Science.gov

Sample records for ad dna synthesis

  1. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  2. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  3. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  4. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  5. Initiation of lymphocyte DNA synthesis.

    PubMed

    Coffman, F D; Fresa, K L; Cohen, S

    1991-01-01

    The initiation of DNA replication in T lymphocytes appears to be regulated by two distinct activities: one associated with proliferation which mediates initiation, and another associated with quiescence which blocks initiation. Activated lymphocytes and proliferating lymphoid cell lines produce an activity, termed ADR, which can initiate DNA replication in isolated, quiescent nuclei. ADR is heat-labile, has protease activity or interacts closely with a protease, and is distinct from the DNA polymerases. ADR activity is absent in quiescent lymphocytes and appears in mitogen-stimulated lymphocytes after IL-2 binding. The generation of active ADR appears to be mediated by phosphorylation of a precursor which is present in resting cells. Nuclei from mitogen-unresponsive lymphocytes fail to initiate DNA replication in response to ADR, of potential importance in the age-related decline of immunity. Quiescent lymphocytes lack ADR and synthesize an ADR-inhibitory activity. The ADR inhibitor is a heat-stable protein which suppresses the initiation of DNA synthesis, but is ineffective at suppressing elongation once DNA strand replication has begun. Nuclei from several neoplastic cell lines fail to respond to the ADR inhibitor, which may play a role in the continuous proliferation of these cells. At least one of these neoplastic cell lines produces both ADR and an inhibitory factor. These findings suggest that the regulation of proliferation is dependent on the balance between activating and inhibitory pathways. PMID:2005180

  6. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  7. RNA-Primed DNA Synthesis In Vitro

    PubMed Central

    Keller, Walter

    1972-01-01

    In vitro DNA synthesis on single-stranded circular DNA can be initiated by RNA primers. RNA chains are covalently extended by DNA polymerase II from KB cells and DNA polymerase I from Micrococcus luteus, but not by an RNA-dependent DNA polymerase from avian myeloblastosis virus. The reaction product consists of DNA chains with a piece of RNA at their 5′-ends, hydrogen bonded to the template DNA. The primer RNA is linked to the product DNA via a 3′:5′-phosphodiester bond, and can be specifically removed by ribonuclease H. The possible role of ribonuclease H in RNA-primed DNA synthesis in vivo is discussed. Images PMID:4338598

  8. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  9. Engineering microbial factories for synthesis of value-added products

    PubMed Central

    Du, Jing; Shao, Zengyi; Zhao, Huimin

    2011-01-01

    Microorganisms have become an increasingly important platform for the production of drugs, chemicals, and biofuels from renewable resources. Advances in protein engineering, metabolic engineering, and synthetic biology enable redesigning microbial cellular networks and fine-tuning physiological capabilities, thus generating industrially viable strains for the production of natural and unnatural value-added compounds. In this review, we describe the recent progress on engineering microbial factories for synthesis of valued-added products including alkaloids, terpenoids, flavonoids, polyketides, non-ribosomal peptides, biofuels, and chemicals. Related topics on lignocellulose degradation, sugar utilization, and microbial tolerance improvement will also be discussed. PMID:21526386

  10. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  11. Synthesis of a Potent Vinblastine: Rationally Designed Added Benign Complexity.

    PubMed

    Allemann, Oliver; Brutsch, Manuela; Lukesh, John C; Brody, Daniel M; Boger, Dale L

    2016-07-13

    Many natural products, including vinblastine, have not been easily subjected to simplifications in their structures by synthetic means or modifications by late-stage semisynthetic derivatization in ways that enhance their biological potency. Herein, we detail a synthetic vinblastine that incorporates added benign complexity (ABC), which improves activity 10-fold, and is now accessible as a result of advances in the total synthesis of the natural product. The compound incorporates designed added molecular complexity but no new functional groups and maintains all existing structural and conformational features of the natural product. It constitutes a member of an analogue class presently inaccessible by semisynthetic derivatization of the natural product, by its late-stage functionalization, or by biosynthetic means. Rather, it was accessed by synthetic means, using an appropriately modified powerful penultimate single-step vindoline-catharanthine coupling strategy that proceeds with a higher diastereoselectivity than found for the natural product itself. PMID:27356080

  12. DNA Nanoparticles for Improved Protein Synthesis In Vitro.

    PubMed

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas; Mazutis, Linas

    2016-02-24

    The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 10(4)  clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription-translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro.

  13. Patterns of DNA synthesis during pollen embryogenesis in henbane.

    PubMed

    Raghavan, V

    1977-05-01

    Continued DNA synthesis in the generative cell nucleus, followed by mitosis and cytokinesis, results in the formation of pollen embryoids in cultured anthers of H. niger. In contrast, the nucleus of the vegetative cell undergoes no DNA synthesis after it is cut off, or synthesizes DNA only during a limited number of cell cycles. DNA synthetic patterns in the generative and vegetative cell nuclei confirm the ontogeny of embryoids described in this plant.

  14. Chemoenzymatic synthesis and antibody detection of DNA glycoconjugates.

    PubMed

    Wang, Yingli; Sheppard, Terry L

    2003-01-01

    A chemoenzymatic approach for the efficient synthesis of DNA-carbohydrate conjugates was developed and applied to an antibody-based strategy for the detection of DNA glycoconjugates. A phosphoramidite derivative of N-acetylglucosamine (GlcNAc) was synthesized and utilized to attach GlcNAc sugars to the 5'-terminus of DNA oligonucleotides by solid-phase DNA synthesis. The resulting GlcNAc-DNA conjugates were used as substrates for glycosyl transferase enzymes to synthesize DNA glycoconjugates. Treatment of GlcNAc-DNA with beta-1,4-galactosyl transferase (GalT) and UDP-Gal produced N-acetyllactosamine-modified DNA (LacNAc-DNA), which could be converted quantitatively to the trisaccharide Lewis X (LeX)-DNA conjugate by alpha-1,3-fucosyltransferase VI (FucT) and GDP-Fuc. The facile enzymatic synthesis of LeX-DNA from GlcNAc-DNA also was accomplished in a one-pot reaction by the combined action of GalT and FucT. The resulting glycoconjugates were characterized by gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), and glycosidase digestion experiments. Covalent modification of the 5'-terminus of DNA with carbohydrates did not interfere with the ability of DNA glycoconjugates to hybridize with complementary DNA, as indicated by UV thermal denaturation analysis. The trisaccharide DNA glycoconjugate, LeX-DNA, was detected by a dual DNA hybridization/monoclonal antibody (mAb) detection protocol ("Southwestern"): membrane-immobilized LeX-DNA was visualized by Southern detection with a radiolabeled complementary DNA probe and by Western chemiluminescence detection with a mAb specific for the LeX antigen. The efficient chemoenzymatic synthesis of DNA glycoconjugates and the Southwestern detection protocol may facilitate the application of glycosylated DNA to cellular targeting and DNA glycoconjugate detection strategies. PMID:14624649

  15. Chemoenzymatic synthesis and antibody detection of DNA glycoconjugates.

    PubMed

    Wang, Yingli; Sheppard, Terry L

    2003-01-01

    A chemoenzymatic approach for the efficient synthesis of DNA-carbohydrate conjugates was developed and applied to an antibody-based strategy for the detection of DNA glycoconjugates. A phosphoramidite derivative of N-acetylglucosamine (GlcNAc) was synthesized and utilized to attach GlcNAc sugars to the 5'-terminus of DNA oligonucleotides by solid-phase DNA synthesis. The resulting GlcNAc-DNA conjugates were used as substrates for glycosyl transferase enzymes to synthesize DNA glycoconjugates. Treatment of GlcNAc-DNA with beta-1,4-galactosyl transferase (GalT) and UDP-Gal produced N-acetyllactosamine-modified DNA (LacNAc-DNA), which could be converted quantitatively to the trisaccharide Lewis X (LeX)-DNA conjugate by alpha-1,3-fucosyltransferase VI (FucT) and GDP-Fuc. The facile enzymatic synthesis of LeX-DNA from GlcNAc-DNA also was accomplished in a one-pot reaction by the combined action of GalT and FucT. The resulting glycoconjugates were characterized by gel electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), and glycosidase digestion experiments. Covalent modification of the 5'-terminus of DNA with carbohydrates did not interfere with the ability of DNA glycoconjugates to hybridize with complementary DNA, as indicated by UV thermal denaturation analysis. The trisaccharide DNA glycoconjugate, LeX-DNA, was detected by a dual DNA hybridization/monoclonal antibody (mAb) detection protocol ("Southwestern"): membrane-immobilized LeX-DNA was visualized by Southern detection with a radiolabeled complementary DNA probe and by Western chemiluminescence detection with a mAb specific for the LeX antigen. The efficient chemoenzymatic synthesis of DNA glycoconjugates and the Southwestern detection protocol may facilitate the application of glycosylated DNA to cellular targeting and DNA glycoconjugate detection strategies.

  16. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  17. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  18. Oxidative DNA damage in peripheral leukocytes of mild cognitive impairment and AD patients.

    PubMed

    Migliore, L; Fontana, I; Trippi, F; Colognato, R; Coppedè, F; Tognoni, G; Nucciarone, B; Siciliano, G

    2005-05-01

    It is well established that oxidative stress plays a key role in the degenerative neuronal death and progression of Alzheimer's disease (AD), although it is not clear if it is the primary triggering event in the pathogenesis of this disorder. Mild cognitive impairment (MCI) is a clinical condition between normal aging and AD, characterized by a memory deficit without loss of general cognitive and functional abilities. We performed this study by a comet assay analysis to evaluate the level of primary and oxidative DNA damage in two groups of MCI and AD patients, compared to healthy controls. Data showed a significantly higher level of primary DNA damage in leukocytes of AD and also of MCI patients compared to control individuals (average: 2.09+/-0.79 and 2.47+/-1.01, respectively for AD and MCI, versus 1.04+/-0.31 in controls). Moreover, the amount of oxidised DNA bases (both purines and pyrimidines) was significatively higher in the two groups of patients (AD and MCI) compared to controls. Our results give a further indication that oxidative stress, at least at the DNA level, is an earlier event in the pathogenesis of AD.

  19. Dual roles for DNA polymerase eta in homologous DNA recombination and translesion DNA synthesis.

    PubMed

    Kawamoto, Takuo; Araki, Kasumi; Sonoda, Eiichiro; Yamashita, Yukiko M; Harada, Kouji; Kikuchi, Koji; Masutani, Chikahide; Hanaoka, Fumio; Nozaki, Kazuhiko; Hashimoto, Nobuo; Takeda, Shunichi

    2005-12-01

    Chicken B lymphocyte precursors and DT40 cells diversify their immunoglobulin-variable (IgV) genes through homologous recombination (HR)-mediated Ig gene conversion. To identify DNA polymerases that are involved in Ig gene conversion, we created DT40 clones deficient in DNA polymerase eta (poleta), which, in humans, is defective in the variant form of xeroderma pigmentosum (XP-V). Poleta is an error-prone translesion DNA synthesis polymerase that can bypass UV damage-induced lesions and is involved in IgV hypermutation. Like XP-V cells, poleta-disrupted (poleta) clones exhibited hypersensitivity to UV. Remarkably, poleta cells showed a significant decrease in the frequency of both Ig gene conversion and double-strand break-induced HR when compared to wild-type cells, and these defects were reversed by complementation with human poleta. Our findings identify a DNA polymerase that carries out DNA synthesis for physiological HR and provides evidence that a single DNA polymerase can play multiple cellular roles. PMID:16337602

  20. DNA sequencing by synthesis based on elongation delay detection

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2015-03-01

    The one of most important problem in modern genetics, biology and medicine is determination of the primary nucleotide sequence of the DNA of living organisms (DNA sequencing). This paper describes the label-free DNA sequencing approach, based on the observation of a discrete dynamics of DNA sequence elongation phase. The proposed DNA sequencing principle are studied by numerical simulation. The numerical model for proposed label-free DNA sequencing approach is based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) and dynamics of nucleotides incorporation to rising DNA strand. The estimates for number of copied DNA sequences for required probability of nucleotide incorporation event detection and correct DNA sequence determination was obtained. The proposed approach can be applied at all known DNA sequencing devices with "sequencing by synthesis" principle of operation.

  1. Apicobasal gradient of chloroplast DNA synthesis and distribution in Acetabularia.

    PubMed

    Hoursiangou-Neubrun, D; Lüttke, A; Arapis, G; Puiseux-Dao, S; Bonotto, S

    1982-01-01

    Autoradiographic and biochemical experiments have revealed the presence, in vegetative cells of Acetabularia, of an apicobasal gradient of penetration and incorporation of labelled DNA precursors into the chloroplasts. Staining of chloroplasts with the DNA-specific fluorochrome DAPI has shown that the number of chloroplasts without DNA increases from the apex towards the base of the cell. All together, our findings support the existence of an apicobasal gradient of chloroplast DNA synthesis and distribution in Acetabularia.

  2. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  3. De novo DNA synthesis using single molecule PCR

    PubMed Central

    Yehezkel, Tuval Ben; Linshiz, Gregory; Buaron, Hen; Kaplan, Shai; Shabi, Uri; Shapiro, Ehud

    2008-01-01

    The throughput of DNA reading (sequencing) has dramatically increased recently due to the incorporation of in vitro clonal amplification. The throughput of DNA writing (synthesis) is trailing behind, with cloning and sequencing constituting the main bottleneck. To overcome this bottleneck, an in vitro alternative for in vivo DNA cloning must be integrated into DNA synthesis methods. Here we show how a new single molecule PCR (smPCR)-based procedure can be employed as a general substitute to in vivo cloning thereby allowing for the first time in vitro DNA synthesis. We integrated this rapid and high fidelity in vitro procedure into our earlier recursive DNA synthesis and error correction procedure and used it to efficiently construct and error-correct a 1.8-kb DNA molecule from synthetic unpurified oligos completely in vitro. Although we demonstrate incorporating smPCR in a particular method, the approach is general and can be used in principle in conjunction with other DNA synthesis methods as well. PMID:18667587

  4. Effect of epidermal growth factor (EGF) on (/sup 3/H)TdR incorporation into DNA in ad lib fed and fasted CD2F1 mice

    SciTech Connect

    Scheving, L.A.; Tsai, T.H.; Scheving, L.E.; Hoke, W.S.

    1987-03-01

    The effect of EGF on the incorporation of (/sup 3/H)TdR into DNA (DNA synthesis) was determined in the esophagus, liver, pancreas, and kidney in mice standardized to 12 hours (hr) of light alternating with 12 hr of darkness. A question asked was whether intraperitoneally administered EGF could alter the circadian patterns of DNA synthesis in these organs. The most marked effects of EGF were: an increase in DNA synthesis but only after a specific duration of time after treatment, ranging from 8 to 23 hr, which differed for each tissue, a similarity in the response of the esophagus in both ad lib fed and fasted mice, but not in the response of the liver, where the stimulatory effect of EGF observed in fed mice was dramatically reduced in fasted ones, and an advance in the phasing of the circadian rhythm in DNA synthesis of the esophagus by about 12 hr. In addition, no sex differences in fasted animals were found under the conditions of this study.

  5. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-01

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  6. Adélie Penguin Population Diet Monitoring by Analysis of Food DNA in Scats

    PubMed Central

    Jarman, Simon N.; McInnes, Julie C.; Faux, Cassandra; Polanowski, Andrea M.; Marthick, James; Deagle, Bruce E.; Southwell, Colin; Emmerson, Louise

    2013-01-01

    The Adélie penguin is the most important animal currently used for ecosystem monitoring in the Southern Ocean. The diet of this species is generally studied by visual analysis of stomach contents; or ratios of isotopes of carbon and nitrogen incorporated into the penguin from its food. There are significant limitations to the information that can be gained from these methods. We evaluated population diet assessment by analysis of food DNA in scats as an alternative method for ecosystem monitoring with Adélie penguins as an indicator species. Scats were collected at four locations, three phases of the breeding cycle, and in four different years. A novel molecular diet assay and bioinformatics pipeline based on nuclear small subunit ribosomal RNA gene (SSU rDNA) sequencing was used to identify prey DNA in 389 scats. Analysis of the twelve population sample sets identified spatial and temporal dietary change in Adélie penguin population diet. Prey diversity was found to be greater than previously thought. Krill, fish, copepods and amphipods were the most important food groups, in general agreement with other Adélie penguin dietary studies based on hard part or stable isotope analysis. However, our DNA analysis estimated that a substantial portion of the diet was gelatinous groups such as jellyfish and comb jellies. A range of other prey not previously identified in the diet of this species were also discovered. The diverse prey identified by this DNA-based scat analysis confirms that the generalist feeding of Adélie penguins makes them a useful indicator species for prey community composition in the coastal zone of the Southern Ocean. Scat collection is a simple and non-invasive field sampling method that allows DNA-based estimation of prey community differences at many temporal and spatial scales and provides significant advantages over alternative diet analysis approaches. PMID:24358158

  7. Adélie penguin population diet monitoring by analysis of food DNA in scats.

    PubMed

    Jarman, Simon N; McInnes, Julie C; Faux, Cassandra; Polanowski, Andrea M; Marthick, James; Deagle, Bruce E; Southwell, Colin; Emmerson, Louise

    2013-01-01

    The Adélie penguin is the most important animal currently used for ecosystem monitoring in the Southern Ocean. The diet of this species is generally studied by visual analysis of stomach contents; or ratios of isotopes of carbon and nitrogen incorporated into the penguin from its food. There are significant limitations to the information that can be gained from these methods. We evaluated population diet assessment by analysis of food DNA in scats as an alternative method for ecosystem monitoring with Adélie penguins as an indicator species. Scats were collected at four locations, three phases of the breeding cycle, and in four different years. A novel molecular diet assay and bioinformatics pipeline based on nuclear small subunit ribosomal RNA gene (SSU rDNA) sequencing was used to identify prey DNA in 389 scats. Analysis of the twelve population sample sets identified spatial and temporal dietary change in Adélie penguin population diet. Prey diversity was found to be greater than previously thought. Krill, fish, copepods and amphipods were the most important food groups, in general agreement with other Adélie penguin dietary studies based on hard part or stable isotope analysis. However, our DNA analysis estimated that a substantial portion of the diet was gelatinous groups such as jellyfish and comb jellies. A range of other prey not previously identified in the diet of this species were also discovered. The diverse prey identified by this DNA-based scat analysis confirms that the generalist feeding of Adélie penguins makes them a useful indicator species for prey community composition in the coastal zone of the Southern Ocean. Scat collection is a simple and non-invasive field sampling method that allows DNA-based estimation of prey community differences at many temporal and spatial scales and provides significant advantages over alternative diet analysis approaches.

  8. Inhibition of DNA-dependent RNA synthesis by 8-methoxypsoralen.

    PubMed

    Gniazdowski, M; Czyz, M; Wilmańska, D; Studzian, K; Frasunek, M; Płucienniczak, A; Szmigiero, L

    1988-09-01

    The effect of the photobinding of 8-methoxypsoralen to phage T7 DNA on different steps of RNA synthesis in vitro was assayed. Total RNA synthesis is reduced to a few percent and the transcript size is decreased, as shown by means of gel filtration on a Sepharose 4B column when DNA of the adduct content of six drug molecules per 10(3) nucleotides is used. The initiation of RNA chains seems to be less affected, as inferred from an abortive initiation assay. Synthesis of pppApU on DNA of the same adduct content is inhibited to 34% of the corresponding controls, while the overall RNA synthesis is inhibited to 6%. The amount of the enzyme needed for maximal retention of DNA, the kinetics of its binding and the decay of the polymerase-DNA complex at high ionic strength (or on decrease of the temperature) are similar with DNA either irradiated in the absence of the drug or DNA bearing six 8-methoxypsoralen molecules per 10(3) nucleotides. It is concluded from this study that 8-methoxypsoralen partially inhibits initiation and blocks movement of RNA polymerase along the template, inducing premature termination. It does not appear to influence the binding of the enzyme to DNA. PMID:3048406

  9. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  10. Amiloride inhibits rat mucosal ornithine decarboxylase activity and DNA synthesis

    SciTech Connect

    Ulrich-Baker, M.G.; Wang, P.; Fitzpatrick, L.; Johnson, L.R. )

    1988-03-01

    Refeeding fasted rats induces a dramatic trophic response in gastrointestinal mucosa and is associated with elevations in both rate of DNA synthesis and ornithine decarboxylase (ODC) activity. The signal for these increases is unknown. Amiloride prevents cell alkalinization by blocking Na{sup +}-H{sup +} exchange at apical epithelial cell membranes. In study 1, rats were fasted 48 h, treated with amiloride (0.5 to 500 mg/kg), and refed for 4 h. Refeeding increased ODC activities in the jejunal mucosa (X8) and liver (X19) but not in the oxyntic gland mucosa. In the jejunum, but not the liver, the activation of ODC was completely abolished by 100 mg/kg amiloride. In study 2, the rate of DNA synthesis was determine by measuring the rate of ({sup 3}H)thymidine incorporation 16 h after refeeding. Refeeding resulted in significantly increased rates of DNA synthesis over fasted levels, and amiloride at 100 mg/kg significantly reduced the elevations in the jejenum and liver. In conclusion, amiloride inhibits the postprandial increases in jejunal ODC activity and DNA synthesis in the jejunum and liver. The results indicate that (1) the Na{sup +}-H{sup +} antiport is essential to the increased ODC activity in the jejunum and liver after a meal and (2) increases in DNA synthesis and their suppression by amiloride are not necessary linked to ODC activity.

  11. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    PubMed

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis.

  12. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ

    PubMed Central

    Copeland, William C.; Kasiviswanathan, Rajesh; Longley, Matthew J.

    2016-01-01

    Summary Mitochondrial DNA is replicated by the nuclear encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand crosslinks from chemotherapy agents. Although many of these lesions block DNA replication, Pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by Pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  13. Unscheduled synthesis of DNA and poly(ADP-ribose) in human fibroblasts following DNA damage

    SciTech Connect

    McCurry, L.S.; Jacobson, M.K.

    1981-01-01

    Unscheduled DNA synthesis has been measured in human fibroblasts under conditions of reduced rates of conversion of NAD to poly)ADP-ribose). Cells heterozygous for the xeroderma pigmentosum genotype showed normal rates of uv induced unscheduled DNA synthesis under conditions in which the rate of poly(ADP-ribose) synthesis was one-half the rate of normal cells. The addition of theophylline, a potent inhibitor of poly(ADP-ribose) polymerase, to the culture medium of normal cells blocked over 90% of the conversion of NAD to poly(ADP-ribose) following treatment with uv or N-methyl-N'-nitro-N-nitro-soguanidine but did not affect the rate of unscheduled DNA synthesis.

  14. Adhoc: an R package to calculate ad hoc distance thresholds for DNA barcoding identification.

    PubMed

    Sonet, Gontran; Jordaens, Kurt; Nagy, Zoltán T; Breman, Floris C; De Meyer, Marc; Backeljau, Thierry; Virgilio, Massimiliano

    2013-12-30

    Identification by DNA barcoding is more likely to be erroneous when it is based on a large distance between the query (the barcode sequence of the specimen to identify) and its best match in a reference barcode library. The number of such false positive identifications can be decreased by setting a distance threshold above which identification has to be rejected. To this end, we proposed recently to use an ad hoc distance threshold producing identifications with an estimated relative error probability that can be fixed by the user (e.g. 5%). Here we introduce two R functions that automate the calculation of ad hoc distance thresholds for reference libraries of DNA barcodes. The scripts of both functions, a user manual and an example file are available on the JEMU website (http://jemu.myspecies.info/computer-programs) as well as on the comprehensive R archive network (CRAN, http://cran.r-project.org).

  15. Adhoc: an R package to calculate ad hoc distance thresholds for DNA barcoding identification

    PubMed Central

    Sonet, Gontran; Jordaens, Kurt; Nagy, Zoltán T.; Breman, Floris C.; De Meyer, Marc; Backeljau, Thierry; Virgilio, Massimiliano

    2013-01-01

    Abstract Identification by DNA barcoding is more likely to be erroneous when it is based on a large distance between the query (the barcode sequence of the specimen to identify) and its best match in a reference barcode library. The number of such false positive identifications can be decreased by setting a distance threshold above which identification has to be rejected. To this end, we proposed recently to use an ad hoc distance threshold producing identifications with an estimated relative error probability that can be fixed by the user (e.g. 5%). Here we introduce two R functions that automate the calculation of ad hoc distance thresholds for reference libraries of DNA barcodes. The scripts of both functions, a user manual and an example file are available on the JEMU website (http://jemu.myspecies.info/computer-programs) as well as on the comprehensive R archive network (CRAN, http://cran.r-project.org). PMID:24453565

  16. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  17. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  18. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

    PubMed

    MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

    2015-09-14

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR

  19. D-ribose inhibits DNA repair synthesis in human lymphocytes

    SciTech Connect

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  20. An efficient synthesis method targeted to marine alkaloids marinacarbolines A-D and their antitumor activities.

    PubMed

    Li, Jun; Tang, Yang; Jin, Hui-Juan; Cui, Yi-Di; Zhang, Li-Juan; Jiang, Tao

    2015-01-01

    Marinacarbolines A-D are a series of marine β-carboline alkaloids isolated from actinomycete Marinactinospora thermotolerans of the deep South China Sea with antiplasmodial activities. In inhibition assays of in vitro growth of Plasmodium falciparum, marinacarbolines exhibited antiplasmodial activity against drug-sensitive line 3D7 and drug-resistant line Dd2 of P. falciparum. However, approaches for the synthesis of such useful compounds are very limited. In this work, we reported a simple, efficient, and versatile process to synthesize marinacarbolines A-D (1-4). On the basis of that, the antitumor activities of marinacarbolines in a structure-dependent manner were allowed to be unveiled.

  1. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  2. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  3. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  4. ATP-Releasing Nucleotides: Linking DNA Synthesis to Luciferase Signaling.

    PubMed

    Ji, Debin; Mohsen, Michael G; Harcourt, Emily M; Kool, Eric T

    2016-02-01

    A new strategy is reported for the production of luminescence signals from DNA synthesis through the use of chimeric nucleoside tetraphosphate dimers in which ATP, rather than pyrophosphate, is the leaving group. ATP-releasing nucleotides (ARNs) were synthesized as derivatives of the four canonical nucleotides. All four derivatives are good substrates for DNA polymerase, with Km values averaging 13-fold higher than those of natural dNTPs, and kcat values within 1.5-fold of those of native nucleotides. Importantly, ARNs were found to yield very little background signal with luciferase. DNA synthesis experiments show that the ATP byproduct can be harnessed to elicit a chemiluminescence signal in the presence of luciferase. When using a polymerase together with the chimeric nucleotides, target DNAs/RNAs trigger the release of stoichiometrically large quantities of ATP, thereby allowing sensitive isothermal luminescence detection of nucleic acids as diverse as phage DNAs and short miRNAs.

  5. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  6. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  7. Rates of evolution in ancient DNA from Adélie penguins.

    PubMed

    Lambert, D M; Ritchie, P A; Millar, C D; Holland, B; Drummond, A J; Baroni, C

    2002-03-22

    Well-preserved subfossil bones of Adélie penguins, Pygoscelis adeliae, underlie existing and abandoned nesting colonies in Antarctica. These bones, dating back to more than 7000 years before the present, harbor some of the best-preserved ancient DNA yet discovered. From 96 radiocarbon-aged bones, we report large numbers of mitochondrial haplotypes, some of which appear to be extinct, given the 380 living birds sampled. We demonstrate DNA sequence evolution through time and estimate the rate of evolution of the hypervariable region I using a Markov chain Monte Carlo integration and a least-squares regression analysis. Our calculated rates of evolution are approximately two to seven times higher than previous indirect phylogenetic estimates.

  8. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  9. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  10. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis.

  11. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.

    1986-01-01

    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  12. Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

    PubMed

    Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

    2014-08-01

    In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence.

  13. 'Shotgun DNA synthesis' for the high-throughput construction of large DNA molecules.

    PubMed

    Kim, Hwangbeom; Han, Hyojun; Ahn, Jinwoo; Lee, Joongoo; Cho, Namjin; Jang, Hoon; Kim, Hyoki; Kwon, Sunghoon; Bang, Duhee

    2012-10-01

    We developed a highly scalable 'shotgun' DNA synthesis technology by utilizing microchip oligonucleotides, shotgun assembly and next-generation sequencing technology. A pool of microchip oligonucleotides targeting a penicillin biosynthetic gene cluster were assembled into numerous random fragments, and tagged with 20 bp degenerate barcode primer pairs. An optimal set of error-free fragments were identified by high-throughput DNA sequencing, selectively amplified using the barcode sequences, and successfully assembled into the target gene cluster.

  14. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates.

  15. A complex between replication factor A (SSB) and DNA helicase stimulates DNA synthesis of DNA polymerase alpha on double-stranded DNA.

    PubMed

    Zhang, S; Grosse, F

    1992-11-01

    A helicase-like DNA unwinding activity was found in highly purified fractions of the calf thymus single-stranded DNA binding protein (ctSSB), also known as replication protein A (RP-A) or replication factor A (RF-A). This activity depended on the hydrolysis of ATP or dATP, and used CTP with a lower efficiency. ctSSB promoted the homologous DNA polymerase alpha to perform DNA synthesis on double-stranded templates containing replication fork-like structures. The rate and amount of DNA synthesis was found to be dependent on the concentration of ctSSB. At a 10-fold mass excess of ctSSB over double-stranded DNA, products of 200-600 nucleotides in length were obtained. This comprises or even exceeds the length of a eukaryotic Okazaki fragment. The ctSSB-associated DNA helicase activity is most likely a distinct protein rather than an inherent property of SSB, as inferred from titration experiments between SSB and DNA. The association of a helicase with SSB and the stimulatory action of this complex to the DNA polymerase alpha-catalyzed synthesis of double-stranded DNA suggests a cooperative function of the three enzymatic activities in the process of eukaryotic DNA replication.

  16. Mechanism of translesion DNA synthesis by DNA polymerase II. Comparison to DNA polymerases I and III core.

    PubMed

    Paz-Elizur, T; Takeshita, M; Goodman, M; O'Donnell, M; Livneh, Z

    1996-10-01

    Bypass synthesis by DNA polymerase II was studied using a synthetic 40-nucleotide-long gapped duplex DNA containing a site-specific abasic site analog, as a model system for mutagenesis associated with DNA lesions. Bypass synthesis involved a rapid polymerization step terminating opposite the nucleotide preceding the lesion, followed by a slow bypass step. Bypass was found to be dependent on polymerase and dNTP concentrations, on the DNA sequence context, and on the size of the gap. A side-by-side comparison of DNA polymerases I, II, and III core revealed the following. 1) Each of the three DNA polymerases bypassed the abasic site analog unassisted by other proteins. 2) In the presence of physiological-like salt conditions, only DNA polymerase II bypassed the lesion. 3) Bypass by each of the three DNA polymerases increased dramatically in the absence of proofreading. These results support a model (Tomer, G., Cohen-Fix, O. , O'Donnell, M., Goodman, M. and Livneh, Z. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1376-1380) by which the RecA, UmuD, and UmuC proteins are accessory factors rather than being absolutely required for the core mutagenic bypass reaction in induced mutagenesis in Escherichia coli.

  17. Microbial chemical factories: recent advances in pathway engineering for synthesis of value added chemicals.

    PubMed

    Dhamankar, Himanshu; Prather, Kristala L J

    2011-08-01

    The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors.

  18. Synthesis of DNA and Poly(Adenosine Diphosphate Ribose) in Normal and Chronic Lymphocytic Leukemia Lymphocytes

    PubMed Central

    Berger, Nathan A.; Adams, Jessie W.; Sikorski, Georgina W.; Petzold, Shirley J.; Shearer, William T.

    1978-01-01

    Peripheral blood lymphocytes were isolated from 9 patients with chronic lymphocytic leukemia (CLL) and 12 normal control donors. The cells were assayed for synthesis of DNA and poly-(adenosine diphosphate ribose) (poly[ADPR]) immediately after isolation and on successive days following their treatment with phytohemagglutinin (PHA). Two different techniques were used to measure DNA synthesis. In the standard technique, DNA synthesis was measured by incubating intact cells with [3H]deoxythymidine. In the new technique, the lymphocytes were first rendered permeable to nucleotides, then DNA synthesis was measured by incubating them with [3H]deoxythymidine triphosphate in the presence of deoxyATP, deoxyGTP, deoxyCTP, ATP, and Mg++. Both assays showed the anticipated rise in DNA synthesis after PHA stimulation of normal cells. PHA-stimulated lymphocytes from patients with CLL demonstrated low levels of DNA synthesis in both assay systems. The initial levels of poly(ADPR) synthesis were greater in CLL lymphocytes than in normal cells. Studies with a T-cell-depleted population of normal cells showed the same activity for poly(ADPR) synthesis that was demonstrated by the original population of normal cells. PHA stimulation produced an increase in poly(ADPR) synthesis in both the normal and CLL cells. The increase in poly(ADPR) synthesis in normal cells was coincident with the increase in DNA synthesis. The increase in poly(ADPR) synthesis in the CLL cells was dissociated from the delayed and diminished increase in DNA synthesis. Thus, CLL cells have higher than normal initial levels of poly(ADPR) synthesis. Poly(ADPR) synthesis is dissociated from DNA synthesis in CLL cells whereas it varies directly with DNA synthesis in normal lymphocytes. PMID:659624

  19. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA.

  20. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  1. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  2. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored.

  3. Autonomously Propelled Motors for Value-Added Product Synthesis and Purification.

    PubMed

    Srivastava, Sarvesh K; Schmidt, Oliver G

    2016-06-27

    A proof-of-concept design for autonomous, self-propelling motors towards value-added product synthesis and separation is presented. The hybrid motor design consists of two distinct functional blocks. The first, a sodium borohydride (NaBH4 ) granule, serves both as a reaction prerequisite for the reduction of vanillin and also as a localized solid-state fuel in the reaction mixture. The second capping functional block consisting of a graphene-polymer composite serves as a hydrophobic matrix to attract the reaction product vanillyl alcohol (VA), resulting in facile separation of this edible value-added product. These autonomously propelled motors were fabricated at a length scale down to 400 μm, and once introduced in the reaction environment showed rapid bubble-propulsion followed by high-purity separation of the reaction product (VA) by the virtue of the graphene-polymer cap acting as a mesoporous sponge. The concept has excellent potential towards the synthesis/isolation of industrially important compounds, affinity-based product separation, pollutant remediation (such as heavy metal chelation/adsorption), as well as localized fuel-gradients as an alternative to external fuel dependency. PMID:27123788

  4. Autonomously Propelled Motors for Value-Added Product Synthesis and Purification.

    PubMed

    Srivastava, Sarvesh K; Schmidt, Oliver G

    2016-06-27

    A proof-of-concept design for autonomous, self-propelling motors towards value-added product synthesis and separation is presented. The hybrid motor design consists of two distinct functional blocks. The first, a sodium borohydride (NaBH4 ) granule, serves both as a reaction prerequisite for the reduction of vanillin and also as a localized solid-state fuel in the reaction mixture. The second capping functional block consisting of a graphene-polymer composite serves as a hydrophobic matrix to attract the reaction product vanillyl alcohol (VA), resulting in facile separation of this edible value-added product. These autonomously propelled motors were fabricated at a length scale down to 400 μm, and once introduced in the reaction environment showed rapid bubble-propulsion followed by high-purity separation of the reaction product (VA) by the virtue of the graphene-polymer cap acting as a mesoporous sponge. The concept has excellent potential towards the synthesis/isolation of industrially important compounds, affinity-based product separation, pollutant remediation (such as heavy metal chelation/adsorption), as well as localized fuel-gradients as an alternative to external fuel dependency.

  5. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach.

  6. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  7. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  8. EDTA chelation therapy, without added vitamin C, decreases oxidative DNA damage and lipid peroxidation.

    PubMed

    Roussel, Anne Marie; Hininger-Favier, Isabelle; Waters, Robert S; Osman, Mireille; Fernholz, Karen; Anderson, Richard A

    2009-03-01

    Chelation therapy is thought to not only remove contaminating metals but also to decrease free radical production. However, in standard ethylene diamine tetracetic acid (EDTA) chelation therapy, high doses of vitamin C with potential pro-oxidant effects are often added to the chelation solution. The authors demonstrated previously that the intravenous administration of the standard chelation cocktail, containing high amounts of vitamin C, resulted in an acute transitory pro-oxidant burst that should be avoided in the treatment of pathologies at risk of increased oxidative stress such as diabetes and cardiovascular disease. The current study was designed to determine the acute and chronic biochemical effects of chelation therapy on accepted clinical, antioxidant variables. An EDTA chelation cocktail not containing ascorbic acid was administered to six adult patients for five weeks (10 sessions of chelation therapy); antioxidant indicators were monitored. Immediately after the initial chelation session, in contrast with the data previously reported with the standard cocktail containing high doses of vitamin C, none of the oxidative stress markers were adversely modified. After five weeks, plasma peroxide levels, monitored by malondialdehyde, decreased by 20 percent, and DNA damage, monitored by formamidopyrimidine-DNA glycosylase (Fpg) sensitive sites, decreased by 22 percent. Remaining antioxidant-related variables did not change. In summary, this study demonstrates that multiple sessions of EDTA chelation therapy in combination with vitamins and minerals, but without added ascorbic acid, decreases oxidative stress. These results should be beneficial in the treatment of diseases associated with increased oxidative stress such as diabetes and cardiovascular diseases.

  9. A DNA-hairpin model for repeat-addition processivity in telomere synthesis.

    PubMed

    Yang, Wei; Lee, Young-Sam

    2015-11-01

    We propose a DNA-hairpin model for the processivity of telomeric-repeat addition. Concomitantly with template-RNA translocation after each repeat synthesis, the complementary DNA repeat, for example, AGGGTT, loops out in a noncanonical base-paired hairpin, thus freeing the RNA template for the next round of repeat synthesis. The DNA hairpin is temporarily stabilized by telomerase and the incoming dGTP but becomes realigned for processive telomere synthesis.

  10. Reovirus inhibition of cellular DNA synthesis: role of the S1 gene.

    PubMed

    Sharpe, A H; Fields, B N

    1981-04-01

    Type 3 reovirus inhibits L cell DNA synthesis, whereas type 1 reovirus exerts little or no effect on L cell DNA synthesis. By using recombinant viruses containing both type 1 and type 3 double-standard RNA segments, we determined that one double-stranded RNA segment, the reovirus type 3 S1 double-stranded RNA segment which encodes the viral hemagglutinin, segregates with and is responsible for the capacity of reovirus type 3 to inhibit L cell DNA synthesis.

  11. Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA.

    PubMed

    Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

    2013-08-28

    Most deoxyribozymes (DNA catalysts) require metal ions as cofactors for catalytic activity, with Mg(2+), Mn(2+), and Zn(2+) being the most represented activators. Trivalent transition-metal ions have been less frequently considered. Rare earth ions offer attractive properties for studying metal ion binding by biochemical and spectroscopic methods. Here we report the effect of lanthanide cofactors, in particular terbium (Tb(3+)), for DNA-catalyzed synthesis of 2',5'-branched RNA. We found up to 10(4)-fold increased ligation rates for the 9F7 deoxribozyme using 100 μM Tb(3+) and 7 mM Mg(2+), compared to performing the reaction with 7 mM Mg(2+) alone. Combinatorial mutation interference analysis (CoMA) was used to identify nucleotides in the catalytic region of 9F7 that are essential for ligation activity with different metal ion combinations. A minimized version of the DNA enzyme sustained high levels of Tb(3+)-assisted activity. Sensitized luminescence of Tb(3+) bound to DNA in combination with DMS probing and DNase I footprinting results supported the CoMA data. The accelerating effect of Tb(3+) was confirmed for related RNA-ligating deoxyribozymes, pointing toward favorable activation of internal 2'-OH nucleophiles. The results of this study offer fundamental insights into nucleotide requirements for DNA-catalyzed RNA ligation and will be beneficial for practical applications that utilize 2',5'-branched RNA.

  12. Thermodynamic impact of abasic sites on simulated translesion DNA synthesis.

    PubMed

    Malina, Jaroslav; Brabec, Viktor

    2014-06-16

    Loss of a base in DNA and the creation of an abasic (apurinic/apyrimidinic, AP) site is a frequent lesion that may occur spontaneously, or as a consequence of the action of DNA-damaging agents. The AP lesion is mutagenic or lethal if not repaired. We report a systematic thermodynamic investigation by differential scanning calorimetry on the evolution, during primer extension, of a model AP site in chemically simulated DNA translesion synthesis. Incorporation of dAMP (deoxyadenosine monophosphate), as well as dTMP (deoxythymidine monophosphate), opposite an AP site is enthalpically unfavorable, although incorporation of dTMP is more enthalpically unfavorable than that of dAMP. This finding is in a good agreement with experimental data showing that AP sites block various DNA polymerases of eukaryotic and prokaryotic origin and that, if bypassed, dAMP is preferentially inserted, whereas insertion of dTMP is less likely. The results emphasize the importance of thermodynamic contributions to the insertion of nucleotides opposite an AP site by DNA polymerases.

  13. Lagging strand DNA synthesis by calf thymus DNA polymerases alpha, beta, delta and epsilon in the presence of auxiliary proteins.

    PubMed Central

    Podust, V N; Hübscher, U

    1993-01-01

    By using a defined gapped DNA substrate that mimics a lagging strand of 230 nucleotides and that contains a defined pause site, we have analyzed calf thymus DNA polymerases (pol) alpha, beta, delta, and epsilon in the presence of the three auxiliary proteins proliferating cell nuclear antigen (PCNA), replication factor C (RF-C) and replication protein A (RP-A) for their ability to complete an Okazaki fragment. Pol alpha alone could fill the gap to near completion, but was strongly stopped by the pause site. Addition of low amounts of RP-A resulted in an increased synthesis by pol alpha past the pause site. In contrast, high amounts of RP-A strongly inhibited gap filling by pol alpha. Further inhibition was evident when the two other auxiliary proteins, PCNA and RF-C, were added in addition to RP-A. Pol beta could completely fill the gap without specific pausing and also was strongly inhibited by RP-A. PCNA and RF-C had no detectable effect on pol beta. Pol delta, relied as expected, on all three auxiliary proteins for complete gap filling synthesis and could, upon longer incubation, perform a limited amount of strand displacement synthesis. Pol epsilon core enzyme was able to fill the gap completely, but like pol alpha, essentially stopped at the pause site. This pausing could only be overcome upon addition of PCNA, RF-C and E. coli single-stranded DNA binding protein. Thus pol epsilon holoenzyme preferentially synthesized to the end of the gap without pausing. Ligation of the DNA products indicated that pol beta core enzyme, pol delta and pol epsilon holoenzymes (but not pol alpha and pol epsilon core enzyme) synthesized products that were easily ligatable. Our results indicate that pol epsilon holoenzyme fills a defined lagging strand gapped template to exact completion and is able to pass a pause site. The data favour the hypothesis of Burgers (Burgers, P.M.J. (1991) J. Biol. Chem. 266, 22698-22706) that pol epsilon might be a candidate for the second

  14. Synthesis and structural characterization of piperazino-modified DNA that favours hybridization towards DNA over RNA

    PubMed Central

    Skov, Joan; Bryld, Torsten; Lindegaard, Dorthe; Nielsen, Katrine E.; Højland, Torben; Wengel, Jesper; Petersen, Michael

    2011-01-01

    We report the synthesis of two C4′-modified DNA analogues and characterize their structural impact on dsDNA duplexes. The 4′-C-piperazinomethyl modification stabilizes dsDNA by up to 5°C per incorporation. Extension of the modification with a butanoyl-linked pyrene increases the dsDNA stabilization to a maximum of 9°C per incorporation. Using fluorescence, ultraviolet and nuclear magnetic resonance (NMR) spectroscopy, we show that the stabilization is achieved by pyrene intercalation in the dsDNA duplex. The pyrene moiety is not restricted to one intercalation site but rather switches between multiple sites in intermediate exchange on the NMR timescale, resulting in broad lines in NMR spectra. We identified two intercalation sites with NOE data showing that the pyrene prefers to intercalate one base pair away from the modified nucleotide with its linker curled up in the minor groove. Both modifications are tolerated in DNA:RNA hybrids but leave their melting temperatures virtually unaffected. Fluorescence data indicate that the pyrene moiety is residing outside the helix. The available data suggest that the DNA discrimination is due to (i) the positive charge of the piperazino ring having a greater impact in the narrow and deep minor groove of a B-type dsDNA duplex than in the wide and shallow minor groove of an A-type DNA:RNA hybrid and (ii) the B-type dsDNA duplex allowing the pyrene to intercalate and bury its apolar surface. PMID:21062815

  15. ADS: A FORTRAN program for automated design synthesis: Version 1.10

    NASA Technical Reports Server (NTRS)

    Vanderplaats, G. N.

    1985-01-01

    A new general-purpose optimization program for engineering design is described. ADS (Automated Design Synthesis - Version 1.10) is a FORTRAN program for solution of nonlinear constrained optimization problems. The program is segmented into three levels: strategy, optimizer, and one-dimensional search. At each level, several options are available so that a total of over 100 possible combinations can be created. Examples of available strategies are sequential unconstrained minimization, the Augmented Lagrange Multiplier method, and Sequential Linear Programming. Available optimizers include variable metric methods and the Method of Feasible Directions as examples, and one-dimensional search options include polynomial interpolation and the Golden Section method as examples. Emphasis is placed on ease of use of the program. All information is transferred via a single parameter list. Default values are provided for all internal program parameters such as convergence criteria, and the user is given a simple means to over-ride these, if desired.

  16. Nitrite-mediated synthesis of chiral epichlorohydrin using halohydrin dehalogenase from Agrobacterium radiobacter AD1.

    PubMed

    Jin, Huo-Xi; Hu, Zhong-Ce; Liu, Zhi-Qiang; Zheng, Yu-Guo

    2012-01-01

    In the current study, the haloalcohol dehalogenase HheC gene from Agrobacterium radiobacter AD1 was synthesized and expressed in Escherichia coli. After purification using Ni-nitrilotriacetic acid affinity chromatography, HheC was used in the synthesis of chiral epichlorohydrin in the presence of NO₂⁻. The optimal pH, temperature, and NO₂⁻ concentration for enantioselectivity are 5.0, 37°C, and 60 mM, respectively. The maximum velocity and Michaelis constant values for (S)-epichlorohydrin are 714.3 µmol min⁻¹ mg⁻¹ and 17.2 mM, respectively, whereas those for (R)-epichlorohydrin are 166.8 µmol min⁻¹ mg⁻¹ and 29.0 mM, respectively. Under optimal conditions, (R)-epichlorohydrin with 99% enantiomeric excess was obtained after an 18 Min reaction; the yield reached 41%, which is the highest amount obtained for chiral epichlorohydrin synthesis using haloalcohol dehalogenase. In addition, (R)-epichlorohydrin with 99% enantiomeric excess was successfully obtained from 1,3-dichloro-2-propanol by the ring opening of racemic epichlorohydrin in the presence of NO₂⁻ after the ring closure of 1,3-dichloro-2-propanol with HheC. To the best of our knowledge, the current study is the first report on the kinetic resolution of epichlorohydrin with NO₂⁻ and synthesis of chiral epichlorohydrin with 99% enantiomeric excess from 1,3-dichloro-2-propanol by combining ring closure of 1,3-dichloro-2-propanol and ring opening of racemic epichlorohydrin.

  17. Isolation and Characterization of a Protein That Stimulates DNA Synthesis from Avian Myeloblastosis Virus*

    PubMed Central

    Leis, Jonathan P.; Hurwitz, Jerard

    1972-01-01

    A protein has been isolated from avian myeloblastosis virus that stimulates the rate and yield of DNA synthesis primed by viral RNA with purified viral polymerase. It specifically affects the viral polymerase and does not stimulate other DNA polymerases under the conditions tested. The viral polymerase, in conjunction with this protein, transcribes extended single-stranded regions of DNA, and permits the enzyme to initiate synthesis from single-strand breaks in DNA. PMID:4340754

  18. [Interrelationships in experiments in vitro between the migration activity of leukocytes and RNA and DNA synthesis].

    PubMed

    Nazarov, P G; Volgarev, A P; Ermakov, S A

    1978-06-01

    The following correlations were revealed in the parallel study of leukocyte migration in vitro in the presence of a specific antigen and of spontaneous RNA and DNA synthesis in the cultured lymphocytes: 1) a direct correlation between the RNA and DNA synthesis in lymphocytes; 2) a close correlation between the antigen-induced migration and the levels of RNA and DNA synthesis. The effect of the antigen was evidenced by the inhibition or stimulation of leukocyte migration. A high ratio of RNA synthesis to DNA synthesis corresponded to the migration inhibition and a low one--to the migration stimulation. The ratio value varied mainly on account of the changes in the level of DNA synthesis. Participation of T and B cells in the regulation of the antigen-induced leukocyte mobility is discussed. PMID:352440

  19. Peptide Synthesis on a Next-Generation DNA Sequencing Platform.

    PubMed

    Svensen, Nina; Peersen, Olve B; Jaffrey, Samie R

    2016-09-01

    Methods for displaying large numbers of peptides on solid surfaces are essential for high-throughput characterization of peptide function and binding properties. Here we describe a method for converting the >10(7) flow cell-bound clusters of identical DNA strands generated by the Illumina DNA sequencing technology into clusters of complementary RNA, and subsequently peptide clusters. We modified the flow-cell-bound primers with ribonucleotides thus enabling them to be used by poliovirus polymerase 3D(pol) . The primers hybridize to the clustered DNA thus leading to RNA clusters. The RNAs fold into functional protein- or small molecule-binding aptamers. We used the mRNA-display approach to synthesize flow-cell-tethered peptides from these RNA clusters. The peptides showed selective binding to cognate antibodies. The methods described here provide an approach for using DNA clusters to template peptide synthesis on an Illumina flow cell, thus providing new opportunities for massively parallel peptide-based assays.

  20. Paternity testing using microsatellite DNA markers in captive Adélie penguins (Pygoscelis adeliae).

    PubMed

    Sakaoka, Ken; Suzuki, Isao; Kasugai, Naeko; Fukumoto, Yohei

    2014-01-01

    We investigated the paternity of 39 Adélie penguins (Pygoscelis adeliae) hatched at the Port of Nagoya Public Aquarium between 1995 and 2005 breeding seasons using microsatellite DNA markers. Among the 13 microsatellite marker loci tested in this study, eight markers amplified and were found to be polymorphic in the colony's founders of the captive population (n = 26). Multiple marker analysis confirmed that all the hatchlings shared alleles with their social fathers and that none of them were sired by any male (all males ≥4 years old in the exhibit tank during each reproductive season; n = 9-15) other than the one carrying out parental duties, except in the case of two inbred hatchlings whose half-sibling parents shared the same father. These results demonstrated that extra-pair paternity (EPP) did not occur in this captive population and that even if EPP has been detected among them, the probability of excluding all other possible fathers in the exhibit tank is extremely high based on paternity exclusion probabilities across the investigated loci. The paternity exclusion probabilities were almost the same between 1994 and 2005. The probability of identity across the investigated loci declined between the two time points, but was still high. These results are reflected in a very short history of breeding in this captive population. In other words, the parentage analyses using a suite of microsatellite markers will be less effective as generations change in small closed populations, such as zoo and aquarium populations.

  1. Control of left ventricular mass by moxonidine involves reduced DNA synthesis and enhanced DNA fragmentation

    PubMed Central

    Paquette, P-A; Duguay, D; Ayoubi, R El-; Menaouar, A; Danalache, B; Gutkowska, J; DeBlois, D; Mukaddam-Daher, S

    2007-01-01

    Background and purpose: Left ventricular hypertrophy (LVH) is a maladaptive process associated with increased cardiovascular risk. Regression of LVH is associated with reduced complications of hypertension. Moxonidine is an antihypertensive imidazoline compound that reduces blood pressure primarily by central inhibition of sympathetic outflow and by direct actions on the heart to release atrial natriuretic peptide, a vasodilator and an antihypertrophic cardiac hormone. This study investigated the effect of moxonidine on LVH and the mechanisms involved in this effect. Experimental approach: Spontaneously hypertensive rats were treated with several doses of moxonidine (s.c.) over 4 weeks. Blood pressure and heart rate were continuously monitored by telemetry. Body weight and water and food intake were measured weekly. Measurements also included left ventricular mass, DNA content, synthesis, fragmentation, and apoptotic/anti-apoptotic pathway proteins. Key results: The decrease in mean arterial pressure stabilized at ∼ −10 mm Hg after 1 week of treatment and thereafter. Compared to vehicle-treated rats (100%), left ventricular mass was dose- and time-dependently reduced by treatment. This reduction remained significantly lower after normalizing to body weight. Moxonidine reduced left ventricular DNA content and inhibited DNA synthesis. DNA fragmentation transiently, but significantly increased at 1 week of moxonidine treatment and was paralleled by elevated active caspase-3 protein. The highest dose significantly decreased the apoptotic protein Bax and all doses stimulated anti-apoptotic Bcl-2 after 4 weeks of treatment. Conclusions and implications: These studies implicate the modulation of cardiac DNA dynamics in the control of left ventricular mass by moxonidine in a rat model of hypertension. PMID:18059325

  2. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  3. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria.

  4. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

    SciTech Connect

    Ramp, W.K.; Lenz, L.G.; Galvin, R.J. )

    1991-05-01

    Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase were concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.

  5. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin.

    PubMed

    Tsurimoto, T; Melendy, T; Stillman, B

    1990-08-01

    Enzymatic synthesis of DNA from the simian virus 40 origin of DNA replication has been reconstituted in vitro with eight purified components. DNA polymerase alpha-primase complex first initiates DNA synthesis at the replication origin and continues as the lagging strand polymerase. Subsequently, the DNA polymerase delta complex initiates replication on the leading strand template. Some prokaryotic DNA polymerase complexes can replace the eukaryotic polymerase delta complex. A model for polymerase switching during initiation of DNA replication is presented.

  6. Aphidicolin-resistant polyomavirus and subgenomic cellular DNA synthesis occur early in the differentiation of cultured myoblasts to myotubes.

    PubMed Central

    DePolo, N J; Villarreal, L P

    1993-01-01

    Small DNA viruses have been historically used as probes of cellular control mechanisms of DNA replication, gene expression, and differentiation. Polyomavirus (Py) DNA replication is known to be linked to differentiation of may cells, including myoblasts. In this report, we use this linkage in myoblasts to simultaneously examine (i) cellular differentiation control of Py DNA replication and (ii) an unusual type of cellular and Py DNA synthesis during differentiation. Early proposals that DNA synthesis was involved in the induced differentiation of myoblasts to myotubes were apparently disproved by reliance on inhibitors of DNA synthesis (cytosine arabinoside and aphidicolin), which indicated that mitosis and DNA replication are not necessary for differentiation. Theoretical problems with the accessibility of inactive chromatin to trans-acting factors led us to reexamine possible involvement of DNA replication in myoblast differentiation. We show here that Py undergoes novel aphidicolin-resistant net DNA synthesis under specific conditions early in induced differentiation of myoblasts (following delayed aphidicolin addition). Under similar conditions, we also examined uninfected myoblast DNA synthesis, and we show that soon after differentiation induction, a period of aphidicolin-resistant cellular DNA synthesis can also be observed. This drug-resistant DNA synthesis appears to be subgenomic, not contributing to mitosis, and more representative of polyadenylated than of nonpolyadenylated RNA. These results renew the possibility that DNA synthesis plays a role in myoblast differentiation and suggest that the linkage of Py DNA synthesis to differentiation may involve a qualitative cellular alteration in Py DNA replication. Images PMID:8389922

  7. Effect of dexamethasone on proliferating osteoblasts: inhibition of prostaglandin E2 synthesis, DNA synthesis, and alterations in actin cytoskeleton.

    PubMed

    Hughes-Fulford, M; Appel, R; Kumegawa, M; Schmidt, J

    1992-11-01

    Elevated levels of glucocorticoids caused by disease (Cushing's syndrome) or therapeutic treatment of asthma are known to cause osteoporosis. Space flight, an environmental condition, is known to cause a rise in endogenous cortisols accompanied by a significant loss of bone and calcium. Long-term space inhabitants have lost up to 18% of weight bearing bone during long-term flight. This study demonstrates that elevated concentrations of glucocorticoids lower the endogenous production of PGE2 and interfere with osteoblast proliferation. Osteoblasts grown with dexamethasone had significantly lower DNA synthesis and endogenous synthesis of PGE2. Addition of exogenous dmPGE2 to the dexamethasone growth-inhibited cells stimulated DNA synthesis over twofold. In synchronous control cultures, we found that endogenous prostaglandin synthesis increased in late G1, preceding S-phase DNA synthesis by several hours. The addition of exogenous dexamethasone to synchronous cultures resulted in a significant decrease in the prostaglandin synthesis followed by a significant decrease in DNA synthesis in parallel cultures. Further, dexamethasone caused the actin cytoskeleton to collapse and the cell morphology to become rounded and spindle shaped. Addition of exogenous PGE2 to the dexamethasone-treated osteoblasts caused recovery of the actin architecture and phenotype. These data support the hypothesis that the glucocorticoid-mediated decrease in prostaglandin synthesis may be a contributing factor in the reduced bone quality and trabecular bone formation seen in glucocorticoid-induced osteoporosis. PMID:1426038

  8. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  9. ADS: A FORTRAN program for automated design synthesis, version 1.00

    NASA Technical Reports Server (NTRS)

    Vanderplaats, G. N.

    1984-01-01

    A new general-purpose optimization program for engineering design is described. ADS-1 (Automated Design Synthesis - Version 1) is a FORTRAN program for solution of nonlinear constrained optimization problems. The program is segmented into three levels, being strategy, optimizer, and one-dimensional search. At each level, several options are available so that a total of over 100 possible combinations can be created. Examples of available strategies are sequential unconstrained minimization, the Augmented Lagrange Multiplier method, and Sequential Linear Programming. Available optimizers include variable metric methods and the Method of Feasible Directions as examples and one-dimensional search options include polynomial interpolation and the Golden Section method as examples. Emphasis is placed on ease of use of the program. All information is transferred via a single parameter list. Default values are provided for all internal program parameters such as convergence criteria, and the user is given a simple means to over-ride these, if desired. The program is demonstrated with a simple structural design example.

  10. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  11. Nerve growth factor enhances DNA synthesis in cultured cerebellar neuroblasts.

    PubMed

    Confort, C; Charrasse, S; Clos, J

    1991-10-01

    The cerebellar neuroblasts in primary cultures from five-day-old rats bore NGF receptor immunoreactivity, suggesting a potential responsive to NGF. At low plating density, NGF was found to enhance DNA synthesis in these cells in a dose-dependent manner. As these cells synthesize NGF, one possibility to account for the lack of response of neuroblasts plated at high density is that the amount of endogenous trophic agent produced in this culture condition is sufficient to ensure an optimal effect. The results demonstrate that premitotic neuroblasts in the CNS, as well postmitotic neurons, are responsive to NGF. At the early stage of its development, the cerebellum therefore appears to be a very good autocrine model of NGF action.

  12. Nerve growth factor enhances DNA synthesis in cultured cerebellar neuroblasts.

    PubMed

    Confort, C; Charrasse, S; Clos, J

    1991-10-01

    The cerebellar neuroblasts in primary cultures from five-day-old rats bore NGF receptor immunoreactivity, suggesting a potential responsive to NGF. At low plating density, NGF was found to enhance DNA synthesis in these cells in a dose-dependent manner. As these cells synthesize NGF, one possibility to account for the lack of response of neuroblasts plated at high density is that the amount of endogenous trophic agent produced in this culture condition is sufficient to ensure an optimal effect. The results demonstrate that premitotic neuroblasts in the CNS, as well postmitotic neurons, are responsive to NGF. At the early stage of its development, the cerebellum therefore appears to be a very good autocrine model of NGF action. PMID:1661619

  13. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  14. Evaluation of DNA synthesis with carbon-11-labeled 4′-thiothymidine

    PubMed Central

    Toyohara, Jun

    2016-01-01

    In the cancer research field, the preferred method for evaluating the proliferative activity of cancer cells in vivo is to measure DNA synthesis rates. The cellular proliferation rate is one of the most important cancer characteristics, and represents the gold standard of pathological diagnosis. Positron emission tomography (PET) has been used to evaluate in vivo DNA synthetic activity through visualization of enhanced nucleoside metabolism. However, methods for the quantitative measurement of DNA synthesis rates have not been fully clarified. Several groups have been engaged in research on 4′-[methyl-11C]-thiothymidine (11C-4DST) in an effort to develop a PET tracer that allows quantitative measurement of in vivo DNA synthesis rates. This mini-review summarizes the results of recent studies of the in vivo measurement of cancer DNA synthesis rates using 11C-4DST. PMID:27721942

  15. The effect of bleomycin on DNA synthesis in ataxia telangiectasia lymphoid cells

    SciTech Connect

    Cohen, M.M.; Simpson, S.J.

    1982-01-01

    Bleomycin, a radiomimetic glycopeptide, inhibits de novo DNA synthesis in ataxia telangiectasia lymphoblastoid B cells to a markedly lesser extent than in normal and xeroderma pigmentosum lymphoid cells. This observation is similar to that following ionizing radiation; however, the effect is slower following the chemical treatment. Recovery of the normal cells occurs 15-18 hours after treatment, whereas the ataxia telangiectasia lines do not attain normal levels of DNA synthesis during the entire 24-hour observation period. Similar differences were not observed following treatment with mitomycin C, a bifunctional alkylating agent, indicating a specific effect of bleomycin on DNA synthesis in ataxia telangiectasia cells. Following bleomycin treatment and preincubation with hydroxyurea, residual DNA synthesis in ataxia telangiectasia cells was similar to that in both normal and xeroderma pigmentosum lymphoid lines, suggesting that the capacity to repair the induced DNA lesion is present.

  16. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  17. PIDD orchestrates translesion DNA synthesis in response to UV irradiation

    PubMed Central

    Logette, E; Schuepbach-Mallepell, S; Eckert, M J; Leo, X H; Jaccard, B; Manzl, C; Tardivel, A; Villunger, A; Quadroni, M; Gaide, O; Tschopp, J

    2011-01-01

    PIDD has been implicated in survival and apoptotic pathways in response to DNA damage, and a role for PIDD was recently identified in non-homologous end-joining (NHEJ) repair induced by γ-irradiation. Here, we present an interaction of PIDD with PCNA, first identified in a proteomics screen. PCNA has essential functions in DNA replication and repair following UV irradiation. Translesion synthesis (TLS) is a process that prevents UV irradiation-induced replication blockage and is characterized by PCNA monoubiquitination and interaction with the TLS polymerase eta (polη). Both of these processes are inhibited by p21. We report that PIDD modulates p21-PCNA dissociation, and promotes PCNA monoubiquitination and interaction with polη in response to UV irradiation. Furthermore, PIDD deficiency leads to a defect in TLS that is associated, both in vitro and in vivo, with cellular sensitization to UV-induced apoptosis. Thus, PIDD performs key functions upon UV irradiation, including TLS, NHEJ, NF-κB activation and cell death. PMID:21415862

  18. Repair synthesis step involving ERCC1-XPF participates in DNA repair of the Top1-DNA damage complex.

    PubMed

    Takahata, Chiaki; Masuda, Yuji; Takedachi, Arato; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2015-08-01

    Topoisomerase 1 (Top1) is the intercellular target of camptothecins (CPTs). CPT blocks DNA religation in the Top1-DNA complex and induces Top1-attached nick DNA lesions. In this study, we demonstrate that excision repair cross complementing 1 protein-xeroderma pigmentosum group F (ERCC1-XPF) endonuclease and replication protein A (RPA) participate in the repair of Top1-attached nick DNA lesions together with other nucleotide excision repair (NER) factors. ERCC1-XPF shows nuclease activity in the presence of RPA on a 3'-phosphotyrosyl bond nick-containing DNA (Tyr-nick DNA) substrate, which mimics a Top1-attached nick DNA lesion. In addition, ERCC1-XPF and RPA form a DNA/protein complex on the nick DNA substrate in vitro, and co-localize in CPT-treated cells in vivo. Moreover, the DNA repair synthesis of Tyr-nick DNA lesions occurred in the presence of NER factors, including ERCC1-XPF, RPA, DNA polymerase delta, flap endonuclease 1 and DNA ligase 1. Therefore, some of the NER repair machinery might be an alternative repair pathway for Top1-attached nick DNA lesions. Clinically, these data provide insights into the potential of ERCC1 as a biomarker during CPT regimens.

  19. Synergistic bombesin and insulin stimulation of DNA synthesis in human fetal kidney in serum-free culture.

    PubMed

    Brière, N; Chailler, P

    1993-05-01

    The respective influences of growth factors during kidney development can be directly evaluated using the chemically-defined serum-free culture system perfected in our laboratory. Since, in this culture model, conditions are minimal for growth and differentiation, DNA synthesis sharply decreases during the first 48 h. The addition of epidermal growth factor (EGF, 100 ng/ml), insulin (5 micrograms/ml) and transferrin (5 micrograms/ml) significantly restores this important cellular function. The objective of the present study was to determine the influence of bombesin, a potent mitogen, supplemented alone or in combination with insulin, transferrin and/or EGF. Cortical explants of human fetal kidneys (17-20 weeks) were maintained during 5 days in culture. When compared with 5 day controls (L-15 medium only), bombesin generated a maximal though weak effect on DNA synthesis at a concentration of 0.3 nM, corresponding to a stimulation index (SI) of 22%. When combined with either transferrin or EGF, or with transferrin plus EGF, bombesin did not alter the SI of individual factors. Insulin, in turn, greatly increased DNA synthesis (SI = 169%), while bombesin strongly potentiated this effect (SI = 275%). Transferrin also enhanced insulin SI from 169 to 240%. When added as a third factor, bombesin further potentiated the effectiveness (SI = 338%) of the combination insulin plus transferrin. These results indicate that bombesin controls cell proliferation in synergism with other regulators and hence may act as a competence growth factor during nephrogenesis.

  20. Synthesis, characterization, DNA binding, DNA cleavage, protein binding and cytotoxic activities of Ru(II) complexes.

    PubMed

    Thota, Sreekanth; Vallala, Srujana; Yerra, Rajeshwar; Rodrigues, Daniel Alencar; Raghavendra, Nulgumnalli Manjunathaiah; Barreiro, Eliezer J

    2016-01-01

    We report on the synthesis of novel Ru(II) compounds (Ru-1 to Ru-8) bearing R-pdc, 4-Cl-pbinh ligands (where R=4-CF3, 4-F, 4-OH pdc=3-phenyl-5-(1H-pyrrol-2-yl)-4,5-dihydro-1H-pyrazole-1-carbothioamide, pbinh=phenoxybenzylidene isonicotinyl hydrazides) and their in vitro antitumor activity toward the cell lines murine leukemia L1210, human lymphocyte CEM, human epithelial cervical carcinoma HeLa, BEL-7402 and Molt4/C8. Some of the complexes exhibited more potent antiproliferative activity against cell lines than the standard drug cisplatin. Ruthenium complex Ru-2 displayed potent cytotoxicity with than that of cisplatin. DNA-binding, DNA cleavage and protein binding properties of ruthenium complexes with these ligands are reported. Interactions of these ruthenium complexes with DNA revealed an intercalative mode of binding between them. Synchronous fluorescence spectra proved that the interaction of ruthenium complexes with bovine serum albumin (BSA) resulted in a conformational change of the latter.

  1. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins.

  2. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  3. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  4. Extracellular matrix components influence DNA synthesis of rat hepatocytes in primary culture

    SciTech Connect

    Sawada, N.; Tomomura, A.; Sattler, C.A.; Sattler, G.L.; Kleinman, H.K.; Pitot, H.C.

    1986-12-01

    The effects of several extracellular matrix components (EMCs) - fibronectin (Fn), laminin (Ln), type I (C-I) and type IV (C-IV) collagen - on DNA synthesis in rat hepatocytes in primary culture were examined by both quantitative scintillation spectrometry and autoradiography of (/sup 3/H)thymidine incorporation. Hepatocytes cultured on Fn showed the most active DNA synthesis initiated by epidermal growth factor (EGF) with decreasing levels of (/sup 3/H)thymidine uptake exhibited in the cell cultured on C-IV, C-I, and Ln, respectively. The decreasing level of DNA synthesis in hepatocytes cultured on Fn, C-IV, C-I, and Ln respectively was not influenced by cell density. The number of EGF receptors of hepatocytes was also not influenced by EMCs. These data suggest that EMCs modify hepatocyte DNA synthesis by means of post-EGF-receptor mechanisms which are regulated by both growth factors and cell density.

  5. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  6. In vitro synthesis of ribosomal proteins directed by Escherichia coli DNA.

    PubMed

    Kaltschmidt, E; Kahan, L; Nomura, M

    1974-02-01

    In vitro synthesis of a number of E. coli 30S ribosomal proteins has been demonstrated in a cell-free system consisting of ribosomes, initiation factors, RNA polymerase, a fraction containing soluble enzymes and factors, and E. coli DNA. DNA-dependent synthesis of the following 30S proteins has been demonstrated: S4, S5, S7, S8, S9, S10, S13, S14, S16, S19, and S20.

  7. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  8. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response.

  9. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  10. Effects of phenolic antioxidants and flavonoids on DNA synthesis in rat liver, spleen, and testis in vitro.

    PubMed

    Wong, W S; McLean, A E

    1999-12-01

    Paracetamol (acetaminophen) and hydroxyurea were found to inhibit DNA synthesis in a dose-dependent manner in tissue slices in vitro, with little effect on protein synthesis. Considerable variation in the sensitivity of the different tissues was also observed with an order of least sensitive to most sensitive tissue of liver < testis < spleen. The phenolic antioxidant properties of paracetamol are thought to be the mechanism by which paracetamol inhibits DNA synthesis, which led us to study other phenolic antioxidant molecules and flavonoids for specific inhibition of DNA synthesis. (+)-catechin, m-aminophenol, p-aminophenol and p-cresol all displayed a highly specific inhibition of DNA synthesis. Quercetin displayed a preferential inhibition of DNA synthesis but a significant level of inhibition of protein synthesis was also seen. Nordihydroguaiaretic acid (NDGA) and n-propyl gallate showed preferential inhibition of DNA synthesis at the lower doses tested, but at higher doses showed significant inhibition of protein synthesis, presumably because of cytotoxicity. Caffeic acid and naringenin did not display any specific inhibition of DNA synthesis as protein synthesis was equally inhibited at all doses tested. This study demonstrates that certain phenolic antioxidants can inhibit DNA synthesis specifically but this is not a property shared by all phenolic antioxidants; and that these inhibitors show considerable variation in effectiveness between different tissues. PMID:10647924

  11. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  12. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    PubMed

    Azeroglu, Benura; Mawer, Julia S P; Cockram, Charlotte A; White, Martin A; Hasan, A M Mahedi; Filatenkova, Milana; Leach, David R F

    2016-02-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  13. A proposed role played by benzene itself in the induction of acute cytopenia: inhibition of DNA synthesis.

    PubMed

    Lee, E W; Garner, C D; Johnson, J T

    1988-04-01

    A single intraperitoneal dose of benzene (880 mg/kg) in mice inhibited DNA synthesis of bone marrow cells within one hour postinjection. However, there was no inhibitory effect on the synthesis of heme and protein at that dosage. Dose-dependent inhibition of DNA synthesis by benzene was observed over the range of 440 to 1760 mg/kg, supporting the idea that cytopenia which was observed by others following multiple doses of benzene (e.g., 440 or 880 mg/kg) might be due to the inhibitory effect of benzene on DNA synthesis. In our studies, benzene concentrations above 81 micrograms/g wet bone marrow resulted in inhibition of DNA synthesis, regardless of whether it was given ip or by inhalation. The effect of benzene itself, rather than its toxic metabolites, on DNA synthesis was further seen in experiments using a bone marrow cell culture system and cell-free DNA synthetic system. Experimental results demonstrated that benzene alone was capable of inhibiting the DNA synthesis of bone marrow cells and that the reduced DNA synthesis resulted from the inhibitory effect of benzene on DNA polymerase alpha, the enzyme that catalyzes the last step of the DNA synthetic pathway. Thus, benzene itself could play a significant role in inducing myelotoxicity in the case of acute or subacute toxicity by exerting its inhibitory effect on DNA synthesis.

  14. Induction of internucleosomal DNA fragmentation by carcinogenic chromate: relationship to DNA damage, genotoxicity, and inhibition of macromolecular synthesis.

    PubMed Central

    Manning, F C; Blankenship, L J; Wise, J P; Xu, J; Bridgewater, L C; Patierno, S R

    1994-01-01

    Hexavalent chromium (Cr) compounds are respiratory carcinogens in humans and animals. Treatment of Chinese hamster ovary cells with 150 and 300 microM sodium chromate (Na2CrO4) for 2 hr decreased colony-forming efficiency by 46 and 92%, respectively. These treatments induced dose-dependent internucleosomal fragmentation of cellular DNA beyond 24 hr after chromate treatment. This fragmentation pattern is characteristic of apoptosis as a mechanism of cell death. These treatments also induced an immediate inhibition of macromolecular synthesis and delayed progression of cells through S-phase of the cell cycle. Cell growth (as evidenced by DNA synthesis) was inhibited for at least 4 days and transcription remained suppressed for at least 32 hr. Many of the cells that did progress to metaphase exhibited chromosome damage. Chromate caused the dose-dependent formation of DNA single-strand breaks and DNA-protein cross-links, but these were repaired 8 and 24 hr after removal of the treatment, respectively. In contrast, Cr-DNA adducts (up to 1/100 base-pairs) were extremely resistant to repair and were still detectable even 5 days after treatment. Compared with other regions of the genome, DNA-protein cross-links and Cr adducts were preferentially associated with the nuclear matrix DNA of treated cells, which was 4.5-fold enriched in actively transcribed genes. Chromium adducts, formed on DNA in vitro at a similar level to that detected in nuclear matrix DNA, arrested the progression of a DNA polymerase in a sequence-specific manner, possibly through the formation of DNA-DNA cross-links.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 2. Figure 3. Figure 7. PMID:7843091

  15. EDTA Chelation Therapy, Without Added Vitamin C, Decreases Oxidative DNA Damage and Lipid Peroxidation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chelation therapy is thought to not only remove contaminating metals, but also to decrease free radical production. However, in standard EDTA chelation therapy high doses of vitamin C with potential prooxidant effects are often added to the chelation solution. We demonstrated previously that the in...

  16. Genome Calligrapher: A Web Tool for Refactoring Bacterial Genome Sequences for de Novo DNA Synthesis.

    PubMed

    Christen, Matthias; Deutsch, Samuel; Christen, Beat

    2015-08-21

    Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher  .

  17. Quantifying hepatic glycogen synthesis by direct and indirect pathways in rats under normal ad libitum feeding conditions.

    PubMed

    Soares, Ana F; Viega, Francisco J; Carvalho, Rui A; Jones, John G

    2009-01-01

    Hepatic glycogen synthesis from intact hexose (direct pathway) relative to that from gluconeogenic precursors (indirect pathway) was quantified in ad libitum-fed rats. Following (2)H(2)O administration and overnight feeding, the livers were removed and glycogen (2)H-enrichment was measured by (2)H NMR. Six controls and six rats rendered hyperglycemic by streptozotocin (STZ; fasting blood glucose = 385 +/- 31 mg/dl) were studied. The indirect pathway contribution, estimated as glycogen hydrogen 5 relative to hydrogen 2 enrichment, was 54% +/- 4% for control rats-similar to values from healthy, meal-fed humans. In STZ-treated rats, the indirect pathway contribution was significantly higher (68% +/- 4%, P < 0.05 vs. controls), similar to that of Type 1 diabetic (T1D) patients. In conclusion, sources of hepatic glycogen synthesis in rats during ad libitum nocturnal feeding were quantified by analysis of glycogen enrichment from (2)H(2)O. STZ caused alterations resembling the pathophysiology of hepatic glycogen synthesis in T1D patients.

  18. Deglycobleomycin: solid-phase synthesis and DNA cleavage by the resin-bound ligand.

    PubMed

    Smith, Kenneth L; Tao, Zhi-Fu; Hashimoto, Shigeki; Leitheiser, Christopher J; Wu, Xihan; Hecht, Sidney M

    2002-04-01

    [structure: see text] A greatly improved solid-phase synthesis of deglycobleomycin using a Dde-based linker is reported. The resin-bound deglycobleomycin could be completely deblocked and assayed for DNA plasmid relaxation, sequence-selective DNA cleavage, and light production from a molecular beacon.

  19. Aphidicolin does not inhibit DNA repair synthesis in ultraviolet-irradiated HeLa cells. A radioautographic study.

    PubMed Central

    Hardt, N; Pedrali-Noy, G; Focher, F; Spadari, S

    1981-01-01

    A radioautographic examination of nuclear DNA synthesis in unirradiated and u.v.-irradiated HeLa cells, in the presence and in the absence of aphidicolin, showed that aphidicolin inhibits nuclear DNA replication and has no detectable effect on DNA repair synthesis. Although the results establish that in u.v.-irradiated HeLa cells most of the DNA repair synthesis is not due to DNA polymerase alpha, they do not preclude a significant role for this enzyme in DNA repair processes. Images PLATE 1 PMID:6803764

  20. Repair synthesis by human cell extracts in DNA damaged by cis- and trans-diamminedichloroplatinum(II).

    PubMed Central

    Hansson, J; Wood, R D

    1989-01-01

    DNA damage was induced in closed circular plasmid DNA by treatment with cis- or trans-diamminedichloroplatinum(II). These plasmids were used as substrates in reactions to give quantitative measurements of DNA repair synthesis mediated by cell free extracts from human lymphoid cell lines. Adducts induced by both drugs stimulated repair synthesis in a dose dependent manner by an ATP-requiring process. Measurements by an isopycnic gradient sedimentation method gave an upper limit for the average patch sizes in this in vitro system of around 140 nucleotides. It was estimated that up to 3% of the drug adducts induce the synthesis of a repair patch. The repair synthesis is due to repair of a small fraction of frequent drug adducts, rather than extensive repair of a rare subclass of lesions. Nonspecific DNA synthesis in undamaged plasmids, caused by exonucleolytic degradation and resynthesis, was reduced by repeated purification of intact circular forms. An extract made from cells belonging to xeroderma pigmentosum complementation group A was deficient in repair synthesis in response to the presence of cis- or trans-diamminedichloroplatinum(II) adducts in DNA. Images PMID:2554251

  1. Effect of human, bovine and ovine prolactin on DNA synthesis by organ cultures of benign human breast tumours.

    PubMed Central

    Welsch, C. W.; Dombroske, S. E.; McManus, M. J.; Calaf, G.

    1979-01-01

    Ten benign breast tumours from 9 female patients (8 with fibrocystic disease and 1 with fibroadenoma) and 1 male patient (with gynaecomastia) were processed into slices and individually cultured for 2 days in serum-free Medium 199. [3H]-TdR was added to the culture medium to assess DNA synthesis. The addition of human prolactin to the culture medium (500 ng/ml) significantly (0.05 greater than P greater than 0.01) increased DNA synthesis; all 9 biopsy specimens from the 9 female patients responded positively to this hormone. Ovine prolactin (500 ng/ml) and bovine prolactin (500 ng/ml) increased the mean incorporation of [3H]-TdR into extracted DNA and increased the mean number of [3H]-TdR-labelled cells, but this increase did not reach the 5% level of probability. The sole case of male breast dysplasia analysed in this study did not respond to either human, ovine or bovine prolactin. These results provide evidence that human prolactin and, to a lesser degree, ovine and bovine prolactin are direct mitogenic stimulants to the epithelium in human (female) benign breast tumours. PMID:575047

  2. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  3. Antifolate-induced misincorporation of deoxyuridine monophosphate into DNA: inhibition of high molecular weight DNA synthesis in human lymphoblastoid cells.

    PubMed Central

    Sedwick, W D; Kutler, M; Brown, O E

    1981-01-01

    In vitro exposure of a human lymphoblastoid cell line (WIL-2) to the antifolate metoprine (DDMP), when followed by the addition of exogenous deoxyuridine, led to intracellular accumulation of deoxyuridine triphosphate (dUTP) and incorporation of deoxyuridine monophosphate (dUMP) into DNA. When newly synthesized DNA was extracted from DDMP-treated cells that had been labeled with deoxyuridine for up to 3 min, most of the DNA synthesized was no larger than 4 S on alkaline sucrose gradients. In contrast, the predominant form of newly synthesized alkali-stable DNA in cells not treated with drug was larger than 4 S. Abnormal progression of DNA synthesis, degradation of newly synthesized DNA, or both occurred as a delayed consequence of DDMP treatment in the absence of exogenous deoxyuridine when thymidine was used to label DNA of DDMP-treated stability of antifolate-induced misincorporation of dUMP into DNA was not elucidated, it was clear that antifolates can directly perturb the quality as well as the quantity of DNA synthesized by drug-treated cells. PMID:6940156

  4. Surface passivation improves the synthesis of highly stable and specific DNA-functionalized gold nanoparticles with variable DNA density.

    PubMed

    Deka, Jashmini; Měch, Rostislav; Ianeselli, Luca; Amenitsch, Heinz; Cacho-Nerin, Fernando; Parisse, Pietro; Casalis, Loredana

    2015-04-01

    We report a novel and multifaceted approach for the quick synthesis of highly stable single-stranded DNA (ssDNA) functionalized gold nanoparticles (AuNPs). The method is based on the combined effect of surface passivation by (1-mercaptoundec-11-yl)hexa(ethylene glycol) and low pH conditions, does not require any salt pretreatment or high excess of ssDNA, and can be generalized for oligonucleotides of any length or base sequence. The synthesized ssDNA-coated AuNPs conjugates are stable at salt concentrations as high as 3.0 M, and also functional and specific toward DNA-DNA hybridization, as shown from UV-vis spectrophotometry, scanning electron microscopy, gel electrophoresis, fluorescence, and small angle X-ray scattering based analyses. The method is highly flexible and shows an additional advantage of creating ssDNA-AuNP conjugates with a predefined number of ssDNA strands per particle. Its simplicity and tenability make it widely applicable to diverse biosensing applications involving ssDNA functionalized AuNPs.

  5. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation.

    PubMed

    Drake, Joshua C; Bruns, Danielle R; Peelor, Frederick F; Biela, Laurie M; Miller, Richard A; Hamilton, Karyn L; Miller, Benjamin F

    2014-11-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1.

  6. Yersinia pestis DNA from Skeletal Remains from the 6th Century AD Reveals Insights into Justinianic Plague

    PubMed Central

    Harbeck, Michaela; Seifert, Lisa; Hänsch, Stephanie; Wagner, David M.; Birdsell, Dawn; Parise, Katy L.; Wiechmann, Ingrid; Grupe, Gisela; Thomas, Astrid; Keim, Paul; Zöller, Lothar; Bramanti, Barbara; Riehm, Julia M.; Scholz, Holger C.

    2013-01-01

    Yersinia pestis, the etiologic agent of the disease plague, has been implicated in three historical pandemics. These include the third pandemic of the 19th and 20th centuries, during which plague was spread around the world, and the second pandemic of the 14th–17th centuries, which included the infamous epidemic known as the Black Death. Previous studies have confirmed that Y. pestis caused these two more recent pandemics. However, a highly spirited debate still continues as to whether Y. pestis caused the so-called Justinianic Plague of the 6th–8th centuries AD. By analyzing ancient DNA in two independent ancient DNA laboratories, we confirmed unambiguously the presence of Y. pestis DNA in human skeletal remains from an Early Medieval cemetery. In addition, we narrowed the phylogenetic position of the responsible strain down to major branch 0 on the Y. pestis phylogeny, specifically between nodes N03 and N05. Our findings confirm that Y. pestis was responsible for the Justinianic Plague, which should end the controversy regarding the etiology of this pandemic. The first genotype of a Y. pestis strain that caused the Late Antique plague provides important information about the history of the plague bacillus and suggests that the first pandemic also originated in Asia, similar to the other two plague pandemics. PMID:23658525

  7. Yersinia pestis DNA from skeletal remains from the 6(th) century AD reveals insights into Justinianic Plague.

    PubMed

    Harbeck, Michaela; Seifert, Lisa; Hänsch, Stephanie; Wagner, David M; Birdsell, Dawn; Parise, Katy L; Wiechmann, Ingrid; Grupe, Gisela; Thomas, Astrid; Keim, Paul; Zöller, Lothar; Bramanti, Barbara; Riehm, Julia M; Scholz, Holger C

    2013-01-01

    Yersinia pestis, the etiologic agent of the disease plague, has been implicated in three historical pandemics. These include the third pandemic of the 19(th) and 20(th) centuries, during which plague was spread around the world, and the second pandemic of the 14(th)-17(th) centuries, which included the infamous epidemic known as the Black Death. Previous studies have confirmed that Y. pestis caused these two more recent pandemics. However, a highly spirited debate still continues as to whether Y. pestis caused the so-called Justinianic Plague of the 6(th)-8(th) centuries AD. By analyzing ancient DNA in two independent ancient DNA laboratories, we confirmed unambiguously the presence of Y. pestis DNA in human skeletal remains from an Early Medieval cemetery. In addition, we narrowed the phylogenetic position of the responsible strain down to major branch 0 on the Y. pestis phylogeny, specifically between nodes N03 and N05. Our findings confirm that Y. pestis was responsible for the Justinianic Plague, which should end the controversy regarding the etiology of this pandemic. The first genotype of a Y. pestis strain that caused the Late Antique plague provides important information about the history of the plague bacillus and suggests that the first pandemic also originated in Asia, similar to the other two plague pandemics.

  8. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis.

    PubMed

    Levring, Trine B; Kongsbak, Martin; Rode, Anna K O; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-09-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication.

  9. The identification of translesion DNA synthesis regulators: Inhibitors in the spotlight.

    PubMed

    Bertolin, A P; Mansilla, S F; Gottifredi, V

    2015-08-01

    Over the past half-century, we have become increasingly aware of the ubiquity of DNA damage. Under the constant exposure to exogenous and endogenous genomic stress, cells must attempt to replicate damaged DNA. The encounter of replication forks with DNA lesions triggers several cellular responses, including the activation of translesion DNA synthesis (TLS), which largely depends upon specialized DNA polymerases with flexible active sites capable of accommodating bulky DNA lesions. A detrimental aspect of TLS is its intrinsic mutagenic nature, and thus the activity of the TLS polymerases must ideally be restricted to synthesis on damaged DNA templates. Despite their potential clinical importance in chemotherapy, TLS inhibitors have been difficult to identify since a direct assay designed to quantify genomic TLS events is still unavailable. Herein we discuss the methods that have been used to validate TLS inhibitors such as USP1, p21 and Spartan, highlighting research that has revealed their contribution to the control of DNA synthesis on damaged and undamaged templates.

  10. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  11. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  12. New coal tar extract and coal tar shampoos. Evaluation by epidermal cell DNA synthesis suppression assay.

    PubMed

    Lowe, N J; Breeding, J H; Wortzman, M S

    1982-07-01

    Coal tar therapy has been used for many years in the treatment of scaling skin diseases, including psoriasis and eczema. Previous studies of the potential effectiveness of tar have utilized phototoxic erythema assays with long-wave ultraviolet light (UV-A). However, in clinical use, coal tar is rarely used with UV-A, particularly for scalp disease. Therefore, we investigated a nonphototoxic approach to evaluate different coal tar products. Coal tar was found to suppress epidermal cell DNA synthesis in the hairless mouse model, and this is the basis for the assay presented. Using the epidermal cell DNA synthesis suppression assay, we observed that crude coal tar and a new extract of crude coal tar were equally effective and that a concentration gradient effect was achieved. In addition, four commercial coal tar shampoos assayed varied greatly in their ability to suppress epidermal cell DNA synthesis. One shampoo was washed after ten minutes and no significant alteration of suppressive effect was seen.

  13. Efficient Automated Solid-Phase Synthesis of DNA and RNA 5'-Triphosphates.

    PubMed

    Sarac, Ivo; Meier, Chris

    2015-11-01

    A fast, high-yielding and reliable method for the synthesis of DNA- and RNA 5'-triphosphates is reported. After synthesizing DNA or RNA oligonucleotides by automated oligonucleotide synthesis, 5-chloro-saligenyl-N,N-diisopropylphosphoramidite was coupled to the 5'-end. Oxidation of the formed 5'-phosphite using the same oxidizing reagent used in standard oligonucleotide synthesis led to 5'-cycloSal-oligonucleotides. Reaction of the support-bonded 5'-cycloSal-oligonucleotide with pyrophosphate yielded the corresponding 5'-triphosphates. The 5'-triphosphorylated DNA and RNA oligonucleotides were obtained after cleavage from the support in high purity and excellent yields. The whole reaction sequence was adapted to be used on a standard oligonucleotide synthesizer.

  14. Ribonucleotide reductase activity is coupled to DNA synthesis via proliferating cell nuclear antigen.

    PubMed

    Salguero, Israel; Guarino, Estrella; Shepherd, Marianne E A; Deegan, Tom D; Havens, Courtney G; MacNeill, Stuart A; Walter, Johannes C; Kearsey, Stephen E

    2012-04-24

    Synthesis of deoxynucleoside triphosphates (dNTPs) is required for both DNA replication and DNA repair and is catalyzed by ribonucleotide reductases (RNR), which convert ribonucleotides to their deoxy forms [1, 2]. Maintaining the correct levels of dNTPs for DNA synthesis is important for minimizing the mutation rate [3-7], and this is achieved by tight regulation of RNR [2, 8, 9]. In fission yeast, RNR is regulated in part by a small protein inhibitor, Spd1, which is degraded in S phase and after DNA damage to allow upregulation of dNTP supply [10-12]. Spd1 degradation is mediated by the activity of the CRL4(Cdt2) ubiquitin ligase complex [5, 13, 14]. This has been reported to be dependent on modulation of Cdt2 levels, which are cell cycle regulated, peaking in S phase, and which also increase after DNA damage in a checkpoint-dependent manner [7, 13]. We show here that Cdt2 level fluctuations are not sufficient to regulate Spd1 proteolysis and that the key step in this event is the interaction of Spd1 with the polymerase processivity factor proliferating cell nuclear antigen (PCNA), complexed onto DNA. This mechanism thus provides a direct link between DNA synthesis and RNR regulation. PMID:22464192

  15. Hypoxia-ischemia induces DNA synthesis without cell proliferation in dying neurons in adult rodent brain.

    PubMed

    Kuan, Chia-Yi; Schloemer, Aryn J; Lu, Aigang; Burns, Kevin A; Weng, Wei-Lan; Williams, Michael T; Strauss, Kenneth I; Vorhees, Charles V; Flavell, Richard A; Davis, Roger J; Sharp, Frank R; Rakic, Pasko

    2004-11-24

    Recent studies suggest that postmitotic neurons can reenter the cell cycle as a prelude to apoptosis after brain injury. However, most dying neurons do not pass the G1/S-phase checkpoint to resume DNA synthesis. The specific factors that trigger abortive DNA synthesis are not characterized. Here we show that the combination of hypoxia and ischemia induces adult rodent neurons to resume DNA synthesis as indicated by incorporation of bromodeoxyuridine (BrdU) and expression of G1/S-phase cell cycle transition markers. After hypoxia-ischemia, the majority of BrdU- and neuronal nuclei (NeuN)-immunoreactive cells are also terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL)-stained, suggesting that they undergo apoptosis. BrdU+ neurons, labeled shortly after hypoxia-ischemia, persist for >5 d but eventually disappear by 28 d. Before disappearing, these BrdU+/NeuN+/TUNEL+ neurons express the proliferating cell marker Ki67, lose the G1-phase cyclin-dependent kinase (CDK) inhibitors p16INK4 and p27Kip1 and show induction of the late G1/S-phase CDK2 activity and phosphorylation of the retinoblastoma protein. This contrasts to kainic acid excitotoxicity and traumatic brain injury, which produce TUNEL-positive neurons without evidence of DNA synthesis or G1/S-phase cell cycle transition. These findings suggest that hypoxia-ischemia triggers neurons to reenter the cell cycle and resume apoptosis-associated DNA synthesis in brain. Our data also suggest that the demonstration of neurogenesis after brain injury requires not only BrdU uptake and mature neuronal markers but also evidence showing absence of apoptotic markers. Manipulating the aberrant apoptosis-associated DNA synthesis that occurs with hypoxia-ischemia and perhaps neurodegenerative diseases could promote neuronal survival and neurogenesis.

  16. The Roles of Tryptophans in Primer Synthesis by the DNA Primase of Bacteriophage T7*

    PubMed Central

    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C.

    2012-01-01

    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step. PMID:22605336

  17. In vivo studies of the control of DNA synthesis in the rat adrenal cortex and medulla.

    PubMed

    McEwan, P E; Lindop, G B; Kenyon, C J

    1995-01-01

    The control of zonation in the adrenal cortex has been studied by measuring DNA synthesis using an analogue of thymidine, bromodeoxyuridine (BrDUrd). Groups of rats were infused with BrDUrd for 10-14 days whilst being treated with: high or low sodium diets; captopril; angiotensin II; dexamethasone; an inhibitor of nitric oxide synthesis, L-NAME. DNA synthesis in the zona glomerulosa was increased by low sodium food and angiotensin and was decreased by dexamethasone, captopril L-NAME and a high sodium diet. Dexamethasone, not manipulations of the renin-angiotensin system, affected DNA synthesis in the outer zona fasciculata. The BrDUrd index in the zona intermedia was unaffected by any of the treatments and was generally lower than in adjacent zona fasciculata and zona glomerulosa cells. Cells of the zona reticularis appeared to be regulated independent of the zona fasciculata. BrDUrd uptake in nuclei of the adrenal medulla was inversely related to blood pressure. We conclude that DNA synthesis in each adrenocortical zone is independently controlled. Migration of cells within zones after proliferation is likely.

  18. Antiinflammatory drug effects on ultraviolet light-induced epidermal ornithine decarboxylase and DNA synthesis

    SciTech Connect

    Lowe, N.J.; Breeding, J.

    1980-06-01

    Epidermal ornithine decarboxylase activity is greatly elevated in response to tumor promoting agents and ultraviolet light. The purpose of this paper is to report modification of ultraviolet-induced epidermal ornithine decarboxylase activity by antiinflammatory agents. Topical triamoinolone acetonide and indomethacin were found to significantly inhibit the UV-B induction of epidermal ornithine decarboxylase in hairless mice when applied following ultraviolet light irradiation. The corticosteroid also showed inhibition of ultraviolet light increased epidermal DNA synthesis. Indomethacin failed to show any inhibition of DNA synthesis.

  19. DNA synthesis in periportal and perivenous hepatocytes of intact and hepatectomized young mice.

    PubMed

    Fernández-Blanco, A; Inda, A M; Errecalde, A L

    2015-01-01

    DNA synthesis of hepatocytes in two areas of Intact and Hepatectomized young mice liver along a circadian period was studied. DNA synthesis was significantly different at all analyzed time points in Intact and Hepatectomized animals. Differences between periportal and perivenous hepatocytes were found in hepatectomized animals at 04/42 and 08/46 hr of day/hour post-hepatectomy. DNAs peak in periportal hepatocytes regenerating liver occurs 4 hr earlier than in perivenous hepatocytes, probably reflecting their shorter G1 phase. Besides, daily mean values of regenerating livers were higher than those observed in Intact animals, as a consequence of surgical removal.

  20. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  1. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  2. Stimulation of DNA synthesis in cultured rat alveolar type II cells

    SciTech Connect

    Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

    1985-01-01

    Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated /sup 3/H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of /sup 3/H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture.

  3. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  4. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  5. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  6. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development.

  7. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis.

  8. Post-synthesis DNA Modifications Using a trans-Cyclooctene Click Handle

    PubMed Central

    Wang, Ke; Wang, Danzhu; Ji, Kaili; Chen, Weixuan; Zheng, Yueqin; Dai, Chaofeng

    2015-01-01

    Post-synthesis DNA modification is a very useful method for DNA functionalization. This is achieved by using a modified NTP, which has a handle for further modifications, replacing the corresponding natural NTP in polymerase-catalyzed DNA synthesis. Subsequently, the handle can be used for further functionalization after PCR, preferably through a very fast reaction. Herein we describe polymerase-mediated incorporation of trans-cyclooctene modified thymidine triphosphate (TCO-TTP). Subsequently, the trans-cyclooctene group was reacted with a tetrazine tethered to other functional groups through a very fast click reaction. The utility of this DNA functionalization method was demonstrated with the incorporation of a boronic acid group and a fluorophore. The same approach was also successfully used in modifying a known aptamer for fluorescent labelling applications. PMID:25407744

  9. Post-synthesis DNA modifications using a trans-cyclooctene click handle.

    PubMed

    Wang, Ke; Wang, Danzhu; Ji, Kaili; Chen, Weixuan; Zheng, Yueqin; Dai, Chaofeng; Wang, Binghe

    2015-01-21

    Post-synthesis DNA modification is a very useful method for DNA functionalization. This is achieved by using a modified NTP, which has a handle for further modifications, replacing the corresponding natural NTP in polymerase-catalyzed DNA synthesis. Subsequently, the handle can be used for further functionalization after PCR, preferably through a very fast reaction. Herein we describe polymerase-mediated incorporation of trans-cyclooctene modified thymidine triphosphate (TCO-TTP). Subsequently, the trans-cyclooctene group was reacted with a tetrazine tethered to other functional groups through a very fast click reaction. The utility of this DNA functionalization method was demonstrated with the incorporation of a boronic acid group and a fluorophore. The same approach was also successfully used in modifying a known aptamer for fluorescent labelling applications.

  10. Continued DNA synthesis in replication checkpoint mutants leads to fork collapse.

    PubMed

    Sabatinos, Sarah A; Green, Marc D; Forsburg, Susan L

    2012-12-01

    Hydroxyurea (HU) treatment activates the intra-S phase checkpoint proteins Cds1 and Mrc1 to prevent replication fork collapse. We found that prolonged DNA synthesis occurs in cds1Δ and mrc1Δ checkpoint mutants in the presence of HU and continues after release. This is coincident with increased DNA damage measured by phosphorylated histone H2A in whole cells during release. High-resolution live-cell imaging shows that mutants first accumulate extensive replication protein A (RPA) foci, followed by increased Rad52. Both DNA synthesis and RPA accumulation require the MCM helicase. We propose that a replication fork "collapse point" in HU-treated cells describes the point at which accumulated DNA damage and instability at individual forks prevent further replication. After this point, cds1Δ and mrc1Δ forks cannot complete genome replication. These observations establish replication fork collapse as a dynamic process that continues after release from HU block.

  11. Simultaneous DNA-based diet analysis of breeding, non-breeding and chick Adélie penguins

    PubMed Central

    McInnes, Julie C.; Emmerson, Louise; Southwell, Colin; Faux, Cassandra; Jarman, Simon N.

    2016-01-01

    As central place foragers, breeding penguins are restricted in foraging range by the need to return to the colony to feed chicks. Furthermore, breeding birds must balance energetic gain from self-feeding with the costs of returning to provision young. Non-breeding birds, however, are likely to be less restricted in foraging range and lack the high energy demands of provisioning, therefore may consume different prey to breeders. We used DNA dietary analysis to determine whether there was a difference in provisioning and self-feeding diet by identifying prey DNA in scat samples from breeding and chick Adélie penguins at two locations in East Antarctica. We also investigated diet differences between breeders and non-breeders at one site. Although previous work shows changing foraging behaviour between chick provisioning and self-feeding, our results suggest no significant differences in the main prey groups consumed by chicks and breeders at either site or between breeding stages. This may reflect the inability of penguins to selectively forage when provisioning, or resources were sufficient for all foraging needs. Conversely, non-breeders were found to consume different prey groups to breeders, which may reflect less restricted foraging ranges, breeders actively selecting particular prey during breeding or reduced foraging experience of non-breeders. PMID:26909171

  12. DNA-mediated silver nanoclusters: synthesis, properties and applications.

    PubMed

    Latorre, Alfonso; Somoza, Álvaro

    2012-05-01

    Fluorescent DNA-AgNCs have emerged as an alternative to standard emitters because of their unique properties: high fluorescent quantum yield, photostability, a broad pallet of colors (blue to near-IR), and the fact that their properties are easily modulated by the DNA sequence and environment. Applications as gene, ion, or small-molecule sensors have been reported. PMID:22508551

  13. Stimulation of DNA and Collagen Synthesis by Autologous Growth Factor in Cultured Fetal Rat Calvaria

    NASA Astrophysics Data System (ADS)

    Canalis, Ernesto; Peck, William A.; Raisz, Lawrence G.

    1980-11-01

    Conditioned medium derived from organ or cell cultures prepared from 19- to 21-day fetal rat calvaria stimulated the incorporation of [3H]proline into collagen and of [3H]thymidine into DNA in organ cultures of the same tissue. Addition of cortisol enhanced the effect on collagen but not on DNA synthesis. These effects appeared to be due to a nondialyzable and heat-stable growth factor.

  14. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  15. Effect of hypolipidemic peroxisome proliferators on unscheduled DNA synthesis in cultured hepatocytes and on mutagenesis in Salmonella.

    PubMed

    Glauert, H P; Reddy, J K; Kennan, W S; Sattler, G L; Rao, V S; Pitot, H C

    1984-09-01

    The peroxisome proliferators Wy-14,643, BR-931, nafenopin and ciprofibrate were tested in the primary hepatocyte culture-unscheduled DNA synthesis assay and in the Ames Salmonella microsome mutagenicity assay. The amount of unscheduled DNA synthesis (UDS) in hepatocytes was determined by quantifying the amount of [3H]thymidine incorporated into DNA in the presence of hydroxyurea after isolation of nuclei from hepatocytes treated with the test agent. Wy-14,643 and BR-931 induced unscheduled DNA synthesis in rat hepatocytes, whereas nafenopin and ciprofibrate had no effect. All of the peroxisome proliferators were negative in the Ames Salmonella assay.

  16. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5'-flaps.

    PubMed

    Koc, Katrina N; Stodola, Joseph L; Burgers, Peter M; Galletto, Roberto

    2015-04-30

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3'-5' exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo(-) to carry out strand displacement synthesis and discovered that it is regulated by the 5'-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5'-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5'-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities.

  17. Adding Concrete Syntax to a Prolog-Based Program Synthesis System

    NASA Technical Reports Server (NTRS)

    Fischer, Bernd; Visser, Eelco

    2003-01-01

    Program generation and transformation systems manipulate large, pa- rameterized object language fragments. Support for user-definable concrete syntax makes this easier but is typically restricted to certain object and meta languages. We show how Prolog can be retrofitted with concrete syntax and describe how a seamless interaction of concrete syntax fragments with an existing legacy meta-programming system based on abstract syntax is achieved. We apply the approach to gradually migrate the schemas of the AUTOBAYES program synthesis system to concrete syntax. Fit experiences show that this can result in a considerable reduction of the code size and an improved readability of the code. In particular, abstracting out fresh-variable generation and second-order term construction allows the formulation of larger continuous fragments and improves the locality in the schemas.

  18. Value-added Synthesis of Graphene: Recycling Industrial Carbon Waste into Electrodes for High-Performance Electronic Devices.

    PubMed

    Seo, Hong-Kyu; Kim, Tae-Sik; Park, Chibeom; Xu, Wentao; Baek, Kangkyun; Bae, Sang-Hoon; Ahn, Jong-Hyun; Kim, Kimoon; Choi, Hee Cheul; Lee, Tae-Woo

    2015-01-01

    We have developed a simple, scalable, transfer-free, ecologically sustainable, value-added method to convert inexpensive coal tar pitch to patterned graphene films directly on device substrates. The method, which does not require an additional transfer process, enables direct growth of graphene films on device substrates in large area. To demonstrate the practical applications of the graphene films, we used the patterned graphene grown on a dielectric substrate directly as electrodes of bottom-contact pentacene field-effect transistors (max. field effect mobility ~0.36 cm(2)·V(-1)·s(-1)), without using any physical transfer process. This use of a chemical waste product as a solid carbon source instead of commonly used explosive hydrocarbon gas sources for graphene synthesis has the dual benefits of converting the waste to a valuable product, and reducing pollution.

  19. Value-added Synthesis of Graphene: Recycling Industrial Carbon Waste into Electrodes for High-Performance Electronic Devices

    NASA Astrophysics Data System (ADS)

    Seo, Hong-Kyu; Kim, Tae-Sik; Park, Chibeom; Xu, Wentao; Baek, Kangkyun; Bae, Sang-Hoon; Ahn, Jong-Hyun; Kim, Kimoon; Choi, Hee Cheul; Lee, Tae-Woo

    2015-11-01

    We have developed a simple, scalable, transfer-free, ecologically sustainable, value-added method to convert inexpensive coal tar pitch to patterned graphene films directly on device substrates. The method, which does not require an additional transfer process, enables direct growth of graphene films on device substrates in large area. To demonstrate the practical applications of the graphene films, we used the patterned graphene grown on a dielectric substrate directly as electrodes of bottom-contact pentacene field-effect transistors (max. field effect mobility ~0.36 cm2·V-1·s-1), without using any physical transfer process. This use of a chemical waste product as a solid carbon source instead of commonly used explosive hydrocarbon gas sources for graphene synthesis has the dual benefits of converting the waste to a valuable product, and reducing pollution.

  20. Value-added Synthesis of Graphene: Recycling Industrial Carbon Waste into Electrodes for High-Performance Electronic Devices

    PubMed Central

    Seo, Hong-Kyu; Kim, Tae-Sik; Park, Chibeom; Xu, Wentao; Baek, Kangkyun; Bae, Sang-Hoon; Ahn, Jong-Hyun; Kim, Kimoon; Choi, Hee Cheul; Lee, Tae-Woo

    2015-01-01

    We have developed a simple, scalable, transfer-free, ecologically sustainable, value-added method to convert inexpensive coal tar pitch to patterned graphene films directly on device substrates. The method, which does not require an additional transfer process, enables direct growth of graphene films on device substrates in large area. To demonstrate the practical applications of the graphene films, we used the patterned graphene grown on a dielectric substrate directly as electrodes of bottom-contact pentacene field-effect transistors (max. field effect mobility ~0.36 cm2·V−1·s−1), without using any physical transfer process. This use of a chemical waste product as a solid carbon source instead of commonly used explosive hydrocarbon gas sources for graphene synthesis has the dual benefits of converting the waste to a valuable product, and reducing pollution. PMID:26567845

  1. Value-added Synthesis of Graphene: Recycling Industrial Carbon Waste into Electrodes for High-Performance Electronic Devices.

    PubMed

    Seo, Hong-Kyu; Kim, Tae-Sik; Park, Chibeom; Xu, Wentao; Baek, Kangkyun; Bae, Sang-Hoon; Ahn, Jong-Hyun; Kim, Kimoon; Choi, Hee Cheul; Lee, Tae-Woo

    2015-01-01

    We have developed a simple, scalable, transfer-free, ecologically sustainable, value-added method to convert inexpensive coal tar pitch to patterned graphene films directly on device substrates. The method, which does not require an additional transfer process, enables direct growth of graphene films on device substrates in large area. To demonstrate the practical applications of the graphene films, we used the patterned graphene grown on a dielectric substrate directly as electrodes of bottom-contact pentacene field-effect transistors (max. field effect mobility ~0.36 cm(2)·V(-1)·s(-1)), without using any physical transfer process. This use of a chemical waste product as a solid carbon source instead of commonly used explosive hydrocarbon gas sources for graphene synthesis has the dual benefits of converting the waste to a valuable product, and reducing pollution. PMID:26567845

  2. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  3. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras.

    PubMed

    Roviello, G N; Gröschel, S; Pedone, C; Diederichsen, U

    2010-05-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the alpha-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy.

  4. DNA polymerase κ-dependent DNA synthesis at stalled replication forks is important for CHK1 activation

    PubMed Central

    Bétous, Rémy; Pillaire, Marie-Jeanne; Pierini, Laura; van der Laan, Siem; Recolin, Bénédicte; Ohl-Séguy, Emma; Guo, Caixia; Niimi, Naoko; Grúz, Petr; Nohmi, Takehiko; Friedberg, Errol; Cazaux, Christophe; Maiorano, Domenico; Hoffmann, Jean-Sébastien

    2013-01-01

    Formation of primed single-stranded DNA at stalled replication forks triggers activation of the replication checkpoint signalling cascade resulting in the ATR-mediated phosphorylation of the Chk1 protein kinase, thus preventing genomic instability. By using siRNA-mediated depletion in human cells and immunodepletion and reconstitution experiments in Xenopus egg extracts, we report that the Y-family translesion (TLS) DNA polymerase kappa (Pol κ) contributes to the replication checkpoint response and is required for recovery after replication stress. We found that Pol κ is implicated in the synthesis of short DNA intermediates at stalled forks, facilitating the recruitment of the 9-1-1 checkpoint clamp. Furthermore, we show that Pol κ interacts with the Rad9 subunit of the 9-1-1 complex. Finally, we show that this novel checkpoint function of Pol κ is required for the maintenance of genomic stability and cell proliferation in unstressed human cells. PMID:23799366

  5. Unscheduled DNA synthesis in human hair follicles after in vitro exposure to 11 chemicals: comparison with unscheduled DNA synthesis in rat hepatocytes.

    PubMed

    van Erp, Y H; Koopmans, M J; Heirbaut, P R; van der Hoeven, J C; Weterings, P J

    1992-06-01

    A new method is described to investigate unscheduled DNA synthesis (UDS) in human tissue after exposure in vitro: the human hair follicle. A histological technique was applied to assess cytotoxicity and UDS in the same hair follicle cells. UDS induction was examined for 11 chemicals and the results were compared with literature findings for UDS in rat hepatocytes. Most chemicals inducing UDS in rat hepatocytes raised DNA repair at comparable concentrations in the hair follicle. However, 1 of 9 chemicals that gave a positive response in the rat hepatocyte UDS test, 2-acetylaminofluorene, failed to induce DNA repair in the hair follicle. Metabolizing potential of hair follicle cells was shown in experiments with indirectly acting compounds, i.e., benzo[a]pyrene, 7,12-dimethylbenz[a]anthracene and dimethylnitrosamine. The results support the conclusion that the test in its present state is valuable as a screening assay for the detection of unscheduled DNA synthesis. Moreover, the use of human tissues may result in a better extrapolation to man.

  6. Synthesis of PCR-derived, single-stranded DNA probes suitable for in situ hybridization.

    PubMed

    Hannon, K; Johnstone, E; Craft, L S; Little, S P; Smith, C K; Heiman, M L; Santerre, R F

    1993-08-01

    We report the novel synthesis of polymerase chain reaction (PCR)-derived single-stranded DNA (ssDNA) probes and their subsequent application in in situ hybridizations. Serial transverse sections of an 11.5-day postcoitum mouse embryo were hybridized to a 33P-ssDNA, 33P-RNA, or 35S-RNA probe corresponding to the same 181-bp sequence in the myogenin cDNA. Signal obtained using 33P-ssDNA was more intense than that using 33P-RNA probe, while signal/noise ratios obtained with both 33P-probes were far superior to those obtained with 35S-probe. Digoxigenin-labeled chicken growth hormone (GH) ssDNA gave slightly more intense signal than did digoxigenin-labeled chicken GH RNA when hybridized to chicken pituitary sections. 32P-ssDNA probes were found to be suitable for Northern blot hybridization. Advantages of using ssDNA probes for in situ hybridization include: (1) The ssDNA technique is rapid and simple. There was no need to clone a DNA template into a special RNA vector or order special T7-containing PCR primers. ssDNA probes can be synthesized in less than 1 day using any primers which currently exist in a laboratory (optimal probe length for in situ hybridization is between 50 and 200 bp). (2) In three separate in situ experiments, ssDNA probes yielded more intense signal than RNA probes. (3) ssDNA probes are potentially more stable than RNA probes. (4) Since the RNAse rinse is eliminated, posthybridization rinses are shortened when hybridizing with ssDNA probes. The ssDNA probes produced by this protocol can be labeled with a variety of different isotopes (both radioactive and nonradioactive), and are excellent probes for use in in situ hybridizations.

  7. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E.

  8. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER.

  9. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  10. The effect of vinyl chloride monomer, chloroethylene oxide and chloracetaldehyde on DNA synthesis in regenerating rat liver.

    PubMed

    Border, E A; Webster, I

    1977-05-01

    Vinyl chloride monomer used in the manufacture of polyvinyl chloride is a chemical of increasing industrial importance but has recently been incriminated as a carcinogen, producing a mutagenic effect after being metabolized to active metabolites. The initial effect of vinyl chloride monomer and two of its presumed metabolites, chloracetaldehyde and chloroethylene oxide, on DNA synthesis was investigated in vivo in regenerating rat liver. The established control curve for the DNA synthesis rate after partial hepatectomy demonstrated two waves of synthetic activity at 21 and 30 h. Vinyl chloride, injected intravenously immediately on completion of the operation, depressed the first wave of DNA synthesis by 49.6%. The second peak of DNA synthetic activity was similar to that of the control. Chloracetaldehyde and chloroethylene oxide both produced similar effects on the first wave of DNA synthesis after partial hepatectomy, inhibiting the DNA synthesis rate by approx. 50%. After a regenerating period of 27 h, however, they produced very different effects, chloroethylene oxide raising the control DNA synthesis rate at 30 h by 49% while chloracetaldehyde tended to desynchronize the well-defined second peak of the control. The test compounds have been compared to literature reports of the inhibitory effects of various carcinogens on DNA synthesis.

  11. [Pseudo-furocoumarin: synthesis, DNA-binding behavior and cytotoxicity].

    PubMed

    Xie, Li-Juan; Chen, Zhuo

    2014-11-01

    Furocoumarin shows some antitumor activity when it is radiated by the UV light. In order to improve the antitumor activity of furocoumarin under standard environment conditions, the "minimal DNA-intercalating" hypothesis was firstly introduced to the structural modification of furocoumarin, which resulted in the design of pseudo-furocoumarin. The pseudo-furocoumarin was synthesized by two-step reaction including Pechmann reaction catalyzed by conc. H2SO4 and Suzuki coupling reaction catalyzed by Pd(PPh3)4. The structural character of the pseudo-furocoumarin is that the bonding mode of furan ring fused to the coumarin is replaced by a chemical single bond between furan ring and coumarin. The interaction of the pseudo-furocoumarin with calf thymus DNA (CT-DNA) has been respectively investigated by using DNA melting curve, UV-Vis absorption spectra, fluorescence spectra and viscosity titration, and the modes of DNA-binding for the pseudo-furocoumarin have been proposed. Based on the results of DNA melting curve, spectra and viscosity titration, it was suggested that 5a and 5b bind to DNA by the partial intercalation and classical intercalation, respectively. The DNA-binding behaviors of 5c and 5d have been rarely reported in literature and may be interpreted in terms of bridge-structure. All target compounds, except 5b, show a decreasing capability of intercalation to DNA. Further, the antiproliferative activities of the pseudo-furocoumarin on human lung adenocarcinoma (A549), human breast cancer (MCF-7) and human ovarian carcinoma cell line (SKOV-3) in vitro were evaluated using the sulforhodamine B (SRB) protein statin assay. All pseudo-furocoumarin exhibited an improved anti-proliferative activity as compared with the control compound psoralen (PS, a linear furocoumarin). Interestingly the pseudo-furocoumarin binding to DNA by a non-classical intercalation mode showed a stronger anti-proliferative activity than PS. The present study extended the applied areas of

  12. Synthesis and Antiplasmodial Evaluation of Analogues Based on the Tricyclic Core of Thiaplakortones A-D.

    PubMed

    Schwartz, Brett D; Coster, Mark J; Skinner-Adams, Tina S; Andrews, Katherine T; White, Jonathan M; Davis, Rohan A

    2015-09-01

    Six regioisomers associated with the tricyclic core of thiaplakortones A-D have been synthesized. Reaction of 1H-indole-4,7-dione and 1-tosyl-1H-indole-4,7-dione with 2-aminoethanesulfinic acid afforded a regioisomeric series, which was subsequently deprotected and oxidized to yield the tricyclic core scaffolds present in the thiaplakortones. All compounds were fully characterized using NMR and MS data. A single crystal X-ray structure was obtained on one of the N-tosyl derivatives. All compounds were screened for in vitro antiplasmodial activity against chloroquine-sensitive (3D7) and multidrug-resistant (Dd2) Plasmodium falciparum parasite lines. Several analogues displayed potent inhibition of P. falciparum growth (IC50 < 500 nM) but only moderate selectivity for P. falciparum versus human neonatal foreskin fibroblast cells. PMID:26389920

  13. Some Characteristics of DNA Synthesis and the Mitotic Cycle in Ehrlich Ascites Tumor Cells

    PubMed Central

    Edwards, Joshua L.; Koch, Arthur L.; Youcis, Pauline; Freese, Herbert L.; Laite, Melville B.; Donalson, J. Thomas

    1960-01-01

    In vivo studies of Ehrlich ascites tumor cells during the first 5 days of growth in peritoneal cavities of mice consisted of the following: 1. Determination of growth curves by direct enumeration of cells. 2. Estimation of the duration of each phase of the mitotic cycle based on incidence of cells in different phases. 3. Radioautographic studies to determine the proportion of cells in different phases of the mitotic cycle that incorporate tritiated thymidine during a single brief exposure to this precursor of DNA. 4. Estimation of the rate of incorporation of tritiated thymidine at different times during the period of DNA synthesis by comparison of mean grain counts over nuclei in radioautographs at different times following exposure to tritiated thymidine. The assumptions underlying these experiments and our observations concerning the duration of the period of DNA synthesis and its relation to the mitotic cycle are discussed. It is concluded that DNA synthesis is continuous, occupying a period of 8.5 hours during the interphase and that the average rate of synthesis is approximately constant. PMID:13819420

  14. Design, synthesis, and characterization of nucleosomes containing site-specific DNA damage.

    PubMed

    Taylor, John-Stephen

    2015-12-01

    How DNA damaged is formed, recognized, and repaired in chromatin is an area of intense study. To better understand the structure activity relationships of damaged chromatin, mono and dinucleosomes containing site-specific damage have been prepared and studied. This review will focus on the design, synthesis, and characterization of model systems of damaged chromatin for structural, physical, and enzymatic studies.

  15. Effect of hypertonicity and X radiation on DNA synthesis in normal and ataxia-telangiectasia cells

    SciTech Connect

    Painter, R.B.; Young, B.R.

    1982-12-01

    Normal human cells and cells from patients with ataxia-telangiectasia (A-T) were exposed to culture medium made hypertonic by raising the NaCl concentration. The rate of DNA synthesis in both types of cells was depressed as a function of increasing hypertonicity. When cells of both types were exposed to X radiation and incubated in hypertonic medium, DNA synthesis appeared to be more radioresistant than in cells incubated in normal medium. Velocity sedimentation analysis showed that this was due to a hypertonicity-induced inhibition of replicon initiation, which is the same process affected by X radiation, indicating that the two treatments were not additive. After a 5-hr incubation in hypertonic medium, there was a new steady state of replicon initiation and elongation similar to that existing in cells grown in normal medium, except that fewer replicons were participating. At this time DNA synthesis in each type of cell had a characteristic response to radiation, i.e., radiosenstivie in normal cells and radioresistant in A-T cells. These results suggest that radioresistant DNA synthesis in A-T cells is not due to increased condensation of chromatin.

  16. DNA-directed in vitro synthesis of proteins involved in bacterial transcription and translation.

    PubMed Central

    Zarucki-Schulz, T; Jerez, C; Goldberg, G; Kung, H F; Huang, K H; Brot, N; Weissbach, H

    1979-01-01

    The in vitro synthesis of elongation factor (EF)-Tu (tufB), the beta beta' subunits of RNA polymerase, ribosomal proteins L10 and L12 directed by DNA from the transducing phage lambda rifd 18, EF-Tu (tufA), EF-G, and the alpha subunit of RNA polymerase directed by DNA from the transducing phage lambda fus3 has been investigated in a crude and a partially defined protein-synthesizing system. Proteins L10 and L12 are synthesized in the partially defined system almost as well as in the crude system. However, the synthesis of EF-Tu, EF-G, and the alpha and beta beta' subunits of RNA polymerase is far less efficient in the partially defined system. An active fraction that stimulates the synthesis of these latter proteins has been obtained by fractionation of a high-speed supernatant on DEAE-cellulose. Because previous studies showed that this fraction (1 M DEAE salt eluate) contains a protein, called L factor, that stimulates beta-galactosidase synthesis in vitro, L factor was tested for activity. Although L factor stimulates the synthesis of the beta beta' subunits, it has little or no effect on the in vitro synthesis of the other products studied. In the present experiments, the ratio of L12/L10 and of EF-Tu (tufA)/EF-G formed is 4-6. These values are consistent with in vivo results. Images PMID:160561

  17. Alternative solutions and new scenarios for translesion DNA synthesis by human PrimPol.

    PubMed

    Martínez-Jiménez, María I; García-Gómez, Sara; Bebenek, Katarzyna; Sastre-Moreno, Guillermo; Calvo, Patricia A; Díaz-Talavera, Alberto; Kunkel, Thomas A; Blanco, Luis

    2015-05-01

    PrimPol is a recently described DNA polymerase that has the virtue of initiating DNA synthesis. In addition of being a sensu stricto DNA primase, PrimPol's polymerase activity has a large capacity to tolerate different kind of lesions. The different strategies used by PrimPol for DNA damage tolerance are based on its capacity to "read" certain lesions, to skip unreadable lesions, and as an ultimate solution, to restart DNA synthesis beyond the lesion thus acting as a TLS primase. This lesion bypass potential, revised in this article, is strengthened by the preferential use of moderate concentrations of manganese ions as the preferred metal activator. We show here that PrimPol is able to extend RNA primers with ribonucleotides, even when bypassing 8oxoG lesions, suggesting a potential new scenario for PrimPol as a TLS polymerase assisting transcription. We also show that PrimPol displays a high degree of versatility to accept or induce distortions of both primer and template strands, creating alternative alignments based on microhomology that would serve to skip unreadable lesions and to connect separate strands. In good agreement, PrimPol is highly prone to generate indels at short nucleotide repeats. Finally, an evolutionary view of the relationship between translesion synthesis and primase functions is briefly discussed.

  18. Microinjected pBR322 stimulates cellular DNA synthesis in Swiss 3T3 cells.

    PubMed Central

    Hyland, J K; Hirschhorn, R R; Avignolo, C; Mercer, W E; Ohta, M; Galanti, N; Jonak, G J; Baserga, R

    1984-01-01

    When pBR322 is manually microinjected into the nuclei of quiescent Swiss 3T3 cells it stimulates the incorporation of [3H]thymidine into DNA. The evidence clearly shows that this increased incorporation that is detected by in situ autoradiography in microinjected cells represents cellular DNA synthesis and not DNA repair or plasmid replication. The effect is due to pBR322 and not due to impurities, mechanical perturbances due to the microinjection technique, or aspecific effects. This stimulation is striking in Swiss 3T3 cells. Some NIH 3T3 cells show a slight stimulation, but hamster cells, derived from baby hamster kidney (BHK) cells, are not stimulated when microinjected with pBR322. The preliminary evidence seems to indicate that the integrity of the pBR322 genome is important for the stimulation of cellular DNA synthesis in quiescent Swiss 3T3 cells. These results, although of a preliminary nature, are of interest because they indicate that a prokaryotic genome may alter the cell cycle of mammalian cells. From a practical point of view the stimulatory effect of microinjected pBR322 on cellular DNA synthesis has a more immediate interest, because pBR322 is the vector most commonly used for molecular cloning and 3T3 cells are very frequently used for gene transfer experiments. Images PMID:6582497

  19. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  20. Template strand scrunching during DNA gap repair synthesis by human polymerase [lamda

    SciTech Connect

    Garcia-Diaz, Miguel; Bebenek, Katarzyna; Larrea, Andres A.; Havener, Jody M.; Perera, Lalith; Krahn, Joseph M.; Pedersen, Lars C.; Ramsden, Dale A.; Kunkel, Thomas A.

    2009-09-25

    Family X polymerases such as DNA polymerase {lambda}(Pol {lambda}) are well suited for filling short gaps during DNA repair because they simultaneously bind both the 5{prime} and 3{prime} ends of short gaps. DNA binding and gap filling are well characterized for 1-nucleotide (nt) gaps, but the location of yet-to-be-copied template nucleotides in longer gaps is unknown. Here we present crystal structures revealing that, when bound to a 2-nt gap, Pol {lambda} scrunches the template strand and binds the additional uncopied template base in an extrahelical position within a binding pocket that comprises three conserved amino acids. Replacing these amino acids with alanine results in less processive gap filling and less efficient NHEJ when 2-nt gaps are involved. Thus, akin to scrunching by RNA polymerase during transcription initiation, scrunching occurs during gap filling DNA synthesis associated with DNA repair.

  1. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  2. Changes in the amplitude of cyclic load biphasically modulate endothelial cell DNA synthesis and division.

    PubMed

    Upchurch, G R; Loscalzo, J; Banes, A J

    1997-01-01

    Several physical factors, including shear stress and cyclic load, modulate the ability of endothelial cells to respond to injury. The objective of these experiments was to test the hypothesis that cyclic mechanical load stimulates endothelial cell DNA synthesis and division in vitro. Rabbit aortic endothelial cells were cultured on Flex I flexible-bottomed culture plates, and subjected to load amplitudes of increasing magnitude (0, 0.18, 0.24 and 0.27 load at 1 Hz) using a Flexercell strain unit. Cells were harvested enzymatically and cell numbers determined on days 1, 3 and 5 after initiating the load regimen. DNA synthesis was quantified after trichloroacetic acid precipitation of [3H]thymidine-labeled cells from: (1) whole culture wells and (2) areas of minimum and maximum strain in culture cells. Data were analyzed using analysis of variance and a Tukey's test (n = 6 observations/strain regimen per day in triplicate). Results from analysis of endothelial cells in whole, subconfluent cultures showed that cells subjected to strains of 0.18 had a decreased rate of cell division (76% of control) and DNA synthesis (63% of control), while cells subjected to strains of 0.24 and 0.27 had an increased rate of cell division (108 and 83% increase, respectively, compared with control; p < 0.001) and DNA synthesis (39 and 172% increase, respectively, compared with control; p < 0.001 for 0.27) on day 3 when compared with control cells. The results indicate that endothelial cells respond to various physiologic levels of cyclic load in a biphasic manner to initiate DNA synthesis and cell division. These data suggest that endothelial cell mitogenesis may be modulated by specific levels of cyclic load. PMID:9546945

  3. Site Specific Synthesis and in-situ Immobilization of Fluorescent Silver Nanoclusters on DNA Nanoscaffolds Using Tollens Reaction

    SciTech Connect

    Pal, Suchetan; Varghese, R.; Deng, Z.; Zhao, Z.; Kumar, A.; Yan, Hao; Liu, Yan

    2011-04-06

    DNA strands with specific sequences and covalently attached sugar moieties were used for the site-specific incorporation of the sugar units on a DNA origami scaffold. This approach enabled the subsequent site-specific synthesis and in situ immobilization of fluorescent Ag clusters at predefined positions on the DNA nanoscaffold by treatment with the Tollens reagent.

  4. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  5. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction.

  6. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans.

  7. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  8. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    SciTech Connect

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  9. Wheat DNA Primase (RNA Primer Synthesis in Vitro, Structural Studies by Photochemical Cross-Linking, and Modulation of Primase Activity by DNA Polymerases).

    PubMed Central

    Laquel, P.; Litvak, S.; Castroviejo, M.

    1994-01-01

    DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187

  10. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering.

  11. Design and synthesis of threading intercalators to target DNA.

    PubMed

    Howell, Lesley A; Gulam, Rosul; Mueller, Anja; O'Connell, Maria A; Searcey, Mark

    2010-12-01

    Threading intercalators are high affinity DNA binding agents that bind by inserting a chromophore into the duplex and locating one group in each groove. The first threading intercalators that can be conjugated to acids, sulfonic acids and peptides to target them to duplex DNA are described, based upon the well studied acridine-3- or 4-carboxamides. Cellular uptake of the parent acridine is rapid and it can be visualized in the nucleus of cells. Both the parent compounds and their conjugates maintain antitumor activity.

  12. Further purification and characterization of a multienzyme complex for DNA synthesis in human cells.

    PubMed

    Li, C; Cao, L G; Wang, Y L; Baril, E F

    1993-12-01

    The 21 S complex of enzymes for DNA synthesis in the combined low salt nuclear extract-post microsomal supernatant from HeLa cells [Malkas et al. (1990) Biochemistry 29:6362-6374] was purified by poly (ethylene glycol) precipitation, Q-Sepharose chromatography, Mono Q Fast Protein Liquid Chromatography (FPLC), and velocity gradient centrifugation. The procedure gives purified enzyme complex at a yield of 45%. The 21 S enzyme complex remains intact and functional in the replication of simian virus 40 DNA throughout the purification. Sedimentation analysis showed that the 21 S enzyme complex exists in the crude HeLa cell extract and that simian virus 40 in vitro DNA replication activity in the cell extract resides exclusively with the 21 S complex. The results of enzyme and immunological analysis indicate that DNA polymerase alpha-primase, a 3',5' exonuclease, DNA ligase I, RNase H, and topoisomerase I are associated with the purified enzyme complex. Denaturing polyacrylamide gel electrophoresis of the purified enzyme complex showed the presence of about 30 polypeptides in the size range of 300 to 15 kDa. Immunofluorescent imaging analysis, with antibodies to DNA polymerase alpha,beta and DNA ligase I, showed that polymerase alpha and DNA ligase I are localized to granular-like foci within the nucleus during S-phase. In contrast, DNA polymerase beta, which is not associated with the 21 S complex, is diffusely distributed throughout the nucleoplasm. PMID:8300757

  13. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  14. Synthesis of base-modified 2'-deoxyribonucleoside triphosphates and their use in enzymatic synthesis of modified DNA for applications in bioanalysis and chemical biology.

    PubMed

    Hocek, Michal

    2014-11-01

    The synthesis of 2'-deoxyribonucleoside triphosphates (dNTPs) either by classical triphosphorylation of nucleosides or by aqueous cross-coupling reactions of halogenated dNTPs is discussed. Different enzymatic methods for synthesis of modified oligonucleotides and DNA by polymerase incorporation of modified nucleotides are summarized, and the applications in redox or fluorescent labeling, as well as in bioconjugations and modulation of interactions of DNA with proteins, are outlined.

  15. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  16. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.

    PubMed

    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng

    2015-01-01

    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  17. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  18. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  19. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  20. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  1. Pyrosequencing for the quantitative assessment of 8-oxodG bypass DNA synthesis.

    PubMed

    Nachtergael, Amandine; Belayew, Alexandra; Duez, Pierre

    2014-10-01

    Translesion synthesis (TLS) with specialized DNA polymerases allows dealing with a base lesion on the template strand during DNA replication; a base is inserted opposite the lesion, correctly or incorrectly, depending on the lesion, the involved DNA polymerase(s) and the sequence context. The major oxidized DNA base 8-oxo-7, 8-dihydro-2'-deoxyguanosine (8-oxodG) is highly mutagenic due to its ability to pair with either cytosine or adenine during DNA synthesis, depending on its conformation and involved DNA polymerases. To measure the correct or mutagenic outcome of lesion bypass, an original quantitative pyrosequencing method was developed and analytically validated. The method was applied to the study of DNA synthesis fidelity through an 8-oxodG or an undamaged guanine. After an in vitro primer-extension through 8-oxodG in the presence of the four deoxynucleotides triphosphates and a total nuclear protein extract, obtained from normal human intestinal epithelial cells (FHs 74 Int cell line), the reaction products were amplified by polymerase chain reaction and analyzed by pyrosequencing to measure nucleotides inserted opposite the lesion. The 8-oxodG bypass fidelity of FHs 74 Int cells nuclear extract is about 85.3%. We calculated within-day and total precisions for both 8-oxodG (2.8% and 2.8%, respectively) and undamaged templates (1.0% and 1.1%, respectively). We also demonstrated that only cytosine is incorporated opposite a normal guanine and that both cytosine and adenine can be incorporated opposite an 8-oxodG lesion. The proposed method is straightforward, fast, reproducible and easily adaptable to other sequences and lesions. It thus has a wide range of applications in the biological field, notably to elucidate TLS mechanisms and modulators. PMID:25200840

  2. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully.

  3. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  4. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis

    PubMed Central

    Hamdan, Samir M.; Loparo, Joseph J.; Takahashi, Masateru; Richardson, Charles C.; van Oijen, Antoine M.

    2009-01-01

    In all organisms, the protein machinery responsible for the replication of DNA, the replisome, is faced with a directionality problem. The antiparallel nature of duplex DNA permits the leading-strand polymerase to advance in a continuous fashion, but forces the lagging-strand polymerase to synthesize in the opposite direction. By extending RNA primers, the lagging-strand polymerase restarts at short intervals and produces Okazaki fragments1,2. At least in prokaryotic systems, this directionality problem is solved by the formation of a loop in the lagging strand of the replication fork to reorient the lagging-strand DNA polymerase so that it advances in parallel with the leading-strand polymerase. The replication loop grows and shrinks during each cycle of Okazaki-fragment synthesis3. Here, we employ single-molecule techniques to visualize, in real time, the formation and release of replication loops by individual replisomes of bacteriophage T7 supporting coordinated DNA replication. Analysis of the distributions of loop sizes and lag times between loops reveals that initiation of primer synthesis and the completion of an Okazaki fragment each serve as a trigger for loop release. The presence of two triggers may represent a fail-safe mechanism ensuring the timely reset of the replisome after the synthesis of every Okazaki fragment. PMID:19029884

  5. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  6. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors

    SciTech Connect

    Wong, R.L.; Gutowski, J.K.; Katz, M.; Goldfarb, R.H.; Cohen, S.

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-..cap alpha..-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These finding are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor the authors have called ADR may be a protease itself.

  7. Cytoplasmic DNA synthesis in Amoeba proteus. I. On the particulate nature of the DNA-containing elements.

    PubMed

    RABINOVITCH, M; PLAUT, W

    1962-12-01

    The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 micro particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H(3)-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles.

  8. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  9. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives.

    PubMed

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; da Silva, Lúcia Patrícia Bezerra Gomes; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Ruiz, Ana Lucia Tasca Gois; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a-h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 10(4) to 1.0 × 10(6) M(-1) and quenching constants from -0.2 × 10(4) to 2.18 × 10(4) M(-1) indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N- (4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  10. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  11. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  12. Synthesis and biological activity of benzamide DNA minor groove binders.

    PubMed

    Khan, Gul Shahzada; Pilkington, Lisa I; Barker, David

    2016-02-01

    A range of di- and triaryl benzamides were synthesised to investigate the effect of the presence and nature of a polar sidechain, bonding and substitution patterns and functionalisation of benzylic substituents. These compounds were tested for their antiproliferative activity as well as their DNA binding activity. The most active compounds in all assays were unsymmetrical triaryl benzamides with a bulky or alkylating benzylic substituent and a polar amino sidechain.

  13. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  14. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  15. Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.

    PubMed

    Ortega, Janice; Li, Jessie Y; Lee, Sanghee; Tong, Dan; Gu, Liya; Li, Guo-Min

    2015-05-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in eukaryotic cells during DNA replication, DNA mismatch repair (MMR), and other events at the replication fork. Earlier studies show that PCNA is regulated by posttranslational modifications, including phosphorylation of tyrosine 211 (Y211) by the epidermal growth factor receptor (EGFR). However, the functional significance of Y211-phosphorylated PCNA remains unknown. Here, we show that PCNA phosphorylation by EGFR alters its interaction with mismatch-recognition proteins MutSα and MutSβ and interferes with PCNA-dependent activation of MutLα endonuclease, thereby inhibiting MMR at the initiation step. Evidence is also provided that Y211-phosphorylated PCNA induces nucleotide misincorporation during DNA synthesis. These findings reveal a novel mechanism by which Y211-phosphorylated PCNA promotes cancer development and progression via facilitating error-prone DNA replication and suppressing the MMR function.

  16. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  17. RNA primer used in synthesis of anticomplementary DNA by reverse transcriptase of avian myeloblastosis virus.

    PubMed Central

    Myers, J C; Dobkin, C; Spiegelman, S

    1980-01-01

    When either the homologous RNA (avian myeloblastosis virus RNA) or a heterologous RNA (poliovirus RNA) was used as a template, the anticomplementary DNA synthesized in vitro by avian myeloblastosis virus reverse transcriptase (RNA-directed DNA nucleotidyltransferase, EC 2.7.7.7) was primed by fragments of the original RNA template that usually had adenosine at their 3' ends. When we used phage T/ RNA ligase (EC 6.5.1.3) to label the 3' end of the RNA template fragments contained in the RNA . cDNA hybrid intermediate, adenosine was found to be the principal nucleoside carrying the label. We infer from these results that the ribonuclease H (hybrid nuclease) activity of the reverse transcriptase creates fragments of the original RNA template with adenosine as the principal 3' terminus and that these fragments serve as primers for the synthesis of anticomplementary DNA. Images PMID:6154930

  18. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  19. Effect of low molecular weight epidermal material upon DNA synthesis in primary cultures of newborn rat keratinocytes

    SciTech Connect

    Abler, A.S.

    1985-01-01

    The objective of this study was to isolate inhibitors of replicative DNA synthesis from newborn rat epidermis. The strategy for this study was to assay epidermal extracts for inhibitors of DNA synthesis in primary cultures of newborn rat keratinocytes. DNA synthesis was measured as the incorporation of /sup 4/H-TdR into acid precipitable material. The low molecular weight fraction, LMWF (less than 10Kd), of an aqueous epidermal extract was found to contain activity that inhibits replicative DNA synthesis in primary cultures. The inhibitory activity of the LMWD was detected in a novel assay utilizing primary cultures that were synchronized at the G1/S boundary with the DNA polymerase alpha inhibitor, aphidicolin. LMWF caused a dose dependent inhibition of replicative DNA synthesis as measured by the incorporation of /sup 3/H-TdR into acid precipitable material. The magnitude of the inhibitory effect for a given dose of LMWF was dependent upon the duration of exposure to that dose. The results presented in this investigation suggest that newborn rat epidermis contains a small polypeptide factor that inhibits replicative DNA synthesis in primary culture of newborn rat keratinocytes.

  20. DNA extraction: an anthropologic aspect of bone remains from sixth- to seventh-century ad bone remains.

    PubMed

    Di Nunno, Nunzio; Saponetti, Sandro Sublimi; Scattarella, Vito; Emanuel, Patrizia; Baldassarra, Stefania Lonero; Volpe, Giuliano; Di Nunno, Cosimo

    2007-12-01

    In the archeological site of the early Christian Episcopal complex of Saint Peter, in Canosa di Puglia (Bari, Italy), during the operations of archaeological excavations, tombs were discovered. They were dated between the sixth and seventh centuries ad with carbon 14 methodology. Five skeletons were found in the 5 tombs: 28A: male individual, 43 years old. The height was 170 cm; the biomass was 65.7 kg. The analysis of the bones indicated several noteworthy pathologies, such as a number of hypoplasia lines of the enamel, the presence of Schmorl hernias on the first 2 lumbar vertebrae, and the outcome of subacromial impingement syndrome. 28E was a male individual, with a biologic age of death of between 44 and 60 years. The height was 177 cm. He had a posttraumatic fracture callus of the medial third of the clavicle, with an oblique fracture rima. 29B was a female individual, 44-49 years old. The height was 158.8 cm; the biomass was 64.8 kg. There was Wells bursitis on the ischial tuberosity on both sides. 29E was a male individual, 45-50 years old. The height was 169.47 cm; the biomass was 70.8 kg. The third and the fourth vertebrae showed Baastrup syndrome (compression of the vertebral spine). There were radiologic signs of deformity on the higher edge of the acetabula and results of frequent sprains of the ankles. 31A was a male individual, 47-54 years old. The height was 178.65 cm; the biomass was 81 kg. The vertebral index showed a heavy overloading in the thoracic lumbar region. There were bony formations under the periosteum on both on the higher and medium facets of the first metatarsus and on the higher and lateral facets of the fifth metatarsus on both sides. As the topography indicates, these small ossifications coincided with the contact points between the back of the foot and parts of the upper shoe. From the osseous remains, in particular from the teeth (central incisors), the DNA was extracted and typed to identify potential family ties among all the

  1. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  2. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  3. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  4. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  5. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  6. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  7. An autoradiographic study of DNA synthesis in lymphoid cells of leucotic and healthy cattle.

    PubMed

    Rodák, L; Procházka, Z

    1976-01-01

    The present study on 3H-thymidine incorporation using the histouatoradiographic method showed that spontaneous DNA synthesis occurred, on average, in 0.526 (+/- 0.233) per cent of lymphoid cells in 19 cattle with the normal blood picture (6,355+/-1,866 leucocytes/cu. mm). In 17 leucotic cattle with persistent leuco- and lymphocytosis (19,138+/-8,817 leucocytes/cu. mm) the proportion of these cells was insignificantly different, hovering about 0.554 (+/-0.191) per cent. The present sample did not include cases with marked changes in the blood picture (50,000-600,000 leucocytes/cu. mm) which occur in only 5-10 per cent of leucotic animals. This fact, however, could not influence the conclusion that even when used in conjunction with other methods, the determination of spontaneous DNA synthesis in peripheral lymphocytes is not a useful tool for the detection of preclinical phases of bovine leucosis.

  8. Enzymatic synthesis of a DNA triblock copolymer that is composed of natural and unnatural nucleotides.

    PubMed

    Mitomo, Hideyuki; Watanabe, Yukie; Matsuo, Yasutaka; Niikura, Kenichi; Ijiro, Kuniharu

    2015-02-01

    DNA molecules have come under the spotlight as potential templates for the fabrication of nanoscale products, such as molecular-scale electronic or photonic devices. Herein, we report an enhanced approach for the synthesis of oligoblock copolymer-type DNA by using the Klenow fragment exonuclease minus of E. coli DNA polymerase I (KF(-) ) in a multi-step reaction with natural and unnatural nucleotides. First, we confirmed the applicability of unnatural nucleotides with 7-deaza-nucleosides-which was expected because they were non-metalized nucleotides-on the unique polymerization process known as the "strand-slippage model". Because the length of the DNA sequence could be controlled by tuning the reaction time, analogous to a living polymerization reaction on this process, stepwise polymerization provided DNA block copolymers with natural and unnatural bases. AFM images showed that this DNA block copolymer could be metalized sequence-selectively. This approach could expand the utility of DNA as a template.

  9. Deoxyribonucleotide synthesis and DNA polymerase activity in plant cells (Vicia faba and Glycine max).

    PubMed

    Hovemann, B; Follmann, H

    1979-01-26

    Enzymes of deoxyribonucleotide and DNA biosynthesis, which are little known in plants, were studied in root tips of germinating broad beans (Vicia faba) and in fast-growing cultures of soybean cells (Glycine max). The plant cells contain a ribonucleoside 5'-diphosphate reductase which is detected in vitro only during a limited period of growth, viz. 30--32 h after inhibition of Vicia seeds, and between the second and third day after inoculation of soybean cultures. In both species ribonucleotide reductase activity precedes maximum DNA synthesis. The reductases could be precipitated with ammonium sulfate but were not purified further due to the extremely low enzyme content of the plant extracts. Therefore the reductive pathway of deoxyribotide formation was also established in Vicia root tips by efficient labeling of the plant DNA with a ribonucleoside, [5-3H]cytidine, which reaches a maximum at the same time as the reductase activity measured in vitro. Cycloheximide inhibits this process, indicating the need for de novo enzyme induction. In contrast, DNA polymerase is present in the tissue throughout the entire development and rises only 2-fold in activity during the S phase. The soluble polymerases were partially characterized in both legume species and were found very similar to the DNA polymerase of pea seedlings. Ribonucleotide reductase is more likely a limiting component of DNA formation during the plant cell cycle than DNA polymerase.

  10. Design and synthesis of fluorescence-labeled nucleotide with a cleavable azo linker for DNA sequencing.

    PubMed

    Tan, Lianjiang; Liu, Yazhi; Yang, Qinglai; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

    2016-01-18

    A cleavable azo linker was synthesized and reacted with 5-(6)-carboxytetramethyl rhodamine succinimidyl ester, followed by further reactions with di(N-succinimidyl) carbonate and 5-(3-amino-1-propynyl)-2'-deoxyuridine 5'-triphosphate [dUTP(AP3)] to obtain the terminal product dUTP-azo linker-TAMRA as a potential reversible terminator for DNA sequencing by synthesis with no need for 3'-OH blocking. PMID:26587573

  11. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  12. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  13. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  14. Total synthesis of the antitumor natural product polycarcin V and evaluation of its DNA binding profile.

    PubMed

    Cai, Xiao; Ng, Kevin; Panesar, Harmanpreet; Moon, Seong-Jin; Paredes, Maria; Ishida, Keishi; Hertweck, Christian; Minehan, Thomas G

    2014-06-01

    The convergent total synthesis of polycarcin V, a gilvocarcin-type natural product that shows significant cytotoxicity with selectivity for nonsmall-cell lung cancer, breast cancer, and melanoma cells, has been achieved in 13 steps from 7, 8, and 22; the sequence features a stereoselective α-C-glycosylation reaction for the union of protected carbohydrate 7 and naphthol 8. The association constant for the binding of polycarcin V to duplex DNA is similar to that previously reported for gilvocarcin V.

  15. Polymerase Synthesis and Restriction Enzyme Cleavage of DNA Containing 7-Substituted 7-Deazaguanine Nucleobases.

    PubMed

    Mačková, Michaela; Boháčová, Soňa; Perlíková, Pavla; Poštová Slavětínská, Lenka; Hocek, Michal

    2015-10-12

    Previous studies of polymerase synthesis of base-modified DNAs and their cleavage by restriction enzymes have mostly related only to 5-substituted pyrimidine and 7-substituted 7-deazaadenine nucleotides. Here we report the synthesis of a series of 7-substituted 7-deazaguanine 2'-deoxyribonucleoside 5'-O-triphosphates (dG(R) TPs), their use as substrates for polymerase synthesis of modified DNA and the influence of the modification on their cleavage by type II restriction endonucleases (REs). The dG(R) TPs were generally good substrates for polymerases but the PCR products could not be visualised on agarose gels by intercalator staining, due to fluorescence quenching. The presence of 7-substituted 7-deazaguanine residues in recognition sequences of REs in most cases completely blocked the cleavage.

  16. Decreased UV-induced DNA repair synthesis in peripheral leukocytes from patients with the nevoid basal cell carcinoma syndrome

    SciTech Connect

    Ringborg, U.; Lambert, B.; Landergen, J.; Lewensohn, R.

    1981-04-01

    The uv-induced DNA repair synthesis in peripheral leukocytes from 7 patients with the nevoid basal cell carcinoma syndrome was compared to that in peripheral leukocytes from 5 patients with basal cell carcinomas and 39 healthy subjects. A dose response curve was established for each individual, and maximum DNA repair synthesis was used as a measure of the capacity for DNA repair. The patients with the nevoid basal cell carcinoma syndrome had about 25% lower level of maximum DNA repair synthesis as compared to the patients with basal cell carcinomas and control individuals. The possibility that DNA repair mechanisms may be involved in the etiology to the nevoid basal cell carcinoma syndrome is discussed.

  17. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  18. DNA repair after ultraviolet irradiation of ICR 2A frog cells: pyrimidine dimers are long acting blocks to nascent DNA synthesis

    SciTech Connect

    Rosenstein, B.S.; Setlow, R.B.

    1980-08-01

    The ability of ICR 2A frog cells to repair DNA damage induced by ultraviolet irradiation was examined. These cells are capable of photoreactivation but are nearly totally deficient in excision repair. They have the ability to convert the small molecular weight DNA made after irradiation into large molecules but do not show an enhancement in this process when the UV dose is delivered in two separate exposures separated by a 3- or 24-h incubation. Total DNA synthesis is depressed and low molecular weight DNA continues to be synthesized during pulse-labeling as long as 48 h after irradiation. The effects of pyrimidine dimer removal through exposure of UV irradiated cells to photoreactivating light indicate that dimers act as the critical lesions blocking DNA synthesis.

  19. Temporal relationships of chromatin protein synthesis, DNA synthesis, and assembly of deoxyribonucleoprotein.

    PubMed Central

    Seale, R L

    1976-01-01

    Chromatin assembly has been investigated in terms of the sites on DNA where newly synthesized chromatin proteins associate. Chromatin from cells labeled with [14C]-BrdUrd and [3H]lysine was fixed with formaldehyde and resolved in CsCl gradients. By varying the spacing of the labeling intervals of the two isotopes so as to encompass all possible periods in S-phase, the association of labeled, newly synthesized proteins on newly synthesized (BrdUrd-substituted) or preexisting chromatin DNA was determined. In all experiments it was found that newly synthesized chromatin proteins predominantly associated with nonreplicating DNA. Possible mechanisms by which cells recycle preexisting chromatin proteins to restore the protein content of newly synthesized DNA are discussed. PMID:1065876

  20. A microfluidic DNA computing processor for gene expression analysis and gene drug synthesis.

    PubMed

    Zhang, Yu; Yu, Hao; Qin, Jianhua; Lin, Bingcheng

    2009-11-06

    Boolean logic performs a logical operation on one or more logic input and produces a single logic output. Here, we describe a microfluidic DNA computing processor performing Boolean logic operations for gene expression analysis and gene drug synthesis. Multiple cancer-related genes were used as input molecules. Their expression levels were identified by interacting with the computing related DNA strands, which were designed according to the sequences of cancer-related genes and the suicide gene. When all the expressions of the cancer-related genes fit in with the diagnostic criteria, positive diagnosis would be confirmed and then a complete suicide gene (gene drug) could be synthesized as an output molecule. Microfluidic chip was employed as an effective platform to realize the computing process by integrating multistep biochemical reactions involving hybridization, displacement, denaturalization, and ligation. By combining the specific design of the computing related molecules and the integrated functions of the microfluidics, the microfluidic DNA computing processor is able to analyze the multiple gene expressions simultaneously and realize the corresponding gene drug synthesis with simplicity and fast speed, which demonstrates the potential of this platform for DNA computing in biomedical applications.

  1. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  2. Managing DNA polymerases: coordinating DNA replication, DNA repair, and DNA recombination.

    PubMed

    Sutton, M D; Walker, G C

    2001-07-17

    Two important and timely questions with respect to DNA replication, DNA recombination, and DNA repair are: (i) what controls which DNA polymerase gains access to a particular primer-terminus, and (ii) what determines whether a DNA polymerase hands off its DNA substrate to either a different DNA polymerase or to a different protein(s) for the completion of the specific biological process? These questions have taken on added importance in light of the fact that the number of known template-dependent DNA polymerases in both eukaryotes and in prokaryotes has grown tremendously in the past two years. Most notably, the current list now includes a completely new family of enzymes that are capable of replicating imperfect DNA templates. This UmuC-DinB-Rad30-Rev1 superfamily of DNA polymerases has members in all three kingdoms of life. Members of this family have recently received a great deal of attention due to the roles they play in translesion DNA synthesis (TLS), the potentially mutagenic replication over DNA lesions that act as potent blocks to continued replication catalyzed by replicative DNA polymerases. Here, we have attempted to summarize our current understanding of the regulation of action of DNA polymerases with respect to their roles in DNA replication, TLS, DNA repair, DNA recombination, and cell cycle progression. In particular, we discuss these issues in the context of the Gram-negative bacterium, Escherichia coli, that contains a DNA polymerase (Pol V) known to participate in most, if not all, of these processes.

  3. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  4. One-pot synthesis of fluorescent oligonucleotide Ag nanoclusters for specific and sensitive detection of DNA.

    PubMed

    Lan, Guo-Yu; Chen, Wei-Yu; Chang, Huan-Tsung

    2011-01-15

    In this study, we prepared fluorescent, functional oligonucleotide-stabilized silver nanoclusters (FFDNA-Ag NCs) through one-pot synthesis and then employed them as probes for single nucleotide polymorphisms (SNPs). The FFDNA-Ag NCs were obtained through the NaBH(4)-mediated reduction of AgNO(3) in the presence of a DNA strand having the sequence 5'-C(12)-CCAGATACTCACCGG-3'. The specific DNA scaffold combines a fluorescent base motif (C(12)) and a specific sequence (CCAGATACTCACCGG) that recognizes a gene for fumarylacetoacetate hydrolase (FAH). The sensing mechanism of our new probe is based on the FFDNA-Ag NCs having different stabilities (fluorescence intensities) in solutions containing 150 mM NaCl in the absence and presence of perfect match DNA (DNA(pmt)). Under the optimal conditions (150 mM NaCl, 20 mM phosphate solution, pH 7.0), the fluorescence ratios of the FFDNA-Ag NC probes in the presence and absence of DNA(pmt), plotted against the concentration of DNA(pmt), was linear over the range 25-1000 nM (R(2)=0.98), with a limit of detection (S/N=3) of 14 nM. This cost-effective and simple FFDNA-Ag NC probe is sensitive and selective for SNPs of a gene for FAH.

  5. Transcriptional repressor ZBTB1 promotes chromatin remodeling and translesion DNA synthesis.

    PubMed

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A; D'Andrea, Alan D

    2014-04-10

    Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for proliferating cell nuclear antigen (PCNA) monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair.

  6. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  7. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  8. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  9. DNA damage-processing in E. coli: on-going protein synthesis is required for fixation of UV-induced lethality and mutation.

    PubMed

    Burger, Amanda; Raymer, Jenny; Bockrath, R

    2002-10-01

    UV irradiation of E. coli produces photoproducts in the DNA genome. In consequence, some bacteria lose viability (colony-forming ability) or remain viable as mutant cells. However, the end-points of viability inactivation (lethality) or mutation are determined by cellular processes that act on the UV-damaged DNA. We have investigated the in vivo time course for processes that deal with cyclobutane pyrimidine dimers (CPD) which can be specifically removed by photoreactivation (PR). At different times during post-UV incubation, samples were challenged with PR and assayed for viability or mutation. We used excision-defective E. coli B/r cells and worked under yellow light to avoid background PR. During post-UV incubation (0-100min) in fully supplemented defined medium, inactivation and mutation were initially significantly reversed by PR but the extent of this reversal decreased during continued incubation defining "fixation" of lethality or mutation, respectively. In contrast, if protein synthesis was restricted during the post-UV incubation, no fixation developed. When chloramphenicol was added to inhibit protein synthesis after 30min of supplemented post-UV incubation, at a time sufficient for expression of UV-induced protein(s), fixation of lethality or mutation was still annulled (no change in the effectiveness of PR developed). Lethality fixation did progress when protein synthesis was restricted and the cells were incubated in the presence of puromycin or were either clpP or clpX defective. We discuss these and related results to suggest (1) on-going protein synthesis is required in the fixation process for lethality and mutation to sustain an effective level of a hypothetical protein sensitive to ClpXP proteolysis and (2) this protein plays a critical role in the process leading to exchange between Pol III activity and alternative polymerase activities required as each cell deals with damage in template DNA.

  10. A simple and efficient enzymatic method for covalent attachment of DNA to cellulose. Application for hybridization-restriction analysis and for in vitro synthesis of DNA probes.

    PubMed Central

    Goldkorn, T; Prockop, D J

    1986-01-01

    Single-stranded DNAs (ssDNAs) were covalently bound by a simple and efficient enzymatic method to a solid support matrix and used to develop several new procedures for gene analysis. The novel procedure to prepare a ssDNA stably coupled to a solid support employed T4 DNA ligase to link covalently oligo (dT)-cellulose and (dA)-tailed DNA. Beginning with essentially any double stranded DNA the procedure generates a ssDNA linked by its 5' end to a cellulose matrix in a concentration of over 500 ng per mg. DNA from the plasmid pBR322 (4300 bp) and a fragment of the beta-globin gene (1800 bp) were coupled to the solid support and used for several experiments. The ssDNAs on the cellulose efficiently hybridized with as little as 5 pg of complementary double-stranded DNAs. The DNA hybrids formed on the solid support were specifically and efficiently cleaved by restriction endonucleases. These specific restriction cuts were utilized for the diagnosis of correct sequences. In addition, the ssDNA on the solid support served as an efficient template for the synthesis of complementary ssDNAs. The complementary synthesized ssDNAs were uniformly labeled, more than two kilobases in size, and largely full length. About 85% of the ssDNA linked to cellulose was available for the synthesis of complementary DNA, and after strand-separation, the preparation was reusable for the synthesis of additional complementary DNA. Images PMID:3024131

  11. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes.

  12. Transposon-mediated mutation of CYP76AD3 affects betalain synthesis and produces variegated flowers in four o'clock (Mirabilis jalapa).

    PubMed

    Suzuki, Mariko; Miyahara, Taira; Tokumoto, Hiroko; Hakamatsuka, Takashi; Goda, Yukihiro; Ozeki, Yoshihiro; Sasaki, Nobuhiro

    2014-11-01

    The variegated flower colors of many plant species have been shown to result from the insertion or excision of transposable elements into genes that encode enzymes involved in anthocyanin synthesis. To date, however, it has not been established whether this phenomenon is responsible for the variegation produced by other pigments such as betalains. During betalain synthesis in red beet, the enzyme CYP76AD1 catalyzes the conversion of L-dihydroxyphenylalanine (DOPA) to cyclo-DOPA. RNA sequencing (RNA-seq) analysis indicated that the homologous gene in four o'clock (Mirabilis jalapa) is CYP76AD3. Here, we show that in four o'clock with red perianths, the CYP76AD3 gene consists of one intron and two exons; however, in a mutant with a perianth showing red variegation on a yellow background, a transposable element, dTmj1, had been excised from the intron. This is the first report that a transposition event affecting a gene encoding an enzyme for betalain synthesis can result in a variegated flower phenotype. PMID:25151127

  13. Transposon-mediated mutation of CYP76AD3 affects betalain synthesis and produces variegated flowers in four o'clock (Mirabilis jalapa).

    PubMed

    Suzuki, Mariko; Miyahara, Taira; Tokumoto, Hiroko; Hakamatsuka, Takashi; Goda, Yukihiro; Ozeki, Yoshihiro; Sasaki, Nobuhiro

    2014-11-01

    The variegated flower colors of many plant species have been shown to result from the insertion or excision of transposable elements into genes that encode enzymes involved in anthocyanin synthesis. To date, however, it has not been established whether this phenomenon is responsible for the variegation produced by other pigments such as betalains. During betalain synthesis in red beet, the enzyme CYP76AD1 catalyzes the conversion of L-dihydroxyphenylalanine (DOPA) to cyclo-DOPA. RNA sequencing (RNA-seq) analysis indicated that the homologous gene in four o'clock (Mirabilis jalapa) is CYP76AD3. Here, we show that in four o'clock with red perianths, the CYP76AD3 gene consists of one intron and two exons; however, in a mutant with a perianth showing red variegation on a yellow background, a transposable element, dTmj1, had been excised from the intron. This is the first report that a transposition event affecting a gene encoding an enzyme for betalain synthesis can result in a variegated flower phenotype.

  14. Human DNA Polymerase ν Catalyzes Correct and Incorrect DNA Synthesis with High Catalytic Efficiency.

    PubMed

    Gowda, A S Prakasha; Moldovan, George-Lucian; Spratt, Thomas E

    2015-06-26

    DNA polymerase ν (pol ν) is a low fidelity A-family polymerase with a putative role in interstrand cross-link repair and homologous recombination. We carried out pre-steady-state kinetic analysis to elucidate the kinetic mechanism of this enzyme. We found that the mechanism consists of seven steps, similar that of other A-family polymerases. pol ν binds to DNA with a Kd for DNA of 9.2 nm, with an off-rate constant of 0.013 s(-1)and an on-rate constant of 14 μm(-1) s(-1). dNTP binding is rapid with Kd values of 20 and 476 μm for the correct and incorrect dNTP, respectively. Pyrophosphorylation occurs with a Kd value for PPi of 3.7 mm and a maximal rate constant of 11 s(-1). Pre-steady-state kinetics, examination of the elemental effect using dNTPαS, and pulse-chase experiments indicate that a rapid phosphodiester bond formation step is flanked by slow conformational changes for both correct and incorrect base pair formation. These experiments in combination with computer simulations indicate that the first conformational change occurs with rate constants of 75 and 20 s(-1); rapid phosphodiester bond formation occurs with a Keq of 2.2 and 1.7, and the second conformational change occurs with rate constants of 2.1 and 0.5 s(-1), for correct and incorrect base pair formation, respectively. The presence of a mispair does not induce the polymerase to adopt a low catalytic conformation. pol ν catalyzes both correct and mispair formation with high catalytic efficiency.

  15. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  16. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  17. Synthesis, chemical characterization, DNA binding and antioxidant studies of ferrocene incorporated selenoure

    NASA Astrophysics Data System (ADS)

    Hussain, Raja Azadar; Badshah, Amin; Sohail, Manzar; Lal, Bhajan; Akbar, Kamran

    2013-09-01

    In this article we have reported synthesis, chemical characterization (with single crystal XRD, elemental analysis, FTIR and multinuclear NMR spectroscopy), DNA binding (with cyclic voltammetry, UV-vis spectroscopy, molecular docking and viscometry) and antioxidant activities (1,1-diphenyl-2-picrylhydrazyl scavenging) of 1-(2-methylbenzoyl)-3-(3-ferrocenylphenyl)selenourea (MOT). We found that this compound interacts electrostatically with DNA and has a binding constant value of 1.703 × 104 M-1. Lower value of diffusion coefficient for MOT-DNA adduct (1.35 × 106 cm2 s-1) relative to free MOT (1.66 × 106 cm2 s-1) in cyclic voltammetry (CV) indicated the binding of the compound with DNA. Smaller value of binding site size (0.88 base pairs) in CV, hyperchromism in UV-vis spectroscopy and decrease of relative specific viscosity of DNA in viscometry favored electrostatic interactions. Binding energy of experimental (-5.77 kcal mol-1) and simulated (-5.86 kcal mol-1) work are in close agreement with each other. IC50 value of MOT for 1,1-diphenyl-2-picrylhydrazyl scavenging was found to be 27 μM.

  18. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    SciTech Connect

    Ching, A.S.L.; Berger, J.D.

    1986-11-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions.

  19. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells

    SciTech Connect

    Riabowol, K.T.; Vosatka, R.J.; Ziff, E.B.; Lamb, N.J.; Feramisco, J.R.

    1988-04-01

    Transcription of the protooncogene c-fos is increased >10-fold within minutes of treatment of fibroblasts with serum or purified growth factors. Recent experiments with mouse 3T3 cell lines containing inducible fos antisense RNA constructs have shown that induced fos antisense RNA transcripts cause either a marked inhibition of growth in continuously proliferating cells or, conversely, a minimal effect except during the transition from a quiescent (G/sub o/) state into the cell cycle. Since intracellular production of large amounts of antisense RNA does not completely block gene expression, the authors microinjected affinity-purified antibodies raised against fos to determine whether and when during the cell cycle c-fos expression was required for cell proliferation. Using this independent method, they found that microinjected fos antibodies efficiently blocked serum-stimulated DNA synthesis when injected up to 6 to 8 h after serum stimulation of quiescent REF-52 fibroblasts. Furthermore, when fos antibodies were injected into asynchronously growing cells, a consistently greater number of cells was prevented from synthesizing DNA than when cells were injected with nonspecific immunoglobulins. Thus, whereas the activity of c-fos may be necessary for transition of fibroblasts from G/sub o/ to G/sub 1/ of the cell cycle, its function is also required during the early G/sub 1/ portion of the cell cycle to allow subsequent DNA synthesis.

  20. Protein-Template-Directed Synthesis across an Acrolein-Derived DNA Adduct by Yeast Rev1 DNA Polymerase

    SciTech Connect

    Nair, Deepak T.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2008-07-08

    Acrolein is generated as the end product of lipid peroxidation and is also a ubiquitous environmental pollutant. Its reaction with the N{sup 2} of guanine leads to a cyclic {gamma}-HOPdG adduct that presents a block to normal replication. We show here the yeast Rev1 incorporates the correct nucleotide C opposite a permanently ring-closed form of {gamma}-HOPdG (PdG) with nearly the same efficiency as opposite an undamaged G. The structural bais of this action lies in the eviction of PdG adduct from the Rev1 active site, and the pairing of incoming dCTP with a surrogate' arginine residue. We also show that yeast Pol{zeta} can carry out the subsequent extension reaction. Together, our studies reveal how the exocyclic PdG adduct is accommodated in a DNA polymerase active site, and they show that the combined action of Rev1 and Pol{zeta} provides for accurate and efficient synthesis through this potentially carcinogenic DNA lesion.

  1. Nucleotides with altered hydrogen bonding capacities impede human DNA polymerase η by reducing synthesis in the presence of the major cisplatin DNA adduct.

    PubMed

    Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J

    2015-04-15

    Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.

  2. Transverse dipoles added to DNA chains by drug binding can induce inversion of the long-range chirality of DNA condensates.

    PubMed

    Samorĭ, B; Osipov, M A; Domini, I; Bartolini, A

    1993-12-01

    The addition of poly(ethylene glycol) (PEG) to a DNA solution induces phase separation of droplets of condensed DNA. These droplets possess liquid crystalline properties and their ordering is cholesteric. It was recently proved that daunomycin, by binding to DNA chains, inverts the long-range chirality of their tertiary packing into aggregates. The present paper suggests one possible mechanism by which this inversion can take place. Daunomycin bears a cationic group in its sugar residue. Its intercalation adds a helicoidal distribution of transverse dipoles to DNA chains. By this mechanism, in favourable cases, ionic or strongly polar groups in drugs which bind DNA can induce handedness inversion of the cholesteric ordering of its condensates. This inversion mechanism was tested experimentally using several, charged and uncharged, homologues of daunomycin. All those bearing the cationic ammonium group inverted the long-range chirality of the PEG-induced DNA mesomorphic state. The effects of the uncharged desamino homologues could not be evaluated because of their lower solubility and binding affinity for DNA.

  3. Design, synthesis and selection of DNA-encoded small-molecule libraries.

    PubMed

    Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

    2009-09-01

    Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase. PMID:19648931

  4. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus.

  5. Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

    SciTech Connect

    Weinberger, Florian Mehrkens, Dennis Starbatty, Jutta Nicol, Philipp Eschenhagen, Thomas

    2015-01-02

    Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activity and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.

  6. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  7. Total Synthesis of the Antitumor Natural Product Polycarcin V and Evaluation of Its DNA Binding Profile

    PubMed Central

    2015-01-01

    The convergent total synthesis of polycarcin V, a gilvocarcin-type natural product that shows significant cytotoxicity with selectivity for nonsmall-cell lung cancer, breast cancer, and melanoma cells, has been achieved in 13 steps from 7, 8, and 22; the sequence features a stereoselective α-C-glycosylation reaction for the union of protected carbohydrate 7 and naphthol 8. The association constant for the binding of polycarcin V to duplex DNA is similar to that previously reported for gilvocarcin V. PMID:24824354

  8. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.

    PubMed

    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao

    2016-09-01

    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  9. Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA.

    PubMed Central

    Meyers, C; Mayer, T J; Ozbun, M A

    1997-01-01

    The lack of a permissive system for the propagation of viral stocks containing abundant human papillomavirus (HPV) particles has hindered the study of infectivity and the early stages of HPV replication. The organotypic (raft) culture system has permitted the study of a number of the differentiation-specific aspects of HPV, including amplification of viral DNA, expression of late genes, and viral morphogenesis. However, these investigations have been limited to a single virus type, namely, HPV type 31 (HPV31). We have artificially introduced linearized HPV18 genomic DNA into primary keratinocytes by electroporation, followed by clonal expansion and induction of epithelial stratification and differentiation in organotypic culture. We report the synthesis of infectious HPV18 virions. Virus particles approximately 50 nm in diameter were observed by electron microscopy. HPV18 virions purified by isopycnic gradient were capable of infecting keratinocytes in vitro, as shown by the expression of multiple HPV18-specific, spliced transcripts. PMID:9311816

  10. Fabrication of polyurethane molecular stamps for the synthesis of DNA microarray

    NASA Astrophysics Data System (ADS)

    Liu, Zhengchun; He, Quanguo; Xiao, Pengfeng; He, Nongyao; Lu, Zuhong; Bo, Liang

    2001-10-01

    Polyurethane based on polypropylene glycol (PPG) and Toluene diisocyanate (TDI) using 3,3'-dichloride-4,4'- methylenedianiline (MOCA) as the crosslinker is presented for the first time to fabricate molecular stamps (PU stamps) for the synthesis of DNA microarray with contact procedure. The predictability of the process is achieved by utilizing commercially available starting materials. SEM analysis of the morphology of PU stamps and master showed that PU elastometer could replicate subtly the motherboard's patterns with high fidelity. It was proved from the contact angle measurement that PU stamps surface has good affinity with acetonitrile, which guarantee the well-distribution of DNA monomers on patterned stamps. Laser confocal fluorescence microscopy images of oligonucleotide arrays confirmed polyurethane is an excellent material for molecular stamps.

  11. Synthesis and antiproliferative activity of some new DNA-targeted alkylating pyrroloquinolines.

    PubMed

    Ferlin, M G; Dalla Via, L; Gia, O M

    2004-02-15

    Two novel DNA-direct alkylating agents, consisting of aniline mustard linked to an angular 3H-pyrrolo[3,2-f]quinoline nucleus, were synthetized and assayed for their in vitro antiproliferative activity. Simple convergent synthesis, consisting of separate preparation of 9-chloro-3H-pyrrolo[3,2-f]quinoline and p-amino-aniline derivatives, and following their linkage by substitution reactions 8a, b and 10, yielded the corresponding diol derivatives 7b and 9. Biological properties were evaluated with respect to cell growth inhibition, ability to form cross-links with DNA, and capacity to give rise to a molecular complex with the macromolecule for 7b, 8b, 9 and 10.

  12. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  13. Stability of the human polymerase δ holoenzyme and its implications in lagging strand DNA synthesis.

    PubMed

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-03-29

    In eukaryotes, DNA polymerase δ (pol δ) is responsible for replicating the lagging strand template and anchors to the proliferating cell nuclear antigen (PCNA) sliding clamp to form a holoenzyme. The stability of this complex is integral to every aspect of lagging strand replication. Most of our understanding comes from Saccharomyces cerevisae where the extreme stability of the pol δ holoenzyme ensures that every nucleobase within an Okazaki fragment is faithfully duplicated before dissociation but also necessitates an active displacement mechanism for polymerase recycling and exchange. However, the stability of the human pol δ holoenzyme is unknown. We designed unique kinetic assays to analyze the processivity and stability of the pol δ holoenzyme. Surprisingly, the results indicate that human pol δ maintains a loose association with PCNA while replicating DNA. Such behavior has profound implications on Okazaki fragment synthesis in humans as it limits the processivity of pol δ on undamaged DNA and promotes the rapid dissociation of pol δ from PCNA on stalling at a DNA lesion.

  14. Functional Role of NBS1 in Radiation Damage Response and Translesion DNA Synthesis.

    PubMed

    Saito, Yuichiro; Komatsu, Kenshi

    2015-01-01

    Nijmegen breakage syndrome (NBS) is a recessive genetic disorder characterized by increased sensitivity to ionizing radiation (IR) and a high frequency of malignancies. NBS1, a product of the mutated gene in NBS, contains several protein interaction domains in the N-terminus and C-terminus. The C-terminus of NBS1 is essential for interactions with MRE11, a homologous recombination repair nuclease, and ATM, a key player in signal transduction after the generation of DNA double-strand breaks (DSBs), which is induced by IR. Moreover, NBS1 regulates chromatin remodeling during DSB repair by histone H2B ubiquitination through binding to RNF20 at the C-terminus. Thus, NBS1 is considered as the first protein to be recruited to DSB sites, wherein it acts as a sensor or mediator of DSB damage responses. In addition to DSB response, we showed that NBS1 initiates Polη-dependent translesion DNA synthesis by recruiting RAD18 through its binding at the NBS1 C-terminus after UV exposure, and it also functions after the generation of interstrand crosslink DNA damage. Thus, NBS1 has multifunctional roles in response to DNA damage from a variety of genotoxic agents, including IR.

  15. Somatic Mutations in Catalytic Core of POLK Reported in Prostate Cancer Alter Translesion DNA Synthesis

    PubMed Central

    Yadav, Santosh; Mukhopadhyay, Sudurkia; Anbalagan, Muralidharan; Makridakis, Nick

    2015-01-01

    DNA Polymerase kappa is a Y-family polymerase that participates to bypass the damaged DNA known as translesion synthesis (TLS) polymerase. Higher frequency of mutations in DNA polymerase kappa (POLK) recently been reported in prostate cancer. We sequenced entire exons of the POLK gene on genomic DNA from 40 prostate cancers and matched normal samples. We identified 28% of patients have somatic mutations in the POLK gene of the prostate tumors. Mutations in these prostate cancers have somatic mutation spectra which is dominated by C-to-T transitions. In the current study we further investigate the effect of p.E29K, p.G154E, p.F155S, p.E430K, p.L442F and p.E449K mutations on the biochemical properties of the polymerase in vitro. Using TLS assay and nucleotide incorporation fidelity, following site directed mutagenesis bacterial expression and purification of the respective polymerase variants. We report that following missense mutations p.E29K, p.G154E, p.F155S, p.E430K and p.L442F significantly diminished the catalytic efficiencies of POLK in regards to the lesion bypass (AP site). POLK variants show extraordinarily low fidelity by mis-incorporating T, C, and G as compared to wild type. Taken together these results suggest that interfering with normal polymerase kappa function by these mutations may be involved in prostate carcinogenesis. PMID:26046662

  16. Error-prone translesion synthesis past DNA-peptide cross-links conjugated to the major groove of DNA via C5 of thymidine.

    PubMed

    Wickramaratne, Susith; Boldry, Emily J; Buehler, Charles; Wang, Yen-Chih; Distefano, Mark D; Tretyakova, Natalia Y

    2015-01-01

    DNA-protein cross-links (DPCs) are exceptionally bulky, structurally diverse DNA adducts formed in cells upon exposure to endogenous and exogenous bis-electrophiles, reactive oxygen species, and ionizing radiation. If not repaired, DPCs can induce toxicity and mutations. It has been proposed that the protein component of a DPC is proteolytically degraded, giving rise to smaller DNA-peptide conjugates, which can be subject to nucleotide excision repair and replication bypass. In this study, polymerase bypass of model DNA-peptide conjugates structurally analogous to the lesions induced by reactive oxygen species and DNA methyltransferase inhibitors was examined. DNA oligomers containing site-specific DNA-peptide conjugates were generated by copper-catalyzed [3 + 2] Huisgen cyclo-addition between an alkyne-functionalized C5-thymidine in DNA and an azide-containing 10-mer peptide. The resulting DNA-peptide conjugates were subjected to steady-state kinetic experiments in the presence of recombinant human lesion bypass polymerases κ and η, followed by PAGE-based assays to determine the catalytic efficiency and the misinsertion frequency opposite the lesion. We found that human polymerase κ and η can incorporate A, G, C, or T opposite the C5-dT-conjugated DNA-peptide conjugates, whereas human polymerase η preferentially inserts G opposite the lesion. Furthermore, HPLC-ESI(-)-MS/MS sequencing of the extension products has revealed that post-lesion synthesis was highly error-prone, resulting in mutations opposite the adducted site or at the +1 position from the adduct and multiple deletions. Collectively, our results indicate that replication bypass of peptides conjugated to the C5 position of thymine by human translesion synthesis polymerases leads to large numbers of base substitution and frameshift mutations.

  17. A pool of peptides extracted from wheat bud chromatin inhibits tumor cell growth by causing defective DNA synthesis

    PubMed Central

    2013-01-01

    Background We previously reported that a pool of low molecular weight peptides can be extracted by alkali treatment of DNA preparations obtained from prokaryotic and eukaryotic cells after intensive deproteinization. This class of peptides, isolated from wheat bud chromatin, induces growth inhibition, DNA damage, G2 checkpoint activation and apoptosis in HeLa cells. In this work we studied their mechanism of action by investigating their ability to interfere with DNA synthesis. Methods BrdUrd comet assays were used to detect DNA replication defects during S phase. DNA synthesis, cell proliferation, cell cycle progression and DNA damage response pathway activation were assessed using 3H-thymidine incorporation, DNA flow cytometry and Western blotting, respectively. Results BrdUrd labelling close to DNA strand discontinuities (comet tails) detects the number of active replicons. This number was significantly higher in treated cells (compared to controls) from entry until mid S phase, but markedly lower in late S phase, indicating the occurrence of defective DNA synthesis. In mid S phase the treated cells showed less 3H-thymidine incorporation with respect to the controls, which supports an early arrest of DNA synthesis. DNA damage response activation was also shown in both p53-defective HeLa cells and p53-proficient U2OS cells by the detection of the phosphorylated form of H2AX after peptide treatment. These events were accompanied in both cell lines by an increase in p21 levels and, in U2OS cells, of phospho-p53 (Ser15) levels. At 24 h of recovery after peptide treatment the cell cycle phase distribution was similar to that seen in controls and CDK1 kinase accumulation was not detected. Conclusion The data reported here show that the antiproliferative effect exhibited by these chromatin peptides results from their ability to induce genomic stress during DNA synthesis. This effect seems to be S-phase specific since surviving cells are able to progress through their

  18. Nuclear DNA synthesis in vitro is mediated via stable replication forks assembled in a temporally specific fashion in vivo.

    PubMed Central

    Heintz, N H; Stillman, B W

    1988-01-01

    A cell-free nuclear replication system that is S-phase specific, that requires the activity of DNA polymerase alpha, and that is stimulated three- to eightfold by cytoplasmic factors from S-phase cells was used to examine the temporal specificity of chromosomal DNA synthesis in vitro. Temporal specificity of DNA synthesis in isolated nuclei was assessed directly by examining the replication of restriction fragments derived from the amplified 200-kilobase dihydrofolate reductase domain of methotrexate-resistant CHOC 400 cells as a function of the cell cycle. In nuclei prepared from cells collected at the G1/S boundary of the cell cycle, synthesis of amplified sequences commenced within the immediate dihydrofolate reductase origin region and elongation continued for 60 to 80 min. The order of synthesis of amplified restriction fragments in nuclei from early S-phase cells in vitro appeared to be indistinguishable from that in vivo. Nuclei prepared from CHOC 400 cells poised at later times in the S phase synthesized characteristic subsets of other amplified fragments. The specificity of fragment labeling patterns was stable to short-term storage at 4 degrees C. The occurrence of stimulatory factors in cytosol extracts was cell cycle dependent in that minimal stimulation was observed with early G1-phase extracts, whereas maximal stimulation was observed with cytosol extracts from S-phase cells. Chromosomal synthesis was not observed in nuclei from G1 cells, nor did cytosol extracts from S-phase cells induce chromosomal replication in G1 nuclei. In contrast to chromosomal DNA synthesis, mitochondrial DNA replication in vitro was not stimulated by cytoplasmic factors and occurred at equivalent rates throughout the G1 and S phases. These studies show that chromosomal DNA replication in isolated nuclei is mediated by stable replication forks that are assembled in a temporally specific fashion in vivo and indicate that the synthetic mechanisms observed in vitro accurately

  19. Depletion of Kupffer cells modulates ethanol-induced hepatocyte DNA synthesis in C57Bl/6 mice.

    PubMed

    Owumi, Solomon E; Corthals, Stacy M; Uwaifo, Anthony O; Kamendulis, Lisa M; Klaunig, James E

    2014-08-01

    Kupffer cells (KCs) are important in hepatic homeostasis and responses to xenobiotics. KCs are activated on interaction with endotoxin, releasing cytokines, and reactive oxygen species normally associated with increased gene expression, cellular growth, or hepatic injury. Ethanol-induced endotoxemia is one means of KC activation. We propose that KC depletion attenuates the effect of EtOH-induced endotoxemia to impact the hepatic growth response. Hepatic DNA synthesis was examined in KC competent (KC+) or KC-depleted (KC-) C57BL/6 mice fed EtOH-containing diet in the presence or absence of polyphenol-60 antioxidant. KC depletion was assessed by F4/80 antigen, and DNA synthesis was assessed by 5-bromo-2'-deoxyuridine incorporation. Tumor necrosis factor alpha (TNF-α) messenger RNA released was quantified by RT-PCR/electrophoresis. ERK1/2 phosphorylation was evaluated by Western blotting, and Nrf2 and CYP2E1protein were also assayed. Apoptosis and hepatic injury were examined by the Tunnel assay and hepatic transaminases in serum, respectively. Hepatic transaminases in serum (AST and ALT) were within normal range. Over 90% of KC was depleted by clodronate treatment. KC depletion decreased TNF-α mRNA release, ERK1/2 phosphorylation, and hepatocyte DNA synthesis. KC depletion is associated with increased numbers of apoptotic cells bodies in KC- mice. Antioxidant treatment decreased DNA synthesis, Nrf2, and CYP2E1 protein expression in EtOH-consuming mice. Our data indicate that upon ethanol exposure, KC participates in hepatic DNA synthesis and growth responses. Collectively, these observations suggest that KC depletion attenuates the downstream effect of ethanol-induced endotoxemia by reduced cytokine and reactive oxygen species production with its concomitant effect on MAPK-signaling pathway on hepatocyte DNA synthesis.

  20. In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

    PubMed Central

    Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi

    2016-01-01

    The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888

  1. DNA synthesis index: higher for human gallbladders with cholesterol gallstones than with pigment gallstones

    SciTech Connect

    Lamote, J.; Putz, P.; Francois, M.; Willems, G.

    1983-09-01

    (/sup 3/H)dThd uptake by the gallbladder epithelium was estimated in 33 patients with cholesterol stones, in 13 patients with pigment stones, and in 12 gallbladders without stones. Proliferative parameters were estimated by autoradiography after in vitro incubation with (/sup 3/H)-dThd. Stones were identified by quantitative infrared spectroscopy. The degree of inflammation of the gallbladder wall was estimated by a histologic scoring method. In the gallbladders containing cholesterol stones the DNA synthesis index (1.39 +/- 0.28%) was higher (P less than .01) than in the gallbladders without stones (0.19 +/- 0.04%). No significant increase in proliferative parameters was found in the gallbladders with pigment stones (0.24 +/- 0.06%). No correlation was found between total stone number, weight or volume, and the DNA synthesis index. No evidence was observed that inflammation could influence the epithelial cell proliferation. Something in the bile of patients with cholesterol stones rather than the physical presence of stones may be the cause of the variations observed.

  2. Replication Protein A: Single-stranded DNA's first responder : Dynamic DNA-interactions allow Replication Protein A to direct single-strand DNA intermediates into different pathways for synthesis or repair

    PubMed Central

    Chen, Ran; Wold, Marc S.

    2015-01-01

    Summary Replication Protein A (RPA), the major single-stranded DNA-binding protein in eukaryotic cells, is required for processing of single-stranded DNA (ssDNA) intermediates found in replication, repair and recombination. Recent studies have shown that RPA binding to ssDNA is highly dynamic and that more than high-affinity binding is needed for function. Analysis of DNA binding mutants identified forms of RPA with reduced affinity for ssDNA that are fully active, and other mutants with higher affinity that are inactive. Single molecule studies showed that while RPA binds ssDNA with high affinity, the RPA complex can rapidly diffuse along ssDNA and be displaced by other proteins that act on ssDNA. Finally, dynamic DNA binding allows RPA to prevent error-prone repair of double-stranded breaks and promote error-free repair. Together, these findings suggest a new paradigm where RPA acts as a first responder at sites with ssDNA, thereby actively coordinating DNA repair and DNA synthesis. PMID:25171654

  3. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  4. DNA Methyltransferase protein synthesis is reduced in CXXC finger protein 1-deficient embryonic stem cells.

    PubMed

    Butler, Jill S; Palam, Lakshmi R; Tate, Courtney M; Sanford, Jeremy R; Wek, Ronald C; Skalnik, David G

    2009-05-01

    CXXC finger protein 1 (CFP1) binds to unmethylated CpG dinucleotides and is required for embryogenesis. CFP1 is also a component of the Setd1A and Setd1B histone H3K4 methyltransferase complexes. Murine embryonic stem (ES) cells lacking CFP1 fail to differentiate, and exhibit a 70% reduction in global genomic cytosine methylation and a 50% reduction in DNA methyltransferase (DNMT1) protein and activity. This study investigated the underlying mechanism for reduced DNMT1 expression in CFP1-deficient ES cells. DNMT1 transcript levels were significantly elevated in ES cells lacking CFP1, despite the observed reduction in DNMT1 protein levels. To address the posttranscriptional mechanisms by which CFP1 regulates DNMT1 protein activity, pulse/chase analyses were carried out, demonstrating a modest reduction in DNMT1 protein half-life in CFP1-deficient ES cells. Additionally, global protein synthesis was decreased in ES cells lacking CFP1, contributing to a reduction in the synthesis of DNMT1 protein. ES cells lacking CFP1 were found to contain elevated levels of phosphorylated eIF2alpha, and an accompanying reduction in translation initiation as revealed by a lower level of polyribosomes. These results reveal a novel role for CFP1 in the regulation of translation initiation, and indicate that loss of CFP1 function leads to decreased DNMT1 protein synthesis and half-life. PMID:19388845

  5. Insights into eukaryotic primer synthesis from structures of the p48 subunit of human DNA primase

    PubMed Central

    Vaithiyalingam, Sivaraja; Arnett, Diana R.; Aggarwal, Amit; Eichman, Brandt F.; Fanning, Ellen; Chazin, Walter J.

    2013-01-01

    DNA replication in all organisms requires polymerases to synthesize copies of the genome. DNA polymerases are unable to function on a bare template and require a primer. Primases are crucial RNA polymerases that perform the initial de novo synthesis, generating the first 8–10 nucleotides of the primer. Although structures of archaeal and bacterial primases have provided insights into general priming mechanisms, these proteins are not well conserved with heterodimeric (p48/p58) primases in eukaryotes. Here, we present X-ray crystal structures of the catalytic engine of a eukaryotic primase, which is contained in the p48 subunit. The structures of p48 reveal eukaryotic primases maintain the conserved catalytic prim fold domain, but with a unique sub-domain not found in the archaeal and bacterial primases. Calorimetry experiments reveal Mn2+ but not Mg2+ significantly enhances the binding of nucleotide to primase, which correlates with in vitro higher catalytic efficiency. The structure of p48 with bound UTP and Mn2+ provides insights into the mechanism of nucleotide synthesis by primase. Substitution of conserved residues involved in either metal or nucleotide binding altered nucleotide binding affinities, and yeast strains containing the corresponding Pri1p substitutions were not viable. Our results revealed two residues (S160 and H166) in direct contact with the nucleotide that were previously unrecognized as critical to the human primase active site. Comparing p48 structures to those of similar polymerases in different states of action suggests changes that would be required to attain a catalytically competent conformation capable of initiating dinucleotide synthesis. PMID:24239947

  6. Evidence that a critical threshold of DNA polymerase-alpha activity may be required for the initiation of DNA synthesis in mammalian cell heterokaryons.

    PubMed

    Pendergrass, W R; Saulewicz, A C; Burmer, G C; Rabinovitch, P S; Norwood, T H; Martin, G M

    1982-10-01

    The specific activity of DNA polymerase (90% alpha) was determined in nine "neoplastoid" cell lines (Martin and Sprague, 1973) and in three different strains of HDF (human diploid fibroblast-like cells), all examined in logarithmic phases of growth. This was compared to the ability of each cell type to "rescue" (reinitiate DNA synthesis in) senescent HDF cells subsequent to polyethylene glycol-mediated cell fusions. A sharp "threshold" value of DNA polymerase activity was observed below which reinitiation of DNA synthesis in heterokaryons with senescent HDF does not occur. This threshold was especially obvious when the specific activity of DNA polymerase (p moles dTTP incorporated per mg protein or per cell) was divided by the percent of S-phase cells present in each culture as determined by flow microfluorometry. Our results indicate that the specific activity of DNA polymerase-alpha (or some other factor tightly coregulated with it) in "recessive" cell types (those unable to rescue senescent cells) is only about two times this theoretical "threshold" value, and that fusion of recessive cell types to senescent HDF cells reduces the specific activity in the heterokaryon to below this minimum, thus preventing the cells from entering S phase.

  7. Measuring DNA synthesis rates with [1-13C]glycine.

    PubMed

    Chen, P; Abramson, F P

    1998-05-01

    We have devised and evaluated a stable-isotopic method for measuring DNA synthesis rates. The probe is [1-13C]-glycine that is incorporated into purines via de novo biosynthesis. The human hepatoma cell line HEP G2 was grown in medium containing [1-13C]glycine, the cells were harvested at various times, and the DNA was extracted. Following hydrolysis to the nucleosides, a reversed-phase HPLC separation was used to provide separate peaks for deoxythymidine (dT), deoxyadenosine (dA), and deoxyguanosine (dG). The HPLC effluent was continuously fed into a chemical reaction interface and an isotope ratio mass spectrometer (HPLC/CRI/IRMS). The isotope ratio of the CO2 produced in the CRI was used to monitor for enrichment. The cells were grown continuously for 5 days in labeled medium and also in a 1-day pulse labeling experiment where the washout of label was observed for the subsequent 9 days. As predicted from the role of glycine in de novo purine biosynthesis, the isotope ratio of the pyrimidine dT did not change. However, for the two purines, dA and dG, the characteristic log growth behavior of the cells was observed in their 13C/12C ratios and good agreement in the doubling time was obtained for each type of experiment. Parallel experiments that measured the HEP G2 doubling time in culture using tritiated thymidine incorporation and direct cell counts were carried out compare to our new method with established ones. We believe that the use of [1-13C]-glycine and the HPLC/CRI/IRMS is a highly sensitive and selective approach that forms the basis of a method that can measure DNA synthesis rates using a nonradioactive, nontoxic tracer. PMID:9599574

  8. Phospholipase C-delta1 expression is linked to proliferation, DNA synthesis, and cyclin E levels.

    PubMed

    Stallings, Jonathan D; Zeng, Yue X; Narvaez, Francisco; Rebecchi, Mario J

    2008-05-16

    We previously reported that phospholipase C-delta1 (PLC-delta1) accumulates in the nucleus at the G1/S transition, which is largely dependent on its binding to phosphatidylinositol 4,5-bisphosphate ( Stallings, J. D., Tall, E. G., Pentyala, S., and Rebecchi, M. J. (2005) J. Biol. Chem. 280, 22060-22069 ). Here, using small interfering RNA (siRNA) that specifically targets rat PLC-delta1, we investigated whether this enzyme plays a role in cell cycle control. Inhibiting expression of PLC-delta1 significantly decreased proliferation of rat C6 glioma cells and altered S phase progression. [3H]Thymidine labeling and fluorescence-activated cell sorting analysis indicated that the rates of G1/S transition and DNA synthesis were enhanced. On the other hand, knockdown cultures released from the G1/S boundary were slower to reach full G2/M DNA content, consistent with a delay in S phase. The levels of cyclin E, a key regulator of the G1/S transition and DNA synthesis, were elevated in asynchronous cultures as well as those blocked at the G1/S boundary. Epifluorescence imaging showed that transient expression of human phospholipase C-delta1, resistant to these siRNA, suppressed expression of cyclin E at the G1/S boundary despite treatment of cultures with rat-specific siRNA. Although whole cell levels of phosphatidylinositol 4,5-bisphosphate were unchanged, suppression of PLC-delta1 led to a significant rise in the nuclear levels of this phospholipid at the G1/S boundary. These results support a role for PLC-delta1 and nuclear phospholipid metabolism in regulating cell cycle progression.

  9. Synthesis of a multibranched porphyrin-oligonucleotide scaffold for the construction of DNA-based nano-architectures.

    PubMed

    Clavé, Guillaume; Chatelain, Grégory; Filoramo, Arianna; Gasparutto, Didier; Saint-Pierre, Christine; Le Cam, Eric; Piétrement, Olivier; Guérineau, Vincent; Campidelli, Stéphane

    2014-05-01

    The interest in the functionalization of oligonucleotides with organic molecules has grown considerably over the last decade. In this work, we report on the synthesis and characterization of porphyrin-oligonucleotide hybrids containing one to four DNA strands (P1-P4). The hybrid P4, which inserts one porphyrin and four DNA fragments, was combined with gold nanoparticles and imaged by transmission electron microscopy.

  10. Synthesis of gamma-substituted peptide nucleic acids: a new place to attach fluorophores without affecting DNA binding.

    PubMed

    Englund, Ethan A; Appella, Daniel H

    2005-08-01

    Molecular beacon strategies using PNA are currently restricted to fluorophore attachment to the ends of the PNA. We report the synthesis of PNA oligomers wherein fluorophores can be attached to the PNA backbone from novel gamma-lysine PNA monomers. Oligomers incorporating the modified PNA showed comparable thermal stability to the corresponding aegPNA oligomer with DNA. When the modified PNA oligomer was annealed with complementary DNA, the fluorescence intensity increased 4-fold over the unbound PNA. [structure: see text

  11. Nuclear DNA synthesis in vitro is mediated via stable replication forks assembled in a temporally specific fashion in vivo

    SciTech Connect

    Heintz, N.H.; Stillman, B.W.

    1988-05-01

    A cell-free nuclear replication system that is S-phase specific, that requires the activity of DNA polymerase alpha, and that is stimulated three- to eightfold by cytoplasmic factors from S-phase cells was used to examine the temporal specificity of chromosomal DNA synthesis in vitro. Temporal specificity of DNA synthesis in isolated nuclei was assessed directly by examining the replication of restriction fragments derived from the amplified 200-kilobase dihydrofolate reductase domain of methotrexate-resistant CHOC 400 cells as a function of the cell cycle. In nuclei prepared from cells collected at the G1/S boundary of the cell cycle, synthesis of amplified sequences commenced within the immediate dihydrofolate reductase origin region and elongation continued for 60 to 80 min. The order of synthesis of amplified restriction fragments in nuclei from early S-phase cells in vitro appeared to be indistinguishable from that in vivo. Nuclei prepared from CHOC 400 cells poised at later times in the S phase synthesized characteristic subsets of other amplified fragments. The specificity of fragment labeling patterns was stable to short-term storage at 4/sup 0/C. The occurrence of stimulatory factors in cytosol extracts was cell cycle dependent in that minimal stimulation was observed with early G1-phase extracts, whereas maximal stimulation was observed with cytosol extracts from S-phase cells. Chromosomal synthesis was not observed in nuclei from G1 cells, nor did cytosol extracts from S-phase cells induce chromosomal replication in G1 nuclei. In contrast to chromosomal DNA synthesis, mitochondrial DNA replication in vitro was not stimulated by cytoplasmic factors and occurred at equivalent rates throughout the G1 and S phases.

  12. Replitase: a complex integrating dNTP synthesis and DNA replication.

    PubMed

    Reddy, G P; Fager, R S

    1993-01-01

    Replitase is a multienzyme complex of mammalian cells that produces deoxynucleoside triphosphates and delivers them to the DNA polymerase activity, which also resides in the complex. Structural interactions within this complex form the basis of internal controls to keep these key biosynthetic processes efficient and in balance. The active complex is formed in the nuclear region in only the S phase of the cell cycle, when the cell's DNA is being replicated. Replitase is a member of the growing family of structured, multienzyme, biosynthetic complexes for which very similar complexes are found in prokaryotes and eukaryotes. Logically, the most basic of all biosynthetic pathways should show the efficiency and precise controls that even lesser pathways possess and, in fact, this seems to be so. In this article, we have outlined a broad range of evidence supporting the existence of the replitase complex in mammalian cells, a complex for dNTP synthesis and polymerase that exists only in the S phase and only in the nuclear region. This is consistent with localization studies in intact cells and after various forms of cell fractionation and, particularly, with experiments of incorporation of precursors into DNA in isolated complexes and S phase permeabilized cells. A most forceful argument for replitase is the existence of three striking phenomena--channeling, compartmentation, and cross-inhibition. These are very difficult, perhaps impossible, to explain without replitase; with replitase, their explanation is beautifully simple.

  13. Replication fork bypass of a pyrimidine dimer blocking leading strand DNA synthesis.

    PubMed

    Cordeiro-Stone, M; Zaritskaya, L S; Price, L K; Kaufmann, W K

    1997-05-23

    We constructed a double-stranded plasmid containing a single cis, syn-cyclobutane thymine dimer (T[c,s]T) 385 base pairs from the center of the SV40 origin of replication. This circular DNA was replicated in vitro by extracts from several types of human cells. The dimer was placed on the leading strand template of the first replication fork to encounter the lesion. Two-dimensional gel electrophoresis of replication intermediates documented the transient arrest of the replication fork by the dimer. Movement of the replication fork beyond the dimer was recognized by the appearance of a single fork arc in DNA sequences located between the T[c,s]T and the half-way point around the circular template (180 degrees from the origin). Upon completion of plasmid replication, the T[c,s]T was detected by T4 endonuclease V in about one-half (46 +/- 9%) of the closed circular daughter molecules. Our results demonstrate that extracts prepared from HeLa cells and SV40-transformed human fibroblasts (SV80, IDH4), including a cell line defective in nucleotide-excision repair (XPA), were competent for leading strand DNA synthesis opposite the pyrimidine dimer and replication fork bypass. In contrast, dimer bypass was severely impaired in otherwise replication-competent extracts from two different xeroderma pigmentosum variant cell lines.

  14. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  15. Synthesis of full length and truncated microcin B17 analogues as DNA gyrase poisons.

    PubMed

    Thompson, Robert E; Collin, Frédéric; Maxwell, Anthony; Jolliffe, Katrina A; Payne, Richard J

    2014-03-14

    Microcin B17 (MccB17) is a post-translationally modified peptide containing thiazole and oxazole heterocycles that interrupt the peptide backbone. MccB17 is capable of poisoning DNA gyrase through stabilization of the gyrase-DNA cleavage complex and has therefore attracted significant attention. Using a combination of Fmoc-strategy solid-phase peptide synthesis and solution-phase fragment assembly we have prepared a library of full-length and truncated MccB17 analogues to investigate key structural requirements for gyrase-poisoning activity. Synthetic peptides lacking the glycine-rich N-terminal portion of the full-length sequence showed strong stabilization of the gyrase-DNA cleavage complex with increased potency relative to the full-length sequences. This truncation, however, led to a decrease in antibacterial activity of these analogues relative to their full-length counterparts indicating a potential role of the N-terminal region of the natural product for cellular uptake.

  16. Nucleotide sequence of the DNA packaging and capsid synthesis genes of bacteriophage P2.

    PubMed Central

    Linderoth, N A; Ziermann, R; Haggård-Ljungquist, E; Christie, G E; Calendar, R

    1991-01-01

    Overlapping DNA fragments containing the DNA packaging and capsid synthesis gene region of bacteriophage P2 were cloned and sequenced. In this report we present the complete nucleotide sequence of this 6550 bp region. Each of six open reading frames found in the interval was assigned to one of the essential genes (Q, P, O, N, M and L) by correlating genetic, physical and mutational data with DNA and protein sequence information. Polypeptides predicted were: a capsid completion protein, gpL; the major capsid precursor, gpN; the presumed capsid scaffolding protein; gpO; the ATPase and proposed endonuclease subunits of terminase, gpP and gpM, respectively; and a candidate for the portal protein, gpQ. These gene and protein sequences exhibited no homology to analogous genes or proteins of other bacteriophages. Expression of gene Q in E. coli from a plasmid caused production of a Mr 39,000 Da protein that restored Qam34 growth. This sequence analysis found only genes previously known from analysis of conditional-lethal mutations. No new capsid genes were found. Images PMID:1837355

  17. Antiproliferative activity of bicyclic benzimidazole nucleosides: synthesis, DNA-binding and cell cycle analysis.

    PubMed

    Sontakke, Vyankat A; Lawande, Pravin P; Kate, Anup N; Khan, Ayesha; Joshi, Rakesh; Kumbhar, Anupa A; Shinde, Vaishali S

    2016-04-26

    An efficient route was developed for synthesis of bicyclic benzimidazole nucleosides from readily available d-glucose. The key reactions were Vörbruggen glycosylation and ring closing metathesis (RCM). Primarily, to understand the mode of DNA binding, we performed a molecular docking study and the binding was found to be in the minor groove region. Based on the proposed binding model, UV-visible and fluorescence spectroscopic techniques using calf thymus DNA (CT-DNA) demonstrated a non-intercalative mode of binding. Antiproliferative activity of nucleosides was tested against MCF-7 and MDA-MB-231 breast cancer cell lines and found to be active at low micromolar concentrations. Compounds and displayed significant antiproliferative activity as compared to and with the reference anticancer drug, doxorubicin. Cell cycle analysis showed that nucleoside induced cell cycle arrest at the S-phase. Confocal microscopy has been performed to validate the induction of cellular apoptosis. Based on these findings, such modified bicyclic benzimidazole nucleosides will make a significant contribution to the development of anticancer drugs. PMID:27074628

  18. Effect of aging and dietary restriction on DNA repair

    SciTech Connect

    Weraarchakul, N.; Strong, R.; Wood, W.G.; Richardson, A.

    1989-03-01

    DNA repair was studied as a function of age in cells isolated from both the liver and the kidney of male Fischer F344 rats. DNA repair was measured by quantifying unscheduled DNA synthesis induced by UV irradiation. Unscheduled DNA synthesis decreased approximately 50% between the ages of 5 and 30 months in both hepatocytes and kidney cells. The age-related decline in unscheduled DNA synthesis in cells isolated from the liver and kidney was compared in rats fed ad libitum and rats fed a calorie-restricted diet; calorie restriction has been shown to increase the survival of rodents. The level of unscheduled DNA synthesis was significantly higher in hepatocytes and kidney cells isolated from the rats fed the restricted diet. Thus, calorie restriction appears to retard the age-related decline in DNA repair.

  19. [Autoradiographic investigations on the effect of city smog extract on DNA synthesis and cell cycle of mammalian cells in vitro. I. Effect of city smog extract on DNA synthesis of kidney- and embryonic cells of the golden hamster in vitro (author's transl)].

    PubMed

    Krampitz, G; Seemayer, N

    1979-05-01

    We analysed the effect of city smog extract from Düsseldorf on DNA synthesis of mammalian cells in vitro. Airborne dust was extracted with aceton and thereafter transferred to dimethylsulfoxide. Dosage was calculated according to the benzo(a)pyrene content. We used logarithmically growing cultures of hamster kidney and embryonic cells. DNA synthesis was determined autoradiographically by incorporation of 3H-Thymidine. We found that city smog extract exerted a dose-dependent cytotoxic effect leading to a decrease of DNA synthesizing cells. High concentrations of city smog extract induced cell necrosis and suppressed DNA synthesis completely. Moderate doses of extract caused a dose-dependent, but temporary cessation of DNA synthesis. Cells resumed DNA synthesis after a certain delay. Low concentrations of city smog extract induced no detectable effects. Inhibition of DNA synthesis was evident already one hour after addition of extract. Therefore a direct effect on DNA metabolism could be supposed. Furthermore, exposed cultures demonstrated a delay in entrance of new cells into the DNA synthesis. Alterations in DNA synthesis could be of great importance for carcinogenesis, especially if we take in consideration the content of carcinogens in city smog extract.

  20. Temperature-sensitive mutants of herpes simplex virus type 2: description of three new complementation groups and studies on the inhibition of host cell DNA synthesis.

    PubMed

    Halliburton, I W; Timbury, M C

    1976-02-01

    Three new complementation groups of type 2 herpes simplex virus are described bringing the total number of complementation groups characterized to 13. Of the three new groups, ts 11 fails to make virus DNA at non-permissive temperature (38 degrees C) whereas ts 12 and ts 13 synthesize only very small amounts of virus or cellular DNA at 38 degrees C. ts 11, like ts 9 (Halliburton & Timbury, 1973) fails to switch off host cell DNA synthesis at 38 degrees C. That this is a failure to switch off cell DNA rather than a stimulation of cell DNA synthesis was confirmed in experiments using resting cells. Both the inability to make virus DNA and the inability to switch off cell DNA are reversed in temperature shift-down experiments with cells infected with ts 9 or ts 11. In temperature shift-up experiments, cellular DNA synthesis is inhibited after the shift but virus DNA is only made in very small amounts, probably due to the continuing functioning of a protein made at permissive temperature (31 degrees C) before the shift but which cannot be made at 38 degrees C. The shift-down experiments and the fact that ts 9 and ts 11 complement one another, suggest that the switch-off of host cell DNA synthesis may involve more than one virus specified function. U.v. irradiated virus fails to switch off host cell DNA synthesis.

  1. Repair synthesis by human cell extracts in cisplatin-damaged DNA is preferentially determined by minor adducts.

    PubMed Central

    Calsou, P; Frit, P; Salles, B

    1992-01-01

    During reaction of cis-diamminedichloroplatinum(II) (cis-DDP) with DNA, a number of adducts are formed which may be discriminated by the excision-repair system. An in vitro excision-repair assay with human cell-free extracts has been used to assess the relative repair extent of monofunctional adducts, intrastrand and interstrand cross-links of cis-DDP on plasmid DNA. Preferential removal of cis-DDP 1,2-intrastrand diadducts occurred in the presence of cyanide ions. In conditions where cyanide treatment removed 85% of total platinum adducts while approximately 70% of interstrand cross-links remained in plasmid DNA, no significant variation in repair synthesis by human cell extracts was observed. Then, we constructed three types of plasmid DNA substrates containing mainly either monoadducts, 1,2-intrastrand cross-links or interstrand cross-links lesions. The three plasmid species were modified in order to obtain the same extent of total platinum DNA adducts per plasmid. No DNA repair synthesis was detected with monofunctional adducts during incubation with human whole cell extracts. However, a two-fold increase in repair synthesis was found when the proportion of interstrand cross-links in plasmid DNA was increased by 2-3 fold. These findings suggest that (i) cis-DDP 1,2-intrastrand diadducts are poorly repaired by human cell extracts in vitro, (ii) among other minor lesions potentially cyanide-resistant, cis-DDP interstrand cross-links represent a major lesion contributing to the repair synthesis signal in the in vitro assay. These results could account for the drug efficiency in vivo. Images PMID:1475197

  2. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  3. Autocrine activities of basic fibroblast growth factor: regulation of endothelial cell movement, plasminogen activator synthesis, and DNA synthesis

    PubMed Central

    1988-01-01

    We have found that the spontaneous migration of bovine aortic endothelial cells from the edge of a denuded area in a confluent monolayer is dependent upon the release of endogenous basic fibroblast growth factor (bFGF). Cell movement is blocked by purified polyclonal rabbit IgG to bFGF as well as affinity purified anti-bFGF IgG and anti- bFGF F(ab')2 fragments. The inhibitory effect of the immunoglobulins is dependent upon antibody concentration, is reversible, is overcome by the addition of recombinant bFGF, and is removed by affinity chromatography of the antiserum through a column of bFGF-Sepharose. Cell movement is also reversibly inhibited by the addition of protamine sulfate and suramin; two agents reported to block bFGF binding to its receptor. The addition of recombinant bFGF to wounded monolayers accelerates the movement of cells into the denuded area. Transforming growth factor beta which has been shown to antagonize several other effects of bFGF also inhibits cell movement. The anti-bFGF IgG prevents the movement of bovine capillary endothelial cells, BHK-21, NIH 3T3, and human skin fibroblasts into a denuded area. Antibodies to bFGF, as well as suramin and protamine sulfate also suppress the basal levels of plasminogen activator and DNA synthesis in bovine aortic endothelial cells. PMID:3417781

  4. Sites of termination of in vitro DNA synthesis on ultraviolet- and N-acetylaminofluorene-treated phi X174 templates by prokaryotic and eukaryotic DNA polymerases

    SciTech Connect

    Moore, P.D.; Bose, K.K.; Rabkin, S.D.; Strauss, B.S.

    1981-01-01

    In vitro DNA synthesis on a phi X174 template primed with a restriction fragment and catalyzed by the Escherichia coli DNA polymerase I large (Klenow) fragment (pol I) terminates at the nucleotide preceding a site that has been altered by ultraviolet irradiation or treatment with N-acetylaminofluorene. Termination on ultraviolet-irradiated templates is similar when synthesis is catalyzed by E. coli DNA polymerase III holoenzyme (pol III), phage T4DNA polymerase a polymerase ..cap alpha.. from human lymphoma cells, or avian myeloblastosis virus reverse transcriptase. 3' ..-->.. 5' exonuclease activity cannot be detected in the reverse transcriptase and DNA polymerase ..cap alpha.. preparations. On N-acetylaminofluorene templates, pol I, pol III, and T4 polymerase reactions terminate immediately preceding the lesion, whereas reverse transcriptase-catalyzed reactions and, at some positions in the sequence, polymerase ..cap alpha..-catalyzed reactions terminate at the site of the lesion. Substitution of Mn/sup 2 +/ for Mg/sup 2 +/ changes the pattern of pol I-catalyzed termination sites. The data sugest that termination is a complicated process that does not depend exclusively on the 3' ..-->.. 5' exonuclease activity associated with many polymerases.

  5. Sites of termination of in vitro DNA synthesis on ultraviolet- and N-acetylaminofluorene-treated phi X174 templates by prokaryotic and eukaryotic DNA polymerases.

    PubMed

    Moore, P D; Bose, K K; Rabkin, S D; Strauss, B S

    1981-01-01

    In vitro DNA synthesis on a phi X174 template primed with a restriction fragment and catalyzed by the Escherichia coli DNA polymerase I large (Klenow) fragment (pol I) terminates at the nucleotide preceding a site that has been altered by ultraviolet irradiation or treatment with N-acetylaminofluorene. Termination on ultraviolet-irradiated templates is similar when synthesis is catalyzed by E. coli DNA polymerase III holoenzyme (pol III), phage T4 DNA polymerase, a polymerase alpha from human lymphoma cells, or avian myeloblastosis virus reverse transcriptase. 3' leads to 5' exonuclease activity cannot be detected in the reverse transcriptase and DNA polymerase alpha preparations. On N-acetylaminofluorene templates, pol I, pol III, and T4 polymerase reactions terminate immediately preceding the lesion, whereas reverse transcriptase-catalyzed reactions and, at some positions in the sequence, polymerase alpha-catalyzed reactions terminate at the site of the lesion. Substitution of Mn2+ for Mg2+ changes the pattern of pol I-catalyzed termination sites. The data suggest that termination is a complicated process that does not depend exclusively on the 3' leads to 5' exonuclease activity associated with many polymerases.

  6. UAP56 is a novel interacting partner of Bcr in regulating vascular smooth muscle cell DNA synthesis

    SciTech Connect

    Sahni, Abha; Wang, Nadan; Alexis, Jeffrey D.

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer UAP56 is an important regulator of DNA synthesis in vascular smooth muscle cells. Black-Right-Pointing-Pointer UAP56 binds to Bcr. Black-Right-Pointing-Pointer Interaction between Bcr and UAP56 is critical for Bcr induced DNA synthesis. -- Abstract: Bcr is a serine/threonine kinase that is a critical regulator of vascular smooth muscle cell inflammation and proliferation. We have previously demonstrated that Bcr acts in part via phosphorylation and inhibition of PPAR{gamma}. We have identified the RNA helicase UAP56 as another substrate of Bcr. In this report we demonstrate that knockdown of UAP56 blocks Bcr induced DNA synthesis in vascular smooth muscle cells (VSMC). We also found that over expression of Bcr increased the expression of cyclin E and decreased the expression of p27. Knockdown of UAP56 reversed the effect of Bcr on cyclin E and p27 expression. Furthermore, we found that Bcr binds to UAP56 and demonstrate that binding of UAP56 to Bcr is critical for Bcr induced DNA synthesis in VSMC. Our data identify UAP56 as an important binding partner of Bcr and a novel target for inhibiting vascular smooth muscle cell proliferation.

  7. SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE

    EPA Science Inventory

    SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE

    Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....

  8. Synthesis and spectroscopic studies of the aminoglycoside (neomycin)--perylene conjugate binding to human telomeric DNA.

    PubMed

    Xue, Liang; Ranjan, Nihar; Arya, Dev P

    2011-04-12

    Synthesis of a novel perylene-neomycin conjugate (3) and the properties of its binding to human telomeric G-quadruplex DNA, 5'-d[AG3(T2AG3)3] (4), are reported. Various spectroscopic techniques were employed to characterize the binding of conjugate 3 to 4. A competition dialysis assay revealed that 3 preferentially binds to 4, in the presence of other nucleic acids, including DNA, RNA, DNA-RNA hybrids, and other higher-order structures (single strands, duplexes, triplexes, other G-quadruplexes, and the i-motif). UV thermal denaturation studies showed that thermal stabilization of 4 increases as a function of the increasing concentration of 3. The fluorescence intercalator displacement (FID) assay displayed a significantly tighter binding of 3 with 4 as compared to its parent constituents [220-fold stronger than neomycin (1) and 4.5-fold stronger than perylene diamine (2), respectively]. The binding of 3 with 4 resulted in pronounced changes in the molar ellipticity of the DNA absorption region as confirmed by circular dichroism. The UV-vis absorption studies of the binding of 3 to 4 resulted in a red shift in the spectrum of 3 as well as a marked hypochromic change in the perylene absorption region, suggesting that the ligand-quadruplex interaction involves stacking of the perylene moiety. Docking studies suggest that the perylene moiety serves as a bridge that end stacks on 4, making contacts with two thymine bases in the loop, while the two neomycin moieties branch into the grooves of 4.

  9. Cell-free synthesis of the branched RNA-linked msDNA from retron-Ec67 of Escherichia coli.

    PubMed

    Hsu, M Y; Eagle, S G; Inouye, M; Inouye, S

    1992-07-15

    msDNA-Ec67 is produced in a clinical strain of Escherichia coli and composed of a 67-base single-stranded DNA, which is linked to the 2'-OH group of the 15th rG residue of a 58-base RNA molecule by a 2',5'-phosphodiester linkage (Lampson, B. C., Sun, J., Hsu, M.-Y., Vallejo-Ramirez, J., Inouye, S., and Inouye, M. (1989) Science 243, 1033-1038). The production of msDNA-Ec67 is dependent upon retron-Ec67, which consists of the msr-msd region and the gene for reverse transcriptase (RT). These two elements were separately cloned into plasmids; p67-BHO.6 contained the msr-msd region and pRT-67 contained the RT gene under the lpp-lac promoter-operator. msDNA-Ec67 was produced only when cells were transformed with both plasmids. In addition, msDNA-Ec67 was synthesized in a cell-free system using total RNA prepared from cells harboring plasmid p67-BHO.6 and purified Ec67-RT. Using this cell-free system, the priming reaction, during initiation of DNA synthesis, was demonstrated to be a specific template-directed event; only dTTP was incorporated into a 132-base precursor RNA yielding a 133-base compound. This specific dT addition could be altered to dA or dC by simply substituting the 118th A residue of the putative msr-msd transcript with a T or G residue. The priming reaction was blocked when A was substituted for G at the 15th residue of the precursor RNA transcript, which corresponds to the branched rG residue in msDNA. DNA chain elongation could be terminated by adding ddNTP in the cell-free system, forming a sequence ladder. The DNA sequence determined from this ladder completely agreed with the msDNA sequence. The RT extension reaction was completely blocked when the RNA preparation was treated with RNase A but not when the preparation was treated with DNase. This clearly demonstrates that RNA but not DNA is responsible for the msDNA production. A part of the fully extended cell-free product contained a 13-base RNA strand resistant to RNase A, which is consistent

  10. Contiguous 2,2,4-triamino-5(2H)-oxazolone obstructs DNA synthesis by DNA polymerases α, β, η, ι, κ, REV1 and Klenow Fragment exo-, but not by DNA polymerase ζ.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Kawada, Taishu; Oyoshi, Takanori; Morikawa, Masayuki; Kobayashi, Takanobu; Miyazawa, Hiroshi

    2016-03-01

    Guanine is the most easily oxidized of the four DNA bases, and contiguous guanines (GG) in a sequence are more readily oxidized than a single guanine in a sequence. Continued oxidation of GGs results in a contiguous oxidized guanine lesion. Two contiguous 2,5-diamino-4H-imidazol-4-ones, an oxidized form of guanine that hydrolyses to 2,2,4-triamino-5(2H)-oxazolone (Oz), are detected following the oxidation of GG. In this study, we analysed translesion synthesis (TLS) across two contiguous Oz molecules (OzOz) using Klenow Fragment exo(-) (KF exo(-)) and DNA polymerases (Pols) α, β, ζ, η, ι, κ and REV1. We found that KF exo(-) and Pols α, β, ι and REV1 inserted one nucleotide opposite the 3' Oz of OzOz and stalled at the subsequent extension, and that Pol κ incorporated no nucleotide. Pol η only inefficiently elongated the primer up to full-length across OzOz; the synthesis of most DNA strands stalled at the 3' or 5' Oz of OzOz. Surprisingly, however, Pol ζ efficiently extended the primer up to full-length across OzOz, unlike the other DNA polymerases, but catalysed error-prone nucleotide incorporation. We therefore believe that Pol ζ is required for efficient TLS of OzOz. These results show that OzOz obstructs DNA synthesis by DNA polymerases except Pol ζ.

  11. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  12. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids.

  13. Interaction between Escherichia coli DNA polymerase IV and single-stranded DNA-binding protein is required for DNA synthesis on SSB-coated DNA.

    PubMed

    Furukohri, Asako; Nishikawa, Yoshito; Akiyama, Masahiro Tatsumi; Maki, Hisaji

    2012-07-01

    DNA polymerase IV (Pol IV) is one of three translesion polymerases in Escherichia coli. A mass spectrometry study revealed that single-stranded DNA-binding protein (SSB) in lysates prepared from exponentially-growing cells has a strong affinity for column-immobilized Pol IV. We found that purified SSB binds directly to Pol IV in a pull-down assay, whereas SSBΔC8, a mutant protein lacking the C-terminal tail, failed to interact with Pol IV. These results show that the interaction between Pol IV and SSB is mediated by the C-terminal tail of SSB. When polymerase activity was tested on an SSBΔC8-coated template, we observed a strong inhibition of Pol IV activity. Competition experiments using a synthetic peptide containing the amino acid sequence of SSB tail revealed that the chain-elongating capacity of Pol IV was greatly impaired when the interaction between Pol IV and SSB tail was inhibited. These results demonstrate that Pol IV requires the interaction with the C-terminal tail of SSB to replicate DNA efficiently when the template ssDNA is covered with SSB. We speculate that at the primer/template junction, Pol IV interacts with the tail of the nearest SSB tetramer on the template, and that this interaction allows the polymerase to travel along the template while disassembling SSB.

  14. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  15. Long conducting polymer nanonecklaces with a 'beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties.

    PubMed

    Chen, Guofang; Mao, Chengde

    2016-05-21

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a 'beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.

  16. Interrelationship between parathyroid hormone and insulin: effects on DNA synthesis in UMR-106-01 cells.

    PubMed

    Felsenfeld, A J; Iida-Klein, A; Hahn, T J

    1992-11-01

    UMR-106-01 osteoblast-like cells respond to high concentrations of parathyroid hormone (PTH) in vitro by decreasing thymidine incorporation, a marker of DNA synthesis and cell proliferation. This response is different from in vivo conditions, such as primary and secondary hyperparathyroidism, in which high PTH levels are associated with an increased number of osteoblasts. When the response of UMR-106-01 cells to PTH is evaluated in vitro, however, these cells are exposed to only a single hormone. The present study was designed to evaluate the combined effects of two hormones, PTH and insulin, on the DNA synthesis of UMR-106-01 cells. PTH is known to decrease and insulin to increase thymidine incorporation by UMR-106-01 cells. To examine the interaction of these hormones, acute studies, defined as a 24 h exposure to hormone, and chronic studies, defined as a 7 day exposure to hormone, were performed. Both acute and chronic exposure to 10(-9) M PTH decreased thymidine incorporation by UMR-106-01 cells, with suppression ranging from 27 to 81% (P < 0.05). Both acute and chronic exposure to 10(-8) M insulin (INS) increased thymidine incorporation by UMR-106-01 cells; this ranged from 26 to 58% (P < 0.05). However, chronic exposure to 10(-9) M PTH followed by an acute exposure to 10(-8) M INS resulted in a 710% increase in thymidine incorporation (P < 0.01). Reversing the sequence by chronically exposing UMR-106-01 cells to 10(-8) M INS followed by acute exposure to 10(-9) M PTH resulted in a 53% decrease in thymidine incorporation (P < 0.01).(ABSTRACT TRUNCATED AT 250 WORDS)

  17. The effect of human milk on DNA synthesis of neonatal rat hepatocytes in primary culture.

    PubMed

    Kohno, Y; Shiraki, K; Mura, T

    1991-03-01

    We studied the effect of human milk on DNA synthesis of neonatal hepatocytes to elucidate the physiologic role of human milk in growth of the liver. Neonatal hepatocytes were isolated from 5-d-old rats and cultured in serum-free medium. Human milk stimulated DNA synthesis of these hepatocytes in a concentration-dependent manner. The stimulatory activity of 7.5% (vol/vol) human milk plus 0.1 mumol/L insulin was five times that of control and was almost the same as that of 20 micrograms/L human epidermal growth factor (hEGF) plus insulin. The effect of human milk was additive with treatment with hEGF and insulin. The milk associated with prolonged jaundice of infants was significantly more active than the milk that was not associated with jaundice, although the concentration of hEGF was not different between the two types of milk. The mitogenic activity of milk was heat-labile, inactivated by DTT and stable after treatment with trypsin. Three peaks of the activity were detected in milk by gel filtration and the fraction containing proteins of molecular weight between 36,000 and 76,000 showed the highest activity. Anti-hEGF antibody did not inhibit this activity completely. These results suggested the presence of mitogens other than hEGF or a more active form of hEGF in human milk. The milk associated with breast-milk jaundice exerts a different influence on cell growth and may affect maturation of the liver function related to bilirubin metabolism. The mitogenic activity of milk might be important for growth and development of the liver in infants.

  18. Synthesis and characterization of monomolecular DNA G-quadruplexes formed by tetra-end-linked oligonucleotides.

    PubMed

    Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Galeone, Aldo; Petraccone, Luigi; Varra, Michela; Piccialli, Gennaro; Mayol, Luciano

    2006-01-01

    Guanine-rich DNA sequences are widely dispersed in the eukaryotic genome and are abundant in regions with relevant biological significance. They can form quadruplex structures stabilized by guanine quartets. These structures differ for number and strand polarity, loop composition, and conformation. We report here the syntheses and the structural studies of a set of interconnected d(TG(4)T) fragments which are tethered, with different orientations, to a tetra-end-linker in an attempt to force the formation of specific four-stranded DNA quadruplex structures. Two synthetic strategies have been used to obtain oligodeoxyribonucleotide (ODN) strands linked with their 3'- or 5'-ends to each of the four arms of the linker. The first approach allowed the synthesis of tetra-end-linked ODN (TEL-ODN) containing the four ODN strands with a parallel orientation, while the latter synthetic pathway led to the synthesis of TEL-ODNs each containing antiparallel ODN pairs. The influence of the linker at 3'- or 5'-ODN, on the quadruplex typology and stability, in the presence of sodium or potassium ions, has been investigated by circular dichroism (CD), CD thermal denaturation, (1)H NMR experiments at variable temperature, and molecular modeling. All synthesized TEL-ODNs formed parallel G-quadruplex structures. Particularly, the TEL-ODN containing all parallel ODN tracts formed very stable parallel G-quadruplex complexes, whereas the TEL-ODNs containing antiparallel ODN pairs led to relatively less stable parallel G-quadruplexes. The molecular modeling data suggested that the above antiparallel TEL-ODNs can adopt parallel G-quadruplex structures thanks to a considerable folding of the tetra-end-linker around the whole quadruplex scaffold.

  19. Tributyrin inhibits human gastric cancer SGC-7901 cell growth by inducing apoptosis and DNA synthesis arrest

    PubMed Central

    Yan, Jun; Xu, Yong-Hua

    2003-01-01

    AIM: To evaluate the effects of tributyrin, a pro-drug of natural butyrate and a neutral short-chain fatty acid triglyceride, on the growth inhibition of human gastric cancer SGC-7901 cell. METHODS: Human gastric cancer SGC-7901 cells were exposed to tributyrin at 0.5, 1, 2, 5, 10 and 50 mmol·L-1 for 24-72 h. MTT assay was applied to detect the cell proliferation. [3H]-TdR uptake was measured to determine DNA synthesis. Apoptotic morphology was observed by electron microscopy and Hoechst-33258 staining. Flow cytometry and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay were performed to detect tributyrin-triggered apoptosis. The expressions of PARP, Bcl-2 and Bax were examined by Western blot assay. RESULTS: Tributyrin could initiate growth inhibition of SGC-7901 cell in a dose- and time-dependent manner. [3H]-TdR uptake by SGC-7901 cells was reduced to 33.6% after 48 h treatment with 2 mmol·L-1 tributyrin, compared with the control (P < 0.05). Apoptotic morphology was detected by TUNEL assay. Flow cytometry revealed that tributyrin could induce apoptosis of SGC-7901 cells in dose-dependent manner. After 48 hours incubation with tributyrin at 2 mmol·L-1, the level of Bcl-2 protein was lowered, and the level of Bax protein was increased in SGC-7901, accompanied by PARP cleavage. CONCLUSION: Tributyrin could inhibit the growth of gastric cancer cells effectively in vitro by inhibiting DNA synthesis and inducing apoptosis, which was associated with the down-regulated Bcl-2 expression and the up-regulated Bax expression. Therefore, tributyrin might be a promising chemopreventive and chemotherapeutic agent against human gastric carcinogenesis. PMID:12679905

  20. Differential inhibition of DNA synthesis in human T cells by the cigarette tar components hydroquinone and catechol.

    PubMed

    Li, Q; Aubrey, M T; Christian, T; Freed, B M

    1997-08-01

    Hydroquinone (HQ), catechol, and phenol exist in microgram quantities in cigarette tar and represent the predominant form of human exposure to benzene. Exposure of human T lymphoblasts (HTL) in vitro to 50 microM HQ or 50 microM catechol decreased IL-2-dependent DNA synthesis and cell proliferation by >90% with no effect on cell viability. Phenol had no effect on HTL proliferation at concentrations up to 1 mm. The addition of HQ or catechol to proliferating HTL blocked 3H-TdR uptake by >90% within 2 hr without significantly affecting 3H-UR uptake, suggesting that both compounds inhibit a rate-limiting step in DNA synthesis. However, the effects of HQ and catechol appear to involve different mechanisms. Ferric chloride (FeCl3) reversed the inhibitory effect of catechol, but not HQ, corresponding with the known ability of catechol to chelate iron. HQ, but not catechol, caused a decrease in transferrin receptor (TfR, CD71) expression, comparable to the level observed in IL-2-starved cells. HQ also inhibited DNA synthesis in cultures of transformed Jurkat T lymphocytes, primary and transformed fibroblasts, and mink lung epithelial cells, indicating that its antiproliferative effect was not restricted to IL-2 mediated proliferation. However, DNA synthesis by primary lymphocytes was more sensitive to HQ (IC50 = 6 microM) than that of the transformed Jurkat T cell line (IC50 = 37 microM) or primary human fibroblasts (IC50 = 45 microM), suggesting that normal lymphocytes may be particularly sensitive to HQ. The effects of HQ and catechol on DNA synthesis could be partially reversed by a combination of adenosine deoxyribose and guanosine deoxyribose, suggesting that both compounds may inhibit ribonucleotide reductase.

  1. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  2. Inhibition of semiconservative DNA synthesis in ICR 2A frog cells exposed to monochromatic uv wavelengths (252-313 nm) and photoreactivating light

    SciTech Connect

    Rosenstein, B.S.

    1982-06-01

    Exposure of ICR 2A frog cells to monochromatic uv wavelengths in the range 252-313 nm caused an inhibition of semiconservative DNA synthesis which was partially relieved in cells receiving a post irradiation treatment with photoreactivating light (>350 nm). Hence pyrimidine dimers acted as lesions blocking DNA synthesis in uv-irradiated cells based upon the specificity of photoreactivating enzyme for the light-dependent monomerization of dimers in DNA. Compared with the shorter wavelengths tested, however, this recovery of DNA synthesis was not as great in cells exposed to 302-nm radiation and was nearly absent in 313-nm-irradiated cells up to 12 hr after treatment. These results suggest that nondimer photoproducts also play an important role in causing DNA synthesis inhibition in cells exposed to wavelengths greater than 300 nm.

  3. Epidermal DNA synthesis in organ culture explants. A study of hairless mouse ear epidermis.

    PubMed

    Hansteen, I L; Iversen, O H; Refsum, S B

    1979-10-01

    Explants of split mouse ear were incubated in organ culture for up to 48 h, and the cell proliferation was studied by the addition of Thymidine-methyl-3-H (3HTdR) to the medium during different time periods, mainly for the first 14 h of incubation. Cultures were started at 0900, 2130 and 2300. In all cases the labelling index remained stable for 6-8 h, and then increased. The mean grain count, however, was falling and so was the epidermal DNA-specific uptake of 3HTdR. Based on the experimental results, calculations can be made of the flux of cells through S. It is concluded that the increasing LI is not due to inherent diurnal variation in cell proliferation, and is not a sign of real growth but caused instead by a complete block of the cell exit from S, probably combined with periods of an increased entrance rate into S. Other methodological factors, however, may also contribute to the increasing LI. Hence, this system is not suited for the measurement of factors that influence epidermal DNA synthesis.

  4. PEG-Labeled Nucleotides and Nanopore Detection for Single Molecule DNA Sequencing by Synthesis

    PubMed Central

    Kumar, Shiv; Tao, Chuanjuan; Chien, Minchen; Hellner, Brittney; Balijepalli, Arvind; Robertson, Joseph W. F.; Li, Zengmin; Russo, James J.; Reiner, Joseph E.; Kasianowicz, John J.; Ju, Jingyue

    2012-01-01

    We describe a novel single molecule nanopore-based sequencing by synthesis (Nano-SBS) strategy that can accurately distinguish four bases by detecting 4 different sized tags released from 5′-phosphate-modified nucleotides. The basic principle is as follows. As each nucleotide is incorporated into the growing DNA strand during the polymerase reaction, its tag is released and enters a nanopore in release order. This produces a unique ionic current blockade signature due to the tag's distinct chemical structure, thereby determining DNA sequence electronically at single molecule level with single base resolution. As proof of principle, we attached four different length PEG-coumarin tags to the terminal phosphate of 2′-deoxyguanosine-5′-tetraphosphate. We demonstrate efficient, accurate incorporation of the nucleotide analogs during the polymerase reaction, and excellent discrimination among the four tags based on nanopore ionic currents. This approach coupled with polymerase attached to the nanopores in an array format should yield a single-molecule electronic Nano-SBS platform. PMID:23002425

  5. Oxymetazoline enhances epidermal- and platelet-derived growth factor-induced DNA synthesis.

    PubMed

    Nickenig, G; Ko, Y; Nettekoven, W; Appenheimer, M; Schiermeyer, B; Vetter, H; Sachinidis, A

    1994-01-01

    In the present study, the effect of 10(-9) to 10(-6) M epinephrine (alpha- and beta-agonist), norepinephrine (alpha- and beta 1-antagonist) isoproterenol (beta-agonist) salbutamol (beta 2-agonist), phenylephrine (alpha 1-agonist) and oxymetazoline (mainly alpha 2-agonist) on DNA synthesis in vascular smooth muscle cells (VSMCs) from rat aorta has been investigated. Our results show that only oxymetazoline induced a moderate dose-dependent elevation of [3H]thymidine incorporation into cell DNA (10(-6) M, 100-300%). Epidermal growth factor (EGF) (50 ng/ml) and platelet-derived growth factor (PDGF)-BB induced an elevation of the [3H]thymidine incorporation into cell DNA from 154 +/- 7 (basal value) to 1270 +/- 95 and 1552 +/- 178 cpm/microgram protein (mean +/- S.D., n = 3). Oxymetazoline (10(-6) M) and phenylephrine induced an increase of [3H]thymidine incorporation to 368 +/- 53 and 205 +/- 27 cpm/microgram protein, respectively. In contrast to phenylephrine, oxymetazoline caused an elevation of the PDGF-BB- and EGF-induced [3H]thymidine incorporation to 1561 +/- 143 and 2086 +/- 235 (means S.D., n = 3), respectively. In addition, EGF (1 to 50 ng/ml) induced a dose-dependent increase of [3H]thymidine incorporation from 154 +/- 7 (basal value) to 486 +/- 35 (1 ng/ml), 912 +/- 74 (5 ng/ml), 1019 +/- 40 (25 ng/ml) and 1270 +/- 95 (50 ng/ml) cpm/microgram protein (mean +/- S.D.). In the presence of 10(-6) M oxymetazoline, 1, 5, 25 and 50 ng/ml EGF caused an increase of [3H]thymidine incorporation to 633 +/- 101, 1124 +/- 87, 1231 +/- 101, and 1561 +/- 89 cpm/microgram protein (mean +/- S.D.).(ABSTRACT TRUNCATED AT 250 WORDS)

  6. A small number of anti-CD3 molecules on dendritic cells stimulate DNA synthesis in mouse T lymphocytes

    PubMed Central

    1989-01-01

    Resting T cells enter cell cycle when challenged with anti-CD3 mAb and accessory cells that bear required Fc receptors (FcR). Presentation of anti-CD3 is thought to be a model for antigens presented by accessory cells to the TCR complex. We have obtained evidence that the number of anti-CD3 molecules that are associated with the accessory cell can be very small. We first noticed that thymic dendritic cells and cultured, but not freshly isolated, epidermal Langerhans cells (LC) were active accessory cells for responses to anti-CD3 mAb. DNA synthesis was abrogated by a mAb to the FcR but not by mAb to other molecules used in clonally specific antigen recognition, i.e., class I and II MHC products or CD4 and CD8. The requisite FcR could be identified on the LC but in small numbers. Freshly isolated LC had 20,000 FcR per cell, while the more active cultured LC had only 2,000 sites, using 125I-anti- FcR mAb in quantitative binding studies. Individual LC had similar levels of FcR, as evidenced with a sensitive FACS. FcR could not be detected on T cells or within the dendritic cell cytoplasm, at the start of or during the mitogenesis response. When the response was assessed at 30 h with single cell assays, at least 20 T cells became lymphoblasts per added LC, and at least 8 T cells were synthesizing DNA while in contact with the LC in discrete cell clusters. To the extent that anti-CD3 represents a polyclonal model for antigen presentation to specific T cell clones, these results suggest two conclusions. First, only 200-300 molecules of ligand on dendritic cells may be required to trigger a T cell. Second, the maturation of LC in culture entails "sensitizing" functions other than ligand presentation (anti-CD3 on FcR) to clonotypic T cell receptors. PMID:2522496

  7. Inhibition of semiconservative DNA synthesis in ICR 2A frog cells by pyrimidine dimers and nondimer photoproducts induced by ultraviolet radiation

    SciTech Connect

    Rosenstein, B.S.

    1984-11-01

    DNA synthesis was examined in ultraviolet (uv)-irradiated ICR 2A frog cells in which either pyrimidine dimers or nondimer photoproducts represented the major class of DNA lesions. In addition, cells were exposed to /sup 60/Co ..gamma.. rays. The cultures were pulse-labeled and the size distribution of the DNA synthesized was estimated using both sucrose gradient sedimentation and alkaline step elution. Using either of these techniques, it was found that the presence of dimers resulted in a reduction principally in the synthesis of high molecular weight (MW) DNA. In contrast, nondimer photoproducts caused a strong inhibition in the synthesis of low MW DNA, as was also observed in ..gamma..-irradiated cells. Hence the induction of pyrimidine dimers in DNA mainly affected the elongation of replicons, whereas nondimer lesions primarily caused an inhibition of replicon initiation.

  8. Quantitative analysis of RNA cleavage during RNA-directed DNA synthesis by human immunodeficiency and avian myeloblastosis virus reverse transcriptases.

    PubMed Central

    DeStefano, J J; Mallaber, L M; Fay, P J; Bambara, R A

    1994-01-01

    We have determined the extent of RNA cleavage carried out during DNA synthesis by either human immunodeficiency virus (HIV) or avian myeloblastosis virus (AMV) reverse transcriptases (RTs). Conditions were chosen that allowed the analysis of the cleavage and synthesis performed by the RT during one binding event on a given template-primer. The maximum quantity of ribonuclease H (RNase H) sensitive template RNA left after synthesis by the RTs was determined by treatment with Escherichia coli RNase H. RNA cleavage products that were expected to be too short to remain hybridized, less than 13 nucleotides in length, were quantitated. Results showed that HIV- and AMV-RT degraded about 80% and less than 20%, respectively, of the potentially degradable RNA to these short products. Survival of longer, hybridized RNA was not a result of synthesis by a population of RTs that had selectively lost RNase H activity. Using an assay that evaluated the proportion of primers extended versus RNA templates cleaved during primer-extension by the RTs, we determined that essentially each molecule of HIV- and AMV-RT with polymerase also has RNase H activity. The results indicate that although both HIV- and AMV-RTs cleave the RNA template during synthesis, the number of cleavages per nucleotide addition with HIV-RT is much greater. They also suggest that some hybridized RNA segments remain right after the passage of the RT making the first DNA strand. In vivo, these segments would have to be cleaved or displaced in later reactions before second strand DNA synthesis could be completed. Images PMID:7524028

  9. Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRI, BglII, and HindIII.

    PubMed Central

    Spector, D H; Hock, L; Tamashiro, J C

    1982-01-01

    We have used cloned EcoRI fragments of the human CMV (HCMV) genome, strain AD169, to prepare restriction endonuclease maps of the DNA. Individual 32P-labeled cloned fragments were hybridized to Southern blots of HCMV DNA cleaved to completion with the restriction endonucleases BglII and HindIII and cleaved partially with EcoRI. By determining which EcoRI fragments hybridized to the same band on a Southern blot, we were able to establish linkage groups. This information coupled with the data derived from digestion of the cloned fragments with the enzymes BglII and HindIII (Tamashiro et al., J. Virol. 42:547-557, 1982) provided the basis for the construction of detailed maps for the enzymes EcoRI, BglII, and HindIII. We also identified the EcoRI fragments derived from the termini of this genome and mapped them with respect to the BglII and HindIII terminal fragments. From our mapping data, we conclude that the genome of HCMV is approximately 240 kilobases in length and is divided into long (198 kilobases) and short (42 kilobases) regions. Both regions consist of a unique sequence bounded by inverted repeats (11 to 12 kilobases for the long region and 2 to 3 kilobases for the short region). Furthermore, the long and short regions can invert relative to each other. Images PMID:6283173

  10. Synthesis of hybrid hollow sub-microspheres assisted by pre-added colloidal SiO2.

    PubMed

    Huang, Ting; Wang, Chao; Zhang, Xinping; Wang, Chen; Li, Ailing; Qiu, Dong

    2015-03-01

    A novel method was developed to synthesize organic-inorganic hybrid hollow sub-microspheres (HHSs) through the addition of colloidal SiO2. The hydrolysis rate of 3-(methacryloyloxy)propyltrimethoxysilane (MPS) was accelerated by SiO2 particles; meanwhile, the condensation rate of the hydrolytic species was decelerated. Thus, the hydrolytic monomers and oligomers of MPS were preserved as emulsifiers. These emulsifiers can then emulsify the isopentyl acetate (PEA) to form a steady O/W emulsion. The HHSs were produced by subsequent free radical polymerization and removal of the oil core. The hydrolytic MPS acted as emulsifiers and polymerizable monomers at the emulsification and polymerization stage, respectively. Thus, extra emulsifiers, co-emulsifiers, and organic monomers were omitted, which simplified the synthesis process. The good dispersion of HHSs in water and oil, as well as the EDX results, indicated the organic-inorganic hybrid structure of HHSs. PMID:25586012

  11. Insulin-like synergistic stimulation of DNA synthesis in Swiss 3T3 cells by the BSC-1 cell-derived growth inhibitor related to transforming growth factor type. beta

    SciTech Connect

    Brown, K.D.; Holley, R.W.

    1987-06-01

    A cell growth inhibitor (GI), purified from BSC-1 cell-conditioned medium, has little if any effect on DNA synthesis when added alone to monolayer cultures of quiescent Swiss mouse 3T3 cells in serum-free medium. However, the inhibitor, which is closely related to transforming growth factor type ..beta.. (TGF-..beta..), exhibits a pronounced synergistic stimulation of DNA synthesis in combination with certain peptide (bombesin, vasopressin) or polypeptide (platelet-derived growth factor) mitogens. /sup 125/I-EGF binding was measured and the efflux of /sup 45/Ca/sup 2 +/ was measured in response to mitogen stimulation. A similar synergistic response has been demonstrated for TGF-..beta.. purified from human platelets. In the presence of 3 nM bombesin, a half-maximal stimulation of DNA synthesis was obtained at a GI concentration of approximately 60 pg/ml, with a maximal response at approximately 600 pg/ml. The synergistic interactions demonstrated by GI or TGF-..beta.. in stimulating Swiss 3T3 cells closely resemble those previously shown for insulin, and the authors have observed that GI does not synergize with insulin to stimulate DNA synthesis in these cells. Like insulin, and in contrast to bombesin, vasopressin, and platelet-derived growth factor, GI does not activate cellular inositolphospholipid hydrolysis, calcium mobilization, or cross-regulation of epidermal growth factor receptor affinity. These results raise the possibility that the biochemical pathways activated by GI/TGF-..beta.. and insulin converge at a post-receptor stage.

  12. DNA polymerase from temperate phage Bam35 is endowed with processive polymerization and abasic sites translesion synthesis capacity

    PubMed Central

    Berjón-Otero, Mónica; Villar, Laurentino; de Vega, Miguel; Salas, Margarita; Redrejo-Rodríguez, Modesto

    2015-01-01

    DNA polymerases (DNAPs) responsible for genome replication are highly faithful enzymes that nonetheless cannot deal with damaged DNA. In contrast, translesion synthesis (TLS) DNAPs are suitable for replicating modified template bases, although resulting in very low-fidelity products. Here we report the biochemical characterization of the temperate bacteriophage Bam35 DNA polymerase (B35DNAP), which belongs to the protein-primed subgroup of family B DNAPs, along with phage Φ29 and other viral and mobile element polymerases. B35DNAP is a highly faithful DNAP that can couple strand displacement to processive DNA synthesis. These properties allow it to perform multiple displacement amplification of plasmid DNA with a very low error rate. Despite its fidelity and proofreading activity, B35DNAP was able to successfully perform abasic site TLS without template realignment and inserting preferably an A opposite the abasic site (A rule). Moreover, deletion of the TPR2 subdomain, required for processivity, impaired primer extension beyond the abasic site. Taken together, these findings suggest that B35DNAP may perform faithful and processive genome replication in vivo and, when required, TLS of abasic sites. PMID:26100910

  13. UV-assisted photocatalytic synthesis of highly dispersed Ag nanoparticles supported on DNA decorated graphene for quantitative iodide analysis.

    PubMed

    Kong, Fen-Ying; Li, Wei-Wei; Wang, Jing-Yi; Wang, Wei

    2015-07-15

    Herein, we report, for the first time, the synthesis of reduced graphene oxide-DNA-Ag (RGO-DNA-Ag) nanohybrids by ultraviolet (UV) irradiation of aqueous solutions of GO and Ag ions in the presence of DNA. The morphology and microstructure characterizations of the resultant nanohybrids reveal that the proposed method leads to the simultaneous reduction of GO and Ag ions together with efficient dispersion of Ag nanoparticles on the surface of RGO sheets. This simple and fast synthesis route is carried out at ambient conditions without using any additional chemical reducing agents, which has the potential to provide new avenues for the green fabrication of various RGO-based nanomaterials. Additionally, the RGO-DNA-Ag nanohybrids can be utilized as a novel sensing interfacial for direct determination of iodide by simple differential pulse voltammetry (DPV), without requiring any preceding preconcentration of the analyte. Based on the RGO-DNA-Ag nanohybrids modified electrode, a wide linear range of 1μM-1mM and a low detection limit of 0.2μM were obtained. This sensitive and direct method of analysis can be applied successfully to the determination of iodide in real samples.

  14. Novel thiosemicarbazone derivatives as potential antitumor agents: Synthesis, physicochemical and structural properties, DNA interactions and antiproliferative activity.

    PubMed

    Dilović, Ivica; Rubcić, Mirta; Vrdoljak, Visnja; Kraljević Pavelić, Sandra; Kralj, Marijeta; Piantanida, Ivo; Cindrić, Marina

    2008-05-01

    The paper describes synthesis of several novel thiosemicarbazone derivatives. Furthermore, crystal and molecular structure of 4-diethylamino-salicylaldehyde 4-phenylthiosemicarbazone revealed planarity of conjugated aromatic system, which suggested the possibility of DNA binding by intercalation, especially for here studied naphthalene derivatives. However, here presented DNA binding studies excluded this mode of action. Physicochemical and structural properties of novel derivatives were compared with previously studied analogues, taken as reference compounds, revealing distinctive differences. In addition, novel thiosemicarbazone derivatives (1, 2 and 5-8) clearly display stronger antiproliferative activity on five tumor cell lines than the reference compounds 3 and 4, which supports their further investigation as potential antitumor agents.

  15. Mutagenic Bypass of an Oxidized Abasic Lesion-Induced DNA Interstrand Cross-Link Analogue by Human Translesion Synthesis DNA Polymerases.

    PubMed

    Xu, Wenyan; Ouellette, Adam; Ghosh, Souradyuti; O'Neill, Tylor C; Greenberg, Marc M; Zhao, Linlin

    2015-12-22

    5'-(2-Phosphoryl-1,4-dioxobutane) (DOB) is an oxidized abasic site that is produced by several antitumor agents and γ-radiolysis. DOB reacts reversibly with a dA opposite the 3'-adjacent nucleotide to form DNA interstrand cross-links (ICLs), genotoxic DNA lesions that can block DNA replication and transcription. Translesion synthesis (TLS) is an important step in several ICL repair pathways to bypass unhooked intermediates generated by endonucleolytic incision. The instability of DOB-ICLs has made it difficult to learn about their TLS-mediated repair capability and mutagenic potential. We recently developed a method for chemically synthesizing oligonucleotides containing a modified DOB-ICL analogue. Herein, we examined the capabilities of several highly relevant eukaryotic TLS DNA polymerases (pols), including human pol η, pol κ, pol ι, pol ν, REV1, and yeast pol ζ, to bypass this DOB-ICL analogue. The prelesion, translesion, and postlesion replication efficiency and fidelity were examined. Pol η showed moderate bypass activity when encountering the DOB-ICL, giving major products one or two nucleotides beyond the cross-linked template nucleotide. In contrast, DNA synthesis by the other pols was stalled at the position before the cross-linked nucleotide. Steady-state kinetic data and liquid chromatography-mass spectrometry sequencing of primer extension products by pol η unambiguously revealed that pol η-mediated bypass is highly error-prone. Together, our study provides the first set of in vitro evidence that the DOB-ICL is a replication-blocking and highly miscoding lesion. Compared to several other TLS pols examined, pol η is likely to contribute to the TLS-mediated repair of the DOB-ICL in vivo.

  16. Biorefining of by-product streams from sunflower-based biodiesel production plants for integrated synthesis of microbial oil and value-added co-products.

    PubMed

    Leiva-Candia, D E; Tsakona, S; Kopsahelis, N; García, I L; Papanikolaou, S; Dorado, M P; Koutinas, A A

    2015-08-01

    This study focuses on the valorisation of crude glycerol and sunflower meal (SFM) from conventional biodiesel production plants for the separation of value-added co-products (antioxidant-rich extracts and protein isolate) and for enhancing biodiesel production through microbial oil synthesis. Microbial oil production was evaluated using three oleaginous yeast strains (Rhodosporidium toruloides, Lipomyces starkeyi and Cryptococcus curvatus) cultivated on crude glycerol and nutrient-rich hydrolysates derived from either whole SFM or SFM fractions that remained after separation of value-added co-products. Fed-batch bioreactor cultures with R. toruloides led to the production of 37.4gL(-1) of total dry weight with a microbial oil content of 51.3% (ww(-1)) when a biorefinery concept based on SFM fractionation was employed. The estimated biodiesel properties conformed with the limits set by the EN 14214 and ASTM D 6751 standards. The estimated cold filter plugging point (7.3-8.6°C) of the lipids produced by R. toruloides is closer to that of biodiesel derived from palm oil.

  17. Effects of methylmercury on primary cultured rat hepatocytes: Cell injury and inhibition of growth factor stimulated DNA synthesis

    SciTech Connect

    Tanno, Keiichi; Fukazawa, Toshiyuki; Tajima, Shizuko; Fujiki, Motoo )

    1992-08-01

    Many more studies deal with the toxicity of methylmercury on nervous tissue than on its toxicity to the liver. Methylmercury accumulates in the liver in higher concentrations than brain and the liver has the primary function of detoxifying methylmercury. According to recent studies, hepatocyte mitochondrial membranes are destroyed by methylmercury and DNA synthesis is inhibited by methylmercury during hepatocyte regeneration. Methylmercury alters the membrane ion permeability of isolate skate hepatocytes, and inhibits the metal-sensitive alcohol dehydrogenase and glutathione reductase of primary cultured rat hepatocytes. However, little is known about the effect of methylmercury on hepatocyte proliferation in primary cultured rat hepatocytes. We therefore used the primary cultured rat hepatocytes to investigate the effects of methylmercury on cell injury and growth factor stimulate DNA synthesis. The primary effect of methylmercury is to inhibit hepatocyte proliferation rather than to cause direct cell injury. 16 refs., 4 figs.

  18. DNA polymerase kappa microsatellite synthesis: two distinct mechanisms of slippage-mediated errors.

    PubMed

    Baptiste, Beverly A; Eckert, Kristin A

    2012-12-01

    Microsatellite tandem repeats are frequent sites of strand slippage mutagenesis in the human genome. Microsatellite mutations often occur as insertion/deletion of a repeat motif (unit-based indels), and increase in frequency with increasing repeat length after a threshold is reached. We recently demonstrated that DNA polymerase κ (Pol κ) produces fewer unit-based indel errors within dinucleotide microsatellites than does polymerase δ. Here, we examined human Pol κ's error profile within microsatellite alleles of varying sequence composition and length, using an in vitro HSV-tk gap-filling assay. We observed that Pol κ displays relatively accurate synthesis for unit-based indels, using di- and tetranucleotide repeat templates longer than the threshold length. We observed an abrupt increase in the unit-based indel frequency when the total microsatellite length exceeds 28 nucleotides, suggesting that extended Pol κ protein-DNA interactions enhance fidelity of the enzyme when synthesizing these microsatellite alleles. In contrast, Pol κ is error-prone within the HSV-tk coding sequence, producing frequent single-base errors in a manner that is highly biased with regard to sequence context. Single-nucleotide errors are also created by Pol κ within di- and tetranucleotide repeats, independently of the microsatellite allele length and at a frequency per nucleotide similar to the frequency of single base errors within the coding sequence. These single-base errors represent the mutational signature of Pol κ, and we propose them a mechanism independent of homology-stabilized slippage. Pol κ's dual fidelity nature provides a unique research tool to explore the distinct mechanisms of slippage-mediated mutagenesis. PMID:22965905

  19. Tyrphostin inhibition of ATP-stimulated DNA synthesis, cell proliferation and fos-protein expression in vascular smooth muscle cells.

    PubMed Central

    Erlinge, D.; Heilig, M.; Edvinsson, L.

    1996-01-01

    1. We and others have shown that extracellular ATP (adenosine triphosphate), released from sympathetic nerves and platelets, stimulates growth of vascular smooth muscle cells (SMC). To study the importance of tyrosine kinases for ATP-mediated proliferation in vascular smooth muscle cells we used tyrphostins, a recently developed group of highly specific inhibitors of tyrosine kinases. 2. ATP induced a powerful concentration-dependent increase in DNA synthesis measured by [3H]-thymidine incorporation in rat aorta SMC (RASMC) and an increase in total cell number after 72 h of incubation as measured by an enzymatic cell proliferation assay. Tyrphostin 25 (10(-5) M) had no effect per se on basal DNA synthesis but reduced ATP-stimulated DNA synthesis and increase in cell number in a dose-dependent manner. Higher concentrations of ATP could not reverse the inhibitory effect of tyrphostin 25. The potency of several (six) other tyrphostins was also examined and found to be slightly greater than tyrphostin 25 with equal efficacy. 3. When RASMC were incubated with 10(-5) M ATP for 2 h, nearly all of the cells (87 +/- 5%) were intensely stained with an antibody to the Fos protein while in the controls only 1 +/- 2% of the cells were weakly stained. Tyrphostin 25 greatly reduced the Fos-protein staining (14 +/- 2%). 4. ATP induced a concentration-dependent increase in 45Ca(2+)-influx and formation of inositol phosphates (IPtotal) in RASMC. These effects were not inhibited by tyrphostin 25. 5. Tyrphostin 25 did not alter ATP-induced contraction in ring segments of rat aorta. 6. In conclusion, tyrphostin 25 inhibited ATP-induced DNA synthesis, cell proliferation and Fos-protein expression, but not ATP-induced 45Ca(2+)-influx, inositolphosphate-production or vasoconstriction. This indicates that the mitogenic effect of ATP on vascular smooth muscle cells is dependent on tyrosine kinases in contrast to the contractile effect of ATP in blood vessels. Images Figure 2 PMID:8799578

  20. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  1. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  2. Effect of metanil yellow and malachite green on DNA synthesis in N-nitrosodiethylamine induced preneoplastic rat livers.

    PubMed

    Sundarrajan, M; Prabhudesai, S; Krishnamurthy, S C; Rao, K V

    2001-09-01

    Metanil yellow (MY) and malachite green (MG) are textile dyes, which, despite the ban occurs unsrupulously as food colouring agents. Accordingly they constitute a serious public health hazard and are of sufficient environmental concern. We have earlier reported that both MY and MG have tumor enhancing effects on the development of hepatic preneoplastic lesions induced by N-nitrosodiethylamine in rats. In order to understand the possible mechanisms by which MY and MG enhance tumor development, in this study we have tested the effects of MY and MG on DNA synthesis and PCNA expression in preneoplastic hepatic lesions during N-nitrosodiethylamine (DEN) induced hepatocarcinogenesis in male Wistar (WR) rats. Rats were administered 200 ppm DEN through drinking water for a period of one month. Administration of DEN for a period of one month showed an upregulation of cell cycle regulatory proteins namely cyclin D1, CDK4, cyclin E and CDK2. Accordingly, in other experiments, the animals were further administered MY and MG for a period of one month following one month DEN treatment. The effects of MY and MG were monitored on the basis of cell proliferation markers--DNA synthesis and PCNA expression both by immunohistochemical and immunoblotting. Following DEN administration, MY, MG and PB showed stimulation of DNA synthesis and increased PCNA expression when compared with either the corresponding controls or only DEN treated animals. In the present study, enhancing effect of MY, MG and PB on the cell proliferation markers during DEN-induced hepatic preneoplasia in rats was observed.

  3. DNA repair and recovery of RNA synthesis following exposure to ultraviolet light are delayed in long genes.

    PubMed

    Andrade-Lima, Leonardo C; Veloso, Artur; Paulsen, Michelle T; Menck, Carlos F M; Ljungman, Mats

    2015-03-11

    The kinetics of DNA repair and RNA synthesis recovery in human cells following UV-irradiation were assessed using nascent RNA Bru-seq and quantitative long PCR. It was found that UV light inhibited transcription elongation and that recovery of RNA synthesis occurred as a wave in the 5'-3' direction with slow recovery and TC-NER at the 3' end of long genes. RNA synthesis resumed fully at the 3'-end of genes after a 24 h recovery in wild-type fibroblasts, but not in cells deficient in transcription-coupled nucleotide excision repair (TC-NER) or global genomic NER (GG-NER). Different transcription recovery profiles were found for individual genes but these differences did not fully correlate to differences in DNA repair of these genes. Our study gives the first genome-wide view of how UV-induced lesions affect transcription and how the recovery of RNA synthesis of large genes are particularly delayed by the apparent lack of resumption of transcription by arrested polymerases.

  4. Individual nuclei differ in their sensitivity to the cytoplasmic inducers of DNA synthesis: implications for the origin of cell cycle variability.

    PubMed

    Hola, M; Howard, M; Nawaz, F N; Castleden, S; Brooks, R F

    1996-12-15

    Nuclei of multinucleate cells generally initiate DNA synthesis simultaneously, suggesting that the timing of DNA synthesis depends upon the appearance of a cytoplasmic signal. In contrast, intact nuclei from quiescent mammalian cells initiate DNA synthesis asynchronously in cell-free extracts of Xenopus eggs, despite the common environment. Here we show that the two nuclei of permeabilized binucleate cells enter DNA synthesis coordinately in egg extracts, as they do in vivo, with different pairs of nuclei initiating replication at different times. This indicates that the two nuclei of a binucleate cell are identical in their sensitivity to the inducers of DNA synthesis in egg extracts; this sensitivity varies in general between the nuclei of unrelated cells. The asynchrony of DNA synthesis shown by unrelated nuclei in egg extracts is therefore not an artifact of the cell-free system but a reflection of genuine differences preexisting within the intact cell. Evidence that these differences between nuclei are responsible for a substantial fraction of G1 variability in living cells is presented.

  5. Endothelin stimulates phosphatidylinositol hydrolysis and DNA synthesis in brain capillary endothelial cells.

    PubMed Central

    Vigne, P; Marsault, R; Breittmayer, J P; Frelin, C

    1990-01-01

    Endothelin-1 (ET-1) is a novel vasoconstricting and cardiotonic peptide that is synthesized by the vascular endothelium. Bovine aortic endothelial cells which secrete ET in vitro lack membrane receptor sites for the peptide. Endothelial cells from rat brain microvessels that do not secrete ET in vitro express large amounts of high-affinity receptors for 125I-labelled ET-1 (Kd 0.8 nM). The ET receptor is recognized by sarafotoxin S6b and the different ET peptides with the following order of potency: ET-1 (Kd 0.5 nM) approximately equal to ET-2 (Kd 0.7 nM) greater than sarafotoxin S6b (Kd 27 nM) greater than ET-3 (Kd 450 nM). This structure-activity relationship is different from those found in vascular smooth muscle cells, renal cells and cardiac cells. ET-1 stimulates DNA synthesis in brain capillary endothelial cells. It is more potent than basic fibroblast growth factor. The action of ET on endothelial cells from microvessels involves phosphatidylinositol hydrolysis and intracellular Ca2+ mobilization. These observations suggest that brain endothelial cells might be an important target for ET. PMID:2156495

  6. Action of ornithine alpha ketoglutarate on DNA synthesis by human fibroblasts

    SciTech Connect

    Vaubourdolle, M.; Salvucci, M.; Coudray-Lucas, C.; Agneray, J.; Cynober, L.; Ekindjian, O.G. )

    1990-02-01

    Ornithine alpha ketoglutarate (OKG) is largely used in clinical nutrition for its anabolic effects. However, the mechanism of its action remains questionable. We investigated the effect of OKG on the rate of DNA synthesis in human fibroblasts. The in vitro experimental procedure required to demonstrate in cell culture the anabolic effects of OKG observed in vivo was found to be glutamine-free and serum-poor medium with sparse cells. In these conditions, OKG induced a significant increase in ({sup 3}H)thymidine incorporation compared to untreated control cells. This effect was dose-dependent and was observed in all the cultures tested. Taken individually, the two constituents of OKG, i.e. alpha KG and Orn, also showed a stimulatory effect, but did not demonstrate a dose-dependent response. Concomitant analysis of extracellular amino acids showed in alpha KG-treated cultures an increase in glutamate and a decrease in aspartate, suggesting a cellular transamination of alpha KG. Glutamine, which is the preferential energetic substrate of fibroblasts, can be produced from glutamate and might play a role in the action of OKG. Moreover, OKG induced a rise in the cellular polyamine content. This, in association with the inhibitory effect on OKG action of difluoromethylornithine, a specific inhibitor of ornithine decarboxylase, suggests a link between the polyamine biosynthesis pathway and the anabolic effect of OKG.

  7. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation.

  8. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  9. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173.

  10. Short-term effects of four antibiotics on DNA synthesis in endothelial cells.

    PubMed

    Lanbeck, P; Paulsen, O

    2001-04-01

    The irritating effect of parenterally administered antibiotics on vessels is a common clinical problem. In a previous study we found that solutions of three commonly used antibiotics, cefuroxime, erythromycin and dicloxacillin, exerted cytotoxic effects on endothelial cells after 24 hr exposure. In contrast benzylpenicillin did not have such effects. In the present study, endothelial cells of different origin were exposed to these four antibiotics at higher concentrations than in the previous investigation but only for 5, 30 and 60 min. Incorporation of 3H-thymidine in the cells as a measurement of DNA synthesis was used as cytotoxic assay. A concentration-dependent and time-related inhibition was found after exposure to erythromycin and dicloxacillin but not after exposure to cefuroxime and benzylpenicillin. The effects were similar on the three different cell types used in the experiments. This study demonstrates that the cytotoxic effects differ even after short-term exposure to the antibiotics. In contrast to the previous study, cefuroxime lacks cytotoxicity when endothelial cells are exposed for less than one hour. The short-term exposition model used in this study should be more predictive as it mimics in vivo conditions better.

  11. Construction and properties of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis.

    PubMed Central

    Igarashi, K; Fawl, R; Roller, R J; Roizman, B

    1993-01-01

    The herpes simplex virus 1 (HSV-1) genome contains three origins of DNA synthesis (Ori) utilized by viral DNA synthesis proteins. One sequence (OriI) maps in the L component, whereas two sequences (OriS) map in the S component. We report the construction of a recombinant virus, R7711, from which both OriS sequences have been deleted, and show that the OriS sequences are not essential for the replication of HSV-1 in cultured cells. In addition to the deletions of OriS in R7711, the alpha 47 gene and the 5' untranscribed and transcribed noncoding regions of the U(S)11 gene were deleted, one of the alpha 4 promoter-regulatory regions was replaced with the simian virus 40 promoter, and the alpha 22 promoter was substituted with the alpha 27 promoter. The total amount of viral DNA synthesized in Vero cells infected with the OriS-negative (OriS-) virus was approximately that seen in cells infected with the OriS-positive virus. However, cells infected with the OriS- virus accumulated viral DNA more slowly than those infected with the wild-type virus during the first few hours after the onset of DNA synthesis. In single-step growth experiments, the yield of OriS- progeny virus was reduced at most fourfold. Although a single OriS (R. Longnecker and B. Roizman, J. Virol. 58:583-591, 1986) and the single OriL (M. Polvino-Bodnar, P. K. Orberg, and P. A. Schaffer, J. Virol. 61:3528-3535, 1987) have been shown to be dispensable, this is the first indication that both copies of OriS are dispensable and that one copy of an Ori sequence may suffice for the replication of HSV-1. Images PMID:8383234

  12. DNA synthesis and Fos and Jun protein expression in mitotic and postmitotic WI-38 fibroblasts in vitro.

    PubMed

    Brenneisen, P; Gogol, J; Bayreuther, K

    1994-04-01

    Normal human embryonic lung fibroblasts WI-38 differentiate spontaneously along the cell lineage mitotic fibroblasts (MF) I, II, and III and postmitotic fibroblasts (PMF) IV, V, VI, and VII in the fibroblast stem cell system in vitro, when appropriate methods are applied. The mitotic fibroblasts can be induced to shift to postmitotic fibroblasts by two treatments with mitomycin C (2 x MMC) in a short period of time compared to spontaneous development. Mitotic and postmitotic fibroblast cell types have specific morphological and biochemical properties, e.g., [35S]methionine polypeptide markers in 2D PAGE. Spontaneously arisen and experimentally induced (2 x MMC) PMF have the same morphological and biochemical characteristics. Mitotic fibroblasts have 2n DNA and undergo DNA synthesis for reduplication. Postmitotic cells undergo, on average, two rounds of DNA synthesis for endoreduplication (polyploidization). Spontaneously arisen and experimentally induced postmitotic populations are composed of postmitotic fibroblasts PMF IV, V, and VI with 2n, 4n, and 8n DNA. DNA synthesis of mitotic and postmitotic WI-38 cell populations may be regulated by the expression of Fos and Jun proteins. The Fos level of MFs was higher by a factor of 15-24 and the Jun level of MFs by a factor of 4.2-6.3 than those of spontaneously arisen PMFs. In 2 x MMC-induced PMFs, the Fos level was about 4.4-7.5 times higher and the Jun level 1.7-3.3 times higher than that of spontaneously arisen PMFs. The down-regulation of these two parameters is a normal event in the development of mitotic to postmitotic WI-38 fibroblasts in the fibroblast stem cell system and is not related to cellular aging. PMID:7908266

  13. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y W T; Haracska, Lajos; Krejci, Lumir

    2016-04-20

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy.

  14. Naphthyridinomycin, a DNA-reactive antibiotic.

    PubMed Central

    Zmijewski, M J; Miller-Hatch, K; Goebel, M

    1982-01-01

    Naphthyridinomycin is a novel quinone antibiotic that is produced in liquid shake cultures by Streptomyces lusitanus. Fermentation studies have shown that this antibiotic is produced maximally after 96 h of cell growth. L-[methyl-3H]methionine efficiently labels naphthyridinomycin when it is added to a fermentation mixture 24 h before culture is harvested. Unlabeled and radioactively labeled naphthyridinomycin were used to determine the mechanism of action of this unique antibiotic. Naphthyridinomycin inhibited bacterial growth primarily by inhibiting DNA synthesis. The structural similarity between naphthyridinomycin and the saframycins suggested that naphthyridinomycin might inhibit DNA synthesis by binding to the template. In vitro studies with radiolabeled naphthyridinomycin indicated that this antibiotic does specifically bind to calf thymus DNA. The binding reaction was enhanced by adding sulfhydryl-containing compounds; dithiothreitol was the best activating agent. DNA-naphthyridinomycin complexes were a poor substrate for enzymes that catalyze DNA-directed DNA and RNA syntheses. These results showed that naphthyridinomycin is similar to the saframycins in its reactivity toward DNA and suggested that the mechanism by which naphthyridinomycin inhibits DNA synthesis is through its ability to bind specifically to the DNA template of the cell. PMID:7103457

  15. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  16. Mutations for Worse or Better: Low-Fidelity DNA Synthesis by SOS DNA Polymerase V Is a Tightly Regulated Double-Edged Sword.

    PubMed

    Jaszczur, Malgorzata; Bertram, Jeffrey G; Robinson, Andrew; van Oijen, Antoine M; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2016-04-26

    1953, the year of Watson and Crick, bore witness to a less acclaimed yet highly influential discovery. Jean Weigle demonstrated that upon infection of Escherichia coli, λ phage deactivated by UV radiation, and thus unable to form progeny, could be reactivated by irradiation of the bacterial host. Evelyn Witkin and Miroslav Radman later revealed the presence of the SOS regulon. The more than 40 regulon genes are repressed by LexA protein and induced by the coproteolytic cleavage of LexA, catalyzed by RecA protein bound to single-stranded DNA, the RecA* nucleoprotein filament. Several SOS-induced proteins are engaged in repairing both cellular and extracellular damaged DNA. There's no "free lunch", however, because error-free repair is accompanied by error-prone translesion DNA synthesis (TLS), involving E. coli DNA polymerase V (UmuD'2C) and RecA*. This review describes the biochemical mechanisms of pol V-mediated TLS. pol V is active only as a mutasomal complex, pol V Mut = UmuD'2C-RecA-ATP. RecA* donates a single RecA subunit to pol V. We highlight three recent insights. (1) pol V Mut has an intrinsic DNA-dependent ATPase activity that governs polymerase binding and dissociation from DNA. (2) Active and inactive states of pol V Mut are determined at least in part by the distinct interactions between RecA and UmuC. (3) pol V is activated by RecA*, not at a blocked replisome, but at the inner cell membrane.

  17. Clickable Cγ-azido(methylene/butylene) peptide nucleic acids and their clicked fluorescent derivatives: synthesis, DNA hybridization properties, and cell penetration studies.

    PubMed

    Jain, Deepak R; Ganesh, Krishna N

    2014-07-18

    Synthesis, characterization, and DNA complementation studies of clickable C(γ)-substituted methylene (azm)/butylene (azb) azido PNAs show that these analogues enhance the stability of the derived PNA:DNA duplexes. The fluorescent PNA oligomers synthesized by their click reaction with propyne carboxyfluorescein are seen to accumulate around the nuclear membrane in 3T3 cells.

  18. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization.

  19. Effects of 8-halo-7-deaza-2'-deoxyguanosine triphosphate on DNA synthesis by DNA polymerases and cell proliferation.

    PubMed

    Yin, Yizhen; Sasaki, Shigeki; Taniguchi, Yosuke

    2016-08-15

    8-OxodG (8-oxo-2'-deoxyguanosine) is representative of nucleoside damage and shows a genotoxicity. To significantly reveal the contributions of 7-NH and C8-oxygen to the mutagenic effect of 8-oxodG by DNA polymerases, we evaluated the effects of the 8-halo-7-deaza-dG (8-halogenated 7-deaza-2'-deoxyguanosine) derivatives by DNA polymerases. 8-Halo-7-deaza-dGTPs were poorly incorporated by both KF(exo(-)) and human DNA polymerase β opposite dC or dA into the template DNA. Furthermore, it was found that KF(exo(-)) was very sensitive to the introduction of the C8-halogen, while polymerase β can accommodate the C8-halogen resulting in an efficient dCTP insertion opposite the 8-halo-7-deaza-dG in the template DNA. These results indicate that strong hydrogen bonding between 7-NH in the 8-oxo-G nucleobase and 1-N in the adenine at the active site of the DNA polymerase is required for the mutagenic effects. Whereas, I-deaza-dGTP shows an antiproliferative effect for the HeLa cells, suggesting that it could become a candidate as a new antitumor agent. PMID:27372838

  20. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  1. Breast cancer proteins PALB2 and BRCA2 stimulate polymerase η in recombination-associated DNA synthesis at blocked replication forks.

    PubMed

    Buisson, Rémi; Niraj, Joshi; Pauty, Joris; Maity, Ranjan; Zhao, Weixing; Coulombe, Yan; Sung, Patrick; Masson, Jean-Yves

    2014-02-13

    One envisioned function of homologous recombination (HR) is to find a template for DNA synthesis from the resected 3'-OH molecules that occur during double-strand break (DSB) repair at collapsed replication forks. However, the interplay between DNA synthesis and HR remains poorly understood in higher eukaryotic cells. Here, we reveal functions for the breast cancer proteins BRCA2 and PALB2 at blocked replication forks and show a role for these proteins in stimulating polymerase η (Polη) to initiate DNA synthesis. PALB2, BRCA2, and Polη colocalize at stalled or collapsed replication forks after hydroxyurea treatment. Moreover, PALB2 and BRCA2 interact with Polη and are required to sustain the recruitment of Polη at blocked replication forks. PALB2 and BRCA2 stimulate Polη-dependent DNA synthesis on D loop substrates. We conclude that PALB2 and BRCA2, in addition to their functions in D loop formation, play crucial roles in the initiation of recombination-associated DNA synthesis by Polη-mediated DNA repair.

  2. Hairy AdS solitons

    NASA Astrophysics Data System (ADS)

    Anabalón, Andrés; Astefanesei, Dumitru; Choque, David

    2016-11-01

    We construct exact hairy AdS soliton solutions in Einstein-dilaton gravity theory. We examine their thermodynamic properties and discuss the role of these solutions for the existence of first order phase transitions for hairy black holes. The negative energy density associated to hairy AdS solitons can be interpreted as the Casimir energy that is generated in the dual filed theory when the fermions are antiperiodic on the compact coordinate.

  3. Different sets of translesion synthesis DNA polymerases protect from genome instability induced by distinct food-derived genotoxins.

    PubMed

    Temviriyanukul, Piya; Meijers, Matty; van Hees-Stuivenberg, Sandrine; Boei, Jan J W A; Delbos, Frédéric; Ohmori, Haruo; de Wind, Niels; Jansen, Jacob G

    2012-05-01

    DNA lesions, induced by genotoxic compounds, block the processive replication fork but can be bypassed by specialized translesion synthesis (TLS) DNA polymerases (Pols). TLS safeguards the completion of replication, albeit at the expense of nucleotide substitution mutations. We studied the in vivo role of individual TLS Pols in cellular responses to benzo[a]pyrene diolepoxide (BPDE), a polycyclic aromatic hydrocarbon, and 4-hydroxynonenal (4-HNE), a product of lipid peroxidation. To this aim, we used mouse embryonic fibroblasts with targeted disruptions in the TLS-associated Pols η, ι, κ, and Rev1 as well as in Rev3, the catalytic subunit of TLS Polζ. After exposure, cellular survival, replication fork progression, DNA damage responses (DDR), and the induction of micronuclei were investigated. The results demonstrate that Rev1, Rev3, and, to a lesser extent, Polη are involved in TLS and the prevention of DDR and of DNA breaks, in response to both agents. Conversely, Polκ and the N-terminal BRCT domain of Rev1 are specifically involved in TLS of BPDE-induced DNA damage. We furthermore describe a novel role of Polι in TLS of 4-HNE-induced DNA damage in vivo. We hypothesize that different sets of TLS polymerases act on structurally different genotoxic DNA lesions in vivo, thereby suppressing genomic instability associated with cancer. Our experimental approach may provide a significant contribution in delineating the molecular bases of the genotoxicity in vivo of different classes of DNA-damaging agents. PMID:22331492

  4. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies.

  5. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  6. Linkage between reovirus-induced apoptosis and inhibition of cellular DNA synthesis: role of the S1 and M2 genes.

    PubMed Central

    Tyler, K L; Squier, M K; Brown, A L; Pike, B; Willis, D; Oberhaus, S M; Dermody, T S; Cohen, J J

    1996-01-01

    The mammalian reoviruses are capable of inhibiting cellular DNA synthesis and inducing apoptosis. Reovirus strains type 3 Abney (T3A) and type 3 Dearing (T3D) inhibit cellular DNA synthesis and induce apoptosis to a substantially greater extent than strain type 1 Lang (T1L). We used T1L x T3A and T1L x T3D reassortant viruses to identify viral genes associated with differences in the capacities of reovirus strains to elicit these cellular responses to viral infection. We found that the S1 and M2 genome segments determine differences in the capacities of both T1L x T3A and T1L x T3D reassortant viruses to inhibit cellular DNA synthesis and to induce apoptosis. These genes encode viral outer-capsid proteins that play important roles in viral attachment and disassembly. To extend these findings, we used field isolate strains of reovirus to determine whether the strain-specific differences in inhibition of cellular DNA synthesis and induction of apoptosis are also associated with viral serotype, a property determined by the S1 gene. In these experiments, type 3 field isolate strains were found to inhibit cellular DNA synthesis and to induce apoptosis to a greater extent than type 1 field isolate strains. Statistical analysis of these data indicate a significant correlation between the capacity of T1L x T3A and T1L x T3D reassortant viruses and field isolate strains to inhibit cellular DNA synthesis and to induce apoptosis. These findings suggest that reovirus-induced inhibition of cellular DNA synthesis and induction of apoptosis are linked and that both phenomena are induced by early steps in the viral replication cycle. PMID:8892922

  7. [Overgrowth and DNA synthesis of neuroepithelium in embryonic stages of induced Long-Evans rat myeloschisis].

    PubMed

    Chono, Y

    1993-01-01

    Overgrowth of the myeloschisis, namely the excessive amount of the neural plate tissue, has been reported in the human myeloschisis. However, it is still debatable how the overgrowth develops and whether the overgrowth is the cause, or the secondary effect of spinal dysraphism. The author induced myeloschisis in the fetuses of Long-Evans rats by the administration of ethylenethiourea (ETU) to pregnant rats on day 10 of gestation. The fetuses were removed 1 hour after the treatment with bromodeoxyuridine (BrdU) to the dams on day 14 and 21. The fetuses were fixed in alcohol and embedded in paraffin. H-E staining and the immunohistologic examination were performed on the staining patterns to anti-neurofilament (NFP), anti-glial fibrillary acidic protein (GFAP) and anti-BrdU antibody by ABC method. On day 14, the lateral portion of everted neural plate showed a loose arrangement of cells and there was rosette formation in the mesoderm. On day 21, cell necrosis was observed at the dorsolateral portion of myeloschisis, although the ventral portion showed almost normal cytoarchitecture and was positive to NFP and GFAP. The cause of myeloschisis in this model is supposed to be the local and direct cytotoxic effect of ETU to neuro-ectodermal junction. On day 14, control animals contained few BrdU-incorporated cells at the basal plate of neural tube. In contrast, everted neural plate showed an active uptake of BrdU diffusely in the subependymal matrix layer cells. Overgrowth was not yet identified. On day 21, overgrowth of myeloschisis was found in spite of a few positive cells to BrdU which was identical to the control animals. These findings seem to suggest that cells in the myeloschisis retain their ability of DNA synthesis for longer periods of development and overgrowth found on day 21 is possibly a secondary effect of spinal dysraphism in this model.

  8. In vivo effects of endotoxin on DNA synthesis in rat nasal epithelium

    SciTech Connect

    Harkema, J.R.; Hotchkiss, J.A. )

    1993-12-01

    Airway inflammation in bacterial infections is characterized by the presence of neutrophils and often epithelial injury and repair. Release of endotoxin from bacteria may contribute to these processes. The purpose of this study was to determine the in vivo effects of repeated endotoxin exposure on DNA synthesis in rat nasal epithelium in the presence and absence of neutrophilic influx. Rats were intranasally instilled, once a day for 3 days, with endotoxin or saline (controls). Before the first and third instillations, half of the saline and endotoxin-instilled animals were depleted of circulating blood neutrophils by administering a rabbit anti-rat neutrophil antiserum. Rats were sacrificed 6 or 24 h after the last instillation. Two hours prior to sacrifice, rats were intraperitoneally injected with bromodeoxyuridine (BrdU), an analog of thymidine that is incorporated in the nucleus of cells in the S-phase of the cell cycle. Nasal tissues were processed for light microscopy and immunohistochemical detection of BrdU in nasal epithelial cells. The numbers of nasal epithelial cells, BrdU-labeled epithelial nuclei, and neutrophils per millimeter of basal lamina in the epithelium lining the nasal turbinates in the proximal nasal passages were determined by morphometric analysis. The authors did not observe a neutrophilic influx in the nasal tissues of neutrophil-depleted rats at 6 or 24 h after the last endotoxin instillation; however, the numbers of nasal epithelial cells and the BrdU-labeling index were significantly increased compared to saline-instilled controls. In contrast, non-neutrophil-depleted rats instilled with endotoxin had a marked neutrophilic influx, but no significant differences in the number of nasal epithelial cells at 6 or 24 h, compared to controls. In addition, the BrdU-labeling index in neutrophil-sufficient rats was increased only 6 h after the last instillation, compared to controls.

  9. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  10. Flow cytometric measurement of total DNA and incorporated halodeoxyuridine

    DOEpatents

    Dolbeare, F.A.; Gray, J.W.

    1983-10-18

    A method for the simultaneous flow cylometric measurement of total cellular DNA content and of the uptake of DNA precursors as a measure of DNA synthesis during various phases of the cell cycle in normal and malignant cells in vitro and in vivo is described. The method comprises reacting cells with labelled halodeoxyuridine (HdU), partially denaturing cellular DNA, adding to the reaction medium monoclonal antibodies (mabs) reactive with HdU, reacting the bound mabs with a second labelled antibody, incubating the mixture with a DNA stain, and measuring simultaneously the intensity of the DNA stain as a measure of the total cellular DNA and the HdU incorporated as a measure of DNA synthesis. (ACR)

  11. Synthesis of no carrier added F-18 16-fluorohexadecanoic acid (FHDA) and investigation of its labeled metabolites and its kinetics in the heart

    SciTech Connect

    DeGrado, T.R.; Bernstein, D.R.; Gatley, S.J.; Ng, C.K.; Holden, J.E.

    1984-01-01

    No carrier added FHDA was prepared via saponification of the product of silver oxide assisted reaction of near-anhydrous tetraethylammonium fluoride with methyl 16-iodohexadecanoate. The labeled fatty acid was injected into isolated perfused rat hearts. Coronary perfusate was collected for 4-9 minutes, when hearts were chilled and homogenized. F-18 in perfusate was analysed by HPLC (NH column; 50mM amm. acetate in 50% acetonitrile). Material with the same retention time as F-18 fluoroacetate (prepared by F-for-I exchange with ethyl iodoacetate) was found. Some F-18 stuck permanently to the column and was assigned as fluoride since the same fraction of label in perfusate was retained on alumina columns eluted with water. Anion exchange HPLC (SAX column; 20mM pot. phosphate, pH 7) of homogenates gave peaks corresponding to fluoroacetate plus fluoride and minor peaks which could be fluoroacetylCoA and fluorocitrate. The authors interpret their data as follows. Beta-oxidation of FHDA results in fluoroacetylCoA which either undergoes ''lethal synthesis'' to fluorocitrate or is hydrolysed to fluoroacetate which diffuses out of the heart. The source of the fluoride is not yet clear, but could complicate interpretation of FHDA kinetics measured in vivo with positron tomography. Clearance of label from FHDA in isolated perfused hearts was faster than for labeled 16-iodohexadecanoic acid, indicating that the F-18 tracer may be a more sensitive probe of myocardial fatty acid metabolism.

  12. DNA binding, cytotoxicity and inhibitory effect on RNA synthesis of two new 1-nitro-9-aminoacridine dimers.

    PubMed

    Markovits, J; Wilmańska, D; Lescot, E; Studzian, K; Szmigiero, L; Gniazdowski, M

    1989-01-01

    Two 1-nitro-9-aminoacridine dimers were prepared: one bearing a spermine flexible linking chain, compound 4, the other a rigid dipiperidine-type linker, compound 7. Both dimers elicited a higher affinity constant for DNA than the parent monomeric drug nitracrine 2. This affinity was several orders lower than what was found for other dimeric compounds having the same linkers and no nitro group on the acridine ring (3, 5, 6 and 8). Bisintercalation was evidenced for compound 4 by viscosimetric measurements. In the absence of dithiothreitol, an inhibitory effect of RNA synthesis in vitro was observed for all the tested compounds except 2 and 7. In the presence of dithiothreitol, 4 and 7 formed irreversible complexes with DNA of decreased template properties. The level of the dimers binding was lower than that of the parent compound 2. Cross-links were detected by means of hydroxylapatite chromatography in a complex of the dimer bearing a flexible linking chain, compound 4 with DNA, while the compound 7-DNA complex eluted in the single-stranded DNA region. The extent of cytotoxicity of the two 1-nitro-9-aminoacridine dimers against L1210 cultured cells was different. PMID:2472225

  13. Modification of PCNA by ISG15 plays a crucial role in termination of error-prone translesion DNA synthesis.

    PubMed

    Park, Jung Mi; Yang, Seung Wook; Yu, Kyung Ryun; Ka, Seung Hyun; Lee, Seong Won; Seol, Jae Hong; Jeon, Young Joo; Chung, Chin Ha

    2014-05-22

    In response to DNA damage, PCNA is mono-ubiquitinated and triggers translesion DNA synthesis (TLS) by recruiting polymerase-η. However, it remained unknown how error-prone TLS is turned off after DNA lesion bypass to prevent mutagenesis. Here we showed that ISG15 modification (ISGylation) of PCNA plays a key role in TLS termination. Upon UV irradiation, EFP, an ISG15 E3 ligase, bound to mono-ubiquitinated PCNA and promoted its ISGylation. ISGylated PCNA then tethered USP10 for deubiquitination and in turn the release of polymerase-η from PCNA. Eventually, PCNA was deISGylated by UBP43 for reloading of replicative DNA polymerases and resuming normal DNA replication. However, ISGylation-defective Lys-to-Arg mutations in PCNA or knockdown of any of ISG15, EFP, or USP10 led to persistent recruitment of mono-ubiquitinated PCNA and polymerase-η to nuclear foci, causing an increase in mutation frequency. These findings establish a crucial role of PCNA ISGylation in termination of error-prone TLS for preventing excessive mutagenesis.

  14. Analysis of bacteriophage phi X174 gene A protein-mediated termination and reinitiation of phi X DNA synthesis. I. Characterization of the termination and reinitiation reactions.

    PubMed

    Brown, D R; Roth, M J; Reinberg, D; Hurwitz, J

    1984-08-25

    The phi X174 (phi X) gene A protein-mediated termination and reinitiation of single-stranded circular (SS(c] phi X viral DNA synthesis in vitro were directly and independently analyzed. Following incubation together with purified DNA replication enzymes from Escherichia coli, ATP, [alpha-32P]dNTPs, and either the phi X A protein and phi X replicative form I (RF I) DNA, or the purified RF II X A complex, the phi X A protein was detected covalently linked to newly synthesized 32P-labeled DNA. Formation of the phi X A protein-[32P]DNA covalent complex required all the factors necessary for phi X (+) SS(c) DNA synthesis in vitro. Thus, it was a product of the reinitiation reaction and an intermediate of the replication cycle. Identification of this complex provided direct evidence that reinitiation of phi X (+) strand DNA synthesis involved regeneration of the RF II X A complex. Substitution of 2',3'-dideoxyguanosine triphosphate (ddGTP) for dGTP in reaction mixtures resulted in the formation of covalent phi X A protein 32P-oligonucleotide complexes; these complexes were trapped analogues of the regenerated RF II X A complex. They could not act catalytically due to the presence of ddGMP residues at the 3'-termini of the oligonucleotide moieties. Reaction mixtures containing ddGTP also yielded nonradioactive (+) SS(c) DNA products derived from circularization of the displaced (+) strand of the input parental template DNA. The formation of the phi X A protein-32P-oligonucleotide complexes and nonradioactive (+) SS(c) DNA were used to assay both reinitiation and termination reactions, respectively. Both reactions required DNA synthesis from the 3'-hydroxyl primer at nucleotide residue 4305 which was formed by cleavage of phi X RF I DNA by the phi X A protein. Elongation of this primer by 18, but not 11 nucleotides was sufficient to support each reaction. Reinitiation reactions proceeded rapidly and were essentially complete after 90 s. In contrast, when ddGTP was replaced

  15. Translesion DNA synthesis-assisted non-homologous end-joining of complex double-strand breaks prevents loss of DNA sequences in mammalian cells

    PubMed Central

    Covo, Shay; de Villartay, Jean-Pierre; Jeggo, Penny A.; Livneh, Zvi

    2009-01-01

    Double strand breaks (DSB) are severe DNA lesions, and if not properly repaired, may lead to cell death or cancer. While there is considerable data on the repair of simple DSB (sDSB) by non-homologous end-joining (NHEJ), little is known about the repair of complex DSBs (cDSB), namely breaks with a nearby modification, which precludes ligation without prior processing. To study the mechanism of cDSB repair we developed a plasmid-based shuttle assay for the repair of a defined site-specific cDSB in cultured mammalian cells. Using this assay we found that repair efficiency and accuracy of a cDSB with an abasic site in a 5′ overhang was reduced compared with a sDSB. Translesion DNA synthesis (TLS) across the abasic site located at the break prevented loss of DNA sequences, but was highly mutagenic also at the template base next to the abasic site. Similar to sDSB repair, cDSB repair was totally dependent on XrccIV, and altered in the absence of Ku80. In contrast, Artemis appears to be specifically involved in cDSB repair. These results may indicate that mammalian cells have a damage control strategy, whereby severe deletions are prevented at the expense of the less deleterious point mutations during NHEJ. PMID:19762482

  16. DNA-directed alkylating agents. 6. Synthesis and antitumor activity of DNA minor groove-targeted aniline mustard analogues of pibenzimol (Hoechst 33258)

    PubMed

    Gravatt, G L; Baguley, B C; Wilson, W R; Denny, W A

    1994-12-01

    A series of nitrogen mustard analogues of the DNA minor groove binding fluorophore pibenzimol (Hoechst 33258) have been synthesized and evaluated for antitumor activity. Conventional construction of the bisbenzimidazole ring system from the piperazinyl terminus, via two consecutive Pinner-type reactions, gave low yields of products contaminated with the 2-methyl analogue which proved difficult to separate. An alternative synthesis was developed, involving construction of the bisbenzimidazole from the mustard terminus, via Cu(2+)-promoted oxidative coupling of the mustard aldehydes with 3,4-diaminobenzonitrile to form the monobenzimidazoles, followed by a Pinner-type reaction and condensation with 4-(1-methyl-4-piperazinyl)-o-phenylenediamine. This process gives higher yields and pure products. The mustard analogues showed high hypersensitivity factors (IC50AA8/IC50 UV4), typical of DNA alkylating agents. There was a large increase in cytotoxicity (85-fold) across the homologous series which cannot be explained entirely by changes in mustard reactivity and may be related to altering orientation of the mustard with respect to the DNA resulting in different patterns of alkylation. Pibenzimol itself (which has been evaluated clinically as an anticancer drug) was inactive against P388 in vivo using a single-dose protocol, but the short-chain mustard homologues were highly effective, eliciting a proportion of long-term survivors.

  17. In Vitro Synthesis of Rous Sarcoma Virus-Specific RNA is Catalyzed by a DNA-Dependent RNA Polymerase

    PubMed Central

    Rymo, L.; Parsons, J. T.; Coffin, J. M.; Weissmann, C.

    1974-01-01

    Synthesis of Rous sarcoma virus RNA was examined in vitro with a new assay for radioactive virus-specific RNA. Nuclei from infected and uninfected cells were incubated with ribonucleoside [α-32P]triphosphates, Mn++, Mg++ and (NH4)2SO4. Incorporation into total and viral RNA proceeded with similar kinetics for up to 25 min at 37°. About 0.5% of the RNA synthesized by the infected system was scored as virus-specific, compared to 0.03% of the RNA from the uninfected system and 0.005% of the RNA synthesized by monkey kidney cell nuclei. Preincubation with DNase or actinomycin D completely suppressed total and virus-specific RNA synthesis. α-Amanitin, a specific inhibitor of eukaryotic RNA polymerase II, completely inhibited virus-specific RNA synthesis, while reducing total RNA synthesis by only 50%. We conclude that tumor virus-specific RNA is synthesized on a DNA template, most probably by the host's RNA polymerase II. PMID:4368801

  18. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  19. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  20. Recent advances in small organic molecules as DNA intercalating agents: synthesis, activity, and modeling.

    PubMed

    Rescifina, Antonio; Zagni, Chiara; Varrica, Maria Giulia; Pistarà, Venerando; Corsaro, Antonino

    2014-03-01

    The interaction of small molecules with DNA plays an essential role in many biological processes. As DNA is often the target for majority of anticancer and antibiotic drugs, study about the interaction of drug and DNA has a key role in pharmacology. Moreover, understanding the interactions of small molecules with DNA is of prime significance in the rational design of more powerful and selective anticancer agents. Two of the most important and promising targets in cancer chemotherapy include DNA alkylating agents and DNA intercalators. For these last the DNA recognition is a critical step in their anti-tumor action and the intercalation is not only one kind of the interactions in DNA recognition but also a pivotal step of several clinically used anti-tumor drugs such as anthracyclines, acridines and anthraquinones. To push clinical cancer therapy, the discovery of new DNA intercalators has been considered a practical approach and a number of intercalators have been recently reported. The intercalative binding properties of such molecules can also be harnessed as diagnostic probes for DNA structure in addition to DNA-directed therapeutics. Moreover, the problem of intercalation site formation in the undistorted B-DNA of different length and sequence is matter of tremendous importance in molecular modeling studies and, nowadays, three models of DNA intercalation targets have been proposed that account for the binding features of intercalators. Finally, despite DNA being an important target for several drugs, most of the docking programs are validated only for proteins and their ligands. Therefore, a default protocol to identify DNA binding modes which uses a modified canonical DNA as receptor is needed.

  1. One-pot synthesis of DNA-CdTe:Zn2+ nanocrystals using Na2TeO3 as the Te source.

    PubMed

    Zhang, Cuiling; Yan, Ji; Liu, Chen; Ji, Xinghu; He, Zhike

    2014-03-12

    DNA-functionalized quantum dots (QDs) are powerful tools for biosensing and bioimaging applications. Facile labeling methods with good fluorescence properties are desirable for the development of DNA-functionalized QDs. In this article, we describe a novel and simple approach that leads to the synthesis of DNA-functionalized CdTe:Zn(2+) QDs in one step. It is the first time that DNA-functionalized QDs have been prepared using sodium tellurite as the tellurium source by a hydrothermal method. This approach will greatly reduce the synthesis time (only about 1 h) and simplify the synthesis process as well as reduce the complexity of the required experimental techniques. The as-prepared QDs exhibit high quantum yield, small size, and low toxicity. UV-vis spectra and FTIR characterization proved that the abundance of DNA on the surface of the QDs increased with the increase in the concentration of the feed DNA. Most importantly, these QDs functionalized with DNA have great potential to bind specifically to DNA, protein, and cell surface receptors.

  2. Site-specific incorporation of N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF) into oligonucleotides using modified ‘ultra-mild’ DNA synthesis

    PubMed Central

    Gillet, Ludovic C. J.; Alzeer, Jawad; Schärer, Orlando D.

    2005-01-01

    Aromatic amino and nitro compounds are potent carcinogens found in the environment that exert their toxic effects by reacting with DNA following metabolic activation. One important adduct is N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF), which has been extensively used in studies of the mechanisms of DNA repair and mutagenesis. Despite the importance of dG-AAF adducts in DNA, an efficient method for its incorporation into DNA using solid-phase synthesis is still missing. We report the development of a modified ‘ultra-mild’ DNA synthesis protocol that allows the incorporation of dG-AAF into oligonucleotides of any length accessible by solid-phase DNA synthesis with high efficiency and independent of sequence context. Key to this endeavor was the development of improved deprotection conditions (10% diisopropylamine in methanol supplemented with 0.25 M of β-mercaptoethanol) designed to remove protecting groups of commercially available ‘ultra-mild’ phosphoramidite building blocks without compromising the integrity of the exquisitely base-labile acetyl group at N8 of dG-AAF. We demonstrate the suitability of these oligonucleotides in the nucleotide excision repair reaction. Our synthetic approach should facilitate comprehensive studies of the mechanisms of repair and mutagenesis induced by dG-AAF adducts in DNA and should be of general use for the incorporation of base-labile functionalities into DNA. PMID:15814813

  3. Value Added?

    ERIC Educational Resources Information Center

    UCLA IDEA, 2012

    2012-01-01

    Value added measures (VAM) uses changes in student test scores to determine how much "value" an individual teacher has "added" to student growth during the school year. Some policymakers, school districts, and educational advocates have applauded VAM as a straightforward measure of teacher effectiveness: the better a teacher, the better students…

  4. Yeast 2-micrometer plasmid DNA replication in vitro: origin and direction.

    PubMed Central

    Kojo, H; Greenberg, B D; Sugino, A

    1981-01-01

    Most yeast strains harbor extrachromosomal 2-micrometer DNA, and this DNA synthesis, like nuclear DNA replication, is strictly under cell cycle control. A soluble extract of yeast Saccharomyces cerevisiae carries out semiconservative replication of added 2-micrometer DNA and Escherichia coli chimeric plasmids containing the 2-micrometer DNA. Replication is initiated on 10% of the DNA, and one round of replication is completed. The major products in early stages of replication are theta ("eye") forms which originate 140 +/- 50 nucleotides within one of the 599-base-pair inverted repeats of 2-micrometer DNA. Their replication is bidirectional and discontinuous. Extracts prepared from the cell division cycle mutant cdc8 show temperature-sensitive 2-micrometer DNA synthesis in vitro, suggesting that this in vitro system resembles in vivo 2-micrometer plasmid DNA replication. This system should provide a useful assay for the purification and characterization of yeast DNA replication proteins. Images PMID:7038673

  5. Expression of c-myc and induction of DNA synthesis by platelet-poor plasma in human diploid fibroblasts

    SciTech Connect

    Ferrari, S.; Calabretta, B.; Battini, R.; Cosenza, S.C.; Owen, T.A.; Soprano, K.J.; Baserga, R. )

    1988-01-01

    When WI-38 human diploid fibroblasts become confluent, they stop synthesizing DNA and dividing. Addition of serum causes the quiescent cell to reenter the cell cycle. Prolonged quiescence after confluence decreases and delays the response to serum. For a few days after reaching confluence. WI-38 cells also respond to platelet-poor plasma. During this period, although not cycling, WI-38 cells still express c-myc and other growth-regulated genes, as measured by steady-state RNA levels. If the quiescence is prolonged further, c-myc expression (and that of two other growth-regulated genes) is no longer detectable, and its disappearance coincides with a loss of response to platelet-poor plasma. These results suggest that, also under physiological conditions, the expression of c-myc and other growth-regulated genes can cooperate with platelet-poor plasma in inducing cellular DNA synthesis in human diploid fibroblasts.

  6. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  7. Synthesis, DNA binding, photo-induced DNA cleavage, cytotoxicity studies of a family of heavy rare earth complexes.

    PubMed

    Chen, Gong-Jun; Wang, Zhi-Gang; Qiao, Xin; Xu, Jing-Yuan; Tian, Jin-Lei; Yan, Shi-Ping

    2013-10-01

    As a continuing investigation of our previous studies about the influence of the different rare earth metal ions on the bioactivity, a family of heavy rare earth metal complexes, [RE(acac)3(dpq)] (RE=Tb (1), Dy (2), Ho (3), Er (4), Tm (5), Yb (6), Lu (7)) and [RE(acac)3(dppz)]·CH3OH (RE=Tb (8), Dy (9), Ho (10), Er (11), Tm (12), Yb (13), Lu (14) viz. acetylacetonate (acac), dipyrido[3,2-d:20,30-f]quinoxaline (dpq), dipyrido[3,2-a:20,30-c] phenazine (dppz)), has been synthesized and their biological activities were also investigated. On the irradiation with UV-A light of 365nm or ambient light, all complexes exhibit efficient DNA cleavage activity via the mechanistic pathway involving the formation of singlet oxygen and hydroxyl radical as the reactive species. In addition, the in vitro cytotoxicity of these complexes on HeLa cells has been examined by MTT assay, which indicate that these compounds have the potential to act as effective anticancer drugs. The results of the above biological experiments also reveal that the choice of different rare earth metal ions has little influence on the DNA binding, DNA cleavage and cytotoxicity.

  8. Photoinduced interactions of supramolecular ruthenium(II) complexes with plasmid DNA: synthesis and spectroscopic, electrochemical, and DNA photocleavage studies.

    PubMed

    Swavey, Shawn; DeBeer, Madeleine; Li, Kaiyu

    2015-04-01

    Two new bridging ligands have been synthesized by combining substituted benzaldehydes with phenanthrolinopyrrole (php), resulting in new polyazine bridging ligands. The ligands have been characterized by (1)H NMR, mass spectroscopy, and elemental analysis. These new ligands display π-π* transitions above 500 nm with modest molar absorptivities. Upon excitation at the ligand-centered charge-transfer transition, weak emission with a maximum wavelength of 612 nm is observed. When coordinated to two ruthenium(II) bis(bipyridyl) groups, the new bimetallic complexes generated give an overall 4+ charge. The electronic transitions of the bimetallic ruthenium(II) complexes display traditional π-π* transitions at 287 nm and metal-to-ligand charge-transfer transitions at 452 nm with molar absorptivities greater than 30000 M(-1) cm(-1). Oxidation of the ruthenium(II) metal centers to ruthenium(III) occurs at potentials above 1.4 V versus the Ag/AgCl reference electrode. Spectroscopic and electrochemical measurements indicate that the ruthenium(II) moieties behave independently. Both complexes are water-soluble and show the ability to photonick plasmid DNA when irradiated with low-energy light above 550 nm. In addition, one of the complexes, [Ru(bpy)2php]2Van(4+), shows the ability to linearize plasmid DNA and gives evidence, by gel electrophoresis, of photoinduced binding to plasmid DNA. PMID:25798576

  9. Sequence identity of the terminal redundancies on the minus-strand DNA template is necessary but not sufficient for the template switch during hepadnavirus plus-strand DNA synthesis.

    PubMed Central

    Loeb, D D; Gulya, K J; Tian, R

    1997-01-01

    The template for hepadnavirus plus-strand DNA synthesis is a terminally redundant minus-strand DNA. An intramolecular template switch during plus-strand DNA synthesis, which permits plus-strand DNA elongation, has been proposed to be facilitated by this terminal redundancy, which is 7 to 9 nucleotides long. The aim of this study was to determine whether the presence of identical copies of the redundancy on the minus-strand DNA template was necessary and/or sufficient for the template switch and at what position(s) within the redundancy the switch occurs for duck hepatitis B virus. When dinucleotide insertions were placed within the copy of the redundancy at the 3' end of the minus-strand DNA template, novel sequences were copied into plus-strand DNA. The generation of these novel sequences could be explained by complete copying of the redundancy at the 5' end of the minus-strand DNA template followed by a template switch and then extension from a mismatched 3' terminus. In a second set of experiments, it was found that when one copy of the redundancy had either three or five nucleotides replaced the template switch was inhibited. When the identical, albeit mutant, sequences were restored in both copies of the redundancy, template switching was not necessarily restored. Our results indicate that the terminal redundancy on the minus-strand DNA template is necessary but not sufficient for template switching. PMID:8985334

  10. Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

    PubMed Central

    Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

    2012-01-01

    Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

  11. Synthesis of metal nanowires using nanocracks and DNA-templates and their characterization

    NASA Astrophysics Data System (ADS)

    Mani, Sathyanarayanan

    A major challenge in the field of nanotechnology is the synthesis and testing of nanostructures, such as nanowires, in a cost effective manner. Currently, there are two general approaches for fabricating nanowires, namely top-down and bottom-up. While the top-down approach that uses nano-lithography is controlled but expensive, the bottom-up approach that uses self-assembly is inexpensive but uncontrolled. This research, describes the mechanism behind an innovative and inexpensive method that combines both the top-down and bottom-up approaches to produce metal nanowires. The method uses cracks in PECVD silicon dioxide thin films on silicon substrate as molds to produce electroless deposited nickel nanowires. The cracks are initiated from voids formed due to nonconformal deposition of oxide on RIE etched trenches in silicon substrate. A model was developed to characterize void formation and the stress response of these oxide films during a thermal ramp, and identify the operating conditions such as film deposit thickness, trench dimensions and annealing temperature for controlled crack pattern formation. The nickel nanowires (50-250 nm wide) are polycrystalline with grain size ranging between 10 to 50 nm. Electrical characterization revealed that the resistivity of these wires decreased 10 times on sintering. However, this resistivity was still twice that of their bulk counterpart. This higher resistivity can be explained by the enhanced scattering of conductive electrons by grain boundaries and phosphorous impurities. An alternate nanowire fabrication technique that simplifies their testing by enabling their direct integration with MEMS test-beds has also been presented. In this approach, commercially available lambda DNA's (16.1 microns long and 2 nm wide) are used as templates to form nanowires of various metals through sputter deposition or evaporation. The test-bed is compatible with commercially available TEM stages for conducting in situ nanostructural

  12. A Novel Method for the Rapid and Specific Post-synthesis Modification of DNA via a Biocompatible Condensation of 1, 2-Aminothiols with 2-Cyanobenzothiazole

    PubMed Central

    Chen, Weixuan; Ni, Nanting; Ke, Bowen; Dai, Chaofeng; Wang, Binghe

    2013-01-01

    Post-synthesis modification of DNA is an important way of functionalizing DNA molecules. Herein we describe a method that first enzymatically incorporates a cyanobenzothiazole (CBT)-modified thymidine. The side chain handle CBT can undergo a rapid and site-specific cyclization reaction with 1,2-aminothiols to afford DNA functionalization in aqueous solution. Another key advantage of this method is the formation of a single stereo/regioisomer in the process, which allows for precise control of DNA modification to yield a single component for aptamer selection work and other applications. PMID:23447494

  13. SYNTHESIS OF THE FULLY PROTECTED PHOSPHORAMIDITE OF THE BENZENE-DNA ADDUCT, N2- (4-HYDROXYPHENYL)-2'-DEOXYGUANOSINE AND INCORPORATION OF THE LATER INTO DNA OLIGOMERS

    SciTech Connect

    Chenna, Ahmed; Gupta, Ramesh C.; Bonala, Radha R.; Johnson, Francis; Huang, Bo

    2008-06-09

    N2-(4-Hydroxyphenyl)-2'-deoxyguanosine-5'-O-DMT-3'-phosphoramidite has been synthesized and used to incorporate the N2-(4-hydroxyphenyl)-2'-dG (N2-4-HOPh-dG) into DNA, using solid-state synthesis technology. The key step to obtaining the xenonucleoside is a palladium (Xantphos-chelated) catalyzed N2-arylation (Buchwald-Hartwig reaction) of a fully protected 2'-deoxyguanosine derivative by 4-isobutyryloxybromobenzene. The reaction proceeded in good yield and the adduct was converted to the required 5'-O-DMT-3'-O-phosphoramidite by standard methods. The latter was used to synthesize oligodeoxynucleotides in which the N2-4-HOPh-dG adduct was incorporated site-specifically. The oligomers were purified by reverse-phase HPLC. Enzymatic hydrolysis and HPLC analysis confirmed the presence of this adduct in the oligomers.

  14. DNA-templated microwave-hydrothermal synthesis of nanostructured hydroxyapatite for storing and sustained release of an antibacterial protein.

    PubMed

    Chen, Xi; Yang, Bin; Qi, Chao; Sun, Tuan-Wei; Chen, Feng; Wu, Jin; Feng, Xi-Ping; Zhu, Ying-Jie

    2016-01-28

    Hydroxyapatite (HA) is promising in various biomedical applications owing to its similar chemical composition, structure and properties to the inorganic component in natural hard tissues. Herein, we report a DNA-templated microwave-assisted hydrothermal strategy for the preparation of HA nanostructured materials. As a kind of natural biomacromolecule, DNA molecules open up a new way to the synthesis of HA nanostructured materials with well-defined structures and morphologies. The HA nanostructured materials with a nanosheet-assembled hierarchical structure and a HA nanorod ordered structure are successfully prepared. The important roles of DNA molecules and pH values in the formation of HA nanostructured materials are investigated, and a possible formation mechanism is proposed. The as-prepared HA nanostructured materials exhibit a relatively high adsorption ability for chicken immunoglobulin Y (IgY) protein and a sustained protein release behavior. The as-prepared HA nanostructured materials after loading the IgY protein show a high antimicrobial activity. Thus, the HA nanostructured materials prepared by the DNA-templated microwave hydrothermal method are promising for the applications in various areas such as the prevention and treatment of dental caries.

  15. Synthesis, dark toxicity and induction of in vitro DNA photodamage by a tetra(4-nido-carboranylphenyl)porphyrin.

    PubMed

    Vicente, M G H; Nurco, D J; Shetty, S J; Osterloh, J; Ventre, E; Hegde, V; Deutsch, W A

    2002-11-01

    The total synthesis of tetra(4-carboranylphenyl)porphyrins 4 and 6 and their zinc(II) complexes 5 and 7 are described. These compounds were characterized by analytical and spectroscopic methods and, in the case of 5, by X-ray crystallography. The water-soluble nido-carboranylporphyrins 6 and 7 were found to have low dark toxicity towards V79 hamster lung fibroblast cells, using a clonogenic assay (50% colony survival, CS(50)>300 microM). Upon light activation nido-carboranylporphyrin 6 effectively induced DNA damage in vitro. Two different methods were used to assess the extent of DNA damage: the super-coiled to nicked DNA and the alkaline Comet assay using human leukemia K562 cells. Significant PDT-induced DNA damage was observed for porphyrin 6 using both assays, compared to light-only and porphyrin-only experiments. It is concluded that this type of nido-carboranylporphyrin is a promising sensitizer for both the boron neutron capture therapy and the photodynamic therapy of tumors.

  16. DNA-templated microwave-hydrothermal synthesis of nanostructured hydroxyapatite for storing and sustained release of an antibacterial protein.

    PubMed

    Chen, Xi; Yang, Bin; Qi, Chao; Sun, Tuan-Wei; Chen, Feng; Wu, Jin; Feng, Xi-Ping; Zhu, Ying-Jie

    2016-01-28

    Hydroxyapatite (HA) is promising in various biomedical applications owing to its similar chemical composition, structure and properties to the inorganic component in natural hard tissues. Herein, we report a DNA-templated microwave-assisted hydrothermal strategy for the preparation of HA nanostructured materials. As a kind of natural biomacromolecule, DNA molecules open up a new way to the synthesis of HA nanostructured materials with well-defined structures and morphologies. The HA nanostructured materials with a nanosheet-assembled hierarchical structure and a HA nanorod ordered structure are successfully prepared. The important roles of DNA molecules and pH values in the formation of HA nanostructured materials are investigated, and a possible formation mechanism is proposed. The as-prepared HA nanostructured materials exhibit a relatively high adsorption ability for chicken immunoglobulin Y (IgY) protein and a sustained protein release behavior. The as-prepared HA nanostructured materials after loading the IgY protein show a high antimicrobial activity. Thus, the HA nanostructured materials prepared by the DNA-templated microwave hydrothermal method are promising for the applications in various areas such as the prevention and treatment of dental caries. PMID:26696032

  17. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  18. Synthesis, antiproliferative activity and DNA binding properties of novel 5-aminobenzimidazo[1,2-a]quinoline-6-carbonitriles.

    PubMed

    Perin, Nataša; Nhili, Raja; Ester, Katja; Laine, William; Karminski-Zamola, Grace; Kralj, Marijeta; David-Cordonnier, Marie-Hélène; Hranjec, Marijana

    2014-06-10

    The synthesis of 5-amino substituted benzimidazo[1,2-a]quinolines prepared by microwave assisted amination from halogeno substituted precursor was described. The majority of compounds were active at micromolar concentrations against colon, lung and breast carcinoma cell lines in vitro. The N,N-dimethylaminopropyl 9 and piperazinyl substituted derivative 19 showed the most pronounced activity towards all of the three tested tumor cell lines, which could be correlated to the presence of another N heteroatom and its potential interactions with biological targets. The DNA binding studies, consisting of UV/Visible absorbency, melting temperature studies, and fluorescence and circular dichroism titrations, revealed that compounds 9, 19 and 20 bind to DNA as strong intercalators. The cellular distribution analysis, based on compounds' intrinsic fluorescence, showed that compound 20 does not enter the cell, while compounds 9 and 19 do, which is in agreement with their cytotoxic effects. Compound 9 efficiently targets the nucleus whereas 19, which also showed DNA intercalating properties in vitro, was mostly localised in the cytoplasm suggesting that the antitumor mechanism of action is DNA-independent. PMID:24780599

  19. Urinary tract infection drives genome instability in uropathogenic Escherichia coli and necessitates translesion synthesis DNA polymerase IV for virulence.

    PubMed

    Gawel, Damian; Seed, Patrick C

    2011-01-01

    Uropathogenic Escherichia coli (UPEC) produces ~80% of community-acquired UTI, the second most common infection in humans. During UTI, UPEC has a complex life cycle, replicating and persisting in intracellular and extracellular niches. Host and environmental stresses may affect the integrity of the UPEC genome and threaten its viability. We determined how the host inflammatory response during UTI drives UPEC genome instability and evaluated the role of multiple factors of genome replication and repair for their roles in the maintenance of genome integrity and thus virulence during UTI. The urinary tract environment enhanced the mutation frequency of UPEC ~100-fold relative to in vitro levels. Abrogation of inflammation through a host TLR4-signaling defect significantly reduced the mutation frequency, demonstrating in the importance of the host response as a driver of UPEC genome instability. Inflammation induces the bacterial SOS response, leading to the hypothesis that the UPEC SOS-inducible translesion synthesis (TLS) DNA polymerases would be key factors in UPEC genome instability during UTI. However, while the TLS DNA polymerases enhanced in vitro, they did not increase in vivo mutagenesis. Although it is not a source of enhanced mutagenesis in vivo, the TLS DNA polymerase IV was critical for the survival of UPEC during UTI during an active inflammatory assault. Overall, this study provides the first evidence of a TLS DNA polymerase being critical for UPEC survival during urinary tract infection and points to independent mechanisms for genome instability and the maintenance of genome replication of UPEC under host inflammatory stress.

  20. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals.

  1. Induction of pyrimidine dimers and unscheduled DNA synthesis in cultured mouse epithelial cells exposed to 254-nm- and u. v. -B radiation

    SciTech Connect

    Yotti, L.P.; Ley, R.D.

    1983-01-01

    The induction and fate of pyrimidine dimers and unscheduled DNA synthesis were measured in u.v.-irradiated primary, newborn SENCAR mouse epithelial cells. Unscheduled DNA synthesis was induced in a dose responsive manner by two u.v. sources, a germicidal lamp (254 nm) and an FS40 sunlamp (280--400 nm). Using the endonuclease-sensitive site assay to detect pyrimidine dimer production and excision, we examined the response of the newborn mouse cells to both u.v. sources. We were unable to detect the removal of pyrimidine dimers with either of the two sources of u.v. The speculation is made that primary, newborn mouse epidermal cells excise u.v.-induced pyrimidine dimers to an extent below the level of detection of the endonuclease-sensitive site assay but to an extent sufficient to induce unscheduled DNA synthesis.

  2. Synthesis, characterization, DNA binding, DNA cleavage and antimicrobial studies of Schiff base ligand and its metal complexes.

    PubMed

    Mendu, Padmaja; Kumari, C Gyana; Ragi, Rajesh

    2015-03-01

    A series of Cu(II), Ni(II), Co(II), Mn(II) and Zn(II) complexes have been synthesized from the Schiff base ligand L. The Schiff base ligand 4-chloro-2-((4-oxo-4H-chromen-3yl) methylene amino) benzoic acid (L) has been synthesized by the reaction between chromone-3-carbaldehyde and 4-chloro-2-amino benzoic acid. The nature of bonding and geometry of the transition metal complexes as well as ligand L have been deduced from elemental analysis, FT-IR, UV-vis, (1)H NMR, (13)C NMR, ESR spectral studies, mass, magnetic susceptibility and molar conductance measurements. The complexes are found to have ML2 composition and are neutral in DMSO. Based on elemental, conductance and spectral studies, six-coordinated geometry was assigned for these complexes. The ligand L acts as tridentate and coordinates through nitrogen atom of azomethine group, hydroxyl of the carboxyl group and oxygen atom of keto group of γ-pyrone ring. The interaction of Cu(II) complex with CT-DNA was carried out by UV-vis, fluorescence titrations and viscosity measurements. The complex binds to DNA through intercalative binding mode. The nuclease activity of the above metal complexes shows that Cu(II) and Co(II) complexes cleave DNA through redox chemistry. The biological activity of the ligand and its complexes have been studied on four bacteria E. coli, B. subtilis, pseudomonas and Edwardella and two fungi penicillium and trichoderma by well disc and fusion method and found that the metal complexes are more active than the free Schiff base ligand.

  3. DNA synthesis and microtubule assembly-related events in fertilized Paracentrotus lividus eggs: reversible inhibition by 10 mM procaine.

    PubMed

    Raymond, M N; Foucault, G; Coffe, G; Pudles, J

    1986-04-01

    This report describes the effects of 10 mM procaine on microtubule assembly and on DNA synthesis, as followed by [3H]colchicine binding assays and [3H]thymidine incorporation respectively, in fertilized Paracentrotus lividus eggs. In the absence of microtubule assembly inhibitors, about 25% of the total egg tubulin is submitted to two cycles of polymerization prior to the first cell division, this polymerization process precedes DNA synthesis. If the zygotes are treated with 10 mM procaine in the course of the cell cycle, tubulin polymerization is inhibited or microtubules are disassembled. DNA synthesis is inhibited when procaine treatment is performed 10 min, before the initiation of the S-period. However, when the drug is applied in the course of this synthetic period, the process is normally accomplished, but the next S-period becomes inhibited. Moreover, procaine treatment increases the cytoplasmic pH of the fertilized eggs by about 0.6 to 0.8 pH units. This pH increase precedes microtubule disassembly and inhibition of DNA synthesis. Washing out the drug induces a decrease of the intracellular pH which returns to about the same value as that of the fertilized egg controls. This pH change is then followed by the reinitiation of microtubule assembly, DNA synthesis and cell division. Our results show that the inhibition of both tubulin polymerization and DNA synthesis in fertilized eggs treated with 10 mM procaine, appears to be related to the drug-induced increase in cytoplasmic pH. PMID:3709552

  4. A Novel Styryldehydropyridocolinium Homodimer: Synthesis and Fluorescence Properties Upon Interaction with DNA.

    PubMed

    Yao, Huirong; Chang, Lifang; Liu, Chang; Jiao, Xiaojie; He, Song; Liu, Haijun; Zeng, Xianshun

    2015-11-01

    A novel homodimer of the styryldehydropyridocolinium dye (TPTP) has been synthesized and characterized. Free TPTP exhibited low fluorescence quantum yield and large Stokes shift (over 160 nm) in water. However, it showed a significant fluorescence turn-on effect upon intercalation into DNA base pairs. Meanwhile, the fluorescence intensity of the intercalated structures formed by TPTP and DNA decreased quickly upon addition of deoxyribonuclease I, indicating that the dye can be used to monitor deoxyribonuclease I activity and DNA hydrolysis. Electrophoresis analysis revealed that the dye had intercalative binding to DNA and can potentially be used for DNA staining in electrophoresis. Thus, the innate nature of large Stokes shift and excellent fluorescence turn on effect upon interaction with DNA endue the dye with a wide range of applications.

  5. A Novel Styryldehydropyridocolinium Homodimer: Synthesis and Fluorescence Properties Upon Interaction with DNA.

    PubMed

    Yao, Huirong; Chang, Lifang; Liu, Chang; Jiao, Xiaojie; He, Song; Liu, Haijun; Zeng, Xianshun

    2015-11-01

    A novel homodimer of the styryldehydropyridocolinium dye (TPTP) has been synthesized and characterized. Free TPTP exhibited low fluorescence quantum yield and large Stokes shift (over 160 nm) in water. However, it showed a significant fluorescence turn-on effect upon intercalation into DNA base pairs. Meanwhile, the fluorescence intensity of the intercalated structures formed by TPTP and DNA decreased quickly upon addition of deoxyribonuclease I, indicating that the dye can be used to monitor deoxyribonuclease I activity and DNA hydrolysis. Electrophoresis analysis revealed that the dye had intercalative binding to DNA and can potentially be used for DNA staining in electrophoresis. Thus, the innate nature of large Stokes shift and excellent fluorescence turn on effect upon interaction with DNA endue the dye with a wide range of applications. PMID:26384336

  6. Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

    PubMed

    Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

    2013-01-01

    All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

  7. The effect of rapamycin on DNA synthesis in multiple tissues from late gestation fetal and postnatal rats.

    PubMed

    Sanders, Jennifer A; Lakhani, Alisha; Phornphutkul, Chanika; Wu, Ke-Ying; Gruppuso, Philip A

    2008-08-01

    Rapamycin is a potent antiproliferative agent that arrests cells in the G1 phase of the cell cycle through a variety of mechanisms involving the inhibition of the mammalian target of rapamycin (mTOR) pathway. The majority of normal cells in culture are sensitive to the cytostatic effects of rapamycin, whereas the growth of many malignant cells and tumors is rapamycin resistant. We had shown previously that hepatic DNA synthesis in the late gestation rat fetus is rapamycin resistant even though signaling through the mTOR/S6 kinase (S6K) pathway is attenuated. On the basis of this finding, we went on to characterize the response to rapamycin in a spectrum of tissues during late gestation and the early postnatal period in the rat. We found that rapamycin had no effect on DNA synthesis in major organs such as heart, intestine, and kidney in the fetal and early postnatal rat despite a marked attenuation in the phosphorylation of ribosomal protein S6. In contrast, the proliferation of mature hepatocytes during liver regeneration was highly sensitive to rapamycin. These data indicate that basal cellular proliferation in a wide variety of tissues is rapamycin resistant and occurs independently of mTOR/S6K signaling. Furthermore, the well-characterized effects of rapamycin in tissue culture systems are not recapitulated in the asynchronous cell proliferation that accompanies normal growth and tissue remodeling.

  8. Inhibition of human carcinoma cell growth and DNA synthesis by silibinin, an active constituent of milk thistle: comparison with silymarin.

    PubMed

    Bhatia, N; Zhao, J; Wolf, D M; Agarwal, R

    1999-12-01

    Several studies from our laboratory have shown the cancer chemopreventive and anti-carcinogenic effects of silymarin, a flavonoid antioxidant isolated from milk thistle, in long-term tumorigenesis models and in human prostate, breast and cervical carcinoma cells. Since silymarin is composed mainly of silibinin with small amounts of other stereoisomers of silibinin, in the present communication, studies were performed to assess whether the cancer preventive and anti-carcinogenic effects of silymarin are due to its major component silibinin. Treatment of different prostate, breast, and cervical human carcinoma cells with silibinin resulted in a highly significant inhibition of both cell growth and DNA synthesis in a time-dependent manner with large loss of cell viability only in case of cervical carcinoma cells. When compared with silymarin, these effects of silibinin were consistent and comparable in terms of cell growth and DNA synthesis inhibition, and loss of cell viability. Based on the comparable results of silibinin and silymarin, we suggest that the cancer chemopreventive and anti-carcinogenic effects of silymarin reported earlier are due to the main constituent silibinin.

  9. DNA specific fluorescent symmetric dimeric bisbenzimidazoles DBP(n): the synthesis, spectral properties, and biological activity.

    PubMed

    Ivanov, Alexander A; Koval, Vasiliy S; Susova, Olga Yu; Salyanov, Victor I; Oleinikov, Vladimir A; Stomakhin, Andrey A; Shalginskikh, Natalya A; Kvasha, Margarita A; Kirsanova, Olga V; Gromova, Elizaveta S; Zhuze, Alexei L

    2015-07-01

    A series of new fluorescent symmetric dimeric bisbenzimidazoles DBP(n) bearing bisbenzimidazole fragments joined by oligomethylene linkers with a central 1,4-piperazine residue were synthesized. The complex formation of DBP(n) in the DNA minor groove was demonstrated. The DBP(n) at micromolar concentrations inhibit in vitro eukaryotic DNA topoisomerase I and prokaryotic DNA methyltransferase (MTase) M.SssI. The DBP(n) were soluble well in aqueous solutions and could penetrate cell and nuclear membranes and stain DNA in live cells. The DBP(n) displayed a moderate effect on the reactivation of gene expression.

  10. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  11. Synthesis, biophysical properties, and nuclease resistance properties of mixed backbone oligodeoxynucleotides containing cationic internucleoside guanidinium linkages: Deoxynucleic guanidine/DNA chimeras

    PubMed Central

    Barawkar, Dinesh A.; Bruice, Thomas C.

    1998-01-01

    The synthesis of mixed backbone oligodeoxynucleotides (18-mers) consisting of positively charged guanidinium linkages along with negatively charged phosphodiester linkages is carried out. The use of a base labile-protecting group for guanidinium linkage offers a synthetic strategy similar to standard oligonucleotide synthesis. The nuclease resistance of the oligodeoxyribonucleotides capped with guanidinium linkages at 5′ and 3′ ends are reported. The hybridization properties and sequence specificity of binding of these deoxynucleic guanidine/DNA chimeras with complementary DNA or RNA are described. PMID:9736687

  12. Conditional Lethal Mutants of Adenovirus 2-Simian Virus 40 Hybrids I. Host Range Mutants of Ad2+ND1

    PubMed Central

    Grodzicker, Terri; Anderson, Carl; Sharp, Phillip A.; Sambrook, Joe

    1974-01-01

    Human adenovirus type 2 (Ad2) grows poorly in monkey cells, although this defect can be overcome by co-infection with simian virus 40 (SV40). The nondefective Ad2-SV40 hybrid virus, Ad2+ND1, replicates efficiently in both human and African green monkey kidney cells, presumably due to the insertion of SV40 sequences into the Ad2 DNA. Several mutants of Ad2+ND1 have been isolated that grow and plaque poorly in monkey cells, although they retain the ability to replicate and plaque efficiently in HeLa cells. One of these mutants (H39) has been examined in detail. Studies comparing the DNA of the mutant with Ad2+ND1 either by the cleavage patterns produced by Escherichia coli R·RI restriction endonuclease digestion or by heteroduplexing reveal no differences. The pattern of protein synthesis of Ad2+ND1 and H39 in monkey cells is quite different with the mutant resembling Ad2, which is defective in the synthesis of late proteins. However, in human cells, the proteins synthesized by H39 and the parent Ad2+ND1 are very similar. The production of SV40 U antigen in H39-infected cells is different from that in Ad2+ND1-infected cells. Finally, the growth of H39 in monkey cells can be complemented by SV40. Images PMID:4364898

  13. DNA minor groove targeted alkylating agents based on bisbenzimidazole carriers: synthesis, cytotoxicity and sequence-specificity of DNA alkylation.

    PubMed

    Smaill, J B; Fan, J Y; Denny, W A

    1998-12-01

    A series of bisbenzimidazoles bearing a variety of alkylating agents [ortho- and meta-mustards, imidazolebis(hydroxymethyl), imidazolebis(methylcarbamate) and pyrrolebis(hydroxymethyl)], appended by a propyl linker chain, were prepared and investigated for sequence-specificity of DNA alkylation and their cytotoxicity. Previous work has shown that, for para-aniline mustards, a propyl linker is optimal for cytotoxicity. Alkaline cleavage assays using a variety of different labelled oligonucleotides showed that the preferred sequences for adenine alkylation were 5'-TTTANANAANN and 5'-ATTANANAANN (underlined bases show the drug alkylation sites), with AT-rich sequences required on both the 5' and 3' sides of the alkylated adenine. The different aniline mustards showed little variation in alkylation pattern and similar efficiencies of DNA cross-link formation despite the changes in orientation and positioning of the mustard, suggesting that the propyl linker has some flexibility. The imidazole- and pyrrolebis(hydroxymethyl) alkylators showed no DNA strand cleavage following base treatment, indicating that no guanine or adenine N3 or N7 adducts were formed. Using the PCR-based polymerase stop assay, these alkylators showed PCR blocks at 5'-C*G sites (the * nucleotide indicates the blocked site), particularly at 5'-TAC*GA 5'-AGC*GGA, and 5'-AGCC*GGT sequences, caused by guanine 2-NH2 lesions on the opposite strand. Only the (more reactive) imidazolebis(methylcarbamoyl) and pyrrolebis(hydroxymethyl) alkylators demonstrated interstrand cross-linking ability. All of the bifunctional mustards showed large (approximately 100-fold) increases in cytotoxicity over chlorambucil, with the corresponding monofunctional mustards being 20- to 60-fold less cytotoxic. These results suggest that in the mustards the propyl linker provides sufficient flexibility to achieve delivery of the alkylator to favoured (adenine N3) sites in the minor groove, regardless of its exact geometry with

  14. CYTOPLASMIC DNA SYNTHESIS IN AMOEBA PROTEUS. 3. FURTHER STUDIES ON THE NATURE OF THE DNA--CONTAINING ELEMENTS.

    PubMed

    WOLSTENHOLME, D R; PLAUT, W

    1964-09-01

    The application of electron microscope autoradiography to Amoeba proteus cells labeled with tritiated thymidine has permitted the identification of morphologically distinct particles in the cytoplasm as the sites of incorporated DNA precursor. The particles correspond to those previously described from light microscope studies, with respect to both H(3)Tdr incorporation and distribution in centrifugally stratified amoebae. Ingested bacteria differ from the particles, in morphology as well as in the absence of associated label. Attempts to introduce a normal particle labeling pattern by incubating amoebae with labeled sediment derived from used amoeba medium failed. The resultant conclusion, that the particles are maintained in the amoeba by self-duplication, is supported by the presence of particles in configurations suggestive of division.

  15. Synthesis of new steroidal imidazo [1,2-a] pyridines: DNA binding studies, cleavage activity and in vitro cytotoxicity.

    PubMed

    Dar, Ayaz Mahmood; Shamsuzzaman; Gatoo, Manzoor Ahmad

    2015-12-01

    A one-pot strategy for the catalytic synthesis of series of new 5α-cholestan-6-spiro-5'-phenylamino-2H-imidazo [1',2'-a] pyridines (4-14) has been investigated. The synthesized products were obtained in good yields (85-90%) and the protocol uses Multi-component Reaction (MCR) involving steroidal ketones, 2-aminopyridines, isocyanides and propylphosphonic anhydride (®T3P) as a catalyst. After characterization by spectral and analytical data, the interaction studies of compounds (4-6) with DNA were studied by UV-vis, fluorescence spectroscopy, gel electrophoresis and molecular docking. The compounds bind to DNA preferentially through electrostatic and hydrophobic interactions with Kb; 2.35×10(4), 3.71×10(4) and 3.24×10(4) M(-1), respectively, indicating the higher binding affinity of compound 5 towards DNA. Gel electrophoresis showed the concentration dependent cleavage activity of compounds 4-6 with DNA. Molecular docking studies suggested that compounds bind through minor groove to DNA. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay depicted promising anti-proliferative activity of compound 4-9 against different given cancer cells. In Western blotting, the expressions of relevant apoptotic markers depicted an apoptosis by steroidal imidazopyridines in A549 cells. Annexin V-FITC/PI staining data indicated that compounds could effectively induce apoptosis in A549 cells in a dose-dependent manner. FACS analysis shows that the compound 6 bring about cell cycle arrest at 2.62 μM concentration.

  16. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase.

    PubMed

    Takezawa, Yusuke; Kobayashi, Teruki; Shionoya, Mitsuhiko

    2016-01-01

    A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H)-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H-Cu(II)-H). In this study, we investigated the effects of a metal cofactor, Mg(II) ion, on the TdT-catalyzed polymerization of H nucleotides. At a high Mg(II) concentration (10 mM), the reaction was halted after several H nucleotides were appended. In contrast, at lower Mg(II) concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the Mg(II) concentration. In the presence of excess Mg(II) ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with Mg(II) ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands. PMID:27338351

  17. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    PubMed Central

    Takezawa, Yusuke; Kobayashi, Teruki; Shionoya, Mitsuhiko

    2016-01-01

    A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H)-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H). In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM), the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands. PMID:27338351

  18. (C-11)-thymidine PET imaging as a measure of DNA synthesis rate: A preliminary quantitative study of human brain glioblastoma

    SciTech Connect

    Wong, C.Y.O.; Yung, B.C.Y.; Conti, P.

    1994-05-01

    (C-11)-Thymidine (TdR) PET imaging can potentially be used to measure the tumor proliferation in-vivo and monitor treatment. Twenty-four stereotactic brain biopsies (SBB) following in-vivo bromodeoxyuridine (BUDR) under MRI guidance were obtained to correlate with TdR PET imaging of primary glioblastoma in human brain. Following data acquisition, standard 4 by 4 pixel (2mm/pixel) regions of interest (ROIs) were placed over the tumor site based on SBB and the corresponding homologous region of contralateral normal cortices. After correcting input function for major metabolites and subtracting TdR activity in the normal side from the tumor side of the brain, 2- and 3- compartmental analysis was performed for all the ROIs. Akaike :(AIC) and Bayes (BIC) information criteria was calculated to compare these 2 kinetic models for differentiating pure blood pool effects from TdR incorporation into DNA. Of 24 SBB regions, 20 non-overlapping and corresponding ROIs in PET were identified and quantified. Eight ROIs were selected based on the AIC, BIC and root-mean-square errors (RMSE < 0.1) (4 couldn`t be modelled and 8 most likely represented blood flow effects). The percentage (%) of BUDR per high power field area %BUDR labelling. The k3, the forward phosphorylation rate (hence an index of DNA synthesis), was categorized into 2 groups according to a threshold value of %BUDR/hpfa - 5%. The tumor regions with low proliferative index (%BUDR/hpfa<5%) have significantly lower k3 than those with high proliferative index (p<0.005). We also find that k4 is at least an order less than k3, suggesting minimal effects of dephosphorylation and efflux of metabolites. We conclude that 3-compartmental, 4-parameter modeling is adequate for TdR PET studies and k3 correlates with DNA synthesis rate.

  19. Next Generation Gene Synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device

    PubMed Central

    Matzas, Mark; Stähler, Peer F.; Kefer, Nathalie; Siebelt, Nicole; Boisguérin, Valesca; Leonard, Jack T.; Keller, Andreas; Stähler, Cord F.; Häberle, Pamela; Gharizadeh, Baback; Babrzadeh, Farbod; Church, George

    2012-01-01

    The setup of synthetic biological systems involving millions of bases is still limited by the required high quality of synthetic DNA. Important drivers to further open up the field are the accuracy and scale of chemical DNA synthesis and the downstream processing of longer DNA assembled from short fragments. We developed a new, highly parallel and miniaturized method for the preparation of high quality DNA termed “Megacloning” by using Next Generation Sequencing (NGS) technology in a preparative way. We demonstrate our method by processing both conventional and microarray-derived DNA oligonucleotides in combination with a bead-based high throughput pyrosequencing platform, gaining a 500-fold error reduction for microarray oligonucleotides in a first embodiment. We also show the assembly of synthetic genes as part of the Megacloning process. In principle, up to millions of DNA fragments can be sequenced, characterized and sorted in a single Megacloner run, enabling many new applications. PMID:21113166

  20. Complex Multiple-Nucleotide Substitution Mutations Causing Human Inherited Disease Reveal Novel Insights into the Action of Translesion Synthesis DNA Polymerases.

    PubMed

    Chen, Jian-Min; Férec, Claude; Cooper, David N

    2015-11-01

    Translesion synthesis (TLS) DNA polymerases allow the bypass of unrepaired lesions during DNA replication. Based upon mutational signatures of a subtype of multiple-nucleotide substitution (MNS) mutations causing human inherited disease, we have recently postulated two properties of TLS DNA polymerases in DNA repair, namely, the generation of neo-microhomologies potentiating strand-misalignment, and additional microlesions within the templated inserts when recruited to stalled replication forks. To provide further support for this postulate, we analyzed the mutational signatures of a new and complex subtype of pathogenic MNS mutation. Several mutations containing long templated inserts (8-19 bp) that are highly informative with regard to their underlying mutational mechanisms, harbor imprints of TLS DNA polymerase action. Dissecting the mechanism underlying the generation of the 19-bp insert implicated repeated participation of TLS DNA polymerases in the conversion of a damaged base into a complex MNS lesion through a process of successive template switching and bypass repair. PMID:26172832

  1. Synthesis of nucleobase-functionalized carbon nanotubes and their hybridization with single-stranded DNA.

    PubMed

    Hwu, Jih Ru; Kapoor, Mohit; Li, Rou-Ying; Lin, Yung-Chieh; Horng, Jia-Cherng; Tsay, Shwu-Chen

    2014-12-01

    For the first time ssDNA (25-aptamer of mixed dA, dT, dG, and dC) was wrapped around functionalized single-walled carbon nanotubes (SWCNTs), whose external surfaces were attached to multiple triazole-(ethylene glycol)-dA ligands. This method of hybridization involved the formation of hydrogen bonds between dT of ssDNA and dA of functionalized SWCNTs. It deviates from the reported π-π stacking between the nucleobases of DNA and the external sidewalls of nanotubes. The structural properties of the functionalized SWCNTs and its ssDNA complex were characterized by spectroscopic (including CD and Raman), thermogravimetric, and microscopic (TEM) methods. The results thus obtained establish a new platform of DNA delivery by use of nanotubes as a new vehicle with great potential in biomedical applications and drug development.

  2. A rescue act: Translesion DNA synthesis past N(2) -deoxyguanosine adducts.

    PubMed

    Nair, Deepak T; Kottur, Jithesh; Sharma, Rahul

    2015-07-01

    Genomic DNA is continually subjected to a number of chemical insults that result in the formation of modified nucleotides--termed as DNA lesions. The N(2) -atom of deoxyguanosine is particularly reactive and a number of chemicals react at this site to form different kinds of DNA adducts. The N(2) -deoxyguanosine adducts perturb different genomic processes and are particularly deleterious for DNA replication as they have a strong tendency to inhibit replicative DNA polymerases. Many organisms possess specialized dPols--generally classified in the Y-family--that serves to rescue replication stalled at N(2) -dG and other adducts. A review of minor groove N(2) -adducts and the known strategies utilized by Y-family dPols to replicate past these lesions will be presented here.

  3. Synthesis of Sequence-Specific DNA-Protein Conjugates via a Reductive Amination Strategy

    PubMed Central

    Wickramaratne, Susith; Mukherjee, Shivam; Villalta, Peter W.; Schärer, Orlando D.; Tretyakova, Natalia

    2013-01-01

    DNA-protein cross-links (DPCs) are ubiquitous, structurally diverse DNA lesions formed upon exposure to bis-electrophiles, transition metals, UV light, and reactive oxygen species. Because of their super-bulky, helix distorting nature, DPCs interfere with DNA replication, transcription, and repair, potentially contributing to mutagenesis and carcinogenesis. However, the biological implications of DPC lesions have not been fully elucidated due to the difficulty of generating site-specific DNA substrates representative of DPC lesions formed in vivo. In the present study, a novel approach involving post-synthetic reductive amination has been developed to prepare a range of hydrolytically stable lesions structurally mimicking the DPCs produced between the N7 position of guanine in DNA and basic lysine or arginine side chains of proteins and peptides. PMID:23885807

  4. DNA-mediated control of metal nanoparticle shape: one-pot synthesis and cellular uptake of highly stable and functional gold nanoflowers.

    PubMed

    Wang, Zidong; Zhang, Jieqian; Ekman, Jonathan M; Kenis, Paul J A; Lu, Yi

    2010-05-12

    The effects of different DNA molecules of the same length on the morphology of gold nanoparticles during synthesis are investigated. While spherical nanoparticles (AuNS) are observed in the presence of 30-mer poly T, like that in the absence of DNA, 30-mer poly A or poly C induces formation of the flower-shaped gold nanoparticle (AuNF). Detailed mechanistic studies indicate that the difference in DNA affinity to the AuNP plays a major role in the different morphology control processes. The DNA adsorbed on the AuNS surface could act as template to mediate the formation of flower-like gold nanoparticles. The formation of the AuNF can result from either selective deposition of the reduced gold metal on AuNS templated by surface bound DNA or uneven growth of the AuNS due to the binding of DNA to the surface. Furthermore, DNA functionalization with high stability was realized in situ during the one-step synthesis while retaining their biorecognition ability, allowing programmable assembly of new nanostructures. We have also shown that the DNA-functionalized nanoflowers can be readily uptaken by cells and visualized under dark-field microscopy.

  5. Enteric adenovirus type 40: complementation of the E4 defect in Ad2 dl808.

    PubMed

    Mautner, V; Mackay, N

    1991-07-01

    The enteric adenovirus type 40 cannot be passaged in HeLa cells, but will grow productively in cells that express the E1B region of adenovirus types 2 or 5. Even in such permissive cells, the lytic cycle is prolonged, there is an abnormal pattern of E1B early gene expression and a failure to switch off host cell functions, suggesting that other gene functions might be impaired in Ad40. For Ad2, E4 ORF 6 and ORF 3 proteins are known to have an essential role in progressing from the early to the late phase of lytic infection and the shutoff of host functions requires an interaction between the E4 ORF 6 34K protein and the E1B 55K protein. To test whether E4 functions of Ad40 are impaired, complementation tests have been made between Ad40 and the E4 deletion mutant Ad2 dl808, which lacks all but ORF 1 of the E4 region. In HeLa and Vero cells, Ad40 complements dl808 to levels equivalent to an Ad2 wild-type infection, as demonstrated by measuring virion packaged DNA, virus titration, and viral protein synthesis. Surprisingly, Ad2 dl808 fails to reciprocally complement Ad40. The results show that Ad40 produces functional E4 ORF 6 and/or ORF 3 activity, and that their expression precedes DNA replication.

  6. Substitutions at Phe61 in the beta3-beta4 hairpin of HIV-1 reverse transcriptase reveal a role for the Fingers subdomain in strand displacement DNA synthesis.

    PubMed

    Fisher, Timothy S; Darden, Tom; Prasad, Vinayaka R

    2003-01-17

    Unlike most DNA polymerases, retroviral reverse transcriptases (RTs) are capable of strand displacement DNA synthesis in vitro, unassisted by other proteins. While human immunodeficiency virus type 1 (HIV-1) RT has been shown to possess this rare ability, the structural determinants responsible are unknown. X-Ray crystallographic and biochemical studies have indicated that the beta3-beta4 hairpin of the fingers subdomain of HIV-1 RT contains key contacts for the incoming template strand. In order to assess the possible role of the fingers subdomain in strand displacement synthesis, a set of substitutions was created at the highly conserved Phe61 residue, which is thought to contact the template strand immediately ahead of the dNTP-binding site. Purified heterodimeric RTs containing Phe61 substitutions displayed altered degrees of strand displacement synthesis on nicked and gapped duplex DNA templates with the relative order being: F61Y > or = F61L > wild-type = F61A > F61W. In order to verify that the effects on strand displacement synthesis were not an indirect effect of alterations in processivity, all Phe61 mutants were tested for processive polymerization. While the strand displacement activity of F61W RT variant was affected severely, it displayed a wild-type-like processivity. In contrast, both F61L and F61Y substitutions, despite showing enhanced strand displacement synthesis, displayed reduced processivity. In contrast, the processivity of F61A mutant, which had displayed nearly wild-type-like strand displacement synthesis, was affected most. These results showed that the effects of Phe61 substitutions on strand displacement are not due to global changes in polymerase processivity. Analysis of pause sites during DNA polymerization on double-stranded templates revealed that the wild-type and the Phe61 mutant RTs interact with the template quite differently. Modeling a 5 nt duplex DNA ahead of the dNTP-binding site of HIV-1 RT suggested a correlation between

  7. High-resolution analysis of DNA synthesis start sites and nucleosome architecture at efficient mammalian replication origins.

    PubMed

    Lombraña, Rodrigo; Almeida, Ricardo; Revuelta, Isabel; Madeira, Sofia; Herranz, Gonzalo; Saiz, Néstor; Bastolla, Ugo; Gómez, María

    2013-10-01

    DNA replication origins are poorly characterized genomic regions that are essential to recruit and position the initiation complex to start DNA synthesis. Despite the lack of specific replicator sequences, initiation of replication does not occur at random sites in the mammalian genome. This has lead to the view that DNA accessibility could be a major determinant of mammalian origins. Here, we performed a high-resolution analysis of nucleosome architecture and initiation sites along several origins of different genomic location and firing efficiencies. We found that mammalian origins are highly variable in nucleosome conformation and initiation patterns. Strikingly, initiation sites at efficient CpG island-associated origins always occur at positions of high-nucleosome occupancy. Origin recognition complex (ORC) binding sites, however, occur at adjacent but distinct positions marked by labile nucleosomes. We also found that initiation profiles mirror nucleosome architecture, both at endogenous origins and at a transgene in a heterologous system. Our studies provide a unique insight into the relationship between chromatin structure and initiation sites in the mammalian genome that has direct implications for how the replication programme can be accommodated to diverse epigenetic scenarios.

  8. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone. PMID:27139727

  9. DNA adducts of aristolochic acid II: total synthesis and site-specific mutagenesis studies in mammalian cells

    PubMed Central

    Attaluri, Sivaprasad; Bonala, Radha R.; Yang, In-Young; Lukin, Mark A.; Wen, Yujing; Grollman, Arthur P.; Moriya, Masaaki; Iden, Charles R.; Johnson, Francis

    2010-01-01

    Aristolochic acids I and II (AA-I, AA-II) are found in all Aristolochia species. Ingestion of these acids either in the form of herbal remedies or as contaminated wheat flour causes a dose-dependent chronic kidney failure characterized by renal tubulointerstitial fibrosis. In ∼50% of these cases, the condition is accompanied by an upper urinary tract malignancy. The disease is now termed aristolochic acid nephropathy (AAN). AA-I is largely responsible for the nephrotoxicity while both AA-I and AA-II are genotoxic. DNA adducts derived from AA-I and AA-II have been isolated from renal tissues of patients suffering from AAN. We describe the total synthesis, de novo, of the dA and dG adducts derived from AA-II, their incorporation site-specifically into DNA oligomers and the splicing of these modified oligomers into a plasmid construct followed by transfection into mouse embryonic fibroblasts. Analysis of the plasmid progeny revealed that both adducts blocked replication but were still partly processed by DNA polymerase(s). Although the majority of coding events involved insertion of correct nucleotides, substantial misincorporation of bases also was noted. The dA adduct is significantly more mutagenic than the dG adduct; both adducts give rise, almost exclusively, to misincorporation of dA, which leads to AL-II-dA→T and AL-II-dG→T transversions. PMID:19854934

  10. Structurally Diverse Polyamines: Solid-Phase Synthesis and Interaction with DNA.

    PubMed

    Umezawa, Naoki; Horai, Yuhei; Imamura, Yuki; Kawakubo, Makoto; Nakahira, Mariko; Kato, Nobuki; Muramatsu, Akira; Yoshikawa, Yuko; Yoshikawa, Kenichi; Higuchi, Tsunehiko

    2015-08-17

    A versatile solid-phase approach based on peptide chemistry was used to construct four classes of structurally diverse polyamines with modified backbones: linear, partially constrained, branched, and cyclic. Their effects on DNA duplex stability and structure were examined. The polyamines showed distinct activities, thus highlighting the importance of polyamine backbone structure. Interestingly, the rank order of polyamine ability for DNA compaction was different to that for their effects on circular dichroism and melting temperature, thus indicating that these polyamines have distinct effects on secondary and higher-order structures of DNA.

  11. New structural snapshots provide molecular insights into the mechanism of high fidelity DNA synthesis.

    PubMed

    Freudenthal, Bret D; Beard, William A; Wilson, Samuel H

    2015-08-01

    Time-lapse X-ray crystallography allows visualization of intermediate structures during the DNA polymerase catalytic cycle. Employing time-lapse crystallography with human DNA polymerase β has recently allowed us to capture and solve novel intermediate structures that are not stable enough to be analyzed by traditional crystallography. The structures of these intermediates reveals exciting surprises about active site metal ions and enzyme conformational changes as the reaction proceeds from the ground state to product release. In this perspective, we provide an overview of recent advances in understanding the DNA polymerase nucleotidyl transferase reaction and highlight both the significance and mysteries of enzyme efficiency and specificity that remain to be solved.

  12. Synthesis, characterization, DNA binding studies, photocleavage, cytotoxicity and docking studies of ruthenium(II) light switch complexes.

    PubMed

    Gabra, Nazar Mohammed; Mustafa, Bakheit; Kumar, Yata Praveen; Devi, C Shobha; Srishailam, A; Reddy, P Venkat; Reddy, Kotha Laxma; Satyanarayana, S

    2014-01-01

    A new ligand 3-(1H-imidazo[4,5-f][1,10]phenanthrolin-2yl)phenylboronic acid and its (IPPBA) three ruthenium(II) complexes [Ru(phen)2(IPPBA)](ClO4)2 (1), [Ru(bpy)2(IPPBA)](ClO4)2 (2) and [Ru(dmb)2(IPPBA)](ClO4)2 (3) have been synthesized and characterized by elemental analysis, UV/VIS, IR, (1)H-NMR,(13)C-NMR and mass spectra. The binding behaviors of the three complexes to calf thymus DNA were investigated by absorption spectra, emission spectroscopy, viscosity measurements, thermal denaturation and photoactivated cleavage. The DNA-binding constants for complexes 1, 2 and 3 have been determined to be 7.9 × 10(5) M(-1), 6.7 × 10(5) M(-1) and 2.9 × 10(5) M(-1). The results suggest that these complexes bound to double-stranded DNA in an intercalation mode. Upon irradiation at 365 nm, three ruthenium complexes were found to promote the cleavage of plasmid pBR322 DNA from super coiled form І to nicked form ІІ. Further in the presence of Co(2+), the emission of DNA-Ru(ΙΙ) complexes can be quenched. And when EDTA was added, the emission was recovered. The experimental results show that all three complexes exhibited the "on-off-on" properties of molecular "light switch". The highest Cytotoxicity potential of the complex1 was observed on the Human alveolar adenocarcinoma (A549) cell line. Good agreement was generally found between the spectroscopic techniques and molecular docked model which provides further evidence of groove binding. PMID:23982735

  13. A noninflammatory immune response in aged DNA Aβ42-immunized mice supports its safety for possible use as immunotherapy in AD patients.

    PubMed

    Lambracht-Washington, Doris; Rosenberg, Roger N

    2015-03-01

    Aging in the immune system results in tendency to proinflammatory responses. Intradermal DNA immunization showed Th2 polarized noninflammatory immune responses. We tested here 18-month-old mice which were immunized with Aβ42 peptide, DNA Aβ42 trimer, or 2 different prime boost protocols identical to previous experiments. High Aβ42 antibody levels were found in aged mice which had received peptide immunizations (900 μg/mL plasma), and in mice which had received peptide prime and DNA boost immunizations (500 μg/mL), compared with antibodies in DNA Aβ42 immunized mice with 50 μg/mL. Although we found T-cell proliferation and inflammatory cytokines in mice which had received peptide or prime boost immunization, these were not found in DNA-immunized mice. The results are concordant with proinflammatory responses because of immunosenescence and contraindicate the use of Aβ42 peptide immunizations or prime boost immunization protocols for the use in elderly Alzheimer's disease patients. DNA Aβ42 immunization only on the other hand does lead to effective levels of antibodies without inflammatory cytokine or T-cell responses in the aged animal model tested. PMID:25725942

  14. A noninflammatory immune response in aged DNA Aβ42-immunized mice supports its safety for possible use as immunotherapy in AD patients.

    PubMed

    Lambracht-Washington, Doris; Rosenberg, Roger N

    2015-03-01

    Aging in the immune system results in tendency to proinflammatory responses. Intradermal DNA immunization showed Th2 polarized noninflammatory immune responses. We tested here 18-month-old mice which were immunized with Aβ42 peptide, DNA Aβ42 trimer, or 2 different prime boost protocols identical to previous experiments. High Aβ42 antibody levels were found in aged mice which had received peptide immunizations (900 μg/mL plasma), and in mice which had received peptide prime and DNA boost immunizations (500 μg/mL), compared with antibodies in DNA Aβ42 immunized mice with 50 μg/mL. Although we found T-cell proliferation and inflammatory cytokines in mice which had received peptide or prime boost immunization, these were not found in DNA-immunized mice. The results are concordant with proinflammatory responses because of immunosenescence and contraindicate the use of Aβ42 peptide immunizations or prime boost immunization protocols for the use in elderly Alzheimer's disease patients. DNA Aβ42 immunization only on the other hand does lead to effective levels of antibodies without inflammatory cytokine or T-cell responses in the aged animal model tested.

  15. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  16. N-aroyloxylthioxo-naphthalimides as DNA photocleavers of aroyloxyl oxygen radicals: synthesis, evaluation, and substituents' effect.

    PubMed

    Xu, Yufang; Huang, Xiayu; Qian, Xuhong; Yao, Wei

    2004-05-01

    Novel N-Aroyloxylthioxo-naphthalimides as highly efficient 'time-resolved' DNA photocleavers of aroyloxyl radicals type were designed and synthesized. The substituents at the aroyloxyl moiety have an important and unusual influence on the DNA photocleavage, and DNA photodamages of the compounds were unusually not depended on the electronic effects of substituents on the corresponding oxygen-centered radicals. With AM1 semi-empirical quantum calculation, it was found that their photocleaving activities were correlated with the densities of electron clouds on the N-O bonds in the triplet state. N-(m-Dichloro-benzoyloxy)-thioxo-naphthalimide could photodamage DNA effectively at less than the concentration of 2 microM.

  17. Synthesis, photochemistry, DNA cleavage/binding and cytotoxic properties of fluorescent quinoxaline and quinoline hydroperoxides.

    PubMed

    Chowdhury, Nilanjana; Gangopadhyay, Moumita; Karthik, S; Pradeep Singh, N D; Baidya, Mithu; Ghosh, S K

    2014-01-01

    Novel fluorescent quinoxaline and quinoline hydroperoxides were shown to perform dual role as both fluorophores for cell imaging and photoinduced DNA cleaving agents. Photophysical studies of newly synthesized quinoxaline and quinoline hydroperoxides showed that they all exhibited moderate to good fluorescence. Photolysis of quinoxaline and quinoline hydroperoxides in acetonitrile using UV light above 350nm resulted in the formation of corresponding ester compounds via γ-hydrogen abstraction by excited carbonyl chromophore. Single strand DNA cleavage was achieved on irradiation of newly synthesized hydroperoxides by UV light (⩾350nm). Both hydroxyl radicals and singlet oxygen were identified as reactive oxygen species (ROS) responsible for the DNA cleavage. Further, we showed quinoline hydroperoxide binds to ct-DNA via intercalative mode. In vitro biological studies revealed that quinoline hydroperoxide has good biocompatibility, cellular uptake property and cell imaging ability. Finally, we showed that quinoline hydroperoxide can permeate into cells efficiently and may cause cytotoxicity upon irradiation by UV light.

  18. Synthesis of dihydromyricetin-manganese (II) complex and interaction with DNA

    NASA Astrophysics Data System (ADS)

    Guo, Qingquan; Yuan, Juan; Zeng, Jinhua; He, Xiangzhu; Li, Daguang

    2012-11-01

    Dihydromyricetin has many physiological functions and its metal complex could have better effects. DNA is very important in biological body, but little attention has been devoted to the relationship between dihydromyricetin-metal complex and the DNA. In this paper, dihydromyricetin-Mn (II) complex has been prepared and characterized using UV-vis absorption spectrophotometry, IR spectroscopy, elemental analysis, and thermal gravimetric analysis (TG-DTA Analysis). The interaction of dihydromyricetin-Mn (II) complex with DNA was investigated using UV-vis spectra, fluorescence measurements and viscosity measurements. The results indicate that the dihydromyricetin-manganese (II) complex can intercalate into the stacked base pairs of DNA with binding constant Kb = 5.64 × 104 M and compete with the strong intercalator ethidium bromide for the intercalative binding sites with Stern-Volmer quenching constant, Ksq = 1.16.

  19. Design and synthesis of DNA-tethered ruthenium complexes that self-assemble into linear arrays.

    PubMed

    Stewart, Kristen M; McLaughlin, Larry W

    2003-12-01

    Ruthenium(II) bis(terpyridine) complexes have been prepared with two triethylene glycol linkers to which DNA sequences have been attached; hybridization at various complex ratios results in linear arrays of varying lengths.

  20. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  1. Synthesis, characterization, thermal and DNA-binding properties of new zinc complexes with 2-hydroxyphenones.

    PubMed

    Mrkalić, Emina; Zianna, Ariadni; Psomas, George; Gdaniec, Maria; Czapik, Agnieszka; Coutouli-Argyropoulou, Evdoxia; Lalia-Kantouri, Maria

    2014-05-01

    The neutral mononuclear zinc complexes with 2-hydroxyphenones (ketoH) having the formula [Zn(keto)2(H2O)2] and [Zn(keto)2(enR)], where enR stands for a N,N'-donor heterocyclic ligand such as 2,2'-bipyridine (bipy), 1,10-phenanthroline (phen) or 2,2'-dipyridylamine (dpamH), have been synthesized and characterized by IR, UV and (1)H NMR spectroscopies. The 2-hydroxyphenones are chelated to the metal ion through the phenolate and carbonyl oxygen atoms. The crystal structures of [bis(2-hydroxy-4-methoxy-benzophenone)(2,2'-bipyridine)zinc(II)] dimethanol solvate and [bis(2-hydroxy-benzophenone)(2,2'-bipyridine)zinc(II)] dimethanol solvate have been determined by X-ray crystallography. The thermal stability of the zinc complexes has been investigated by simultaneous TG/DTG-DTA technique. The ability of the complexes to bind to calf-thymus DNA (CT DNA) has been studied by UV-absorption and fluorescence emission spectroscopy as well as viscosity measurements. UV studies of the interaction of the complexes with DNA have shown that they can bind to CT DNA and the corresponding binding constants to DNA have been calculated and evaluated. The complexes most probably bind to CT DNA via intercalation as concluded by studying the viscosity of a DNA solution in the presence of the complexes. Competitive studies with ethidium bromide (EB) have shown that the reported complexes can displace the DNA-bound EB, suggesting strong competition with EB for the intercalation site. PMID:24561277

  2. Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine

    SciTech Connect

    Lee, S.; Bowman, B.R.; Ueno, Y.; Wang, S.; Verdine, G.L.

    2008-11-03

    The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in the DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.

  3. Sm(III)nitrate-catalyzed one-pot synthesis of furano[3,2c]-1,2,3,4-tetrahydroquinolines and DNA photocleavage studies

    NASA Astrophysics Data System (ADS)

    Bindu, P. J.; Mahadevan, K. M.; Ravikumar Naik, T. R.

    2012-08-01

    The synthesis and DNA photocleavage studies of furano[3,2-c]-1,2,3,4-tetrahydroquinolines have been reported. Sm(III)nitrate was found to be an efficient for the Diels-Alder reaction of aryl amines with 2,3-dihydrofuran to offer the corresponding furano[3,2-c]-1,2,3,4-tetrahydroquinolines derivatives as a mixture of cis/trans stereoisomers in moderate yields. The aqueous solubility of acid catalyst can be recycled without significant loss of activity. The DNA photocleavage studies shows that, the cis/trans stereoisomers are good DNA cleavage mimic in terms of molecular structure.

  4. Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not.

    PubMed

    de Castro, R D; van Lammeren, A A; Groot, S P; Bino, R J; Hilhorst, H W

    2000-02-01

    We studied cell cycle events in embryos of tomato (Lycopersicon esculentum Mill. cv Moneymaker) seeds during imbibition in water and during osmoconditioning ("priming") using both quantitative and cytological analysis of DNA synthesis and beta-tubulin accumulation. Most embryonic nuclei of dry, untreated control seeds were arrested in the G(1) phase of the cell cycle. This indicated the absence of DNA synthesis (the S-phase), as confirmed by the absence of bromodeoxyuridine incorporation. In addition, beta-tubulin was not detected on western blots and microtubules were not present. During imbibition in water, DNA synthesis was activated in the radicle tip and then spread toward the cotyledons, resulting in an increase in the number of nuclei in G(2). Concomitantly, beta-tubulin accumulated and was assembled into microtubular cytoskeleton networks. Both of these cell cycle events preceded cell expansion and division and subsequent growth of the radicle through the seed coat. The activation of DNA synthesis and the formation of microtubular cytoskeleton networks were also observed throughout the embryo when seeds were osmoconditioned. However, this pre-activation of the cell cycle appeared to become arrested in the G(2) phase since no mitosis was observed. The pre-activation of cell cycle events in osmoconditioned seeds appeared to be correlated with enhanced germination performance during re-imbibition in water.

  5. Design, synthesis, physicochemical studies, solvation, and DNA damage of quinoline-appended chalcone derivative: comprehensive spectroscopic approach toward drug discovery.

    PubMed

    Kumar, Himank; Chattopadhyay, Anjan; Prasath, R; Devaraji, Vinod; Joshi, Ritika; Bhavana, P; Saini, Praveen; Ghosh, Sujit Kumar

    2014-07-01

    The present study epitomizes the design, synthesis, photophysics, solvation, and interaction with calf-thymus DNA of a potential antitumor, anticancer quinoline-appended chalcone derivative, (E)-3-(anthracen-10-yl)-1-(6,8-dibromo-2-methylquinolin-3-yl)prop-2-en-1-one (ADMQ) using steady state absorption and fluorescence spectroscopy, molecular modeling, molecular docking, Fourier-transform infrared spectroscopy (FTIR), molecular dynamics (MD) simulation, and gel electrophoresis studies. ADMQ shows an unusual photophysical behavior in a variety of solvents of different polarity. The dual emission has been observed along with the formation of twisted intramolecular charge transfer (TICT) excited state. The radiationless deactivation of the TICT state is found to be promoted strongly by hydrogen bonding. Quantum mechanical (DFT, TDDFT, and ZINDO-CI) calculations show that the ADMQ is sort of molecular rotor which undergoes intramolecular twist followed by a complete charge transfer in the optimized excited state. FTIR studies reveals that ADMQ undergoes important structural change from its native structure to a β-hydroxy keto form in water at physiological pH. The concentration-dependent DNA cleavage has been identified in agarose gel DNA electrophoresis experiment and has been further supported by MD simulation. ADMQ forms hydrogen bond with the deoxyribose sugar attached with the nucleobase adenine DA-17 (chain A) and result in significant structural changes which potentially cleave DNA double helix. The compound does not exhibit any deleterious effect or toxicity to the E. coli strain in cytotoxicity studies. The consolidated spectroscopic research described herein can provide enormous information to open up new avenues for designing and synthesizing chalcone derivatives with low systematic toxicity for medicinal chemistry research. PMID:24962605

  6. The E1B19K-deleted oncolytic adenovirus mutant AdΔ19K sensitizes pancreatic cancer cells to drug-induced DNA-damage by down-regulating Claspin and Mre11

    PubMed Central

    Pantelidou, Constantia; Cherubini, Gioia; Lemoine, Nick R.; Halldén, Gunnel

    2016-01-01

    Adenovirus-mediated sensitization of cancer cells to cytotoxic drugs depends on simultaneous interactions of early viral genes with cell death and survival pathways. It is unclear what cellular factors mediate these interactions in the presence of DNA-damaging drugs. We found that adenovirus prevents Chk1-mediated checkpoint activation through inactivation of Mre11 and downregulation of the pChk1 adaptor-protein, Claspin, in cells with high levels of DNA-damage induced by the cytotoxic drugs gemcitabine and irinotecan. The mechanisms for Claspin downregulation involve decreased transcription and increased degradation, further attenuating pChk1-mediated signalling. Live cell imaging demonstrated that low doses of gemcitabine caused multiple mitotic aberrations including multipolar spindles, micro- and multi-nucleation and cytokinesis failure. A mutant virus with the anti-apoptotic E1B19K-gene deleted (AdΔ19K) further enhanced cell killing, Claspin downregulation, and potentiated drug-induced DNA damage and mitotic aberrations. Decreased Claspin expression and inactivation of Mre11 contributed to the enhanced cell killing in combination with DNA-damaging drugs. These results reveal novel mechanisms that are utilised by adenovirus to ensure completion of its life cycle in the presence of cellular DNA damage. Taken together, our findings reveal novel cellular targets that may be exploited when developing improved anti-cancer therapeutics. PMID:26872382

  7. Novel sphingosine-containing analogues selectively inhibit sphingosine kinase (SK) isozymes, induce SK1 proteasomal degradation and reduce DNA synthesis in human pulmonary arterial smooth muscle cells

    PubMed Central

    Byun, Hoe-Sup; Pyne, Susan; MacRitchie, Neil; Pyne, Nigel J.

    2013-01-01

    Sphingosine 1-phosphate (S1P) is involved in hyper-proliferative diseases such as cancer and pulmonary arterial hypertension. We have synthesized inhibitors that are selective for the two isoforms of sphingosine kinase (SK1 and SK2) that catalyze the synthesis of S1P. A thiourea adduct of sphinganine (F02) is selective for SK2 whereas the 1-deoxysphinganines 55-21 and 77-7 are selective for SK1. (2S,3R)-1-Deoxysphinganine (55-21) induced the proteasomal degradation of SK1 in human pulmonary arterial smooth muscle cells and inhibited DNA synthesis, while the more potent SK1 inhibitors PF-543 and VPC96091 failed to inhibit DNA synthesis. These findings indicate that moderate potency inhibitors such as 55-21 are likely to have utility in unraveling the functions of SK1 in inflammatory and hyperproliferative disorders. PMID:24396570

  8. Simulated Screens of DNA Encoded Libraries: The Potential Influence of Chemical Synthesis Fidelity on Interpretation of Structure-Activity Relationships.

    PubMed

    Satz, Alexander L

    2016-07-11

    Simulated screening of DNA encoded libraries indicates that the presence of truncated byproducts complicates the relationship between library member enrichment and equilibrium association constant (these truncates result from incomplete chemical reactions during library synthesis). Further, simulations indicate that some patterns observed in reported experimental data may result from the presence of truncated byproducts in the library mixture and not structure-activity relationships. Potential experimental methods of minimizing the presence of truncates are assessed via simulation; the relationship between enrichment and equilibrium association constant for libraries of differing purities is investigated. Data aggregation techniques are demonstrated that allow for more accurate analysis of screening results, in particular when the screened library contains significant quantities of truncates.

  9. Induction by gamma-radiation of DNA synthesis in radicle cells of germinating seeds of Pisum sativum l.

    PubMed

    Gudkov, I N; Grodzinsky, D M

    1976-05-01

    In radicle meristem cells of germinating seeds of the pea (Pisum sativum L) before the onset of replicative synthesis of DNA, irradiation with 2-3 krad of gamma-rays induced the incorporation of 3H-thymidine (3H-TdR). Maximum isotope incorporation was noted during the first 2 hours after irradiation. Higher doses of radiation suppressed 3H-TdR incorporation. It was not seen after gamma-irradiation of air-dried seeds, nor after fast-neutron irradiation. The replication inhibitors hydroxyurea and 5-aminouracil had no effect on the gamma-induced incorporation of 3H-TdR, Whereas caffeine and acriflavine inhibited it to some extent. It is suggested that the gamma-radiation-induced incorporation of 3H-TdR in meristem cells during the pre-replicative period may be connected with repair phenomena.

  10. Purification of a Factor from Human Placenta That Stimulates Capillary Endothelial Cell Protease Production, DNA Synthesis, and Migration

    NASA Astrophysics Data System (ADS)

    Moscatelli, David; Presta, Marco; Rifkin, Daniel B.

    1986-04-01

    A protein that stimulates the production of plasminogen activator and latent collagenase in cultured bovine capillary endothelial cells has been purified 106-fold from term human placenta by using a combination of heparin affinity chromatography, ion-exchange chromatography, and gel chromatography. The purified molecule has a molecular weight of 18,700 as determined by NaDodSO4/PAGE under both reducing and nonreducing conditions. The purified molecule stimulates the production of plasminogen activator and latent collagenase in a dose-dependent manner between 0.1 and 10 ng of protein/ml. The purified protein also stimulates DNA synthesis and chemotaxis in capillary endothelial cells in the same concentration range. Thus, this molecule has all of the properties predicted for an angiogenic factor.

  11. Further studies on the ability of different metal salts to influence the DNA synthesis of human lymphoid cells.

    PubMed

    Nordlind, K

    1986-01-01

    In a further study on the ability of different metal salts to influence the DNA synthesis of human lymphoid cells, aluminum chloride, beryllium chloride, cadmium chloride, cupric sulfate, ferric chloride, manganese chloride, palladium chloride, platinum chloride and silver nitrate, were tested regarding effect on thymocytes and peripheral blood lymphocytes in children. At certain concentrations in the range of 10(-4)-10(-5)M, all tested compounds but aluminum chloride and ferric chloride, were inhibitory, the latter compounds inhibited at 4.8 X 10(-3)M. A slight stimulation mainly on the thymocytes was obtained with beryllium chloride, cadmium chloride, palladium chloride, platinum chloride and silver nitrate, at certain concentrations in the range of 10(-5)-10(-6)M, while ferric chloride gave a slight stimulation at 1.2 X 10(-3)M. Thus, the tested metal salts should be suitable for use in lymphocyte transformation tests for diagnosis of contact allergy.

  12. Industrial scale gene synthesis.

    PubMed

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery.

  13. Translesion synthesis mechanisms depend on the nature of DNA damage in UV-irradiated human cells

    PubMed Central

    Quinet, Annabel; Martins, Davi Jardim; Vessoni, Alexandre Teixeira; Biard, Denis; Sarasin, Alain; Stary, Anne; Menck, Carlos Frederico Martins

    2016-01-01

    Ultraviolet-induced 6-4 photoproducts (6-4PP) and cyclobutane pyrimidine dimers (CPD) can be tolerated by translesion DNA polymerases (TLS Pols) at stalled replication forks or by gap-filling. Here, we investigated the involvement of Polη, Rev1 and Rev3L (Polζ catalytic subunit) in the specific bypass of 6-4PP and CPD in repair-deficient XP-C human cells. We combined DNA fiber assay and novel methodologies for detection and quantification of single-stranded DNA (ssDNA) gaps on ongoing replication forks and postreplication repair (PRR) tracts in the human genome. We demonstrated that Rev3L, but not Rev1, is required for postreplicative gap-filling, while Polη and Rev1 are responsible for TLS at stalled replication forks. Moreover, specific photolyases were employed to show that in XP-C cells, CPD arrest replication forks, while 6-4PP are responsible for the generation of ssDNA gaps and PRR tracts. On the other hand, in the absence of Polη or Rev1, both types of lesion block replication forks progression. Altogether, the data directly show that, in the human genome, Polη and Rev1 bypass CPD and 6-4PP at replication forks, while only 6-4PP are also tolerated by a Polζ-dependent gap-filling mechanism, independent of S phase. PMID:27095204

  14. Synthesis and evaluation of gold(III) complexes as efficient DNA binders and cytotoxic agents.

    PubMed

    Patel, Mohan N; Bhatt, Bhupesh S; Dosi, Promise A

    2013-06-01

    In recent years, great interest has been focused on gold(III) complexes as cytotoxic and antitumor drugs. Recent studies demonstrated that simple bidentate or polydentate ligands containing nitrogen donor atoms may offer sufficient redox stabilization to produce viable Au(III) anticancer drug targets under physiologic conditions. So, we have synthesized square planer Au(III) complexes of type [Au(A(n))Clx]·Cly and characterized them using UV-Vis absorption, C, H, N elemental analysis, FT-IR, LC-MS, (1)H and (13)C NMR spectroscopy. These compounds manifested significant cytotoxic properties in vitro for brine shrimp lethality bioassay. The metal complexes were screened for series of DNA binding activity using UV-Vis absorption titration, hydrodynamic measurement and thermal DNA denaturation study. The nucleolytic activity was performed on plasmid pUC19 DNA. The Michaelis-Menten kinetic studies were performed to evaluate rate of enhancement in metal complexes mediated DNA cleavage over the non-catalyzed DNA cleavage.

  15. Synthesis and evaluation of gold(III) complexes as efficient DNA binders and cytotoxic agents

    NASA Astrophysics Data System (ADS)

    Patel, Mohan N.; Bhatt, Bhupesh S.; Dosi, Promise A.

    2013-06-01

    In recent years, great interest has been focused on gold(III) complexes as cytotoxic and antitumor drugs. Recent studies demonstrated that simple bidentate or polydentate ligands containing nitrogen donor atoms may offer sufficient redox stabilization to produce viable Au(III) anticancer drug targets under physiologic conditions. So, we have synthesized square planer Au(III) complexes of type [Au(An)Clx]·Cly and characterized them using UV-Vis absorption, C, H, N elemental analysis, FT-IR, LC-MS, 1H and 13C NMR spectroscopy. These compounds manifested significant cytotoxic properties in vitro for brine shrimp lethality bioassay. The metal complexes were screened for series of DNA binding activity using UV-Vis absorption titration, hydrodynamic measurement and thermal DNA denaturation study. The nucleolytic activity was performed on plasmid pUC19 DNA. The Michaelis-Menten kinetic studies were performed to evaluate rate of enhancement in metal complexes mediated DNA cleavage over the non-catalyzed DNA cleavage.

  16. Synthesis, Characterization, Molecular Modeling, and DNA Interaction Studies of Copper Complex Containing Food Additive Carmoisine Dye.

    PubMed

    Shahabadi, Nahid; Akbari, Alireza; Jamshidbeigi, Mina; Khodarahmi, Reza

    2016-06-01

    A copper complex of carmoisine dye; [Cu(carmoisine)2(H2O)2]; was synthesized and characterized by using physico-chemical and spectroscopic methods. The binding of this complex with calf thymus (ct) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, and viscosity measurements. UV-vis results confirmed that the Cu complex interacted with DNA to form a ground-state complex and the observed binding constant (2× 10(4) M(-1)) is more in keeping with the groove bindings with DNA. Furthermore, the viscosity measurement result showed that the addition of complex causes no significant change on DNA viscosity and it indicated that the intercalation mode is ruled out. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the reaction. The results of circular dichroism (CD) suggested that the complex can change the conformation of DNA from B-like form toward A-like conformation. The cytotoxicity studies of the carmoisine dye and its copper complex indicated that both of them had anticancer effects on HT-29 (colon cancer) cell line and they may be new candidates for treatment of the colon cancer.

  17. Synthesis, Characterization, Molecular Modeling, and DNA Interaction Studies of Copper Complex Containing Food Additive Carmoisine Dye.

    PubMed

    Shahabadi, Nahid; Akbari, Alireza; Jamshidbeigi, Mina; Khodarahmi, Reza

    2016-06-01

    A copper complex of carmoisine dye; [Cu(carmoisine)2(H2O)2]; was synthesized and characterized by using physico-chemical and spectroscopic methods. The binding of this complex with calf thymus (ct) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, and viscosity measurements. UV-vis results confirmed that the Cu complex interacted with DNA to form a ground-state complex and the observed binding constant (2× 10(4) M(-1)) is more in keeping with the groove bindings with DNA. Furthermore, the viscosity measurement result showed that the addition of complex causes no significant change on DNA viscosity and it indicated that the intercalation mode is ruled out. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the reaction. The results of circular dichroism (CD) suggested that the complex can change the conformation of DNA from B-like form toward A-like conformation. The cytotoxicity studies of the carmoisine dye and its copper complex indicated that both of them had anticancer effects on HT-29 (colon cancer) cell line and they may be new candidates for treatment of the colon cancer. PMID:27152751

  18. Synthesis and characterisation of platinum (II) salphen complex and its interaction with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Sukri, Shahratul Ain Mohd; Heng, Lee Yook; Karim, Nurul Huda Abd

    2014-09-01

    A platinum (II) salphen complex was synthesised by condensation reaction of 2,4-dihydroxylbenzaldehyde and o-phenylenediamine with potassium tetrachloroplatinate to obtain N,N'-Bis-4-(hydroxysalicylidene)-phenylenediamine-platinum (II). The structure of the complex was confirmed by 1H and 13C NMR spectroscopy, FTIR spectroscopy, CHN elemental analyses and ESI-MS spectrometry. The platinum (II) salphen complex with four donor atoms N2O2 from its salphen ligand coordinated to platinum (II) metal centre were determined. The binding mode and interaction of this complex with calf thymus DNA was determined by UV/Vis DNA titration and emission titration. The intercalation between the DNA bases by π-π stacking due to its square planar geometry and aromatic rings structures was proposed.

  19. Structural Insight into Processive Human Mitochondrial DNA Synthesis and Disease-Related Polymerase Mutations

    SciTech Connect

    Lee, Young-Sam; Kennedy, W. Dexter; Yin, Y. Whitney

    2010-09-07

    Human mitochondrial DNA polymerase (Pol {gamma}) is the sole replicase in mitochondria. Pol {gamma} is vulnerable to nonselective antiretroviral drugs and is increasingly associated with mutations found in patients with mitochondriopathies. We determined crystal structures of the human heterotrimeric Pol {gamma} holoenzyme and, separately, a variant of its processivity factor, Pol {gamma}B. The holoenzyme structure reveals an unexpected assembly of the mitochondrial DNA replicase where the catalytic subunit Pol {gamma}A interacts with its processivity factor primarily via a domain that is absent in all other DNA polymerases. This domain provides a structural module for supporting both the intrinsic processivity of the catalytic subunit alone and the enhanced processivity of holoenzyme. The Pol {gamma} structure also provides a context for interpreting the phenotypes of disease-related mutations in the polymerase and establishes a foundation for understanding the molecular basis of toxicity of anti-retroviral drugs targeting HIV reverse transcriptase.

  20. Synthesis and characterisation of platinum (II) salphen complex and its interaction with calf thymus DNA

    SciTech Connect

    Sukri, Shahratul Ain Mohd; Heng, Lee Yook; Karim, Nurul Huda Abd

    2014-09-03

    A platinum (II) salphen complex was synthesised by condensation reaction of 2,4-dihydroxylbenzaldehyde and o-phenylenediamine with potassium tetrachloroplatinate to obtain N,N′-Bis-4-(hydroxysalicylidene)-phenylenediamine-platinum (II). The structure of the complex was confirmed by {sup 1}H and {sup 13}C NMR spectroscopy, FTIR spectroscopy, CHN elemental analyses and ESI-MS spectrometry. The platinum (II) salphen complex with four donor atoms N{sub 2}O{sub 2} from its salphen ligand coordinated to platinum (II) metal centre were determined. The binding mode and interaction of this complex with calf thymus DNA was determined by UV/Vis DNA titration and emission titration. The intercalation between the DNA bases by π-π stacking due to its square planar geometry and aromatic rings structures was proposed.

  1. Synthesis, antioxidant, enzyme inhibition and DNA binding studies of novel N-benzylated derivatives of sulfonamide

    NASA Astrophysics Data System (ADS)

    Abbas, Aadil; Murtaza, Shahzad; Tahir, Muhammad Nawaz; Shamim, Saima; Sirajuddin, Muhammad; Rana, Usman Ali; Naseem, Khadija; Rafique, Hummera

    2016-08-01

    A series of novel N-benzylated derivatives of sulfonamide were synthesized and characterized by FT-IR, NMR and XRD analysis. The synthesized compounds were assayed for their biological potential. The biological studies involved antioxidant, enzyme inhibition, and DNA interaction studies. Antioxidant potential was investigated by Ferric Reducing Antioxidant Power assay (FRAP) and DPPH free radical scavenging method, the capacity of synthesized compounds to inhibit the enzyme's activity was assayed by using the well-known Elman method whereas DNA interaction studies were carried out with the help UV-Vis absorption titration method. Moreover, a direct correlation between enzyme inhibition activity and concentration of the compounds was observed both in experimental and molecular docking studies. DNA interaction studies of the synthesized compounds showed weak interaction.

  2. Synthesis, characterization, DNA/BSA interactions and anticancer activity of achiral and chiral copper complexes.

    PubMed

    Zhou, Xue-Quan; Sun, Qian; Jiang, Lin; Li, Si-Tong; Gu, Wen; Tian, Jin-Lei; Liu, Xin; Yan, Shi-Ping

    2015-05-28

    Six novel copper(ii) complexes of [CuCl]ClO4 (), [Cu(acac)]PF6 (), [CuCl]2(PF6)2 (), [CuCl]2(PF6)2 (), [Cu(acac)]PF6 () and [Cu(acac)]PF6 (), ( = 1-naphthyl-N,N-[bis(2-pyridyl)methyl]amine, = R/S-1-naphthyl-N,N-[bis(2-pyridyl)methyl]ethanamine, acac = diacetone) were synthesized to serve as artificial nucleases. All complexes were structurally characterized using X-ray crystallography. The crystal structures showed the presence of distorted square-planar CuLCl (, and ) and distorted tetragonal-pyramidal CuL(acac) (, and ) geometry. The interaction of these complexes with calf thymus DNA (CT-DNA) was researched by means of several spectroscopy methods, which indicated that the complexes were bound to CT-DNA by an intercalation binding mode. DNA cleavage experiments revealed that the complexes exhibited remarkable DNA cleavage activities in the presence of H2O2, and single oxygen ((1)O2) or hydroxyl radicals may serve as the major cleavage active species. In particular, the in vitro cytotoxicity of the complexes on four human cancer cell lines (HeLa, MCF-7, Bel-7404 and HepG-2) demonstrated that the six compounds had broad-spectrum anti-cancer activity with low IC50 values. The stronger cytotoxicity and DNA cleavage activity of the chiral enantiomers compared with chiral analogues verified the influence of chirality on the antitumor activity of complexes. Meanwhile, the protein binding ability was revealed by quenching of tryptophan emission with the addition of complexes using BSA as a model protein. The results indicated that the quenching mechanism of BSA by the complexes was a static process.

  3. Gelatin-based nanoparticles as DNA delivery systems: Synthesis, physicochemical and biocompatible characterization.

    PubMed

    Morán, M C; Rosell, N; Ruano, G; Busquets, M A; Vinardell, M P

    2015-10-01

    The rapidly rising demand for therapeutic grade DNA molecules requires associated improvements in encapsulation and delivery technologies. One of the challenges for the efficient intracellular delivery of therapeutic biomolecules after their cell internalization by endocytosis is to manipulate the non-productive trafficking from endosomes to lysosomes, where degradation may occur. The combination of the endosomal acidity with the endosomolytic capability of the nanocarrier can increase the intracellular delivery of many drugs, genes and proteins, which, therefore, might enhance their therapeutic efficacy. Among the suitable compounds, the gelification properties of gelatin as well as the strong dependence of gelatin ionization with pH makes this compound an interesting candidate to be used to the effective intracellular delivery of active biomacromolecules. In the present work, gelatin (either high or low gel strength) and protamine sulfate has been selected to form particles by interaction of oppositely charged compounds. Particles in the absence of DNA (binary system) and in the presence of DNA (ternary system) have been prepared. The physicochemical characterization (particle size, polydispersity index and degree of DNA entrapment) have been evaluated. Cytotoxicity experiments have shown that the isolated systems and the resulting gelatin-based nanoparticles are essentially non-toxic. The pH-dependent hemolysis assay and the response of the nanoparticles co-incubated in buffers at defined pHs that mimic extracellular, early endosomal and late endo-lysosomal environments demonstrated that the nanoparticles tend to destabilize and DNA can be successfully released. It was found that, in addition to the imposed compositions, the gel strength of gelatin is a controlling parameter of the final properties of these nanoparticles. The results indicate that these gelatin-based nanoparticles have excellent properties as highly potent and non-toxic intracellular delivery

  4. Solid-phase synthesis and hybridization properties of DNA containing sulfide-linked dinucleosides.

    PubMed Central

    Kawai, S H; Wang, D; Giannaris, P A; Damha, M J; Just, G

    1993-01-01

    Oligodeoxyribonucleotides incorporating non-hydrolyzable dialkyl sulfide linked thymidine dimers (TsT) were synthesized chemically by the solid-phase approach. The sulfide dimer TsT was stable to degradation by snake-venom phosphodiesterase, calf spleen phosphodiesterase, Nuclease P1 and Nuclease S1. Thermal denaturation analysis indicated that the incorporation of TsT dimers into DNA weakened, but did not prevent, binding to complementary DNA and RNA over a wide range of salt concentrations (10 mM to 2 M NaCl). Images PMID:8464740

  5. DNA Dynamics.

    ERIC Educational Resources Information Center

    Warren, Michael D.

    1997-01-01

    Explains a method to enable students to understand DNA and protein synthesis using model-building and role-playing. Acquaints students with the triplet code and transcription. Includes copies of the charts used in this technique. (DDR)

  6. [Analysis of the biological effect of city smog extract. V. Comparative investigations on the effect of city smog extracts on DNA synthesis of Syrian hamster kidney and embryonic cells and of African green monkey kidney cells in vitro (author's transl)].

    PubMed

    Krampitz, G; Seemayer, N

    1979-01-01

    We analysed the effect of two samples of city smog extract from Bochum and Duisburg on DNA synthesis of mammalian cells in vitro. As a test system we used tissue cultures of kidney and embryonic cells from the Syrian golden hamster and monkey kidney cells from Cercopithecus aethiops. DNA synthesis of cells was measured by autoradiography using 3H-Thymidine. Both samples of city smog extract exerted a dose-dependent decrease of the rate of DNA synthesis in tissue culture cells. These alterations of nucleic acid metabolism were expressed by a reduction of DNA-synthesizing cells and by a delay of entrance of cells in DNA synthesis. High concentrations of city smog extracts induced a large number of cell necroses. Monkey kidney cells were more sensitive to the toxic action than hamster cells. Furthermore the city smog extract from Duisburg showed a stronger toxic effect than the extract from Bochum.

  7. Preclinical activity of 8-chloroadenosine with mantle cell lymphoma: Roles of energy depletion and inhibition of DNA and RNA synthesis

    PubMed Central

    Dennison, Jennifer B.; Balakrishnan, Kumudha; Gandhi, Varsha

    2009-01-01

    8-Chloroadenosine (8-Cl-Ado), an RNA-directed nucleoside analog, is currently being evaluated in phase I clinical trials for treatment of chronic lymphocytic leukemia. In the current study, the efficacy of 8-Cl-Ado was evaluated using mantle cell lymphoma (MCL) cell lines: Granta 519, JeKo, Mino, and SP-53. After continuous exposure to 10 μM 8-Cl-Ado for 24 h, loss of mitochondrial transmembrane potential and PARP cleavage were detected in 3 of 4 cell lines. Reduced ATP levels (30 to 60% reduction) and concurrent 8-Cl-ATP accumulation were highly associated with cell death (P < 0.01). The intracellular 8-Cl-ATP concentrations were also highly correlated with inhibition of global transcription (50 to 90%, r2 = 0.90, P < 0.01). However, the inhibition of transcription only accounted for 30 to 40% of cell death as determined by equivalent inhibition with actinomycin D. Likewise, short-lived mRNAs, those encoding cyclin D1 and Mcl-1, were not consistently reduced after treatment. Unique to MCL as compared to other hematological malignancies, 8-Cl-Ado inhibited the rates of DNA synthesis and selectively depleted dATP pools (50 to 80%). We conclude that the DNA and RNA directed actions of 8-Cl-Ado in combination with depleted energetics may promote cell death and inhibit growth of MCL cell lines. PMID:19709085

  8. Impaired coenzyme A synthesis in fission yeast causes defective mitosis, quiescence-exit failure, histone hypoacetylation and fragile DNA

    PubMed Central

    Nakamura, Takahiro; Pluskal, Tomáš; Nakaseko, Yukinobu; Yanagida, Mitsuhiro

    2012-01-01

    Biosynthesis of coenzyme A (CoA) requires a five-step process using pantothenate and cysteine in the fission yeast Schizosaccharomyces pombe. CoA contains a thiol (SH) group, which reacts with carboxylic acid to form thioesters, giving rise to acyl-activated CoAs such as acetyl-CoA. Acetyl-CoA is essential for energy metabolism and protein acetylation, and, in higher eukaryotes, for the production of neurotransmitters. We isolated a novel S. pombe temperature-sensitive strain ppc1-537 mutated in the catalytic region of phosphopantothenoylcysteine synthetase (designated Ppc1), which is essential for CoA synthesis. The mutant becomes auxotrophic to pantothenate at permissive temperature, displaying greatly decreased levels of CoA, acetyl-CoA and histone acetylation. Moreover, ppc1-537 mutant cells failed to restore proliferation from quiescence. Ppc1 is thus the product of a super-housekeeping gene. The ppc1-537 mutant showed combined synthetic lethal defects with five of six histone deacetylase mutants, whereas sir2 deletion exceptionally rescued the ppc1-537 phenotype. In synchronous cultures, ppc1-537 cells can proceed to the S phase, but lose viability during mitosis failing in sister centromere/kinetochore segregation and nuclear division. Additionally, double-strand break repair is defective in the ppc1-537 mutant, producing fragile broken DNA, probably owing to diminished histone acetylation. The CoA-supported metabolism thus controls the state of chromosome DNA. PMID:23091701

  9. Targeted expression of transforming growth factor-beta 1 in intracardiac grafts promotes vascular endothelial cell DNA synthesis.

    PubMed Central

    Koh, G Y; Kim, S J; Klug, M G; Park, K; Soonpaa, M H; Field, L J

    1995-01-01

    Intracardiac grafts comprised of genetically modified skeletal myoblasts were assessed for their ability to effect long-term delivery of recombinant transforming growth factor-beta (TGF-beta) to the heart. C2C12 myoblasts were stably transfected with a construct comprised of an inducible metallothionein promoter fused to a modified TGF-beta 1 cDNA. When cultured in medium supplemented with zinc sulfate, cells carrying this transgene constitutively secrete active TGF-beta 1. These genetically modified myoblasts were used to produce intracardiac grafts in syngeneic C3Heb/FeJ hosts. Viable grafts were observed as long as three months after implantation, and immunohistological analyses of mice maintained on water supplemented with zinc sulfate revealed the presence of grafted cells which stably expressed TGF-beta 1. Regions of apparent neovascularization, as evidenced by tritiated thymidine incorporation into vascular endothelial cells, were observed in the myocardium which bordered grafts expressing TGF-beta 1. The extent of vascular endothelial cell DNA synthesis could be modulated by altering dietary zinc. Similar effects on the vascular endothelial cells were not seen in mice with grafts comprised of nontransfected cells. This study indicates that genetically modified skeletal myoblast grafts can be used to effect the local, long-term delivery of recombinant molecules to the heart. Images PMID:7529257

  10. Effect of ultraviolet B radiation and 100 Hz electromagnetic fields on proliferation and DNA synthesis of Jurkat cells.

    PubMed

    Nindl, G; Hughes, E F; Johnson, M T; Spandau, D F; Vesper, D N; Balcavage, W X

    2002-09-01

    The use of ultraviolet B light (UVB) has been proven to be highly effective for treatment of various inflammatory skin diseases, but UVB phototherapy is limited by its carcinogenic side effects. It is necessary to uncover effectors that augment UVB so that similar or improved efficacy can be obtained with lower UVB doses. We found that low frequency, low intensity electromagnetic fields (EMFs) can act as such an effector and synergistically inhibit T lymphocyte proliferation. We first characterized the effects of UVB on Jurkat cells, a model for cutaneous T lymphocytes, and determined UVB's dose dependent inhibition of cell proliferation and induction of apoptosis. Cells exposed to a sublethal UVB dose retained their sensitivity to UVB, but repetitive irradiation seemed to cause accumulation of delayed DNA damage. We then exposed cells to combinations of UVB plus EMFs and found that 100 Hz, 1 mT EMFs decrease DNA synthesis of UVB-activated Jurkat cells by 34 +/- 13% compared to UVB alone. The decrease is, however, most effective when relatively high UVB doses are employed. Since EMFs alone had only a very weak inhibitory effect (10 +/- 2%), the data suggest that EMFs augment the cell killing effects of UVB in a synergistic way. These findings could provide the basis for development of new and improved clinical phototherapy protocols.

  11. Stabilization and targeting of INO80 to replication forks by BAP1 during normal DNA synthesis.

    PubMed

    Lee, Han-Sae; Lee, Shin-Ai; Hur, Shin-Kyoung; Seo, Jeong-Wook; Kwon, Jongbum

    2014-10-06

    The INO80 chromatin-remodelling complex has been implicated in DNA replication during stress in yeast. However, its role in normal DNA replication and its underlying mechanisms remain unclear. Here, we show that INO80 binds to replication forks and promotes fork progression in human cells under unperturbed, normal conditions. We find that Ino80, which encodes the catalytic ATPase of INO80, is essential for mouse embryonic DNA replication and development. Ino80 is recruited to replication forks through interaction with ubiquitinated H2A--aided by BRCA1-associated protein-1 (BAP1), a tumour suppressor and nuclear de-ubiquitinating enzyme that also functions to stabilize Ino80. Importantly, Ino80 is downregulated in BAP1-defective cancer cells due to the lack of an Ino80 stabilization mechanism via BAP1. Our results establish a role for INO80 in normal DNA replication and uncover a mechanism by which this remodeler is targeted to replication forks, suggesting a molecular basis for the tumour-suppressing function of BAP1.

  12. Imidazolium tagged acridines: Synthesis, characterization and applications in DNA binding and anti-microbial activities

    NASA Astrophysics Data System (ADS)

    Raju, Gembali; Vishwanath, S.; Prasad, Archana; Patel, Basant K.; Prabusankar, Ganesan

    2016-03-01

    New water soluble 4,5-bis imidazolium tagged acridines have been synthesized and structurally characterized by multinuclear NMR and single crystal X-ray diffraction techniques. The DNA binding and anti-microbial activities of these acridine derivatives were investigated by fluorescence and far-UV circular dichroism studies.

  13. Steroidal pyrimidines: Synthesis, characterization, molecular docking studies with DNA and in vitro cytotoxicity

    NASA Astrophysics Data System (ADS)

    Shamsuzzaman; Dar, Ayaz Mahmood; Yaseen, Zahid; Alam, Khursheed; Hussain, Altaf; Gatoo, Manzoor Ahmad

    2013-08-01

    A series of new steroid pyrimidines (7-9) were synthesized by reacting steroidal thiosemicarbazones (4-6) with diethyl malonate. The new compounds were characterized by IR, 1H NMR, 13C NMR, MS and analytical data. The interaction studies of compounds (7-9) with DNA were carried out by employing gel electrophoresis, UV-vis and fluorescence spectroscopy. The acting force between the compounds (7-9) and DNA was mainly hydrophobic while the other interactions like van der Waals, hydrogen bonding cannot be ruled out. The gel electrophoresis pattern also demonstrated that the compound 7 alone or in presence of Cu (II) causes the nicking of supercoiled pBR322 and it seems to follow the mechanistic pathway involving generation of hydroxyl radicals that are responsible for initiating DNA strand scission. The docking study of compounds (7-9) suggested that the intercalation of compounds in between the nucleotide base pairs might be due to the presence of pyrimidine moiety in steroid molecule. MTT assay was carried out to check the toxicity of new compounds (7-9) against the different human cancer as well as non-cancer cell lines A545, MCF-7, HeLa, HL-60, SW480, HepG2, HT-29, A549, 184B5, MCF10A, NL-20, HPC and HPLF. Apoptotic degradation of DNA in presence of steroidal pyrimidines (7-9) was analyzed by agarose gel electrophoresis and visualized by ethidium bromide staining (comet assay).

  14. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomized pool of imidazole modified ssDNA. Sequencing data from the evolved pool shows that conserved 5 and 6 nt motifs were shared amongst many of the isolates, which indicates that these motifs could serve as chelation sites for gold atoms or help stabilize colloidal gold solutions in a base specific manner.

  15. Synthesis, characterization, DNA-binding and cleavage studies of polypyridyl copper(II) complexes

    NASA Astrophysics Data System (ADS)

    Gubendran, Ammavasi; Rajesh, Jegathalaprathaban; Anitha, Kandasamy; Athappan, Periyakaruppan

    2014-10-01

    Six new mixed-ligand copper(II) complexes were synthesized namely [Cu(phen)2OAc]ClO4ṡH2O(1), [Cu(bpy)2OAc]ClO4ṡH2O(2), [Cu(o-ampacac)(phen)]ClO4(3), [Cu(o-ampbzac)(phen)]ClO4(4), [Cu(o-ampacac)(bpy)]ClO4(5), and [Cu(o-ampbzac)(bpy)]ClO4(6) (phen = 1,10-phenanthroline, bpy = 2, 2‧-bipyridine, o-ampacac = (Z)-4-(2-hydroxylamino)pent-3-ene-2-one,o-ampbzac = (Z)-4-(2-hydroxylamino)-4-phenylbut-3-ene-2-one)and characterized by UV-Vis, IR, EPR and cyclic voltammetry. Ligands were characterized by NMR spectra. Single crystal X-ray studies of the complex 1 shows Cu(II) ions are located in a highly distorted octahedral environment. Absorption spectral studies reveal that the complexes 1-6 exhibit hypochromicity during the interaction with DNA and binding constant values derived from spectral and electrochemical studies indicate that complexes 1, 2 and 3 bind strongly with DNA possibly by an intercalative mode. Electrochemical studies reveal that the complexes 1-4 prefer to bind with DNA in Cu(I) rather than Cu(II) form. The shift in the formal potentials E1/2 and CD spectral studies suggest groove or electrostatic binding mode for the complexes 4-6. Complex 1 can cleave supercoiled (SC) pUC18 DNA efficiently into nicked form II under photolytic conditions and into an open circular form (form II) and linear form (form III) in the presence of H2O2 at pH 8.0 and 37 °C, while the complex 2 does not cleave DNA under similar conditions.

  16. Templated synthesis of monodisperse mesoporous maghemite/silica microspheres for magnetic separation of genomic DNA

    NASA Astrophysics Data System (ADS)

    Chen, Feng; Shi, Ruobing; Xue, Yun; Chen, Lei; Wan, Qian-Hong

    2010-08-01

    A novel method is described for the preparation of superparamagnetic mesoporous maghemite (γ-Fe 2O 3)/silica (SiO 2) composite microspheres to allow rapid magnetic separation of DNA from biological samples. With magnetite (Fe 3O 4) and silica nanoparticles as starting materials, such microspheres were synthesized by the following two consecutive steps: (1) formation of monodispersed organic/inorganic hybrid microspheres through urea-formaldedyde (UF) polymerization and (2) removal of the organic template and phase transformation of Fe 3O 4 to γ-Fe 2O 3 by calcination at elevated temperatures. The as-synthesized particles obtained by heating at temperature 300 °C feature spherical shape and uniform particle size ( dparticle=1.72 μm), high saturation magnetization ( Ms=17.22 emu/g), superparamagnetism ( Mr/ Ms=0.023), high surface area ( SBET=240 m 2/g), and mesoporosity ( dpore=6.62 nm). The composite microsphere consists of interlocked amorphous SiO 2 nanoparticles, in which cubic γ-Fe 2O 3 nanocrystals are homogeneously dispersed and thermally stable against γ- to α-phase transformation at temperatures up to 600 °C. With the exposed iron oxide nanoparticles coated with a thin layer of silica shell, the magnetic microspheres were used as a solid-phase adsorbent for rapid extraction of genomic DNA from plant samples. The results show that the DNA templates isolated from pea and green pepper displayed single bands with molecular weights greater than 8 kb and A260/ A280 values of 1.60-1.72. The PCR amplification of a fragment encoding the endogenous chloroplast ndhB gene confirmed that the DNA templates obtained were inhibitor-free and amenable to sensitive amplification-based DNA technologies.

  17. Synthesis of a drug delivery vehicle for cancer treatment utilizing DNA-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Brann, Tyler

    The treatment of cancer with chemotherapeutic agents has made great strides in the last few decades but still introduces major systemic side effects. The potent drugs needed to kill cancer cells often cause irreparable damage to otherwise healthy organs leading to further morbidity and mortality. A therapy with intrinsic selective properties and/or an inducible activation has the potential to change the way cancer can be treated. Gold nanoparticles (GNPs) are biocompatible and chemically versatile tools that can be readily functionalized to serve as molecular vehicles. The ability of these particles to strongly absorb light with wavelengths in the therapeutic window combined with the heating effect of surface plasmon resonance makes them uniquely suited for noninvasive heating in biologic applications. Specially designed DNA aptamers have shown their ability to serve as drug carriers through intercalation as well as directly acting as therapeutic agents. By combining these separate molecules a multifaceted drug delivery vehicle can be created with great potential as a selective and controllable treatment for cancer. Oligonucleotide-coated GNPs have been created using spherical GNPs but little work has been reported using gold nanoplates in this way. Using the Diasynth method gold nanoplates were produced to absorb strongly in the therapeutic near infrared (nIR) window. These particles were functionalized with two DNA oligonucleotides: one serving as an intercalation site for doxorubicin, and another, AS1411, serving directly as an anticancer targeting/therapeutic agent. These functional particles were fully synthesized and processed along with confirmation of DNA functionalization and doxorubicin intercalation. Doxorubicin is released via denaturation of the DNA structure into which doxorubicin is intercalated upon the heating of the gold nanoplate well above the DNA melting temperature. This temperature increase, due to light stimulation of surface plasmon

  18. Effects of BMS-986094, a Guanosine Nucleotide Analogue, on Mitochondrial DNA Synthesis and Function.

    PubMed

    Baumgart, Bethany R; Wang, Faye; Kwagh, Jae; Storck, Chris; Euler, Catherine; Fuller, Megan; Simic, Damir; Sharma, Suresh; Arnold, Jamie J; Cameron, Craig E; Van Vleet, Terry R; Flint, Oliver; Bunch, Roderick T; Davies, Marc H; Graziano, Michael J; Sanderson, Thomas P

    2016-10-01

    BMS-986094, the prodrug of a guanosine nucleotide analogue (2'-C-methylguanosine), was withdrawn from clinical trials due to serious safety issues. Nonclinical investigative studies were conducted as a follow up to evaluate the potential for BMS-986094-related mitochondrial-toxicity. In vitro, BMS-986094 was applied to human hepatoma cells (HepG2 and Huh-7) or cardiomyocytes (hiPSCM) up to 19 days to assess mitochondrial DNA content and specific gene expression. There were no mitochondrial DNA changes at concentrations ≤10 µM. Transcriptional effects, such as reductions in Huh-7 MT-ND1 and MT-ND5 mRNA content and hiPSCM MT-ND1, MT-COXII, and POLRMT protein expression levels, occurred only at cytotoxic concentrations (≥10 µM) suggesting these transcriptional effects were a consequence of the observed toxicity. Additionally, BMS-986094 has a selective weak affinity for inhibition of RNA polymerases as opposed to DNA polymerases. In vivo, BMS-986094 was given orally to cynomolgus monkeys for 3 weeks or 1 month at doses of 15 or 30 mg/kg/day. Samples of heart and kidney were collected for assessment of mitochondrial respiration, mitochondrial DNA content, and levels of high energy substrates. Although pronounced cardiac and renal toxicities were observed in some monkeys at 30 mg/kg/day treated for 3-4 weeks, there were no changes in mitochondrial DNA content or ATP/GTP levels. Collectively, these data suggest that BMS-986094 is not a direct mitochondrial toxicant.

  19. Chemical synthesis of oligodeoxyribonucleotides containing N3- and O4-carboxymethylthymidine and their formation in DNA

    PubMed Central

    Wang, Jianshuang; Wang, Yinsheng

    2009-01-01

    Humans are exposed to N-nitroso compounds from both endogenous and exogenous sources. Many N-nitroso compounds can be metabolically activated to give diazoacetate, which can result in the carboxymethylation of DNA. The remarkable similarity in p53 mutations found in human gastrointestinal tumors and in shuttle vector studies, where the human p53 gene-containing vector was treated with diazoacetate and propagated in yeast cells, suggests that diazoacetate might be an important etiological agent for human gastrointestinal tumors. The O6-carboxymethyl-2′-deoxyguanosine was previously detected in isolated DNA upon exposure to diazoacetate and in blood samples of healthy human subjects. The corresponding modifications of thymidine and 2′-deoxyadenosine have not been assessed, though significant mutations at A:T base pairs were found in the p53 tumor suppressor gene in human gastrointestinal tumors and in shuttle vector studies. To understand the implications of the carboxymethylation chemistry of thymidine in the observed mutations at A:T base pairs, here we synthesized authentic N3-carboxymethylthymidine (N3-CMdT) and O4-carboxymethylthymidine (O4-CMdT), incorporated them into DNA, and demonstrated, for the first time, that they were the major carboxymethylated derivatives of thymidine formed in calf thymus DNA upon exposure to diazoacetate. The demonstration of the formation of N3-CMdT and O4-CMdT in isolated DNA upon treatment with diazoacetate, together with the preparation of authentic oligodeoxyribonucleotide substrates housing these two lesions, laid the foundation for investigating the replication and repair of these lesions and for understanding their implications in the mutations observed in human gastrointestinal tumors. PMID:19042973

  20. Low Concentrations of Anti-Aβ Antibodies Generated in Tg2576 Mice by DNA Epitope Vaccine Fused with 3C3d Molecular Adjuvant Do Not Affect AD Pathology

    PubMed Central

    Movsesyan, Nina; Davtyan, Hayk; Mkrtichyan, Mikayel; Petrushina, Irina; Tiraturyan, Tigran; Ross, Ted; Agadjanyan, Michael G.

    2010-01-01

    Abstract It has been demonstrated that an active vaccination strategy with protein- or DNA-based epitope vaccines composed of the immunodominant self B cell epitope of amyloid-β42 (Aβ42) and a non-self T helper (Th) cell epitope is an immunotherapeutic approach to preventing or treating Alzheimer's disease (AD). As a DNA-based epitope vaccine, we used a plasmid encoding three copies of Aβ1–11 and Th cell epitope, PADRE (p3Aβ1–11-PADRE). We have previously reported that three copies of component of complement C3d (3C3d) acts as a molecular adjuvant significantly enhancing immune responses in wild-type mice of the H2b haplotype immunized with p3Aβ1–11-PADRE. Here, we tested the efficacy of p3Aβ1–11-PADRE and the same vaccine fused with 3C3d (p3Aβ1–11-PADRE-3C3d) in a transgenic (Tg) mouse model of AD (Tg2576) of the H2bxs immune haplotype. The overall responses to both vaccines were very weak in Tg2576 mice despite the fact that the 3C3d molecular adjuvant significantly enhanced the anti-Aβ response to 3Aβ1–11-PADRE. Importantly, generation of low antibody responses was associated with the strain of amyloid precursor protein Tg mice rather than with a molecular adjuvant, as a p3Aβ1–11-PADRE-3C3d vaccine induced significantly higher antibody production in another AD mouse model, 3xTg-AD of the H2b haplotype. Finally, this study demonstrated that low concentrations of antibodies generated by both DNA vaccines were not sufficient for the reduction of Aβ pathology in the brains of vaccinated Tg2576 animals, confirming previous reports from preclinical studies and the AN-1792 clinical trials, which concluded that the concentration of anti-Aβ antibodies may be essential for the reduction of AD pathology. PMID:20528468

  1. DIS in AdS

    SciTech Connect

    Albacete, Javier L.; Kovchegov, Yuri V.; Taliotis, Anastasios

    2009-03-23

    We calculate the total cross section for the scattering of a quark-anti-quark dipole on a large nucleus at high energy for a strongly coupled N = 4 super Yang-Mills theory using AdS/CFT correspondence. We model the nucleus by a metric of a shock wave in AdS{sub 5}. We then calculate the expectation value of the Wilson loop (the dipole) by finding the extrema of the Nambu-Goto action for an open string attached to the quark and antiquark lines of the loop in the background of an AdS{sub 5} shock wave. We find two physically meaningful extremal string configurations. For both solutions we obtain the forward scattering amplitude N for the quark dipole-nucleus scattering. We study the onset of unitarity with increasing center-of-mass energy and transverse size of the dipole: we observe that for both solutions the saturation scale Q{sub s} is independent of energy/Bjorken-x and depends on the atomic number of the nucleus as Q{sub s}{approx}A{sup 1/3}. Finally we observe that while one of the solutions we found corresponds to the pomeron intercept of {alpha}{sub P} = 2 found earlier in the literature, when extended to higher energy or larger dipole sizes it violates the black disk limit. The other solution we found respects the black disk limit and yields the pomeron intercept of {alpha}{sub P} = 1.5. We thus conjecture that the right pomeron intercept in gauge theories at strong coupling may be {alpha}{sub P} = 1.5.

  2. Cellular accumulation of 18F-labelled boronophenylalanine depending on DNA synthesis and melanin incorporation: a double-tracer microautoradiographic study of B16 melanomas in vivo.

    PubMed

    Kubota, R; Yamada, S; Ishiwata, K; Tada, M; Ido, T; Kubota, K

    1993-04-01

    The cellular distribution of 4-borono-2-[18F]fluoro-L-phenylalanine ([18F]FBPA, an analog of p-boronophenylaline), a potential agent for boron neutron capture therapy (BNCT), and [6-3H]thymidine ([3H]Thd, a DNA precursor) in murine two B16 melanoma sublines and FM3A mammary carcinoma was studied in vivo using double-tracer microautoradiography. Tumour volume, tumour age, cell density in the tissues and the proportion of S phase cells in the cell cycle were the same in the three tumour models. Volume doubling time, which represents tumour growth rate, was fastest in B16F10, followed by B16F1 (P < 0.05), the slowest being in FM3A (P < 0.001). The rate of DNA synthesis in S phase cells corresponded to the volume doubling time. The greatest amount of [18F]FBPA was observed in S phase melanocytes and the lowest amount was found in non-S phase non-melanocytes. The [18F]FBPA accumulation was primarily related to the activity of DNA synthesis and, secondarily, to the degree of pigmentation in melanocytes. The therapeutic efficacy of BNCT with p-boronophenylalanine may be greater in melanoma that exhibits greater DNA synthesis activity and higher melanin content.

  3. Cellular accumulation of 18F-labelled boronophenylalanine depending on DNA synthesis and melanin incorporation: a double-tracer microautoradiographic study of B16 melanomas in vivo.

    PubMed Central

    Kubota, R.; Yamada, S.; Ishiwata, K.; Tada, M.; Ido, T.; Kubota, K.

    1993-01-01

    The cellular distribution of 4-borono-2-[18F]fluoro-L-phenylalanine ([18F]FBPA, an analog of p-boronophenylaline), a potential agent for boron neutron capture therapy (BNCT), and [6-3H]thymidine ([3H]Thd, a DNA precursor) in murine two B16 melanoma sublines and FM3A mammary carcinoma was studied in vivo using double-tracer microautoradiography. Tumour volume, tumour age, cell density in the tissues and the proportion of S phase cells in the cell cycle were the same in the three tumour models. Volume doubling time, which represents tumour growth rate, was fastest in B16F10, followed by B16F1 (P < 0.05), the slowest being in FM3A (P < 0.001). The rate of DNA synthesis in S phase cells corresponded to the volume doubling time. The greatest amount of [18F]FBPA was observed in S phase melanocytes and the lowest amount was found in non-S phase non-melanocytes. The [18F]FBPA accumulation was primarily related to the activity of DNA synthesis and, secondarily, to the degree of pigmentation in melanocytes. The therapeutic efficacy of BNCT with p-boronophenylalanine may be greater in melanoma that exhibits greater DNA synthesis activity and higher melanin content. Images Figure 1 PMID:8471428

  4. cis-Acting sequences in addition to donor and acceptor sites are required for template switching during synthesis of plus-strand DNA for duck hepatitis B virus.

    PubMed Central

    Havert, M B; Loeb, D D

    1997-01-01

    A characteristic of all hepadnaviruses is the relaxed-circular conformation of the DNA genome within an infectious virion. Synthesis of the relaxed-circular genome by reverse transcription requires three template switches. These template switches, as for the template switches or strand transfers of other reverse-transcribing genetic elements, require repeated sequences (the donor and acceptor sites) between which a complementary strand of nucleic acid is transferred. The mechanism for each of the template switches in hepadnaviruses is poorly understood. To determine whether sequences other than the donor and acceptor sites are involved in the template switches of duck hepatitis B virus (DHBV), a series of molecular clones which express viral genomes bearing deletion mutations were analyzed. We found that three regions of the DHBV genome, which are distinct from the donor and acceptor sites, are required for the synthesis of relaxed-circular DNA. One region, located near the 3' end of the minus-strand template, is required for the template switch that circularizes the genome. The other two regions, located in the middle of the genome and near DR2, appear to be required for plus-strand primer translocation. We speculate that these cis-acting sequences may play a role in the organization of the minus-strand DNA template within the capsid particle so that it supports efficient template switching during plus-strand DNA synthesis. PMID:9188603

  5. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer.

  6. Click Reaction on Solid Phase Enables High Fidelity Synthesis of Nucleobase-Modified DNA.

    PubMed

    Tolle, Fabian; Rosenthal, Malte; Pfeiffer, Franziska; Mayer, Günter

    2016-03-16

    The post-synthetic functionalization of nucleic acids via click chemistry (CuAAC) has seen tremendous implementation, extending the applicability of nucleobase-modified nucleic acids in fields like fluorescent labeling, nanotechnology, and in vitro selection. However, the production of large quantities of high-density functionalized material via solid phase synthesis has been hampered by oxidative by-product formation associated with the alkaline workup conditions. Herein, we describe a rapid and cost-effective protocol for the high fidelity large-scale production of nucleobase-modified nucleic acids, exemplified with a recently described nucleobase-modified aptamer. PMID:26850226

  7. Synthesis of isatin thiosemicarbazones derivatives: In vitro anti-cancer, DNA binding and cleavage activities

    NASA Astrophysics Data System (ADS)

    Ali, Amna Qasem; Teoh, Siang Guan; Salhin, Abdussalam; Eltayeb, Naser Eltaher; Khadeer Ahamed, Mohamed B.; Majid, A. M. S. Abdul

    New derivatives of thiosemicarbazone Schiff base with isatin moiety were synthesized L1-L6. The structures of these compounds were characterized based on the spectroscopic techniques. Compound L6 was further characterized by XRD single crystal. The interaction of these compounds with calf thymus (CT-DNA) exhibited high intrinsic binding constant (kb = 5.03-33.00 × 105 M-1) for L1-L3 and L5 and (6.14-9.47 × 104 M-1) for L4 and L6 which reflect intercalative activity of these compounds toward CT-DNA. This result was also confirmed by the viscosity data. The electrophoresis studies reveal the higher cleavage activity of L1-L3 than L4-L6. The in vitro anti-proliferative activity of these compounds against human colon cancer cell line (HCT 116) revealed that the synthesized compounds (L3, L6 and L2) exhibited good anticancer potency.

  8. Inhibition of de novo NAD(+) synthesis by oncogenic URI causes liver tumorigenesis through DNA damage.

    PubMed

    Tummala, Krishna S; Gomes, Ana L; Yilmaz, Mahmut; Graña, Osvaldo; Bakiri, Latifa; Ruppen, Isabel; Ximénez-Embún, Pilar; Sheshappanavar, Vinayata; Rodriguez-Justo, Manuel; Pisano, David G; Wagner, Erwin F; Djouder, Nabil

    2014-12-01

    Molecular mechanisms responsible for hepatocellular carcinoma (HCC) remain largely unknown. Using genetically engineered mouse models, we show that hepatocyte-specific expression of unconventional prefoldin RPB5 interactor (URI) leads to a multistep process of HCC development, whereas its genetic reduction in hepatocytes protects against diethylnitrosamine (DEN)-induced HCC. URI inhibits aryl hydrocarbon (AhR)- and estrogen receptor (ER)-mediated transcription of enzymes implicated in L-tryptophan/kynurenine/nicotinamide adenine dinucleotide (NAD(+)) metabolism, thereby causing DNA damage at early stages of tumorigenesis. Restoring NAD(+) pools with nicotinamide riboside (NR) prevents DNA damage and tumor formation. Consistently, URI expression in human HCC is associated with poor survival and correlates negatively with L-tryptophan catabolism pathway. Our results suggest that boosting NAD(+) can be prophylactic or therapeutic in HCC. PMID:25453901

  9. The Eukaryotic Mismatch Recognition Complexes Track with the Replisome during DNA Synthesis

    PubMed Central

    Haye, Joanna E.; Gammie, Alison E.

    2015-01-01

    During replication, mismatch repair proteins recognize and repair mispaired bases that escape the proofreading activity of DNA polymerase. In this work, we tested the model that the eukaryotic mismatch recognition complex tracks with the advancing replisome. Using yeast, we examined the dynamics during replication of the leading strand polymerase Polε using Pol2 and the eukaryotic mismatch recognition complex using Msh2, the invariant protein involved in mismatch recognition. Specifically, we synchronized cells and processed samples using chromatin immunoprecipitation combined with custom DNA tiling arrays (ChIP-chip). The Polε signal was not detectable in G1, but was observed at active origins and replicating DNA throughout S-phase. The Polε signal provided the resolution to track origin firing timing and efficiencies as well as replisome progression rates. By detecting Polε and Msh2 dynamics within the same strain, we established that the mismatch recognition complex binds origins and spreads to adjacent regions with the replisome. In mismatch repair defective PCNA mutants, we observed that Msh2 binds to regions of replicating DNA, but the distribution and dynamics are altered, suggesting that PCNA is not the sole determinant for the mismatch recognition complex association with replicating regions, but may influence the dynamics of movement. Using biochemical and genomic methods, we provide evidence that both MutS complexes are in the vicinity of the replisome to efficiently repair the entire spectrum of mutations during replication. Our data supports the model that the proximity of MutSα/β to the replisome for the efficient repair of the newly synthesized strand before chromatin reassembles. PMID:26684201

  10. Synthesis, DNA Binding and Antitumor Evaluation of Styelsamine and Cystodytin Analogues

    PubMed Central

    Fong, Hugo K. H.; Copp, Brent R.

    2013-01-01

    A series of N-14 sidechain substituted analogues of styelsamine (pyrido[4,3,2-mn]acridine) and cystodytin (pyrido[4,3,2-mn]acridin-4-one) alkaloids have been prepared and evaluated for their DNA binding affinity and antiproliferative activity towards a panel of human tumor cell lines. Overall it was found that styelsamine analogues were stronger DNA binders, with the natural products styelsamines B and D having particularly high affinity (Kapp 5.33 × 106 and 3.64 × 106 M−1, respectively). In comparison, the cystodytin iminoquinone alkaloids showed lower affinity for DNA, but were typically just as active as styelsamine analogues at inhibiting proliferation of tumor cells in vitro. Sub-panel selectivity towards non-small cell lung, melanoma and renal cancer cell lines were observed for a number of the analogues. Correlation was observed between whole cell activity and clogP, with the most potent antiproliferative activity being observed for 3-phenylpropanamide analogues 37 and 41 (NCI panel average GI50 0.4 μM and 0.32 μM, respectively) with clogP ~4.0–4.5. PMID:23358307

  11. Homodinuclear lanthanide complexes of phenylthiopropionic acid: synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity.

    PubMed

    Shiju, C; Arish, D; Kumaresan, S

    2013-03-15

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H(2)O(2). The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  12. Homodinuclear lanthanide complexes of phenylthiopropionic acid: Synthesis, characterization, cytotoxicity, DNA cleavage, and antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Shiju, C.; Arish, D.; Kumaresan, S.

    2013-03-01

    Lanthanide complexes of La(III), Pr(III), Nd(III), Sm(III), and Ho(III) with phenylthiopropionic acid were synthesized and characterized by elemental analysis, mass, IR, electronic spectra, molar conductance, TGA, and powder XRD. The results show that the lanthanide complexes are homodinuclear in nature. The two lanthanide ions are bridged by eight oxygen atoms from four carboxylate groups. Thermal decomposition profiles are consistent with the proposed formulations. Powder XRD studies show that all the complexes are amorphous in nature. Antimicrobial studies indicate that these complexes exhibit more activity than the ligand itself. The DNA cleavage activity of the ligand and its complexes were assayed on Escherichia coli DNA using gel electrophoresis in the presence of H2O2. The result shows that the Pr(III) and Nd(III) complexes have completely cleaved the DNA. The anticancer activities of the complexes have also been studied towards human cervical cancer cell line (HeLa) and colon cancer cells (HCT116) and it was found that the La(III) and Nd(III) complexes are more active than the corresponding Pr(III), Sm(III), Ho(III) complexes, and the free ligand on both the cancer cells.

  13. Synthesis, G-quadruplexes DNA binding, and photocytotoxicity of novel cationic expanded porphyrins.

    PubMed

    Jin, Shu-fang; Zhao, Ping; Xu, Lian-cai; Zheng, Min; Lu, Jia-zheng; Zhao, Peng-liang; Su, Qiu-lan; Chen, Hui-xian; Tang, Ding-tong; Chen, Jiong; Lin, Jia-qi

    2015-06-01

    Intensive reports allowed the conclusion that molecules with extended aromatic surfaces always do good jobs in the DNA interactions. Inspired by the previous successful researches, herein, we designed a series of cationic porphyrins with expanded planar substituents, and evaluated their binding behaviors to G-quadruplex DNA using the combination of surface-enhanced raman, circular dichroism, absorption spectroscopy and fluorescence resonance energy transfer melting assays. Asymmetrical tetracationic porphyrin with one phenyl-4-N-methyl-4-pyridyl group and three N-methyl-4-pyridyl groups exhibit the best G4-DNA binding affinities among all the designed compounds, suggesting that the bulk of the substituents should be matched to the width of the grooves they putatively lie in. Theoretical calculations applying the density functional theory have been carried out and explain the binding properties of these porphyrins reasonably. Meanwhile, these porphyrins were proved to be potential photochemotherapeutic agents since they have photocytotoxic activities against both myeloma cell (Ag8.653) and gliomas cell (U251) lines.

  14. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    PubMed

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  15. Coordinate synthesis and turnover of heat shock proteins in Borrelia burgdorferi: degradation of DnaK during recovery from heat shock.

    PubMed Central

    Cluss, R G; Goel, A S; Rehm, H L; Schoenecker, J G; Boothby, J T

    1996-01-01

    The synthesis and turnover of heat shock proteins (Hsps) by Borrelia burgdorferi, the Lyme disease spirochete, was investigated by radiolabeling of whole spirochetes and spheroplasts, comparison of one- and two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and use of immunochemistry. The approximately 72-kDa DnaK homolog and three additional Hsps of 39, 27, and 21 kDa increased in amount by 3- to 15-fold between 2 and 6 h following temperature upshift from 28 to 39 degrees C. Temperature downshift experiments following the transfer of spirochetes from 40 to 28 degrees C showed that within 15 to 30 min, synthesis of most of the major Hsps returned to levels seen in spirochetes statically maintained at the lower temperature. Spheroplasts of B. burgdorferi produced by treatment with EDTA and lysozyme were radiolabeled, and specific Hsps were localized to either the cytoplasm or membrane fraction. Further analysis by two-dimensional electrophoresis demonstrated three constitutively expressed DnaK isoforms with pIs near 5.5. A pattern suggestive of DnaK degradation was observed following recovery from heat shock but not in spirochetes maintained entirely at a low temperature. Some of these putative degradation products were recognized by monoclonal antibodies directed against the B. burgdorferi DnaK protein. These data suggest that following a period of peak synthesis, DnaK is actively degraded as the spirochete reestablishes its metabolic thermometer. These findings provide a new interpretation of previous work suggesting that 10 to 15 B. burgdorferi polypeptides, including DnaK have a common epitope. PMID:8613385

  16. p53-dependent but ATM-independent inhibition of DNA synthesis and G2 arrest in cadmium-treated human fibroblasts

    SciTech Connect

    Cao Feng |; Zhou Tong; Simpson, Dennis; Zhou Yingchun; Boyer, Jayne; Chen Bo |; Jin Taiyi; Cordeiro-Stone, Marila; Kaufmann, William . E-mail: wkarlk@med.unc.edu

    2007-01-15

    This study focused on the activation of cell cycle checkpoint responses in diploid human fibroblasts that were treated with cadmium chloride and the potential roles of ATM and p53 signaling pathways in cadmium-induced responses. The alkaline comet assay indicated that cadmium caused a dose-dependent increase in DNA damage. Cells that were rendered p53-defective by expression of a dominant-negative p53 allele or knockdown of p53 mRNA were more resistant to cadmium-induced inactivation of colony formation than normal and ataxia telangiectasia (AT) cells. Synchronized fibroblasts in S were more sensitive to cadmium toxicity than cells in G1, suggesting that cadmium may target some element of DNA replication. Cadmium produced a dose- and time-dependent inhibition of DNA synthesis. An immediate inhibition was associated with severe delay in progression through S phase and a delayed inhibition seen 24 h after treatment was associated with accumulation of cells in G2. AT and normal cells displayed similar patterns of inhibition of DNA synthesis and G2 delay after treatment with cadmium, while p53-defective cells displayed significantly less of the delayed inhibition of DNA synthesis and accumulation in G2 post-treatment. Total p53 protein and ser15-phosphorylated p53 were induced by cadmium in normal and AT cells. The p53 transactivation target Gadd45{alpha} was induced in both p53-effective and p53-defective cells after 4 h cadmium treatment, and this was associated with an acute inhibition of mitosis. Cadmium produced a very unusual pattern of toxicity in human fibroblasts, inhibiting DNA replication and inducing p53-dependent growth arrest but without induction of p21{sup Cip1/Waf1} or activation of Chk1.

  17. A comprehensive DNA barcode database for Central European beetles with a focus on Germany: adding more than 3500 identified species to BOLD.

    PubMed

    Hendrich, Lars; Morinière, Jérôme; Haszprunar, Gerhard; Hebert, Paul D N; Hausmann, Axel; Köhler, Frank; Balke, Michael

    2015-07-01

    Beetles are the most diverse group of animals and are crucial for eco