed that LAT- deletion mutant viruses express viral productive-cycle genes in greater numbers of murine trigeminal ganglion neurons than LAT+ HSV type 1 at early times during acute infection but show reduced reactivation from latent infection. Thus, a viral function associated with the LAT region exerts an effect at an early stage of neuronal infection to reduce productive-cycle viral gene expression. These results provide the first evidence that the virus plays an active role in down-regulating productive infection during acute infection of sensory neurons. The effect of down-regulation of productive-cycle gene expression during acute infection may contribute to viral evasion from the host immune responses and to reduced cytopathic effects, thereby facilitating neuronal survival and the establishment of latency. PMID:9223478

  10. [Cytomegalovirus mononucleosis complicated with peripheral facial palsy].

    PubMed

    Hirano, Taichi; Tsuji, Takahiro; Yamasaki, Hiroshi; Tsuda, Hiroyuki

    2014-03-01

    A 36-year-old woman was admitted to our hospital for further examination of an acute febrile illness with liver dysfunction. A peripheral blood smear displayed atypical lymphocytes. Cytomegalovirus (CMV) mononucleosis was diagnosed based on the detection of CMV-specific IgM and conventional CMV pp65 antigen. The physical examination on admission revealed signs of lower motor neuron right facial palsy. There were no significant cerebrospinal fluid findings, nor were there other neurological abnormalities. After receiving a short-course of oral corticosteroids, the patient gradually recovered from the facial paralysis. A one-month follow-up examination indicated that she had fully recovered neurologically, showing disappearance of CMV-DNA and a significant increase in the anti-CMV IgG titer. To our knowledge, there has been only one previous report describing CMV as the cause of an isolated facial palsy combined with CMV mononucleosis. PMID:24681941

  11. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure.

    PubMed

    King, L M; Anderson, M B; Sikka, S C; George, W J

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 micromol/kg CdCl2). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 micromol/kg ZnAc), given 24 h prior to 20 micromol/kg CdCl2 administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  12. Trametes versicolor Protein YZP Activates Regulatory B Lymphocytes – Gene Identification through De Novo Assembly and Function Analysis in a Murine Acute Colitis Model

    PubMed Central

    Kuan, Yen-Chou; Wu, Ying-Jou; Hung, Chih-Liang; Sheu, Fuu

    2013-01-01

    Background Trametes versicolor (Yun-Zhi) is a medicinal fungus used as a chemotherapy co-treatment to enhance anti-tumor immunity. Although the efficacies of T. versicolor extracts have been documented, the active ingredients and mechanisms underlying the actions of these extracts remain uncharacterized. Results We purified a new protein, YZP, from the fruiting bodies of T. versicolor and identified the gene encoding YZP using RNA-seq and de novo assembly technologies. YZP is a 12-kDa non-glycosylated protein comprising 139 amino acids, including an 18-amino acids signal peptide. YZP induced a greater than 60-fold increase in IL-10 secretion in mice B lymphocytes; moreover, YZP specifically triggered the differentiation of CD1d+ B cells into IL-10-producing regulatory B cells (Bregs) and enhanced the expression of CD1d. YZP-induced B cells suppressed approximately 40% of the LPS-activated macrophage production of inflammatory cytokines in a mixed leukocyte reaction and significantly alleviated the disease activity and colonic inflammation in a DSS-induced acute colitis murine model. Furthermore, YZP activated Breg function via interaction with TLR2 and TLR4 and up-regulation of the TLR-mediated signaling pathway. Conclusions We purified a novel Breg-stimulating protein, YZP, from T. versicolor and developed an advanced approach combining RNA-seq and de novo assembly technologies.to clone its gene. We demonstrated that YZP activated CD1d+ Breg differentiation through TLR2/4-mediated signaling pathway, and the YZP-stimulated B cells exhibited anti-inflammatory efficacies in vitro and in murine acute colitis models. PMID:24019869

  13. A Case of Primary HIV Type 1 and Cytomegalovirus Coinfection Presenting with Widespread Clinical Disease

    PubMed Central

    Kim, Joseph Y.; Singer, Elyse J.; Bonelli, Laura; Klausner, Jeffrey D.

    2015-01-01

    Coinfection of HIV-1 and cytomegalovirus (CMV) may occur given the shared routes of transmission, and the clinical presentations of each process overlap. We present a case of acute HIV-1 and CMV coinfection presenting with an acute febrile illness complicated by meningitis, hepatitis, and retinopathy. This and other similar cases demonstrate the need to consider CMV coin-fection in acute HIV-1 disease, particularly in situations with significant end-organ damage. PMID:24476962

  14. Uveitic angle closure glaucoma in a patient with inactive cytomegalovirus retinitis and immune recovery uveitis.

    PubMed

    Goldberg, Daniel E; Freeman, William R

    2002-01-01

    We report a case of uveitic acute angle closure glaucoma in a patient with acquired immunodeficiency syndrome (AIDS) associated with inactive cytomegalovirus retinitis and immune recovery vitritis. We conducted a long-term, follow-up examination of a 47-year-old male with AIDS and inactive cytomegalovirus retinitis caused by immune recovery on highly active antiretroviral therapy (HAART). We found vitritis and ultimate development of uveitic glaucoma in the postoperative periods following repair of retinal detachment and extracapsular cataract extraction with intraocular lens implant. An episode of acute angle closure secondary to posterior synechiae and iris bombé subsequently developed, requiring peripheral laser iridotomy. Immune recovery in the setting of inactive cytomegalovirus retinitis can result in intraocular inflammation severe enough to cause angle closure glaucoma and profound ocular morbidity. PMID:12358297

  15. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation

    PubMed Central

    Cloarec, Robin; Bauer, Sylvian; Luche, Hervé; Buhler, Emmanuelle; Pallesi-Pocachard, Emilie; Salmi, Manal; Courtens, Sandra; Massacrier, Annick; Grenot, Pierre; Teissier, Natacha; Watrin, Françoise; Schaller, Fabienne; Adle-Biassette, Homa; Gressens, Pierre; Malissen, Marie; Stamminger, Thomas; Streblow, Daniel N.; Bruneau, Nadine; Szepetowski, Pierre

    2016-01-01

    Background Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells. Objectives and Methods In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15) and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments. Results Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b– lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1. Conclusion In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which

  16. Cytomegalovirus infection: an Indian perspective.

    PubMed

    Chakravarti, A; Kashyap, B; Matlani, M

    2009-01-01

    Human cytomegalovirus (CMV) poses an important public health problem as it may cause serious morbidity and mortality in congenitally infected newborns and immunocompromised patients, most notably transplant recipients and HIV-infected persons. It is probably one of the most common infections known to humans and is characterized by a self-limiting infection in healthy individuals. CMV infection is the single most frequent cause of infectious complications in the early period following kidney transplantation Post-transfusion cytomegalovirus infection is of concern in the immunocompetent as well as in certain categories of immunocompromised individuals such as neonates, pregnant women, recipients of bone marrow and other organ transplants and individuals with immunodeficiency disorders. The emergence of AIDS in India has necessitated the establishment of reliable tests for diagnosis of cytomegalovirus infection as a damaged immune system permits cytomegalovirus reactivation. The magnitude of this problem in India and the various diagnostic modalities used have not been adequately investigated and, hence, CMV infection is still a major health problem warranting strong preventive measures. The ultimate goal of the prevention program is to develop a vaccine that can be administered to seronegative women of childbearing age to prevent primary infection during pregnancy. PMID:19172051

  17. Macrophages and galectin 3 play critical roles in CVB3-induced murine acute myocarditis and chronic fibrosis.

    PubMed

    Jaquenod De Giusti, Carolina; Ure, Agustín E; Rivadeneyra, Leonardo; Schattner, Mirta; Gomez, Ricardo M

    2015-08-01

    Macrophage influx and galectin 3 production have been suggested as major players driving acute inflammation and chronic fibrosis in many diseases. However, their involvement in the pathogenesis of viral myocarditis and subsequent cardiomyopathy are unknown. Our aim was to characterise the role of macrophages and galectin 3 on survival, clinical course, viral burden, acute pathology, and chronic fibrosis in coxsackievirus B3 (CVB3)-induced myocarditis. Our results showed that C3H/HeJ mice infected with CVB3 and depleted of macrophages by liposome-encapsulated clodronate treatment compared with infected untreated mice presented higher viral titres but reduced acute myocarditis and chronic fibrosis, compared with untreated infected mice. Increased galectin 3 transcriptional and translational expression levels correlated with CVB3 infection in macrophages and in non-depleted mice. Disruption of the galectin 3 gene did not affect viral titres but reduced acute myocarditis and chronic fibrosis compared with C57BL/6J wild-type mice. Similar results were observed after pharmacological inhibition of galectin 3 with N-acetyl-d-lactosamine in C3H/HeJ mice. Our results showed a critical role of macrophages and their galectin 3 in controlling acute viral-induced cardiac injury and the subsequent fibrosis. Moreover, the fact that pharmacological inhibition of galectin 3 induced similar results to macrophage depletion regarding the degree of acute cardiac inflammation and chronic fibrosis opens up the possibility of new pharmacological strategies for viral myocarditis. PMID:26002282

  18. Cytomegalovirus infection in transplant recipients.

    PubMed

    Azevedo, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Caiaffa Filho, Helio Hehl; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; Santos, Vera Aparecida dos; Linardi, Camila da Cruz Gouveia; Yasuda, Maria Aparecida Shikanai; Marques, Heloisa Helena de Sousa

    2015-07-01

    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  19. Cytomegalovirus infection in transplant recipients

    PubMed Central

    Azevedo*, Luiz Sergio; Pierrotti, Lígia Camera; Abdala, Edson; Costa, Silvia Figueiredo; Strabelli, Tânia Mara Varejão; Campos, Silvia Vidal; Ramos, Jéssica Fernandes; Latif, Acram Zahredine Abdul; Litvinov, Nadia; Maluf, Natalya Zaidan; Filho, Helio Hehl Caiaffa; Pannuti, Claudio Sergio; Lopes, Marta Heloisa; dos Santos, Vera Aparecida; da Cruz Gouveia Linardi, Camila; Yasuda, Maria Aparecida Shikanai; de Sousa Marques, Heloisa Helena

    2015-01-01

    Cytomegalovirus infection is a frequent complication after transplantation. This infection occurs due to transmission from the transplanted organ, due to reactivation of latent infection, or after a primary infection in seronegative patients and can be defined as follows: latent infection, active infection, viral syndrome or invasive disease. This condition occurs mainly between 30 and 90 days after transplantation. In hematopoietic stem cell transplantation in particular, infection usually occurs within the first 30 days after transplantation and in the presence of graft-versus-host disease. The major risk factors are when the recipient is cytomegalovirus seronegative and the donor is seropositive as well as when lymphocyte-depleting antibodies are used. There are two methods for the diagnosis of cytomegalovirus infection: the pp65 antigenemia assay and polymerase chain reaction. Serology has no value for the diagnosis of active disease, whereas histology of the affected tissue and bronchoalveolar lavage analysis are useful in the diagnosis of invasive disease. Cytomegalovirus disease can be prevented by prophylaxis (the administration of antiviral drugs to all or to a subgroup of patients who are at higher risk of viral replication) or by preemptive therapy (the early diagnosis of viral replication before development of the disease and prescription of antiviral treatment to prevent the appearance of clinical disease). The drug used is intravenous or oral ganciclovir; oral valganciclovir; or, less frequently, valacyclovir. Prophylaxis should continue for 90 to 180 days. Treatment is always indicated in cytomegalovirus disease, and the gold-standard drug is intravenous ganciclovir. Treatment should be given for 2 to 3 weeks and should be continued for an additional 7 days after the first negative result for viremia. PMID:26222822

  20. Evolutive leukoencephalopathy in congenital cytomegalovirus infection.

    PubMed

    Krakar, Goran; Đaković, Ivana; Delin, Sanja; Bošnjak, Vlatka Mejaški

    2015-01-01

    Congenital cytomegalovirus infection is the most common infectious cause of congenital brain injury. Type and severity of congenital cytomegalovirus infection-related brain abnormalities depend on the developmental stage of the central nervous system at the time of fetal infection. The aim of this study was to follow the course of leukoencephalopathy in a patient with congenital cytomegalovirus infection. We describe brain magnetic resonance imaging (MRI) findings of a boy with symptomatic congenital cytomegalovirus infection performed at the age of 3 weeks, 13 months, and 4 and 7 years. Neonatal brain MRI showed most of characteristic findings in congenital cytomegalovirus infection with most prominent white matter abnormalities and cortical dysplasia. MRI follow-up images showed that cortical dysgenesis remained unchanged and static, whereas white matter abnormalities evolved over the years. We propose that leukoencephalopathy in congenital cytomegalovirus infection is not only nonprogressive or static but even evolutive and suggests both underlying disruption and delay of myelination. PMID:24453153

  1. Efficacy of species-specific protein antibiotics in a murine model of acute Pseudomonas aeruginosa lung infection

    PubMed Central

    McCaughey, Laura C.; Ritchie, Neil. D.; Douce, Gillian R.; Evans, Thomas J.; Walker, Daniel

    2016-01-01

    Protein antibiotics, known as bacteriocins, are widely produced by bacteria for intraspecies competition. The potency and targeted action of bacteriocins suggests that they could be developed into clinically useful antibiotics against highly drug resistant Gram-negative pathogens for which there are few therapeutic options. Here we show that Pseudomonas aeruginosa specific bacteriocins, known as pyocins, show strong efficacy in a murine model of P. aeruginosa lung infection, with the concentration of pyocin S5 required to afford protection from a lethal infection at least 100-fold lower than the most commonly used inhaled antibiotic tobramycin. Additionally, pyocins are stable in the lung, poorly immunogenic at high concentrations and efficacy is maintained in the presence of pyocin specific antibodies after repeated pyocin administration. Bacteriocin encoding genes are frequently found in microbial genomes and could therefore offer a ready supply of highly targeted and potent antibiotics active against problematic Gram-negative pathogens. PMID:27444885

  2. Cytomegalovirus Infection in Ireland

    PubMed Central

    Hassan, Jaythoon; O’Neill, Derek; Honari, Bahman; De Gascun, Cillian; Connell, Jeff; Keogan, Mary; Hickey, David

    2016-01-01

    Abstract Cytomegalovirus (CMV) infections occur worldwide and primary infection usually occurs in early childhood and is often asymptomatic whereas primary infection in adults may result in symptomatic illness. CMV establishes a chronic latent infection with intermittent periods of reactivation. Primary infection or reactivation associate with increased mortality and morbidity in those who are immunocompromised. Transplacental transmission may result in significant birth defects or long-term sensorineural hearing loss. We performed a study to determine the CMV seroprevalence and the association between HLA Class I alleles and frequency of CMV infection in Ireland. The presence of CMV IgG, a marker of previous CMV infection, was determined for a cohort of 1849 HLA typed solid organ transplant donors between 1990 and 2013. The presence of CMV IgG was correlated with HLA type. The CMV seroprevalence in solid organ transplant donors was 33.4% (range 22–48% per annum) over the time period 1990 to 2013. Multivariate logistic regression analysis showed that both age and HLA alleles were associated with CMV seropositivity. A significant and positive relationship between age and CMV seropositivity was observed (OR = 1.013, P < 0.001, CI [1.007, 1.019]). Chi-square analysis revealed that the female gender was independently associated with CMV seropositivity (P < 0.01). Seroprevalence in women of reproductive age (20–39 years) was significantly higher than men of the same age (37% vs 26%, P < 0.01). The frequencies of HLA-A1, HLA-A2, and HLA-A3 in our cohort were 40.8%, 48.8%, and 25.9%, respectively. Logistic regression analysis showed that the presence of HLA-A1 but not HLA-A2 or HLA-A3 was independently associated with CMV seronegativity (P < 0.01). Interestingly, individuals who co-expressed HLA-A2 and HLA-A3 alleles were significantly more likely to be CMV seropositive (P < 0.02). The frequencies of HLA-B5, HLA-B7, and HLA-B8 in our cohort

  3. Preventive Effects of Escherichia coli Strain Nissle 1917 on Acute and Chronic Intestinal Inflammation in Two Different Murine Models of Colitis

    PubMed Central

    Schultz, Michael; Strauch, Ulrike G.; Linde, Hans-Jörg; Watzl, Sonja; Obermeier, Florian; Göttl, Claudia; Dunger, Nadja; Grunwald, Nicole; Schölmerich, Jürgen; Rath, Heiko C.

    2004-01-01

    Escherichia coli strain Nissle 1917 (EcN) is as effective in maintaining remission in ulcerative colitis as is treatment with mesalazine. This study aims to evaluate murine models of acute and chronic intestinal inflammation to study the antiinflammatory effect of EcN in vivo. Acute colitis was induced in mice with 2% dextran-sodium sulfate (DSS) in drinking water. EcN was administered from day −2 to day +7. Chronic colitis was induced by transfer of CD4+ CD62L+ T lymphocytes from BALB/c mice in SCID mice. EcN was administered three times/week from week 1 to week 8 after cell transfer. Mesenteric lymph node (MLN) cytokine secretion (of gamma interferon [IFN-γ], interleukin 5 [IL-5], IL-6, and IL-10) was measured by enzyme-linked immunosorbent assay. Histologic sections of the colon were analyzed by using a score system ranging from 0 to 4. Intestinal contents and homogenized MLN were cultured, and the number of E. coli-like colonies was determined. EcN was identified by repetitive extragenic palindromic (REP) PCR. EcN administration to DSS-treated mice reduced the secretion of proinflammatory cytokines (IFN-γ, 32,477 ± 6,377 versus 9,734 ± 1,717 [P = 0.004]; IL-6, 231 ± 35 versus 121 ± 17 [P = 0.02]) but had no effect on the mucosal inflammation. In the chronic experimental colitis of the transfer model, EcN ameliorated the intestinal inflammation (histology score, 2.7 ± 0.2 versus 1.9 ± 0.3 [P = 0.02]) and reduced the secretion of proinflammatory cytokines. Translocation of EcN and resident E. coli into MLN was observed in the chronic colitis model but not in healthy controls. Administration of EcN ameliorated acute and chronic experimental colitis by modifying proinflammatory cytokine secretion but had no influence on the acute DSS-induced colitis. In this model, preexisting colitis was necessary for translocation of EcN and resident E. coli into MLN. PMID:15013990

  4. Oxidative stress and acute changes in murine brain tissues after nasal instillation of copper particles with different sizes.

    PubMed

    Liu, Yang; Gao, Yuxi; Liu, Ying; Li, Bai; Chen, Chunying; Wu, Gang

    2014-06-01

    We aim to investigate the biological effects of copper particles on the murine brain and their underlying mechanism after nasal instillation of copper particles. We choose different sizes and different concentrations of copper nanoparticles for mice intranasal use. Within one week, the mice were sacrificed. Pathological lesions of glial cells were detected by immunohistochemical assay. Immunohistochemical assay reveals that glial fibrillary acidic protein (GFAP) increased significantly in all experimental groups, especially in nanocopper groups. The ultrastructure of nerve cells was observed through TEM, whose results show that there were chromatin congregation and mitochondria shrinkage in the olfactory cells, and that there was increase of endoplasmic reticulum and disassociation of endoplasmic reticulum ribosomes in hippocampus, particularly in the nanocopper-groups. Oxidative stress indexes were determined with colorimetric methods. There was no significant increase in the antioxidative enzymes (GPX, GST, SOD) in brain tissues; however, significant increase of malondiadehyde (MDA) contents was only found in the Cu nanoparticle-exposed mice at the high dose of 40 mg per kg body weight. Based on the investigation into the biological effects of copper nanoparticles (23.5 nm) after intranasal instillation to the mice, we have found that copper particles can indeed enter into the olfactory bulb and then the deeper brain. The inhalation of high dose copper nanoparticles can induce severer lesions of brain in the experimental mice. The underlying mechanism of copper nanoparticles causing severe brain damage bears little connection with oxidative stress. PMID:24738425

  5. Efficacy of JAK/STAT pathway inhibition in murine xenograft models of early T-cell precursor (ETP) acute lymphoblastic leukemia

    PubMed Central

    Maude, Shannon L.; Dolai, Sibasish; Delgado-Martin, Cristina; Vincent, Tiffaney; Robbins, Alissa; Selvanathan, Arthavan; Ryan, Theresa; Hall, Junior; Wood, Andrew C.; Tasian, Sarah K.; Hunger, Stephen P.; Loh, Mignon L.; Mullighan, Charles G.; Wood, Brent L.; Hermiston, Michelle L.; Grupp, Stephan A.; Lock, Richard B.

    2015-01-01

    Early T-cell precursor (ETP) acute lymphoblastic leukemia (ALL) is a recently described subtype of T-ALL characterized by a unique immunophenotype and genomic profile, as well as a high rate of induction failure. Frequent mutations in cytokine receptor and Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathways led us to hypothesize that ETP-ALL is dependent on JAK/STAT signaling. Here we demonstrate aberrant activation of the JAK/STAT pathway in ETP-ALL blasts relative to non-ETP T-ALL. Moreover, ETP-ALL showed hyperactivation of STAT5 in response to interleukin-7, an effect that was abrogated by the JAK1/2 inhibitor ruxolitinib. In vivo, ruxolitinib displayed activity in 6 of 6 patient-derived murine xenograft models of ETP-ALL, with profound single-agent efficacy in 5 models. Ruxolitinib treatment decreased peripheral blast counts relative to pretreatment levels and compared with control (P < .01) in 5 of 6 ETP-ALL xenografts, with marked reduction in mean splenic blast counts (P < .01) in 6 of 6 samples. Surprisingly, both JAK/STAT pathway activation and ruxolitinib efficacy were independent of the presence of JAK/STAT pathway mutations, raising the possibility that the therapeutic potential of ruxolitinib in ETP-ALL extends beyond those cases with JAK mutations. These findings establish the preclinical in vivo efficacy of ruxolitinib in ETP-ALL, a biologically distinct subtype for which novel therapies are needed. PMID:25645356

  6. Cytomegalovirus infection in renal transplantation: clinical aspects, management and the perspectives

    PubMed Central

    Requião-Moura, Lúcio Roberto; de Matos, Ana Cristina Carvalho; Pacheco-Silva, Alvaro

    2015-01-01

    Cytomegalovirus infection is one of most frequent infectious complications after renal transplantation, and can be classified as primo-infection, when the transmission occurs through the graft, or reactivation, when the recipient is cytomegalovirus seropositive. After transplantation, cytomegalovirus can appear as an infection, when the patient presents with evidence of viral replication without symptoms or disease, which has two clinical spectra: typical viral syndrome or invasive disease, which is a less common form. Their effects can be classified as direct, while the disease is developed, or indirect, with an increase of acute rejection and chronic allograft dysfunction risks. Diagnosis must be made based on viremia by one of the standardized methods: antigenemia or PCR, which is more sensitive. The risk factors related to infection after transplantation are the serologic matching (positive donor and negative recipient) and anti-lymphocyte antibody drugs. One of the strategies to reduce risk of disease should be chosen for patients at high risk: preemptive treatment or universal prophylaxis. Recent clinical research has described ganciclovir resistance as an emergent problem in management of cytomegalovirus infection. Two types of mutation that cause resistance were described: UL97 (most frequent) and UL54. Today, sophisticated methods of immunologic monitoring to detect specific T-cell clones against cytomegalovirus are used in clinical practice to improve the management of high-risk patients after renal transplantation. PMID:25993081

  7. Macrophage migration inhibitory factor drives neutrophil accumulation by facilitating IL-1β production in a murine model of acute gout.

    PubMed

    Galvão, Izabela; Dias, Ana Carolina Fialho; Tavares, Livia Duarte; Rodrigues, Irla Paula Stopa; Queiroz-Junior, Celso Martins; Costa, Vivian Vasconcelos; Reis, Alesandra Corte; Ribeiro Oliveira, Rene Donizeti; Louzada-Junior, Paulo; Souza, Daniele Glória; Leng, Lin; Bucala, Richard; Sousa, Lirlândia Pires; Bozza, Marcelo Torres; Teixeira, Mauro Martins; Amaral, Flávio Almeida

    2016-06-01

    This study evaluated the role of macrophage migration inhibitory factor in inflammation caused by monosodium urate crystals. The concentration of macrophage migration inhibitory factor was increased in synovial fluid of patients with acute gout, and there was a positive correlation between intra-articular macrophage migration inhibitory factor and IL-1β concentrations. In mice, the injection of monosodium urate crystals into the knee joint increased the levels of macrophage migration inhibitory factor in macrophages and in inflamed tissue. The injection of recombinant macrophage migration inhibitory factor into the joint of mice reproduced the inflammatory response observed in acute gout, including histologic changes, the recruitment of neutrophils, and increased levels of IL-1β and CXCL1. Importantly, the accumulation of neutrophils and the amount IL-1β in the joints were reduced in macrophage migration inhibitory factor-deficient mice when injected with monosodium urate crystals. We observed a similar effect when we blocked macrophage migration inhibitory factor with (S,R)-3-(4-hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid or anti-macrophage migration inhibitory factor. In addition, the blockade of IL-1R and CXCR2 reduced recombinant macrophage migration inhibitory factor-induced neutrophil recruitment. Mechanistically, recombinant macrophage migration inhibitory factor is important for the synthesis of il1β mRNA in vivo and in isolated macrophages. Altogether, macrophage migration inhibitory factor promotes neutrophil accumulation and is important for IL-1β production, which are 2 crucial events contributing to the pathogenesis of acute gout. PMID:26868525

  8. Acute desipramine restores presynaptic cortical defects in murine experimental autoimmune encephalomyelitis by suppressing central CCL5 overproduction

    PubMed Central

    Di Prisco, Silvia; Merega, Elisa; Lanfranco, Massimiliano; Casazza, Simona; Uccelli, Antonio; Pittaluga, Anna

    2014-01-01

    Background and Purpose Altered glutamate exocytosis and cAMP production in cortical terminals of experimental autoimmune encephalomyelitis (EAE) mice occur at the early stage of disease (13 days post-immunization, d.p.i.). Neuronal defects were paralleled by overexpression of the central chemokine CCL5 (also known as RANTES), suggesting it has a role in presynaptic impairments. We propose that drugs able to restore CCL5 content to physiological levels could also restore presynaptic defects. Because of its efficacy in controlling CCL5 overexpression, desipramine (DMI) appeared to be a suitable candidate to test our hypothesis. Experimental Approach Control and EAE mice at 13 d.p.i. were acutely or chronically administered DMI and monitored for behaviour and clinical scores. Noradrenaline and glutamate release, cAMP, CCL5 and TNF-α production were quantified in cortical synaptosomes and homogenates. Peripheral cytokine production was also determined. Key Results Noradrenaline exocytosis and α2-adrenoeceptor-mediated activity were unmodified in EAE mice at 13 d.p.i. when compared with control. Acute, but not chronic, DMI reduced CCL5 levels in cortical homogenates of EAE mice at 13 d.p.i., but did not affect peripheral IL-17 and TNF-α contents or CCL5 plasma levels. Acute DMI caused a long-lasting restoration of glutamate exocytosis, restored endogenous cAMP production and impeded the shift from inhibition to facilitation of the CCL5-mediated control of glutamate exocytosis. Finally, DMI ameliorated anxiety-related behaviour but not motor activity or severity of clinical signs. Conclusions We propose DMI as an add-on therapy to normalize neuropsychiatric symptoms in multiple sclerosis patients at the early stage of the disease. PMID:24528439

  9. Toxicity assessment of zinc oxide nanoparticles using sub-acute and sub-chronic murine inhalation models

    PubMed Central

    2014-01-01

    Background Although ZnO nanoparticles (NPs) are used in many commercial products and the potential for human exposure is increasing, few in vivo studies have addressed their possible toxic effects after inhalation. We sought to determine whether ZnO NPs induce pulmonary toxicity in mice following sub-acute or sub-chronic inhalation exposure to realistic exposure doses. Methods Mice (C57Bl/6) were exposed to well-characterized ZnO NPs (3.5 mg/m3, 4 hr/day) for 2 (sub-acute) or 13 (sub-chronic) weeks and necropsied immediately (0 wk) or 3 weeks (3 wks) post exposure. Toxicity was assessed by enumeration of total and differential cells, determination of total protein, lactate dehydrogenase activity and inflammatory cytokines in bronchoalveolar lavage (BAL) fluid as well as measurements of pulmonary mechanics. Generation of reactive oxygen species was assessed in the lungs. Lungs were evaluated for histopathologic changes and Zn content. Zn concentration in blood, liver, kidney, spleen, heart, brain and BAL fluid was measured. Results An elevated concentration of Zn2+ was detected in BAL fluid immediately after exposures, but returned to baseline levels 3 wks post exposure. Dissolution studies showed that ZnO NPs readily dissolved in artificial lysosomal fluid (pH 4.5), but formed aggregates and precipitates in artificial interstitial fluid (pH 7.4). Sub-acute exposure to ZnO NPs caused an increase of macrophages in BAL fluid and a moderate increase in IL-12(p40) and MIP-1α, but no other inflammatory or toxic responses were observed. Following both sub-acute and sub-chronic exposures, pulmonary mechanics were no different than sham-exposed animals. Conclusions Our ZnO NP inhalation studies showed minimal pulmonary inflammation, cytotoxicity or lung histopathologic changes. An elevated concentration of Zn in the lung and BAL fluid indicates dissolution of ZnO NPs in the respiratory system after inhalation. Exposure concentration, exposure mode and time post

  10. Bile Acid Signaling Is Involved in the Neurological Decline in a Murine Model of Acute Liver Failure.

    PubMed

    McMillin, Matthew; Frampton, Gabriel; Quinn, Matthew; Ashfaq, Samir; de los Santos, Mario; Grant, Stephanie; DeMorrow, Sharon

    2016-02-01

    Hepatic encephalopathy is a serious neurological complication of liver failure. Serum bile acids are elevated after liver damage and may disrupt the blood-brain barrier and enter the brain. Our aim was to assess the role of serum bile acids in the neurological complications after acute liver failure. C57Bl/6 or cytochrome p450 7A1 knockout (Cyp7A1(-/-)) mice were fed a control, cholestyramine-containing, or bile acid-containing diet before azoxymethane (AOM)-induced acute liver failure. In parallel, mice were given an intracerebroventricular infusion of farnesoid X receptor (FXR) Vivo-morpholino before AOM injection. Liver damage, neurological decline, and molecular analyses of bile acid signaling were performed. Total bile acid levels were increased in the cortex of AOM-treated mice. Reducing serum bile acids via cholestyramine feeding or using Cyp7A1(-/-) mice reduced bile acid levels and delayed AOM-induced neurological decline, whereas cholic acid or deoxycholic acid feeding worsened AOM-induced neurological decline. The expression of bile acid signaling machinery apical sodium-dependent bile acid transporter, FXR, and small heterodimer partner increased in the frontal cortex, and blocking FXR signaling delayed AOM-induced neurological decline. In conclusion, circulating bile acids may play a pathological role during hepatic encephalopathy, although precisely how they dysregulate normal brain function is unknown. Strategies to minimize serum bile acid concentrations may reduce the severity of neurological complications associated with liver failure. PMID:26683664

  11. Impairment of the cellular immune response in acute murine toxoplasmosis: regulation of interleukin 2 production and macrophage-mediated inhibitory effects.

    PubMed Central

    Haque, S; Khan, I; Haque, A; Kasper, L

    1994-01-01

    infected and normal splenocytes. These results indicate that during acute murine toxoplasmosis, there is a well-defined period (day 7) during which both the T-cell mitogen and parasite antigen-associated lymphoproliferative response are reduced. Further, there is a reduction in the production of IL-2 and an increase in IL-10, which appear to mediate, in part, the observed downregulation of immunity to T. gondii. PMID:8005679

  12. β-Nicotinamide adenine dinucleotide attenuates lipopolysaccharide-induced inflammatory effects in a murine model of acute lung injury.

    PubMed

    Umapathy, Nagavedi Siddaramappa; Gonzales, Joyce; Fulzele, Sadanand; Kim, Kyung-mi; Lucas, Rudolf; Verin, Alexander Dimitrievich

    2012-06-01

    Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) occur in approximately 200,000 patients per year. Studies indicate that lung endothelium plays a significant role in ALI. The authors' recent in vitro studies demonstrate a novel mechanism of β-nicotinamide adenine dinucleotide (β-NAD)-induced protection against gram-positive (pneumolysin, PLY) and gram-negative (lipopolysaccharide, LPS) toxin-induced lung endothelial cell (EC) barrier dysfunction. The objective of the current study was to evaluate the protective effect of β-NAD against LPS-induced ALI in mice. C57BL/6J mice were randomly divided into 4 groups: vehicle, β-NAD, LPS, and LPS/β-NAD. After surgery, mice were allowed to recover for 24 hours. Evans blue dye-albumin (EBA) was given through the internal jugular vein 2 hours prior to the termination of the experiments. Upon sacrificing the animals, bronchoalveolar lavage fluid (BALF) was collected and the lungs were harvested. β-NAD treatment significantly attenuated the inflammatory response by means of reducing the accumulation of cells and protein in BALF, blunting the parenchymal neutrophil infiltration, and preventing capillary leak. In addition, the histological examination demonstrated decreased interstitial edema in the LPS/β-NAD specimens, as compared to the LPS-only specimens. The mRNA levels of the anti-inflammatory cytokines were up-regulated in the LPS group treated with β-NAD compared to the LPS-only-treated group. β-NAD treatment down-regulated the mRNA levels of the proinflammatory cytokines. These findings suggest that β-NAD could be investigated as a therapeutic option against bacterial toxin-induced lung inflammation and ALI in mice. PMID:22563684

  13. L-type calcium channel mediates anticonvulsant effect of cannabinoids in acute and chronic murine models of seizure.

    PubMed

    Naderi, Nima; Ahmad-Molaei, Leila; Mazar-Atabaki, Ali; Ronaghi, Abdolaziz; Shirazi-zand, Zahra; Motiei-Langroudi, Seyed Mehrdad; Eslahkar, Somayeh

    2012-02-01

    The anticonvulsant activities of cannabinoid compounds have been shown in various models of seizure and epilepsy. At least, part of antiseizure effects of cannabinoid compounds is mediated through calcium (Ca(2+)) channels. The L-type Ca(2+) channels have been shown to be important in various epilepsy models. However, there is no data regarding the role of L-type Ca(2+) channels in protective action of cannabinoids on acute and chronic models of seizure. In this study, the effects of cannabinoid compounds and L-type Ca(2+) channels blockers, either alone or in combination were investigated using acute model of pentylenetetrazole (PTZ)-induced seizure in mice and chronic model electrical kindling of amygdala in rats. Pretreatment of mice with both cannabinoid CB1 receptor agonist arachidonyl-2'-chloroethylamide (ACEA) and endocannabinoid degradating enzyme inhibitor cyclohexylcarbamic acid 3'-carbamoyl-biphenyl-3-yl ester (URB597) produced a protective effect against PTZ-induced seizure. Administration of various doses of the two L-type Ca(2+) channel blockers verapamil and diltiazem did not alter PTZ-induced seizure threshold. However, co-administration of verapamil and either ACEA or URB597 attenuated the protective effect of cannabinoid compounds against PTZ-induced seizure. Also, pretreatment of mice with diltiazem blocked the anticonvulsant activity of both ACEA and URB597. Moreover, (R)-(+)-[2,3-dihydro-5-methyl-3[(4-morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4-benzoxazinyl]-(1-naphthalenyl) methanone mesylate (WIN55,212-2), the non-selective cannabinoid CB1 and CB2 receptor agonist showed anticonvulsant effect in amygdala-kindled rats. However, co-administration of WIN55,212-2 and verapamil attenuated the protective properties of WIN55,212-2. Our results showed that the anticonvulsant activity of cannabinoid compounds is mediated, at least in part, by L-type Ca(2+) channels in these two models of convulsion and epilepsy. PMID:21928146

  14. Promising Efficacy of Benznidazole Nanoparticles in Acute Trypanosoma cruzi Murine Model: In-Vitro and In-Vivo Studies.

    PubMed

    Scalise, María L; Arrúa, Eva C; Rial, Marcela S; Esteva, Mónica I; Salomon, Claudio J; Fichera, Laura E

    2016-08-01

    The aim of this study was to evaluate the effectiveness of benznidazole nanoparticles (BNZ-nps) on trypomastigote forms and on intracellular infection in mammalian cells and primary cardiac myocyte cells. Its effectiveness was also evaluated on acute Trypanosoma cruzi Nicaragua mice infection. Trypomastigotes from culture were treated with different concentrations of BNZ-nps to determine the drug concentration that lyses 50% of trypomastigotes (LC50). Infected mammalian cells were incubated with different concentrations of BNZ-nps to determine the percentage of amastigote inhibition. C3H/HeN mice with lethal acute infection were treated with 10, 25, and 50 mg/kg/day of BNZ-nps for 30 and 15 days to control the survival rate of animals. BNZ-nps having a mean particle size of 63.3 nm, a size distribution of 3.35, and a zeta potential of -18.30 were successfully prepared using poloxamer 188 as a stabilizer. BNZ-nps 25 and 50 μg/mL showed no significant differences in the percentage of inhibition of infected mammalian cells. Infected mice treated with BNZ-nps (50, 25, and 10 mg/kg/day) for 30 days and with BNZ-nps (50 and 25 mg/kg/day) for 15 days presented a 100% survival, whereas the animals treated with 10 mg/kg/day for 15 days of BNZ-nps showed a 70% survival rate. The results obtained demonstrate, for the first time, that benznidazole nanoparticles are a useful and attractive approach to treat Chagas disease in infected mice. PMID:27246447

  15. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.

    PubMed

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-03-01

    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation. PMID:26900989

  16. [Historical outlook on cytomegalovirus research].

    PubMed

    Furukawa, T

    1998-01-01

    In historical point of view, cytomegalovirus (CMV) research could be divided into two phases, before and after discovery of the virus from a baby with severe jaundice. CMV is an ubiquitous virus which makes it difficult to diagnose CMV diseases. Therefore criteria for definite CMV disease has been proposed by the expert committee. Basic research is concentrating on analysis of functional map of the sequences, which helps to develop more genetically engineered vaccine and clarify the mechanism of latency of CMV. I hope increased awareness of CMV disease in organ transplantation advances the development of both chemotherapy and preventive method in near future. PMID:9465657

  17. Temporal Analysis of Gene Expression in the Murine Schwann Cell Lineage and the Acutely Injured Postnatal Nerve.

    PubMed

    Balakrishnan, Anjali; Stykel, Morgan G; Touahri, Yacine; Stratton, Jo Anne; Biernaskie, Jeff; Schuurmans, Carol

    2016-01-01

    Schwann cells (SCs) arise from neural crest cells (NCCs) that first give rise to SC precursors (SCPs), followed by immature SCs, pro-myelinating SCs, and finally, non-myelinating or myelinating SCs. After nerve injury, mature SCs 'de-differentiate', downregulating their myelination program while transiently re-activating early glial lineage genes. To better understand molecular parallels between developing and de-differentiated SCs, we characterized the expression profiles of a panel of 12 transcription factors from the onset of NCC migration through postnatal stages, as well as after acute nerve injury. Using Sox10 as a pan-glial marker in co-expression studies, the earliest transcription factors expressed in E9.0 Sox10+ NCCs were Sox9, Pax3, AP2α and Nfatc4. E10.5 Sox10+ NCCs coalescing in the dorsal root ganglia differed slightly, expressing Sox9, Pax3, AP2α and Etv5. E12.5 SCPs continued to express Sox10, Sox9, AP2α and Pax3, as well as initiating Sox2 and Egr1 expression. E14.5 immature SCs were similar to SCPs, except that they lost Pax3 expression. By E18.5, AP2α, Sox2 and Egr1 expression was turned off in the nerve, while Jun, Oct6 and Yy1 expression was initiated in pro-myelinating Sox9+/Sox10+ SCs. Early postnatal and adult SCs continued to express Sox9, Jun, Oct6 and Yy1 and initiated Nfatc4 and Egr2 expression. Notably, at all stages, expression of each marker was observed only in a subset of Sox10+ SCs, highlighting the heterogeneity of the SC pool. Following acute nerve injury, Egr1, Jun, Oct6, and Sox2 expression was upregulated, Egr2 expression was downregulated, while Sox9, Yy1, and Nfatc4 expression was maintained at similar frequencies. Notably, de-differentiated SCs in the injured nerve did not display a transcription factor profile corresponding to a specific stage in the SC lineage. Taken together, we demonstrate that uninjured and injured SCs are heterogeneous and distinct from one another, and de-differentiation recapitulates

  18. Temporal Analysis of Gene Expression in the Murine Schwann Cell Lineage and the Acutely Injured Postnatal Nerve

    PubMed Central

    Touahri, Yacine; Stratton, Jo Anne; Biernaskie, Jeff; Schuurmans, Carol

    2016-01-01

    Schwann cells (SCs) arise from neural crest cells (NCCs) that first give rise to SC precursors (SCPs), followed by immature SCs, pro-myelinating SCs, and finally, non-myelinating or myelinating SCs. After nerve injury, mature SCs ‘de-differentiate’, downregulating their myelination program while transiently re-activating early glial lineage genes. To better understand molecular parallels between developing and de-differentiated SCs, we characterized the expression profiles of a panel of 12 transcription factors from the onset of NCC migration through postnatal stages, as well as after acute nerve injury. Using Sox10 as a pan-glial marker in co-expression studies, the earliest transcription factors expressed in E9.0 Sox10+ NCCs were Sox9, Pax3, AP2α and Nfatc4. E10.5 Sox10+ NCCs coalescing in the dorsal root ganglia differed slightly, expressing Sox9, Pax3, AP2α and Etv5. E12.5 SCPs continued to express Sox10, Sox9, AP2α and Pax3, as well as initiating Sox2 and Egr1 expression. E14.5 immature SCs were similar to SCPs, except that they lost Pax3 expression. By E18.5, AP2α, Sox2 and Egr1 expression was turned off in the nerve, while Jun, Oct6 and Yy1 expression was initiated in pro-myelinating Sox9+/Sox10+ SCs. Early postnatal and adult SCs continued to express Sox9, Jun, Oct6 and Yy1 and initiated Nfatc4 and Egr2 expression. Notably, at all stages, expression of each marker was observed only in a subset of Sox10+ SCs, highlighting the heterogeneity of the SC pool. Following acute nerve injury, Egr1, Jun, Oct6, and Sox2 expression was upregulated, Egr2 expression was downregulated, while Sox9, Yy1, and Nfatc4 expression was maintained at similar frequencies. Notably, de-differentiated SCs in the injured nerve did not display a transcription factor profile corresponding to a specific stage in the SC lineage. Taken together, we demonstrate that uninjured and injured SCs are heterogeneous and distinct from one another, and de-differentiation recapitulates

  19. Low levels of tissue factor lead to alveolar hemorrhage, potentiating murine acute lung injury and oxidative stress

    PubMed Central

    Bastarache, J.A.; Sebag, S. C.; Clune, J.K.; Grove, B.S.; Lawson, W.E.; Janz, D. R.; Roberts, L. J.; Dworski, R; Mackman, N.; Ware, L. B.

    2013-01-01

    Background Systemic blockade of Tissue Factor (TF) attenuates acute lung injury (ALI) in animal models of sepsis but the effects of global TF deficiency are unknown. Hypothesis We used mice with complete knockout of mouse TF and low levels (~1%) of human TF (LTF mice) to test the hypothesis that global TF deficiency attenuates lung inflammation in direct lung injury. Methods LTF mice were treated with 10 μg of lipopolysaccharide (LPS) or vehicle administered by direct intratracheal (IT) injection and studied at 24 hours. Results Contrary to our hypothesis, LTF mice had increased lung inflammation and injury as measured by bronchoalveolar lavage cell count (3.4 × 105 WT LPS versus 3.3 × 105 LTF LPS, p=0.947) and protein (493 μg/ml WT LPS versus 1014 μg/ml LTF LPS, p=0.006), proinflammatory cytokines (TNF-α, IL-10, IL-12, p<0.035 WT LPS versus LTF LPS) and histology compared to wild type mice. LTF mice also had increased hemorrhage and free hemoglobin in the airspace accompanied by increased oxidant stress as measured by lipid peroxidation products (F2-Isoprostanes and Isofurans). Conclusions These findings indicate that global TF deficiency does not confer protection in a direct lung injury model. Rather, TF deficiency causes increased intra-alveolar hemorrhage following LPS leading to increased lipid peroxidation. Strategies to globally inhibit tissue factor may be deleterious in patients with ALI. PMID:23033361

  20. Metabolomics Investigation Reveals Metabolite Mediators Associated with Acute Lung Injury and Repair in a Murine Model of Influenza Pneumonia

    PubMed Central

    Cui, Liang; Zheng, Dahai; Lee, Yie Hou; Chan, Tze Khee; Kumar, Yadunanda; Ho, Wanxing Eugene; Chen, Jian Zhu; Tannenbaum, Steven R.; Ong, Choon Nam

    2016-01-01

    Influenza virus infection (IVI) can cause primary viral pneumonia, which may progress to acute lung injury (ALI) and respiratory failure with a potentially fatal outcome. At present, the interactions between host and influenza virus at molecular levels and the underlying mechanisms that give rise to IVI-induced ALI are poorly understood. We conducted a comprehensive mass spectrometry-based metabolic profiling of serum, lung tissue and bronchoalveolar lavage fluid (BALF) from a non-lethal mouse model with influenza A virus at 0, 6, 10, 14, 21 and 28 days post infection (dpi), representing the major stages of IVI. Distinct metabolite signatures were observed in mice sera, lung tissues and BALF, indicating the molecular differences between systematic and localized host responses to IVI. More than 100 differential metabolites were captured in mice sera, lung tissues and BALF, including purines, pyrimidines, acylcarnitines, fatty acids, amino acids, glucocorticoids, sphingolipids, phospholipids, etc. Many of these metabolites belonged to pulmonary surfactants, indicating IVI-induced aberrations of the pulmonary surfactant system might play an important role in the etiology of respiratory failure and repair. Our findings revealed dynamic host responses to IVI and various metabolic pathways linked to disease progression, and provided mechanistic insights into IVI-induced ALI and repair process. PMID:27188343

  1. Inhalation of glycopyrronium inhibits cigarette smoke-induced acute lung inflammation in a murine model of COPD.

    PubMed

    Shen, Liang-liang; Liu, Ya-nan; Shen, Hui-juan; Wen, Chong; Jia, Yong-liang; Dong, Xin-wei; Jin, Fang; Chen, Xiao-ping; Sun, Yun; Xie, Qiang-min

    2014-02-01

    Glycopyrronium bromide (GB) is a muscarinic receptor antagonist that has been used as a long-acting bronchodilator in chronic obstructive pulmonary disease (COPD) patients. The aim of this study was to investigate the anti-inflammatory activity of inhaled GB in a cigarette smoke-induced acute lung inflammation mouse model. We found that aerosol pre-treatment with GB suppresses the accumulation of neutrophils and macrophages in the bronchoalveolar lavage fluid (BALF) in cigarette smoke (CS)-exposed mice. GB at doses of 300 and 600 μg/ml significantly inhibited the CS-induced increases in the mRNA and protein expression levels of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, monocyte chemotactic protein (MCP)-1 and transforming growth factor (TGF)-β1 in lung tissues and the BALF. Moreover, GB at a dose of 600 μg/ml significantly inhibited the CS-induced changes in glutathione (GSH) and myeloperoxidase (MPO) activities in the BALF, decreased the CS-induced expression of matrix metalloproteinases (MMP)-9, and increased the CS-induced expression of tissue inhibitor of metalloproteinases (TIMP)-1, as determined through the immunohistochemical staining of lung tissue. Our results demonstrate the beneficial effects of inhaled GB on the inflammatory reaction in COPD. PMID:24389380

  2. Nobiletin protects against murine l-arginine-induced acute pancreatitis in association with downregulating p38MAPK and AKT.

    PubMed

    Liu, Bing; Huang, Jian; Zhang, Bin

    2016-07-01

    Acute pancreatitis (AP) is an inflammatory disease characterized by acinar cell damage, oxidative stress, and inflammation of the pancreas. Nobiletin (3',4',5,6,7,8-hexamethoxyflavone), a major polymethoxy flavone, has shown health-promoting properties in previous studies. Therefore, in this study, we investigated whether nobiletin protects against experimental AP induced with l-arginine. C57BL/6 mice were treated with 25 or 50mg/kg nobiletin by intraperitoneal injection once daily for 14 consecutive days. AP was then induced in the mice with two intraperitoneal injections of l-arginine (4g/kg). The nobiletin treatment significantly reduced the plasma amylase levels, pancreatic myeloperoxidase activity, percentage of pancreatic necrosis, plasma proinflammatory factors, the generation of reactive oxygen species, cell apoptosis, tissue damage, and the expression of phosphorylated p38MAPK (p-p38MAPK) and p-AKT. These results suggest that nobiletin is a new therapeutic method for l-arginine-induced AP in mice. PMID:27261583

  3. Metabolomics Investigation Reveals Metabolite Mediators Associated with Acute Lung Injury and Repair in a Murine Model of Influenza Pneumonia.

    PubMed

    Cui, Liang; Zheng, Dahai; Lee, Yie Hou; Chan, Tze Khee; Kumar, Yadunanda; Ho, Wanxing Eugene; Chen, Jian Zhu; Tannenbaum, Steven R; Ong, Choon Nam

    2016-01-01

    Influenza virus infection (IVI) can cause primary viral pneumonia, which may progress to acute lung injury (ALI) and respiratory failure with a potentially fatal outcome. At present, the interactions between host and influenza virus at molecular levels and the underlying mechanisms that give rise to IVI-induced ALI are poorly understood. We conducted a comprehensive mass spectrometry-based metabolic profiling of serum, lung tissue and bronchoalveolar lavage fluid (BALF) from a non-lethal mouse model with influenza A virus at 0, 6, 10, 14, 21 and 28 days post infection (dpi), representing the major stages of IVI. Distinct metabolite signatures were observed in mice sera, lung tissues and BALF, indicating the molecular differences between systematic and localized host responses to IVI. More than 100 differential metabolites were captured in mice sera, lung tissues and BALF, including purines, pyrimidines, acylcarnitines, fatty acids, amino acids, glucocorticoids, sphingolipids, phospholipids, etc. Many of these metabolites belonged to pulmonary surfactants, indicating IVI-induced aberrations of the pulmonary surfactant system might play an important role in the etiology of respiratory failure and repair. Our findings revealed dynamic host responses to IVI and various metabolic pathways linked to disease progression, and provided mechanistic insights into IVI-induced ALI and repair process. PMID:27188343

  4. A diagnostic window for the treatment of acute graft-versus-host disease prior to visible clinical symptoms in a murine model

    PubMed Central

    2013-01-01

    Background Acute graft-versus-host disease (aGVHD) poses a major limitation for broader therapeutic application of allogeneic hematopoietic cell transplantation (allo-HCT). Early diagnosis of aGVHD remains difficult and is based on clinical symptoms and histopathological evaluation of tissue biopsies. Thus, current aGVHD diagnosis is limited to patients with established disease manifestation. Therefore, for improved disease prevention it is important to develop predictive assays to identify patients at risk of developing aGVHD. Here we address whether insights into the timing of the aGVHD initiation and effector phases could allow for the detection of migrating alloreactive T cells before clinical aGVHD onset to permit for efficient therapeutic intervention. Methods Murine major histocompatibility complex (MHC) mismatched and minor histocompatibility antigen (miHAg) mismatched allo-HCT models were employed to assess the spatiotemporal distribution of donor T cells with flow cytometry and in vivo bioluminescence imaging (BLI). Daily flow cytometry analysis of peripheral blood mononuclear cells allowed us to identify migrating alloreactive T cells based on homing receptor expression profiles. Results We identified a time period of 2 weeks of massive alloreactive donor T cell migration in the blood after miHAg mismatch allo-HCT before clinical aGVHD symptoms appeared. Alloreactive T cells upregulated α4β7 integrin and P-selectin ligand during this migration phase. Consequently, targeted preemptive treatment with rapamycin, starting at the earliest detection time of alloreactive donor T cells in the peripheral blood, prevented lethal aGVHD. Conclusions Based on this data we propose a critical time frame prior to the onset of aGVHD symptoms to identify alloreactive T cells in the peripheral blood for timely and effective therapeutic intervention. PMID:23692886

  5. Preclinical activity of the novel B-cell-specific Moloney murine leukemia virus integration site 1 inhibitor PTC-209 in acute myeloid leukemia: Implications for leukemia therapy.

    PubMed

    Nishida, Yuki; Maeda, Aya; Chachad, Dhruv; Ishizawa, Jo; Qiu, Yi Hua; Kornblau, Steven M; Kimura, Shinya; Andreeff, Michael; Kojima, Kensuke

    2015-12-01

    Curing patients with acute myeloid leukemia (AML) remains a therapeutic challenge. The polycomb complex protein B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) is required for the self-renewal and maintenance of leukemia stem cells. We investigated the prognostic significance of BMI-1 in AML and the effects of a novel small molecule selective inhibitor of BMI-1, PTC-209. BMI-1 protein expression was determined in 511 newly diagnosed AML patients together with 207 other proteins using reverse-phase protein array technology. Patients with unfavorable cytogenetics according to Southwest Oncology Group criteria had higher levels of BMI-1 compared to those with favorable (P = 0.0006) or intermediate cytogenetics (P = 0.0061), and patients with higher levels of BMI-1 had worse overall survival (55.3 weeks vs. 42.8 weeks, P = 0.046). Treatment with PTC-209 reduced protein level of BMI-1 and its downstream target mono-ubiquitinated histone H2A and triggered several molecular events consistent with the induction of apoptosis, this is, loss of mitochondrial membrane potential, caspase-3 cleavage, BAX activation, and phosphatidylserine externalization. PTC-209 induced apoptosis in patient-derived CD34(+)CD38(low/-) AML cells and, less prominently, in CD34(-) differentiated AML cells. BMI-1 reduction by PTC-209 directly correlated with apoptosis induction in CD34(+) primary AML cells (r = 0.71, P = 0.022). However, basal BMI-1 expression was not a determinant of AML sensitivity. BMI-1 inhibition, which targets a primitive AML cell population, might offer a novel therapeutic strategy for AML. PMID:26450753

  6. Gene silencing of TNF-alpha in a murine model of acute colitis using a modified cyclodextrin delivery system.

    PubMed

    McCarthy, J; O'Neill, M J; Bourre, L; Walsh, D; Quinlan, A; Hurley, G; Ogier, J; Shanahan, F; Melgar, S; Darcy, R; O'Driscoll, C M

    2013-05-28

    Inflammatory bowel disease (IBD) is a chronic relapsing inflammation of the gastrointestinal tract. The cytokine TNF-alpha (TNF-α) plays a pivotal role in mediating this inflammatory response. RNA interference (RNAi) holds great promise for the specific and selective silencing of aberrantly expressed genes, such as TNF-α in IBD. The aim of this study was to investigate the efficacy of an amphiphilic cationic cyclodextrin (CD) vector for effective TNF-α siRNA delivery to macrophage cells and to mice with induced acute-colitis. The stability of CD.siRNA was examined by gel electrophoresis in biorelevant media reflecting colonic fluids. RAW264.7 cells were transfected with CD.TNF-α siRNA, stimulated with lipopolysaccharide (LPS) and TNF-α and IL-6 responses were measured by PCR and ELISA. Female C57BL/6 mice were exposed to dextran sodium sulphate (DSS) and treated by intrarectal administration with either CD.siRNA TNF-α or a control solution. In vitro, siRNA in CD nanocomplexes remained intact and stable in both fed and fasted simulated colonic fluids. RAW264.7 cells transfected with CD.TNF-α siRNA and stimulated with LPS displayed a significant reduction in both gene and protein levels of TNF-α and IL-6. CD.TNF-α siRNA-treated mice revealed a mild amelioration in clinical signs of colitis, but significant reductions in total colon weight and colonic mRNA expression of TNF-α and IL-6 compared to DSS-control mice were detected. This data indicates the clinical potential of a local CD-based TNF-α siRNA delivery system for the treatment of IBD. PMID:23500058

  7. Activity of trifluorothymidine against cytomegalovirus.

    PubMed Central

    Wingard, J R; Stuart, R K; Saral, R; Burns, W H

    1981-01-01

    Trifluorothymidine (TFT) was tested for antiviral activity against mouse cytomegalovirus (MCMV) and human cytomegalovirus (HCMV) in one-step replication assays. The TFT concentration required to reduce virus yield by 50% (ID50) was 0.22 microM for MCMV and 0.012 microM for HCMV. The antiviral activity of TFT against MCMV was reversed by addition of equimolar thymidine, and no antiviral activity was demonstrable in a host cell line lacking thymidine kinase. Thus, TFT's anti-MCMV activity is dependent on a host cell TK since this herpesvirus lacks thymidine kinase. A continuous subcutaneous infusion of TFT achieving a serum concentration of 1 microM failed to protect mice from lethal MCMV infection, perhaps because serum levels of thymidine were comparable to the drug level. Comparison of the ID50 against HCMV and the ID50 against human bone marrow progenitor cells resulted in an in vitro therapeutic ratio of 108, suggesting that TFT might offer some promise as a clinically useful anti-HCMV agent. PMID:6272627

  8. Physiological noise in murine solid tumours using T2*-weighted gradient-echo imaging: a marker of tumour acute hypoxia?

    NASA Astrophysics Data System (ADS)

    Baudelet, Christine; Ansiaux, Réginald; Jordan, Bénédicte F.; Havaux, Xavier; Macq, Benoit; Gallez, Bernard

    2004-08-01

    with no contrast enhancement as the result of vessel functional impairment. Furthermore, transient fluctuations appeared to occur preferentially in neoangiogenic hyperpermeable vessels. The present study suggests that spontaneous T2*-weighted GRE fluctuations are very likely to be related to the spontaneous fluctuations in blood flow and oxygenation associated with the pathophysiology of acute hypoxia in tumours. The disadvantage of the T2*-weighted GRE MRI technique is the complexity of signal interpretation with regard to pO2 changes. Compared to established techniques such as intravital microscopy or histological assessments, the major advantage of the MRI technique lies in its capacity to provide simultaneously both temporal and detailed spatial information on spontaneous fluctuations throughout the tumour.

  9. Cerebral ultrasound images in prenatal cytomegalovirus infection.

    PubMed

    Tomà, P; Magnano, G M; Mezzano, P; Lazzini, F; Bonacci, W; Serra, G

    1989-01-01

    A male newborn with prenatal cytomegalovirus infection was referred for cranial ultrasound. The cranial ultrasound demonstrated areas of increased echogenicity in the thalamic and gray nuclei resembling "a branched candlestick". Doppler technique located the "branched candlestick" along the thalamostriate arteries. This image is particularly interesting because to our knowledge it has never before been described in congenital cytomegalovirus infection, but only in congenital rubella. PMID:2550848

  10. T cell responses to cytomegalovirus.

    PubMed

    Klenerman, Paul; Oxenius, Annette

    2016-06-01

    Human cytomegalovirus (HCMV) establishes a latent infection that generally remains asymptomatic in immune-competent hosts for decades but can cause serious illness in immune-compromised individuals. The long-term control of CMV requires considerable effort from the host immune system and has a lasting impact on the profile of the immune system. One hallmark of CMV infection is the maintenance of large populations of CMV-specific memory CD8(+) T cells - a phenomenon termed memory inflation - and emerging data suggest that memory inflation is associated with impaired immunity in the elderly. In this Review, we discuss the molecular triggers that promote memory inflation, the idea that memory inflation could be considered a natural pathway of T cell maturation that could be harnessed in vaccination, and the broader implications of CMV infection and the T cell responses it elicits. PMID:27108521

  11. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention

    PubMed Central

    van Zuylen, Wendy J; Hamilton, Stuart T; Naing, Zin; Hall, Beverly; Shand, Antonia

    2014-01-01

    Cytomegalovirus is the most common congenital infection causing serious disease in infants. It is the leading infectious cause of sensorineural hearing loss and neurodevelopmental disability in developed countries. Despite the clinical importance of congenital cytomegalovirus, surveys show there is limited awareness and knowledge in the medical and general community about congenital cytomegalovirus infection. This article reviews the clinical features, global epidemiology, transmission and risk factors for cytomegalovirus infections. It also highlights several major advances made in recent years in the diagnosis and prevention of cytomegalovirus infection during pregnancy. Although research is ongoing, no therapy is currently proven to prevent or treat maternal, fetal or neonatal cytomegalovirus infection. Education of women regarding hygiene measures can help prevent cytomegalovirus infection and are currently the best strategy to prevent congenital cytomegalovirus disease.

  12. Cytomegalovirus

    MedlinePlus

    ... be contagious? I have CMV. Should I stop breastfeeding my baby? I work at a daycare center. How long should I stay home? Will my newborn have any problems because I had CMV while I was pregnant? I have HIV. Do I need any special treatments? Should I ...

  13. Evaluating an etiologically relevant platform for therapy development for temporal lobe epilepsy: effects of carbamazepine and valproic acid on acute seizures and chronic behavioral comorbidities in the Theiler's murine encephalomyelitis virus mouse model.

    PubMed

    Barker-Haliski, Melissa L; Dahle, E Jill; Heck, Taylor D; Pruess, Timothy H; Vanegas, Fabiola; Wilcox, Karen S; White, H Steve

    2015-05-01

    Central nervous system infections can underlie the development of epilepsy, and Theiler's murine encephalomyelitis virus (TMEV) infection in C57BL/6J mice provides a novel model of infection-induced epilepsy. Approximately 50-65% of infected mice develop acute, handling-induced seizures during the infection. Brains display acute neuropathology, and a high number of mice develop spontaneous, recurrent seizures and behavioral comorbidities weeks later. This study characterized the utility of this model for drug testing by assessing whether antiseizure drug treatment during the acute infection period attenuates handling-induced seizures, and whether such treatment modifies associated comorbidities. Male C57BL/6J mice infected with TMEV received twice-daily valproic acid (VPA; 200 mg/kg), carbamazepine (CBZ; 20 mg/kg), or vehicle during the infection (days 0-7). Mice were assessed twice daily during the infection period for handling-induced seizures. Relative to vehicle-treated mice, more CBZ-treated mice presented with acute seizures; VPA conferred no change. In mice displaying seizures, VPA, but not CBZ, reduced seizure burden. Animals were then randomly assigned to acute and long-term follow-up. VPA was associated with significant elevations in acute (day 8) glial fibrillary acidic protein (astrocytes) immunoreactivity, but did not affect NeuN (neurons) immunoreactivity. Additionally, VPA-treated mice showed improved motor performance 15 days postinfection (DPI). At 36 DPI, CBZ-treated mice traveled significantly less distance through the center of an open field, indicative of anxiety-like behavior. CBZ-treated mice also presented with significant astrogliosis 36 DPI. Neither CBZ nor VPA prevented long-term reductions in NeuN immunoreactivity. The TMEV model thus provides an etiologically relevant platform to evaluate potential treatments for acute seizures and disease modification. PMID:25755209

  14. Virus Attenuation after Deletion of the Cytomegalovirus Fc Receptor Gene Is Not due to Antibody Control

    PubMed Central

    Crnković-Mertens, Irena; Messerle, Martin; Milotić, Irena; Szepan, Uwe; Kučić, Natalija; Krmpotić, Astrid; Jonjić, Stipan; Koszinowski, Ulrich H.

    1998-01-01

    The murine cytomegalovirus (MCMV) fcr-1 gene codes for a glycoprotein located at the surface of infected cells which strongly binds the Fc fragment of murine immunoglobulin G. To determine the biological significance of the fcr-1 gene during viral infection, we constructed MCMV fcr-1 deletion mutants and revertants. The fcr-1 gene was disrupted by insertion of the Escherichia coli lacZ gene. In another mutant, the marker gene was also deleted, by recombinase cre. As expected for its hypothetical role in immunoevasion, the infection of mice with fcr-1 deletion mutants resulted in significantly restricted replication in comparison with wild-type MCMV and revertant virus. In mutant mice lacking antibodies, however, the fcr-1 deletion mutants also replicated poorly. This demonstrated that the cell surface-expressed viral glycoprotein with FcR activity strongly modulates the virus-host interaction but that this biological function is not caused by the immunoglobulin binding property. PMID:9445038

  15. Congenital Cytomegalovirus Infection: Audiologic Outcome

    PubMed Central

    Fowler, Karen B.

    2013-01-01

    The association between congenital cytomegalovirus (CMV) infection and sensorineural hearing loss (SNHL) was first described almost 50 years ago. Studies over the intervening decades have further described the relationship between congenital CMV infection and SNHL in children. However, congenital CMV infection remains a leading cause of SNHL in children in the United States and the world today. As more CMV infections are identified, it is important to recognize that infants who are born to seroimmune mothers are not completely protected from SNHL, although their hearing loss is often milder than that seen in CMV-infected infants following primary maternal infections. Late-onset and progressive hearing losses occur following congenital CMV infection, and CMV-infected infants should be evaluated regularly to provide for early detection of hearing loss and appropriate intervention. Fluctuating hearing loss that is not explained by concurrent middle ear infections is another characteristic of CMV-related hearing loss in children. Challenges still remain in predicting which children with congenital CMV infection will develop hearing loss and, among those who do develop loss, whether or not the loss will continue to deteriorate. PMID:24257423

  16. Murine Typhus

    PubMed Central

    Dzul-Rosado, Karla R; Zavala Velázquez, Jorge Ernesto; Zavala-Castro, Jorge

    2012-01-01

    Rickettsia typhi: is an intracellular bacteria who causes murine typhus. His importance is reflected in the high frequency founding specific antibodies against Rickettsia typhi in several worldwide seroepidemiological studies, the seroprevalence ranging between 3-36%. Natural reservoirs of R. typhi are rats (some species belonging the Rattus Genus) and fleas (Xenopsylla cheopis) are his vector. This infection is associated with overcrowding, pollution and poor hygiene. Typically presents fever, headache, rash on trunk and extremities, in some cases may occur organ-specific complications, affecting liver, kidney, lung or brain. Initially the disease is very similar to other diseases, is very common to confuse the murine typhus with Dengue fever, therefore, ignorance of the disease is a factor related to complications or non-specific treatments for the resolution of this infection. This paper presents the most relevant information to consider about the rickettsiosis caused by Rickettsia typhi. PMID:24893060

  17. A young patient with multisystem complications after cytomegalovirus infection.

    PubMed

    Pulivarthi, Swaroopa; Gurram, Murali Krishna

    2014-01-01

    We are describing a case of an 18-year-old male patient with cytomegalovirus (CMV) associated guillain-barre syndrome (GBS) who presented with an acute onset of generalized weakness and numbness in the extremities, dysphagia, and facial diplegia, followed by respiratory failure, which led to mechanical ventilation. He had positive immunoglobulin G and immunoglobulin M antibodies against CMV, and CMV polymerase chain reaction was positive with <2000 copies of deoxyribonucleic acid. Human immunodeficiency virus test was negative. He received a course of ganciclovir, intravenous immunoglobulin, and plasmapheresis. After improving from acute episode, patient was transferred to a rehabilitation facility for physical and occupational therapy. At the rehabilitation facility, he exhibited signs of acute abdomen with pain in the left upper quadrant secondary to peritonitis from dislodged gastrostomy tube and underwent exploratory laparotomy. During the hospital course he was found to have splenic infarct and colitis on the computed tomography of abdomen. This case showed an immunocompetent young patient with multisystem complications including guillain-barre syndrome (GBS), splenic infarct, hepatitis, and colitis due to CMV. PMID:24741254

  18. Subclinical Congenital Cytomegalovirus Infection and Hearing Impairment

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1974-01-01

    When the hearing sensitivity of children with subclinical congenital cytomegalovirus infection was evaluated and compared with that of a group of matched control subjects, nine of the 18 infected subjects were found to have some hearing loss, ranging from slight high-frequency impairments to a severe-to-profound unilateral loss. (MYS)

  19. Cytomegalovirus appendicitis in an immunocompetent host.

    PubMed

    Canterino, Joseph E; McCormack, Michael; Gurung, Ananta; Passarelli, James; Landry, Marie L; Golden, Marjorie

    2016-05-01

    Cytomegalovirus (CMV) is a common viral pathogen. Asymptomatic infection or a mononucleosis syndrome are the most common manifestations in otherwise healthy individuals. End-organ disease is rare in immunocompetent individuals. Here, we describe a case of CMV appendicitis in a patient without an immune-compromising condition. PMID:26942831

  20. An infantile case of cytomegalovirus induced idiopathic thrombocytopenic purpura with predominant proliferation of CD10 positive lymphoblast in bone marrow.

    PubMed

    Mizutani, K; Azuma, E; Komada, Y; Ito, M; Sakurai, M; Hironaka, T; Hirai, K

    1995-02-01

    An infant with cytomegalovirus infection (CMV) developed idiopathic thrombocytopenic purpura (ITP) at 4 months of age. A bone marrow (BM) aspiration showed a remarkable increase of immature megakaryocytes and prominent proliferation of lymphoblasts. Flow cytometric analysis of the bone marrow cells showed that the predominant cells in the lymphocyte cluster were of B-lineage (CD19) with CD10 (common acute lymphoblastic leukemia antigen) positive. Virus study showed a higher titer of CMV antibody. Cytomegalovirus DNA was detected by the polymerase chain reaction (PCR) method in urine, peripheral cells and marrow cells. Low-grade fever, diarrhea and petechiae were accompanied by mild liver dysfunction. Complete remission was made with intravenous high-dose immunoglobulin (IVIg) without progression to overt acute leukemia. The percentage of CD10+/CD19+ lymphocytes in bone marrow also diminished. We postulated that the proliferation of immature lymphocytes and megakaryocytes in bone marrow was caused by maturation arrest that might result from CMV infection. PMID:7754772

  1. Cytomegalovirus Colitis: An Uncommon Mimicker of Common Colitides.

    PubMed

    Baniak, Nick; Kanthan, Rani

    2016-08-01

    Cytomegalovirus latency, though ubiquitous in the human population, is known to cause colitis in both immunocompromised and immunocompetent hosts. Furthermore, the clinical, endoscopic, and histologic appearance of cytomegalovirus colitis can mimic that of inflammatory bowel disease, an extremely well-documented disease. In this context, though many reports have looked at inflammatory bowel disease with superimposed cytomegalovirus infection, less attention has been paid to cytomegalovirus as a primary cause of isolated colitis. Owing to the rarity of this phenomenon, it is important to consider this diagnosis and implement proper testing to avoid misdiagnosis and mismanagement. PMID:27472242

  2. Rosmarinus officinalis L. extract ameliorates intestinal inflammation through MAPKs/NF-κB signaling in a murine model of acute experimental colitis.

    PubMed

    Medicherla, Kanakaraju; Ketkar, Avanee; Sahu, Bidya Dhar; Sudhakar, Godi; Sistla, Ramakrishna

    2016-07-13

    We investigated the anti-inflammatory and anti-colitis effects of Rosmarinus officinalis L. extract (RE) by using both in vitro LPS-activated mouse RAW 264.7 macrophages and in vivo dextran sulfate sodium (DSS)-induced experimental murine colitis and suggested the underlying possible mechanisms. Liquid Chromatography-Mass Spectrometry (LC-MS) analysis was performed to identify the major components present in the RE. The clinical signs, biochemistry, immunoblot, ELISA and histology in colon tissues were assessed in order to elucidate the beneficial effect of RE. RE suppressed the LPS-induced pro-inflammatory cytokine production and the expressions of inflammatory proteins in macrophages. Administration of RE (50 and 100 mg kg(-1)) also significantly reduced the severity of DSS-induced murine colitis, as assessed by the clinical symptoms, colon length and histology. RE administration prevented the DSS-induced activation of p38, ERK and JNK MAPKs, attenuated IκBα phosphorylation and subsequent nuclear translocation and DNA binding of NF-κB (p65). RE also suppressed the COX-2 and iNOS expressions, decreased the levels of TNF-α and IL-6 cytokines and the myeloperoxidase activity in the colon tissue. Histological observation revealed that RE administration alleviated mucosal damage and inflammatory cell infiltration induced by DSS in the colon tissue. Hence, RE could be used as a new preventive and therapeutic food ingredient or as a dietary supplement for inflammatory bowel disease. PMID:27349640

  3. Toxoplasmosis, Parvovirus, and Cytomegalovirus in Pregnancy.

    PubMed

    Feldman, Deborah M; Keller, Rebecca; Borgida, Adam F

    2016-06-01

    There are several infections in adults that warrant special consideration in pregnant women given the potential fetal consequences. Among these are toxoplasmosis, parvovirus B19, and cytomegalovirus. These infections have an important impact on the developing fetus, depending on the timing of infection. This article reviews the modes of transmission as well as maternal and neonatal effects of each of these infections. In addition, the article outlines recommended testing, fetal surveillance, and treatment where indicated. PMID:27235921

  4. Cytomegalovirus Cutaneous Infection in an Immunocompromised Patient

    PubMed Central

    Pedersen, Faye T; Alhassan, Sulaiman; Adjapong, Opoku; Thirumala, Raghukumar

    2016-01-01

    Cytomegalovirus (CMV), a member of the Herpesviridae family, is an opportunistic infection with a typically benign course in the healthy host but has a more ominous course in the immunocompromised population. CMV infection commonly affects the visceral organs, particularly the respiratory and the gastrointestinal tract. CMV cutaneous lesions are rare and can be easily missed. We present a case of a 76-year-old woman presenting with a diffuse non-pruritic macular lesion with scattered vesicles and bullae, which was initially treated as a varicella zoster virus infection and herpes simplex viral infection, but was later found on biopsy to be due to cytomegalovirus. She has a history of Sjögren's syndrome, interstitial lung disease, and being on chronic immunosuppression therapy. This case highlights the importance of considering CMV infection in the differential diagnosis of vesicular skin lesions in immunocompromised patients. Based on a PubMed search for “cutaneous cytomegalovirus”, “cutaneous CMV”, “cytomegalovirus skin”, and “skin CMV” in material published in the last 20 years (from 1996 to 2016) and reviewing any applicable referenced material outside of those dates, cases of cutaneous CMV are not well documented. PMID:27335710

  5. Failure in generating hemopoietic stem cells is the primary cause of death from cytomegalovirus disease in the immunocompromised host

    SciTech Connect

    Mutter, W.; Reddehase, M.J.; Busch, F.W.; Buehring, H.J.K.; Koszinowski, U.H.

    1988-05-01

    We have shown in a murine model system for cytomegalovirus (CMV) disease in the immunocompromised host that CMV infection interferes with the earliest detectable step in hemopoiesis, the generation of the stem cell CFU-S-I, and thereby prevents the autoreconstitution of bone marrow after sublethal irradiation. The antihemopoietic effect could not be ascribed to a direct infection of stem cells. The failure in hemopoiesis was prevented by adoptive transfer of antiviral CD8+ T lymphocytes and could be overcome by syngeneic bone marrow transplantation. CD8+ T lymphocytes and bone marrow cells both mediated survival, although only CD8+ T lymphocytes were able to limit virus multiplication in host tissues. We concluded that not the cytopathic effect of virus replication in host tissues, but the failure in hemopoiesis, is the primary cause of death in murine CMV disease.

  6. Hepatic decompensation in the absence of obvious precipitants: the potential role of cytomegalovirus infection/reactivation

    PubMed Central

    Rosi, Silvia; Poretto, Valentina; Cavallin, Marta; Angeli, Paolo; Amodio, Piero; Sattin, Andrea; Montagnese, Sara

    2015-01-01

    Details of two patients with alcohol-related and mixed aetiology cirrhosis who developed acute-on-chronic liver failure/hepatic decompensation with no obvious precipitants are reported. Cytomegalovirus (CMV) infection or reactivation was diagnosed in both, and required treatment with ganciclovir in one. Both returned to baseline hepatic function and remain well. Physicians should be alert to the possibility that CMV might cause or contribute to hepatic decompensation in patients with cirrhosis, even if they are not severely immunocompromised, and especially if they are alcohol misusers. PMID:26629358

  7. Induction of murine p30 by superinfecting herpesviruses.

    PubMed Central

    Reed, C L; Rapp, F

    1976-01-01

    The interaction of endogenous type C viruses with superinfecting herpes simplex virus type 2 (HSV-2) was investigated in two murine cell lines. Replication of HSV-2 was suboptimal in random-bred Swiss/3T3A cells and, in initial experiments, infection with a low virus-to-cell ratio resulted in carrier cultures with enhanced murine leukemia virus (MuLV) p30 expression. Immunofluorescence tests with Swiss/3T3A cells productively infected with HSV-2 also showed HSV-associated cytoplasmic antigens and enhanced MuLV p30 expression when compared with uninfected controls. Inactivation of HSV-2 with UV light did not abolish this reaction, although the number of cells expressing p30 was reduced. HSV-2 replicated more efficiently in a line of NIH Swiss cells (N c1 A c1 10). These cells are not readily inducible for type C expression by conventional methods; however, untreated and UV-inactivated HSV-2 induced both HSV-2-associated antigens and MuLV p30 in these cells. Although the Birch strain of human cytomegalovirus induced MuLV p30, neither mouse cytomegalovirus nor vesicular stomatitis virus induced MuLV p30 in either cell line. Images PMID:184296

  8. Nanocomposite Treatment Reduces Disease and Lethality in a Murine Model of Acute Graft-versus-Host Disease and Preserves Anti-Tumor Effects

    PubMed Central

    Resende, Carolina B.; De Paula, Talles P.; Reis, Alesandra C.; Gonçalves, William A.; Vieira, Elias G.; Pinheiro, Maurício V. B.; Souza, Danielle G.; Castor, Marina G. M.; Teixeira, Mauro M.; Pinho, Vanessa

    2015-01-01

    Graft versus host disease (GVHD) is an immunological disorder triggered by bone marrow transplantation that affects several organs, including the gastrointestinal tract and liver. Fullerenes and their soluble forms, fullerols, are nanocomposites with a closed symmetrical structure with anti-inflammatory and anti-oxidant properties. The present study evaluated the effects of treatment with the fullerol (C60(OH)18-20) in the development and pathogenesis of GVHD in a murine model. Mice with experimental GVHD that were treated with the fullerol showed reduced clinical signs of disease and mortality compared with untreated mice. Treatment with the fullerol decreased the hepatic damage associated with reduced hepatic levels of reactive oxygen species, pro-inflammatory cytokines and chemokines (IFN-γ TNF-α, CCL2, CCL3 and CCL5) and reduced leukocyte accumulation. The amelioration of GVHD after treatment with the fullerol was also associated with reduced intestinal lesions and consequent bacterial translocation to the blood, liver and peritoneal cavity. Moreover, the fullerol treatment alleviated the GVHD while preserving effects of the graft against a leukemia cell line (GFP+P815). In summary, the fullerol was effective in reducing the GVHD inflammatory response in mice and may suggest novel ways to treat this disease. PMID:25875016

  9. The Oncogenic Potential of Human Cytomegalovirus and Breast Cancer

    PubMed Central

    Herbein, Georges; Kumar, Amit

    2014-01-01

    Breast cancer is the leading causes of cancer-related death among women. The vast majority of breast cancers are carcinomas that originate from cells lining the milk-forming ducts of the mammary gland. Numerous articles indicate that breast tumors exhibit diverse phenotypes depending on their distinct physiopathological signatures, clinical courses, and therapeutic possibilities. The human cytomegalovirus (HCMV) is a multifaceted highly host specific betaherpesvirus that is regarded as asymptomatic or mildly pathogenic virus in immunocompetent host. HCMV may cause serious in utero infections as well as acute and chronic complications in immunocompromised individual. The involvement of HCMV in late inflammatory complications underscores its possible role in inflammatory diseases and cancer. HCMV targets a variety of cell types in vivo, including macrophages, epithelial cells, endothelial cells, fibroblasts, stromal cells, neuronal cells, smooth muscle cells, and hepatocytes. HCMV can be detected in the milk after delivery and thereby HCMV could spread to adjacent mammary epithelial cells. HCMV also infects macrophages and induces an atypical M1/M2 phenotype, close to the tumor-associated macrophage phenotype, which is associated with the release of cytokines involved in cancer initiation or promotion and breast cancer of poor prognosis. HCMV antigens and DNA have been detected in tissue biopsies of breast cancers and elevation in serum HCMV IgG antibody levels has been reported to precede the development of breast cancer in some women. In this review, we will discuss the potential role of HCMV in the initiation and progression of breast cancer. PMID:25202681

  10. Cytomegalovirus infection following liver transplantation: review of the literature.

    PubMed

    Kanj, S S; Sharara, A I; Clavien, P A; Hamilton, J D

    1996-03-01

    Cytomegalovirus (CMV) remains a major cause of problems following solid organ transplantation, accounting for a significant increase in morbidity and affiliated costs. Infection with CMV following orthotopic liver transplantation (OLT) is commonly seen as a result of marked cell-mediated immunosuppression and is an independent risk factor for opportunistic and fungal infections. The role of CMV infection in acute cellular or chronic rejection remains unclear. Recent advances in diagnostic modalities, particularly the use of the antigenemia assay and the polymerase chain reaction, have provided ways to quantitate viral load during infection or disease, as well as providing a useful marker of response to therapy. Ganciclovir remains the best antiviral agent for the treatment of CMV disease, but the use of combination therapy with other antivirals or CMV immunoglobulin may improve outcome for patients with severe disease. The ideal prophylactic therapy for patients undergoing OLT remains to be identified, as tested regimens have shown variable efficacy when analyzed with regard to defined risk groups. The use of risk group-specific prophylaxis may prove to be most successful, however, in terms of efficacy and cost savings. Future advances in basic CMV virology and transplant immunology will be essential in defining rational approaches to control and prevention of CMV infection and disease following liver transplantation. PMID:8852975

  11. Role of the protein annexin A1 on the efficacy of anti-TNF treatment in a murine model of acute colitis.

    PubMed

    de Paula-Silva, Marina; Barrios, Bibiana Elisabeth; Macció-Maretto, Lisa; Sena, Angela Aparecida; Farsky, Sandra Helena Poliselli; Correa, Silvia Graciela; Oliani, Sonia Maria

    2016-09-01

    TNF-α is involved in the mechanisms that initiate inflammatory bowel diseases (IBDs). Anti-TNF-α drugs, such as infliximab (IFX), cause non-responsiveness and side effects, indicating the need to investigate alternative therapies for these diseases. The anti-inflammatory protein, annexin A1 (AnxA1), has been associated with the protection of the gastrointestinal mucosa. To further address the role of endogenous AnxA1 on the TNF-α blockade efficacy in a murine model, we assessed colitis induced by Dextran Sulfate Sodium (DSS) in wild-type (WT) and AnxA1(-/-) Balb/c mice treated with IFX. We consistently observed endogenous AnxA1 prevented clinical and physiological manifestations of experimental colitis treated with IFX, additionally the manifestation of the disease was observed earlier in AnxA1(-)(/-) mice. Rectal bleeding, diarrhea, histological score, epithelial damages and collagen degradation caused by DSS were prevented following IFX treatment only in WT mice. IL-6 increased during colitis in WT and AnxA1(-)(/-) mice, decreasing under IFX treatment in WT. The influx of neutrophils and TNF-α secretion were largely elevated in AnxA1(-)(/-) mice when compared to WT mice. In the group WT/DSS+IFX, phagocytes were more susceptible to apoptosis following treatment with IFX. Endogenous expression of AnxA1 increased after DSS and decreased with IFX treatment, demonstrating an attenuated inflammatory response. The data indicate that AnxA1 contributes to the establishment of intestinal homeostasis after blocking of TNF-α was used as a treatment of IBD, constituting a key molecule in the mechanism of action and a potential biomarker of therapeutic efficacy. PMID:27343762

  12. Human cytomegalovirus induces JC virus DNA replication in human fibroblasts.

    PubMed Central

    Heilbronn, R; Albrecht, I; Stephan, S; Bürkle, A; zur Hausen, H

    1993-01-01

    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248262

  13. Cytomegalovirus Colitis in a Burn Patient.

    PubMed

    Gibbs, Jeff T; Zieger, Madeline; Sood, Rajiv

    2016-01-01

    The prevalence of cytomegalovirus in the burn population is high. However, its role in the clinical management of burn patients is still being defined. This report documents a 41-year-old man who developed cytomegalovirus (CMV) colitis after being admitted with a 72% burn. Before the administration of ganciclovir, the authors had difficulty controlling his quantitative wound cultures with serial debridements, topical agents, and systemic antibiotics for known pathogens, which led to graft loss. After the ganciclovir was given, his quantitative wound cultures improved without changing the authors' topical agents or systemic antibiotics and had improved graft take. Whether CMV infection alone contributed to an increased morbidity in this patient or the combination of bacteria/fungal infection with CMV led to a synergistic effect is still not clearly understood. CMV may have contributed to a dysfunction in his cell mediated immunity, which, in turn, lowered the bacterial and fungal load necessary to cause graft loss. Patients who continue to do poorly despite adequate treatment for known pathogens may need to be screened for CMV and treated. PMID:26056763

  14. Effects of 28Si ions, 56Fe ions, and protons on the induction of murine acute myeloid leukemia and hepatocellular carcinoma.

    PubMed

    Weil, Michael M; Ray, F Andrew; Genik, Paula C; Yu, Yongjia; McCarthy, Maureen; Fallgren, Christina M; Ullrich, Robert L

    2014-01-01

    Estimates of cancer risks posed to space-flight crews by exposure to high atomic number, high-energy (HZE) ions are subject to considerable uncertainty because epidemiological data do not exist for human populations exposed to similar radiation qualities. We assessed the carcinogenic effects of 300 MeV/n 28Si or 600 MeV/n 56Fe ions in a mouse model for radiation-induced acute myeloid leukemia and hepatocellular carcinoma. C3H/HeNCrl mice were irradiated with 0.1, 0.2, 0.4, or 1 Gy of 300 MeV/n 28Si ions, 600 MeV/n 56Fe ions or 1 or 2 Gy of protons simulating the 1972 solar particle event (1972SPE) at the NASA Space Radiation Laboratory. Additional mice were irradiated with 137Cs gamma rays at doses of 1, 2, or 3 Gy. All groups were followed until they were moribund or reached 800 days of age. We found that 28Si or 56Fe ions do not appear to be substantially more effective than gamma rays for the induction of acute myeloid leukemia. However, 28Si or 56Fe ion irradiated mice had a much higher incidence of hepatocellular carcinoma than gamma ray irradiated or proton irradiated mice. These data demonstrate a clear difference in the effects of these HZE ions on the induction of leukemia compared to solid tumors, suggesting potentially different mechanisms of tumorigenesis. Also seen in this study was an increase in metastatic hepatocellular carcinoma in the 28Si and 56Fe ion irradiated mice compared with those exposed to gamma rays or 1972SPE protons, a finding with important implications for setting radiation exposure limits for space-flight crew members. PMID:25126721

  15. Effects of 28Si Ions, 56Fe Ions, and Protons on the Induction of Murine Acute Myeloid Leukemia and Hepatocellular Carcinoma

    PubMed Central

    Weil, Michael M.; Ray, F. Andrew; Genik, Paula C.; Yu, Yongjia; McCarthy, Maureen; Fallgren, Christina M.; Ullrich, Robert L.

    2014-01-01

    Estimates of cancer risks posed to space-flight crews by exposure to high atomic number, high-energy (HZE) ions are subject to considerable uncertainty because epidemiological data do not exist for human populations exposed to similar radiation qualities. We assessed the carcinogenic effects of 300 MeV/n 28Si or 600 MeV/n 56Fe ions in a mouse model for radiation-induced acute myeloid leukemia and hepatocellular carcinoma. C3H/HeNCrl mice were irradiated with 0.1, 0.2, 0.4, or 1 Gy of 300 MeV/n 28Si ions, 600 MeV/n 56Fe ions or 1 or 2 Gy of protons simulating the 1972 solar particle event (1972SPE) at the NASA Space Radiation Laboratory. Additional mice were irradiated with 137Cs gamma rays at doses of 1, 2, or 3 Gy. All groups were followed until they were moribund or reached 800 days of age. We found that 28Si or 56Fe ions do not appear to be substantially more effective than gamma rays for the induction of acute myeloid leukemia. However, 28Si or 56Fe ion irradiated mice had a much higher incidence of hepatocellular carcinoma than gamma ray irradiated or proton irradiated mice. These data demonstrate a clear difference in the effects of these HZE ions on the induction of leukemia compared to solid tumors, suggesting potentially different mechanisms of tumorigenesis. Also seen in this study was an increase in metastatic hepatocellular carcinoma in the 28Si and 56Fe ion irradiated mice compared with those exposed to gamma rays or 1972SPE protons, a finding with important implications for setting radiation exposure limits for space-flight crew members. PMID:25126721

  16. Evaluating Human T-Cell Therapy of Cytomegalovirus Organ Disease in HLA-Transgenic Mice

    PubMed Central

    Thomas, Simone; Klobuch, Sebastian; Podlech, Jürgen; Plachter, Bodo; Hoffmann, Petra; Renzaho, Angelique; Theobald, Matthias

    2015-01-01

    Reactivation of human cytomegalovirus (HCMV) can cause severe disease in recipients of hematopoietic stem cell transplantation. Although preclinical research in murine models as well as clinical trials have provided 'proof of concept' for infection control by pre-emptive CD8 T-cell immunotherapy, there exists no predictive model to experimentally evaluate parameters that determine antiviral efficacy of human T cells in terms of virus control in functional organs, prevention of organ disease, and host survival benefit. We here introduce a novel mouse model for testing HCMV epitope-specific human T cells. The HCMV UL83/pp65-derived NLV-peptide was presented by transgenic HLA-A2.1 in the context of a lethal infection of NOD/SCID/IL-2rg-/- mice with a chimeric murine CMV, mCMV-NLV. Scenarios of HCMV-seropositive and -seronegative human T-cell donors were modeled by testing peptide-restimulated and T-cell receptor-transduced human T cells, respectively. Upon transfer, the T cells infiltrated host tissues in an epitope-specific manner, confining the infection to nodular inflammatory foci. This resulted in a significant reduction of viral load, diminished organ pathology, and prolonged survival. The model has thus proven its potential for a preclinical testing of the protective antiviral efficacy of HCMV epitope-specific human T cells in the evaluation of new approaches to an immunotherapy of CMV disease. PMID:26181057

  17. Mast cells: innate attractors recruiting protective CD8 T cells to sites of cytomegalovirus infection.

    PubMed

    Podlech, Jürgen; Ebert, Stefan; Becker, Marc; Reddehase, Matthias J; Stassen, Michael; Lemmermann, Niels A W

    2015-06-01

    Reactivation of latent cytomegalovirus (CMV) in the transient immunocompromised state after hematoablative treatment is a major concern in patients undergoing hematopoietic cell transplantation (HCT) as a therapy of hematopoietic malignancies. Timely reconstitution of antiviral CD8 T cells and their efficient recruitment to the lungs is crucial for preventing interstitial pneumonia, the most severe disease manifestation of CMV in HCT recipients. Here, we review recent work in a murine model, implicating mast cells (MC) in the control of pulmonary infection. Murine CMV (mCMV) productively infects MC in vivo and triggers their degranulation, resulting in the release of the CC chemokine ligand 5 (CCL5) that attracts CD8 T cells to infiltrate infected tissues. Comparing infection of MC-sufficient C57BL/6 mice and congenic MC-deficient Kit (W-sh/W-sh) "sash" mutants revealed an inverse relation between the number of lung-infiltrating CD8 T cells and viral burden in the lungs. Specifically, reduced lung infiltration by CD8 T cells in "sash" mutants was associated with an impaired infection control. The causal, though indirect, involvement of MC in antiviral control was confirmed by reversion of the deficiency phenotype in "sash" mutants reconstituted with MC. These recent findings predict that efficient MC reconstitution facilitates the control of CMV infection also in immunocompromised HCT recipients. PMID:25648117

  18. Post-exposure administration of diazepam combined with soluble epoxide hydrolase inhibition stops seizures and modulates neuroinflammation in a murine model of acute TETS intoxication

    SciTech Connect

    Vito, Stephen T.; Austin, Adam T.; Banks, Christopher N.; Inceoglu, Bora; Bruun, Donald A.; Zolkowska, Dorota; Tancredi, Daniel J.; Rogawski, Michael A.; Hammock, Bruce D.; Lein, Pamela J.

    2014-12-01

    Tetramethylenedisulfotetramine (TETS) is a potent convulsant poison for which there is currently no approved antidote. The convulsant action of TETS is thought to be mediated by inhibition of type A gamma-aminobutyric acid receptor (GABA{sub A}R) function. We, therefore, investigated the effects of post-exposure administration of diazepam, a GABA{sub A}R positive allosteric modulator, on seizure activity, death and neuroinflammation in adult male Swiss mice injected with a lethal dose of TETS (0.15 mg/kg, ip). Administration of a high dose of diazepam (5 mg/kg, ip) immediately following the second clonic seizure (approximately 20 min post-TETS injection) effectively prevented progression to tonic seizures and death. However, this treatment did not prevent persistent reactive astrogliosis and microglial activation, as determined by GFAP and Iba-1 immunoreactivity and microglial cell morphology. Inhibition of soluble epoxide hydrolase (sEH) has been shown to exert potent anti-inflammatory effects and to increase survival in mice intoxicated with other GABA{sub A}R antagonists. The sEH inhibitor TUPS (1 mg/kg, ip) administered immediately after the second clonic seizure did not protect TETS-intoxicated animals from tonic seizures or death. Combined administration of diazepam (5 mg/kg, ip) and TUPS (1 mg/kg, ip, starting 1 h after diazepam and repeated every 24 h) prevented TETS-induced lethality and influenced signs of neuroinflammation in some brain regions. Significantly decreased microglial activation and enhanced reactive astrogliosis were observed in the hippocampus, with no changes in the cortex. Combining an agent that targets specific anti-inflammatory mechanisms with a traditional antiseizure drug may enhance treatment outcome in TETS intoxication. - Highlights: • Acute TETS intoxication causes delayed and persistent neuroinflammation. • Diazepam given post-TETS prevents lethal tonic seizures but not neuroinflammation. • A soluble epoxide hydrolase

  19. Progressive Hearing Impairment in Children with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Dahle, Arthur J.; And Others

    1979-01-01

    Audiological assessment of 86 children (mean age 38 months at last evaluation time) with congenital cytomegalovirus infection revealed progressive hearing loss in four of 12 Ss with sensorineural hearing impairments. Case descriptions documented the progression of the hearing loss. (Author)

  20. Late cytomegalovirus infection after hematopoietic stem cell transplantation: case reports

    PubMed Central

    Pinheiro, Sâmara Grapiuna; de Matos, Sócrates Bezerra; Botura, Mônica Borges; Meyer, Roberto; Lima, Fernanda Washington de Mendonça

    2013-01-01

    Cytomegalovirus is related to high rates of morbidity and mortality after hematopoietic stem cell transplantation. This report highlights the importance of adequate monitoring and management of this infection. We report on two cases of patients with late subclinical cytomegalovirus infection. These patients were monitored for antigenemia by indirect immunofluorescence assay. Active cytomegalovirus infection is most common in the first three months after transplantation however the cases reported herein show the importance of monitoring for active infection after Day +100 post-transplantation. Early detection of active infection enables quick preemptive therapy. In conclusion, we emphasize that patients with risk factors for developing severe or late cytomegalovirus disease should be monitored for more than 100 post-transplant days as late active infection is a reality. PMID:24478611

  1. The Anti-Trypanosoma cruzi activity of posaconazole in a murine model of acute Chagas' disease is less dependent on gamma interferon than that of benznidazole.

    PubMed

    Ferraz, Marcela L; Gazzinelli, Ricardo T; Alves, Rosana O; Urbina, Julio A; Romanha, Alvaro J

    2007-04-01

    We have investigated the influences of gamma interferon (IFN-gamma) and interleukin-12 (IL-12) on the efficacy of posaconazole (POS) treatment of acute experimental infections with Trypanosoma cruzi; the standard drug, benznidazole (BZ), was used as a positive control. Wild-type (WT) mice infected with T. cruzi and treated with POS or BZ had no parasitemia, 100% survival, and cure rates of 86 to 89%. IFN-gamma-knockout (KO) mice infected with T. cruzi and treated with BZ controlled the infection during treatment but relapsed after the drug pressure ceased and had 0% survival, while those receiving POS better controlled the infection after the end of treatment and had 70% survival (P<0.0001 compared to the results for both untreated and BZ-treated animals). IL-12-KO mice infected and treated with POS or BZ had intermediate results, displaying enhanced parasitemia, decreased survival (77 to 83%), and reduced cure rates (35 to 39%) compared with those of the WT animals. Our results demonstrate that either IFN-gamma or IL-12 deficiency reduces the efficacy of POS or BZ in this experimental model but also indicate that the anti-T. cruzi activity of POS is much less dependent on the activity of IFN-gamma than that of BZ is. PMID:17220408

  2. Cytomegalovirus and Langerhans Cell Histiocytosis: Is There a Link?

    PubMed Central

    Khoddami, Maliheh; Nadji, Seyed-Alireza; Dehghanian, Paria; Vahdatinia, Mahsa; Shamshiri, Ahmad-Reza

    2016-01-01

    Background: Langerhans cell histiocytosis is a rare proliferative histiocytic disease of unknown etiology. Histologically, it is characterized by granuloma-like proliferation of Langerhans-type dendritic cells derived from bone marrow. Many investigators have suggested the possible role of viruses such as Epstein-Barr virus, human herpesvirus-6 (HHV-6), herpes simplex virus (HSV) types 1 and 2, and Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. Objectives: In this study, we have investigated the presence of Cytomegalovirus in Langerhans cell histiocytosis in Iranian children. Patients and Methods: In this retrospective study, we have investigated the presence of Cytomegalovirus DNA expression, using paraffin-embedded tissue samples of 30 patients with Langerhans cell histiocytosis and 30 age and site-matched controls by qualitative Polymerase Chain Reaction (PCR) method. Results: No significant difference in prevalence of Cytomegalovirus presence between patients and controls was found. Cytomegalovirus was found by qualitative PCR in only 2 (6.66%) out of 30 patients and in 1 (3.3%) of 30 control samples with a P value of 1 (1.00 > 0.05) using chi-square test with OR: 2.07; 95% CI of OR: 0.18 - 24.15. Conclusions: Our findings do not support the hypothesis of a possible role for Cytomegalovirus in the pathogenesis of Langerhans cell histiocytosis. PMID:27307972

  3. Biochemical and histological evaluations of anti-inflammatory and antioxidant p-chloro-selenosteroid actions in acute murine models of inflammation.

    PubMed

    Marcondes Sari, Marcel Henrique; Souza, Ana Cristina Guerra; Rosa, Suzan Gonçalves; Chagas, Pietro Maria; da Luz, Sônia Cristina Almeida; Rodrigues, Oscar Endrigo Dorneles; Nogueira, Cristina Wayne

    2016-06-15

    This study investigated the potential p-chloro-selenosteroid (PCS) anti-inflammatory effect in different animal models of acute inflammation. In order to determine a time- and a dose-curve response of action, female adult Swiss mice (25-35g) were divided in different groups and pretreated by the intragastric route (i.g.) with PCS (5-10mg/kg) and after the specific times (5, 30 and 60min) the ear inflammation was induced with croton oil (2.5%, 20μl). The ear edema, myeloperoxidase (MPO) activity and histological analyses were performed. In a second experiment, the pleurisy model was used to determine the PCS protective effect (10mg/kg, i.g., 30min before induction) in the inflammatory and oxidative alterations induced by an intrapleural injection of a 1% carrageenan solution (0.1ml) in exudate and lung samples. Dexamethasone (1mg/kg, i.g.) was used as positive control for both models. Statistical analysis was performed through a One-Way ANOVA test followed by the Newman-Keuls' test. Pretreatment of 30min with PCS, only at a dose of 10mg/kg, decreased ear edema and the MPO activity as well as the histological alterations induced by croton oil. In the pleurisy model, PCS (10mg/kg, i.g.; 30min) reduced the leukocyte counts, histological alterations, MPO and adenosine deaminase activities, oxidative damage and the non-enzymatic antioxidant defense imbalance. PCS had a similar anti-inflammatory profile to dexamethasone; however, it showed a better antioxidant effect. PCS had anti-inflammatory and antioxidant actions in two well established inflammation models in mice. PMID:27102337

  4. Cytomegalovirus myelitis in perinatally acquired HIV.

    PubMed Central

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W

    1993-01-01

    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, neurons, macrophages, ependymal, endothelial, and Schwann cells. Other organs had no signs of CMV infection. Central nervous spinal CMV infection was most probably due to insufficient penetration of the blood-brain barrier by the CMV hyper-immunoglobulin. In suspicious cases early spinal magnetic resonance imaging (1.5 tesla) combined with an examination of urine and cerebrospinal fluid for CMV is recommended. Images Figure 1 Figure 2 Figure 3 PMID:8385439

  5. Cytomegalovirus as an Insidious Pathogen Causing Duodenitis.

    PubMed

    Hagiya, Hideharu; Iwamuro, Masaya; Tanaka, Takehiro; Hanayama, Yoshihisa; Otsuka, Fumio

    2015-01-01

    A 60-year-old woman with rheumatoid arthritis treated with methotrexate for a decade complained of slight epigastric discomfort. A positive cytomegalovirus (CMV) antigenemia test indicated the probability of CMV-related gastrointestinal infection, for which esophagogastroduodenoscopy was performed. Endoscopic findings showed a non-specific duodenal mucosal lesion;however, pathological investigation revealed evidence of CMV duodenitis. There is scarce information on the clinical and pathological features of CMV-related duodenitis, likely due to its low prevalence. CMV infection in the upper gastrointestinal tract should be considered as a differential diagnosis in high-risk individuals, particularly those with symptoms relating to the digestive system. Biopsy examinations are preferable for the definitive diagnosis of CMV gastrointestinal infection, even without specific endoscopic features. PMID:26490030

  6. Viral and host control of cytomegalovirus maturation

    PubMed Central

    Tandon, Ritesh; Mocarski, Edward S.

    2012-01-01

    Maturation in herpesviruses initiates in the nucleus of the infected cell with encapsidation of viral DNA to form nucleocapsids and concludes with envelopment in the cytoplasm to form infectious virions that egress the cell. The entire process of virus maturation is orchestrated by protein-protein interactions and enzymatic activities of viral and host origin. Viral tegument proteins play important roles in maintaining the structural stability of capsids and directing the acquisition of virus envelope. Envelopment occurs at modified host membranes and exploits host vesicular trafficking. In this review, we summarize the current knowledge and concepts in human cytomegalovirus (HCMV) maturation and their parallels in other herpesviruses with an emphasis on viral and host factors regulating this process. PMID:22633075

  7. Overview: cytomegalovirus and the herpesviruses in transplantation.

    PubMed

    Fishman, J A

    2013-02-01

    Herpesviruses infect most animal species. Infections due to the eight human herpesviruses (HHV) are exacerbated by immunosuppression in organ transplantation. The special features of the herpesvirus life cycle include the ability to establish latent, nonproductive infection and the life-long capacity for reactivation to productive, lytic infection. Interactions between latent virus and the immune system determine the frequency and severity of symptomatic infections. The immunologic and cellular effects of herpesvirus infections contribute to risk for opportunistic infections and graft rejection. Among the most important advances in transplantation are laboratory assays for the diagnosis and monitoring of herpesvirus infections and antiviral agents with improved efficacy in prophylaxis and therapy. For herpes simplex virus, varicella zoster virus and cytomegalovirus, these advances have significantly reduced the morbidity of infection. The syndromes of EBV-associated posttransplant lymphoproliferative disorders (PTLD) and Kaposi's sarcoma remain important complications of immunosuppression. The epidemiology and essential biology of human herpesvirus is reviewed. PMID:23347210

  8. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  9. Optimum treatment of congenital cytomegalovirus infection.

    PubMed

    Leruez-Ville, Marianne; Ville, Yves

    2016-01-01

    Congenital cytomegalovirus infection affects 0.7% of live births and is the leading cause of congenital neurological handicaps of infectious origin. However, systematic screening of this infection has not been implemented in pregnancy or at birth in any country. This apparent paradox has been justified by the unavailability of an efficient vaccine and by the scarcity of data available on the treatment of congenital CMV. However, in the last decade interesting new data on the management of this congenital infection has emerged including new results on both neonatal and postnatal treatments. This review provides an update on the potential benefits of antiviral treatment and on passive immunisation both in the neonatal and the antenatal periods. These suggest a benefit to a proactive approach for neonatal and prenatal congenital infections. PMID:27043943

  10. Pathogenesis of Experimental Rhesus Cytomegalovirus Infection

    PubMed Central

    Lockridge, Kristen M.; Sequar, Getachew; Zhou, Shan Shan; Yue, Yujuan; Mandell, Carol P.; Barry, Peter A.

    1999-01-01

    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v.), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  11. Late-onset cytomegalovirus infection complicated by Guillain-Barre syndrome in a kidney transplant recipient: case report and review of the literature.

    PubMed

    Shaban, E; Gohh, R; Knoll, B M

    2016-04-01

    Cytomegalovirus (CMV) infection remains a common infection after solid-organ transplantation. In the general population CMV disease is associated with Guillain-Barre syndrome (GBS), an autoimmune disease leading to an acute peripheral neuropathy, in 1 of 1000 cases. Interestingly, GBS is a rarely observed complication in solid-organ transplant recipients, possibly related to maintenance immunosuppression. We describe a case of CMV infection complicated by GBS in a kidney transplant recipient and review the literature. PMID:26141820

  12. The S1P/S1PR2 axis regulates early airway T cell infiltration in murine mast cell-dependent acute allergic responses

    PubMed Central

    Oskeritzian, Carole A.; Hait, Nitai C.; Wedman, Piper; Chumanevich, Alena; Kolawole, Elizabeth M.; Price, Megan M.; Falanga, Yves T.; Harikumar, Kuzhuvelil B.; Ryan, John J.; Milstien, Sheldon; Sabbadini, Roger; Spiegel, Sarah

    2014-01-01

    Background Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid produced by mast cells (MC) upon cross-linking of their high affinity receptors for IgE by antigen (Ag) that can amplify MC responses by binding to its S1P receptors. Acute MC-dependent allergic reaction can lead to systemic shock but the early events of its development in lung tissues have not been investigated, and S1P functions in the onset of allergic processes remain to be examined. Objective We used a highly specific neutralizing anti-S1P antibody (mAb) and an S1P receptor 2 (S1PR2) antagonist, JTE-013, to study S1P and S1PR2 signaling contributions to MC- and IgE-dependent airway allergic responses in mice within minutes after Ag challenge. Methods Allergic reaction was triggered by a single intraperitoneal (i.p.) dose of Ag in sensitized mice pre-treated i.p. with anti-S1P or isotype control mAb, or JTE-013 or vehicle prior to Ag challenge. Results Kinetics experiments revealed early pulmonary infiltration of mostly T cells around blood vessels of sensitized mice 20 minutes post-Ag exposure. Pre-treatment with anti-S1P mAb inhibited in vitro MC activation, as well as in vivo development of airway infiltration and MC activation, reducing serum levels of histamine, cytokines and the chemokines MCP-1/CCL2, MIP-1α/CCL3 and RANTES/CCL5. S1PR2 antagonism or deficiency, or MC deficiency recapitulated these results. Both in vitro and in vivo experiments demonstrated MC S1PR2 dependency for chemokine release and the necessity for signal transducer and activator of transcription 3 (Stat3) activation. Conclusion Activation of S1PR2 by S1P and downstream Stat3 signaling in MC regulate early T cell recruitment to antigen-challenged lungs by chemokine production. PMID:25512083

  13. CYTOMEGALOVIRUS CONTRIBUTES TO GLIOBLASTOMA IN THE CONTEXT OF TUMOR SUPPRESSOR MUTATIONS

    PubMed Central

    Chiocca, E. Antonio; Price, Richard L.; Hollon, Todd; Alvarez-Breackenridge, Christopher; Fernandez, Soledad; Oglesbee, Mike; Cook, Charles; Lawler, Sean; Kwon, Chang-Hyuk

    2014-01-01

    BACKGROUND: There have been several reports that have linked human cytomegalovirus (CMV) to gliomas. Although clinical trials of immunotherapy against CMV antigens found in gliomas have commenced in multiple institutions, the data linking these tumors to this virus remains controversial. METHODS: To study the controversial role of cytomegalovirus (CMV) in glioblastoma, we assessed the effects of murine CMV (MCMV) perinatal infection in a GFAP-cre; Nf1loxP/+ ; Trp53-/+ genetic mouse model of glioma (Mut3 mice). RESULTS: Early on after infection, MCMV antigen was predominantly localized in CD45+ lymphocytes in the brain with active viral replication and local areas of inflammation, but by 7 weeks there was a generalized loss of MCMV in brain, confirmed by bioluminescent imaging. MCMV-infected Mut3 mice exhibited a shorter survival time from their gliomas, when compared to control Mut3 mice, perinatally infected with mock or with a different neurotropic virus. Animal survival was also significantly shortened when orthotopic gliomas were implanted in mice perinatally infected with MCMV vs. controls. MCMV infection increased phosphorylated STAT3 (P-STAT3) levels in neural stem cells (NSCs) harvested from Mut3 mice SVZ and in vivo there was increased P-STAT3 in NSCs in MCMV-infected compared to control mice. Of relevance, human CMV (HCMV) also increased P-STAT3 and proliferation of patient-derived glioblastoma neurospheres, while a STAT3 inhibitor reversed this effect in vitro and in vivo. CONCLUSIONS: These findings thus associate CMV infection to a STAT3-dependent modulatory role in glioma formation/progression in the context of tumor suppressor mutations in mice and possibly in humans. SECONDARY CATEGORY: Neuropathology & Tumor Biomarkers.

  14. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant

    MedlinePlus

    ... Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a ... weakened by medicines that you must take after stem cell transplant and by the transplant itself. Your body ...

  15. A cyclooxygenase-2 homologue encoded by rhesus cytomegalovirus is a determinant for endothelial cell tropism.

    PubMed

    Rue, Cary A; Jarvis, Michael A; Knoche, Amber J; Meyers, Heather L; DeFilippis, Victor R; Hansen, Scott G; Wagner, Markus; Früh, Klaus; Anders, David G; Wong, Scott W; Barry, Peter A; Nelson, Jay A

    2004-11-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  16. A Cyclooxygenase-2 Homologue Encoded by Rhesus Cytomegalovirus Is a Determinant for Endothelial Cell Tropism

    PubMed Central

    Rue, Cary A.; Jarvis, Michael A.; Knoche, Amber J.; Meyers, Heather L.; DeFilippis, Victor R.; Hansen, Scott G.; Wagner, Markus; Früh, Klaus; Anders, David G.; Wong, Scott W.; Barry, Peter A.; Nelson, Jay A.

    2004-01-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  17. Fulminant Cytomegalovirus Myocarditis in an Immunocompetent Host: Resolution with Oral Valganciclovir

    PubMed Central

    Kumar, Anupam; Padala, Sandeep

    2014-01-01

    We report a case of fulminant myocarditis after a primary cytomegalovirus infection, in a previously healthy 72-year-old woman. The infection underwent clinical and immunologic resolution consequent to treatment with oral valganciclovir. In an immunocompetent host, the primary cytomegalovirus infection is usually asymptomatic or manifests itself as a heterophile-negative mononucleosis-like syndrome. Cytomegalovirus myocarditis is uncommon in immunocompetent patients. After presenting our case, we review the literature on cytomegalovirus myocarditis in immunocompetent individuals. PMID:25425988

  18. Limitations of the murine nose in the development of nonviral airway gene transfer.

    PubMed

    Griesenbach, Uta; Sumner-Jones, Stephanie G; Holder, Emma; Munkonge, Felix M; Wodehouse, Theresa; Smith, Stephen N; Wasowicz, Marguerite Y; Pringle, Ian; Casamayor, Isabel; Chan, Mario; Coles, Rebecca; Cornish, Nikki; Dewar, Ann; Doherty, Ann; Farley, Raymond; Green, Anne-Marie; Jones, Bryony L; Larsen, Mia D B; Lawton, Anna E; Manvell, Michelle; Painter, Hazel; Singh, Charanjit; Somerton, Lucinda; Stevenson, Barbara; Varathalingam, Anusha; Siegel, Craig; Scheule, Ronald K; Cheng, Seng H; Davies, Jane C; Porteous, David J; Gill, Deborah R; Boyd, A Christopher; Hyde, Steve C; Alton, Eric W F W

    2010-07-01

    A clinical program to assess whether lipid GL67A-mediated gene transfer can ameliorate cystic fibrosis (CF) lung disease is currently being undertaken by the UK CF Gene Therapy Consortium. We have evaluated GL67A gene transfer to the murine nasal epithelium of wild-type and CF knockout mice to assess this tissue as a test site for gene transfer agents. The plasmids used were regulated by either (1) the commonly used short-acting cytomegalovirus promoter/enhancer or (2) the ubiquitin C promoter. In a study of approximately 400 mice with CF, vector-specific CF transmembrane conductance regulator (CFTR) mRNA was detected in nasal epithelial cells of 82% of mice treated with a cytomegalovirus-plasmid (pCF1-CFTR), and 62% of mice treated with an ubiquitin C-plasmid. We then assessed whether CFTR gene transfer corrected a panel of CFTR-specific endpoint assays in the murine nose, including ion transport, periciliary liquid height, and ex vivo bacterial adherence. Importantly, even with the comparatively large number of animals assessed, the CFTR function studies were only powered to detect changes of more than 50% toward wild-type values. Within this limitation, no significant correction of the CF phenotype was detected. At the current levels of gene transfer efficiency achievable with nonviral vectors, the murine nose is of limited value as a stepping stone to human trials. PMID:19648474

  19. PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter.

    PubMed

    Chao, Sheng-Hao; Harada, Josephine N; Hyndman, Francie; Gao, Xiaoqi; Nelson, Christian G; Chanda, Sumit K; Caldwell, Jeremy S

    2004-04-16

    Cellular homeoproteins have been shown to regulate the transcription of several viruses, including herpes simplex viruses, human papillomaviruses, and mouse mammary tumor viruses. Previous studies investigating the anti-viral mechanisms of several cyclin-dependent kinase inhibitors showed that the homeoproteins, pre B-cell leukemia transcription factor 1 (PBX1) and PBX-regulating protein-1 (PREP1), function as transcriptional activators of Moloney murine leukemia virus. Here, we examined the involvement of cellular homeoproteins in regulating the activity of the human cytomegalovirus immediate early (CMV IE) promoter. We identified a 45-bp element located at position -593 to -549 upstream of the transcription start site of the CMV IE gene, which contains multiple putative homeoprotein binding motifs. Gel shift assays demonstrated the physical association between a homeodomain protein, pancreatic-duodenal homeobox factor-1 (PDX1) and the 45-bp cytomegalovirus (CMV) region. We further determined that PDX1 represses the CMV IE promoter activity in 293 cells. Overexpression of PDX1 resulted in a decrease in transcription of the CMV IE gene. Conversely, blocking PDX1 protein synthesis and mutating the PDX1 binding sites enhanced CMV IE-dependent transcription. Collectively, our results represent the first work demonstrating that a cellular homeoprotein, PDX1, may be a repressor involved in regulation of human CMV gene expression. PMID:14764605

  20. [Ulcerous colitis and infection with cytomegalovirus, herpes simplex virus and clostridium difficile].

    PubMed

    Arnold, C; von Sanden, S; Theilacker, C; Blum, H E

    2008-08-01

    The treatment of severe flares of ulcerative colitis is based on systemic corticosteroids, immunomodulators such as cyclosporine and azathioprine and in some cases TNF-alpha-antagonists, respectively. These immunosuppressed patients are susceptible for infectious pathogens. Here we report the case of a patient with a severe flare of ulcerative colitis that was first treated with systemic corticosteroids combined with immunomodulators and subsequent with infliximab. The patient then experienced an infection with Clostridium difficile and cytomegalovirus of the colon and a Herpes simplex esophagitis, respectively. After specific treatment the patient responded well to the immunosuppressive therapy. This case illustrates that infections have to be considered before systemic treatment of an acute flare of ulcerative colitis is instituted especially in the case of disease activation during immunosuppressive treatment. PMID:18759202

  1. Immunomodulation by cytomegaloviruses: manipulative strategies beyond evasion.

    PubMed

    Mocarski, Edward S

    2002-07-01

    Human cytomegalovirus (CMV) remains the major infectious cause of birth defects as well as an important opportunistic pathogen. Individuals infected with CMV mount a strong immune response that suppresses persistent viral replication and maintains life-long latency. Loss of immune control opens the way to virus reactivation and disease. The large number of immunomodulatory functions encoded by CMV increases the efficiency of infection, dissemination, reactivation and persistent infection in hosts with intact immune systems and could contribute to virulence in immunocompromised hosts. These functions modulate both the innate and adaptive arms of the immune response and appear to target cellular rather than humoral responses preferentially. CMV encodes a diverse arsenal of proteins focused on altering and/or mimicking: (1) classical and non-classical major histocompatibility complex (MHC) protein function; (2) leukocyte migration, activation and cytokine responses; and (3) host cell susceptibility to apoptosis. Evidence that the host evolves mechanisms to counteract virus immune modulation is also accumulating. Although immune evasion is certainly one clear goal of the virus, the pro-inflammatory impact of certain viral functions suggests that increased inflammation benefits viral dissemination. The ability of such viral functions to successfully 'face off' against the host immune system ensures the success of this pathogen in the human population and could provide key insights into disease mechanisms. PMID:12110212

  2. Leflunomide for cytomegalovirus: bench to bedside.

    PubMed

    Chacko, B; John, G T

    2012-04-01

    Cytomegalovirus (CMV) remains a major cause of morbidity and mortality among transplant recipients, frequently engaging the clinician in a struggle to balance graft preservation with control of CMV disease. Leflunomide has been shown to have immunosuppressive activity in experimental allograft models together with antiviral activity inhibiting CMV both in vitro and in vivo. Data are emerging about its potential role in ganciclovir-sensitive and -resistant CMV, primarily by virtue of a unique mechanism inhibiting virion assembly, as opposed to inhibition of viral DNA synthesis by current agents. This review aims to put in perspective, the knowledge acquired in the last decade or so on leflunomide for CMV. Evidence suggests that it might have activity against human CMV with good oral bioavailability and, more importantly in the resource-poor setting, is economical. Although the data presented here are not from randomized trials, several relevant observations have been made that could influence future, more structured assessments of the drug. An immune suppressive compound with antiviral features and experimental activity in chronic rejection is an attractive combination for organ transplantation, and it appears that leflunomide may just fit that niche. PMID:22093814

  3. Cytomegalovirus and glioblastoma; controversies and opportunities.

    PubMed

    Lawler, Sean E

    2015-07-01

    One of the more polarized ongoing debates in the brain tumor field over recent years has centered on the association of cytomegalovirus (CMV) with glioblastoma. Several laboratories have reported the presence of CMV antigens in glioblastoma patient specimens, whereas others have failed to detect them. CMV genomic DNA and mRNAs have been detected by PCR, but not in next-generation sequencing studies. CMV promotes high grade glioma progression in a mouse genetic model, and many CMV proteins promote cancer hallmarks in vitro, but actively replicating virus has not been isolated from tumor samples. A consensus is gradually emerging in which the presence of CMV antigens in glioblastoma is increasingly accepted. However, it remains challenging to understand this mechanistically due to the low levels of CMV nucleic acids and the absence of viral replication observed in tumors thus far. Nonetheless, these observations have inspired the development of novel therapeutic approaches based on anti-viral drugs and immunotherapy. The potential benefit of valganciclovir in glioblastoma has generated great interest, but efficacy remains to be established in a randomized trial. Also, early stage immunotherapy trials targeting CMV have shown promise. In the near future we will know more answers to these questions, and although areas of controversy may remain, and the mechanisms and roles of CMV in tumor growth are yet to be clearly defined, this widespread virus may have created important new therapeutic concepts and opportunities for the treatment of glioblastoma. PMID:25682092

  4. Cytomegalovirus vaccine: phase II clinical trial results.

    PubMed

    Rieder, F; Steininger, C

    2014-05-01

    Cytomegalovirus (CMV) is one of the most significant viral pathogens during pregnancy and in immunocompromised patients. Antiviral prophylactic strategies are limited by toxicities, drug-drug interactions and development of antiviral resistance. A safe and protective vaccine against CMV is highly desirable in view of the potential positive impact on CMV-associated morbidity and mortality as well as healthcare costs. Unfortunately, this demand could not be met in the past four decades although development of a CMV vaccine has been ranked at the highest priority by the US Institute of Medicine. Multiple different vaccine candidates have been developed and evaluated in phase I clinical trials and few succeeded to phase II trials. Nevertheless, two different vaccines showed recently promising results in trials that studied healthy adults and immunocompromised solid-organ and bone-marrow transplant recipients, respectively. The gB/MF59 vaccine exhibited a vaccine efficacy of 50% in healthy, postpartum females. In transplant patients, gB/MF59 and the DNA vaccine TransVax both limited the periods of viraemia and consequently the need for antiviral treatment. The success of these trials is encouraging and will probably give new impetus to the development of an effective CMV vaccine. Sterilizing immunity may not be attainable in the near future and may not be necessary for a CMV vaccine to have a significant impact on health care as discussed in the present review. PMID:24283990

  5. Cytomegalovirus Infection After Intestinal Transplantation in Children

    PubMed Central

    Bueno, Javier; Green, Michael; Kocoshis, Samuel; Furukawa, Hiroyuki; Ahu-Elmagd, Kareem; Yunis, Eduardo; Irish, William; Todo, Satoru; Reyes, Jorge; Starzl, Thomas E.

    2010-01-01

    Sixteen episodes of cytomegalovirus (CMV) disease occurred in 10 of 41 children undergoing intestinal transplantation from 1990 to 1995. Stratification of CMV disease by donor (D)/recipient (R) serological status was as follows: 3 of 8, D+/R−; 3 of 9, D+/R+; 4 of 9, D−/R+; and 0 of 15, D−/R−. Treatment resulted in resolution of CMV disease in 93.3% of episodes. No deaths attributable to CMV disease occurred in this series. CMV in D+/R− children resulted in more extensive and persistent disease. However, patient and graft survival rates were similar in the different D/R subgroups and between children with and without CMV disease. Cumulative dose of steroid boluses (relative risk [RR]. 1.59; 95% confidence interval [CI]. 1.14–2.21) and history of steroid recycles (RR, 2.72; 95% CI, 1.21–6.13) were associated with CMV disease. These results suggest that although CMV-associated morbidity in pediatric intestinal transplant recipients was substantial, it was not associated with an increased rate of mortality or graft loss, even among high-risk D+/R− patients. PMID:9402361

  6. An animal model of human cytomegalovirus infection.

    PubMed

    Gao, L; Qian, S; Zeng, L; Wang, R; Wei, G; Fan, J; Zheng, S

    2007-12-01

    To develop a rat model that allowed in vivo progressive human cytomegalovirus (HCMV) infection, allogeneic liver transplantation was performed across a rat combination of Dark Agouti (DA) to Brown Norway (BN). AD169, a well-characterized laboratory strain of HCMV, was used to establish a rat model of HCMV infection by injection of 0.4 mL (30.0 logTCID50) supernate into the rat peritoneum. Histological and blood specimens were obtained from animals sacrificed at predetermined timepoints. We performed immunohistochemical staining in liver, heart, kidney, spleen, and lung for HCMV immediate-early antigen (IE), lower matrix protein (pp65) detection in peripheral blood leukocytes, and HCMV early antigen (EA) and late antigen (LA). We compared survival rates. Our results showed positive HCMV IE and pp65 antigenemia detected in peripheral blood leukocytes in transplanted recipients from day 1 to day 30. Positive HCMV EA and LA staining cells were only detected in sections 10 days after liver transplantation, namely, in hepatocytes, mononuclear cells, bile duct epithelial cells, and endothelial cells. Successful HCMV replication was due to the combination of liver transplantation and cyclosporine (CsA) immunosuppression. Survival analysis showed no significant differences between the HCMV-infected group and HCMV-uninfected group. This new rat model of HCMV infection may be helpful to understand immune system modulation of HCMV infection. PMID:18089401

  7. Cytomegalovirus pneumonia in transplant patients: CT findings

    SciTech Connect

    Eun-Young Kang; Patz, E.F. Jr.; Mueller, N.L.

    1996-03-01

    Our goal was to assess the CT findings of cytomegalovirus (CMV) pneumonia in transplant patients. The study included 10 transplant patients who had chest CT scan and pathologically proven isolated pulmonary CMV infection. Five patients had bone marrow transplant and five had solid organ transplant. The CT scans were retrospectively reviewed for pattern and distribution of disease and the CT findings compared with the findings on open lung biopsy (n = 9) and autopsy (n = 1). Nine of 10 patients had parenchymal abnormalities apparent at CT and I had normal CT scans. The findings in the nine patients included small nodules (n = 6), consolidation (n = 4), ground-glass attenuation (n = 4), and irregular lines (n = 1). The nodules had a bilateral and symmetric distribution and involved all lung zones. The consolidation was most marked in the lower lung zones. The CT findings of CMV pneumonia in transplant patients are heterogeneous. The most common patterns include small nodules and areas of consolidation. 13 refs., 4 figs., 1 tab.

  8. Comparative efficacy of handwashing agents against cytomegalovirus.

    PubMed

    Faix, R G

    1987-04-01

    Conscientious handwashing is often recommended as an important method for limiting transmission of cytomegalovirus (CMV) from infected individuals to health, education, and child care professionals. To assess the efficacy of handwashing, fingertips of radiation-sterilized latex gloves were inoculated with 0.2 mL of ten different CMV strains. Virus in each inoculum was quantitated by plaque assay. After five minutes, viral inocula were allowed to remain (control), or were washed away by dropwise application of 10 mL of distilled water (DI), 5 mL of 0.08% soap followed by 5 mL of DI, 5 mL of 0.01% chlorhexidine gluconate followed by 5 mL of DI, or 5 mL of 0.025% povidone-iodine solution followed by 5 mL of DI. Separate glove fingertips were sampled 5, 15, 30, 60, 120 and 240 minutes after washing and cultured in duplicate for CMV. Similar studies were performed using human cadaver skin. Ordinary soap was as effective at preventing CMV recovery as other more expensive agents. For inocula with less than 5 log10 pfu CMV/mL, washing with water alone was as effective as other agents. This was confirmed in similar studies with human hands using five CMV stains. Handwashing is probably an effective method for removing CMV from contaminated hands. PMID:3034815

  9. Renal deposition of cytomegalovirus antigen in immunoglobulin-A nephropathy.

    PubMed

    Gregory, M C; Hammond, M E; Brewer, E D

    Renal biopsy specimens from patients with various glomerular disorders were examined by indirect immunofluorescence microscopy with three different heterologous antibodies directed against cytomegalovirus and two heterologous antibodies against herpes simplex virus (HSV) type 1. All 31 samples from patients with immunoglobulin-A (IgA) nephropathy, 1 of 12 with systemic lupus erythematosus (SLE), and 1 of 5 with Henoch-Schönlein purpura (HSP) showed mesangial staining with cytomegalovirus antiserum, whereas no sample from 37 patients with other forms of glomerulonephritis was positive. Antigens of herpes simplex virus I were demonstrated in samples from 4 of 31 patients with IgA nephropathy, 1 of 12 patients with SLE, 1 of 5 patients with HSP, and 1 of 37 patients with other glomerular diseases. The consistent finding of glomerular cytomegalovirus antigen in IgA nephropathy suggests but does not prove that the virus has a role in the aetiology of this disorder. PMID:2891887

  10. Cloning of murine ferrochelatase.

    PubMed Central

    Brenner, D A; Frasier, F

    1991-01-01

    Ferrochelatase (protoheme ferro-lyase, EC 4.99.1.1) catalyzes the last step in the heme biosynthetic pathway, the chelation of ferrous iron and protoporphyrin to form heme. The activity of ferrochelatase is deficient in the inherited disease protoporphyria. In this study, murine ferrochelatase cDNAs were obtained by screening cDNA libraries with an oligonucleotide probe. The derived amino acid sequence of murine ferrochelatase has 47% identity with the recently cloned Saccharomyces cerevisiae ferrochelatase, but it is not significantly similar to other published sequences. Results of Southern blotting are consistent with a single murine ferrochelatase gene, while Northern blotting demonstrates two ferrochelatase transcripts in all tissues examined. The ferrochelatase protein and mRNAs have different relative concentrations in different tissues. The cloning of murine ferrochelatase cDNAs provides the basis for future studies on ferrochelatase gene expression and on the identification of the molecular defect in protoporphyria. Images PMID:1704134

  11. Cytomegalovirus infection in pregnancy: review of the literature

    PubMed Central

    Bonalumi, Silvia; Trapanese, Angelica; Santamaria, Angelo; D’Emidio, Laura; Mobili, Luisa

    2011-01-01

    The aim of this review is to summarize the principles of cytomegalovirus (CMV) infection in pregnancy. In particular, the aim of this review is to evaluate: Incidence and mother-to-child transmissionThe value of screening of pregnant womenDiagnosis of CMV maternal infectionDiagnosis of fetal infection (evaluate the value of ultrasound examination and amniocentesis and evaluate whether the amniotic viral load of mothers with primary cytomegalovirus infection correlate with fetal or neonatal outcomes)Diagnosis of infection in newbornsTherapy in pregnancy, postnatal therapy and prevention PMID:22439067

  12. Ileal perforation caused by cytomegalovirus infection in an immunocompetent adult.

    PubMed

    Van Schaeybroeck, S; Hiele, M; Miserez, M; Croes, R

    2002-01-01

    A 71-year-old woman developed a small bowel perforation due to cytomegalovirus infection. She did not taken any immunosuppressive medication and her cellular immunity was normal. Surgical resection and antiviral therapy with ganciclovir led to complete recovery. As far as we know, this paper reports the first case of small bowel perforation due to cytomegalovirus infection in a non-immunocompromised patient. Nevertheless the patient was known with diabetes mellitus. It should be emphasised that elderly patients have impaired immune defences and may be unsuspected hosts of opportunistic infections. PMID:12212357

  13. Electrochemical detection of a single cytomegalovirus at an ultramicroelectrode and its antibody anchoring

    PubMed Central

    Dick, Jeffrey E.; Hilterbrand, Adam T.; Boika, Aliaksei; Upton, Jason W.; Bard, Allen J.

    2015-01-01

    We report observations of stochastic collisions of murine cytomegalovirus (MCMV) on ultramicroelectrodes (UMEs), extending the observation of discrete collision events on UMEs to biologically relevant analytes. Adsorption of an antibody specific for a virion surface glycoprotein allowed differentiation of MCMV from MCMV bound by antibody from the collision frequency decrease and current magnitudes in the electrochemical collision experiments, which shows the efficacy of the method to size viral samples. To add selectivity to the technique, interactions between MCMV, a glycoprotein-specific primary antibody to MCMV, and polystyrene bead “anchors,” which were functionalized with a secondary antibody specific to the Fc region of the primary antibody, were used to affect virus mobility. Bead aggregation was observed, and the extent of aggregation was measured using the electrochemical collision technique. Scanning electron microscopy and optical microscopy further supported aggregate shape and extent of aggregation with and without MCMV. This work extends the field of collisions to biologically relevant antigens and provides a novel foundation upon which qualitative sensor technology might be built for selective detection of viruses and other biologically relevant analytes. PMID:25870261

  14. Vaccination with synthetic constructs expressing cytomegalovirus immunogens is highly T cell immunogenic in mice

    PubMed Central

    Shedlock, Devon J.; Talbott, Kendra T.; Wu, Stephan J.; Wilson, Christine M.; Muthumani, Karuppiah; Boyer, Jean D.; Sardesai, Niranjan Y.; Awasthi, Sita; Weiner, David B.

    2012-01-01

    There is no licensed vaccine or cure for human cytomegalovirus (CMV), a ubiquitous β-herpesvirus infecting 60–95% of adults worldwide. Infection can cause congenital abnormalities, result in severe disease in immunocompromised patients, and is a major impediment during successful organ transplantation. In addition, it has been associated with numerous inflammatory diseases and cancers, as well as being implicated in the development of essential hypertension, a major risk factor for heart disease. To date, limited data regarding the identification of immunogenic viral targets has frustrated CMV vaccine development. Based upon promising clinical data suggesting an important role for T cells in protecting against disease in the transplantation setting, we designed a novel panel of highly-optimized synthetic vaccines encoding major CMV proteins and evaluated their immune potential in murine studies. Vaccination induced robust CD8+ and CD4+ T cells of great epitopic breadth as extensively analyzed using a novel modified T cell assay described herein. Together with improved levels of CMV-specific T cells as driven by a vaccine, further immune evaluation of each target is warranted. The present model provides an important tool for guiding future immunization strategies against CMV. PMID:23151448

  15. Cytomegalovirus-induced sensorineural hearing loss with persistent cochlear inflammation in neonatal mice.

    PubMed

    Schachtele, Scott J; Mutnal, Manohar B; Schleiss, Mark R; Lokensgard, James R

    2011-06-01

    Congenital cytomegalovirus (CMV) infection is the leading cause of sensorineural hearing loss (SNHL) in children. During murine (M)CMV-induced encephalitis, the immune response is important for both the control of viral dissemination and the clearance of virus from the brain. While the importance of CMV-induced SNHL has been described, the mechanisms surrounding its pathogenesis and the role of inflammatory responses remain unclear. This study presents a neonatal mouse model of profound SNHL in which MCMV preferentially infected both cochlear perilymphatic epithelial cells and spiral ganglion neurons. Interestingly, MCMV infection induced cochlear hair cell death by 21 days post-infection, despite a clear lack of direct infection of hair cells and the complete clearance of the virus from the cochlea by 14 dpi. Flow cytometric, immunohistochemical, and quantitative PCR analysis of MCMV-infected cochlea revealed a robust and chronic inflammatory response, including a prolonged increase in reactive oxygen species production by infiltrating macrophages. These data support a pivotal role for inflammation during MCMV-induced SNHL. PMID:21416394

  16. Latent cytomegalovirus infection exacerbates experimental pulmonary fibrosis by activating TGF-β1.

    PubMed

    Li, Yonghuai; Gao, Jian; Wang, Guoliang; Fei, Guanghe

    2016-08-01

    The aim of the present study was to investigate the hypotheses that cytomegalovirus (CMV) may trigger idiopathic pulmonary fibrosis (IPF) in a susceptible host and/or that the presence of CMV may alter IPF in response to a well-defined trigger of pulmonary fibrosis. A mouse model of murine CMV (MCMV) infection was established, and the mice were divided into a control group, bleomycin group and an MCMV+bleomycin group. Changes in the weights of the mice were determined in the three groups. Pulmonary fibrosis was detected using a histopathological method. The activity of transforming growth factor (TGF)‑β1 was measured, and the levels of E‑cadherin, Vimentin and phosphorylated (phospho)‑small mothers against decapentaplegic (SMAD)2 were determined using western blot analysis. MCMV was found to invade the lungs, however, it did not cause pulmonary fibrosis. The progression of fibrosis in the mice treated with MCMV+bleomycin was more rapid, compared with that in the control mice. The protein levels of Vimentin and phospho-SMAD2 were upregulated, whereas the level of E‑cadherin was downregulated in the MCMV+bleomycin group,. The results suggested that latent MCMV infection aggravated pulmonary fibrosis in the mouse model, possibly through the activation of TGF-β1. PMID:27279470

  17. Congenital cytomegalovirus infection in fraternal twins: a longitudinal case study examining neurocognitive and neurobehavioral correlates.

    PubMed

    Llorente, Antolin M; Castillo, Christine L

    2012-01-01

    Cytomegalovirus (CMV) is the most ubiquitous member of the herpes virus family and is the leading cause of congenital (vertical) infection in newborns (Fowler, Stagno, & Pass, 2003; Llorente, Steigmeyer, Cooper, Rivers, & Gazley, 2011; Noyola et al., 2000; Steigmeyer & Llorente, 2010). CMV is related to the group of viruses capable of causing more pernicious infectious diseases, such as chicken pox (Santos de Barona, 1998). Although the virus generally remains dormant, individuals whose symptoms are clinically apparent often are dramatically affected. Common symptomatic characteristics of the virus include microcephaly, jaundice, liver-spleen infections, pneumonia, cardiac anomalies, chorioretinitis, vision loss, sensory-neural hearing loss, mental retardation, and mononucleosis (Demmler, 1991; Kashden, Frison, Fowler, Pass, & Boll, 1998; Noyola et al., 2000; Pass, 2005; Santos de Barona). The prognosis of individuals with CMV is highly variable, and the prognosis of individuals with congenital CMV can usually be determined based on the extent of infection at birth. The purpose of this investigation is to present longitudinal results of neuropsychological evaluation of two dizygotic twin sets (one twin of each set is asymptomatic CMV-positive and the other is uninfected) who were reared in the same environment. In addition, the present findings are discussed within the context of emerging murine and other animal analogues of CMV as well as within the extant CMV literature. PMID:23428280

  18. Cytomegalovirus seropositivity is associated with herpes zoster.

    PubMed

    Ogunjimi, Benson; Hens, Niel; Pebody, Richard; Jansens, Hilde; Seale, Holly; Quinlivan, Mark; Theeten, Heidi; Goossens, Herman; Breuer, Judy; Beutels, Philippe

    2015-01-01

    Herpes zoster (HZ) is caused by VZV reactivation that is facilitated by a declined immunity against varicella-zoster virus (VZV), but also occurs in immunocompetent individuals. Cytomegalovirus (CMV) infection is associated with immunosenescence meaning that VZV-specific T-cells could be less responsive. This study aimed to determine whether CMV infection could be a risk factor for the development of HZ. CMV IgG serostatus was determined in stored serum samples from previously prospectively recruited ambulatory adult HZ patients in the UK (N = 223) in order to compare the results with those from UK population samples (N = 1545) by means of a logistic regression (controlling for age and gender). Furthermore, we compared the UK population CMV seroprevalence with those from population samples from other countries (from Belgium (N1 = 1741, N2 = 576), USA (N = 5572) and Australia (N = 2080)). Furthermore, CMV IgG titers could be compared between UK HZ patients and Belgium N2 population samples because the same experimental set-up for analysis was used. We found UK ambulatory HZ patients to have a higher CMV seroprevalence than UK population samples (OR 1.56 [1.11 2.19]). CMV IgG seropositivity was a significant risk factor for HZ in the UK (OR 3.06 [1.32 7.04]. Furthermore, high CMV IgG titers (exceeding the upper threshold) were less abundant in CMV-seropositive Belgian N2 population samples than in CMV-seropositive UK HZ patients (OR 0.51 [0.31 0.82]. We found CMV-seroprevalence to increase faster with age in the UK than in other countries (P < 0.05). We conclude that CMV IgG seropositivity is associated with HZ. This finding could add to the growing list of risk factors for HZ. PMID:25905443

  19. Cytomegalovirus seropositivity is associated with herpes zoster

    PubMed Central

    Ogunjimi, Benson; Hens, Niel; Pebody, Richard; Jansens, Hilde; Seale, Holly; Quinlivan, Mark; Theeten, Heidi; Goossens, Herman; Breuer, Judy; Beutels, Philippe

    2015-01-01

    Herpes zoster (HZ) is caused by VZV reactivation that is facilitated by a declined immunity against varicella-zoster virus (VZV), but also occurs in immunocompetent individuals. Cytomegalovirus (CMV) infection is associated with immunosenescence meaning that VZV-specific T-cells could be less responsive. This study aimed to determine whether CMV infection could be a risk factor for the development of HZ. CMV IgG serostatus was determined in stored serum samples from previously prospectively recruited ambulatory adult HZ patients in the UK (N = 223) in order to compare the results with those from UK population samples (N = 1545) by means of a logistic regression (controlling for age and gender). Furthermore, we compared the UK population CMV seroprevalence with those from population samples from other countries (from Belgium (N1 = 1741, N2 = 576), USA (N = 5572) and Australia (N = 2080)). Furthermore, CMV IgG titers could be compared between UK HZ patients and Belgium N2 population samples because the same experimental set-up for analysis was used. We found UK ambulatory HZ patients to have a higher CMV seroprevalence than UK population samples (OR 1.56 [1.11 2.19]). CMV IgG seropositivity was a significant risk factor for HZ in the UK (OR 3.06 [1.32 7.04]. Furthermore, high CMV IgG titers (exceeding the upper threshold) were less abundant in CMV-seropositive Belgian N2 population samples than in CMV-seropositive UK HZ patients (OR 0.51 [0.31 0.82]. We found CMV-seroprevalence to increase faster with age in the UK than in other countries (P < 0.05). We conclude that CMV IgG seropositivity is associated with HZ. This finding could add to the growing list of risk factors for HZ. PMID:25905443

  20. Topical Apigenin Alleviates Cutaneous Inflammation in Murine Models

    PubMed Central

    Man, Mao-Qiang; Hupe, Melanie; Sun, Richard; Man, George; Mauro, Theodora M.; Elias, Peter M.

    2012-01-01

    Herbal medicines have been used in preventing and treating skin disorders for centuries. It has been demonstrated that systemic administration of chrysanthemum extract exhibits anti-inflammatory properties. However, whether topical applications of apigenin, a constituent of chrysanthemum extract, influence cutaneous inflammation is still unclear. In the present study, we first tested whether topical applications of apigenin alleviate cutaneous inflammation in murine models of acute dermatitis. The murine models of acute allergic contact dermatitis and acute irritant contact dermatitis were established by topical application of oxazolone and phorbol 12-myristate 13-acetate (TPA), respectively. Inflammation was assessed in both dermatitis models by measuring ear thickness. Additionally, the effect of apigenin on stratum corneum function in a murine subacute allergic contact dermatitis model was assessed with an MPA5 physiology monitor. Our results demonstrate that topical applications of apigenin exhibit therapeutic effects in both acute irritant contact dermatitis and allergic contact dermatitis models. Moreover, in comparison with the vehicle treatment, topical apigenin treatment significantly reduced transepidermal water loss, lowered skin surface pH, and increased stratum corneum hydration in a subacute murine allergic contact dermatitis model. Together, these results suggest that topical application of apigenin could provide an alternative regimen for the treatment of dermatitis. PMID:23304222

  1. Autism in a Child with Congenital Cytomegalovirus Infection.

    ERIC Educational Resources Information Center

    Markowitz, Phillip I.

    1983-01-01

    A case study is described in which early infantile autism was diagnosed in a child with congenital cytomegalovirus (CMU) infection. It is suggested that congenital infection should be considered as an etiological agent in autism. The case's synergistic effect of CMU-induced brain damage, deafness, and maternal deprivation in noted. (CL)

  2. Infantile Spasms and Cytomegalovirus Infection: Antiviral and Antiepileptic Treatment

    ERIC Educational Resources Information Center

    Dunin-Wasowicz, Dorota; Kasprzyk-Obara, Jolanta; Jurkiewicz, Elzbieta; Kapusta, Monika; Milewska-Bobula, Bogumila

    2007-01-01

    From 1 January 1995 to 31 December 2004, 22 patients (13 males, nine females; age range 2-12mo) with infantile spasms and cytomegalovirus (CMV) infection were treated with intravenous ganciclovir (GCV) and antiepileptic drugs. GCV was given for 3 to 12 weeks with a 1-month interval (one, two, or three courses). Epileptic spasms occurred before…

  3. Brief Report: Autistic Disorder in Three Children with Cytomegalovirus Infection

    ERIC Educational Resources Information Center

    Sweeten, Thayne L.; Posey, David J.; McDougle, Christopher J.

    2004-01-01

    Previous research has identified a relationship between autistic disorder (autism) and specific congenital infections. Three cases of congenital or perinatal cytomegalovirus (CMV) infection occurring in association with autism are described. Hypothetical mechanisms relating congenital infection, such as CMV, to the development of autism are…

  4. Cytomegalovirus Meningitis in an Infant with Severe Combined Immunodeficiency.

    PubMed

    Vicetti Miguel, Claudia P; Mejias, Asuncion; Ramilo, Octavio; Ardura, Monica I; Sánchez, Pablo J

    2016-06-01

    A 35-day-old female with severe combined immunodeficiency developed cytomegalovirus (CMV) meningitis before undergoing hematopoietic stem cell transplantation. Strategies for timely diagnosis of neonates with congenital or acquired CMV infection and prevention of CMV acquisition in the era of universal newborn severe combined immunodeficiency screening are needed. PMID:26996725

  5. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  6. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  7. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  8. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  9. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cytomegalovirus serological reagents. 866.3175 Section 866.3175 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  10. Cytomegalovirus infection: its incidence and management in cytomegalovirus-seropositive living related liver transplant recipients: a single-center experience.

    PubMed

    Wadhawan, Manav; Gupta, Subash; Goyal, Neerav; Vasudevan, Karisangal R; Makki, Kausar; Dawar, Reetika; Sardana, Raman; Lal, Nand; Kumar, Ajay

    2012-12-01

    It is believed that antiviral prophylaxis decreases the incidence of cytomegalovirus (CMV) reactivation and disease. There are few data regarding weekly assays for CMV DNA after transplantation and the subsequent management of CMV. Here we report a cohort of living related liver transplantation (LRLT) patients who were treated for invasive CMV disease or for CMV infections if they were receiving steroids for rejection. Patients who underwent liver transplantation at our center between September 2006 and August 2010 and were recipient-positive/donor-positive (R(+) /D(+) ) were prospectively included. Patients were tested for CMV DNA 3 weeks after transplantation. CMV DNA-positive patients underwent weekly DNA monitoring until there were 2 consecutive negative reports. Those who developed CMV disease or had rising DNA titers while they were on treatment for rejection were treated. A Cox regression analysis was performed for factors predicting survival. Two hundred sixty-six of the 306 R(+) /D(+) patients were CMV DNA-negative 3 weeks after transplantation, and 40 had detectable DNA. One of the DNA-negative patients developed CMV disease after treatment for rejection with methylprednisolone. Thirty patients had <500 copies/mL, and 10 had ≥500 copies/mL. Two of the 30 patients with DNA levels < 500 copies/mL developed CMV disease. Six of the 10 patients with DNA levels ≥500 copies/mL developed disease. CMV disease occurred in 9 of the 306 patients (2.9%). One patient received treatment for a rise in DNA titers while he was receiving steroids. There was a significant correlation between steroid administration for acute cellular rejection (ACR) and CMV reactivation (P = 0.003) and disease (P = 0.002). A multivariate analysis showed that CMV reactivation/disease did not predict survival. There was no difference in survival between CMV DNA-positive patients and CMV DNA-negative patients (P = 0.68). In conclusion, CMV reactivation is common after LRLT (13%), but the

  11. Prevention of Primary Cytomegalovirus Infection in Pregnancy☆

    PubMed Central

    Revello, Maria Grazia; Tibaldi, Cecilia; Masuelli, Giulia; Frisina, Valentina; Sacchi, Alessandra; Furione, Milena; Arossa, Alessia; Spinillo, Arsenio; Klersy, Catherine; Ceccarelli, Manuela; Gerna, Giuseppe; Todros, Tullia

    2015-01-01

    Background Cytomegalovirus (CMV) is the leading infectious agent causing congenital sensorineural hearing loss and psychomotor retardation. CMV vaccine is currently unavailable and treatment options in pregnancy are limited. Susceptible pregnant women caring for children are at high risk for primary infection. CMV educational and hygienic measures have the potential to prevent primary maternal infection. Methods A mixed interventional and observational controlled study was conducted to investigate the effectiveness of hygiene information among pregnant women at risk for primary CMV infection for personal/occupational reasons. In the intervention arm, CMV-seronegative women, identified at the time of maternal serum screening for fetal aneuploidy at 11–12 weeks of gestation, were given hygiene information and prospectively tested for CMV until delivery. The comparison arm consisted of women enrolled at delivery who were neither tested for nor informed about CMV during pregnancy, and who had a serum sample stored at the screening for fetal aneuploidy. By design, groups were homogeneous for age, parity, education, and exposure to at least one risk factor. The primary outcome was CMV seroconversion. Acceptance of hygiene recommendations was a secondary objective and was measured by a self-report. Findings Four out of 331 (1.2%) women seroconverted in the intervention group compared to 24/315 (7.6%) in the comparison group (delta = 6.4%; 95% CI 3.2–9.6; P < 0.001). There were 3 newborns with congenital infection in the intervention group and 8 in the comparison group (1 with cerebral ultrasound abnormalities at birth). Ninety-three percent of women felt hygiene recommendations were worth suggesting to all pregnant women at risk for infection. Interpretation This controlled study provides evidence that an intervention based on the identification and hygiene counseling of CMV-seronegative pregnant women significantly prevents maternal infection. While waiting for

  12. Acquisition of cytomegalovirus infection: an update.

    PubMed Central

    Forbes, B A

    1989-01-01

    Human cytomegalovirus (CMV) is a ubiquitous deoxyribonucleic acid virus that commonly infects a majority of individuals at some time during their life. Although most of these CMV infections are asymptomatic, certain patient groups are at risk to develop serious illness. Understanding the epidemiology of this virus is a key element in the development of strategies for preventing CMV disease. However, a number of features of this virus complicate such understanding. Following infection, CMV can remain latent, with subsequent reactivation; the factors controlling latency and reactivation and those factors which determine whether a CMV infection will be symptomatic are unknown. CMV disease can be acquired by natural routes, including horizontal and vertical transmission. Due to the ubiquity of CMV, the delineation of CMV transmission by these natural routes is complicated by the myriad of possible sources. Moreover, concerns over the risk of CMV transmission to the seronegative pregnant female have been raised in relation to preventing CMV transmission. By using molecular biologic techniques, much knowledge has been gained regarding the transmission of CMV disease by natural routes; however, a number of questions remain unanswered. The transmission of CMV infection by natural routes is therefore reviewed and the issues are highlighted. Primary infection, reactivation, and reinfection are the types of active CMV infections that can occur in an immunocompromised patient. In addition to natural routes of infection, introduction of presumably latently infected organs and requirements for multiple blood transfusions increase potential exposure to CMV in the immunocompromised patient. Understanding the epidemiology of CMV infections in the immunocompromised patient is difficult and in some instances controversial due to the complexity and interdependency of a number of factors which lead to CMV infection. In an immunocompromised individual, a major risk factor in developing

  13. Peptide inhibition of human cytomegalovirus infection

    PubMed Central

    2011-01-01

    Background Human cytomegalovirus (HCMV) is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV)- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB), a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS), several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF) were infected with the Towne-GFP strain of HCMV (0.5 MOI), preincubated with peptides at a range of concentrations (78 nm to 100 μM), and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100 μM and 50 μM, respectively

  14. Cutaneous involvement by cytomegalovirus in a renal transplant recipient as an indicator of severe systemic infection*

    PubMed Central

    Neumann, Antonielle Borges Faria; Daxbacher, Egon Luiz Rodrigues; Chiaratti, Francielle Chiavelli; Jeunon, Thiago

    2016-01-01

    Cytomegalovirus is an opportunistic virus that commonly affects immunosuppressed patients. Cutaneous involvement by this virus is rare and occurs in significantly immunocompromised hosts, with a poor prognosis. Skin ulcers may represent the first sign of systemic infection by cytomegalovirus in these patients. Herein, a case of a systemic infection by Cytomegalovirus presenting as genital and oral ulcers in a kidney-transplant recipient is reported. PMID:26982783

  15. Infrequency of cytomegalovirus genome in coronary arteriopathy of human heart allografts.

    PubMed Central

    Gulizia, J. M.; Kandolf, R.; Kendall, T. J.; Thieszen, S. L.; Wilson, J. E.; Radio, S. J.; Costanzo, M. R.; Winters, G. L.; Miller, L. L.; McManus, B. M.

    1995-01-01

    In heart transplantation, long-term engraftment success is severely limited by the rapid development of obliterative disease of the coronary arteries. Data from various groups have been suggestive of a pathogenetic role of herpesviruses, particularly human cytomegalovirus, in accelerated allograft coronary artery disease; however, results are not yet conclusive. This study examines the hypothesis that human cytomegalovirus infection of allograft tissues is related pathogenetically and directly to accelerated coronary artery disease. Using in situ DNA hybridization and polymerase chain reaction, we examined particular coronary artery segments from 41 human heart allografts (ranging from 4 days to greater than 4 years after transplantation; mean, 457 days) and 22 donor age- and gender-comparable, coronary site-matched trauma victims for presence of human cytomegalovirus DNA. Human cytomegalovirus genome was detected in 8 of 41 (19.5%) allografts and in 1 of 22 (4.5%) control hearts. This difference in positivity was not statistically significant (P = 0.10). In the human cytomegalovirus-positive hearts, viral genome was localized to perivascular myocardium or coronary artery media or adventitia. Human cytomegalovirus genome was not detected in arterial intima of any allograft or control heart, although human cytomegalovirus genome was readily identified within intima of small pulmonary arteries from lung tissue with human cytomegalovirus pneumonitis. By statistical analyses, the presence of human cytomegalovirus genome was not associated with the nature or digitized extent of transplant arteriopathy, evidence of rejection, allograft recipient or donor serological data suggestive of human cytomegalovirus infection, duration of allograft implantation, or causes of death or retransplantation. Thus, our data indicate a low frequency of detectable human cytomegalovirus genome in accelerated coronary artery disease and do not support a direct role for human cytomegalovirus

  16. Human and murine erythropoiesis

    PubMed Central

    An, Xiuli; Schulz, Vincent P.; Mohandas, Narla; Gallagher, Patrick G.

    2015-01-01

    Purpose of review Research into the fundamental mechanisms of erythropoiesis has provided critical insights into inherited and acquired disorders of the erythrocyte. Studies of human erythropoiesis have primarily utilized in-vitro systems, whereas murine models have provided insights from in-vivo studies. This report reviews recent insights into human and murine erythropoiesis gained from transcriptome-based analyses. Recent findings The availability of high-throughput genomic methodologies has allowed attainment of detailed gene expression data from cells at varying developmental and differentiation stages of erythropoiesis. Transcriptome analyses of human and murine reveal both stage and species-specific similarities and differences across terminal erythroid differentiation. Erythroid-specific long noncoding RNAs exhibit poor sequence conservation between human and mouse. Genome-wide analyses of alternative splicing reveal that complex, dynamic, stage-specific programs of alternative splicing program are utilized during terminal erythroid differentiation. Transcriptome data provide a significant resource for understanding mechanisms of normal and perturbed erythropoiesis. Understanding these processes will provide innovative strategies to detect, diagnose, prevent, and treat hematologic disease. Summary Understanding the shared and different mechanisms controlling human and murine erythropoiesis will allow investigators to leverage the best model system to provide insights in normal and perturbed erythropoiesis. PMID:25719574

  17. Block of Death-Receptor Apoptosis Protects Mouse Cytomegalovirus from Macrophages and Is a Determinant of Virulence in Immunodeficient Hosts

    PubMed Central

    Ebermann, Linda; Ruzsics, Zsolt; Guzmán, Carlos A.; van Rooijen, Nico; Casalegno-Garduño, Rosaely; Koszinowski, Ulrich; Čičin-Šain, Luka

    2012-01-01

    The inhibition of death-receptor apoptosis is a conserved viral function. The murine cytomegalovirus (MCMV) gene M36 is a sequence and functional homologue of the human cytomegalovirus gene UL36, and it encodes an inhibitor of apoptosis that binds to caspase-8, blocks downstream signaling and thus contributes to viral fitness in macrophages and in vivo. Here we show a direct link between the inability of mutants lacking the M36 gene (ΔM36) to inhibit apoptosis, poor viral growth in macrophage cell cultures and viral in vivo fitness and virulence. ΔM36 grew poorly in RAG1 knockout mice and in RAG/IL-2-receptor common gamma chain double knockout mice (RAGγC−/−), but the depletion of macrophages in either mouse strain rescued the growth of ΔM36 to almost wild-type levels. This was consistent with the observation that activated macrophages were sufficient to impair ΔM36 growth in vitro. Namely, spiking fibroblast cell cultures with activated macrophages had a suppressive effect on ΔM36 growth, which could be reverted by z-VAD-fmk, a chemical apoptosis inhibitor. TNFα from activated macrophages synergized with IFNγ in target cells to inhibit ΔM36 growth. Hence, our data show that poor ΔM36 growth in macrophages does not reflect a defect in tropism, but rather a defect in the suppression of antiviral mediators secreted by macrophages. To the best of our knowledge, this shows for the first time an immune evasion mechanism that protects MCMV selectively from the antiviral activity of macrophages, and thus critically contributes to viral pathogenicity in the immunocompromised host devoid of the adaptive immune system. PMID:23271968

  18. Physical requirements and functional consequences of complex formation between the cytomegalovirus IE1 protein and human STAT2.

    PubMed

    Krauss, Steffen; Kaps, Julia; Czech, Nathalie; Paulus, Christina; Nevels, Michael

    2009-12-01

    Our previous work has shown that efficient evasion from type I interferon responses by human cytomegalovirus (hCMV) requires expression of the 72-kDa immediate-early 1 (IE1) protein. It has been suggested that IE1 inhibits interferon signaling through intranuclear sequestration of the signal transducer and activator of transcription 2 (STAT2) protein. Here we show that physical association and subnuclear colocalization of IE1 and STAT2 depend on short acidic and serine/proline-rich low-complexity motifs in the carboxy-terminal region of the 491-amino-acid viral polypeptide. These motifs compose an essential core (amino acids 373 to 420) and an adjacent ancillary site (amino acids 421 to 445) for STAT2 interaction that are predicted to form part of a natively unstructured domain. The presence of presumably "disordered" carboxy-terminal domains enriched in low-complexity motifs is evolutionarily highly conserved across all examined mammalian IE1 orthologs, and the murine cytomegalovirus IE1 protein appears to interact with STAT2 just like the human counterpart. A recombinant hCMV specifically mutated in the IE1 core STAT2 binding site displays hypersensitivity to alpha interferon, delayed early viral protein accumulation, and attenuated growth in fibroblasts. However, replication of this mutant virus is specifically restored by knockdown of STAT2 expression. Interestingly, complex formation with STAT2 proved to be entirely separable from disruption of nuclear domain 10 (ND10), another key activity of IE1. Finally, our results demonstrate that IE1 counteracts the antiviral interferon response and promotes viral replication by at least two distinct mechanisms, one depending on sequestration of STAT2 and the other one likely involving ND10 interaction. PMID:19812155

  19. Intraperitoneal administration of cytomegalovirus hyperimmunoglobulin to the cytomegalovirus-infected fetus.

    PubMed

    Negishi, H; Yamada, H; Hirayama, E; Okuyama, K; Sagawa, T; Matsumoto, Y; Fujimoto, S

    1998-01-01

    Twenty-five percent of cytomegalovirus (CMV)-infected fetuses had sequelae and 8% of those in the recurrent-infected group had sequelae. There is no report yet on the fetal therapy for CMV infections. A Japanese pregnant woman with intrauterine fetal CMV infection diagnosed at 26 weeks of pregnancy is presented. CMV culture of amniotic fluid was positive. A CMV DNA assay using the polymerase chain reaction method of the cord blood and the amniotic fluid was positive during the pregnancy; however, testing for fetal serum CMV-specific IgM was negative. The CMV IgG titer of fetal serum at 27 weeks of pregnancy was a third of that of the maternal serum. CMV hyperimmunoglobulin was injected into the fetal abdominal cavity at 28 and 29 weeks of pregnancy. A second administration of CMV hyperimmunoglobulin increased the titer of CMV IgG in the fetal circulation. At birth, the urine culture was positive for CMV. However, CMV DNA of the ascites became negative. A brain CT scan performed 2 weeks after birth revealed some small calcifications beside the right ventricle. CMV hyperimmunoglobulin injection to the fetal abdominal cavity has been shown to increase the IgG in the fetal serum. This is the first report of fetal therapy of congenital CMV infection. PMID:9848763

  20. Cytomegalovirus-associated colitis causing diarrhea in an immunocompetent patient

    PubMed Central

    Carter, Dan; Olchovsky, David; Pokroy, Russell; Ezra, David

    2006-01-01

    Cytomegalovirus (CMV) colitis rarely occurs in immunocompetent patients. We report a case of disabling and life threatening diarrhea in an immunocompetent elderly woman due to CMV colitis. The diagnosis of CMV was based on histological examination of tissues biopsied at colonoscopy, positive CMV antigen and high CMV-IgM titer in peripheral blood samples and a good response to systemic gancyclovir treatment. We conclude that CMV should be considered in the differential diagnosis of colitis in elderly immunocompetent patients. PMID:17106945

  1. [Cytomegalovirus and BK polyomavirus infection after renal transplantation].

    PubMed

    De Paolis, P; Gervasio, E; Tedesco, M; Favaro', A; Iappelli, M; Di Giulio, S

    2009-01-01

    Cytomegalovirus (CMV) and BK polyomavirus (BKV) infections have been described in a high percentage of renal transplant patients and are known to cause various complications in renal transplantation. They are closely related to immunosuppressive therapy and implicated in the progression of graft failure. This review focuses on the clinical aspects of CMV and BKV infection after renal transplantation, optimal monitoring, and recent preventive measures and interventions to improve graft function and recipient survival. PMID:19382094

  2. Deficiency in MyD88 Signaling Results in Decreased Antibody Responses to an Adeno-Associated Virus Vector in Murine Pompe Disease

    PubMed Central

    Zhang, Ping; Luo, Xiaoyan; Bird, Andrew; Li, Songtao

    2012-01-01

    Abstract We have previously shown that antibody and T cell responses limit the efficacy of an adeno-associated virus (AAV) pseudotype 8 (2/8) vector containing the universally active cytomegalovirus enhancer/chicken β-actin regulatory cassette (AAV2/8-CBhGAA) in treating murine Pompe disease. However, the innate immune responses to AAV2/8-CBhGAA are largely unknown. In this study, we investigated acute immune responses to AAV2/8-CBhGAA and the role of MyD88/TRIF signaling pathway in shaping adaptive immune responses to this vector. We showed here that a small and transient increase in CXCL-1 and IL-1β expression in livers of acid-α-glucosidase knockout (GAAKO) mice 6 h following injection with AAV2/8-CBhGAA. There was a robust antibody response to GAA in wild-type mice injected with this vector. In contrast, the anti-GAA IgG1 response was diminished in MyD88KO mice, and showed a trend toward a decrease in TRIFKO mice. In addition, the vector genome and GAA activity were significantly higher in MyD88KO livers compared with wild-type livers, suggesting reduced cytotoxic T cell responses. Importantly, elevated CD4+ T cells were detected by immunohistochemistry in MyD88KO livers. When adoptively transferred to wild-type mice, these CD4+ T cells have an ability to suppress antibody responses against AAV2/8-CBhGAA and to prevent further immunization against rhGAA. Our study suggests that the MyD88 deficiency leads to the suppression of deleterious immune responses to AAV2/8-CBhGAA, which has implications for gene therapy in Pompe disease. PMID:23514839

  3. Deficiency in MyD88 Signaling Results in Decreased Antibody Responses to an Adeno-Associated Virus Vector in Murine Pompe Disease.

    PubMed

    Zhang, Ping; Luo, Xiaoyan; Bird, Andrew; Li, Songtao; Koeberl, Dwight D

    2012-06-01

    We have previously shown that antibody and T cell responses limit the efficacy of an adeno-associated virus (AAV) pseudotype 8 (2/8) vector containing the universally active cytomegalovirus enhancer/chicken β-actin regulatory cassette (AAV2/8-CBhGAA) in treating murine Pompe disease. However, the innate immune responses to AAV2/8-CBhGAA are largely unknown. In this study, we investigated acute immune responses to AAV2/8-CBhGAA and the role of MyD88/TRIF signaling pathway in shaping adaptive immune responses to this vector. We showed here that a small and transient increase in CXCL-1 and IL-1β expression in livers of acid-α-glucosidase knockout (GAAKO) mice 6 h following injection with AAV2/8-CBhGAA. There was a robust antibody response to GAA in wild-type mice injected with this vector. In contrast, the anti-GAA IgG1 response was diminished in MyD88KO mice, and showed a trend toward a decrease in TRIFKO mice. In addition, the vector genome and GAA activity were significantly higher in MyD88KO livers compared with wild-type livers, suggesting reduced cytotoxic T cell responses. Importantly, elevated CD4(+) T cells were detected by immunohistochemistry in MyD88KO livers. When adoptively transferred to wild-type mice, these CD4(+) T cells have an ability to suppress antibody responses against AAV2/8-CBhGAA and to prevent further immunization against rhGAA. Our study suggests that the MyD88 deficiency leads to the suppression of deleterious immune responses to AAV2/8-CBhGAA, which has implications for gene therapy in Pompe disease. PMID:23514839

  4. Vaccine Therapy in Preventing Cytomegalovirus Infection in Patients With Hematological Malignancies Undergoing Donor Stem Cell Transplant

    ClinicalTrials.gov

    2016-05-27

    Accelerated Phase Chronic Myelogenous Leukemia; Adult Acute Lymphoblastic Leukemia in Remission; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Acute Promyelocytic Leukemia (M3); Adult Nasal Type Extranodal NK/T-cell Lymphoma; Adult Nodular Lymphocyte Predominant Hodgkin Lymphoma; Anaplastic Large Cell Lymphoma; B-cell Adult Acute Lymphoblastic Leukemia; Chronic Eosinophilic Leukemia; Chronic Myelomonocytic Leukemia; Chronic Phase Chronic Myelogenous Leukemia; Contiguous Stage II Adult Burkitt Lymphoma; Contiguous Stage II Adult Diffuse Large Cell Lymphoma; Contiguous Stage II Adult Lymphoblastic Lymphoma; Contiguous Stage II Grade 1 Follicular Lymphoma; Contiguous Stage II Grade 2 Follicular Lymphoma; Contiguous Stage II Grade 3 Follicular Lymphoma; Contiguous Stage II Mantle Cell Lymphoma; Contiguous Stage II Small Lymphocytic Lymphoma; Cytomegalovirus Infection; de Novo Myelodysplastic Syndromes; Essential Thrombocythemia; Extramedullary Plasmacytoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Isolated Plasmacytoma of Bone; Monoclonal Gammopathy of Undetermined Significance; Nodal Marginal Zone B-cell Lymphoma; Noncontiguous Stage II Adult Burkitt Lymphoma; Noncontiguous Stage II Adult Diffuse Large Cell Lymphoma; Noncontiguous Stage II Adult Lymphoblastic Lymphoma; Noncontiguous Stage II Grade 1 Follicular Lymphoma; Noncontiguous Stage II Grade 2 Follicular Lymphoma; Noncontiguous Stage II Grade 3 Follicular Lymphoma; Noncontiguous Stage II Mantle Cell Lymphoma; Noncontiguous Stage II Small Lymphocytic Lymphoma; Peripheral T-cell Lymphoma; Polycythemia Vera; Post-transplant Lymphoproliferative Disorder; Previously

  5. Cutaneous Co-infected Cytomegalovirus and Herpes Simplex Virus Perigenital Ulcers in Human Immunodeficiency Virus Patients.

    PubMed

    Schoenfeld, Jason; Cannon, Sarah; Cam, Kristin; Keller, Matthew

    2013-10-01

    There is uncertainty regarding the pathogenic nature of cytomegalovirus in cutaneous lesions co-infected with herpes simplex virus. It is widely believed that herpes simplex virus is the main pathogenic factor in such lesions and that cytomegalovirus plays little if any role. There are, however, isolated case reports that describe cytomegalovirus as an important driving pathogen in such lesions. The authors present two human immunodeficiency virus patients who have cytomegalovirus and herpes simplex virus co-infected perigenital ulcers, one of whom improved on valacyclovir, while the other, who was already on valacyclovir for chronic herpes simplex virus suppression, showed no improvement with a single dose of cidofovir. He only showed rapid improvement when treated with valganciclovir. The latter patient underscores the viewpoint that at least in some cases, cytomegalovirus may be an important driving force behind the formation of such lesions. The authors therefore recommend that clinicians be aware of the possible pathogenic role of cytomegalovirus in these ulcers, and, in nonhealing ulcers, use anti-cytomegalovirus agents to prevent the onset of systemic disease. These results warrant further study of the pathogenesis of cytomegalovirus in co-infected herpes simplex virus ulcers. PMID:24155993

  6. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation.

    PubMed

    Reddehase, Matthias J

    2016-01-01

    Hematopoietic cell transplantation (HCT) is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a "window of opportunity" for latent Cytomegalovirus (CMV) by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A "window of opportunity" for the virus represents a "window of risk" for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8(+) T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP) representing the most severe clinical manifestation. Here, I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a preemptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing "proof of concept" for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8(+) T cells bridging the critical interim. However, CMV is not a "passive antigen" but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow (BM) stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected BM stroma and impaired colony growth and lineage differentiation can lead to "graft failure." In consequence, uncontrolled virus spread causes morbidity and

  7. Perforation of the bowel due to cytomegalovirus infection in a man with AIDS: surgery is not always necessary!

    PubMed

    Yoganathan, Katie Tharshana; Morgan, Andrew Roger; Yoganathan, Kathir G

    2016-01-01

    Cytomegalovirus (CMV) infection is the most common viral opportunistic infection in immunocompromised patients and is a rare cause of bowel perforation. It invariably requires surgical intervention and is often fatal. We report a 50-year-old Caucasian man with AIDS, presented 3 weeks after developing abdominal pain and distension. He was treated for CMV retinitis in the past. His adherence to antiretroviral therapy was poor. Examination revealed a recurrence of active CMV retinitis. His abdomen was tender and distended. The plain X-ray of the abdomen revealed a double wall sign (Rigler's sign), indicating pneumoperitoneum due to the bowel perforation. The upper endoscopy was normal. His CD4 count was 30 cells/mm(3) He was treated with cidofovir infusion. He made a full recovery, without requiring any form of surgery. However, he died of adult respiratory distress syndrome 14 months later, due to iatrogenic acute pancreatitis. PMID:27440845

  8. Analysis of Mutations in the Gene Encoding Cytomegalovirus DNA Polymerase in a Phase 2 Clinical Trial of Brincidofovir Prophylaxis

    PubMed Central

    Lanier, E. Randall; Foster, Scott; Brundage, Tom; Chou, Sunwen; Prichard, Mark N.; Kleiboeker, Steven; Wilson, Chad; Colville, Donella; Mommeja-Marin, Herve

    2016-01-01

    Brincidofovir is an oral antiviral in development for prevention of cytomegalovirus disease. Cytomegalovirus genotyping results from a phase 2 trial comparing brincidofovir to placebo for prophylaxis against cytomegalovirus infection in hematopoietic cell transplant recipients provided initial data on the clinical resistance profile for brincidofovir. In this study, no known resistance-associated mutations were detected in brincidofovir-treated subjects; identified genotypic substitutions did not confer resistance to cytomegalovirus antivirals in vitro, suggesting that these changes represent polymorphisms unrelated to brincidofovir resistance. Lack of evidence for genotypic resistance during prophylaxis suggests that first-line use of brincidofovir for prevention of cytomegalovirus infection may preserve downstream options for patients. PMID:26941282

  9. Analysis of Mutations in the Gene Encoding Cytomegalovirus DNA Polymerase in a Phase 2 Clinical Trial of Brincidofovir Prophylaxis.

    PubMed

    Lanier, E Randall; Foster, Scott; Brundage, Tom; Chou, Sunwen; Prichard, Mark N; Kleiboeker, Steven; Wilson, Chad; Colville, Donella; Mommeja-Marin, Herve

    2016-07-01

    Brincidofovir is an oral antiviral in development for prevention of cytomegalovirus disease. Cytomegalovirus genotyping results from a phase 2 trial comparing brincidofovir to placebo for prophylaxis against cytomegalovirus infection in hematopoietic cell transplant recipients provided initial data on the clinical resistance profile for brincidofovir. In this study, no known resistance-associated mutations were detected in brincidofovir-treated subjects; identified genotypic substitutions did not confer resistance to cytomegalovirus antivirals in vitro, suggesting that these changes represent polymorphisms unrelated to brincidofovir resistance. Lack of evidence for genotypic resistance during prophylaxis suggests that first-line use of brincidofovir for prevention of cytomegalovirus infection may preserve downstream options for patients. PMID:26941282

  10. Comparison of Presentation, Course, and Outcome of Congenital and Acquired Cytomegalovirus Infection in Twins

    PubMed Central

    Samedi, Veronica Mugarab; Skappak, Christopher; Jantzie, Lindsay; Trevenen, Cynthia; Kamaluddeen, Majeeda; Ekwalanga, Pauline; Al Awad, Essa Hamdan

    2015-01-01

    Background Cytomegalovirus (CMV) is one of the most common causes of serious viral intrauterine infections. It is universally distributed among the human population with an average incidence of 0.15 to 2%. Indeed, at least half of the women in the reproductive age have evidence of prior CMV infection. Epidemiology and Pathogenicity However, it is not a usual practice to screen asymptomatic pregnant woman or neonates for CMV. Even if a mother developed a primary CMV infection during pregnancy, up to 90% of the newborns with congenital CMV will be asymptomatic at the time of birth. Only 5 to 7% of the infected babies will be acutely symptomatic, and the typical clinical presentation includes intrauterine growth restriction, microcephaly, various cutaneous manifestations (including petechiae and purpura), hematological abnormalities (particularly resistant thrombocytopenia), hepatosplenomegaly, chorioretinitis, hepatitis, etc. In contrast, acquired CMV infection is extremely unlikely to cause any serious sequelae for the infant. Cases  We present a case of congenital and acquired CMV infection in twins with a focus of dissimilarity in presentation, clinical course, and outcome. PMID:26929859

  11. Cytomegalovirus infection impairs immunosuppressive and antimicrobial effector functions of human multipotent mesenchymal stromal cells.

    PubMed

    Meisel, Roland; Heseler, Kathrin; Nau, Julia; Schmidt, Silvia Kathrin; Leineweber, Margret; Pudelko, Sabine; Wenning, Johannes; Zimmermann, Albert; Hengel, Hartmut; Sinzger, Christian; Degistirici, Özer; Sorg, Rüdiger Volker; Däubener, Walter

    2014-01-01

    Human mesenchymal stromal cells (MSC) possess immunosuppressive and antimicrobial effects that are partly mediated by the tryptophan-catabolizing enzyme indoleamine-2,3-dioxygenase (IDO). Therefore MSC represent a promising novel cellular immunosuppressant which has the potential to control steroid-refractory acute graft versus host disease (GvHD). In addition, MSC are capable of reducing the risk of infection in patients after haematopoietic stem cell transplantation (HST). Recent data indicate that signals from the microenvironment including those from microbes may modulate MSC effector functions. As Cytomegalovirus (CMV) represents a prominent pathogen in immunocompromised hosts, especially in patients following HST, we investigated the impact of CMV infection on MSC-mediated effects on the immune system. We demonstrate that CMV-infected MSC lose their cytokine-induced immunosuppressive capacity and are no longer able to restrict microbial growth. IDO expression is substantially impaired following CMV infection of MSC and this interaction critically depends on intact virus and the number of MSC as well as the viral load. Since overt CMV infection may undermine the clinical efficacy of MSC in the treatment of GvHD in transplant patients, we recommend that patients scheduled for MSC therapy should undergo thorough evaluation for an active CMV infection and receive CMV-directed antiviral therapy prior to the administration of MSC. PMID:24782599

  12. Prevalence and clinical management of cytomegalovirus retinitis in AIDS patients in shanghai, china

    PubMed Central

    2011-01-01

    Background Cytomegalovirus retinitis is a common AIDS-associated illness, leading to blindness in up to 30% of patients. This study was to investigate the prevalence and clinical management of the cytomegalovirus retinitis associated with AIDS in a large municipality of China. Methods Clinical and laboratory data from 23 cytomegalovirus retinitis patients (35 eyes) out of 303 hospitalized AIDS individuals in a single medical center were analyzed retrospectively. Two of 23 patients were diagnosed cytomegalovirus retinitis just before hospitalization without anti-CMV therapy. Ganciclovir combined with the high active anti-retroviral therapy was installed for treatment of cytomegalovirus retinitis after diagnosis was confirmed. The data were analyzed by specialists and statistics was also applied. Results The prevalence of cytomegalovirus retinitis in hospitalized AIDS patients was 7.6% in this study. The level of CD4+ T lymphocytes was correlated well with the occurrence of cytomegalovirus retinitis, showing 16.8% (19/113) (95% confidence interval: 10.4,25.0), 5.4% (3/56) (95% confidence interval: 1.1,14.9), and 1.4% (1/69) (95% confidence interval: 0.0,7.8) occurrence in the patients with CD4+ T lymphocyte counts < 50, 50~99, and 100~199 cells/μl, respectively. The mean CD4+ T lymphocyte counts was 31.7 ± 38.6 cells/μl in 23 AIDS patients with cytomegalovirus retinitis. Median CD4+ T lymphocyte count is 20 cells/μl with inter-quartile range as (5, 36). Seven patients died (11 eyes) and 16 patients (24 eyes) survived. The proportion of blindness and low vision in eyes infected with cytomegalovirus retinitis respectively was 20.8% (5/24) and 29.2% (7/24) when they were diagnosed in survivors. The ganciclovir therapy was effective in 16 patients (24 eyes). Clinical recovery of cytomegalovirus retinitis was 41.7% (10/24) and clinical improvement 58.3% (14/24). After anti-CMV treatment, the proportion of blindness or low vision was 16.7% (4/24). Conclusions The AIDS

  13. Congenital cytomegalovirus: implications for maternal-child nursing.

    PubMed

    Alex, Marion Rita

    2014-01-01

    Congenital cytomegalovirus (CMV) is a leading infectious cause of neurodevelopmental disorders in children. Despite its prevalence and devastating consequences, there is limited public and professional awareness about it. This practice-focused article presents two stories describing the family experience of congenital CMV; a literature review describing incidence and epidemiology of congenital CMV; sequelae including infection; the extent of public awareness about congenital CMV; and risk reduction approaches. Implications for maternal-child nurses, whose work uniquely situates them with populations of childbearing women, are discussed. PMID:24201241

  14. Guillain-Barré syndrome and cytomegalovirus infection during pregnancy.

    PubMed

    Lupo, Julien; Germi, Raphaële; Jean, Dominique; Baccard-Longère, Monique; Casez, Olivier; Besson, Gérard; Rougé, Alain; Boutonnat, Jean; Schwebel, Carole; Hoffmann, Pascale; Morand, Patrice

    2016-06-01

    Guillain-Barré syndrome (GBS) is an immune-mediated disorder which can be triggered by cytomegalovirus (CMV) infection. GBS following CMV primary infection is a rare event during pregnancy, which raises the question of maternal and fetal management. We describe an unusual case of GBS after CMV primary infection in a pregnant woman. The mother was successfully treated with standard immunoglobulins but in utero fetal death caused by CMV congenital infection unfortunately occurred. Similar cases have rarely been reported in the literature. PMID:27105316

  15. Impairment of cytomegalovirus and host balance in elderly subjects.

    PubMed Central

    Musiani, M; Zerbini, M; Zauli, D; Cometti, G; La Placa, M

    1988-01-01

    The titres of IgG antibody against "late antigens", "immediate early antigens", and "early antigens" induced by cytomegalovirus (CMV) and IgM antibody against "late antigens" induced by CMV were analysed in 67 geriatric subjects by immunocytochemical techniques. The titres obtained were compared with those of an adult control population. Significantly increased titres of IgG antibody against induced antigens and a significant increase in CMV reactivated infections occurred in the elderly compared with control subjects. These findings indicate that the CMV and host balance in the elderly is disturbed, leading to activation of the CMV latent carrier state that follows primary CMV infection. PMID:2842379

  16. Cytomegalovirus infection in a cohort of pregnant women.

    PubMed

    El Sanousi, S M; Osman, Z A; Mohmed, A B S; Al Awfi, M S H

    2016-04-01

    Enzyme linked immunosorbent assay was used to detect the seroprevalence of cytomegalovirus (CMV) immunoglobulin M (IgM) and immunoglobulin G (IgG) in 300 pregnant women. Seventeen (5.7%) and 274 (91.3%) women were seropositive for IgM and IgG, respectively. There was significant increase in seroprevalence of CMV IgG and no significant increase in seroprevalence of CMV IgM among tested age groups. CMV IgM and IgG seroprevalence differed nonsignificantly by type of residence, the stage of pregnancy, and the level of education. PMID:26810886

  17. Congenital cytomegalovirus infection: a cause of renal dysplasia?

    PubMed

    Chan, Maren; Hecht, Jonathan L; Boyd, Theonia; Rosen, Seymour

    2007-01-01

    Cytomegalovirus (CMV) infection is one of the most frequently encountered viral infections of the fetus and induces a wide range of histologic and clinical manifestations. Congenital abnormalities are typically restricted to the central nervous system despite evidence of CMV inclusions occurring in most epithelial cells. Although tissue injury and even glomerulonephritis have been observed in congenital CMV infections, renal multicystic dysplasia has not been reported. Herein, we describe a case of unilateral renal dysplasia in a 19-week fetus with concurrent CMV infection. We believe the present case to be the first description of a virus apparently inducing renal multicystic dysplasia. PMID:17638423

  18. Mast cells as rapid innate sensors of cytomegalovirus by TLR3/TRIF signaling-dependent and -independent mechanisms.

    PubMed

    Becker, Marc; Lemmermann, Niels A W; Ebert, Stefan; Baars, Pamela; Renzaho, Angelique; Podlech, Jürgen; Stassen, Michael; Reddehase, Matthias J

    2015-03-01

    The succinct metaphor, 'the immune system's loaded gun', has been used to describe the role of mast cells (MCs) due to their storage of a wide range of potent pro-inflammatory and antimicrobial mediators in secretory granules that can be released almost instantly on demand to fight invaders. Located at host-environment boundaries and equipped with an arsenal of pattern recognition receptors, MCs are destined to be rapid innate sensors of pathogens penetrating endothelial and epithelial surfaces. Although the importance of MCs in antimicrobial and antiparasitic defense has long been appreciated, their role in raising the alarm against viral infections has been noted only recently. Work on cytomegalovirus (CMV) infection in the murine model has revealed MCs as players in a novel cross-talk axis between innate and adaptive immune surveillance of CMV, in that infection of MCs, which is associated with MC degranulation and release of the chemokine CCL5, enhances the recruitment of protective CD8 T cells to extravascular sites of virus replication, specifically to lung interstitium and alveolar epithelium. Here, we have expanded on these studies by investigating the conditions for MC activation and the consequent degranulation in response to host infection. Surprisingly, the data revealed two temporally and mechanistically distinct waves of MC activation: an almost instant indirect activation that depended on TLR3/TRIF signaling and delayed activation by direct infection of MCs that did not involve TLR3/TRIF signaling. Cell type-specific Cre-recombination that yielded eGFP-expressing reporter virus selectively originating from MCs identified MC as a new in vivo, first-hit target cell of productive murine CMV infection. PMID:25152077

  19. In situ hybridization and immunohistochemistry for the detection of porcine cytomegalovirus.

    PubMed

    Sekiguchi, Maki; Shibahara, Tomoyuki; Miyazaki, Ayako; Tajima, Tomoko; Shimizu, Shinya; Kabali, Emmanuel; Takano, Yoshiyuki; Sasaki, Yosuke; Kubo, Masanori

    2012-01-01

    To establish in situ hybridization and immunohistochemistry based-assays for the detection of porcine cytomegalovirus, routinely processed renal tissue sections from 34 diseased piglets suspected of having the infection were obtained and examined. Using hematoxylin and eosin, porcine cytomegalovirus inclusion bodies were found in the nucleus of renal epithelial cells and capillary endothelial cells in the renal medulla in 30 cases. Inclusion bodies corresponding to porcine cytomegalovirus mRNA after in situ hybridization or porcine cytomegalovirus antigens after immunohistochemistry were easily determined. The cells were characterized by cytomegaly and basophilic intranuclear inclusion bodies. Using in situ hybridization, porcine cytomegalovirus mRNA were clearly detected in the nucleus and cytoplasm of the cells in 28 of the 30 (93.3%) cases. Using immunohistochemistry, porcine cytomegalovirus antigens were clearly detected in the cytoplasm of the cells in 21 of the 30 (70.0%) cases. Higher specificities and increased intensity of staining was observed with minimal background using in situ hybridization and immunohistochemistry compared with hematoxylin and eosin. Thus, the two established methods are useful and helpful tools for detecting the presence of a porcine cytomegalovirus infection. PMID:22008295

  20. Irradiation, Cisplatin, and 5-Azacytidine Upregulate Cytomegalovirus Promoter in Tumors and Muscles: Implementation of Non-invasive Fluorescence Imaging

    PubMed Central

    Kamensek, Urska; Sersa, Gregor; Vidic, Suzana; Tevz, Gregor; Kranjc, Simona

    2010-01-01

    Purpose The cytomegalovirus (CMV) promoter is one of the most commonly used promoters for expression of transgenes in mammalian cells. The aim of our study was to evaluate the role of methylation and upregulation of the CMV promoter by irradiation and the chemotherapeutic agent cisplatin in vivo using non-invasive fluorescence in vivo imaging. Procedures Murine fibrosarcoma LPB and mammary carcinoma TS/A cells were stably transfected with plasmids encoding CMV and p21 promoter-driven green fluorescent protein (GFP) gene. Solid TS/A tumors were induced by subcutaneous injection of fluorescent tumor cells, while leg muscles were transiently transfected with plasmid encoding GFP under the control of the CMV promoter. Cells, tumors, and legs were treated either by DNA methylation inhibitor 5-azacytidine, irradiation, or cisplatin. GFP expression was determined using a fluorescence microplate reader in vitro and by non-invasive fluorescence imaging in vivo. Results Treatment of cells, tumors, and legs with 5-azacytidine (re)activated the CMV promoter. Furthermore, treatment with irradiation or cisplatin resulted in significant upregulation of GFP expression both in vitro and in vivo. Conclusions Observed alterations in the activity of the CMV promoter limit the usefulness of this widely used promoter as a constitutive promoter. On the other hand, inducibility of CMV promoters can be beneficially used in gene therapy when combined with standard cancer treatment, such as radiotherapy and chemotherapy. PMID:20396957

  1. Autoimmunity induced by human cytomegalovirus in patients with systemic lupus erythematosus

    PubMed Central

    2012-01-01

    Human cytomegalovirus is a common herpesvirus that is linked to autoimmunity, especially in genetically predisposed persons. The article by Hsieh and colleagues in a previous issue of Arthritis Research & Therapy suggests that a C-terminal peptide of the human cytomegalovirus protein pp65 is highly immunogenic in patients with systemic lupus erythematosus and that antibodies against this peptide cross-react with nuclear proteins and double-stranded DNA, which are highly frequent autoantibodies in systemic lupus erythematosus patients. These observations highlight the fact that immunization with one small cytomegalovirus-specific peptide results in multiple autoreactive antibodies, probably through molecular mimicry and epitope spreading, in genetically predisposed persons. PMID:22277352

  2. Human cytomegalovirus and transplantation: drug development and regulatory issues.

    PubMed

    McIntosh, Megan; Hauschild, Benjamin; Miller, Veronica

    2016-01-01

    Cytomegalovirus (CMV) infection is highly prevalent worldwide and can cause serious disease among immunocompromised individuals, including persons with HIV and transplant recipients on immunosuppressive therapies. It can also result in congenital cytomegalovirus when women are infected during pregnancy. Treatment and prevention of CMV in solid organ and haematopoietic stem cell transplant recipients is accomplished in one of three ways: (1) prophylactic therapy to prevent CMV viraemia; (2) pre-emptive therapy for those with low levels of replicating virus; and (3) treatment for established disease. Despite the high prevalence of CMV, there are few available approved drug therapies, and those that are available are hampered by toxicity and less-than-optimal efficacy. New therapies are being developed and tested; however, inconsistency in standardisation of virus levels and questions about potential endpoints in clinical trials present regulatory hurdles that must be addressed. This review covers the current state of CMV therapy, drugs currently under investigation, and clinical trial issues and questions that are in need of resolution. PMID:27482453

  3. Seroprevalence and Risk Factors for Cytomegalovirus Infections in Adolescent Females

    PubMed Central

    Stadler, Laura Patricia; Bernstein, David I.; Callahan, S. Todd; Turley, Christine B.; Munoz, Flor M.; Ferreira, Jennifer; Acharya, Mekhala; Simone, Gina A. Gorgone; Patel, Shital M.; Edwards, Kathryn M.; Rosenthal, Susan L.

    2013-01-01

    Background Congenital cytomegalovirus (CMV) is a leading cause of disability, including sensorineural hearing loss, developmental delay, and mental retardation. Understanding risk factors for acquisition of CMV infection in adolescent females will help determine vaccine strategies. Methods Females (12–17 years) were recruited from primary care settings in Cincinnati, Galveston, Houston, and Nashville from June 2006 to July 2010 for a seroepidemiologic study, from which seronegative participants were recruited for a CMV vaccine trial. Participants (n = 1585) responded to questions regarding potential exposures. For those with young children in the home (n = 859), additional questions were asked about feeding and changing diapers, and for those > 14 years of age (n = 1162), questions regarding sexual activity were asked. Serum was evaluated for CMV antibody using a commercial immunoglobulin G assay. Results Cytomegalovirus antibody was detected in 49% of participants. In the univariate analyses, CMV seroprevalence was significantly higher among African Americans, those with children < 3 years of age in the home, and those with a history of oral, anal, or vaginal intercourse. Among those with young children in the home, feeding children and changing diapers further increased the association with CMV infection. However, in the final multivariate analysis, only African Americans and household contact with young children were associated with CMV infection. Conclusions By age 12, evidence of CMV infection was common. Multiple factors regarding race and personal behaviors likely contribute to seroconversion earlier in life. PMID:23687583

  4. Expression of infectious woodchuck hepatitis virus in murine and avian fibroblasts.

    PubMed Central

    Seeger, C; Baldwin, B; Tennant, B C

    1989-01-01

    The liver is the primary site for replication of the hepadnavirus genome. We asked whether the posttranscriptional phase of the viral replication cycle would depend on hepatocyte-specific functions. For this purpose, we assayed a previously constructed chimera between sequences of the cytomegalovirus immediate-early promoter-enhancer region and woodchuck hepatitis virus (WHV) (C. Seeger and J. Maragos, J. Virol. 63:1907-1915, 1989) for its ability to direct the synthesis of infectious WHV in hepatoma cells and in murine and avian fibroblast cells. Viruslike particles containing WHV DNA were produced transiently in transfected hepatoma cells and in fibroblasts. Inoculation of woodchucks with culture medium from hepatoma cells or fibroblasts transfected with viral DNA led to productive WHV infection, as observed following infection of woodchucks with serum from WHV-infected animals. These results demonstrate that posttranscriptional events of the hepadnavirus replication cycle are not dependent on hepatocyte-specific functions. Images PMID:2795716

  5. Murine CMV infection induces the continuous production of mucosal resident T cells

    PubMed Central

    Smith, Corinne J.; Caldeira-Dantas, Sofia; Turula, Holly; Snyder, Christopher M.

    2015-01-01

    Summary Cytomegalovirus (CMV) is a herpesvirus that persists for life and maintains extremely large numbers of T cells with select specificities in circulation. However, it is unknown how viral persistence impacts T cell populations in mucosal sites. We found that many murine (M)CMV-specific CD8s in mucosal tissues became resident memory T cells (TRM). These cells adopted an intraepithelial localization in the salivary gland that correlated with, but did not depend on, expression of the integrin CD103. MCMV-specific TRM cells formed early after infection and spleen-localized cells had reduced capacities to become TRM at late times. Surprisingly however, small numbers of new TRM cells were formed from the circulating pool throughout infection, favoring populations maintained at high levels in the blood and shifting the immunodominance within the TRM populations over time. These data show that mucosal TRM populations can be dynamically maintained by a persistent infection. PMID:26526996

  6. Murine acute leukemia cell line with megakaryocytic differentiation (MK-8057) induced by whole-body irradiation in C sup 3 H/He mice: Cytological properties and kinetics of its leukemic stem cells

    SciTech Connect

    Hirabayashi, Y.; Inoue, T.; Yoshida, K.; Sasaki, H.; Kubo, S.; Kanisawa, M.; Seki, M. )

    1991-01-01

    Five cases of murine leukemia with megakaryocytic differentiation were observed among the 417 cases of radiation-induced leukemias which developed in 30% of C{sup 3}H/HeMs mice exposed at 8 to 10 weeks to 0.5 to 5 gy total body irradiation. Cells from individual leukemic colonies in the spleen of the irradiated mice, and cells from colonies in methylcellulose (MC) culture in vitro, derived from one of these leukemias, MK-8057, were injected into mice; both types of cells caused the deaths of the recipient mice by inducing the same type of leukemia. MK-8057 can be maintained in Dexter-type liquid culture with a feeder layer of irradiated bone marrow cells. There was a linear reciprocal relationship between the increasing number of MK-8057 cells injected versus the survival of the recipient mice. A reciprocal relationship also was seen between an increasing number of leukemic stem cells, corresponding to the number of MK-8057 cells, and the survival of mice injected with MK-8057. Giant nuclear megakaryocytes developed during the course of colony growth in the spleen as they did in the MC culture. Such megakaryocytes were acetylcholinesterase positive, whereas leukemic cells in the peripheral blood showed no sign of platelet production nor of a positive reaction to acetylcholinesterase. Cells maintained in culture were entirely positive in platelet glycoprotein IIb/IIIa when anti-human antibody was used. The larger cells in a splenic cell suspension derived from a moribund mouse were separated and enriched by velocity sedimentation using centrifugal elutriation (CE), and then subjected to flow cytometry using propidium iodide staining. Cells with up to 32N-DNA content were detected. After separating MK-8057 by counter-flow CE, the larger cell fraction produced more leukemic colonies when injected into irradiated mice than did the small cell fraction.

  7. Cytomegalovirus Antibody in Cerebrospinal Fluid of Schizophrenic Patients Detected by Enzyme Immunoassay

    NASA Astrophysics Data System (ADS)

    Fuller Torrey, E.; Yolken, Robert H.; Winfrey, C. Jack

    1982-05-01

    By means of enzyme immunoassay techniques to detect the presence of antibody to cytomegalovirus, the cerebrospinal fluid of 178 patients with schizophrenia, 17 patients with bipolar disorders, and 11 other psychiatric patients was compared with that of 79 neurological patients and 41 normal control subjects. The cerebrospinal fluid of 20 of the schizophrenic patients and 3 of the patients with bipolar disorders showed significant increases in immunoglobulin M antibody to cytomegalovirus; no difference was found in patients on or off psychotropic medications.

  8. Fetal outcome in murine Lyme disease.

    PubMed

    Silver, R M; Yang, L; Daynes, R A; Branch, D W; Salafia, C M; Weis, J J

    1995-01-01

    Lyme disease is an inflammatory syndrome caused by infection with Borrelia burgdorferi. Although this syndrome has important implications for human pregnancy, little is known about gestational infection with B. burgdorferi. Fetal death occurred in 33 of 280 gestational sacs (12%) in 39 C3H/HeN female mice infected by intradermal injection of B. burgdorferi 4 days after mating (acute infection), compared with 0 of 191 sacs in 25 control mice (P = 0.0001). Forty-six percent of acutely infected mice suffered at least one fetal death, compared with none of the control animals (P = 0.0002). There were no fetal deaths in 18 C3H/HeN mice infected 3 weeks prior to mating (chronic infection). A sensitive PCR technique detected B. burgdorferi DNA in the uteri of acutely infected mice but did not detect DNA in the uteri of controls or chronically infected mice. Spirochete DNA was only rarely detected in fetal tissues, and its presence was not required for fetal death. The inclusion of an internal competitive PCR target indicated that the lack of B. burgdorferi sequences in fetal DNA was not due to the presence of a PCR inhibitor. Histologic analysis of gestational tissues from infected animals demonstrated nonspecific pathology consistent with fetal death. These findings indicate an association between murine fetal death and acute infection with B. burgdorferi early in gestation but not with chronic infection. Our data suggest that fetal death is due to a maternal response to infection rather than fetal infection. These findings could provide an explanation for observations in humans in which sporadic cases of fetal death in women infected with B. burgdorferi during pregnancy have been reported, while previous infection has not been associated with fetal death. PMID:7806385

  9. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  10. Reactivation and shedding of cytomegalovirus in astronauts during spaceflight

    NASA Technical Reports Server (NTRS)

    Mehta, S. K.; Stowe, R. P.; Feiveson, A. H.; Tyring, S. K.; Pierson, D. L.

    2000-01-01

    The reactivation of cytomegalovirus (CMV) in 71 astronauts was investigated, using polymerase chain reaction. A significantly greater (P<.0001) shedding frequency was found in urine samples from astronauts before spaceflight (10.6%) than in urine from the healthy control subject group (1.2%). Two of 4 astronauts studied during spaceflight shed CMV in urine. A significant increase (P<.0001) in CMV antibody titer, compared with baseline values, was also found 10 days before spaceflight. CMV antibody titer was further increased (P<.001) 3 days after landing, compared with 10 days before the mission. Significant increases in stress hormones were also found after landing. These results demonstrate that CMV reactivation occurred in astronauts before spaceflight and indicate that CMV may further reactivate during spaceflight.

  11. Cytomegalovirus and inflammatory bowel disease: Is there a link?

    PubMed Central

    Criscuoli, Valeria; Rizzuto, Maria Rosa; Cottone, Mario

    2006-01-01

    The objective of this report is to give an overall view of the epidemiological, clinical, diagnostic and therapeutic features of Cytomegalovirus (CMV) infection in inflammatory bowel disease (IBD). A review of published reports on this topic was carried out, with particular attention paid to the selection of patients included in studies and the diagnostic methods employed. CMV is frequently associated with IBD. In some cases, CMV infection is associated with a poor outcome but it is not clear which patients are more likely to be affected and in which stage of the disease. The use of anti-viral therapy in IBD is controversial and an empirical study with controls is needed. The natural history of CMV infection related to the development and treatment of IBD has not been clarified but it is important to take it in consideration because of the possibility of viral persistence in the immunocompromised host and viral interaction with the immune system. PMID:16937462

  12. Cytomegalovirus Survival on Common Environmental Surfaces: Opportunities for Viral Transmission

    PubMed Central

    Stowell, Jennifer D.; Forlin-Passoni, Daniela; Din, Erica; Radford, Kay; Brown, Denise; White, Audrey; Bate, Sheri L.; Dollard, Sheila C.; Bialek, Stephanie R.; Cannon, Michael J.

    2012-01-01

    Congenital cytomegalovirus (CMV) affects ∼1 of 150 births and is a leading cause of hearing loss and intellectual disability. It has been suggested that transmission may occur via contaminated surfaces. CMV AD169 in filtered human saliva, applied to environmental surfaces, was recovered at various time points. Samples were evaluated by culture and real-time polymerase chain reaction. CMV was found viable on metal and wood to 1 hour, glass and plastic to 3 hours, and rubber, cloth, and cracker to 6 hours. CMV was cultured from 83 of 90 wet and 5 of 40 dry surfaces. CMV was more likely to be isolated from wet, highly absorbent surfaces at earlier time points. PMID:22116837

  13. [Successful treatment of congenital cytomegalovirus infection with valganciclovir].

    PubMed

    Ishida, Yu; Miyajima, Tasuku; Shimura, Masaru; Morichi, Shinichiro; Morishima, Yasuyuki; Ioi, Hiroaki; Oana, Shingo; Yamanaka, Gaku; Kawashima, Hisashi; Hoshika, Akinori

    2012-01-01

    Congenital cytomegalovirus (CMV) infection occurs frequently in neonates. However, there are no screening tests or definitive treatments for this infection in Japan. We report a case of a 21-day-old Japanese boy with congenital CMV infection. He was referred to our hospital for treatment of congenital bilateral deafness. Brain magnetic resonance imaging (MRI) revealed cortical dysplasia of the temporal poles, enlarged ventricles, and areas of abnormal intensity in the white matter. He was given a diagnosis of congenital CMV infection based on the detection of CMV DNA in his urine and the umbilical cord. After the administration of valganciclovir, no CMV DNA was detected in his serum, and brain MRI and electroencephalogram findings, motor development, and deafness improved. Further investigation is needed to establish a screening test and treatment for congenital CMV infection in Japan. PMID:22352032

  14. Knowledge and Awareness of Congenital Cytomegalovirus Among Women

    DOE PAGESBeta

    Jeon, Jiyeon; Victor, Marcia; Adler, Stuart P.; Arwady, Abigail; Demmler, Gail; Fowler, Karen; Goldfarb, Johanna; Keyserling, Harry; Massoudi, Mehran; Richards, Kristin; et al

    2006-01-01

    Bmore » ackground . Congenital cytomegalovirus (CMV) infection is a leading cause of disabilities in children, yet the general public appears to have little awareness of CMV. Methods . Women were surveyed about newborn infections at 7 different geographic locations. Results . Of the 643 women surveyed, 142 ( 22 % ) had heard of congenital CMV. Awareness increased with increasing levels of education ( P < .0001 ). Women who had worked as a healthcare professional had a higher prevalence of awareness of CMV than had other women ( 56 % versus 16 % , P < .0001 ). Women who were aware of CMV were most likely to have heard about it from a healthcare provider ( 54 % ), but most could not correctly identify modes of CMV transmission or prevention. Among common causes of birth defects and childhood illnesses, women's awareness of CMV ranked last. Conclusion . Despite its large public health burden, few women had heard of congenital CMV, and even fewer were aware of prevention strategies.« less

  15. Is human cytomegalovirus associated with breast cancer progression?

    PubMed Central

    2013-01-01

    Background It has been hypothesized that human cytomegalovirus (HCMV) may be associated with breast cancer progression. However, the role of HCMV infection in breast cancer remains controversial. We aimed to assess whether HCMV genes (UL122 and UL83) could be detected in breast carcinomas and reinvestigated their possible association with breast cancer progression. DNA from paraffin-embedded tissues was analyzed by real-time PCR. We investigated 20 fibroadenomas and 27 primary breast carcinomas (stages II, III, and IV). Findings Two carcinomas were positive for HCMV, one was positive for two TaqMan viral detection probes, and one was positive for a sole TaqMan viral detection probe (UL83), whereas the remainder of the samples was negative. Conclusions Samples studied showed no association between HCMV infection and breast cancer progression. PMID:23557440

  16. Cytomegalovirus and HIV: A Dangerous Pas de Deux.

    PubMed

    Gianella, Sara; Letendre, Scott

    2016-10-01

    Human immunodeficiency virus (HIV)-infected adults who take stable antiretroviral therapy (ART) are at risk for early onset of age-related diseases. This is likely due to a complex interaction between traditional risk factors, HIV infection itself, and other factors, such as underlying immune dysfunction and persistent inflammation. HIV disrupts the balance between the host and coinfecting microbes, worsening control of these potential pathogens. For example, HIV-infected adults are more likely than the general population to have subclinical bursts of cytomegalovirus (CMV) replication at mucosal sites. Production of antigens can activate the immune system and stimulate HIV replication, and it could contribute to the pathogenesis of adverse outcomes of aging, like cardiovascular disease and neurocognitive impairment. Further investigation of the relationships between CMV, immune dysfunction, and unsuccessful aging during chronic HIV infection is warranted. PMID:27625433

  17. Cytomegalovirus Retinitis after Intravitreal Bevacizumab Injection in an Immunocompetent Patient

    PubMed Central

    Bae, So Hyun; Kim, Tae Wan; Chung, Hum

    2013-01-01

    We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection. PMID:23372384

  18. Expanding role of cytomegalovirus as a human pathogen.

    PubMed

    Navarro, David

    2016-07-01

    Cytomegalovirus (CMV) continues to be a leading cause of morbidity and mortality in transplant recipients, despite major advancements in preventative strategies. Antiviral prophylaxis and pre-emptive antiviral therapeutic regimens are associated with a high incidence of late-onset end-organ disease and cause drug-related toxicity when overused. Therefore, the identification of risk factors for CMV replication is required. Genetic and immunological factors that predispose individuals to CMV-related clinical complications have been identified and may be instrumental for optimizing CMV treatment in the future. Evidence suggests a causal pathogenetic link between CMV-related complications and inflammatory diseases in non-canonically immunosuppressed individuals such as patients with lung injury and critically ill and cancer patients. However, a randomized clinical trial is required to determine if a causal relationship exists. J. Med. Virol. 88:1103-1112, 2016. © 2015 Wiley Periodicals, Inc. PMID:26681168

  19. SOCS1 and SOCS3 are expressed in mononuclear cells in human cytomegalovirus viremia after allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Shin, Seung-Hwan; Lee, Ji Yoon; Lee, Tae Hyang; Park, So-Hye; Yahng, Seung-Ah; Yoon, Jae-Ho; Lee, Sung-Eun; Cho, Byung-Sik; Lee, Dong-Gun; Kim, Yoo-Jin; Lee, Seok; Min, Chang-Ki; Cho, Seok-Goo; Kim, Dong-Wook; Lee, Jong-Wook; Min, Woo-Sung; Park, Chong-Won

    2015-01-01

    Background The expression of the SOCS genes in cytomegalovirus (CMV) viremia after hematopoietic stem cell transplantation (HSCT) remains largely unexplored. Methods Using quantitative RT-PCR of mononuclear cells, we conducted pairwise comparison of SOCS1 and SOCS3 expression levels among a healthy donor group (N=55), a pre-HSCT group (N=17), and the recipient subgroup (N=107), which were divided according to the occurrence of CMV viremia and acute graft-versus-host disease (aGVHD). Results Compared to that in the healthy donor group, SOCS1 expression was higher in the CMV+ subgroup, especially in the CMV+GVHD- group, but decreased in the other subgroups. When compared to the expression in the pre-HSCT group, SOCS1 expression was significantly higher in the CMV+ subgroup, especially in the CMV+GVHD+ subgroup. Meanwhile, compared to that in the healthy donor group, SOCS3 expression was significantly lower in all other groups. The CMV-GVHD- subgroup showed significantly lower SOCS3 expression compared to the CMV+ subgroup, the CMV+GVHD+ subgroup, and the CMV+GVHD- subgroup. Conclusion We report differential expression of SOCS genes according to CMV viremia with acute GVHD occurrence after HSCT, suggesting that regulation of SOCS expression is associated with CMV viremia. PMID:25830129

  20. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation

    PubMed Central

    Reddehase, Matthias J.

    2016-01-01

    Hematopoietic cell transplantation (HCT) is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a “window of opportunity” for latent Cytomegalovirus (CMV) by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A “window of opportunity” for the virus represents a “window of risk” for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8+ T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP) representing the most severe clinical manifestation. Here, I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a preemptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing “proof of concept” for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8+ T cells bridging the critical interim. However, CMV is not a “passive antigen” but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow (BM) stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected BM stroma and impaired colony growth and lineage differentiation can lead to “graft failure.” In consequence, uncontrolled virus spread

  1. Cytomegalovirus infection enhances smooth muscle cell proliferation and intimal thickening of rat aortic allografts.

    PubMed Central

    Lemström, K B; Bruning, J H; Bruggeman, C A; Lautenschlager, I T; Häyry, P J

    1993-01-01

    Inbred DA (AG-B4, RT1a) and WF (AG-B2, RT1v) rats were used as donors and recipients of aortic allografts. The recipient rats were inoculated i.p. either on day 1 (early infection) or on day 60 (late infection) with 10(5) plaque-forming units of rat cytomegalovirus (RCMV). The control rats were left noninfected. The presence of viral infection was demonstrated by plaque assays from biopsies of the salivary glands, liver, and spleen at sacrifice. The rats received 300 microCi[3H]thymidine by i.v. injection 3 h before sacrifice, and the grafts were removed at various time points for histology, immunohistochemistry, and autoradiography. RCMV infection significantly enhanced the generation of allograft arteriosclerosis. Infection at the time of transplantation had two important effects. First, the infection was associated with an early, prominent inflammatory episode and proliferation of inflammatory cells in the allograft adventitia. Second, the viral infection doubled the proliferation rate of smooth muscle cells and the arteriosclerotic alterations in the intima. In late infection the impact of RCMV infection on the allograft histology was nearly nonexistent. RCMV infection showed no effect in syngeneic grafts. These results suggest that early infection is more important to the generation of accelerated allograft arteriosclerosis than late infection, and that an acute alloimmune response must be associated with virus infection, to induce accelerated allograft arteriosclerosis. RCMV-infected aortic allografts, as described here, provide the first experimental model to investigate the interaction between the virus and the vascular wall of the transplant. Images PMID:8394384

  2. Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

    PubMed Central

    Zheng, Xiaoqun; Gao, Yan; Zhang, Qi; Liu, Yanqing; Peng, Ying; Fu, Miao; Ji, Yanhong

    2015-01-01

    Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies. PMID:25658598

  3. Macrophage specific delivery of TNF-α siRNA complexed with β-1,3-glucan inhibits LPS-induced cytokine production in a murine acute hepatitis model.

    PubMed

    Mochizuki, Shinichi; Morishita, Hiromi; Sakurai, Kazuo

    2013-05-01

    RNA interference therapy utilizes physiological gene silencing that is originally found as a defense function against foreign RNAs. To silence the target gene, short double stranded RNA has to be delivered to cytosol. However, lack of a suitable delivering carrier is the major obstacle to practical usage. In this study, we present a novel complex consisting of β-1,3-glucan and short interference RNA (siRNA) as a solution for the problem. We used a β-1,3-glucan schizophyllan (SPG) and a siRNA (dA-siTNFα) that is designed to suppress tumor necrosis factor alpha (TNF-α), where the sense strand of siRNA has (dA(40)) tail to induce complexation with SPG. The dA-siTNFα/SPG complex showed higher affinity to recombinant dectin-1 than SPG itself, where dectin-1 is a β-1,3-glucan receptor expressed on antigen presenting cells and can be a target for specific delivery. The complex suppressed lipopolysaccharide (LPS)-induced TNF-α secretion by peritoneal macrophages in vitro. When the complex was intravenously injected, the oligonucleotide accumulated in liver; especially distributed into Kupffer cells. The complex significantly decreased the serum TNF-α level for the mouse model of LPS-induced acute hepatitis. This new siRNA delivery system may overcome the problem for RNA interference therapy because of its non-toxicity and high target specificity. PMID:23523387

  4. In vivo-in vitro comparison of acute respiratory tract toxicity using human 3D airway epithelial models and human A549 and murine 3T3 monolayer cell systems.

    PubMed

    Sauer, Ursula G; Vogel, Sandra; Hess, Annemarie; Kolle, Susanne N; Ma-Hock, Lan; van Ravenzwaay, Bennard; Landsiedel, Robert

    2013-02-01

    The usefulness of in vitro systems to predict acute inhalation toxicity was investigated. Nineteen substances were tested in three-dimensional human airway epithelial models, EpiAirway™ and MucilAir™, and in A549 and 3T3 monolayer cell cultures. IC(50) values were compared to rat four-hour LC(50) values classified according to EPA and GHS hazard categories. Best results were achieved with a prediction model distinguishing toxic from non-toxic substances, with satisfactory specificities and sensitivities. Using a self-made four-level prediction model to classify substances into four in vitro hazard categories, in vivo-in vitro concordance was mediocre, but could be improved by excluding substances causing pulmonary edema and emphysema in vivo. None of the test systems was outstanding, and there was no evidence that tissue or monolayer systems using respiratory tract cells provide an added value. However, the test systems only reflected bronchiole epithelia and alveolar cells and investigated cytotoxicity. Effects occurring in other cells by other mechanisms could not be recognised. Further work should optimise test protocols and expand the set of substances tested to define applicability domains. In vivo respiratory toxicity data for in vitro comparisons should distinguish different modes of action, and their relevance for human health effects should be ensured. PMID:23085368

  5. Murine typhus in travelers returning from Indonesia.

    PubMed Central

    Parola, P.; Vogelaers, D.; Roure, C.; Janbon, F.; Raoult, D.

    1998-01-01

    We report the first three documented cases of murine typhus imported into Europe from Indonesia, discuss clues for the diagnosis of the disease, and urge that murine fever be considered in the diagnosis of febrile disease in travelers. PMID:9866749

  6. Antibacterial activity of recombinant murine beta interferon.

    PubMed Central

    Fujiki, T; Tanaka, A

    1988-01-01

    Recombinant murine beta interferon was protective and therapeutic for mice against Listeria monocytogenes infection in vivo. The recombinant murine beta interferon caused enhanced H2O2 release by macrophages in vivo, but not in vitro. PMID:3343048

  7. Systematic Evaluation of Different Nucleic Acid Amplification Assays for Cytomegalovirus Detection: Feasibility of Blood Donor Screening.

    PubMed

    Vollmer, T; Knabbe, C; Dreier, J

    2015-10-01

    Acute primary cytomegalovirus (CMV) infections, which commonly occur asymptomatically among blood donors, represent a significant risk for serious morbidity in immunocompromised patients (a major group of transfusion recipients). We implemented a routine CMV pool screening procedure for plasma for the identification of CMV DNA-positive donors, and we evaluated the sensitivities and performance of different CMV DNA amplification systems. Minipools (MPs) of samples from 18,405 individual donors (54,451 donations) were screened for CMV DNA using the RealStar CMV PCR assay (Altona Diagnostic Technologies), with a minimum detection limit of 11.14 IU/ml. DNA was extracted with a high-volume protocol (4.8 ml, Chemagic Viral 5K kit; PerkinElmer) for blood donor pool screening (MP-nucleic acid testing [NAT]) and with the Nuclisens easyMAG system (0.5 ml; bioMérieux) for individual donation (ID)-NAT. In total, six CMV DNA-positive donors (0.03%) were identified by routine CMV screening, with DNA concentrations ranging from 4.35 × 10(2) to 4.30 × 10(3) IU/ml. Five donors already showed seroconversion and detectable IgA, IgM, and/or IgG antibody titers (IgA(+)/IgM(+)/IgG(-) or IgA(+)/IgM(+)/IgG(+)), and one donor showed no CMV-specific antibodies. Comparison of three commercial assays, i.e., the RealStar CMV PCR kit, the Sentosa SA CMV quantitative PCR kit (Vela Diagnostics), and the CMV R-gene PCR kit (bioMérieux), for MP-NAT and ID-NAT showed comparably good analytical sensitivities, ranging from 10.23 to 11.14 IU/ml (MP-NAT) or from 37.66 to 57.94 IU/ml (ID-NAT). The clinical relevance of transfusion-associated CMV infections requires further investigation, and the evaluated methods present powerful basic tools providing sensitive possibilities for viral testing. The application of CMV MP-NAT facilitated the identification of one donor with a window-phase donation during acute primary CMV infection. PMID:26202109

  8. Human Cytomegalovirus-Induces Cytokine Changes in the Placenta with Implications for Adverse Pregnancy Outcomes

    PubMed Central

    Hamilton, Stuart T.; Scott, Gillian; Naing, Zin; Iwasenko, Jenna; Hall, Beverley; Graf, Nicole; Arbuckle, Susan; Craig, Maria E.; Rawlinson, William D.

    2012-01-01

    Human cytomegalovirus (CMV) infection of the developing fetus can result in adverse pregnancy outcomes including death in utero. Fetal injury results from direct viral cytopathic damage to the CMV-infected fetus, although evidence suggests CMV placental infection may indirectly cause injury to the fetus, possibly via immune dysregulation with placental dysfunction. This study investigated the effects of CMV infection on expression of the chemokine MCP-1 (CCL2) and cytokine TNF-α in placentae from naturally infected stillborn babies, and compared these changes with those found in placental villous explant histocultures acutely infected with CMV ex vivo. Tissue cytokine protein levels were assessed using quantitative immunohistochemistry. CMV-infected placentae from stillborn babies had significantly elevated MCP-1 and TNF-α levels compared with uninfected placentae (p = 0.001 and p = 0.007), which was not observed in placentae infected with other microorganisms (p = 0.62 and p = 0.71) (n = 7 per group). Modelling acute clinical infection using ex vivo placental explant histocultures showed infection with CMV laboratory strain AD169 (0.2 pfu/ml) caused significantly elevated expression of MCP-1 and TNF-α compared with uninfected explants (p = 0.0003 and p<0.0001) (n = 25 per group). Explant infection with wild-type Merlin at a tenfold lower multiplicity of infection (0.02 pfu/ml), caused a significant positive correlation between increased explant infection and upregulation of MCP-1 and TNF-α expression (p = 0.0001 and p = 0.017). Cytokine dysregulation has been associated with adverse outcomes of pregnancy, and can negatively affect placental development and function. These novel findings demonstrate CMV infection modulates the placental immune environment in vivo and in a multicellular ex vivo model, suggesting CMV-induced cytokine modulation as a potential initiator and/or exacerbator of placental and fetal injury. PMID

  9. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  10. Antimicrobial proteins of murine macrophages.

    PubMed Central

    Hiemstra, P S; Eisenhauer, P B; Harwig, S S; van den Barselaar, M T; van Furth, R; Lehrer, R I

    1993-01-01

    Three murine microbicidal proteins (MUMPs) were purified from cells of the murine macrophage cell line RAW264.7 that had been activated by gamma interferon. Similar proteins were also present in nonactivated RAW264.7 cells, in cells of the murine macrophage cell line J774A.1, and in resident and activated murine peritoneal macrophages. MUMP-1, MUMP-2, and MUMP-3 killed Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Mycobacterium fortuitum, and Cryptococcus neoformans in vitro. MUMP-1 resembled an H1 histone but was unusual because its N-terminal residue (serine) was not N acetylated. Although MUMP-2 was N terminally blocked, its high lysine/arginine ratio and its reactivity with an antibody to H1 histones suggested that it also belonged to the H1 histone family. MUMP-3 was identical to histone H2B in 30 of 30 amino-terminal residues. Although the antimicrobial properties of histones have been recognized for decades, this is the first evidence that such proteins may endow the lysosomal apparatus of macrophages with nonoxidative antimicrobial potential. Other MUMPs, including some with a more restricted antimicrobial spectrum and one that appeared to be induced in RAW264.7 cells after gamma interferon stimulation, were noted but remain to be characterized. Images PMID:8514411

  11. Cloning and characterization of a murine SIL gene

    SciTech Connect

    Collazo-Garcia, N.; Scherer, P.; Aplan, P.D.

    1995-12-10

    The human SIL gene is disrupted by a site-specific interstitial deletion in 25% of children with T-cell acute lymphoblastic leukemia. Since transcriptionally active genes are prone to recombination events, the recurrent nature of this lesion suggests that the SIL gene product is transcriptionally active in the cell type that undergoes this interstitial deletion and that the SIL gene product may play a role in normal lymphoid development. To facilitate studies of SIL gene function, we have cloned and characterized a murine SIL gene. The predicted murine SIL protein is 75% identical to the human gene, with good homology throughout the open reading frame. An in vitro translated SIL cDNA generated a protein slightly larger than the predicted 139-kDa protein. Although a prior report detected SIL mRNA expression exclusively in hematopoietic tissues, a sensitive RT-PCR assay demonstrated SIL expression to be ubiquitous, detectable in all tissues examined. Since the RT-PCR assay suggested that SIL mRNA expression was higher in rapidly proliferating tissues, we assayed SIL mRNA expression using a murine erythroleukemia model of terminal differentiation and found it to be dramatically decreased in conjunction with terminal differentiation. These studies demonstrate that the human SIL gene product is quite well conserved in rodents and suggest that the SIL gene product may play a role in cell proliferation. 26 refs., 6 figs.

  12. Evaluation of a Murine Single-Blood-Injection SAH Model

    PubMed Central

    Sommer, Clemens; Steiger, Hans-Jakob; Schneider, Toni; Hänggi, Daniel

    2014-01-01

    The molecular pathways underlying the pathogenesis after subarachnoid haemorrhage (SAH) are poorly understood and continue to be a matter of debate. A valid murine SAH injection model is not yet available but would be the prerequisite for further transgenic studies assessing the mechanisms following SAH. Using the murine single injection model, we examined the effects of SAH on regional cerebral blood flow (rCBF) in the somatosensory (S1) and cerebellar cortex, neuro-behavioural and morphological integrity and changes in quantitative electrocorticographic and electrocardiographic parameters. Micro CT imaging verified successful blood delivery into the cisterna magna. An acute impairment of rCBF was observed immediately after injection in the SAH and after 6, 12 and 24 hours in the S1 and 6 and 12 hours after SAH in the cerebellum. Injection of blood into the foramen magnum reduced telemetric recorded total ECoG power by an average of 65%. Spectral analysis of ECoGs revealed significantly increased absolute delta power, i.e., slowing, cortical depolarisations and changes in ripples and fast ripple oscillations 12 hours and 24 hours after SAH. Therefore, murine single-blood-injection SAH model is suitable for pathophysiological and further molecular analysis following SAH. PMID:25545775

  13. Cytomegalovirus in inflammatory bowel disease: A systematic review

    PubMed Central

    Römkens, Tessa EH; Bulte, Geert J; Nissen, Loes HC; Drenth, Joost PH

    2016-01-01

    AIM: To identify definitions of cytomegalovirus (CMV) infection and intestinal disease, in inflammatory bowel disease (IBD), to determine the prevalence associated with these definitions. METHODS: We conducted a systematic review and interrogated PubMed, EMBASE and Cochrane for literature on prevalence and diagnostics of CMV infection and intestinal disease in IBD patients. As medical headings we used “cytomegalovirus” OR “CMV” OR “cytomegalo virus” AND “inflammatory bowel disease” OR “IBD” OR “ulcerative colitis” OR “colitis ulcerosa” OR “Crohn’s disease”. Both MeSH-terms and free searches were performed. We included all types of English-language (clinical) trials concerning diagnostics and prevalence of CMV in IBD. RESULTS: The search strategy identified 924 citations, and 52 articles were eligible for inclusion. We identified 21 different definitions for CMV infection, 8 definitions for CMV intestinal disease and 3 definitions for CMV reactivation. Prevalence numbers depend on used definition, studied population and region. The highest prevalence for CMV infection was found when using positive serum PCR as a definition, whereas for CMV intestinal disease this applies to the use of tissue PCR > 10 copies/mg tissue. Most patients with CMV infection and intestinal disease had steroid refractory disease and came from East Asia. CONCLUSION: We detected multiple different definitions used for CMV infection and intestinal disease in IBD patients, which has an effect on prevalence numbers and eventually on outcome in different trials. PMID:26811669

  14. Leukocyte Responsiveness to Exercise in Individuals Positive for Human Cytomegalovirus.

    PubMed

    Wilson, J N; Navalta, J W

    2016-05-01

    Human cytomegalovirus (HCMV) infects 50% of adults in the United States. HCMV can become a cause for concern in individuals who have a compromised immune system, which may occur after high-intensity exercise. The purpose of this preliminary study was to characterize the lymphocyte, monocyte, and neutrophil responses to exercise in HCMV+individuals. Participants were either positive (HCMV +) or negative (HCMV-) for HCMV. Participants visited the laboratory on 3 separate occasions: HCMV screening, 100% VO2max test, and 80% VO2max run. Mixed-model factorial ANOVA procedures with repeated measures on sampling condition were performed on absolute and relative circulating lymphocytes, monocytes, and neutrophils. Significant main effects for time for both absolute and relative values were seen for all leukocyte subsets regardless of virus status. Significant differences for absolute and relative values were seen between sampling conditions for all leukocyte subsets. We report for the first time that HCMV status does not affect circulating neutrophil responses to high-intensity exercise, though exercise-induced neutrocytosis is seen during the post-exercise and 60 min post-exercise sampling conditions, regardless of HCMV status. There is no HCMV effect on circulating monocyte responses to exercise, though exercise-induced monocytosis was seen during the post-exercise sampling condition regardless of HCMV status. PMID:26837931

  15. The Cell Biology of Cytomegalovirus: Implications for Transplantation.

    PubMed

    Kaminski, H; Fishman, J A

    2016-08-01

    Interpretation of clinical data regarding the impact of cytomegalovirus (CMV) infection on allograft function is complicated by the diversity of viral strains and substantial variability of cellular receptors and viral gene expression in different tissues. Variation also exists in nonspecific (monocytes and dendritic cells) and specific (NK cells, antibodies) responses that augment T cell antiviral activities. Innate immune signaling pathways and expanded pools of memory NK cells and γδ T cells also serve to amplify host responses to infection. The clinical impact of specific memory T cell anti-CMV responses that cross-react with graft antigens and alloantigens is uncertain but appears to contribute to graft injury and to the abrogation of allograft tolerance. These responses are modified by diverse immunosuppressive regimens and by underlying host immune deficits. The impact of CMV infection on the transplant recipient reflects cellular changes and corresponding host responses, the convergence of which has been termed the "indirect effects" of CMV infection. Future studies will clarify interactions between CMV infection and allograft injury and will guide interventions that may enhance clinical outcomes in transplantation. PMID:26991039

  16. Childhood Environments and Cytomegalovirus Serostatus and Reactivation in Adults

    PubMed Central

    Janicki-Deverts, Denise; Cohen, Sheldon; Doyle, William J.; Marsland, Anna L.; Bosch, Jos A.

    2014-01-01

    Childhood adversity, defined in terms of material hardship or physical or emotional maltreatment has been associated with risk for infection with cytomegalovirus (CMV) among children and adolescents, and with CMV reactivation in children and adults. The present study examined whether different dimensions of childhood experience—those pertaining to socioeconomic status (SES), physical environment, or family relationships, relate differentially to CMV serostatus and reactivation during adulthood. Participants were 140 healthy adults, aged 18–55 years (41% female; 64% white). Childhood environments were assessed retrospectively and included family SES (parental housing tenure); childhood neighborhood environment (urban residence; physical conditions; safety; and social atmosphere); residential exposures (parental smoking and physical condition of home); and family relationships (parental divorce; warmth; harmony; dysfunction; parental bonding). Approximately 39% (n = 53) of participants were CMV+. In individual analyses controlling for age, sex, race, body mass, current adult SES and smoking status, fewer years of parental home ownership, having a parent who smoked, and living in a poorly maintained or unsafe neighborhood each were associated with greater odds of infection with CMV. By comparison, in individual analyses limited to CMV+ participants, less family warmth, less harmony, greater dysfunction, and suboptimal parental bonding each were related to higher antibody levels, independent of the aforementioned covariates. Findings were not attributable to current adult perceptions of psychological stress or relative levels of emotional stability. These results suggest that different types of childhood adversity may be associated with differential effects on CMV infection and latency. PMID:24675032

  17. Antiviral Drug- and Multidrug Resistance in Cytomegalovirus Infected SCT Patients

    PubMed Central

    Göhring, Katharina; Hamprecht, Klaus; Jahn, Gerhard

    2015-01-01

    In pediatric and adult patients after stem cell transplantation (SCT) disseminated infections caused by human cytomegalovirus (HCMV) can cause life threatening diseases. For treatment, the three antivirals ganciclovir (GCV), foscarnet (PFA) and cidofovir (CDV) are approved and most frequently used. Resistance to all of these antiviral drugs may induce a severe problem in this patient cohort. Responsible for resistance phenomena are mutations in the HCMV phosphotransferase-gene (UL97) and the polymerase-gene (UL54). Most frequently mutations in the UL97-gene are associated with resistance to GCV. Resistance against all three drugs is associated to mutations in the UL54-gene. Monitoring of drug resistance by genotyping is mostly done by PCR-based Sanger sequencing. For phenotyping with cell culture the isolation of HCMV is a prerequisite. The development of multidrug resistance with mutation in both genes is rare, but it is often associated with a fatal outcome. The manifestation of multidrug resistance is mostly associated with combined UL97/UL54-mutations. Normally, mutations in the UL97 gene occur initially followed by UL54 mutation after therapy switch. The appearance of UL54-mutation alone without any detection of UL97-mutation is rare. Interestingly, in a number of patients the UL97 mutation could be detected in specific compartments exclusively and not in blood. PMID:25750703

  18. Increased intestinal permeability during cytomegalovirus infection in renal transplant recipients.

    PubMed

    de Maar, E F; Kleibeuker, J H; Boersma-van Ek, W; The, T H; van Son, W J

    1996-01-01

    Cytomegalovirus (CMV) infections in renal transplant recipients can affect the gastrointestinal tract, but significant clinical manifestations are seldom seen. We hypothesize that subclinical involvement of the gastrointestinal tract may be quite frequent during CMV infection. In order to study this, we measured intestinal permeability by calculating the urinary lactulose mannitol (LM) excretion ratio after oral administration of lactulose and mannitol (normal < 0.030) in patients with symptomatic and asymptomatic CMV infection. A total of 111 patients were enrolled in the study, 104 of whom were tested on postoperative day (POD) 10. Twenty-nine patients developed CMV infection, 12 of whom could be studied with the permeability test (median POD 40). Another nine patients without CMV infection were also studied at day 40 and served as controls. The LM ratio increased significantly during CMV infection compared to measurements before active infection (median 0.060 vs. 0.030, P < 0.01) and was significantly higher during the infection than in the control group (median 0.007, P < 0.01). No correlation could be found between the LM ratio and viral load, humoral response to the virus, or symptomatology of infection. We conclude that an increased intestinal permeability is found in a substantial number of patients with an active, albeit asymptomatic, CMV infection after renal transplantation. Pathophysiological mechanisms and clinical implications remain speculative but will be subject to further study. PMID:8914238

  19. Cytomegalovirus infection in immunosuppressed patients after kidney transplantation

    PubMed Central

    LUSCALOV, SIMONA; LOGA, LUMINITA; DICAN, LUCIA; JUNIE, LIA MONICA

    2016-01-01

    The first kidney transplantation was performed in 1951 and ever since then living donor transplantation became a more and more important solution for patients with end-stage renal disease (ESRD). Renal transplantation is a life-saving procedure. Morbidity and mortality on waiting-lists are strongly correlated with the time of dialysis and end-stage renal disease is one of the most important causes of death; this is the reason why transplantation has to be performed as soon as possible in order to reduce the time of dialysis. Once the transplantation is performed, a number of complications may occur in post-transplant evolution, the most important of which is rejection. The rejection may appear through several mechanisms, but one of the most frequent causes of rejection is cytomegalovirus (CMV) infection. It is very important to have a precocious and fast diagnosis of CMV infection in order to maintain the functionality and survival of the graft. PP65 CMV antigenemia has proven its effectiveness in detecting and monitoring the CMV infection in transplanted patients. In the laboratory of the Clinical Institute of Urology and Renal Transplantation (ICUTR) of Cluj Napoca the CMV infection is evidenced by two methods: PP65antigenemia and IgM antibody identification by chemiluminiscence. PMID:27547053

  20. Design of cocktail peptide vaccine against Cytomegalovirus infection

    PubMed Central

    Tabaei, Samira; Mashkani, Baratali; Esmaili, Arezoo; Karimi, Reza; Jamehdar, Saeid Amel

    2016-01-01

    Objective(s): Human Cytomegalovirus (HCMV) remains a major morbidity and mortality cause in immuno suppressed patients. Therefore, significant effort has been made towards the development of a vaccine. In this study, the expression of the pp65 and gB fusion peptides and Fc domain of mouse IgG2a as a novel delivery system for selective uptake of antigens by antigen-presenting cells (APCs) in Pichia pastoris yeast system were studied. Materials and Method: In this study, four immune dominant sequences in pp65 protein and 3 immuno dominant sequences in gB protein were selected according to literature review. Peptide linker -GGGGS- was used for construction of fusion peptide. This fusion peptide was cloned in the pPICZαA expression vector and transfected into P. pastoris host cells. Results: Dot blot and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) techniques showed that a high level of pp65-gB-Fc fusion peptide was expressed. Conclusion: This CMV pp65-gB-Fc fusion peptide could be a promising candidate for the development of a novel peptide vaccine. PMID:27279990

  1. Cytomegalovirus and ulcerative colitis: Place of antiviral therapy

    PubMed Central

    Pillet, Sylvie; Pozzetto, Bruno; Roblin, Xavier

    2016-01-01

    The link between cytomegalovirus (CMV) infection and inflammatory bowel diseases remains an important subject of debate. CMV infection is frequent in ulcerative colitis (UC) and has been shown to be potentially harmful. CMV reactivation needs to be diagnosed using methods that include in situ detection of viral markers by immunohistochemistry or by nucleic acid amplification techniques. Determination of the density of infection using quantitative tools (numbers of infected cells or copies of the genome) is particularly important. Although CMV reactivation can be considered as an innocent bystander in active flare-ups of refractory UC, an increasing number of studies suggest a deleterious role of CMV in this situation. The presence of colonic CMV infection is possibly linked to a decreased response to steroids and other immunosuppressive agents. Some treatments, notably steroids and cyclosporine A, have been shown to favor CMV reactivation, which seems not to be the case for therapies using anti-tumor necrosis factor drugs. According to these findings, in flare-ups of refractory UC, it is now recommended to look for the presence of CMV reactivation by using quantitative tools in colonic biopsies and to treat them with ganciclovir in cases of high viral load or severe disease. PMID:26877608

  2. Cytomegalovirus infection in the bone marrow transplant patient

    PubMed Central

    Bhat, Vivek; Joshi, Amit; Sarode, Rahul; Chavan, Preeti

    2015-01-01

    Cytomegalovirus (CMV) infection is an important contributor to the morbidity and mortality associated with bone marrow transplantation (BMT). Infection may lead to CMV disease involving multiple organs such as pneumonia, gastroenteritis, retinitis, central nervus system involvement and others. CMV seropositivity is an important risk factor and approximately half of BMT recipients will develop clinically significant infection most commonly in the first 100 d post-transplant. The commonly used tests to diagnose CMV infection in these patients include the pp65 antigenemia test and the CMV DNA polymerase chain reaction (PCR) assay. Because of its greater sensitivity and lesser turnaround time, the CMV PCR is nowadays the preferred test and serves as a main guide for pre-emptive therapy. Methods of CMV prevention include use of blood products from seronegative donors or leukodepleted products. Prophylaxis or pre-emptive therapy strategies for CMV prevention may be used post-transplant with the latter becoming more common. The commonly used antivirals for pre-emptive therapy and CMV disease management include intravenous gancyclovir and foscarnet. The role of intravenous immunoglobulin, although used commonly in CMV pneumonia is not clear. PMID:26722656

  3. Cytomegalovirus in urine: detection of viral DNA by sandwich hybridization.

    PubMed

    Virtanen, M; Syvänen, A C; Oram, J; Söderlund, H; Ranki, M

    1984-12-01

    A cytomegalovirus (CMV)-specific sandwich hybridization test was constructed by using two adjacent BamHI DNA fragments of CMV DNA as reagents. The fragments were cloned into two different vectors. One of the recombinants was attached to the filter, and the other was the labeled probe. When present in the sample, CMV DNA mediated labeling of the filter by hybridizing to both the filter-bound DNA and the probe. The sandwich hybridization test was applied for the detection of CMV DNA from urine. DNA was released from virus by 2% Sarkosyl, concentrated by 2-butanol extraction and isopropanol precipitation, denatured, and finally subjected to the sandwich hybridization test. As a result, 70 to 90% of the original viral DNA could be recovered and demonstrated by the quantitative hybridization reaction. Urine could be stored at room temperature in Sarkosyl for at least 2 days without affecting the detectability of CMV. The clinical applicability of the test was evaluated by studying urine samples from four infants excreting CMV. Sandwich hybridization demonstrated the presence of CMV DNA in all of the specimens. These contained originally 10(5) to 10(8) CMV DNA molecules per ml. PMID:6097598

  4. Cytomegalovirus and glioma: putting the cart before the horse.

    PubMed

    Dey, Mahua; Ahmed, Atique U; Lesniak, Maciej S

    2015-02-01

    In 1908, Oluf Bang and Vilhelm Ellerman laid the foundation for theory of oncoviruses by demonstrating that the avian erythroblastosis (a form of chicken leukaemia) could be transmitted by cell-free extracts. Since then, it has been shown very convincingly that viruses can directly cause several human cancers by various mechanisms. Epidemiological data imply that viruses are the second most important risk factor for cancer development in humans, exceeded only by tobacco consumption. Although the ability of certain viruses (hepatitis B and C, human papillomavirus, etc) to cause cancer has been time tested and proven scientifically, there are several other potential viral candidates whose role in oncogenesis is more controversial. One such controversial scenario involves the role of cytomegalovirus (CMV) in malignant gliomas, the most common form of primary brain tumour. CMV first attracted attention about a decade ago when CMV gene products were found in glioma tissue but not in normal brain. Since this initial observation, several different groups have shown an oncomodulatory effect of CMV; however, direct association between CMV infection and incidence of glioma is lacking. In this review, we will evaluate the evidence, both preclinical and clinical, regarding the possible role of CMV in gliomagenesis and maintenance. We will also critically evaluate the rationale for using antiviral drugs in the treatment of patients with glioma. PMID:24906494

  5. Expression of cytomegalovirus in glioblastoma multiforme: Myth or reality?

    PubMed

    Taha, Mahmoud S; Abdalhamid, Baha A; El-Badawy, Samy A; Sorour, Yasser M; Almsned, Fahad M; Al-Abbadi, Mousa A

    2016-06-01

    A role for human cytomegalovirus (HCMV) in the pathogenesis of glioblastoma multiforme (GBM) was proposed more than a decade ago and has since generated a considerable debate as a possible therapeutic target. We investigate the presence of HCMV in the specimens of patients with GBM treated in our centre. This is a retrospective cohort study to investigate the presence of HCMV by routine immunohistochemical stains and polymerase chain reaction (PCR)-based molecular analysis on formalin-fixed-paraffin-embedded tissue of all patients with GBM treated in our hospital in 2009-2013 (5 years). The evaluation of positivity by immunohistochemistry (IHC) was semi-quantitative. The molecular analysis was performed by extracting the tumour DNA from representative paraffin-embedded tissue blocks and amplified for detection by a sensitive real time PCR (RT-PCR) CMV assay. During the study period, we treated 45 patients with GBM; however, adequate pathology tissue materials were available only for 32 patients. All the pathology material was reviewed and the diagnosis was confirmed. All the cases were found to be negative for CMV expression by our IHC and RT-PCR CMV assay. Our study has shown no expression of CMV in GBM. Our results were similar to other recent reports that concluded insufficient evidence to recommend routine testing for CMV in GBM or treatment as an add-on therapy. PMID:26742571

  6. Use of recombinant approaches to construct human cytomegalovirus mutants.

    PubMed

    Dekhtiarenko, Iryna; Cičin-Šain, Luka; Messerle, Martin

    2014-01-01

    To fully understand the function of cytomegalovirus (CMV) genes, it is imperative that they be studied in the context of infection. Therefore, the targeted deletion of individual viral genes and the comparison of loss of function viral mutants to the wild-type virus allow the identification of the relevance and role for a particular gene in the viral replication cycle. Targeted CMV mutagenesis has made huge advances over the past 15 years. The cloning of CMV genomes into (E. coli) as bacterial artificial chromosomes (BAC) allows not only quick and efficient deletion of viral genomic regions, individual genes, or single nucleotide exchanges in the viral genome but also the insertion of heterologous genetic sequences for gain of function approaches. The conceptual advantage of this strategy is that it overcomes the restrictions of recombinant technologies in cell culture systems. Namely, recombination in infected cells occurs only in a few clones, and their selection is not possible if the targeted genes are relevant for virus replication and are not able to compete for growth against the unrecombined viruses. On the other hand, BAC mutagenesis enables the selection for antibiotic resistance in E. coli, allowing a selective growth advantage to the recombined genomes. Here we describe the methods used for the generation of a CMV BAC, targeted mutagenesis of BAC clones, and transfection of human cells with CMV BAC DNA in order to reconstitute the viral infection process. PMID:24639218

  7. Cytomegalovirus and ulcerative colitis: Place of antiviral therapy.

    PubMed

    Pillet, Sylvie; Pozzetto, Bruno; Roblin, Xavier

    2016-02-14

    The link between cytomegalovirus (CMV) infection and inflammatory bowel diseases remains an important subject of debate. CMV infection is frequent in ulcerative colitis (UC) and has been shown to be potentially harmful. CMV reactivation needs to be diagnosed using methods that include in situ detection of viral markers by immunohistochemistry or by nucleic acid amplification techniques. Determination of the density of infection using quantitative tools (numbers of infected cells or copies of the genome) is particularly important. Although CMV reactivation can be considered as an innocent bystander in active flare-ups of refractory UC, an increasing number of studies suggest a deleterious role of CMV in this situation. The presence of colonic CMV infection is possibly linked to a decreased response to steroids and other immunosuppressive agents. Some treatments, notably steroids and cyclosporine A, have been shown to favor CMV reactivation, which seems not to be the case for therapies using anti-tumor necrosis factor drugs. According to these findings, in flare-ups of refractory UC, it is now recommended to look for the presence of CMV reactivation by using quantitative tools in colonic biopsies and to treat them with ganciclovir in cases of high viral load or severe disease. PMID:26877608

  8. Human cytomegalovirus (CMV) in Africa: a neglected but important pathogen.

    PubMed

    Bates, Matthew; Brantsaeter, Arne Broch

    2016-01-01

    In Africa, human cytomegalovirus (CMV) is an important pathogen in a diverse range of patient groups. Congenital CMV infection is common, and most children undergo primary infection during the first year of life. Preliminary studies suggest that these early primary CMV infections could have population-wide effects on growth and development. In most studies of adults, CMV seroprevalence is close to 100%, but some studies have found that significant minorities of adults are seronegative. CMV is a common cause of pneumonia and meningitis in hospitalised immunosuppressed patient groups, and CMV DNAemia may be an important marker of rapid progression and poor outcomes of HIV infection, despite roll-out of antiretroviral therapy (ART). Diagnosis and treatment of CMV-related disease is broadly neglected in Africa, and no randomised clinical trials of anti-CMV drugs have been conducted to date. Autopsy is rarely performed in Africa, but identifies CMV as a frequent pathogen when it is carried out. Here we review the available literature on CMV in Africa, primarily in adult patients, and discuss this in the context of contemporary understanding of CMV as a human pathogen. PMID:27482452

  9. Manipulation of dendritic cell functions by human cytomegalovirus.

    PubMed

    Sinclair, John

    2008-01-01

    Dendritic cells are the most potent antigen-presenting cells of the mammalian immune system and are central to the initiation and maintenance of the adaptive immune response. They are crucial for the presentation of antigen to T cells and B cells, as well as the induction of chemokines and proinflammatory cytokines, which orchestrate the balance of the cell-mediated (Th1) and antibody (Th2) response. This ability of dendritic cells to present antigen and release chemokines and cytokines also bridges the innate and adaptive immune responses by driving T cell activation. These cells thus possess key immunological functions that make them the front line of defence for the targeting and clearance of any invading pathogen and, as such, they underpin the host immune response to infection. For efficient infection, invading pathogens often need to overcome these sentinel immune functions. It is therefore not surprising that pathogens have evolved numerous mechanisms to target dendritic cell functions directly or indirectly during infection, and at least one herpesvirus--human cytomegalovirus--has evolved a life cycle that hijacks dendritic cells for its long-term persistence in the infected host. PMID:19025715

  10. Antineurofilament and antiretinal antibodies in AIDS patients with cytomegalovirus retinitis.

    PubMed Central

    Rosberger, D F; Tshering, S L; Polsky, B; Heinemann, M H; Klein, R F; Cunningham-Rundles, S

    1994-01-01

    Sera obtained from AIDS patients with cytomegalovirus (CMV) retinitis before and after treatment with foscarnet, AIDS patients with human immunodeficiency virus (HIV) retinopathy, AIDS patients without retinal disease, and normal healthy controls with and without positive CMV serologies were assayed for the presence of antibodies against the 200-kDa outer, 160-kDa middle, and 68-kDa core subunits of the neurofilament triplet. Additional studies were performed to determine the presence of antibodies reactive with proteins extracted from crude human retinal antigen preparations. Antibodies against the 200-, 260-, and 68-kDa proteins of the neurofilament triplet were detected in 15 of 15 AIDS patients with CMV retinitis. The expression of these antibodies was unaffected, qualitatively, by successful treatment with foscarnet. In contrast, only 30% of patients with HIV retinopathy unrelated to CMV, fewer than 35% of AIDS patients with positive CMV titers but without evident retinitis, and fewer than 25% of healthy controls with positive or negative CMV titers possessed antibodies against any of the triplet proteins (P < 0.001). Antibodies against several clusters of retinal antigens were also identified in the sera of patients with CMV retinitis. In summary, the data indicate that retinal elements damaged by CMV infection induce an antibody response against the 200-, 160-, and 68kDa components of the neurofilament triplet as well as other, as yet undefined retinal antigens. Images PMID:8556483

  11. Childhood environments and cytomegalovirus serostatus and reactivation in adults.

    PubMed

    Janicki-Deverts, Denise; Cohen, Sheldon; Doyle, William J; Marsland, Anna L; Bosch, Jos

    2014-08-01

    Childhood adversity, defined in terms of material hardship or physical or emotional maltreatment has been associated with risk for infection with cytomegalovirus (CMV) among children and adolescents, and with CMV reactivation in children and adults. The present study examined whether different dimensions of childhood experience-those pertaining to socioeconomic status (SES), physical environment, or family relationships-relate differentially to CMV serostatus and reactivation during adulthood. Participants were 140 healthy adults, aged 18-55years (41% female; 64% white). Childhood environments were assessed retrospectively and included family SES (parental housing tenure); childhood neighborhood environment (urban residence; physical conditions; safety; and social atmosphere); residential exposures (parental smoking and physical condition of home); and family relationships (parental divorce; warmth; harmony; dysfunction; parental bonding). Approximately 39% (n=53) of participants were CMV+. In individual analyses controlling for age, sex, race, body mass, current adult SES and smoking status, fewer years of parental home ownership, having a parent who smoked, and living in a poorly maintained or unsafe neighborhood each were associated with greater odds of infection with CMV. By comparison, in individual analyses limited to CMV+ participants, less family warmth, less harmony, greater dysfunction, and suboptimal parental bonding each were related to higher antibody levels, independent of the aforementioned covariates. Findings were not attributable to current adult perceptions of psychological stress or relative levels of emotional stability. These results suggest that different types of childhood adversity may be associated with differential effects on CMV infection and latency. PMID:24675032

  12. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  13. Absence of human cytomegalovirus infection in childhood brain tumors.

    PubMed

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients' neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  14. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  15. Clinical Utility of Droplet Digital PCR for Human Cytomegalovirus

    PubMed Central

    Sedlak, Ruth Hall; Cook, Linda; Cheng, Anqi; Magaret, Amalia

    2014-01-01

    Human cytomegalovirus (CMV) has historically been the major infectious cause of morbidity and mortality among patients receiving hematopoietic cell or organ transplant. Standard care in a transplant setting involves frequent monitoring of CMV viral load over weeks to months to determine when antiviral treatment may be required. Quantitative PCR (qPCR) is the standard molecular diagnostic method for monitoring. Recently, digital PCR (dPCR) has shown promise in viral diagnostics, although current dPCR systems have lower throughput than qPCR systems. Here, we compare qPCR and droplet digital PCR (ddPCR) for CMV detection in patient plasma samples. Droplet digital PCR exhibits increased precision over qPCR at viral loads of ≥4 log10 with equivalent sensitivity. However, retrospective analysis of longitudinal samples from transplant patients with CMV viral loads near therapeutic thresholds did not provide evidence that the improved precision of ddPCR would be of clinical benefit. Given the throughput advantages of current qPCR systems, a widespread switch to dPCR for CMV monitoring would appear premature. PMID:24871214

  16. Bilateral Cytomegalovirus Retinitis in a Patient with Systemic Lupus Erythematosus

    PubMed Central

    Haze, Masaya; Kobayashi, Takatoshi; Kakurai, Keigo; Shoda, Hiromi; Takai, Nanae; Takeda, Sayako; Tada, Rei; Maruyama, Kouichi; Kida, Teruyo; Ikeda, Tsunehiko

    2016-01-01

    Purpose The purpose of this study was to report the case of a patient who underwent vitrectomy for bilateral rhegmatogenous retinal detachment caused by cytomegalovirus (CMV) retinitis while undergoing steroid and immunosuppressant therapy for systemic lupus erythematosus (SLE). Case Report We report on a 29-year-old female who was undergoing steroids and immunosuppressants treatment for SLE at Osaka Medical College Hospital, Takatsuki City, Japan. Examination of the patient due to prolonged and worsening diarrhea revealed positive test results for C7-HRP, and she was diagnosed with CMV colitis. She was subsequently admitted to the hospital and started on intravenous ganciclovir for treatment. Approximately 1.5 months later, her primary complaint was deterioration of the upper visual field in her left eye, and she was then referred to the Department of Ophthalmology. Numerous granular exudative spots were found around the lower retinal area of her left eye with retinal breaks that had developed in an area of retinal necrosis that resulted in retinal detachment. After time was allowed for the patient's general condition to improve, a vitrectomy was performed on that eye. The patient subsequently developed a similar retinal detachment in her right eye, for which she underwent a vitrectomy. Although the patient required multiple surgeries on both eyes, her retinas currently remain reattached and the inflammation has subsided. Conclusion The findings of this study show that strict attention must be paid to SLE patients on immunosuppressive therapy due to the possible association of CMV retinitis. PMID:27462259

  17. Successful treatment of cytomegalovirus associated hemophagocytic lymphohistiocytosis with the interleukin 1 inhibitor - anakinra.

    PubMed

    Divithotawela, Chandima; Garrett, Peter; Westall, Glen; Bhaskar, Balu; Tol, Maneesha; Chambers, Daniel C

    2016-03-01

    Hemophagocytic lymphohistiocytosis (HLH) is a rare, frequently under-recognized condition associated with multi-organ failure and very high mortality. A 44-year-old woman was admitted with a 4-day history of fever, headache, delirium, and dyspnea. She progressed rapidly to type 1 respiratory failure and required intubation and mechanical ventilation. Laboratory tests showed pancytopenia, abnormal liver enzyme levels, elevated triglyceride level, and elevated ferritin level. Bone marrow biopsy showed features of HLH. Computed tomography scan showed bilateral consolidation. Bronchoalveolar lavage was positive for cytomegalovirus. She was treated with ganciclovir, methylprednisolone, broad spectrum antibiotics, and cytomegalovirus hyperimmunoglobulin without clinical response. Given the poor prognosis and reports of success in pediatric HLH, anakinra 100 µg subcutaneously daily was commenced. There was rapid defervescence, resolution of delirium, and improvement in gas exchange, leading to complete recovery. This case illustrates successful treatment of HLH associated with cytomegalovirus pneumonitis with the interleukin 1 inhibitor anakinra. PMID:26839691

  18. Cytomegalovirus Infection in Inflammatory Bowel Disease Is Not Associated with Worsening of Intestinal Inflammatory Activity

    PubMed Central

    do Carmo, Alexandre Medeiros; Santos, Fabiana Maria; Ortiz-Agostinho, Carmen Lucia; Nishitokukado, Iêda; Frota, Cintia S.; Gomes, Flavia Ubeda; de Arruda Leite, André Zonetti; Pannuti, Claudio Sérgio; Boas, Lucy Santos Vilas; Teixeira, Magaly Gemio; Sipahi, Aytan Miranda

    2014-01-01

    Background Cytomegalovirus is highly prevalent virus and usually occurs in immunocompromised patients. The pathophysiology and treatment of inflammatory bowel disease often induce a state of immunosuppression. Because this, there are still doubts and controversies about the relationship between inflammatory bowel disease and cytomegalovirus. Aim Evaluate the frequency of cytomegalovirus in patients with inflammatory bowel disease and identify correlations. Methods Patients with inflammatory bowel disease underwent an interview, review of records and collection of blood and fecal samples. The search for cytomegalovirus was performed by IgG and IgM blood serology, by real-time PCR in the blood and by qualitative PCR in feces. Results were correlated with red blood cell levels, C-reactive protein levels, erythrocyte sedimentation rates and fecal calprotectin levels for each patient. Results Among the 400 eligible patients, 249 had Crohn's disease, and 151 had ulcerative colitis. In the group of Crohn's disease, 67 of the patients had moderate or severe disease, but 126 patients presented with active disease, based on the evaluation of the fecal calprotectin. In patients with ulcerative colitis, only 21 patients had moderate disease, but 76 patients presented with active disease, based on the evaluation of the fecal calprotectin. A large majority of patients had positive CMV IgG. Overall, 10 patients had positive CMV IgM, and 9 patients had a positive qualitative detection of CMV DNA by PCR in the feces. All 400 patients returned negative results after the quantitative detection of CMV DNA in blood by real-time PCR. Analyzing the 19 patients with active infections, we only found that such an association occurred with the use of combined therapy (anti-TNF-alpha + azathioprine) Conclusion The findings show that latent cytomegalovirus infections are frequent and active cytomegalovirus infection is rare. We did not find any association between an active infection of CMV

  19. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.

    2016-01-01

    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  20. The efficacy and cost-effectiveness of valacyclovir in cytomegalovirus prevention in solid organ transplantation.

    PubMed

    Reischig, Tomas; Kacer, Martin

    2014-12-01

    Prevention of cytomegalovirus infection using antiviral prophylaxis or the pre-emptive therapy approach is an integral part of management of patients after solid organ transplantation. Regarding renal transplantation, valacyclovir is currently the only antiviral agent recommended for prophylaxis as an alternative to valganciclovir. This review article discusses studies documenting the efficacy and safety of valacyclovir prophylaxis as well as those comparing valacyclovir with other prophylactic regimens or with pre-emptive therapy. Also addressed are the economic aspects supporting the cost-effectiveness of valacyclovir prophylaxis and demonstrating lower costs compared with other cytomegalovirus preventive strategies. PMID:25252996

  1. Cytomegalovirus Replicates in Differentiated but not in Undifferentiated Human Embryonal Carcinoma Cells

    NASA Astrophysics Data System (ADS)

    Gonczol, Eva; Andrews, Peter W.; Plotkin, Stanley A.

    1984-04-01

    To study the mode of action of human cytomegalovirus, an important teratogenic agent in human populations, the susceptibility of a pluripotent human embryonal carcinoma cell line to the virus was investigated. Viral antigens were not expressed nor was infectious virus produced by human embryonal carcinoma cells after infection, although the virus was able to penetrate these cells. In contrast, retinoic acid-induced differentiated derivatives of embryonal carcinoma cells were permissive for antigen expression and infectious virus production. Replication of human cytomegalovirus in human teratocarcinoma cells may therefore depend on cellular functions associated with differentiation.

  2. Cytomegalovirus infection associated with clonal proliferation of T-cell large granular lymphocytes: causal or casual?

    PubMed

    Wong, K F; Yip, S F; So, C C; Lau, G T C; Yeung, Y M

    2003-04-01

    Clonal proliferation of T-cell large granular lymphocytes (LGL) is an indolent disorder characterized by splenomegaly, lymphocytosis and frequent manifestations of immune disturbances. The LGL are CD3(+) CD4(-) CD8(+) CD56(-). The clonality of the tumor cell population is often only demonstrable by T-cell receptor (TCR) gene rearrangement study because chromosomal abnormality is distinctly rare. We describe a case of T-cell LGL leukemia that presented initially as cytomegalovirus infection. The leukemic LGL are shown to be clonal by both TCR gene rearrangement and chromosomal studies. They persist after subsidence of the cytomegalovirus infection. PMID:12660039

  3. Cytomegalovirus-induced Hemorrhagic Colitis in a Patient with Chronic Myeloid Leukemia (Chronic Phase) on Dasatinib as an Upfront Therapy.

    PubMed

    Yassin, Mohamed A; Nashwan, Abdulqadir J; Soliman, Ashraf T; Yousif, Anil; Moustafa, Afra; AlBattah, Afaf; Mohamed, Shehab F; Mudawi, Deena S; Elkourashy, Sarah; Asaari, Deena-Raiza; Gutierrez, Hope-Love G; Almusharaf, Mohamed; Hussein, Radwa M; Moustafa, Abbas H; Derhoubi, Hatim El; Boukhris, Sarra; Kohla, Samah; AlDewik, Nader

    2015-01-01

    Dasatinib is a kinase inhibitor indicated for the treatment of newly diagnosed adults with Philadelphia chromosome-positive (Ph+) chronic myeloid leukemia (CML) in chronic phase and accelerated (myeloid or lymphoid blast) phase, and CML with resistance or intolerance to prior therapy including imatinib and in adults with Ph+ acute lymphoblastic leukemia1 The most common adverse reactions (≥15%) in patients with newly diagnosed chronic-phase (CP) CML include myelosuppression, fluid retention, and diarrhea, whereas in patients with resistance or intolerance to prior imatinib therapy, side effects include myelosuppression, fluid retention, diarrhea, headache, dyspnea, skin rash, fatigue, nausea, and hemorrhage. We report a 39-year-old Ethiopian female patient who received dasatinib as upfront therapy for the treatment of CP-CML who experienced chronic diarrhea for two months, which progressed to hemorrhagic colitis due to cytomegalovirus (CMV) infection of the colon. To our knowledge, this is the first case of CMV colitis in a patient receiving dasatinib as upfront therapy. PMID:26379451

  4. Cytomegalovirus-induced Hemorrhagic Colitis in a Patient with Chronic Myeloid Leukemia (Chronic Phase) on Dasatinib as an Upfront Therapy

    PubMed Central

    Yassin, Mohamed A; Nashwan, Abdulqadir J; Soliman, Ashraf T; Yousif, Anil; Moustafa, Afra; AlBattah, Afaf; Mohamed, Shehab F; Mudawi, Deena S; Elkourashy, Sarah; Asaari, Deena-Raiza; Gutierrez, Hope-Love G; Almusharaf, Mohamed; Hussein, Radwa M; Moustafa, Abbas H; Derhoubi, Hatim El; Boukhris, Sarra; Kohla, Samah; AlDewik, Nader

    2015-01-01

    Dasatinib is a kinase inhibitor indicated for the treatment of newly diagnosed adults with Philadelphia chromosome–positive (Ph+) chronic myeloid leukemia (CML) in chronic phase and accelerated (myeloid or lymphoid blast) phase, and CML with resistance or intolerance to prior therapy including imatinib and in adults with Ph+ acute lymphoblastic leukemia1 The most common adverse reactions (≥15%) in patients with newly diagnosed chronic-phase (CP) CML include myelosuppression, fluid retention, and diarrhea, whereas in patients with resistance or intolerance to prior imatinib therapy, side effects include myelosuppression, fluid retention, diarrhea, headache, dyspnea, skin rash, fatigue, nausea, and hemorrhage. We report a 39-year-old Ethiopian female patient who received dasatinib as upfront therapy for the treatment of CP-CML who experienced chronic diarrhea for two months, which progressed to hemorrhagic colitis due to cytomegalovirus (CMV) infection of the colon. To our knowledge, this is the first case of CMV colitis in a patient receiving dasatinib as upfront therapy. PMID:26379451

  5. Cytomegalovirus generates long-lived antigen-specific NK cells with diminished bystander activation to heterologous infection

    PubMed Central

    Min-Oo, Gundula

    2014-01-01

    Natural killer (NK) cells play a key role in the host response to cytomegalovirus (CMV) and can mediate an enhanced response to secondary challenge with CMV. We assessed the ability of mouse CMV (MCMV)–induced memory Ly49H+ NK cells to respond to challenges with influenza, an acute viral infection localized to the lung, and Listeria monocytogenes, a systemic bacterial infection. MCMV-memory NK cells did not display enhanced activation or proliferation after infection with influenza or Listeria, as compared with naive Ly49H+ or Ly49H− NK cells. Memory NK cells also showed impaired activation compared with naive cells when challenged with a mutant MCMV lacking m157, highlighting their antigen-specific response. Ex vivo, MCMV-memory NK cells displayed reduced phosphorylation of STAT4 and STAT1 in response to stimulation by IL-12 and type I interferon (IFN), respectively, and IFN-γ production was reduced in response to IL-12 + IL-18 compared with naive NK cells. However, costimulation of MCMV-memory NK cells with IL-12 and m157 antigen rescues their impaired response compared with cytokines alone. These findings reveal that MCMV-primed memory NK cells are diminished in their response to cytokine-driven bystander responses to heterologous infections as they become specialized and antigen-specific for the control of MCMV upon rechallenge. PMID:25422494

  6. The risk of early and late cytomegalovirus DNAemia associated with Campath use in stem cell transplant recipients

    PubMed Central

    Buyck, Hubertus C; Prentice, H Grant; Griffiths, Paul D; Emery, Vincent C

    2009-01-01

    The risks associated with in vivo and ex vivo use of Campath-1H and -1G in a cohort of 206 stem cell transplant recipients for cytomegalovirus (HCMV) DNAemia have been quantified. DNAemia showed a biphasic incidence pattern with an inflexion at day 60. The first phase had a linear risk rate for HCMV DNAemia of 0.3 % day−1 whilst the second phase had a substantially lower risk rate of 0.058 % day−1. In multivariable analyses, risk factors for early DNAemia were HCMV serostatus, radiotherapy based conditioning and CD34 stem cell dose, with the use of in vivo Campath-1H having the most significant risk (Hazards Ratio = 3.68 (95% CI 2.02-6.72; p<0.001). Ex vivo use of Campath was not associated with an increased risk for HCMV DNAemia. Patients receiving either in vivo Campath-1H or -1G experienced HCMV DNAemia earlier (27 and 33 days respectively) compared to patients receiving no Campath (time to DNAemia, 51 days; p = 0.0006). Multivariable analysis of risk factors for HCMV DNAemia occurring beyond 100 days after transplant were older age, acute GVHD > grade II and a lower CD34 stem cell dose whereas Campath-1H use was not associated with late HCMV DNAemia. PMID:19966846

  7. A murine model of urinary tract infection

    PubMed Central

    Hung, Chia-Suei; Dodson, Karen W; Hultgren, Scott J

    2010-01-01

    Urinary tract infections (UTIs) inflict extreme pain and discomfort to those affected and have profound medical and socioeconomic impact. Although acute UTIs are often treatable with antibiotics, a large proportion of patients suffer from multiple recurrent infections. Here, we describe and provide a protocol for a robust murine UTI model that allows for the study of uropathogens in an ideal setting. The infections in the urinary tract can be monitored quantitatively by determining the bacterial loads at different times post-infection. In addition, the simple bladder architecture allows observation of disease progression and the uropathogenic virulence cascade using a variety of microscopic techniques. This mouse UTI model is extremely flexible, allowing the study of different bacterial strains and species of uropathogens in a broad range of mouse genetic backgrounds. We have used this protocol to identify important aspects of the host-pathogen interaction that determine the outcome of infection. The time required to complete the entire procedure will depend on the number of bacterial strains and mice included in the study. Nevertheless, one should expect 4 h of hands-on time, including inoculum preparation on the day of infection, transurethral inoculation, tissue harvest and post-harvest processing for a small group of mice (e.g., 5 mice). PMID:19644462

  8. Cytomegalovirus Colitis and Subsequent New Diagnosis of Inflammatory Bowel Disease in an Immunocompetent Host: A Case Study and Literature Review

    PubMed Central

    Khan, Tipu V.; Toms, Carla

    2016-01-01

    Patient: Male, 40 Final Diagnosis: CMV colitis Symptoms: Abdominal pain • diarrhea • jaundice Medication: — Clinical Procedure: Flexible sigmoidoscopy • colonoscopy Specialty: Family Medicine Objective: Rare co-existance of disease or pathology Background: Infection with gastrointestinal cytomegalovirus in an immunocompetent host is a rather rare occurrence in the literature. There are a few reports of gastrointestinal infection in the immunocompetent who are then subsequently given a new diagnosis of inflammatory bowel disease. It is speculated that the initial cytomegalovirus colitis infection triggers the onset of inflammatory bowel disease. Case Report: Herein we report a case of cytomegalovirus colitis and new diagnosis of inflammatory bowel disease identified in a 40-year-old immunocompetent adult man who presented with gastrointestinal symptoms and disseminated cytomegalovirus infection requiring anti-viral therapy, which successfully treated the episode of cytomegalovirus infection. He then went on to have persistent symptomatic inflammatory bowel disease confirmed by pathology. Conclusions: In this paper we will review the literature and explore the rare case of cytomegalovirus colitis in the immunocompetent host and discuss the pathology, physiology, diagnosis, and treatment of cytomegalovirus colitis. PMID:27460032

  9. Acute Bronchitis

    MedlinePlus

    ... or though physical contact (for example, on unwashed hands). Being exposed to tobacco smoke, air pollution, dusts, vapors, and fumes can also cause acute bronchitis. Less often, bacteria can also cause acute bronchitis. To diagnose acute ...

  10. Cystitis - acute

    MedlinePlus

    Uncomplicated urinary tract infection; UTI - acute; Acute bladder infection; Acute bacterial cystitis ... control. Menopause also increases the risk for a urinary tract infection. The following also increase your chances of having ...

  11. Activation of Cytomegalovirus in Pig-to-Primate Organ Xenotransplantation

    PubMed Central

    Mueller, Nicolas J.; Barth, Rolf N.; Yamamoto, Shin; Kitamura, Hiroshi; Patience, Clive; Yamada, Kazuhiko; Cooper, David K. C.; Sachs, David H.; Kaur, Amitinder; Fishman, Jay A.

    2002-01-01

    Xenotransplantation of porcine organs carries the risk of reactivation of latent virus in donor and recipient tissues as well as transmission of viruses between species. We have investigated the activation of baboon cytomegalovirus (BCMV) and porcine CMV (PCMV) in a pig-to-primate model of xenotransplantation. Tissues originating from a series of six swine-to-baboon composite thymokidney xenotransplants were investigated. Four immunosuppressed baboons died (survival range, 7 to 27 days) with the graft in situ. Increases in BCMV DNA copy numbers occurred in three (75%) of these baboons and was thought to be responsible for pneumonitis and the death of one animal. In two baboons, disseminated intravascular coagulation was successfully treated by graftectomy and discontinuation of immunosuppression. PCMV was upregulated in five of six xenografts (83%). PCMV infection was associated with ureteric necrosis in one xenograft. Although significantly increased in native tissues, low levels of BCMV and PCMV were also detected in tissues other than that of the native viral host species. The cross-species presence of CMV did not appear to cause clinical or histological signs of invasive disease. Thus, viral infections with clinical disease were restricted to tissues of the native species of each virus. Intensive immune suppression currently required for xenotransplantation results in a significant risk of reactivation of latent infections by BCMV and PCMV. It is not yet known whether viral DNA detected across species lines represents cellular microchimerism, ongoing viral infection, or uptake of free virus. The observation of graft injury by PCMV demonstrates that CMV will be an important pathogen in immunosuppressed xenograft recipients. Strategies must be developed to exclude CMV from porcine organ donors. PMID:11967290

  12. Cytomegalovirus Infection after CD34(+)-Selected Hematopoietic Cell Transplantation.

    PubMed

    Huang, Yao-Ting; Neofytos, Dionysios; Foldi, Julia; Kim, Seong Jin; Maloy, Molly; Chung, Dick; Castro-Malaspina, Hugo; Giralt, Sergio A; Papadopoulos, Esperanza; Perales, Miguel-Angel; Jakubowski, Ann A; Papanicolaou, Genovefa A

    2016-08-01

    The effectiveness of preemptive treatment (PET) for cytomegalovirus (CMV) in recipients of ex vivo T cell-depleted (TCD) hematopoietic cell transplantation (HCT) by CD34(+) selection is not well defined. We analyzed 213 adults who received TCD-HCT at our institution from June 2010 through May 2014. Patients were monitored by a CMV quantitative PCR assay if recipient (R) or donor (D) were CMV seropositive. CMV viremia occurred early (median, 27 days after HCT) in 91 of 213 (42.7%) patients for a 180-day cumulative incidence of 84.5%, 61.8%, and 0 for R+/D+, R+/D-, and R-/D+ patients, respectively. CMV disease occurred in 5% of patients. In Cox regression analysis, R+/D+ status was associated with increased risk for CMV viremia compared with R+/D- (hazard ratio [HR], 1.79, 95% confidence interval [CI], 1.16 to 2.76, P = .01), whereas matched unrelated donor allograft was associated with decreased risk (HR, .62; 95% CI, .39 to .97, P = .04). Of 91 patients with CMV viremia, 52 (57%) had persistent viremia (>28 days duration). Time lag from detection of CMV viremia to PET was associated with incremental risk for persistent viremia (HR, 1.09; 95% CI, 1.01 to 1.18; P = .03). Overall, 166 of 213 (77.9%) patients were alive 1 year after HCT, with no difference between patients with and without CMV viremia or among the different CMV serostatus pairs (P = not significant). CMV viremia occurred in 70% of R + TCD-HCT. Delay in PET initiation was associated with persistent viremia. With PET, CMV R/D serostatus did not adversely impact survival in TCD-HCT on 1-year survival in the present cohort. PMID:27178374

  13. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    PubMed Central

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-01-01

    The most abundantly produced virion protein in human cytomegalovirus (HCMV) is the immunodominant phosphoprotein 65 (pp65), which is frequently included in CMV vaccines. Although it is nonessential for in vitro CMV growth, pp65 displays immunomodulatory functions that support a potential role in primary and/or persistent infection. To determine the contribution of pp65 to CMV infection and immunity, we generated a rhesus CMV lacking both pp65 orthologs (RhCMVΔpp65ab). While deletion of pp65ab slightly reduced growth in vitro and increased defective particle formation, the protein composition of secreted virions was largely unchanged. Interestingly, pp65 was not required for primary and persistent infection in animals. Immune responses induced by RhCMVΔpp65ab did not prevent reinfection with rhesus CMV; however, reinfection with RhCMVΔUS2-11, which lacks viral-encoded MHC-I antigen presentation inhibitors, was prevented. Unexpectedly, induction of pp65b-specific T cells alone did not protect against RhCMVΔUS2-11 challenge, suggesting that T cells targeting multiple CMV antigens are required for protection. However, pp65-specific immunity was crucial for controlling viral dissemination during primary infection, as indicated by the marked increase of RhCMVΔpp65ab genome copies in CMV-naive, but not CMV-immune, animals. Our data provide rationale for inclusion of pp65 into CMV vaccines but also demonstrate that pp65-induced T cell responses alone do not recapitulate the protective effect of natural infection. PMID:24691437

  14. Induction of cellular hsp70 expression by human cytomegalovirus.

    PubMed Central

    Santomenna, L D; Colberg-Poley, A M

    1990-01-01

    Expression of the cellular heat shock protein 70 gene (hsp70) is transiently induced by human cytomegalovirus (HCMV) infection of permissive human diploid fibroblasts. Induction of the cellular heat shock response during critical times of infection had previously been reported to alter the growth of HCMV in vitro. Thus, a potential interaction between heat shock proteins and HCMV expression was indicated. HCMV dramatically increased expression of hsp70 RNA within 8 h of infection. hsp70 RNA remained elevated at 24 and 48 h postinfection and decreased to low levels of 72 h postinfection. Induction of HSP70 protein occurred more slowly; inducible HSP70 protein encoded by this RNA increased within 16 h postinfection and continued to increase throughout infection until 72 h postinfection, when the highest abundance of inducible HSP70 protein was observed. Cells that received both heat (43 degrees C for 70 min) treatment and HCMV infection expressed hsp70 RNA to levels above the sum of levels present in cells given either treatment alone. Furthermore, hsp70 RNA induction occurred earlier and remained elevated longer than in cells infected with HCMV alone or in cells treated with heat alone, respectively. Nevertheless, the pattern of HCMV immediate-early transcript expression at 2, 4, and 6 h postinfection appeared to be unchanged by this prior heat treatment. Our results suggest that heat shock treatment and HCMV infection can act additively in stimulating hsp70 RNA expression. The previously reported stimulation of HCMV growth in vitro following the heat shock response apparently does not result from alterations in the steady-state expression of HCMV immediate-early transcripts. Images PMID:2157870

  15. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  16. Intrauterine diagnosis of cytomegalovirus and rubella infections by amniocentesis.

    PubMed Central

    Skvorc-Ranko, R; Lavoie, H; St-Denis, P; Villeneuve, R; Gagnon, M; Chicoine, R; Boucher, M; Guimond, J; Dontigny, Y

    1991-01-01

    OBJECTIVE: To establish a correlation between the presence of cytomegalovirus (CMV) or rubella virus in amniotic fluid obtained through amniocentesis and fetal infection. DESIGN: Case series. SETTING: Five hospitals in the Montreal region. Virology testing was done at the Virology Research Centre, Institut Armand-Frappier, Laval, Que. PATIENTS: Thirteen pregnant women infected with CMV, 3 with rubella, their 15 babies and 2 fetuses. Twelve of the women with CMV infection were recruited from a prospective study of CMV infection in pregnancy. Infection in the other women was detected through routine laboratory diagnostic testing. INTERVENTION: Amniotic fluid samples were cultured for CMV and rubella virus. Congenital infection of the neonates was established through isolation of either virus from pharyngeal mucus and urine specimens collected during the first 3 days of life or from fetal tissue if the pregnancy was terminated. MAIN RESULTS: CMV was cultured from the amniotic fluid of three of the CMV-infected women and from the pharyngeal mucus and urine specimens of their infants. Of the three women with rubella the amniotic fluid of one (who had a twin pregnancy) was positive for rubella virus. After the in-utero death of one fetus she underwent a therapeutic abortion of both. Examination of fetal tissue indicated that both fetuses had been infected with rubella virus. Each of the two other women with rubella gave birth to an uninfected, healthy infant. CONCLUSIONS: We found a strong correlation between the isolation of CMV or rubella virus from the amniotic fluid and the presence of congenital infection. This suggests that amniocentesis used to detect the presence of a virus is a useful method for the diagnosis of fetal infection. PMID:1654193

  17. Clinical Features of Newly Diagnosed Cytomegalovirus Retinitis in Northern Thailand

    PubMed Central

    Ausayakhun, Somsanguan; Keenan, Jeremy D; Ausayakhun, Sakarin; Jirawison, Choeng; Khouri, Claire M; Skalet, Alison H; Heiden, David; Holland, Gary N; Margolis, Todd P

    2011-01-01

    Purpose To characterize the clinical manifestations of cytomegalovirus (CMV) retinitis in northern Thailand. Design Prospective, observational cross-sectional study. Methods We recorded characteristics of 52 consecutive patients newly diagnosed with CMV retinitis at a tertiary university-based medical center in northern Thailand. Indirect ophthalmoscopy by experienced ophthalmologists was supplemented with fundus photography to determine the proportion of eyes with various clinical features of CMV retinitis. Results Of the 52 patients with CMV retinitis, 55.8% were female. All were HIV-positive. The vast majority (90.4%) had started antiretroviral therapy. CMV retinitis was bilateral in 46.2% of patients. Bilateral visual acuity worse than 20/60 was observed in 23.1% of patients. Of 76 eyes with CMV retinitis, 61.8% had zone I disease and 21.6% had lesions involving the fovea. Lesions larger than 25% of the retinal area were observed in 57.5% of affected eyes. CMV retinitis lesions commonly had marked or severe border opacity (47.4% of eyes). Vitreous haze was often present (46.1% of eyes). Visual impairment was more common in eyes with larger retinitis lesions. Retinitis lesion size, used as a proxy for duration of disease, was associated with fulminant appearance (OR 1.24 [1.01 – 1.51]), and marked or severe border opacity (OR 1.36 [1.11 – 1.67]). Based on lesion size, retinitis preceded antiretroviral treatment in each patient. Conclusions Patients presenting to a tertiary medical center in northern Thailand have advanced CMV retinitis, possibly due to delayed diagnosis. Earlier screening and treatment of CMV retinitis may limit progression of disease and prevent visual impairment in this population. PMID:22265148

  18. Terminal structure and heterogeneity in human cytomegalovirus strain AD169.

    PubMed Central

    Tamashiro, J C; Spector, D H

    1986-01-01

    We have characterized the heterogeneity occurring at the junction of the long (L) and short (S) segments and at the termini of the strain AD169 human cytomegalovirus (HCMV) genome by restriction endonuclease mapping and nucleotide sequence analyses. The HCMV a sequence was identified by its position at both termini and inverted orientation at the L-S junction. Heterogeneity at both termini and the L-S junction was generated by the presence of fused and tandem a sequences. Some S termini lacked an a sequence. In addition, near the L terminus and at the L-S junction there were a variable number of 217-base-pair (bp) XhoI fragments arranged in tandem. The 217-bp fragments consisted of a portion of the a and adjacent b sequences (in the L-segment repeat) bounded by the same direct repeats (DR1) found at the boundaries of the a sequence. A model for the generation of these heterogeneous fragments is presented. We also determined the sequence of seven cloned terminal fragments, five from the L terminus and two from the S terminus. All L termini contained identical terminal sequences ending with base 32 of a 33-bp DR1. The S termini differed from each other and from the L-segment termini. One S terminus lacked an a sequence and terminated within S-segment repeat (c) sequences. The second S terminus contained an a sequence and terminated with bases 20 to 33 of a 33-bp DR1. A comparison of the cloned L and S terminal sequences with cloned L-S junction sequences suggested that the termini contained 3' single base extensions which were removed during the cloning. We also show that the herpesvirus conserved sequence is in a similar position relative to the termini of HCMV and several other herpesviruses, thus adding further support for the role of the sequence in the maturation of viral DNA. Images PMID:3016322

  19. AABB Committee Report: reducing transfusion-transmitted cytomegalovirus infections.

    PubMed

    Heddle, Nancy M; Boeckh, Michael; Grossman, Brenda; Jacobson, Jessica; Kleinman, Steven; Tobian, Aaron A R; Webert, Kathryn; Wong, Edward C C; Roback, John D

    2016-06-01

    Transfusion-transmitted cytomegalovirus (TT-CMV) is often asymptomatic, but certain patient populations, such as very low birth weight neonates, fetuses requiring intrauterine transfusion, pregnant women, patients with primary immunodeficiencies, transplant recipients, and patients receiving chemotherapy or transplantation for malignant disease, may be at risk of life-threatening CMV infection. It is unclear whether leukoreduction of cellular blood components is sufficient to reduce TT-CMV or whether CMV serological testing adds additional benefit to leukoreduction. The AABB CMV Prevention Work Group commissioned a systematic review to address these issues and subsequently develop clinical practice guidelines. However, the data were of poor quality, and no studies of significant size have been performed for over a decade. Rather than creating guidelines of questionable utility, the Work Group (with approval of the AABB Board of Directors) voted to prepare this Committee Report. There is wide variation in practices of using leukoreduced components alone or combining CMV-serology and leukoreduction to prevent TT-CMV for at-risk patients. Other approaches may also be feasible to prevent TT-CMV, including plasma nucleic acid testing, pathogen inactivation, and patient blood management programs to reduce the frequency of inappropriate transfusions. It is unlikely that future large-scale clinical trials will be performed to determine whether leukoreduction, CMV-serology, or a combination of both is superior. Consequently, alternative strategies including pragmatic randomized controlled trials, registries, and collaborations for electronic data merging, nontraditional approaches to inform evidence, or development of a systematic approach to inform expert opinion may help to address the issue of CMV-safe blood components. PMID:26968400

  20. Two strategies for prevention of cytomegalovirus infections after liver transplantation

    PubMed Central

    Simon, Philipp; Sasse, Max; Laudi, Sven; Petroff, David; Bartels, Michael; Kaisers, Udo X; Bercker, Sven

    2016-01-01

    AIM: To analyze differences in patients’ clinical course, we compared two regimes of either preemptive therapy or prophylaxis after liver transplantation. METHODS: This retrospective study was reviewed and approved by the institutional review board of the University of Leipzig. Cytomegalovirus (CMV) prophylaxis with valganciclovir hydrochloride for liver transplant recipients was replaced by a preemptive strategy in October 2009. We retrospectively compared liver transplant recipients 2 years before and after October 2009. During the first period, all patients received valganciclovir daily. During the second period all patients included in the analysis were treated following a preemptive strategy. Outcomes included one year survival and therapeutic intervention due to CMV viremia or infection. RESULTS: Between 2007 and 2010 n = 226 patients underwent liver transplantation in our center. n = 55 patients were D+/R- high risk recipients and were excluded from further analysis. A further 43 patients had to be excluded since CMV prophylaxis/preemptive strategy was not followed although there was no clinical reason for the deviation. Of the remaining 128 patients whose data were analyzed, 60 received prophylaxis and 68 were treated following a preemptive strategy. The difference in overall mortality was not significant, nor was it significant for one-year mortality where it was 10% (95%CI: 8%-28%, P = 0.31) higher for the preemptive group. No significant differences in blood count abnormalities or the incidence of sepsis and infections were observed other than CMV. In total, 19 patients (14.7%) received ganciclovir due to CMV viremia and/or infections. Patients who were treated according to the preemptive algorithm had a significantly higher rate risk of therapeutic intervention with ganciclovir [n = 16 (23.5%) vs n = 3 (4.9%), P = 0.003)]. CONCLUSION: These data suggest that CMV prophylaxis is superior to a preemptive strategy in patients undergoing liver

  1. Commutability of Cytomegalovirus WHO International Standard in Different Matrices.

    PubMed

    Jones, Sara; Webb, Erika M; Barry, Catherine P; Choi, Won S; Abravaya, Klara B; Schneider, George J; Ho, Shiaolan Y

    2016-06-01

    Commutability of quantitative standards allows patient results to be compared across molecular diagnostic methods and laboratories. This is critical to establishing quantitative thresholds for use in clinical decision-making. A matrix effect associated with the 1st cytomegalovirus (CMV) WHO international standard (IS) was identified using the Abbott RealTime CMV assay. A commutability study was performed to compare the CMV WHO IS and patient specimens diluted in plasma and whole blood. Patient specimens showed similar CMV DNA quantitation values regardless of the diluent or extraction procedure used. The CMV WHO IS, on the other hand, exhibited a matrix effect. The CMV concentration reported for the WHO IS diluted in plasma was within the 95% prediction interval established with patient samples. In contrast, the reported DNA concentration of the CMV WHO IS diluted in whole blood was reduced approximately 0.4 log copies/ml, and values fell outside the 95% prediction interval. Calibrating the assay by using the CMV WHO IS diluted in whole blood would introduce a bias for CMV whole-blood quantitation; samples would be reported as having higher measured concentrations, by approximately 0.4 log IU/ml. Based on the commutability study with patient samples, the RealTime CMV assay was standardized based on the CMV WHO IS diluted in plasma. A revision of the instructions for use of the CMV WHO IS should be considered to alert users of the potential impact from the diluent matrix. The identification of a matrix effect with the CMV WHO IS underscores the importance of assessing commutability of the IS in order to achieve consistent results across methods. PMID:27030491

  2. Commutability of Cytomegalovirus WHO International Standard in Different Matrices

    PubMed Central

    Jones, Sara; Webb, Erika M.; Barry, Catherine P.; Choi, Won S.; Abravaya, Klara B.; Schneider, George J.

    2016-01-01

    Commutability of quantitative standards allows patient results to be compared across molecular diagnostic methods and laboratories. This is critical to establishing quantitative thresholds for use in clinical decision-making. A matrix effect associated with the 1st cytomegalovirus (CMV) WHO international standard (IS) was identified using the Abbott RealTime CMV assay. A commutability study was performed to compare the CMV WHO IS and patient specimens diluted in plasma and whole blood. Patient specimens showed similar CMV DNA quantitation values regardless of the diluent or extraction procedure used. The CMV WHO IS, on the other hand, exhibited a matrix effect. The CMV concentration reported for the WHO IS diluted in plasma was within the 95% prediction interval established with patient samples. In contrast, the reported DNA concentration of the CMV WHO IS diluted in whole blood was reduced approximately 0.4 log copies/ml, and values fell outside the 95% prediction interval. Calibrating the assay by using the CMV WHO IS diluted in whole blood would introduce a bias for CMV whole-blood quantitation; samples would be reported as having higher measured concentrations, by approximately 0.4 log IU/ml. Based on the commutability study with patient samples, the RealTime CMV assay was standardized based on the CMV WHO IS diluted in plasma. A revision of the instructions for use of the CMV WHO IS should be considered to alert users of the potential impact from the diluent matrix. The identification of a matrix effect with the CMV WHO IS underscores the importance of assessing commutability of the IS in order to achieve consistent results across methods. PMID:27030491

  3. Non-cytomegalovirus ocular opportunistic infections in patients with AIDS

    PubMed Central

    Gangaputra, Sapna; Drye, Lea; Vaidya, Vijay; Thorne, Jennifer E.; Jabs, Douglas A; Lyon, Alice T.

    2014-01-01

    Purpose To report the incidence and clinical outcomes of non-cytomegalovirus (non-CMV) ocular opportunistic infections in patients with AIDS in the era of highly active antiretroviral therapy (HAART). Design Multicenter, prospective, observational study of patients with AIDS Methods Medical history, ophthalmologic examination, and laboratory tests were performed at enrollment and every 6 months subsequently. Once an ocular opportunistic infection was diagnosed, patients were seen every 3 months for outcomes. Results At enrollment, 37 non-CMV ocular opportunistic infections were diagnosed: 16 patients, herpetic retinitis; 11 patients, toxoplasmic retinitis; and 10 patients, choroiditis. During the follow-up period, the estimated incidences (and 95% confidence intervals [CI]) of these were: herpetic retinitis, 0.007/100 person-years (PY) (95% CI 0.0004, 0.039); toxoplasmic retinitis, 0.007/100 PY (95% CI 0.004, 0.039); and choroiditis 0.014/100 PY (95% CI 0.0025, 0.050). The mortality rates appeared higher among those patients with newly diagnosed or incident herpetic retinitis and choroiditis (rates=21.7 deaths/100 PY [P=0.02] and 12.8 deaths/100 PY [P=0.04]) respectively, than that for patients with AIDS without an ocular opportunistic infection (4.1 deaths/100 PY); Toxoplasmic retinitis did not appear to be associated with greater mortality (6.4/100 PY, P=0.47). Eyes with newly-diagnosed herpetic retinitis appeared to have a poor visual prognosis with high rates of visual impairment (37.9/100 PY) and blindness (17.5/100 PY), whereas those outcomes in eyes with choroiditis appeared to be lower (2.3/100 PY and 0/100 PY, respectively). Conclusions Although uncommon, non-CMV ocular opportunistic infections may be associated with high rates of visual loss and/or mortality. PMID:23068916

  4. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.

    2015-01-01

    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  5. Functional Properties of Human Cytomegalovirus Hyperimmunoglobulin and Standard Immunoglobulin Preparations.

    PubMed

    Germer, Matthias; Herbener, Peter; Schüttrumpf, Jörg

    2016-01-01

    BACKGROUND Cytomegalovirus hyperimmunoglobulin (CMV-HIG) preparations reduce mortality after solid organ transplantation. Polyspecific intravenous immunoglobulin (IVIg) products are also used prophylactically by some centers. Since direct comparative characterizations of the preparations are scarce, it is challenging to compare different clinical studies. MATERIAL AND METHODS The functionality of 2 CMV-HIG preparations (Cytotect® CP, Cytogam®) and 2 IVIg preparations (Ig Vena®, Flebogamma®) were compared in terms of: (i) CMV-specific immunoglobulin G (IgG) antibody levels determined by enzyme-linked immunoabsorbent assay (ELISA), (ii) avidity index using a CMV IgG avidity enzyme immunoassay, (iii) immunoblot assay against CMV-specific antigens, and (iv) anti-CMV microneutralization assay. RESULTS Median CMV-specific IgG antibody concentration was similar in the 2 CMV-HIG preparations (Cytotect® CP 101.8 PEIU/ml, Cytogam® 112.5 PEIU/ml) but markedly lower in the IVIg preparations (13.5 PEIU/ml and 21.3 PEIU/ml). CMV binding avidity was virtually identical for both CMV-HIG products (~90%). Immunoblot assay showed consistently high binding of both CMV-HIG preparations against all antigenic CMV glycoproteins tested. Recognition of some CMV-specific antigens (IE1, CM2, and p65) was weaker for the 2 IVIg products. Median CMV neutralizing antibody titers were identical for both CMV-HIG preparations (1:256), and 4-fold lower (1:64) for the IVIg products. CMV IgG antibody concentration correlated with the CMV neutralization titer. CONCLUSIONS Compared to the polyspecific IVIg products tested here, CMV-HIG preparations showed higher CMV binding activity and wider recognition of tested CMV-specific glycoprotein antigens, with markedly higher neutralizing activity. There do not appear to be any relevant distinctions between the Cytotect® CP and Cytogam® CMV-HIG products in terms of functional activity. PMID:27595792

  6. Anti-Cytomegalovirus Activity of the Anthraquinone Atanyl Blue PRL

    PubMed Central

    Alam, Zohaib; Al-Mahdi, Zainab; Zhu, Yali; McKee, Zachary; Parris, Deborah S.; Parikh, Hardik I.; Kellogg, Glen E.; Kuchta, Alison; McVoy, Michael A.

    2014-01-01

    Human cytomegalovirus (CMV) causes significant disease in immunocompromised patients and serious birth defects if acquired in utero. Available CMV antivirals target the viral DNA polymerase, have significant toxicities, and suffer from resistance. New drugs targeting different pathways would be beneficial. The anthraquinone emodin is proposed to inhibit herpes simplex virus by blocking the viral nuclease. Emodin and related anthraquinones are also reported to inhibit CMV. In the present study, emodin reduced CMV infectious yield with an EC50 of 4.9 μM but was cytotoxic at concentrations only two-fold higher. Related anthraquinones acid blue 40 and alizarin violet R inhibited CMV at only high concentrations (238–265 μM) that were also cytotoxic. However, atanyl blue PRL inhibited infectious yield of CMV with an EC50 of 6.3 μM, significantly below its 50% cytotoxic concentration of 216 μM. Atanyl blue PRL reduced CMV infectivity and inhibited spread. When added up to one h after infection, it dramatically reduced CMV immediate early protein expression and blocked viral DNA synthesis. However, it had no antiviral activity when added 24 h after infection. Interestingly, atanyl blue PRL inhibited nuclease activities of purified CMV UL98 protein with IC50 of 4.5 and 9.3 μM. These results indicate that atanyl blue PRL targets very early post-entry events in CMV replication and suggest it may act through inhibition of UL98, making it a novel CMV inhibitor. This compound may provide valuable insights into molecular events that occur at the earliest times post-infection and serve as a lead structure for antiviral development. PMID:25499125

  7. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  8. Human fetal inner ear involvement in congenital cytomegalovirus infection

    PubMed Central

    2013-01-01

    Background Congenital cytomegalovirus (CMV) infection is a leading cause of sensorineural hearing loss (SNHL). The mechanisms of pathogenesis of CMV-related SNHL are still unclear. The aim is to study congenital CMV-related damage in the fetal inner ear, in order to better understand the underlying pathophysiology behind CMV-SNHL. Results We studied inner ears and brains of 20 human fetuses, all at 21 week gestational age, with a high viral load in the amniotic fluid, with and without ultrasound (US) brain abnormalities. We evaluated histological brain damage, inner ear infection, local inflammatory response and tissue viral load. Immunohistochemistry revealed that CMV was positive in 14/20 brains (70%) and in the inner ears of 9/20 fetuses (45%). In the cases with inner ear infection, the marginal cell layer of the stria vascularis was always infected, followed by infection in the Reissner’s membrane. The highest tissue viral load was observed in the inner ear with infected Organ of Corti. Vestibular labyrinth showed CMV infection of sensory cells in the utricle and in the crista ampullaris. US cerebral anomalies were detected in 6 cases, and in all those cases, the inner ear was always involved. In the other 14 cases with normal brain scan, histological brain damage was present in 8 fetuses and 3 of them presented inner ear infection. Conclusions CMV-infection of the marginal cell layer of the stria vascularis may alter potassium and ion circulation, dissipating the endocochlear potential with consequent SNHL. Although abnormal cerebral US is highly predictive of brain and inner ear damage, normal US findings cannot exclude them either. PMID:24252374

  9. Early cytomegalovirus reactivation remains associated with increased transplant-related mortality in the current era: a CIBMTR analysis.

    PubMed

    Teira, Pierre; Battiwalla, Minoo; Ramanathan, Muthalagu; Barrett, A John; Ahn, Kwang Woo; Chen, Min; Green, Jaime S; Saad, Ayman; Antin, Joseph H; Savani, Bipin N; Lazarus, Hillard M; Seftel, Matthew; Saber, Wael; Marks, David; Aljurf, Mahmoud; Norkin, Maxim; Wingard, John R; Lindemans, Caroline A; Boeckh, Michael; Riches, Marcie L; Auletta, Jeffery J

    2016-05-19

    Single-center studies have reported an association between early (before day 100) cytomegalovirus (CMV) reactivation and decreased incidence of relapse for acute myeloid leukemia (AML) following allogeneic hematopoietic cell transplantation. To substantiate these preliminary findings, the Center for International Blood and Marrow Transplant Research (CIBMTR) Database was interrogated to analyze the impact of CMV reactivation on hematologic disease relapse in the current era. Data from 9469 patients transplanted with bone marrow or peripheral blood between 2003 and 2010 were analyzed according to 4 disease categories: AML (n = 5310); acute lymphoblastic leukemia (ALL, n = 1883); chronic myeloid leukemia (CML, n = 1079); and myelodysplastic syndrome (MDS, n = 1197). Median time to initial CMV reactivation was 41 days (range, 1-362 days). CMV reactivation had no preventive effect on hematologic disease relapse irrespective of diagnosis. Moreover, CMV reactivation was associated with higher nonrelapse mortality [relative risk [RR] among disease categories ranged from 1.61 to 1.95 and P values from .0002 to <.0001; 95% confidence interval [CI], 1.14-2.61). As a result, CMV reactivation was associated with lower overall survival for AML (RR = 1.27; 95% CI, 1.17-1.38; P <.0001), ALL (RR = 1.46; 95% CI, 1.25-1.71; P <.0001), CML (RR = 1.49; 95% CI, 1.19-1.88; P = .0005), and MDS (RR = 1.31; 95% CI, 1.09-1.57; P = .003). In conclusion, CMV reactivation continues to remain a risk factor for poor posttransplant outcomes and does not seem to confer protection against hematologic disease relapse. PMID:26884374

  10. Complement-fixing antibodies against cytomegalovirus in different parts of the world*

    PubMed Central

    Krech, U.

    1973-01-01

    A WHO cooperative study in which 27 laboratories participated showed that the distribution of cytomegalovirus antibodies in healthy blood donors varies widely, ranging from 40% in highly industrialized areas to 100% in developing countries. Climatic factors did not appear to play an important role in the spread of the virus. PMID:4363395

  11. A case of invasive cytomegalovirus duodenitis in an immunosuppressed patient 15 months after renal transplantation.

    PubMed

    Kazanji, N; Davila, F; Manickam, P; Wang, Y; Bossory, L

    2015-06-01

    Cytomegalovirus (CMV) remains one of the most important infections in kidney transplantation. Only a handful of images have been reported in the literature thus far. We present classic pathologic and gross images of CMV duodenitis in an immunosuppressed patient more than one year post-renal transplantation. PMID:25582982

  12. Molecular dissection of the human B cell response against cytomegalovirus infection by lambda display.

    PubMed

    Beghetto, Elisa; Paolis, Francesca De; Spadoni, Andrea; Del Porto, Paola; Buffolano, Wilma; Gargano, Nicola

    2008-07-01

    Human cytomegalovirus (HCMV), a ubiquitous herpesvirus, is the main cause of congenital abnormalities and mental retardation in newborns and is also responsible for severe life-threatening complications in immunocompromised individuals, including AIDS patients and transplant recipients. The disorders generated by cytomegalovirus are closely associated with the competence of the host immune system and both humoral and cell-mediated mechanisms are involved in the response to viral infection. To identify viral proteins recognized by host antibody responses, a cytomegalovirus genome library was created and displayed on lambda bacteriophage. The challenge of such a library with sera from individuals with congenital or acquired infection allowed the identification of a wide panel of recombinant bacteriophages carrying cytomegalovirus B cell epitopes. Epitope-containing fragments within the families of tegument proteins (pUL25, pUL32), structural proteins (pUL48, pUL56) and glycoproteins (pUL55) were identified. Moreover, library screening permitted isolation of phage clones carrying an antigenic region of an uncharacterized HCMV protein encoded by the UL71 open reading frame (ORF), highlighting the potential of lambda display technology in antigen and epitope discovery. PMID:18499273

  13. Congenital Cytomegalovirus Infection: A Significant Cause of Deafness and Mental Deficiency.

    ERIC Educational Resources Information Center

    Eichhorn, Sarah K.

    1982-01-01

    Research on cytomegalovirus (CMV), a herpes virus causing neurological damage (hearing problems and/or mental retardation) in 10 percent of infants born with the condition, is reviewed. Incidence of hearing and retardation in CMV cases is reported and current treatment described. (CL)

  14. Child Care Provider Awareness and Prevention of Cytomegalovirus and Other Infectious Diseases

    ERIC Educational Resources Information Center

    Thackeray, Rosemary; Magnusson, Brianna M.

    2016-01-01

    Background: Child care facilities are prime locations for the transmission of infectious and communicable diseases. Children and child care providers are at high risk for cytomegalovirus (CMV) infection which causes severe birth defects and developmental delays. Objective: The goals of study were: (1) to determine the level of cytomegalovirus…

  15. Complete Genome Sequence of a Human Cytomegalovirus Strain AD169 Bacterial Artificial Chromosome Clone

    PubMed Central

    Ostermann, Eleonore; Spohn, Michael; Indenbirken, Daniela

    2016-01-01

    The complete sequence of the human cytomegalovirus strain AD169 (variant ATCC) cloned as a bacterial artificial chromosome (AD169-BAC, also known as HB15 or pHB15) was determined. The viral genome has a length of 230,290 bp and shows 52 nucleotide differences compared to a previously sequenced AD169varATCC clone. PMID:27034483

  16. INCREASED SUSCEPTIBILITY TO PENTOBARBITAL FOLLOWING MOUSE CYTOMEGALOVIRUS INFECTION: ROLE OF VIRAL-INDUCED INTERFERON

    EPA Science Inventory

    The purpose of this study was to determine the relative roles of viral induced interferon (IFN) and viral infection of the liver in mouse cytomegalovirus (MCMV)-induced depression of cytochrome P-450 (cyt P-450) levels and enhancement of pentobarbital-induced sleeping time (PEN-S...

  17. Silent oophoritis due to cytomegalovirus in a patient with advanced HIV disease.

    PubMed

    Manfredi, R; Alampi, G; Talò, S; Calza, L; Tadolini, M; Martinelli, G N; Chiodo, F

    2000-06-01

    A case of isolated necrotizing cytomegalovirus (CMV) oophoritis disclosed only by necropsy studies in a patient with AIDS, is described. This unusual case report is discussed with a review of the literature dealing with CMV involvement of genital organs in the immunocompromised host, and in patients with HIV infection and AIDS. PMID:10872916

  18. Horizontal In Utero Acquisition of Cytomegalovirus Infection in a Twin Pregnancy

    PubMed Central

    Gabrielli, Liliana; Lazzarotto, Tiziana; Foschini, Maria Pia; Lanari, Marcello; Guerra, Brunella; Eusebi, Vincenzo; Landini, Maria Paola

    2003-01-01

    It is generally accepted that viral infections can be transmitted horizontally by direct or indirect contact with virus-excreting persons, and some viral infections can be transmitted vertically, either prenatally or perinatally, from mother to child. This report presents data strongly supporting a prenatal horizontal acquisition of human cytomegalovirus infection in a twin pregnancy. PMID:12624079

  19. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    SciTech Connect

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.; Balkin, Ethan R.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Frayo, Shani; Hylarides, Mark; Green, Damian J.; Gopal, Ajay K.; Press, Oliver W.; Pagel, John M.

    2013-05-15

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  20. Emerging concepts in the management of acute retinal necrosis.

    PubMed

    Wong, Robert William; Jumper, J Michael; McDonald, H Richard; Johnson, Robert N; Fu, Arthur; Lujan, Brandon J; Cunningham, Emmett T

    2013-05-01

    Acute retinal necrosis (ARN), also known as Kirisawa-type uveitis, is an uncommon condition caused by infection of the retina by one of the herpes family of viruses, most typically varicella zoster virus or herpes simplex virus and less commonly cytomegalovirus. Clinical diagnosis can be challenging and is often aided by PCR-based analysis of ocular fluids. Treatment typically involves extended use of one or more antiviral agents. Long term retinal detachment risk is high. We review the literature on ARN and present an approach to the diagnosis and management of this serious condition. PMID:23235944

  1. Cytomegalovirus survival and transferability and the effectiveness of common hand-washing agents against cytomegalovirus on live human hands.

    PubMed

    Stowell, Jennifer D; Forlin-Passoni, Daniela; Radford, Kay; Bate, Sheri L; Dollard, Sheila C; Bialek, Stephanie R; Cannon, Michael J; Schmid, D Scott

    2014-01-01

    Congenital cytomegalovirus (CMV) transmission can occur when women acquire CMV while pregnant. Infection control guidelines may reduce risk for transmission. We studied the duration of CMV survival after application of bacteria to the hands and after transfer from the hands to surfaces and the effectiveness of cleansing with water, regular and antibacterial soaps, sanitizer, and diaper wipes. Experiments used CMV AD169 in saliva at initial titers of 1 × 10(5) infectious particles/ml. Samples from hands or surfaces (points between 0 and 15 min) were placed in culture and observed for at least 2 weeks. Samples were also tested using CMV real-time PCR. After application of bacteria to the hands, viable CMV was recovered from 17/20 swabs at 0 min, 18/20 swabs at 1 min, 5/20 swabs at 5 min, and 4/20 swabs at 15 min. After transfer, duration of survival was at least 15 min on plastic (1/2 swabs), 5 min on crackers and glass (3/4 swabs), and 1 min or less on metal and cloth (3/4 swabs); no viable virus was collected from wood, rubber, or hands. After cleansing, no viable virus was recovered using water (0/22), plain soap (0/20), antibacterial soap (0/20), or sanitizer (0/22). Viable CMV was recovered from 4/20 hands 10 min after diaper wipe cleansing. CMV remains viable on hands for sufficient times to allow transmission. CMV may be transferred to surfaces with reduced viability. Hand-cleansing methods were effective at eliminating viable CMV from hands. PMID:24185855

  2. [Associated infections in acute bronchopulmonary infections in children].

    PubMed

    Lykova, E A; Vorob'ev, A A; Bokovoĭ, A G; Karazhas, N V; Evseeva, L F

    2003-01-01

    A total of 189 children with bacterial complications of the acute respiratory viral infection (ARVI)--primarily with pneumonia and bronchitis--were dynamically examined for typical and atypical pneumotropic causative agents of the infection process (Mycoplasma pneumoniae, Chlamydia spp., Streptococcus pneumoniae, Haemophilus influenzae, Pneumocystis carini, and Citomegalovirus). A high frequency rate of the associative infection involving mycoplasmas and pneumocysts was registered (45-50%); it was lower in the cases involving Chlamydias, hemophilic bacteria, pneumococcus, and cytomegalovirus--up to 25-30%. No sharp difference was found between the indices of an infection degree and those of an active clinical infectious process involving the same pneumotropic agent: the biggest difference was observed in Chlamydia infections (9.4%) and the lowest one--in mycoplasma infections (3%). A dynamic comparison of different classes of immunoglobulins revealed that, in acute bronchitis and pneumonias, the Chlamydia and cytomegalovirus infections are, primarily, of the persistent nature; the hemophilic and pneumocystic infections are of a mixed nature; and the pneumococcus one is of the acute nature. The Mycoplasma infection, which is more often encountered in pre-school children, is of the primary type with a trend towards a prolonged clinical course. All pneumonias had a typical clinical course; the clinical picture was compared in 128 patients with the etiological factor (including a description of characteristic symptoms). PMID:12861708

  3. Molecular and Culture-Based Bronchoalveolar Lavage Fluid Testing for the Diagnosis of Cytomegalovirus Pneumonitis.

    PubMed

    Tan, Susanna K; Burgener, Elizabeth B; Waggoner, Jesse J; Gajurel, Kiran; Gonzalez, Sarah; Chen, Sharon F; Pinsky, Benjamin A

    2016-01-01

    Background.  Cytomegalovirus (CMV) is a major cause of morbidity and mortality in immunocompromised patients, with CMV pneumonitis among the most severe manifestations of infection. Although bronchoalveolar lavage (BAL) samples are frequently tested for CMV, the clinical utility of such testing remains uncertain. Methods.  Retrospective analysis of adult patients undergoing BAL testing via CMV polymerase chain reaction (PCR), shell vial culture, and conventional viral culture between August 2008 and May 2011 was performed. Cytomegalovirus diagnostic methods were compared with a comprehensive definition of CMV pneumonitis that takes into account signs and symptoms, underlying host immunodeficiency, radiographic findings, and laboratory results. Results.  Seven hundred five patients underwent 1077 bronchoscopy episodes with 1090 BAL specimens sent for CMV testing. Cytomegalovirus-positive patients were more likely to be hematopoietic cell transplant recipients (26% vs 8%, P < .0001) and less likely to have an underlying condition not typically associated with lung disease (3% vs 20%, P < .0001). Histopathology was performed in only 17.3% of CMV-positive bronchoscopy episodes. When CMV diagnostic methods were evaluated against the comprehensive definition, the sensitivity and specificity of PCR, shell vial culture, and conventional culture were 91.3% and 94.6%, 54.4% and 97.4%, and 28.3% and 96.5%, respectively. Compared with culture, PCR provided significantly higher sensitivity and negative predictive value (P ≤ .001), without significantly lower positive predictive value. Cytomegalovirus quantitation did not improve test performance, resulting in a receiver operating characteristic curve with an area under the curve of 0.53. Conclusions.  Cytomegalovirus PCR combined with a comprehensive clinical definition provides a pragmatic approach for the diagnosis of CMV pneumonitis. PMID:26885542

  4. Molecular and Culture-Based Bronchoalveolar Lavage Fluid Testing for the Diagnosis of Cytomegalovirus Pneumonitis

    PubMed Central

    Tan, Susanna K.; Burgener, Elizabeth B.; Waggoner, Jesse J.; Gajurel, Kiran; Gonzalez, Sarah; Chen, Sharon F.; Pinsky, Benjamin A.

    2016-01-01

    Background. Cytomegalovirus (CMV) is a major cause of morbidity and mortality in immunocompromised patients, with CMV pneumonitis among the most severe manifestations of infection. Although bronchoalveolar lavage (BAL) samples are frequently tested for CMV, the clinical utility of such testing remains uncertain. Methods. Retrospective analysis of adult patients undergoing BAL testing via CMV polymerase chain reaction (PCR), shell vial culture, and conventional viral culture between August 2008 and May 2011 was performed. Cytomegalovirus diagnostic methods were compared with a comprehensive definition of CMV pneumonitis that takes into account signs and symptoms, underlying host immunodeficiency, radiographic findings, and laboratory results. Results. Seven hundred five patients underwent 1077 bronchoscopy episodes with 1090 BAL specimens sent for CMV testing. Cytomegalovirus-positive patients were more likely to be hematopoietic cell transplant recipients (26% vs 8%, P < .0001) and less likely to have an underlying condition not typically associated with lung disease (3% vs 20%, P < .0001). Histopathology was performed in only 17.3% of CMV-positive bronchoscopy episodes. When CMV diagnostic methods were evaluated against the comprehensive definition, the sensitivity and specificity of PCR, shell vial culture, and conventional culture were 91.3% and 94.6%, 54.4% and 97.4%, and 28.3% and 96.5%, respectively. Compared with culture, PCR provided significantly higher sensitivity and negative predictive value (P ≤ .001), without significantly lower positive predictive value. Cytomegalovirus quantitation did not improve test performance, resulting in a receiver operating characteristic curve with an area under the curve of 0.53. Conclusions. Cytomegalovirus PCR combined with a comprehensive clinical definition provides a pragmatic approach for the diagnosis of CMV pneumonitis. PMID:26885542

  5. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  6. Human Leukocyte Antigen Alleles and Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Futohi, Farzaneh; Saber, Azadeh; Nemati, Eglim; Einollahi, Behzad; Rostami, Zohre

    2015-01-01

    Background: Several studies have been conducted on the relationship between a number of human leukocyte antigen (HLA) alleles and cytomegalovirus infection (CMV), in kidney transplant recipients, after transplantation. However, only a limited number of HLAs have been investigated, so far, and the results have been contradictory. Objectives: This study aimed to investigate the relationship between 59 HLA alleles and the CMV infection, in transplant recipients, after kidney transplantation. Patients and Methods: This retrospective cohort study was conducted on 200 patients, receiving a kidney transplant, in Baqiyatallah Hospital, in Tehran, during 2013. Throughout a one-year follow-up of kidney transplant recipients, in case of detecting the CMV antigen in patients’ blood, at any time, they were placed in the group of patients with CMV infection, whereas, if no CMV-specific antigen was developed, over a year, patients were placed in the group of patients without CMV infection, after transplantation. This study investigated the relationship between CMV infection in kidney transplant recipients and 59 HLA alleles, including 14 HLA-A, 28 HLA-B, and 17 HLA-DRB1 cases. Results: Of all participants, 104 patients (52%) were diagnosed with CMV infection. There was no significant difference between the two groups, with and without CMV infection, in terms of patient’s characteristics. The CMV infection, in patients receiving a transplanted organ from deceased donor, was significantly more prevalent than in those receiving kidney transplant from living donor (63% vs. 39%, respectively, P = 0.001). Recipients with HLA-B44 were more infected with CMV compared with patients without this allele (80% vs. 50%, respectively, P = 0.024); on the contrary, kidney recipients with HLA-DRB1-1 were less infected with CMV than patients without this allele (31% vs. 55%, respectively, P = 0.020). There was no significant relationship between CMV infection and other HLA alleles. Results of

  7. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    SciTech Connect

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  8. Immunological response to cytomegalovirus in congenitally infected neonates

    PubMed Central

    Hassan, J; Dooley, S; Hall, W

    2007-01-01

    Cytomegalovirus (CMV) is the most common cause of congenital infection worldwide and occurs as a result of transplacental transmission of the virus. The human neonate is highly susceptible to infection due to a combination of immaturity of the immune system and antigenic inexperience. This study uses the in vivo model of congenital CMV to examine both the humoral and cell-mediated immune responses in vertically infected neonates and their mothers. Ten pairs of matched neonates and their mothers were evaluated for specific IgM responses to three immunodominant CMV antigens: pp38 (pUL80a), pp52 (pUL44) and pp150 (pUL32). In contrast to conventional enzyme immunoassay (EIA) testing for CMV-specific IgM, which found five of the mothers and four of the neonates to be positive, Western immunoblotting showed all 10 adults and nine newborns to be positive. Eight mothers and nine newborns had serological evidence of primary infection. All neonates showed a response to pp38, an assembly protein, nine responded to the pp52 immediate early antigen but only four had reactivity to the pp150 tegument associated protein. Of the mothers, eight had pp38 reactivity, 10 showed a response to the pp52 antigen and seven to the pp150 antigen. T cell-mediated immunity was assessed by measuring cytokines using a multiplex microarray assay. Levels of interferon (IFN)-γ were high in both groups [mean ± standard error of the mean (s.e.m.): neonates = 657 ± 238 pg/ml, mothers = 1072 ± 677 pg/ml, pNS]; however, neonates had significantly higher levels of interleukin (IL)-8 (316 ± 136 pg/ml versus 48 ± 28 pg/ml, P < 0·005). Similar levels of IL-2, IL-7, IL-10 and IL-12 were measured in both groups, but levels of IL-1α, IL-1β, IL-4, IL-6 and tumour necrosis factor (TNF)-α were either absent or low. In response to CMV, neonates and adults mount a predominant T helper 1 (Th1) response, as evidenced by the presence of IL-2, IL-8, IL-12 and IFN-γ with concomitant lack of IL-4. These

  9. The immunological underpinnings of vaccinations to prevent cytomegalovirus disease

    PubMed Central

    Louise McCormick, A.; Mocarski, Edward S.

    2015-01-01

    A universal cytomegalovirus (CMV) vaccination promises to reduce the burden of the developmental damage that afflicts up to 0.5% of live births worldwide. An effective vaccination that prevents transplacental transmission would reduce CMV congenital disease and CMV-associated still births and leave populations less susceptible to opportunistic CMV disease. Thus, a vaccination against this virus has long been recognized for the potential of enormous health-care savings because congenital damage is life-long and existing anti-viral options are limited. Vaccine researchers, industry leaders, and regulatory representatives have discussed the challenges posed by clinical efficacy trials that would lead to a universal CMV vaccine, reviewing the links between infection and disease, and identifying settings where disrupting viral transmission might provide a surrogate endpoint for disease prevention. Reducing the complexity of such trials would facilitate vaccine development. Children and adolescents are the targets for universal vaccination, with the expectation of protecting the offspring of immunized women. Given that a majority of females worldwide experience CMV infection during childhood, a universal vaccine must boost natural immunity and reduce transmission due to reactivation and re-infection as well as primary infection during pregnancy. Although current vaccine strategies recognize the value of humoral and cellular immunity, the precise mechanisms that act at the placental interface remain elusive. Immunity resulting from natural infection appears to limit rather than prevent reactivation of latent viruses and susceptibility to re-infection, leaving a challenge for universal vaccination to improve upon natural immunity levels. Despite these hurdles, early phase clinical trials have achieved primary end points in CMV seronegative subjects. Efficacy studies must be expanded to mixed populations of CMV-naive and naturally infected subjects to understand the overall

  10. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  11. Evaluation of a new reagent for anti-cytomegalovirus and anti-Epstein-Barr virus immunoglobulin G.

    PubMed Central

    Gutierrez, J; Maroto, M D; Piédrola, G

    1994-01-01

    The Enzygnost alpha method was tested against the complement fixation test and anti-VCA immunofluorescence to determine the respective titers of anti-cytomegalovirus and anti-Epstein-Barr virus immunoglobulin G antibodies. For cytomegalovirus, the Enzygnost results showed 97.99% agreement with the readings obtained by the alternative method, with 100% sensitivity and 93.7% specificity. For Epstein-Barr virus, Enzygnost showed 97.71% agreement, 100% sensitivity, and 91.11% specificity. PMID:7814510

  12. Murine Typhus, Reunion, France, 2011–2013

    PubMed Central

    Camuset, Guillaume; Socolovschi, Cristina; Moiton, Marie-Pierre; Kuli, Barbara; Foucher, Aurélie; Poubeau, Patrice; Borgherini, Gianandrea; Wartel, Guillaume; Audin, Héla; Raoult, Didier; Filleul, Laurent; Parola, Philippe; Pagès, Fréderic

    2015-01-01

    Murine typhus case was initially identified in Reunion, France, in 2012 in a tourist. Our investigation confirmed 8 autochthonous cases that occurred during January 2011–January 2013 in Reunion. Murine typhus should be considered in local patients and in travelers returning from Reunion who have fevers of unknown origin. PMID:25625653

  13. Cytomegalovirus infections in allogeneic stem cell recipients after reduced-intensity or myeloablative conditioning assessed by quantitative PCR and pp65-antigenemia.

    PubMed

    Schetelig, J; Oswald, O; Steuer, N; Radonic, A; Thulke, S; Held, T K; Oertel, J; Nitsche, A; Siegert, W

    2003-10-01

    Since the incidence of cytomegalovirus (CMV) infections after hematopoietic stem cell transplantation (HSCT) may depend on the intensity of the pretreatment, we studied the incidence of CMV infections after reduced-intensity compared to myeloablative conditioning. A total of 82 patients with matched related or unrelated donors were prospectively monitored for CMV infections after HSCT by CMV-PCR techniques, CMV-antigenemia and clinical observation. A total of 45 patients received reduced-intensity conditioning consisting of fludarabine, busulfan and ATG and 37 patients received myeloablative conditioning. Leukocyte engraftment occurred after a median of 15 vs 18 days (P=0.012) and platelet engraftment after 12 days vs 20 days (P=0.001), respectively. Acute graft-versus-host disease (GVHD) grade II-IV was observed in 58 vs 54% patients (P=0.737), respectively. The onset and peak values of CMV-antigenemia and DNAemia and the incidence of CMV infections did not differ statistically significantly between the two treatment groups. Multivariate analysis confirmed CMV seropositivity of the recipient (P=0.035), acute GVHD II-IV (P=0.001) but not the type of conditioning as significant risk factors for CMV-antigenemia. In conclusion, the kinetics of CMV-antigenemia and DNAemia and the incidence of CMV infections were not statistically different in patients who received HSCT after reduced-intensity conditioning with fludarabine, busulfan and ATG compared to myeloablative conditioning. PMID:13130317

  14. Enveloped Virus-Like Particle Expression of Human Cytomegalovirus Glycoprotein B Antigen Induces Antibodies with Potent and Broad Neutralizing Activity

    PubMed Central

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David

    2014-01-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  15. Enveloped virus-like particle expression of human cytomegalovirus glycoprotein B antigen induces antibodies with potent and broad neutralizing activity.

    PubMed

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David; Anderson, David E

    2014-02-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  16. Cytomegalovirus retinitis after central retinal vein occlusion in a patient on systemic immunosuppression: does venooclusive disease predispose to cytomegalovirus retinitis in patients already at risk?

    PubMed Central

    Welling, John D; Tarabishy, Ahmad B; Christoforidis, John B

    2012-01-01

    Cytomegalovirus (CMV) retinitis remains the most common opportunistic ocular infection in immunocompromised patients. Patients with immunocompromising diseases, such as acquired immunodeficiency syndrome, inherited immunodeficiency states, malignancies, and those on systemic immunosuppressive therapy, are known to be at risk. Recently, it has been suggested that patients undergoing intravitreal injection of immunosuppressive agents may also be predisposed. One previous case report speculated that there may be an additional risk for CMV retinitis in acquired immunodeficiency syndrome patients with venoocclusive disease. This case study presents a case of CMV retinitis following central retinal vein occlusion in a patient on systemic immunosuppressants. PMID:22570539

  17. Successful treatment with foscarnet for ganciclovir-resistant cytomegalovirus infection in a kidney transplant recipient: A case report.

    PubMed

    Iwami, Daiki; Ogawa, Yayoi; Fujita, Hiromi; Morita, Ken; Sasaki, Hajime; Oishi, Yuichiro; Higuchi, Haruka; Hatanaka, Kanako; Shinohara, Nobuo

    2016-07-01

    Cytomegalovirus (CMV) infection is the most common infectious complication following solid organ transplantation. Ganciclovir (GCV)-resistant CMV infection may be fatal, and is difficult to treat while avoiding allograft rejection. A 31-year-old woman received a second ABO-incompatible kidney transplant, from her father. Induction therapy consisted of basiliximab and rituximab followed by maintenance immunosuppression with tacrolimus, mycophenolate mofetil, and methylprednisolone. Her CMV serostatus was D(+) /R(-) at second transplant and she received prophylactic low-dose valganciclovir (VGCV). BK polyoma virus nephropathy (BKVN) developed 7 months after transplant concurrent with CMV hepatitis and retinitis. VGCV was increased to a therapeutic dose combined with reduced immunosuppression with minimal methylprednisolone (2 mg/day) and everolimus (0.5 mg/day). However, pp65 antigenaemia continued to increase for 6 weeks. Her CMV was defined as ganciclovir (GCV)-resistant. Foscarnet was therefore administered and her CMV disease resolved within 2 weeks. Kidney allograft dysfunction developed 9 months after transplant, and graft biopsy showed tubulointerstitial injury with crystal deposition suggesting foscarnet nephrotoxicity, with no findings of BKVN or rejection. Kidney function recovered after cessation of foscarnet and the patient had good graft function 18 months after transplant. This case demonstrates the successful use of foscarnet to treat GCV-resistant CMV infection after ABO-incompatible kidney transplant complicated with BKVN, without acute allograft rejection. This case further highlights the need to establish appropriate management for CMV D(+) /R(-) patients to avoid the acquisition of GCV-resistant gene mutations. PMID:26970406

  18. Specific serum immunoglobulin D, detected by antibody capture enzyme-linked immunosorbent assay (ELISA), in cytomegalovirus infection.

    PubMed Central

    Mortensen, J; Nielsen, S L; Sørensen, I; Andersen, H K

    1989-01-01

    An antibody capture enzyme-linked immunosorbent assay (ELISA) was developed for the detection of immunoglobulin D (IgD) antibodies to cytomegalovirus (CMV) in sera from blood donors and various groups of patients infected with CMV. This method has previously been found especially valuable in detecting specific antibodies of the IgM, IgE, IgA and IgG class in patients with CMV infection. Specific CMV IgD antibodies were found in 37% of CMV seropositive blood donors and in 47 (88%) of the 53 patients investigated, including bone marrow transplant and renal allograft transplant patients, patients with CMV mononucleosis, neonates with CMV infection and AIDS patients with CMV infection. The highest IgD reactivity was found in patients having either a primary post-transplant CMV infection or CMV mononucleosis. The IgD reactivity in patients with AIDS and in neonates was low. It was also found that in the acute phase of CMV infection the development of CMV antibodies of the IgD class was similar to the development of antibodies of the other classes. The maintenance of IgD activity in some patients together with the presence of CMV IgD antibodies in a great proportion of the blood donors indicates that the development of CMV IgD antibodies resembles that of the IgG class. Determination of specific IgD antibodies offered no advantage over determination of specific antibodies of the IgM, IgE and IgA classes in the diagnosis of CMV infection. PMID:2539278

  19. Acute Bronchitis

    MedlinePlus

    Bronchitis is an inflammation of the bronchial tubes, the airways that carry air to your lungs. It ... chest tightness. There are two main types of bronchitis: acute and chronic. Most cases of acute bronchitis ...

  20. Gain of Virulence Caused by Loss of a Gene in Murine Cytomegalovirus‡

    PubMed Central

    Bubić, Ivan; Wagner, Markus; Krmpotić, Astrid; Saulig, Tanja; Kim, Sungjin; Yokoyama, Wayne M.; Jonjić, Stipan; Koszinowski, Ulrich H.

    2004-01-01

    Mouse strains are either resistant or susceptible to murine cytomegalovirus (MCMV). Resistance is determined by the Cmv1r (Ly49h) gene, which encodes the Ly49H NK cell activation receptor. The protein encoded by the m157 gene of MCMV has been defined as a ligand for Ly49H. To find out whether the m157 protein is the only Ly49H ligand encoded by MCMV, we constructed the m157 deletion mutant and a revertant virus. Viruses were tested for susceptibility to NK cell control in Ly49H+ and Ly49H− mouse strains. Deletion of the m157 gene abolished the viral activation of Ly49H+ NK cells, resulting in higher virus virulence in vivo. Thus, in the absence of m157, Ly49H+ mice react like susceptible strains. 129/SvJ mice lack the Ly49H activation NK cell receptor but express the inhibitory Ly49I NK cell receptor that binds to the m157 protein. The Δm157 inhibitory phenotype was weak because MCMV encodes a number of proteins that mediate NK inhibition, whose contribution could be shown by another mutant. PMID:15220428

  1. [Ménétrieŕs disease associated with cytomegalovirus infection].

    PubMed

    Fernández Caamaño, B; Ramos Boluda, E; Martínez-Ojinaga Nodal, E; Molina Arias, M; Sarría Osés, J; Prieto Bozano, G

    2015-01-01

    Menetrier's disease is a rare entity in children, characterized by a protein-losing gastroenteropathy with thickening of the gastric mucosa and generalized edema. The most common etiology is viral, and cytomegalovirus is the agent most frequently implicated. Unlike in the adult, it is a self-limited disorder with a good prognosis in children. Four patients (three boys and one girl) diagnosed with Ménétrier disease in the past five years were reviewed. The mean age at presentation was 28.7 months (range: 10-48 months). The most common clinical symptoms were fever, vomiting, and edema. Endoscopy showed thickened gastric folds and erosions in several stages. All patients had an associated gastric cytomegalovirus infection, and a favorable outcome, with resolution of the disorder,was observed within a few weeks. PMID:24666786

  2. Dataset of aqueous humor cytokine profile in HIV patients with Cytomegalovirus (CMV) retinitis.

    PubMed

    Iyer, Jayant Venkatramani; Agrawal, Rupesh; Yeo, Tun Kuan; Gunasekeran, Dinesh V; Balne, Praveen Kumar; Lee, Bernett; Au, Veonice Bijin; Connolly, John; Teoh, Stephen C B

    2016-09-01

    The data shows the aqueous humor cytokine profiling results acquired in a small cohort of 17 HIV patients clinically diagnosed with Cytomegalovirus retinitis using the FlexMAP 3D (Luminex®) platform using the Milliplex Human Cytokine® kit. Aqueous humor samples were collected from these patients at different time points (pre-treatment and at 4-weekly intervals through the 12-week course of intravitreal ganciclovir treatment) and 41 cytokine levels were analyzed at each time point. CMV DNA viral load was assessed in 8 patients at different time points throughout the course of ganciclovir treatment. The data described herein is related to the research article entitled "Aqueous humor immune factors and cytomegalovirus (CMV) levels in CMV retinitis through treatment - The CRIGSS study" (Iyer et al., 2016) [1]. Cytokine levels against the different time points which indicate the response to the given treatment and against the CMV viral load were analyzed. PMID:27547803

  3. A Supraglottic Pseudotumor in an Immunocompromised Patient with Nephrotic Syndrome, Herpes Zoster, and a Cytomegalovirus Infection

    PubMed Central

    Akimoto, Tetsu; Yamazaki, Tomoyuki; Saito, Osamu; Muto, Shigeaki; Kusano, Eiji; Nagata, Daisuke

    2016-01-01

    Several viral infections may occasionally induce supraglottic mass lesions, resulting in an obstructive airway emergency. We herein report one such case in a 63-year-old male immunocompromised patient with nephrotic syndrome due to membranous nephropathy who also had ophthalmic herpes zoster with a laryngeal mass, which required urgent intubation and mechanical ventilation. The patient was initially treated with acyclovir; however, because a serological analysis revealed a concurrent cytomegalovirus infection, we discontinued the administration of acyclovir and gave priority to the simultaneous treatment of the cytomegalovirus and varicella-zoster virus infections with ganciclovir. The clinical course was favorable, and he was weaned from the ventilator 10 days later when a serial imaging analysis revealed no signs of the supraglottic mass, leading us to conclude that these two viral infections could have additively or synergistically contributed to the development of the local pseudotumor. The diagnostic and therapeutic concerns arising in the current case are also discussed. PMID:27547043

  4. Angelica acutiloba Kitagawa Extract Attenuates DSS-Induced Murine Colitis

    PubMed Central

    Jang, Jong-Chan; Lee, Kang Min

    2016-01-01

    We examined the protective effects of Angelica acutiloba Kitagawa (AAK) extract on a murine model of acute experimental colitis. Colitis was induced by 4% dextran sulfate sodium (DSS) in the drinking water of male C57BL/6 mice, for 7 consecutive days. Oral administration of AAK extract (500 mg/kg/day) significantly alleviated DSS-induced symptoms such as anorexia, weight loss, events of diarrhea or bloody stools, and colon shortening. Histological damage was also ameliorated, as evidenced by the architectural preservation and suppression of inflammatory cell infiltration in colonic samples. Treatment improved the colonic mRNA expression of different inflammatory markers: cytokines, inducible enzymes, matrix metalloproteinases, and tight junction-related proteins. In the isolated serum, IgE levels were downregulated. Collectively, these findings indicate the therapeutic potentials of AAK as an effective complementary or alternative modality for the treatment of ulcerative colitis. PMID:27293323

  5. Cytomegalovirus Retinitis and the Acquired Immune Deficiency Syndrome: Bench to Bedside: LXVII Edward Jackson Memorial Lecture

    PubMed Central

    Jabs, Douglas A.

    2010-01-01

    Purpose To update information on cytomegalovirus (CMV) retinitis in patients with the acquired immune deficiency syndrome (AIDS) and to integrate information on its pathogenesis and clinical outcomes. Design Literature review. Methods Selected articles from the medical literature, particularly large epidemiologic studies, including the Johns Hopkins Cytomegalovirus Retinitis Cohort Study, the Longitudinal Study of the Ocular Complications of AIDS, and the Cytomegalovirus Retinitis and Viral Resistance Study, were reviewed. Clinical information is discussed in light of knowledge on CMV, its pathogenesis, and its interactions with human immunodeficiency virus (HIV). Results Cytomegalovirus uses several mechanisms to evade the immune system and establish latent infection in immunologically normal hosts. With immune deficiency, such as late-stage AIDS, CMV reactivates, is disseminated to the eye, and establishes a productive infection, resulting in retinal necrosis. HIV and CMV potentiate each other: CMV accelerates HIV disease, and CMV retinitis is associated with increased mortality. Randomized clinical trials have demonstrated the efficacy of treatments for CMV retinitis. Systemically-administered treatment for CMV retinitis decreases AIDS mortality. Highly active antiretroviral therapy (HAART), effectively suppresses HIV replication, resulting in immune recovery, which, if sufficient, controls retinitis without anti-CMV therapy. Resistant CMV, detected in the blood, correlates with resistant virus in the eye and is associated with worse clinical outcomes, including mortality. Host factors, including host genetics and access to care, play a role in the development of CMV retinitis. Conclusions Clinical outcomes of CMV retinitis in patients with AIDS are dependent on characteristics of the virus and host and on HIV–CMV interactions. PMID:21168815

  6. Cytomegalovirus implicated in a case of progressive outer retinal necrosis (PORN).

    PubMed

    Sfeir, Maroun

    2015-08-01

    Progressive outer retinal necrosis, also known as PORN, has been described as a variant of necrotizing herpetic retinopathy, occurring particularly in patients with acquired immune deficiency syndrome (AIDS). Although the etiologic organism has been reported to be Varicella-zoster virus, cytomegalovirus (CMV) can be an etiologic agent. Our case illustrates the occurrence of two opportunistic infections: PORN associated with CMV and Mycobacterium avium intracellulare duodenitis in a patient with uncontrolled HIV infection. PMID:26209386

  7. Complete Genome Sequence of Rat Cytomegalovirus Strain ALL-03 (Malaysian Strain).

    PubMed

    Balakrishnan, Krishnan Nair; Abdullah, Ashwaq Ahmed; Camalxaman, Siti Nazrina; Quah, Yi Wan; Abba, Yusuf; Hani, Homayoun; Loh, Hwei San; Kamal, Farina Mustaffa; Zeenathul, Nazariah Allaudin; Aini, Ideris; Omar, A R; Noordin, Mohamed Mustapha; Mohd Azmi, Mohd Lila

    2015-01-01

    The complete genome sequence of the ALL-03 strain of rat cytomegalovirus (RCMV) has been determined. The RCMV genome has a length of 197,958 bp and is arranged as a single unique sequence flanked by 504-bp terminal direct repeats. This strain is closely related to the English strain of RCMV in terms of genetic arrangement but differs slightly in size. PMID:26044413

  8. Co-infection of Plasmodium vivax Malaria and Cytomegalovirus in an Immunocompetent Neonate.

    PubMed

    Chandelia, Sudha; Jain, Sarika

    2014-12-01

    Co-infections when occur can pose substantial diagnostic and treatment challenges for clinicians. In this case report we describe a neonate with co infection of plasmodium vivax malaria with Cytomegalovirus and discuss whether it can be the result of reactivation of one by the other infection postnatally or if these infections can affect and facilitate the transplacental transmission of each other from the mother. PMID:25653999

  9. [Severe thrombocytopenia associated with simultaneous cytomegalovirus and Epstein-barr virus infection in an immunocompetence patient].

    PubMed

    Bober, Grazyna; Krawczyk-Kuliś, Małgorzata; Kopera, Małgorzata; Hołowiecki, Jerzy

    2003-06-01

    A 22 year old woman, without preceeding immunological and hematological disorders was hospitalized because of severe thrombocytopenia. The results of extended workup revealed simultaneous cytomegalovirus and Epstein-Barr virus infection as the most probable causative factor. Both, thrombocytopenia and the symptoms of viral infections resolved after consequent treatment with acyclovir, corticosteroids and intravenous immunoglobulines. Based on this original case report authors suggest the need of virological tests in newly diagnosed idiopatic thrombocytopenia. PMID:14567095

  10. Dendritic polyglycerol sulfate attenuates murine graft-versus-host disease.

    PubMed

    Budde, Holger; Sorns, Marie-Sophie; Welker, Pia; Licha, Kai; Wolff, Hendrik; Riggert, Joachim; Wulf, Gerald; Legler, Tobias J

    2016-02-01

    Graft-versus-host disease (GvHD) is a severe immune reaction commonly occurring after hematopoietic stem cell transplantation. The outcome of patients who do not respond to the currently used immunosuppressive drugs is poor, thus there is an urgent need for the evaluation of new therapies. Heparin has a well-known anti-inflammatory effect and heparin analogues with a low anticoagulant effect are interesting candidates as new anti-inflammatory drugs. We explored the therapeutic potential of dendritic polyglycerol sulfates (dPGS), a novel class of heparin derivatives, on murine acute GvHD in vivo. The therapeutic effect of dPGS on murine GvHD was more intense after intravenous application compared to subcutaneous injection. An increased survival rate and improved clinical scores were observed in mice treated with 5 mg/kg once a week. In these animals, there was a reduction in the percentage of CD4(+) and CD8(+) T cells, which are the main effectors of GvHD. In addition, dPGS treatment decreased the number of tumor necrosis factor alpha (TNFα)-producing T cells. Increasing the dose of dPGS reversed the positive effect on survival as well as the clinical score, which indicates a small therapeutic range. Here, we report for the first time that dPGS have a significant immunosuppressive in vivo effect in a mouse model of severe acute GvHD. Therefore, we propose to study dPGS as promising candidates for the development of potential new drugs in the treatment of steroid-refractory GvHD patients first in larger animals and later in humans. PMID:26634847

  11. IL-10 regulates murine lupus.

    PubMed

    Yin, Zhinan; Bahtiyar, Gul; Zhang, Na; Liu, Lanzhen; Zhu, Ping; Robert, Marie E; McNiff, Jennifer; Madaio, Michael P; Craft, Joe

    2002-08-15

    MRL/MpJ-Tnfrsf6(lpr) (MRL/MpJ-Fas(lpr); MRL-Fas(lpr)) mice develop a spontaneous lupus syndrome closely resembling human systemic lupus erythematosus. To define the role of IL-10 in the regulation of murine lupus, IL-10 gene-deficient (IL-10(-/-)) MRL-Fas(lpr) (MRL-Fas(lpr) IL-10(-/-)) mice were generated and their disease phenotype was compared with littermates with one or two copies of an intact IL-10 locus (MRL-Fas(lpr) IL-10(+/-) and MRL-Fas(lpr) IL-10(+/+) mice, respectively). MRL-Fas(lpr) IL-10(-/-) mice developed severe lupus, with earlier appearance of skin lesions, increased lymphadenopathy, more severe glomerulonephritis, and higher mortality than their IL-10-intact littermate controls. The increased severity of lupus in MRL-Fas(lpr) IL-10(-/-) mice was closely associated with enhanced IFN-gamma production by both CD4(+) and CD8(+) cells and increased serum concentration of IgG2a anti-dsDNA autoantibodies. The protective effect of IL-10 in this lupus model was further supported by the observation that administration of rIL-10 reduced IgG2a anti-dsDNA autoantibody production in wild-type MRL-Fas(lpr) animals. In summary, our results provide evidence that IL-10 can down-modulate murine lupus through inhibition of pathogenic Th1 cytokine responses. Modulation of the level of IL-10 may be of potential therapeutic benefit for human lupus. PMID:12165544

  12. Serological Study on Cytomegalovirus and Toxoplasma Gondii in Thalassemia Major Patients of Yazd, Iran

    PubMed Central

    Moghimi, M; Doosti, M; Vahedian-Ardakani, HA; Talebi, A; Akhavan-Ghalibaf, M; Najafi, A; Aminorroaya, MM; Yazdani, Sh; Shayestehpour, M; Bahrami, H; Khodayari, F

    2015-01-01

    Background Beta-thalassemia patients receive blood products from blood transfusion centers repeatedly. Blood transfusion can transmit Cytomegalovirus (CMV) and Toxoplasma gondii. The aim of this study was serological evaluation of these two infectious agents in thalassemia patients. Materials and Methods In a cross-sectional study, the enzyme-linked immunosorbent assay (ELISA) testing was performed to detect IgM and IgG antibodies against CMV and Toxoplasma gondii in 96 thalassemia patients (under 18 years) and 144 healthy people. Data were analyzed by SPSS software and Chi-square test. Results A significant difference was observed in CMVIgM antibody levels between test groups in women (p<0.05). The prevalence of CMV IgM, CMV IgG, Toxo-IgG, and Toxo IgM antibodies in thalassemia patients were 5.2%, 95.9%, 16%, and 0%, respectively. Conclusion In all thalassemia patients, Cytomegalovirus IgG is higher than healthy people. In addition, CMV IgM antibodies are higher in female patients. Antibody screening (IgM) on blood products for detecting Cytomegalovirus is necessary, but for Toxoplasma gondii is not necessary in the Yazd transfusion center. PMID:26705454

  13. Colonic perforation in a patient with systemic lupus erythematosus accompanied by cytomegalovirus infection: A case report

    PubMed Central

    Tachikawa, Yuichi; Nozawa, Hiroaki; Tanaka, Junichiro; Nishikawa, Takeshi; Tanaka, Toshiaki; Kiyomatsu, Tomomichi; Hata, Keisuke; Kawai, Kazushige; Kazama, Shinsuke; Yamaguchi, Hironori; Ishihara, Soichiro; Sunami, Eiji; Kitayama, Joji; Fujisawa, Madoka; Takahashi, Katutoshi; Sakaguchi, Yoshiki; Ushiku, Tetsuo; Fukayama, Masashi; Watanabe, Toshiaki

    2016-01-01

    Introduction Cytomegalovirus (CMV) infection of the gastrointestinal tract is an uncommon illness, but can be observed in immunocompromised patients. Systemic lupus erythematosus (SLE) patients are generally at high risk of CMV infection. Here we report a subacute progressive case of colitis in SLE accompanied by cytomegalovirus infection. Presentation of case The patient, a 79-year-old woman, was hospitalized complaining of fever, polyarthritis, and skin ulcer that had lasted seven days. She additionally manifested vomiting, high fever, and right abdominal pain within two weeks thereafter, and was diagnosed with perforation of the intestine. Emergency operation was carried out for panperitonitis due to perforation of one of the multiple colon ulcers. Multidisciplinary postoperative treatment could not save her life. Pathological examination suggested that cytomegalovirus infection as well as cholesterin embolization contributed to the rapid progression of colitis. Discussion There have been only a limited number of case reports of CMV enteritis in SLE. Moreover, only two SLE patients on multiple medications have been reported to experience gastrointestinal perforation. Viral infections, including CMV, can induce clinical manifestations resembling SLE and for this reason we suspect that there are potentially many more patients misdiagnosed and/or unreported. Conclusion Our case underscores the importance of exploring the possibility of CMV infection as a differential diagnosis in SLE patients with obvious gastrointestinal symptoms who were treated by immunosuppressive drugs. PMID:27093690

  14. Inactivation of Influenza A virus, Adenovirus, and Cytomegalovirus with PAXgene tissue fixative and formalin.

    PubMed

    Kap, Marcel; Arron, Georgina I; Loibner, M; Hausleitner, Anja; Siaulyte, Gintare; Zatloukal, Kurt; Murk, Jean-Luc; Riegman, Peter

    2013-08-01

    Formalin fixation is known to inactivate most viruses in a vaccine production context, but nothing is published about virus activity in tissues treated with alternative, non-crosslinking fixatives. We used a model assay based on cell culture to test formalin and PAXgene Tissue fixative for their virus-inactivating abilities. MDCK, A549, and MRC-5 cells were infected with Influenza A virus, Adenovirus, and Cytomegalovirus, respectively. When 75% of the cells showed a cytopathic effect (CPE), the cells were harvested and incubated for 15 min, or 1, 3, 6, or 24 hours, with PBS (positive control), 4% formalin, or PAXgene Tissue Fix. The cells were disrupted and the released virus was used to infect fresh MDCK, A549, and MRC-5 cells cultured on cover slips in 24-well plates. The viral cultures were monitored for CPE and by immunocytochemistry (ICC) to record viral replication and infectivity. Inactivation of Adenovirus by formalin occurred after 3 h, while Influenza A virus as well as Cytomegalovirus were inactivated by formalin after 15 min. All three virus strains were inactivated by PAXgene Tissue fixative after 15 min. We conclude that PAXgene Tissue fixative is at least as effective as formalin in inactivating infectivity of Influenza A virus, Adenovirus, and Cytomegalovirus. PMID:24845590

  15. Analysis of the nucleotide sequence of the guinea pig cytomegalovirus (GPCMV) genome

    PubMed Central

    Schleiss, Mark R; McGregor, Alistair; Choi, K Yeon; Date, Shailesh V; Cui, Xiaohong; McVoy, Michael A

    2008-01-01

    In this report we describe the genomic sequence of guinea pig cytomegalovirus (GPCMV) assembled from a tissue culture-derived bacterial artificial chromosome clone, plasmid clones of viral restriction fragments, and direct PCR sequencing of viral DNA. The GPCMV genome is 232,678 bp, excluding the terminal repeats, and has a GC content of 55%. A total of 105 open reading frames (ORFs) of > 100 amino acids with sequence and/or positional homology to other CMV ORFs were annotated. Positional and sequence homologs of human cytomegalovirus open reading frames UL23 through UL122 were identified. Homology with other cytomegaloviruses was most prominent in the central ~60% of the genome, with divergence of sequence and lack of conserved homologs at the respective genomic termini. Of interest, the GPCMV genome was found in many cases to bear stronger phylogenetic similarity to primate CMVs than to rodent CMVs. The sequence of GPCMV should facilitate vaccine and pathogenesis studies in this model of congenital CMV infection. PMID:19014498

  16. Estrogen-related receptor α is required for efficient human cytomegalovirus replication

    PubMed Central

    Hwang, Jesse; Purdy, John G.; Wu, Kai; Rabinowitz, Joshua D.; Shenk, Thomas

    2014-01-01

    An shRNA-mediated screen of the 48 human nuclear receptor genes identified multiple candidates likely to influence the production of human cytomegalovirus in cultured human fibroblasts, including the estrogen-related receptor α (ERRα), an orphan nuclear receptor. The 50-kDa receptor and a 76-kDa variant were induced posttranscriptionally following infection. Genetic and pharmacological suppression of the receptor reduced viral RNA, protein, and DNA accumulation, as well as the yield of infectious progeny. In addition, RNAs encoding multiple metabolic enzymes, including enzymes sponsoring glycolysis (enolase 1, triosephosphate isomerase 1, and hexokinase 2), were reduced when the function of ERRα was inhibited in infected cells. Consistent with the effect on RNAs, a substantial number of metabolites, which are normally induced by infection, were either not increased or were increased to a reduced extent in the absence of normal ERRα activity. We conclude that ERRα is needed for the efficient production of cytomegalovirus progeny, and we propose that the nuclear receptor contributes importantly to the induction of a metabolic environment that supports optimal cytomegalovirus replication. PMID:25512541

  17. Host cellular annexin II is associated with cytomegalovirus particles isolated from cultured human fibroblasts.

    PubMed Central

    Wright, J F; Kurosky, A; Pryzdial, E L; Wasi, S

    1995-01-01

    A significant amount of host cellular annexin II was found to be associated with human cytomegalovirus isolated from cultured human fibroblasts (approximately 1,160 molecules per virion). This composition was established by four different analytical approaches that included (i) Western blot (immunoblot) analysis of gradient-purified virions with a monoclonal antibody specific for annexin II, (ii) peptide mapping and sequence analysis of virus-associated proteins and proteins dissociated from virus following EDTA treatment, (iii) electron microscopic immunocytochemistry of gradient-purified virions, and (iv) labeling of virus-associated proteins by lactoperoxidase-catalyzed radioiodination. These results indicated that annexin II was primarily localized to the viral surface, where it bound in a divalent cation-dependent manner. In functional experiments, a rabbit antiserum raised against annexin II inhibited cytomegalovirus plaque formation in human foreskin fibroblast monolayers in a concentration-dependent manner. Cumulatively, these studies demonstrate an association of host annexin II with cytomegalovirus particles and provide evidence for the involvement of this cellular protein in virus infectivity. PMID:7609045

  18. The Excess Burden of Cytomegalovirus in African American Communities: A Geospatial Analysis

    PubMed Central

    Lantos, Paul M.; Permar, Sallie R.; Hoffman, Kate; Swamy, Geeta K.

    2015-01-01

    Background. Cytomegalovirus (CMV) is a common cause of birth defects and hearing loss in infants and opportunistic infections in the immunocompromised. Previous studies have found higher CMV seroprevalence rates among minorities and among persons with lower socioeconomic status. No studies have investigated the geographic distribution of CMV and its relationship to age, race, and poverty in the community. Methods. We identified patients from 6 North Carolina counties who were tested in the Duke University Health System for CMV immunoglobulin G. We performed spatial statistical analyses to analyze the distributions of seropositive and seronegative individuals. Results. Of 1884 subjects, 90% were either white or African American. Cytomegalovirus seropositivity was significantly more common among African Americans (73% vs 42%; odds ratio, 3.31; 95% confidence interval, 2.7–4.1), and this disparity persisted across the life span. We identified clusters of high and low CMV odds, both of which were largely explained by race. Clusters of high CMV odds were found in communities with high proportions of African Americans. Conclusions. Cytomegalovirus seropositivity is geographically clustered, and its distribution is strongly determined by a community's racial composition. African American communities have high prevalence rates of CMV infection, and there may be a disparate burden of CMV-associated morbidity in these communities. PMID:26716106

  19. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  20. Impact of Cytomegalovirus (CMV) Reactivation After Umbilical Cord Blood Transplantation

    PubMed Central

    Beck, Jill C.; Wagner, John E.; DeFor, Todd E.; Brunstein, Claudio G.; Schleiss, Mark R.; Young, Jo-Anne; Weisdorf, Daniel H.; Cooley, Sarah; Miller, Jeffrey S.; Verneris, Michael R.

    2009-01-01

    This study investigated the impact of pre-transplant CMV serostatus and post-transplant CMV reactivation and disease on umbilical cord blood transplant (UCBT) outcomes. Between 1994 and 2007, 332 patients with hematologic malignancies underwent UCBT and 54% were CMV seropositive. Pre-transplant recipient CMV serostatus had no impact on acute or chronic GVHD, relapse, DFS or OS. There was a trend toward greater day 100 TRM in CMV seropositive recipients (p=0.07). CMV reactivation occurred in 51% (92/180) of patients with no difference in myeloablative vs. RIC recipients (p=0.33). Similarly, reactivation was not influenced by the number of UCB units transplanted, the degree of HLA disparity, the CD34+ or CD3+ cell dose or donor KIR gene haplotype. Rapid lymphocyte recovery was associated with CMV reactivation (p=0.02). CMV reactivation was not associated with acute (p=0.97) or chronic GVHD (p=0.65), nor did it impact TRM (p=0.88), relapse (p=0.62) or survival (p=0.78). CMV disease occurred in 13.8% of the CMV seropositive patients resulting in higher TRM (p=0.01) and lower OS (p=0.02). Thus, while recipient CMV serostatus and CMV reactivation have little demonstrable impact on UCB transplant outcomes, the development of CMV disease remains a risk, associated with inferior outcomes. PMID:19786112

  1. Comparison of simian and human cytomegalovirus reactivities in an enzyme-linked immunospecific assay: effect of antigen preparation on cross-reactive antigens.

    PubMed Central

    Tinghitella, T J; Swack, N; Baumgarten, A; Hsiung, G D

    1982-01-01

    Simian cytomegalovirus was substituted for human cytomegalovirus in an enzyme-linked immunoassay. Unlike the indirect immunofluorescence assay which demonstrates a two-way cross-reactivity, only one-way cross-reactivity was observed. Altering the method of simian antigen preparation gave some insight other this different reactivity. PMID:6288573

  2. Subepithelial Accumulation of Versican in a Cockroach Antigen-Induced Murine Model of Allergic Asthma.

    PubMed

    Reeves, Stephen R; Kaber, Gernot; Sheih, Alyssa; Cheng, Georgiana; Aronica, Mark A; Merrilees, Mervyn J; Debley, Jason S; Frevert, Charles W; Ziegler, Steven F; Wight, Thomas N

    2016-06-01

    The extracellular matrix (ECM) is an important contributor to the asthmatic phenotype. Recent studies investigating airway inflammation have demonstrated an association between hyaluronan (HA) accumulation and inflammatory cell infiltration of the airways. The ECM proteoglycan versican interacts with HA and is important in the recruitment and activation of leukocytes during inflammation. We investigated the role of versican in the pathogenesis of asthmatic airway inflammation. Using cockroach antigen (CRA)-sensitized murine models of allergic asthma, we demonstrate increased subepithelial versican in the airways of CRA-treated mice that parallels subepithelial increases in HA and leukocyte infiltration. During the acute phase, CRA-treated mice displayed increased gene expression of the four major versican isoforms, as well as increased expression of HA synthases. Furthermore, in a murine model that examines both acute and chronic CRA exposure, versican staining peaked 8 days following CRA challenge and preceded subepithelial leukocyte infiltration. We also assessed versican and HA expression in differentiated primary human airway epithelial cells from asthmatic and healthy children. Increases in the expression of versican isoforms and HA synthases in these epithelial cells were similar to those of the murine model. These data indicate an important role for versican in the establishment of airway inflammation in asthma. PMID:27126823

  3. [Severe acute pancreatitis and infection by influenza A (H1N1) virus in a child: case report].

    PubMed

    Rodríguez Schulz, Diego; Martínez, Agustina; Guzmán, María Belén; Robledo, Hugo; Capocasa, Patricia; Martínez, Luz; Garnero, Analía

    2015-08-01

    Acute pancreatitis is an inflammatory disease of the pancreas, characterized by abdominal pain and high level of pancreatic enzymes. Pancreatitis is the most common disease of pancreas in children and adults. For the diagnosis we need 2 of 3 characteristics: abdominal pain characteristic of acute pancreatitis, amylase and/or lipase 3 times higher than the normal upper limit and characteristic findings in images. The etiologies are multiple: trauma, metabolic disease and infections: mixovirus, HIV, measles, coxsackie, hepatitis B, C, cytomegalovirus, varicella, herpes simplex. Three cases of PA associated with H1N1 Influenza virus were reported, only one in a child with uncomplicated features. PMID:26172021

  4. Non-redundant and Redundant Roles of Cytomegalovirus gH/gL Complexes in Host Organ Entry and Intra-tissue Spread

    PubMed Central

    Lemmermann, Niels A. W.; Krmpotic, Astrid; Podlech, Jürgen; Brizic, Ilija; Prager, Adrian; Adler, Heiko; Karbach, Astrid; Wu, Yiquan; Jonjic, Stipan

    2015-01-01

    Herpesviruses form different gH/gL virion envelope glycoprotein complexes that serve as entry complexes for mediating viral cell-type tropism in vitro; their roles in vivo, however, remained speculative and can be addressed experimentally only in animal models. For murine cytomegalovirus two alternative gH/gL complexes, gH/gL/gO and gH/gL/MCK-2, have been identified. A limitation of studies on viral tropism in vivo has been the difficulty in distinguishing between infection initiation by viral entry into first-hit target cells and subsequent cell-to-cell spread within tissues. As a new strategy to dissect these two events, we used a gO-transcomplemented ΔgO mutant for providing the gH/gL/gO complex selectively for the initial entry step, while progeny virions lack gO in subsequent rounds of infection. Whereas gH/gL/gO proved to be critical for establishing infection by efficient entry into diverse cell types, including liver macrophages, endothelial cells, and hepatocytes, it was dispensable for intra-tissue spread. Notably, the salivary glands, the source of virus for host-to-host transmission, represent an exception in that entry into virus-producing cells did not strictly depend on either the gH/gL/gO or the gH/gL/MCK-2 complex. Only if both complexes were absent in gO and MCK-2 double-knockout virus, in vivo infection was abolished at all sites. PMID:25659098

  5. Pathobiology of human RH strain induced experimental toxoplasmosis in murine model.

    PubMed

    Sudan, Vikrant; Tewari, A K; Singh, Harkirat; Singh, R

    2016-09-01

    Of late, toxoplasmosis has gained immense importance as an opportunist parasite in immunocompromised patients. In immunocompromised subjects, the disease is supposed to occur in acute form and causes acute toxoplasmic encephalitis. However, the exact pathogenesis of other vital organs, particularly in acute form of infection, is still a matter of debate. Therefore, an attempt was made to study the pathogenesis of acute form of toxoplasmosis using cryopreserved human RH strain of the parasite in murine models. For this, 100 tachyzoites were given to individual mice and upon the setup of acute form of infection, the mice were euthanized and the organs were processed for histopathology. Histopathology revealed tachyzoites in liver only while severe necrosis due to multiplication of tachyzoites were visible in liver, spleen, lungs and brain. Kidneys and heart appeared more or less normal. Finally, the pathology of disease in these organs is described in detail. The present research has generated some vital information regarding necrotic changes in tissues due to acute toxoplasmosis and will defiantly help the researchers in the better understanding of disease particularly in humans and putting up of suitable treatment regime for human subjects infected with acute toxoplasmosis. PMID:27605794

  6. Association of Cumulative Steroid Dose with Risk of Infection after Treatment for Severe Acute Graft-versus-Host Disease.

    PubMed

    Matsumura-Kimoto, Yayoi; Inamoto, Yoshihiro; Tajima, Kinuko; Kawajiri, Akihisa; Tanaka, Takashi; Hirakawa, Tsuneaki; Ino, Kazuko; Asao, Yu; Tamogami, Hiroyuki; Kono, Chika; Takeda, Wataru; Okinaka, Keiji; Fuji, Shigeo; Kurosawa, Saiko; Kim, Sung-Won; Tanosaki, Ryuji; Yamashita, Takuya; Fukuda, Takahiro

    2016-06-01

    This study aimed to characterize the incidence and risk factors of invasive fungal disease, cytomegalovirus infection, other viral diseases, and gram-negative rod infection after glucocorticoid treatment for severe acute graft-versus-host disease (GVHD) after allogeneic hematopoietic cell transplantation and to elucidate the associations of cumulative steroid dose with the risks of individual infections. The study cohort included 91 consecutive patients who developed maximum grades III and IV acute GVHD at our center. The mean cumulative prednisolone-equivalent dose was 41 mg/kg during the first 4 weeks. The cumulative incidence rates of fungal disease, cytomegalovirus disease, other viral diseases, and gram-negative rod infection at 6 months after glucocorticoid treatment were remarkably high, at 14%, 21%, 28%, and 20%, respectively. GVHD within 26 days after transplantation and low lymphocyte count at GVHD treatment were associated with increased risks of several infections. Cumulative prednisolone-equivalent steroid doses ≥ 55 mg/kg during the first 4 weeks were associated with an increased risk of fungal disease (hazard ratio, 3.65; P = .03) and cumulative doses ≥ 23 mg/kg were associated with an increased risk of non-cytomegalovirus viral diseases (hazard ratio, 4.14; P = .02). Strategies to reduce the risk of infectious complications are needed, particularly for patients who have risk factors and those who receive high cumulative steroid doses. PMID:26968790

  7. Acute nephritic syndrome

    MedlinePlus

    Glomerulonephritis - acute; Acute glomerulonephritis; Nephritis syndrome - acute ... Acute nephritic syndrome is often caused by an immune response triggered by an infection or other disease. Common causes ...

  8. Apoptosis in irradiated murine tumors.

    PubMed

    Stephens, L C; Ang, K K; Schultheiss, T E; Milas, L; Meyn, R E

    1991-09-01

    Early radiation responses of transplantable murine ovarian (OCaI) and hepatocellular (HCaI) carcinomas were examined at 6, 24, 48, 96, and 144 h after single photon doses of 25, 35, or 45 Gy. Previous studies using tumor growth delay and tumor radiocurability assays had shown OCaI tumors to be relatively radiosensitive and HCaI tumors to be radioresistant. At 6 h, approximately 20% of nuclei in OCaI tumors showed aberrations characteristic of cell death by apoptosis. This contrasted to an incidence of 3% in HCaI tumors. Mitotic activity was eliminated in OCaI tumors but was only transiently suppressed in HCaI tumors. At 24-96 h, OCaI tumors continued to display apoptosis and progressive necrosis, whereas HCaI tumors responded by exhibiting marked pleomorphism. Factors other than mitotic activity may influence tumor radiosensitivity, and one of these may be susceptibility to induction of apoptosis (programmed cell death), because this was a prominent early radiation response by the radiosensitive OCaI tumors. PMID:1886987

  9. Chemoimmunotherapy of murine bladder cancer.

    PubMed

    Stogdill, B J; Lamm, D L; Livingston, R B

    1981-11-01

    The lethality of invasive transitional cell carcinoma (TCC) has prompted a search for effective, minimally toxic, adjuvant therapy. Such agents were evaluated in a murine bladder cancer (MBT2) model which parallels the clinical disease. One hundred C3H/He mice were inoculated i.d. with 2.5 x 10(4) viable MBT2 tumor cells and randomized to receive either normal saline (control), cis-Platinum (CPT), cyclophosphamide (CY), methotrexate (MTX), BCG, (CY + MTX), or (CY + MTX + BCG). Chemotherapy was given intraperitoneally weekly starting on day 7 after inoculation. Immunotherapy was given intralesionally on days 1 and 10 only. All mice were treated for 5 weeks followed by 5 weeks of observation. At 5 weeks, tumors of mice receiving cyclophosphamide alone or either of the combinations of therapy were smaller (P less than 0.01) than tumors of controls or other single agents alone. Each regimen increased survival, but only the combination regimen increase survival significantly (P less than 0.01). In the doses and schedule used in this model. Combination chemotherapy and chemoimmunotherapy significantly delay tumor growth and increase duration of survival (P less than 0.01) when compared with controls or single agent groups. PMID:7298287

  10. Retino-hypothalamic regulation of light-induced murine sleep

    PubMed Central

    Muindi, Fanuel; Zeitzer, Jamie M.; Heller, Horace Craig

    2014-01-01

    The temporal organization of sleep is regulated by an interaction between the circadian clock and homeostatic processes. Light indirectly modulates sleep through its ability to phase shift and entrain the circadian clock. Light can also exert a direct, circadian-independent effect on sleep. For example, acute exposure to light promotes sleep in nocturnal animals and wake in diurnal animals. The mechanisms whereby light directly influences sleep and arousal are not well understood. In this review, we discuss the direct effect of light on sleep at the level of the retina and hypothalamus in rodents. We review murine data from recent publications showing the roles of rod-, cone- and melanopsin-based photoreception on the initiation and maintenance of light-induced sleep. We also present hypotheses about hypothalamic mechanisms that have been advanced to explain the acute control of sleep by light. Specifically, we review recent studies assessing the roles of the ventrolateral preoptic area (VLPO) and the suprachiasmatic nucleus (SCN). We also discuss how light might differentially promote sleep and arousal in nocturnal and diurnal animals respectively. Lastly, we suggest new avenues for research on this topic which is still in its early stages. PMID:25140132

  11. Can microbiota transplantation abrogate murine colonization resistance against Campylobacter jejuni?

    PubMed Central

    Plickert, R.; Fischer, A.; Göbel, U. B.; Bereswill, S.

    2013-01-01

    Enterocolitis caused by Campylobacter jejuni represents an important socioeconomic burden worldwide. The host-specific intestinal microbiota is essential for maintaining colonization resistance (CR) against C. jejuni in conventional mice. Notably, CR is abrogated by shifts of the intestinal microbiota towards overgrowth with commensal E. coli during acute ileitis. Thus, we investigated whether oral transplantation (TX) of ileal microbiota derived from C. jejuni susceptible mice with acute ileitis overcomes CR of healthy conventional animals. Four days following ileitis microbiota TX or ileitis induction and right before C. jejuni infection, mice displayed comparable loads of main intestinal bacterial groups as shown by culture. Eight days following ileitis induction, but not ileal microbiota TX, however, C. jejuni could readily colonize the gastrointestinal tract of conventional mice and also translocate to extra-intestinal tissue sites such as mesenteric lymph nodes, spleen, liver, and blood within 4 days following oral infection. Of note, C. jejuni did not further deteriorate histopathology following ileitis induction. Lack of C. jejuni colonization in TX mice was accompanied by a decrease of commensal E. coli loads in the feces 4 days following C. jejuni infection. In summary, oral ileal microbiota TX from susceptible donors is not sufficient to abrogate murine CR against C. jejuni. PMID:24265916

  12. Seroprevalence and Seroconversion Rates of Cytomegalovirus pp65 Antigen and Cord Blood Screening of Pregnant Women in Malatya, Turkey

    PubMed Central

    Dogan, Keziban; Kafkasli, Ayse; Kaya, Cihan; Cengiz, Huseyin

    2013-01-01

    Objective: The rates of seropositivity, seroconversion and fetal infection with human cytomegalovirus were analyzed in pregnant women and newborn cord blood in this study. The relationships between maternal age, parity, cytomegalovirus serology and polymerase chain reaction results were evaluated. Materials and Methods: A total of 217 pregnant women attended our pregnancy clinic between April 2004 and October 2005. During each trimester, 5 cc of maternal blood was obtained and 5 cc of cord blood was collected after birth. An enzyme-linked immunosorbent assay (ELISA) was used to assess these samples for the presence of human cytomegalovirus protein pp65 antigen (in leukocytes) and cytomegalovirus DNA (in plasma). Results: The mean age of the pregnant women in our study was 28.1±5.3 years. No seroconversion was observed. Among the pregnant women, 212 (97.7%) were IgG positive, and 29 (13.4%) were IgM positive. Five of the pregnant women were positive for IgM alone (2.3%), whereas 24 (11.3%) were positive for both IgM and IgG. The 29 IgM-positive patients were reevaluated using the polymerase chain reaction, and no seropositivity was found. None of the cord blood samples were IgM positive, whereas 211 (97.3%) were IgG positive. There was no significant correlation between parity and seropositivity (p=0.487). The relationship between human cytomegalovirus seropositivity and maternal age was evaluated by dividing the pregnant women into two groups, with a cut-off age of 35 years. There was a significant difference in seropositivity between these two groups (p=0.045). Conclusion: Clearly, there is no need to screen pregnant women for Human cytomegalovirus (HCMV) in the Malatya region. Confirming serology results using the polymerase chain reaction and antigenemia testing to detect false positive results offers the advantage of avoiding unnecessary invasive interventions. PMID:25610259

  13. Rapid and combined detection of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus using AllGlo quadruplex quantitative PCR.

    PubMed

    Chen, Yi; He, Hui; Pan, Ping; He, Songzhe; Dong, Xueyan; Chen, Yueming; Wang, Shuying; Yu, Daojun

    2016-07-01

    Acute respiratory infections (ARIs) cause substantial morbidity and mortality worldwide. The causes of ARI are dynamic, and co-infections of Mycoplasma pneumoniae, Epstein-Barr virus and human cytomegalovirus are recently developed causes of ARI. Here, we established a quadruplex quantitative PCR (qPCR) method to rapidly identify and simultaneously detect a single infection or co-infection of these three pathogens and an internal control in a single tube using AllGlo probes. The analysis demonstrated a wide linear range of detection from 101 to 108 copies per test and a low coefficient of variation of less than 5 %. The amplification efficiencies were all close to 1, and the correlation coefficients (r2) were all greater than 0.99. We found no significant difference in a comparative reagent test (P >0.05). Moreover, the results of tests on clinical samples using AllGlo quadruplex qPCR and TaqMan uniplex qPCR were in near-perfect agreement (κ =0.97). Clinically, the availability of this method will enable better differential diagnosis, disease surveillance and controlled outcomes. PMID:27093597

  14. Acute sacroiliitis.

    PubMed

    Slobodin, Gleb; Rimar, Doron; Boulman, Nina; Kaly, Lisa; Rozenbaum, Michael; Rosner, Itzhak; Odeh, Majed

    2016-04-01

    The purpose of this study was to review the data on the etiology, risk factors, clinical presentations, and diagnosis of acute sacroiliitis. A Pubmed search utilizing the indexing term "acute sacroiliitis" was conducted and the data pertinent to the aim of the review was extracted and organized in accordance with the preplanned structure of the manuscript. The diagnosis of acute sacroiliitis is often challenging because of both the relative rarity of this presentation and diverse character of acute sacroiliac pain, frequently mimicking other, more prevalent disorders. Technetium bone scintigraphy can localize the disease process to the sacroiliac joint, while computed tomography or magnetic resonance imaging can be used for the detailed characterization and the extent of the disease as well as the diagnosis of complications. Pyogenic sacroiliitis is by far the most common cause of acute sacroiliitis. Brucellosis, acute sacroiliitis in the course of reactive arthritis, and crystalline-induced sacroiliitis frequently imitate pyogenic sacroiliitis. Acute sacroiliitis can rarely be also related to hematological malignancies or treatment with isotretinoin. Awareness to the possibility of acute sacroiliitis and a thorough physical examination are the necessary prerequisites to its timely diagnosis, while the appropriate laboratory and imaging studies should confirm the precise diagnosis and direct the appropriate treatment strategy. PMID:26847855

  15. Comparison of cytomegalovirus viral load measure by real-time PCR with pp65 antigenemia for the diagnosis of cytomegalovirus disease in solid organ transplant patients.

    PubMed

    Hernando, S; Folgueira, L; Lumbreras, C; San Juan, R; Maldonado, S; Prieto, C; Babiano, M J; Delgado, J; Andres, A; Moreno, E; Aguado, J M; Otero, J R

    2005-11-01

    Cytomegalovirus (CMV) infection is the most frequent complication in solid organ transplant recipients. Currently, the antigenemia assay is widely used to detect this infection, although its success is being questioned to a great extent nowadays. The aim of our study is to compare a quantitative real time PCR to measure CMV DNA to the antigenemia assay, for the diagnosis to CMV disease. For our research, we prospectively processed 1198 samples (plasma and peripheral blood leukocytes [PBMC]), which belonged to 158 transplant recipients. In every sample the detection of the pp65 antigen in PBMC was carried out, as well as the quantification of CMV DNA by PCR (Light Cycler, LC-PCR). For this process, FRET probes, which detect a 254-bp fragment from the CMV gB gene, were used. The dynamic range of the LC-PCR was 500 to 5.10(7) copies/mL plasma and from 62 to 6.10(6) copies/10(6) PBMC. Twenty-three episodes of cytomegalovirus (CMV) disease occurred in 22 out of 158 patients and PCR displayed levels of sensitivity and specificity of 100% and 67%, respectively. The antigenemia assay obtained values of 91% and 57%. We established a cutoff value of 10(3) copies/mL plasma and 315 copies/10(6) cells. According to these cutoff values, PCR showed levels of sensitivity, specificity, VPN and VPP of 95.6%, 81.6%, 99%, and 53% respectively. Moreover, the LC-PCR assay anticipated the antigenemia assay in 10 patients out of 22 who developed CMV disease and the appearance of any clinical symptoms in 12 out of 22 patients. In conclusion, we believe that the quantification of CMV DNA by LC-PCR is a superior assay to pp65 antigenemia test regarding the early diagnosis of CMV disease in solid organ transplant recipients. PMID:16386635

  16. [Diagnosis of congenital cytomegalovirus infection in newborn dried blood spots on Guthrie cards. A promissory technique].

    PubMed

    Distéfano, Angélica L; González, Cecilia A; Pardón, Fabián; Sarubi, María A; Canero Velazco, Cristina

    2008-04-01

    Laboratories play a crucial role in the diagnosis of congenital and perinatal cytomegalovirus infection, considering that other viral infections in newborn infants have similar clinical characteristics. The objectives of this work are to compare the results of the polymerase reaction in blood spots and urine as well as point out the relevance of the result in the Guthrie cards to differentiate congenital from perinatal infection. A total of 148 patients suspicious of CMVH infections were studied in the Congenital Perinatal Infections and Sexual Transmission Laboratory, at the National Institute "Carlos G. Malbrán". The dry blood samples (Guthrie cards) and urine of all patients were studied through the polymerase chain reaction. From the 148 patients, 3 presented other infections, 95 tested negative and 50 positive for cytomegalovirus: 35 had congenital infection and 15 perinatal. In the congenital cases, the polymerase reaction in dry blood was positive (sensitivity 100%, specificity 98.9%, VPP 98% and VPN 100%). Four of them with tardive symptoms were studied retrospectively. The urine specimens from the remaining 15 patients that were taken 15 days after birth were analyzed through the same methods, showing a sensitivity of 100%, the retrospective analysis of this dry blood group yielded negative results, so the infection was considered perinatal. Thus, the dry blood polymerase reaction of the newborn infants makes it a reliable assay for diagnosing congenital cytomegalovirus infection and could be used as an alternative method to urine polymerase reaction. In addition, this test is able to reveal whether the infection is congenital or perinatal in those cases of late symptom or other cases of controversial origin. PMID:18661038

  17. Retinal arteriolar occlusions due to cytomegalovirus retinitis in elderly patients without HIV

    PubMed Central

    2013-01-01

    Background Five of 7 (71%) elderly immunocompetent patients with cytomegalovirus retinitis had retinal arteriolar occlusions versus 2 of 8 (25%) elderly immunocompromised patients and 1 of 19 (5%) younger HIV-infected patients. Compared to HIV-infected patients, elderly patients were more likely to have occlusive events, neovascularization or hemorrhage, and underlying vasculopathy. The purpose of this study is to report the novel finding of extensive retinal arteriolar occlusions and neovascularization in immunocompetent patients with cytomegalovirus retinitis. This is a retrospective observational cohort study of cytomegalovirus retinitis (CMVR) in a university setting. Seven patients were elderly but not immunocompromised, 8 were elderly and iatrogenically immunocompromised, and 16 were HIV-infected. All patients underwent polymerase chain reaction testing of intraocular fluid. Primary outcome measure was visual acuity. Secondary outcome measures were vascular occlusions, ischemic complications, and response to treatment. Results Mean age was 73, 70, and 41 years for immunocompetent, immunocompromised, and HIV-infected patients, respectively. Diabetes and vascular disease were common in the elderly. Vision loss to less than 5/200 occurred in 50% of the immunocompetent elderly patients, and 17% of CMV eyes in immunocompromised and HIV patients. Occlusion of the entire retinal vasculature occurred in 4/7 (57%) of immunocompetent patients despite lack of Zone I involvement, and rubeosis occurred in three, disc neovascularization in one, and vitreous hemorrhage in two patients. Vascular occlusive events were less common in immunocompromised patients and rare in the HIV-infected. Conclusions CMVR in non-HIV-infected elderly patients is associated with retinal arteriolar occlusions. An intact host immune response may increase damage to retinal vessels. Prompt diagnosis may avert catastrophic vision loss. PMID:23514532

  18. Management of cytomegalovirus infection in solid organ transplant recipients: SET/GESITRA-SEIMC/REIPI recommendations.

    PubMed

    Torre-Cisneros, J; Aguado, J M; Caston, J J; Almenar, L; Alonso, A; Cantisán, S; Carratalá, J; Cervera, C; Cordero, E; Fariñas, M C; Fernández-Ruiz, M; Fortún, J; Frauca, E; Gavaldá, J; Hernández, D; Herrero, I; Len, O; Lopez-Medrano, F; Manito, N; Marcos, M A; Martín-Dávila, P; Monforte, V; Montejo, M; Moreno, A; Muñoz, P; Navarro, D; Pérez-Romero, P; Rodriguez-Bernot, A; Rumbao, J; San Juan, R; Vaquero, J M; Vidal, E

    2016-07-01

    Cytomegalovirus (CMV) infection remains a major complication of solid organ transplantation. Because of management of CMV is variable among transplant centers, in 2011 the Spanish Transplantation Infection Study Group (GESITRA) of the Spanish Society of Infectious Diseases and Clinical Microbiology (SEIMC) developed consensus guidelines for the prevention and treatment of CMV infection in solid organ transplant recipients. Since then, new publications have clarified or questioned the aspects covered in the previous document. For that reason, a panel of experts revised the evidence on CMV management, including immunological monitoring, diagnostics, prevention, vaccines, indirect effects, treatment, drug resistance, immunotherapy, investigational drugs, and pediatric issues. This document summarizes the recommendations. PMID:27132815

  19. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.

    2016-01-01

    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  20. Case of cytomegalovirus-associated direct anti-globulin test-negative autoimmune hemolytic anemia.

    PubMed

    Kaneko, Saeko; Sato, Masanori; Sasaki, Goro; Eguchi, Hiroyuki; Oishi, Tsutomu; Kamesaki, Toyomi; Kawaguchi, Hiroyuki

    2013-12-01

    A 1-year-old boy developed autoimmune hemolytic anemia after a negative direct anti-globulin test. The concentration of erythrocyte membrane-associated immunoglobulin G, determined using an immunoradiometric assay, correlated with disease activity. He was positive for cytomegalovirus (CMV) both serologically and by quantitative real-time polymerase chain reaction, indicating that his autoimmune hemolytic anemia was directly caused by CMV infection. Since anti-CMV immunoglobulin G was not absorbed by the patient's erythrocytes, cross-reaction between erythrocyte antigens and CMV was not likely a causative factor for hemolysis. PMID:24330288

  1. [Phylogenetic analysis of cytomegaloviruses isolated from man and different primate species].

    PubMed

    Agumava, A A; Chikobava, M G; Lapin, B A; Tonkonozhenko, O A; Pavlovsky, A N

    2011-01-01

    Institute of Medical Primatology, Russian Academy of Medical Sciences, Sochi The conserved regions of nucleotide sequences were found in primate cytomegaloviruses (CMV). Universal primers were designed for the consensus sequence of a conservative region of the UL56 gene of the betaherpesvirinae subfamily. Amplification, sequencing, and phylogenetic analysis of the fragments of CMV strains isolated from man and different primate species were made. Analysis of sequenced gene fragments showed that the UL56 gene area is most suitable for the phylogenetic analysis of primate CMV and could identify several groups of clusters by the degree of relationship among the viruses of this family. PMID:21545038

  2. Cutaneous cytomegalovirus infection on multi dermatomal herpes zoster scars: an isotopic immune response.

    PubMed

    Katibi, O S; Dlova, N C; Mosam, A

    2015-01-01

    As more patients with human immunodeficiency virus (HIV) are surviving, despite severe immune suppression, clinicians are faced with atypical manifestations of both common and uncommon dermatoses. A 30-year-old black South African woman presented with a 10-month history of multiple chronic ulcers appearing on a multidermatomal herpes zoster (HZ) scar. The woman was infected with HIV, and her CD4 count was 45 cells/μL. Histology and PCR revealed cytomegalovirus (CMV) infection. This case highlights an unusual presentation of cutaneous CMV occurring as an isotopic immune response on a pre-existing multidermatomal HZ scar. PMID:25266481

  3. Cytomegalovirus Myocarditis Required Extracorporeal Membrane Oxygenation Support Followed by Ganciclovir Treatment in Infant

    PubMed Central

    Kim, Bong Jun; Jung, Jo Won; Shin, Yu Rim; Park, Han Ki; Park, Young Hwan; Shin, Hong Ju

    2016-01-01

    A 7-month-old girl with no medical history was treated with mechanical circulatory support due to myocarditis. Her cardiac contractility did not improve despite more than one week of extracorporeal membrane oxygenation treatment. Thus, we planned a heart transplant. However, a high level of cytomegalovirus was found in blood laboratory results by quantitative polymerase chain reaction. The patient’s heart contractility recovered to normal range four days after ganciclovir treatment. She was discharged with slightly decreased cardiac contractility with a left ventricular ejection fraction of 45%. PMID:27298799

  4. Murine Norovirus: Propagation, Quantification and Genetic Manipulation

    PubMed Central

    Hwang, Seungmin; Alhatlani, Bader; Arias, Armando; Caddy, Sarah L; Christodoulou, Constantina; Cunha, Juliana; Emmott, Ed; Gonzalez-Hernandez, Marta; Kolawole, Abimbola; Lu, Jia; Rippinger, Christine; Sorgeloos, Frédéric; Thorne, Lucy; Vashist, Surender; Goodfellow, Ian

    2014-01-01

    Murine norovirus (MNV) is a positive-sense, plus-stranded RNA virus in the Caliciviridae family. It is the most common pathogen in biomedical research colonies. MNV is also related to the human noroviruses, which cause the majority of non-bacterial gastroenteritis worldwide. Like the human noroviruses, MNV is an enteric virus that replicates in the intestine and is transmitted by the fecal-oral route. MNV replicates in murine macrophages and dendritic cells in cells in culture and in the murine host. This virus is often used to study mechanisms in norovirus biology, because the human noroviruses are refractory to growth in cell culture. MNV combines the availability of a cell culture and reverse genetics system with the ability to study infection in the native host. Herein, we describe a panel of techniques that are commonly used to study MNV biology. PMID:24789596

  5. Murine typhus in Kuwait in 1978

    PubMed Central

    Al-Awadi, Abdul Rahman; Al-Kazemi, Nouri; Ezzat, Gaafar; Saah, Alfred J.; Shepard, Charles; Zaghloul, Talaat; Gherdian, Beatriz

    1982-01-01

    Murine typhus occurred in 254 individuals in Kuwait between April and August 1978; 81% of patients were aged between 15 and 44 years, and 63% were male. The highest attack rate occurred among people in the lowest socioeconomic class. The outbreak coincided with a period of high rat and flea density. A study of the first 104 cases suggested that infection was acquired in the home, but a case — control study revealed no significant differences between patients and control subjects in terms of exposure to rats or domestic animals, and other factors. This suggests that murine typhus is hyperendemic rather than epidemic in Kuwait. The disease is being controlled through reduction of both flea and rat populations. Murine typhus may be much more common in many areas than is generally realized, and its status should be re-evaluated regularly in all known and potential foci. PMID:6980739

  6. Antioxidants as novel therapy in a murine model of colitis.

    PubMed

    Oz, Helieh S; Chen, Theresa S; McClain, Craig J; de Villiers, Willem J S

    2005-05-01

    Reactive oxygen species (ROS) are increased in inflammatory bowel disease (IBD) and have been implicated as mediators of intestinal inflammation. We investigated the hypothesis that antioxidants with diverse properties attenuate disease progression in a murine dextran sodium sulfate (DSS)-induced colitis model. These antioxidants were (A) S-adenosylmethionine, a glutathione (GSH) precursor; (B) green tea polyphenols, a well-known antioxidant; and (C) 2(R,S)-n-propylthiazolidine-4(R)-carboxylic acid (PTCA), a cysteine prodrug, involved in GSH biosynthesis. BALB/c mice were divided into four groups and provided with the above mentioned antioxidants or the vehicle incorporated into chow. The animals were further divided into two subgroups and given normal drinking water (control) or water supplemented with DSS (to induce colitis), and the progression of the disease was studied. DSS-treated mice developed severe colitis as shown by bloody diarrhea, weight loss and pathological involvement (P<.001). However, all the antioxidants significantly improved diarrhea and colon lesions (P<.01), and increased body weights (P<.05). Hematocrits were significantly less affected in DSS-treated animals receiving antioxidants (P<.01). Colon lengths were significantly decreased due to mucosal inflammation in DSS-treated animals, but antioxidant therapy normalized this pathological finding (P<.001). The blood level of reduced GSH was decreased in DSS-treated mice (P<.05) and returned to normal when treated with antioxidants. Serum amyloid A (acute phase protein; P=.0015) and tumor necrosis factor-alpha (TNF-alpha; pro-inflammatory cytokine; P<.01) were significantly increased in DSS-treated animals (161+/-40 pg/ml) and improved with antioxidant treatment (P<.01). Finally, actin cytoskeleton was distorted and fragmented in the mucosa of DSS-treated mice and improved with antioxidant therapy. In conclusion, three structurally dissimilar antioxidants provided protection against DSS

  7. Cytomegalovirus prophylaxis in pediatric kidney transplantation: the Dutch experience.

    PubMed

    Jongsma, Hidde; Bouts, Antonia H; Cornelissen, Elisabeth A M; Beersma, Matthias F C; Cransberg, Karlien

    2013-09-01

    Many children receiving a kidney transplant are seronegative for CMV and therefore, highly susceptible to a primary CMV infection. This study aims at evaluating incidence, time of occurrence, and severity of CMV infection in the first year post-transplantation in relation to different types of CMV prophylaxis. Transplantations in three centers in the Netherlands between 1999 and 2010 were included. Retrospective, observational, multicenter study. Clinical data and PCR measurements of CMV were collected. Prophylaxis in high-risk patients (CMV serostatus D+R-) consisted of (val)ganciclovir during three months, or acyclovir plus CMV immunoglobulin at a former stage. Intermediate-risk patients (R+) received (val)acyclovir, or acyclovir plus CMV immunoglobulin at a former stage. Low-risk patients (D-R-) did not receive prophylaxis. Infection was defined as CMV PCR above 50 geq/mL plasma or whole blood, a clinically relevant infection above 1000 geq/mL. One hundred and fifty-nine transplantations were included. CMV infection was documented for 41% of high-risk, 24% of intermediate-risk, and 13% of low-risk patients, in the latter two groups typically during the first three months. The infection rate was highest in the high-risk group after cessation of valganciclovir prophylaxis. Valganciclovir provided better protection than did acyclovir + CMV immunoglobulin. Adding an IL2-receptor blocker to the immunosuppressive regimen did not affect the infection rate. Acute graft rejection was not related with CMV infection. Valganciclovir prophylaxis effectively prevents CMV infection in high-risk pediatric kidney recipients, but only during prophylaxis. Valacyclovir prophylaxis in intermediate-risk patients is less effective. PMID:23890076

  8. SuperSILAC Quantitative Proteome Profiling of Murine Middle Ear Epithelial Cell Remodeling with NTHi

    PubMed Central

    Val, Stéphanie; Burgett, Katelyn; Brown, Kristy J.; Preciado, Diego

    2016-01-01

    Background Chronic Otitis Media with effusion (COME) develops after sustained inflammation and is characterized by secretory middle ear epithelial metaplasia and effusion, most frequently mucoid. Non-typeable Haemophilus influenzae (NTHi), the most common acute Otitis Media (OM) pathogen, is postulated to promote middle ear epithelial remodeling in the progression of OM from acute to chronic. The goals of this study were to examine histopathological and quantitative proteomic epithelial effects of NTHi challenge in a murine middle ear epithelial cell line. Methods NTHi lysates were generated and used to stimulate murine epithelial cells (mMEEC) cultured at air-liquid interface over 48 hours– 1 week. Conditional quantitative Stable Isotope Labeling with Amino Acids in Cell Culture (SILAC) of cell lysates was performed to interrogate the global protein production in the cells, using the SuperSILAC technique. Histology of the epithelium over time was done to measure bacterial dependent remodeling. Results Mass spectrometry analysis identified 2,565 proteins across samples, of which 74 exhibited differential enrichment or depletion in cell lysates (+/-2.0 fold-change; p value<0.05). The key molecular functions regulated by NTHi lysates exposure were related to cell proliferation, death, migration, adhesion and inflammation. Finally, chronic exposure induced significant epithelial thickening of cells grown at air liquid interface. Conclusions NTHi lysates drive pathways responsible of cell remodeling in murine middle ear epithelium which likely contributes to observed epithelial hyperplasia in vitro. Further elucidation of these mediators will be critical in understanding the progression of OM from acute to chronic at the molecular level. PMID:26859300

  9. Cytomegalovirus Infection in Pediatric Hematopoietic Stem Cell Transplantation: Risk Factors for Primary Infection and Cases of Recurrent and Late Infection at a Single Center.

    PubMed

    Rowe, R Grant; Guo, Dongjing; Lee, Michelle; Margossian, Steven; London, Wendy B; Lehmann, Leslie

    2016-07-01

    Cytomegalovirus (CMV) infection is a significant source of morbidity and mortality in allogeneic stem cell transplantation (SCT). We identified a cohort of 91 pediatric SCT patients at risk (defined as either donor and/or recipient seropositivity) for CMV infection at our institution. We retrospectively categorized at-risk SCT recipients as those who (1) were at risk of CMV infection in the post-SCT period, (2) had documented CMV infection before SCT, (3) experienced recurrence of post-SCT CMV viremia, or (4) experienced late post-SCT CMV viremia; categories were not mutually exclusive. We analyzed the impact of SCT-related factors on incidence of CMV infection and outcome, and we described the outcome of each of these cohorts. In univariate analysis, recipient CMV seropositivity, use of umbilical cord blood graft, and acute graft-versus-host disease (GVHD) predicted post-SCT CMV viremia, and the effects of acute GVHD (odds ratio, 4.018; 95% confidence interval, 1.032 to 15.643) and CMV seropositivity (odds ratio, 16.525; 95% confidence interval, 2.041 to 133.803) were confirmed in multivariate analysis. Patients with recurrence of post-SCT CMV viremia had a 50% all-cause mortality rate, compared with 12% in all 91 patients. Patients with pre-SCT CMV infection had a high incidence of post-SCT CMV infection but could successfully undergo SCT with antiviral prophylaxis and pre-emptive CMV treatment. All patients with late CMV infection had prior GVHD. Theses findings identify risk factors for post-SCT CMV infection and provide novel descriptions of childhood SCT recipients with pre-SCT, recurrent, and late CMV infection, which may contribute to risk stratification strategies for CMV at-risk patients in pediatric allogeneic SCT. PMID:27090959

  10. Acute malocclusion.

    PubMed

    Dupont, John S

    2006-01-01

    Acute malocclusion can result from disturbances in the maxillary/mandibular tooth relationship. These alterations in the occlusal position can result from high fillings, sinus problems, abscesses, periodontal disease, and moving or erupting teeth. Conditions seen less frequently include acute malocclusions secondary to an event (such as trauma) that make a stable dental relationship an unstable one. Patients can demonstrate any of a number of clinical conditions that interfere with their comfort and ability to function. This article provides information on some of the less familiar causes of acute malocclusion. PMID:16689064

  11. Immune-based guidance of foscarnet treatment duration in a transplant recipient with ganciclovir-resistant cytomegalovirus infection.

    PubMed

    Mihm, Janine; Leyking, Sarah; Dirks, Jan; Smola, Sigrun; Fliser, Danilo; Sester, Urban; Sester, Martina; Wilkens, Heinrike; Rissland, Jürgen

    2016-09-01

    A lung and kidney transplant recipient underwent cytomegalovirus (CMV) primary infection with a UL97 mutation. Combined monitoring of viral load and CMV-specific CD4 T-cells allowed reduction of treatment duration with foscarnet, and illustrates how knowledge on the individual immunocompetence towards CMV may be used to individualize duration of antiviral treatment. PMID:27389910

  12. Acute Bronchitis

    MedlinePlus

    ... bronchitis? Acute bronchitis is almost always caused by viruses that attack the lining of the bronchial tree ... infection. As your body fights back against these viruses, more swelling occurs and more mucus is produced. ...

  13. Acute Pericarditis

    MedlinePlus

    ... large pericardial effusions). Acute pericarditis usually responds to colchicine or NSAIDs (such as aspirin and ibuprofen ) taken ... reduce pain but relieves it by reducing inflammation. Colchicine also decreases the chance of pericarditis returning later. ...

  14. In vitro activity evaluation of Parkia pendula seed lectin against human cytomegalovirus and herpes virus 6.

    PubMed

    Favacho, Alexsandra R M; Cintra, Elizabete A; Coelho, Luana C B B; Linhares, Maria Iêda S

    2007-06-01

    Human cytomegalovirus (HCMV) in vitro infectivity was inhibited by Parkia pendula seed lectin (PpeL) in contrast to human herpes virus 6 (HHV-6) which was not affected. The antiviral activity was detected for HCMV in human embryo lung (HEL) cells using a microtechnique in culture plates. The assay showed a reduction of cellular infectivity from approximately 95%, at a concentration of 150microg/mL with minimal cytotoxicity (25%). Also, a reduction of 75% was observed in HEL cells at a concentration of 75microg/mL without toxic effect. The reduction on infectivity was observed even after virus pre-adsorption to cells suggesting that this action should occur after virus penetration, in the intracellular replication phase. MT4 lymphocytes and cord blood mononuclear cells (CBMC) were used to evaluate the lectin effect on HHV-6 following the same technique. Lectin concentrations with few or no toxic effects on lymphocytes did not show inhibitory action of HHV-6 cytopathic effect. The results obtained with PpeL demonstrate that it may have an impact in the design of pharmacological strategies to infection of cytomegalovirus. PMID:17254798

  15. Peroxisomes are platforms for cytomegalovirus' evasion from the cellular immune response.

    PubMed

    Magalhães, Ana Cristina; Ferreira, Ana Rita; Gomes, Sílvia; Vieira, Marta; Gouveia, Ana; Valença, Isabel; Islinger, Markus; Nascimento, Rute; Schrader, Michael; Kagan, Jonathan C; Ribeiro, Daniela

    2016-01-01

    The human cytomegalovirus developed distinct evasion mechanisms from the cellular antiviral response involving vMIA, a virally-encoded protein that is not only able to prevent cellular apoptosis but also to inhibit signalling downstream from mitochondrial MAVS. vMIA has been shown to localize at mitochondria and to trigger their fragmentation, a phenomenon proven to be essential for the signalling inhibition. Here, we demonstrate that vMIA is also localized at peroxisomes, induces their fragmentation and inhibits the peroxisomal-dependent antiviral signalling pathway. Importantly, we demonstrate that peroxisomal fragmentation is not essential for vMIA to specifically inhibit signalling downstream the peroxisomal MAVS. We also show that vMIA interacts with the cytoplasmic chaperone Pex19, suggesting that the virus has developed a strategy to highjack the peroxisomal membrane proteins' transport machinery. Furthermore, we show that vMIA is able to specifically interact with the peroxisomal MAVS. Our results demonstrate that peroxisomes constitute a platform for evasion of the cellular antiviral response and that the human cytomegalovirus has developed a mechanism by which it is able to specifically evade the peroxisomal MAVS-dependent antiviral signalling. PMID:27181750

  16. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  17. Auditory steady state response in hearing assessment in infants with cytomegalovirus

    PubMed Central

    Silva, Daniela Polo C.; Lopez, Priscila Suman; Montovani, Jair Cortez

    2013-01-01

    OBJECTIVE: To report an infant with congenital cytomegalovirus and progressive sensorineural hearing loss, who was assessed by three methods of hearing evaluation. CASE DESCRIPTION: In the first audiometry, at four months of age, the infant showed abnormal response in Otoacoustic Emissions and normal Auditory Brainstem Response (ABR), with electrophysiological threshold in 30dBnHL, in both ears. With six months of age, he showed bilateral absence of the ABR at 100dBnHL. The behavioral observational audiometry was impaired due to the delay in neuropsychomotor development. At eight months of age, he was submitted to Auditory Steady State Response (ASSR) and the thresholds were 50, 70, absent in 110 and in 100dB, respectively for 500, 1,000, 2,000 and 4,000Hz in the right ear, and 70, 90, 90 and absent in 100dB, respectively for 500, 1,000, 2,000 and 4,000Hz in the left ear. COMMENTS: In the first evaluation, the infant had abnormal Otoacoustic Emission and normal ABR, which became altered at six months of age. The hearing loss severity could be identified only by the ASSR, which allowed the best procedure for hearing aids adaptation. The case description highlights the importance of the hearing status follow-up for children with congenital cytomegalovirus. PMID:24473963

  18. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  19. Does cytomegalovirus infection contribute to socioeconomic disparities in all-cause mortality?

    PubMed

    Feinstein, Lydia; Douglas, Christian E; Stebbins, Rebecca C; Pawelec, Graham; Simanek, Amanda M; Aiello, Allison E

    2016-09-01

    The social patterning of cytomegalovirus (CMV) and its implication in aging suggest that the virus may partially contribute to socioeconomic disparities in mortality. We used Cox regression and inverse odds ratio weighting to quantify the proportion of the association between socioeconomic status (SES) and all-cause mortality that was attributable to mediation by CMV seropositivity. Data were from the National Health and Nutrition Examination Survey (NHANES) III (1988-1994), with mortality follow-up through December 2011. SES was assessed as household income (income-to-poverty ratio ≤1.30;>1.30 to≤1.85;>1.85 to≤3.50;>3.50) and education (high school). We found strong associations between low SES and increased mortality: hazard ratio (HR) 1.80; 95% confidence interval (CI): 1.57, 2.06 comparing the lowest versus highest income groups and HR 1.29; 95% CI: 1.13, 1.48 comparing high school education. 65% of individuals were CMV seropositive, accounting for 6-15% of the SES-mortality associations. Age modified the associations between SES, CMV, and mortality, with CMV more strongly associated with mortality in older individuals. Our findings suggest that cytomegalovirus may partially contribute to persistent socioeconomic disparities in mortality, particularly among older individuals. PMID:27268074

  20. Murine neonatal intravascular injections: Modeling newborn disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability to perform murine neonatal intravascular injections likely will prove useful in studying many newborn-specific disease states that are modeled in mice. Unfortunately, effective intravascular injection in the neonatal mouse has been limited by developmental immaturity and small size. To e...

  1. Evaluation of a standardised real-time PCR based DNA-detection method (Realstar®) in whole blood for the diagnosis of primary human cytomegalovirus (CMV) infections in immunocompetent patients.

    PubMed

    Berth, M; Benoy, I; Christensen, N

    2016-02-01

    Cytomegalovirus (CMV) DNA detection in blood could, as a supplementary test to serology, improve the accuracy and speed of diagnosis of an acute CMV infection. In this study we evaluated the performance of a commercially available and standardised CMV PCR assay in whole blood for the diagnosis of a primary infection in immunocompetent adults. Moreover, the kinetics of viral DNA was evaluated in order to provide a time frame in which viral DNA could be detected during an acute primary infection. Whole blood samples were collected from 66 patients with an acute CMV infection, 65 patients with an acute Epstein-Barr virus infection, 27 patients with various other acute infections (parvovirus B19, HIV, Toxoplasma gondii), 20 patients with past CMV infections (>1 year) and 20 apparently healthy persons. For CMV DNA detection and quantification a commercially available real-time PCR was applied (RealStar®, altona Diagnostics). The clinical sensitivity of CMV PCR in whole blood for the diagnosis of a recent primary CMV infection was 93.9 % and the diagnostic specificity 99.2 %. In the majority of the patients CMV DNA was not detectable anymore approximately within 4 weeks after the first blood sample was taken. From these data we concluded that, together with a suggestive serological profile, a positive CMV PCR result in whole blood can be regarded as a diagnostic confirmation of a recent CMV infection on a single blood sample in an immunocompetent patient. However, a negative CMV PCR result does not exclude a recent CMV infection. PMID:26661089

  2. Efficient expression of protein coding genes from the murine U1 small nuclear RNA promoters.

    PubMed Central

    Bartlett, J S; Sethna, M; Ramamurthy, L; Gowen, S A; Samulski, R J; Marzluff, W F

    1996-01-01

    Few promoters are active at high levels in all cells. Of these, the majority encode structural RNAs transcribed by RNA polymerases I or III and are not accessible for the expression of proteins. An exception are the small nuclear RNAs (snRNAs) transcribed by RNA polymerase II. Although snRNA biosynthesis is unique and thought not to be compatible with synthesis of functional mRNA, we have tested these promoters for their ability to express functional mRNAs. We have used the murine U1a and U1b snRNA gene promoters to express the Escherichia coli lacZ gene and the human alpha-globin gene from either episomal or integrated templates by transfection, or infection into a variety of mammalian cell types. Equivalent expression of beta-galactosidase was obtained from < 250 nucleotides of 5'-flanking sequence containing the complete promoter of either U1 snRNA gene or from the 750-nt cytomegalovirus promoter and enhancer regions. The mRNA was accurately initiated at the U1 start site, efficiently spliced and polyadenylylated, and localized to polyribosomes. Recombinant adenovirus containing the U1b-lacZ chimeric gene transduced and expressed beta-galactosidase efficiently in human 293 cells and airway epithelial cells in culture. Viral vectors containing U1 snRNA promoters may be an attractive alternative to vectors containing viral promoters for persistent high-level expression of therapeutic genes or proteins. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8799116

  3. Fatty acid extracts from Lucilia sericata larvae promote murine cutaneous wound healing by angiogenic activity

    PubMed Central

    2010-01-01

    Background fatty acids are considered to be effective components to promote wound healing and Lucilia sericata larvae are applied clinically to treat intractable wounds. We aimed to investigat the effect of fatty acid extracts from dried Lucilia sericata larvae on murine cutaneuous wound healing as well as angiogenesis. Results On day 7 and 10 after murine acute excision wounds creation, the percent wound contraction of fatty acid extracts group was higher than that of vaseline group. On day 3, 7 and 10 after wounds creation, the wound healing quality of fatty acid extracts group was better than that of vaseline group on terms of granulation formation and collagen organization. On day 3 after wounds creation, the micro vessel density and vascular endothelial growth factor expression of fatty acid extracts group were higher than that of vaseline group. Component analysis of the fatty acid extracts by gas chromatography-mass spectrometry showed there were 10 kinds of fatty acids in total and the ratio of saturated fatty acid, monounsaturated fatty acid and polyunsaturated fatty acid (PUFA) was: 20.57%:60.32%:19.11%. Conclusions Fatty acid extracts from dried Lucilia sericata larvae, four fifths of which are unsaturated fatty acids, can promote murine cutaneous wound healing probably resulting from the powerful angiogenic activity of the extracts. PMID:20211009

  4. Acute myelogenous leukemia (AML) - children

    MedlinePlus

    Acute myelogenous leukemia - children; AML; Acute myeloid leukemia - children; Acute granulocytic leukemia - children; Acute myeloblastic leukemia - children; Acute non-lymphocytic leukemia (ANLL) - children

  5. Effects of ethanol on cAMP production in murine embryonic palate mesenchymal cells

    SciTech Connect

    Weston, W.M.; Greene, R.M. )

    1991-01-01

    Ethanol affected the ability of murine embryonic palate mesenchymal (MEPM) cells to produce cAMP in response to hormone treatment. Acute exposure to ethanol resulted in an increase in hormone-stimulated cAMP levels, while chronic ethanol treatment led to decreased sensitivity to hormone. Forskolin-stimulated cAMP levels were decreased by both acute and chronic ethanol treatment, while the cells' response to cholera toxin was unchanged by ethanol treatment. The lack of sensitivity of the cholera toxin response to ethanol suggests that,in contrast to what has been observed in other systems, ethanol does not affect the production or activity of G{alpha}s in MEPM cells. These results suggest a possible explanation for the molecular basis for the craniofacial abnormalities observed in the fetal alcohol syndrome.

  6. Successful low-dose leflunomide treatment for ganciclovir-resistant cytomegalovirus infection with high-level antigenemia in a kidney transplant: A case report and literature review.

    PubMed

    Morita, Shinya; Shinoda, Kazunobu; Tamaki, Satoshi; Kono, Hidaka; Asanuma, Hiroshi; Nakagawa, Ken; Oya, Mototsugu

    2016-09-01

    Ganciclovir-resistant cytomegalovirus infection is sometimes life-threatening for organ transplant recipients. Foscarnet is an alternative, although it may potentially worsen the preexistent impaired renal function. Here we report the case of a successful low-dose leflunomide treatment in a kidney transplant recipient with very high viral replication, who underwent kidney transplantation 10 years before. Administering 10mg leflunomide daily for 5 months without a loading dose completely cleared the ganciclovir-resistant cytomegalovirus strains. PMID:27494108

  7. Distribution of Cytomegalovirus Genotypes among Neonates Born to Infected Mothers in Islamabad, Pakistan

    PubMed Central

    Mujtaba, Ghulam; Khurshid, Adnan; Sharif, Salmaan; Alam, Muhammad Masroor; Aamir, Uzma Bashir; Shaukat, Shahzad; Angez, Mehar; Rana, Muhammad Suleman; Umair, Massab; Shah, Aamer Ali; Zaidi, Syed Sohail Zahoor

    2016-01-01

    Background Congenital cytomegalovirus (cCMV) infection contributes to considerable long-term sequelae in neonates and children all over the world. The association between viral genotypes and severity of clinical cytomegalovirus (CMV) infection is yet to be defined. The objective of this study was to find the impact of active CMV infection during pregnancy and the clinical significance of genotypes in neonates with congenital cytomegalovirus infections in Pakistan. Methods A total of 409 blood samples from pregnant women seeking health care services at the two antenatal hospitals of Islamabad during January to December 2012 were tested by ELISA and nested-PCR. Pregnant women with active infection (detected as IgM positive, PCR positive or positive on both assays) were followed until delivery, to detect the outcome of overt cCMV infection in neonates. Genetic characterization of CMV strains was performed by sequence analysis of envelope glycoproteins: gB, gN and gH to detect the contributing CMV genotypes. Results The seroprevalence of anti-CMV IgG and IgM was 97.5% (399 out of 409) and 12.7% (52 out of 409), respectively, while 20% (82/409) pregnant women were found positive for CMV DNA by PCR. Logistic regression analysis showed a significant association of active infection with parity [OR = 2.56, 95% CI = 1.82–2.62, p = 0.04], febrile illness [OR = 1.84, 95% CI = 1.76–3.65, p = 0.01] and jaundice [OR = 22.5, 95% CI = 4.53–85.02, p = 0.002]. We were able to isolate virus in 41 out of 70 neonates; 36.6% (15 out of 41) of them were symptomatic at birth while 63.4% (26 out of 41) were asymptomatic. The most prominent clinical feature observed in symptomatic neonates was hepatosplenomegaly (26.6%; 4 out of 15). All three genotypes gB, gN and gH were found with the highest frequency of gB1 genotype, found in 75% infants with hepatic damage. Phylogenetic analysis of Pakistani strains showed 96%-100% homology to their prototype strains. Conclusions Active CMV

  8. Killer-cell immunoglobulin-like receptors and cytomegalovirus reactivation during late pregnancy.

    PubMed

    Alvarado-Hernández, D L; Benítez-Sánchez, A; Rodríguez-Cuevas, J S; Rosales-Saavedra, T; Guerra-Palomares, S E; Comas-García, A; Noyola, D E; García-Sepúlveda, C A

    2016-08-01

    Human cytomegalovirus (CMV) represents an important public health concern as it is associated with severe morbidity and mortality in transplant recipients, HIV-infected individuals and pregnant women given the risk of congenital infection. Congenital CMV is a leading cause of neurological sequelae, developmental delay and birth defects worldwide. Cytomegalovirus can be transmitted to the foetus following maternal infection or reactivation. NK cells expressing killer-cell immunoglobulin-like receptors (KIR) are part of the innate immune system and the first line of defence against viral incursions. Previous reports have shown that KIR genes are associated with CMV infections in the post-transplant setting. In this study, we set out to determine whether a protective effect of KIR genes over CMV infection is seen in Mexican pregnant women. Cytomegalovirus infection was assessed through nucleic acid testing in 200 pregnant women and 600 healthy blood donors comprising the Mexican mestizo reference population. Killer-cell immunoglobulin-like receptors and HLA-C genotypes were obtained from 200 pregnant women and 300 reference samples using a comprehensive PCR-SSP approach. We observed statistically lower carrier frequencies of cB03|tA01 gene-content haplotype, of cB03 haplotype motif, of the KIR2DL5 + 2DS3/2DS5 gene pair and of KIR2DL5 amongst CMV-positive pregnant women in comparison with those CMV negative. None of these were associated with CMV status in the reference population. Logistic regression analysis revealed that the most important factor determining CMV status during third-trimester pregnancies was the KIR2DL5 + 2DS3/2DS5 gene pair (OR 0.376 (95%CI 0.174, 0.811, P = 0.013). Our results indicate that CMV-protective KIR gene associations described in Caucasoid populations are also present in the genetically distinct Mexican mestizo population. Our results suggest that certain KIR gene combinations provide protection against CMV infections occurring

  9. Opossums and Cat Fleas: New Insights in the Ecology of Murine Typhus in Galveston, Texas.

    PubMed

    Blanton, Lucas S; Idowu, Boluwatife M; Tatsch, Tyler N; Henderson, Joshua M; Bouyer, Donald H; Walker, David H

    2016-08-01

    Murine typhus is an acute undifferentiated febrile illness caused by Rickettsia typhi The classic reservoir (Rattus spp.) and flea vector (Xenopsylla cheopis) were once culprits of murine typhus in the United States. Vector and rodent control efforts have drastically decreased the prevalence of disease, except in a few endemic foci where opossums and cat fleas play a role in transmission. Since 2012, there has been a reemergence of murine typhus in Galveston, TX. We hypothesize that opossums and cat fleas are involved in the transmission of R. typhi in Galveston. To explore this, we sought to find the seroprevalence of typhus group antibodies from opossums. We also sought to find the prevalence of R. typhi in fleas parasitizing these animals. We collected blood from 12 opossums and found that eight (66.7%) had the presence of anti-R. typhi antibodies. All opossums were infested with fleas; a total of 250 Ctenocephalides felis fleas were collected from these animals. Seven opossums (53.8%) were infested with fleas that had molecular evidence of R. typhi infection, while six (46.2%) were infested with fleas that contained Candidatus Rickettsia senegalensis, an organism closely related to R. felis The minimum flea infection rate for R. typhi was 7.0%. The minimum infection rate for Candidatus R. senegalensis was 6.1%. Our study demonstrates that fleas infected with R. typhi parasitize opossums in Galveston. It is therefore likely that opossums and their fleas play a role in the city's recent reemergence of murine typhus. PMID:27273642

  10. Murine and epidemic typhus rickettsiae: how close is their relationship?

    PubMed

    Woodward, T E

    1982-01-01

    Typhus fever has occurred globally as epidemic and endemic disorders. In 1910, Brill reported a typhus-like illness which Zinsser and others determined to be recurrent epidemic typhus fever. Maxcy, in 1926, proposed rodents and fleas as reservoir and vector, respectively, of endemic typhus, which Dyer confirmed in 1930. Animals experimentally infected with epidemic typhus (Rickettsia prowazeki) are immune to murine typhus (Rickettsia typhi) and vice versa. Similar solid cross-immunity exists for humans. The two diseases are clinically similar in pathologic and serologic reactions. Human epidemic typhus presumably involved a man-louse-man cycle without an animal reservoir. This concept is now questioned. Antibodies to R. prowazeki have been reported in livestock in Africa, rats in Manila, and from flying squirrels and humans in the United States. R. prowazeki was recovered from blood specimens of goats, sheep, from ixodid ticks, louse, and flea-ectoparasites of flying squirrels, and tissues of flying squirrels. More than 20 cases of squirrel-related acute epidemic typhus have been reported in the United States. R. prowazeki has not been recovered from human cases. Chemical studies of R. prowazeki and R. typhi show genetic similarities but differences in genome size and degree of hybridization suggest that interconversions between the two agents do not occur rapidly in nature. It is proposed that, with time, their relatedness will become even closer. PMID:6817526

  11. Maternal CD4+ T cells protect against severe congenital cytomegalovirus disease in a novel nonhuman primate model of placental cytomegalovirus transmission.

    PubMed

    Bialas, Kristy M; Tanaka, Takayuki; Tran, Dollnovan; Varner, Valerie; Cisneros De La Rosa, Eduardo; Chiuppesi, Flavia; Wussow, Felix; Kattenhorn, Lisa; Macri, Sheila; Kunz, Erika L; Estroff, Judy A; Kirchherr, Jennifer; Yue, Yujuan; Fan, Qihua; Lauck, Michael; O'Connor, David H; Hall, Allison H S; Xavier, Alvarez; Diamond, Don J; Barry, Peter A; Kaur, Amitinder; Permar, Sallie R

    2015-11-01

    Elucidation of maternal immune correlates of protection against congenital cytomegalovirus (CMV) is necessary to inform future vaccine design. Here, we present a novel rhesus macaque model of placental rhesus CMV (rhCMV) transmission and use it to dissect determinants of protection against congenital transmission following primary maternal rhCMV infection. In this model, asymptomatic intrauterine infection was observed following i.v. rhCMV inoculation during the early second trimester in two of three rhCMV-seronegative pregnant females. In contrast, fetal loss or infant CMV-associated sequelae occurred in four rhCMV-seronegative pregnant macaques that were CD4(+) T-cell depleted at the time of inoculation. Animals that received the CD4(+) T-cell-depleting antibody also exhibited higher plasma and amniotic fluid viral loads, dampened virus-specific CD8(+) T-cell responses, and delayed production of autologous neutralizing antibodies compared with immunocompetent monkeys. Thus, maternal CD4(+) T-cell immunity during primary rhCMV infection is important for controlling maternal viremia and inducing protective immune responses that prevent severe CMV-associated fetal disease. PMID:26483473

  12. Maternal CD4+ T cells protect against severe congenital cytomegalovirus disease in a novel nonhuman primate model of placental cytomegalovirus transmission

    PubMed Central

    Bialas, Kristy M.; Tanaka, Takayuki; Tran, Dollnovan; Varner, Valerie; Cisneros De La Rosa, Eduardo; Chiuppesi, Flavia; Wussow, Felix; Kattenhorn, Lisa; Macri, Sheila; Kunz, Erika L.; Estroff, Judy A.; Kirchherr, Jennifer; Yue, Yujuan; Fan, Qihua; Lauck, Michael; O’Connor, David H.; Hall, Allison H. S.; Xavier, Alvarez; Diamond, Don J.; Barry, Peter A.; Kaur, Amitinder; Permar, Sallie R.

    2015-01-01

    Elucidation of maternal immune correlates of protection against congenital cytomegalovirus (CMV) is necessary to inform future vaccine design. Here, we present a novel rhesus macaque model of placental rhesus CMV (rhCMV) transmission and use it to dissect determinants of protection against congenital transmission following primary maternal rhCMV infection. In this model, asymptomatic intrauterine infection was observed following i.v. rhCMV inoculation during the early second trimester in two of three rhCMV-seronegative pregnant females. In contrast, fetal loss or infant CMV-associated sequelae occurred in four rhCMV-seronegative pregnant macaques that were CD4+ T-cell depleted at the time of inoculation. Animals that received the CD4+ T-cell–depleting antibody also exhibited higher plasma and amniotic fluid viral loads, dampened virus-specific CD8+ T-cell responses, and delayed production of autologous neutralizing antibodies compared with immunocompetent monkeys. Thus, maternal CD4+ T-cell immunity during primary rhCMV infection is important for controlling maternal viremia and inducing protective immune responses that prevent severe CMV-associated fetal disease. PMID:26483473

  13. Acute Pneumonia.

    PubMed

    Arshad, Hammad; Fasanya, Adebayo; Cheema, Tariq; Singh, Anil C

    2016-01-01

    Acute pneumonia is an active infection of the lungs that results when an individual at risk gets exposed to a particular microbiological pathogen. Acute pneumonia is the leading cause of death in the United States that is attributable to an infection. The risk factors, pathogenesis, and microbiological organisms involved differ if the pneumonia develops in the community versus health care-associated environment. The development of concise and comprehensive guidelines has led to an improvement in the management of the problem. However, the emergence of multidrug-resistant organisms and the increase in the percentage of elderly population keep mortality risk very substantial. PMID:26919676

  14. Crystal Structure of the Human Cytomegalovirus pUL50-pUL53 Core Nuclear Egress Complex Provides Insight into a Unique Assembly Scaffold for Virus-Host Protein Interactions.

    PubMed

    Walzer, Sascha A; Egerer-Sieber, Claudia; Sticht, Heinrich; Sevvana, Madhumati; Hohl, Katharina; Milbradt, Jens; Muller, Yves A; Marschall, Manfred

    2015-11-13

    Nuclear replication of cytomegalovirus relies on elaborate mechanisms of nucleocytoplasmic egress of viral particles. Thus, the role of two essential and conserved viral nuclear egress proteins, pUL50 and pUL53, is pivotal. pUL50 and pUL53 heterodimerize and form a core nuclear egress complex (NEC), which is anchored to the inner nuclear membrane and provides a scaffold for the assembly of a multimeric viral-cellular NEC. Here, we report the crystal structure of the pUL50-pUL53 heterodimer (amino acids 1-175 and 50-292, respectively) at 2.44 Å resolution. Both proteins adopt a globular fold with mixed α and β secondary structure elements. pUL53-specific features include a zinc-binding site and a hook-like N-terminal extension, the latter representing a hallmark element of the pUL50-pUL53 interaction. The hook-like extension (amino acids 59-87) embraces pUL50 and contributes 1510 Å(2) to the total interface area (1880 Å(2)). The pUL50 structure overall resembles the recently published NMR structure of the murine cytomegalovirus homolog pM50 but reveals a considerable repositioning of the very C-terminal α-helix of pUL50 upon pUL53 binding. pUL53 shows structural resemblance with the GHKL domain of bacterial sensory histidine kinases. A close examination of the crystal structure indicates partial assembly of pUL50-pUL53 heterodimers to hexameric ring-like structures possibly providing additional scaffolding opportunities for NEC. In combination, the structural information on pUL50-pUL53 considerably improves our understanding of the mechanism of HCMV nuclear egress. It may also accelerate the validation of the NEC as a unique target for developing a novel type of antiviral drug and improved options of broad-spectrum antiherpesviral therapy. PMID:26432641

  15. Safety and antidiarrheal activity of Priva adhaerens aqueous leaf extract in a murine model

    PubMed Central

    Nansunga, Miriam; Barasa, Ambrose; Abimana, Justus; Alele, Paul E.; Kasolo, Josephine

    2014-01-01

    Ethnopharmacological relevance Priva adhaerens (Forssk.) Chiov., a wildly growing plant, is reported in central Uganda to be an effective traditional remedy for diarrhea. The objective of this study was to provide a scientific basis for the ethnopharmacological utility of this plant whose aqueous leaf and shoot extract was evaluated for acute toxicity and antidiarrheal activity using a murine model. Materials and methods Acute toxicity of the aqueous leaf and shoot extract was assessed after determining the major phytochemicals present in the extract. The aqueous leaf and shoot extract was assayed against castor oil-induced diarrhea, transit time, and enteropooling, in comparison to loperamide, a standard drug. Results The oral LD50 value obtained for Priva adhaerens aqueous extract was greater than 5000 mg/kg in rats; the aqueous leaf and shoot extract possessed several important phytochemicals. Furthermore, the aqueous extract significantly, and dose-dependently, reduced frequency of stooling in castor oil-induced diarrhea, intestinal motility, and castor oil-induced enteropooling in rats. Conclusion This murine model shows that it is relatively safe to orally use the aqueous leaf and shoot extract of Priva adhaerens . The aqueous extract contains phytochemicals that are active for the treatment of diarrhea in a rat model. PMID:25304198