ADAR RNA editing in human disease; more to it than meets the I.

PubMed

Gallo, Angela; Vukic, Dragana; Michalík, David; O'Connell, Mary A; Keegan, Liam P

2017-09-01

We review the structures and functions of ADARs and their involvements in human diseases. ADAR1 is widely expressed, particularly in the myeloid component of the blood system, and plays a prominent role in promiscuous editing of long dsRNA. Missense mutations that change ADAR1 residues and reduce RNA editing activity cause Aicardi-Goutières Syndrome, a childhood encephalitis and interferonopathy that mimics viral infection and resembles an extreme form of Systemic Lupus Erythmatosus (SLE). In Adar1 mouse mutant models aberrant interferon expression is prevented by eliminating interferon activation signaling from cytoplasmic dsRNA sensors, indicating that unedited cytoplasmic dsRNA drives the immune induction. On the other hand, upregulation of ADAR1 with widespread promiscuous RNA editing is a prominent feature of many cancers and particular site-specific RNA editing events are also affected. ADAR2 is most highly expressed in brain and is primarily required for site-specific editing of CNS transcripts; recent findings indicate that ADAR2 editing is regulated by neuronal excitation for synaptic scaling of glutamate receptors. ADAR2 is also linked to the circadian clock and to sleep. Mutations in ADAR2 could contribute to excitability syndromes such as epilepsy, to seizures, to diseases involving neuronal plasticity defects, such as autism and Fragile-X Syndrome, to neurodegenerations such as ALS, or to astrocytomas or glioblastomas in which reduced ADAR2 activity is required for oncogenic cell behavior. The range of human disease associated with ADAR1 mutations may extend further to include other inflammatory conditions while ADAR2 mutations may affect psychiatric conditions.

ADAR1 regulates ARHGAP26 gene expression through RNA editing by disrupting miR-30b-3p and miR-573 binding.

PubMed

Wang, Qiong; Hui, Haipeng; Guo, Zhendong; Zhang, Weina; Hu, Yaou; He, Tao; Tai, Yanhong; Peng, Peng; Wang, Li

2013-11-01

Rho GTPase activating protein 26 (ARHGAP26) is a negative regulator of the Rho family that converts the small G proteins RhoA and Cdc42 to their inactive GDP-bound forms. It is essential for the CLIC/GEEC endocytic pathway, cell spreading, and muscle development. The present study shows that ARHGAP26 mRNA undergoes extensive A-to-I RNA editing in the 3' UTR that is specifically catalyzed by ADAR1. Furthermore, the mRNA and protein levels of ARHGAP26 were decreased in cells in which ADAR1 was knocked down. Conversely, ADAR1 overexpression increased the abundance of ARHGAP26 mRNA and protein. In addition, we found that both miR-30b-3p and miR-573 target the ARHGAP26 gene and that RNA editing of ARHGAP26 mediated by ADAR1 abolished the repression of its expression by miR-30b-3p or miR-573. When ADAR1 was overexpressed, the reduced abundance of ARHGAP26 protein mediated by miR-30b-3p or miR-573 was rescued. Importantly, we also found that knocking down ADAR1 elevated RhoA activity, which was consistent with the reduced level of ARHGAP26. Conversely, when ADAR1 was overexpressed, the amount of RhoA-GTP decreased. The similar expression patterns of ARHGAP26 and ADAR1 in human tissue samples further confirmed our findings. Taken together, our results suggest that ADAR1 regulates the expression of ARHGAP26 through A-to-I RNA editing by disrupting the binding of miR-30b-3p and miR-573 within the 3' UTR of ARHGAP26. This study provides a novel insight into the mechanism by which ADAR1 and its RNA editing function regulate microRNA-mediated modulation of target genes.

Patterns of developmental expression of the RNA editing enzyme rADAR2.

PubMed

Paupard M-C; O'Connell, M A; Gerber, A P; Zukin, R S

2000-01-01

To date, two structurally related RNA-editing enzymes with adenosine deaminase activity have been identified in mammalian tissue: ADAR1 and ADAR2 [Bass B. I. et al. (1997) RNA 3, 947-949]. In rodents, ADAR2 undergoes alternative RNA splicing, giving rise to two splice variants that differ by the presence or absence of a 10-amino-acid insert in the carboxy-terminal catalytic domain. However, the physiological significance of the splicing and its regional and developmental regulation are as yet unknown. The present study examined spatial and temporal patterns of ADAR2 gene transcripts within specific neuronal populations of rat brain. The two rodent ADAR2 isoforms were expressed at comparable levels at all ages examined. rADAR2 messenger RNA expression was first detectable in the thalamic nuclei formation at embryonic day E19. The rADAR2b insert and rADAR2a splice probes produced images similar to that of the rADAR2 pan probe. At birth, rADAR2a messenger RNA splice variants were abundantly expressed in the thalamic nuclei. No signal for any probe was detectable in other brain regions, including neocortex, hippocampus, striatum and cerebellum at this stage of development. During the first week of postnatal life, rADAR2 messenger RNA expression (detected with the pan probe) increased gradually in several brain regions, with low expression detected at postnatal day P7 in the olfactory bulb, inferior colliculus, and within the pyramidal and granule cell layers of the hippocampus. Hybridization patterns of the rADAR2a variant probe reached peak expression at about the second week of life, while peak expression of the rADAR2b probe was reached at about the third week of life. At the end of the first week of life (P7), expression of both splice variants was strongest in the thalamic nuclei. By P14, rADAR2 messenger RNA expression was more consolidated in the deeper structures, including the thalamic nuclei and the granule cell layer of the cerebellum. By P21, maximal levels

Combinatory RNA-Sequencing Analyses Reveal a Dual Mode of Gene Regulation by ADAR1 in Gastric Cancer.

PubMed

Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan

2018-04-25

Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.

A novel immune resistance mechanism of melanoma cells controlled by the ADAR1 enzyme

PubMed Central

Galore-Haskel, Gilli; Nemlich, Yael; Greenberg, Eyal; Ashkenazi, Shira; Hakim, Motti; Itzhaki, Orit; Shoshani, Noa; Shapira-Fromer, Ronnie; Ben-Ami, Eytan; Ofek, Efrat; Anafi, Liat; Besser, Michal J.

2015-01-01

The blossom of immunotherapy in melanoma highlights the need to delineate mechanisms of immune resistance. Recently, we have demonstrated that the RNA editing protein, adenosine deaminase acting on RNA-1 (ADAR1) is down-regulated during metastatic transition of melanoma, which enhances melanoma cell proliferation and tumorigenicity. Here we investigate the role of ADAR1 in melanoma immune resistance. Importantly, knockdown of ADAR1 in human melanoma cells induces resistance to tumor infiltrating lymphocytes in a cell contact-dependent mechanism. We show that ADAR1, in an editing-independent manner, regulates the biogenesis of miR-222 at the transcription level and thereby Intercellular Adhesion Molecule 1 (ICAM1) expression, which consequently affects melanoma immune resistance. ADAR1 thus has a novel, pivotal, role in cancer immune resistance. Corroborating with these results, the expression of miR-222 in melanoma tissue specimens was significantly higher in patients who had no clinical benefit from treatment with ipilimumab as compared to patients that responded clinically, suggesting that miR-222 could function as a biomarker for the prediction of response to ipilimumab. These results provide not only novel insights on melanoma immune resistance, but also pave the way to the development of innovative personalized tools to enable optimal drug selection and treatment. PMID:26338962

RNA Adenosine Deaminase ADAR1 Deficiency Leads to Increased Activation of Protein Kinase PKR and Reduced Vesicular Stomatitis Virus Growth Following Interferon Treatment

PubMed Central

Li, Zhiqun; Wolff, Karen C.; Samuel, Charles E.

2009-01-01

Two size forms of ADAR1 adenosine deaminase are known, one constitutively expressed (p110) and the other interferon (IFN)-induced (p150). To test the role of ADAR1 in viral infection, HeLa cells with ADAR1 stably knocked down and 293 cells over expressing ADAR1 were utilized. Over expression of p150 ADAR1 had no significant effect on the yield of vesicular stomatitis virus. Likewise, reduction of p110 and p150 ADAR1 proteins to less than ~10 to 15% of parental levels (ADAR1-deficient) had no significant effect on VSV growth in the absence of IFN treatment. However, inhibition of virus growth following IFN treatment was ~1 log10 further reduced compared to ADAR1-sufficient cells. The level of phosphorylated protein kinase PKR was increased in ADAR1-deficient cells compared to ADAR1-sufficient cells following IFN treatment, regardless of viral infection. These results suggest that ADAR1 suppresses activation of PKR and inhibition of VSV growth in response to IFN treatment. PMID:19913273

Tuning of RNA editing by ADAR is required in Drosophila

PubMed Central

Keegan, Liam P; Brindle, James; Gallo, Angela; Leroy, Anne; Reenan, Robert A; O'Connell, Mary A

2005-01-01

RNA editing increases during development in more than 20 transcripts encoding proteins involved in rapid synaptic neurotransmission in Drosophila central nervous system and muscle. Adar (adenosine deaminase acting on RNA) mutant flies expressing only genome-encoded, unedited isoforms of ion-channel subunits are viable but show severe locomotion defects. The Adar transcript itself is edited in adult wild-type flies to generate an isoform with a serine to glycine substitution close to the ADAR active site. We show that editing restricts ADAR function since the edited isoform of ADAR is less active in vitro and in vivo than the genome-encoded, unedited isoform. Ubiquitous expression in embryos and larvae of an Adar transcript that is resistant to editing is lethal. Expression of this transcript in embryonic muscle is also lethal, with above-normal, adult-like levels of editing at sites in a transcript encoding a muscle voltage-gated calcium channel. PMID:15920480

Gene amplification-associated overexpression of the RNA editing enzyme ADAR1 enhances human lung tumorigenesis.

PubMed

Anadón, C; Guil, S; Simó-Riudalbas, L; Moutinho, C; Setien, F; Martínez-Cardús, A; Moran, S; Villanueva, A; Calaf, M; Vidal, A; Lazo, P A; Zondervan, I; Savola, S; Kohno, T; Yokota, J; Ribas de Pouplana, L; Esteller, M

2016-08-18

The introduction of new therapies against particular genetic mutations in non-small-cell lung cancer is a promising avenue for improving patient survival, but the target population is small. There is a need to discover new potential actionable genetic lesions, to which end, non-conventional cancer pathways, such as RNA editing, are worth exploring. Herein we show that the adenosine-to-inosine editing enzyme ADAR1 undergoes gene amplification in non-small cancer cell lines and primary tumors in association with higher levels of the corresponding mRNA and protein. From a growth and invasion standpoint, the depletion of ADAR1 expression in amplified cells reduces their tumorigenic potential in cell culture and mouse models, whereas its overexpression has the opposite effects. From a functional perspective, ADAR1 overexpression enhances the editing frequencies of target transcripts such as NEIL1 and miR-381. In the clinical setting, patients with early-stage lung cancer, but harboring ADAR1 gene amplification, have poor outcomes. Overall, our results indicate a role for ADAR1 as a lung cancer oncogene undergoing gene amplification-associated activation that affects downstream RNA editing patterns and patient prognosis.

Hyperactive hypothalamus, motivated and non-distractible chronic overeating in ADAR2 transgenic mice

PubMed Central

Akubuiro, Ashley; Zimmerman, M. Bridget; Boles Ponto, Laura L.; Walsh, Susan A.; Sunderland, John; McCormick, Laurie; Singh, Minati

2013-01-01

ADAR2 transgenic mice misexpressing the RNA editing enzyme ADAR2 (Adenosine Deaminase that act on RNA) show characteristics of overeating and experience adult onset obesity. Behavioral patterns and brain changes related to a possible addictive overeating in these transgenic mice were explored as transgenic mice display chronic hyperphagia. ADAR2 transgenic mice were assessed in their food preference and motivation to overeat in a competing reward environment with ad lib access to a running wheel and food. Metabolic activity of brain and peripheral tissue were assessed with [18F] fluorodeoxyglucose positron emission tomography (FDG-PET) and RNA expression of feeding related genes, ADAR2, dopamine and opiate receptors from the hypothalamus and striatum were examined. The results indicate that ADAR2 transgenic mice exhibit, (1) a food preference for diets with higher fat content, (2) significantly increased food intake that is non-distractible in a competing reward environment, (3) significantly increased mRNA expressions of ADAR2, serotonin 2C receptor (5HT2CR), D1, D2, and mu opioid receptors and no change in CRH mRNAs and significantly reduced ADAR2 protein expression in the hypothalamus, (4) significantly increased D1 receptor and altered bioamines with no change in ADAR2, mu opioid and D2 receptor mRNA expression in the striatum, and (5) significantly greater glucose metabolism in the hypothalamus, brain stem, right hippocampus, left and right mid brain regions and suprascapular peripheral tissue than controls. These results suggest that highly motivated and goal-oriented overeating behaviors of ADAR2 transgenic mice are associated with altered feeding, reward-related mRNAs, and hyperactive brain mesolimbic region. PMID:23323881

Effects of social isolation and re-socialization on cognition and ADAR1 (p110) expression in mice.

PubMed

Chen, Wei; An, Dong; Xu, Hong; Cheng, Xiaoxin; Wang, Shiwei; Yu, Weizhi; Yu, Deqin; Zhao, Dan; Sun, Yiping; Deng, Wuguo; Tang, Yiyuan; Yin, Shengming

2016-01-01

It has been reported that social isolation stress could be a key factor that leads to cognitive deficit for both humans and rodent models. However, detailed mechanisms are not yet clear. ADAR1 (Adenosine deaminase acting on RNA) is an enzyme involved in RNA editing that has a close relation to cognitive function. We have hypothesized that social isolation stress may impact the expression of ADAR1 in the brain of mice with cognitive deficit. To test our hypothesis, we evaluated the cognition ability of mice isolated for different durations (2, 4, and 8 weeks) using object recognition and object location tests; we also measured ADAR1 expression in hippocampus and cortex using immunohistochemistry and western blot. Our study showed that social isolation stress induced spatial and non-spatial cognition deficits of the tested mice. In addition, social isolation significantly increased both the immunoreactivity and protein expression of ADAR1 (p110) in the hippocampus and frontal cortex. Furthermore, re-socialization could not only recover the cognition deficits, but also bring ADAR1 (p110) immunoreactivity of hippocampus and frontal cortex, as well as ADAR1 (p110) protein expression of hippocampus back to the normal level for the isolated mice in adolescence. In conclusion, social isolation stress significantly increases ADAR1 (p110) expression in the hippocampus and frontal cortex of the mice with cognitive deficit. This finding may open a window to better understand the reasons (e.g., epigenetic change) that are responsible for social isolation-induced cognitive deficit and help the development of novel therapies for the resulted diseases.

New Insights into the Biological Role of Mammalian ADARs; the RNA Editing Proteins

PubMed Central

Mannion, Niamh; Arieti, Fabiana; Gallo, Angela; Keegan, Liam P.; O’Connell, Mary A.

2015-01-01

The ADAR proteins deaminate adenosine to inosine in double-stranded RNA which is one of the most abundant modifications present in mammalian RNA. Inosine can have a profound effect on the RNAs that are edited, not only changing the base-pairing properties, but can also result in recoding, as inosine behaves as if it were guanosine. In mammals there are three ADAR proteins and two ADAR-related proteins (ADAD) expressed. All have a very similar modular structure; however, both their expression and biological function differ significantly. Only two of the ADAR proteins have enzymatic activity. However, both ADAR and ADAD proteins possess the ability to bind double-strand RNA. Mutations in ADARs have been associated with many diseases ranging from cancer, innate immunity to neurological disorders. Here, we will discuss in detail the domain structure of mammalian ADARs, the effects of RNA editing, and the role of ADARs in human diseases. PMID:26437436

Evidence for ADAR-induced hypermutation of the Drosophila sigma virus (Rhabdoviridae).

PubMed

Carpenter, Jennifer A; Keegan, Liam P; Wilfert, Lena; O'Connell, Mary A; Jiggins, Francis M

2009-11-26

ADARs are RNA editing enzymes that target double stranded RNA and convert adenosine to inosine, which is read by translation machinery as if it were guanosine. Aside from their role in generating protein diversity in the central nervous system, ADARs have been implicated in the hypermutation of some RNA viruses, although why this hypermutation occurs is not well understood. Here we describe the hypermutation of adenosines to guanosines in the genome of the sigma virus--a negative sense RNA virus that infects Drosophila melanogaster. The clustering of these mutations and the context in which they occur indicates that they have been caused by ADARs. However, ADAR-editing of viral RNA is either rare or edited viral RNA are rapidly degraded, as we only detected evidence for editing in two of the 104 viral isolates we studied. This is the first evidence for ADARs targeting viruses outside of mammals, and it raises the possibility that ADARs could play a role in the antiviral defences of insects.

Postspreading rifting in the Adare Basin, Antarctica: Regional tectonic consequences

NASA Astrophysics Data System (ADS)

Granot, R.; Cande, S. C.; Stock, J. M.; Davey, F. J.; Clayton, R. W.

2010-08-01

Extension during the middle Cenozoic (43-26 Ma) in the north end of the West Antarctic rift system (WARS) is well constrained by seafloor magnetic anomalies formed at the extinct Adare spreading axis. Kinematic solutions for this time interval suggest a southward decrease in relative motion between East and West Antarctica. Here we present multichannel seismic reflection and seafloor mapping data acquired within and near the Adare Basin on a recent geophysical cruise. We have traced the ANTOSTRAT seismic stratigraphic framework from the northwest Ross Sea into the Adare Basin, verified and tied to DSDP drill sites 273 and 274. Our results reveal three distinct periods of tectonic activity. An early localized deformational event took place close to the cessation of seafloor spreading in the Adare Basin (˜24 Ma). It reactivated a few normal faults and initiated the formation of the Adare Trough. A prominent pulse of rifting in the early Miocene (˜17 Ma) resulted in normal faulting that initiated tilted blocks. The overall trend of structures was NE-SW, linking the event with the activity outside the basin. It resulted in major uplift of the Adare Trough and marks the last extensional phase of the Adare Basin. Recent volcanic vents (Pliocene to present day) tend to align with the early Miocene structures and the on-land Hallett volcanic province. This latest phase of tectonic activity also involves near-vertical normal faulting (still active in places) with negligible horizontal consequences. The early Miocene extensional event found within the Adare Basin does not require a change in the relative motion between East and West Antarctica. However, the lack of subsequent rifting within the Adare Basin coupled with the formation of the Terror Rift and an on-land and subice extension within the WARS require a pronounced change in the kinematics of the rift. These observations indicate that extension increased southward, therefore suggesting that a major change in

Hyperactive hypothalamus, motivated and non-distractible chronic overeating in ADAR2 transgenic mice.

PubMed

Akubuiro, A; Bridget Zimmerman, M; Boles Ponto, L L; Walsh, S A; Sunderland, J; McCormick, L; Singh, M

2013-04-01

ADAR2 transgenic mice misexpressing the RNA editing enzyme ADAR2 (Adenosine Deaminase that act on RNA) show characteristics of overeating and experience adult onset obesity. Behavioral patterns and brain changes related to a possible addictive overeating in these transgenic mice were explored as transgenic mice display chronic hyperphagia. ADAR2 transgenic mice were assessed in their food preference and motivation to overeat in a competing reward environment with ad lib access to a running wheel and food. Metabolic activity of brain and peripheral tissue were assessed with [(18) F] fluorodeoxyglucose positron emission tomography (FDG-PET) and RNA expression of feeding related genes, ADAR2, dopamine and opiate receptors from the hypothalamus and striatum were examined. The results indicate that ADAR2 transgenic mice exhibit, (1) a food preference for diets with higher fat content, (2) significantly increased food intake that is non-distractible in a competing reward environment, (3) significantly increased messenger RNA (mRNA) expressions of ADAR2, serotonin 2C receptor (5HT2C R), D1, D2 and mu opioid receptors and no change in corticotropin-releasing hormone mRNAs and significantly reduced ADAR2 protein expression in the hypothalamus, (4) significantly increased D1 receptor and altered bioamines with no change in ADAR2, mu opioid and D2 receptor mRNA expression in the striatum and (5) significantly greater glucose metabolism in the hypothalamus, brain stem, right hippocampus, left and right mid brain regions and suprascapular peripheral tissue than controls. These results suggest that highly motivated and goal-oriented overeating behaviors of ADAR2 transgenic mice are associated with altered feeding, reward-related mRNAs and hyperactive brain mesolimbic region. Genes, Brain and Behavior © 2013 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Fmrp Interacts with Adar and Regulates RNA Editing, Synaptic Density and Locomotor Activity in Zebrafish

PubMed Central

Porath, Hagit T.; Barak, Michal; Pinto, Yishay; Wachtel, Chaim; Zilberberg, Alona; Lerer-Goldshtein, Tali; Efroni, Sol; Levanon, Erez Y.; Appelbaum, Lior

2015-01-01

Fragile X syndrome (FXS) is the most frequent inherited form of mental retardation. The cause for this X-linked disorder is the silencing of the fragile X mental retardation 1 (fmr1) gene and the absence of the fragile X mental retardation protein (Fmrp). The RNA-binding protein Fmrp represses protein translation, particularly in synapses. In Drosophila, Fmrp interacts with the adenosine deaminase acting on RNA (Adar) enzymes. Adar enzymes convert adenosine to inosine (A-to-I) and modify the sequence of RNA transcripts. Utilizing the fmr1 zebrafish mutant (fmr1-/-), we studied Fmrp-dependent neuronal circuit formation, behavior, and Adar-mediated RNA editing. By combining behavior analyses and live imaging of single axons and synapses, we showed hyperlocomotor activity, as well as increased axonal branching and synaptic density, in fmr1-/- larvae. We identified thousands of clustered RNA editing sites in the zebrafish transcriptome and showed that Fmrp biochemically interacts with the Adar2a protein. The expression levels of the adar genes and Adar2 protein increased in fmr1-/- zebrafish. Microfluidic-based multiplex PCR coupled with deep sequencing showed a mild increase in A-to-I RNA editing levels in evolutionarily conserved neuronal and synaptic Adar-targets in fmr1-/- larvae. These findings suggest that loss of Fmrp results in increased Adar-mediated RNA editing activity on target-specific RNAs, which, in turn, might alter neuronal circuit formation and behavior in FXS. PMID:26637167

ADAR1-mediated 3' UTR editing and expression control of antiapoptosis genes fine-tunes cellular apoptosis response.

PubMed

Yang, Chang-Ching; Chen, Yi-Tung; Chang, Yi-Feng; Liu, Hsuan; Kuo, Yu-Ping; Shih, Chieh-Tien; Liao, Wei-Chao; Chen, Hui-Wen; Tsai, Wen-Sy; Tan, Bertrand Chin-Ming

2017-05-25

Adenosine-to-inosine RNA editing constitutes a crucial component of the cellular transcriptome and critically underpins organism survival and development. While recent high-throughput approaches have provided comprehensive documentation of the RNA editome, its functional output remains mostly unresolved, particularly for events in the non-coding regions. Gene ontology analysis of the known RNA editing targets unveiled a preponderance of genes related to apoptosis regulation, among which proto-oncogenes XIAP and MDM2 encode two the most abundantly edited transcripts. To further decode this potential functional connection, here we showed that the main RNA editor ADAR1 directly targets this 3' UTR editing of XIAP and MDM2, and further exerts a negative regulation on the expression of their protein products. This post-transcriptional silencing role was mediated via the inverted Alu elements in the 3' UTR but independent of alteration in transcript stability or miRNA targeting. Rather, we discovered that ADAR1 competes transcript occupancy with the RNA shuttling factor STAU1 to facilitate nuclear retention of the XIAP and MDM2 mRNAs. As a consequence, ADAR1 may acquire functionality in part by conferring spatial distribution and translation efficiency of the target transcripts. Finally, abrogation of ADAR1 expression or catalytic activity elicited a XIAP-dependent suppression of apoptotic response, whereas ectopic expression reversed this protective effect on cell death. Together, our results extended the known functions of ADAR1 and RNA editing to the critical fine-tuning of the intracellular apoptotic signaling and also provided mechanistic explanation for ADAR1's roles in development and tumorigenesis.

Genetic, Phenotypic, and Interferon Biomarker Status in ADAR1-Related Neurological Disease.

PubMed

Rice, Gillian I; Kitabayashi, Naoki; Barth, Magalie; Briggs, Tracy A; Burton, Annabel C E; Carpanelli, Maria Luisa; Cerisola, Alfredo M; Colson, Cindy; Dale, Russell C; Danti, Federica Rachele; Darin, Niklas; De Azua, Begoña; De Giorgis, Valentina; De Goede, Christian G L; Desguerre, Isabelle; De Laet, Corinne; Eslahi, Atieh; Fahey, Michael C; Fallon, Penny; Fay, Alex; Fazzi, Elisa; Gorman, Mark P; Gowrinathan, Nirmala Rani; Hully, Marie; Kurian, Manju A; Leboucq, Nicolas; Lin, Jean-Pierre S-M; Lines, Matthew A; Mar, Soe S; Maroofian, Reza; Martí-Sanchez, Laura; McCullagh, Gary; Mojarrad, Majid; Narayanan, Vinodh; Orcesi, Simona; Ortigoza-Escobar, Juan Dario; Pérez-Dueñas, Belén; Petit, Florence; Ramsey, Keri M; Rasmussen, Magnhild; Rivier, François; Rodríguez-Pombo, Pilar; Roubertie, Agathe; Stödberg, Tommy I; Toosi, Mehran Beiraghi; Toutain, Annick; Uettwiller, Florence; Ulrick, Nicole; Vanderver, Adeline; Waldman, Amy; Livingston, John H; Crow, Yanick J

2017-06-01

We investigated the genetic, phenotypic, and interferon status of 46 patients from 37 families with neurological disease due to mutations in ADAR1 . The clinicoradiological phenotype encompassed a spectrum of Aicardi-Goutières syndrome, isolated bilateral striatal necrosis, spastic paraparesis with normal neuroimaging, a progressive spastic dystonic motor disorder, and adult-onset psychological difficulties with intracranial calcification. Homozygous missense mutations were recorded in five families. We observed a p.Pro193Ala variant in the heterozygous state in 22 of 23 families with compound heterozygous mutations. We also ascertained 11 cases from nine families with a p.Gly1007Arg dominant-negative mutation, which occurred de novo in four patients, and was inherited in three families in association with marked phenotypic variability. In 50 of 52 samples from 34 patients, we identified a marked upregulation of type I interferon-stimulated gene transcripts in peripheral blood, with a median interferon score of 16.99 (interquartile range [IQR]: 10.64-25.71) compared with controls (median: 0.93, IQR: 0.57-1.30). Thus, mutations in ADAR1 are associated with a variety of clinically distinct neurological phenotypes presenting from early infancy to adulthood, inherited either as an autosomal recessive or dominant trait. Testing for an interferon signature in blood represents a useful biomarker in this context. Georg Thieme Verlag KG Stuttgart · New York.

An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer.

PubMed

Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei

2017-10-13

Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer

PubMed Central

Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre

2017-01-01

Abstract Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3′ untranslated regions (3′UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3′UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3′UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3′UTR to repress its expression level. In sum, our study unveils that the extensive 3′UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. PMID:28985428

A-to-I editing of coding and non-coding RNAs by ADARs

PubMed Central

Nishikura, Kazuko

2016-01-01

Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

A-to-I RNA editing independent of ADARs in filamentous fungi

PubMed Central

Wang, Chenfang; Xu, Jin-Rong; Liu, Huiquan

2016-01-01

ABSTRACT ADAR mediated A-to-I RNA editing is thought to be unique to animals and occurs mainly in the non-coding regions. Recently filamentous fungi such as Fusarium graminearum were found to lack orthologs of animal ADARs but have stage-specific A-to-I editing during sexual reproduction. Unlike animals, majority of editing sites are in the coding regions and often result in missense and stop loss changes in fungi. Furthermore, whereas As in RNA stems are targeted by animal ADARs, RNA editing in fungi preferentially targets As in hairpin loops, implying that fungal RNA editing involves mechanisms related to editing of the anticodon loop by ADATs. Identification and characterization of fungal adenosine deaminases and their stage-specific co-factors may be helpful to understand the evolution of human ADARs. Fungi also can be used to study biological functions of missense and stop loss RNA editing events in eukaryotic organisms. PMID:27533598

Rare ADAR and RNASEH2B variants and a type I interferon signature in glioma and prostate carcinoma risk and tumorigenesis.

PubMed

Beyer, Ulrike; Brand, Frank; Martens, Helge; Weder, Julia; Christians, Arne; Elyan, Natalie; Hentschel, Bettina; Westphal, Manfred; Schackert, Gabriele; Pietsch, Torsten; Hong, Bujung; Krauss, Joachim K; Samii, Amir; Raab, Peter; Das, Anibh; Dumitru, Claudia A; Sandalcioglu, I Erol; Hakenberg, Oliver W; Erbersdobler, Andreas; Lehmann, Ulrich; Reifenberger, Guido; Weller, Michael; Reijns, Martin A M; Preller, Matthias; Wiese, Bettina; Hartmann, Christian; Weber, Ruthild G

2017-12-01

In search of novel germline alterations predisposing to tumors, in particular to gliomas, we studied a family with two brothers affected by anaplastic gliomas, and their father and paternal great-uncle diagnosed with prostate carcinoma. In this family, whole-exome sequencing yielded rare, simultaneously heterozygous variants in the Aicardi-Goutières syndrome (AGS) genes ADAR and RNASEH2B co-segregating with the tumor phenotype. AGS is a genetically induced inflammatory disease particularly of the brain, which has not been associated with a consistently increased cancer risk to date. By targeted sequencing, we identified novel ADAR and RNASEH2B variants, and a 3- to 17-fold frequency increase of the AGS mutations ADAR,c.577C>G;p.(P193A) and RNASEH2B,c.529G>A;p.(A177T) in the germline of familial glioma patients as well as in test and validation cohorts of glioblastomas and prostate carcinomas versus ethnicity-matched controls, whereby rare RNASEH2B variants were significantly more frequent in familial glioma patients. Tumors with ADAR or RNASEH2B variants recapitulated features of AGS, such as calcification and increased type I interferon expression. Patients carrying ADAR or RNASEH2B variants showed upregulation of interferon-stimulated gene (ISG) transcripts in peripheral blood as seen in AGS. An increased ISG expression was also induced by ADAR and RNASEH2B variants in tumor cells and was blocked by the JAK inhibitor Ruxolitinib. Our data implicate rare variants in the AGS genes ADAR and RNASEH2B and a type I interferon signature in glioma and prostate carcinoma risk and tumorigenesis, consistent with a genetic basis underlying inflammation-driven malignant transformation in glioma and prostate carcinoma development.

Magnetic anomalies northeast of Cape Adare, northern Victoria Land (Antarctica), and their relation to onshore structures

USGS Publications Warehouse

Damaske, D.; Läufer, A.L.; Goldmann, F.; Möller, H.-D.; Lisker, F.

2007-01-01

An aeromagnetic survey was flown over the offshore region northeast of Cape Adare and the magnetic anomalies compared to onshore structures between Pennell Coast and Tucker Glacier. The magnetic anomalies show two nearly orthogonal major trends. NNW-SSE trending anomalies northeast of Cape Adare represent seafloor spreading within the Adare Trough. A connection of these anomalies to the Northern Basin of the Ross Sea is not clear. Onshore faults are closely aligned to offshore anomalies. Main trends are NW-SE to NNW-SSE and NE-SW to NNESSW. NNW-SSE oriented dextral-transtensional to extensional faults parallel the Adare Peninsula and Adare Trough anomalies. NE-SW trending normal faults appear to segment the main Hallett volcanic bodies.

ADAR2 induces reproducible changes in sequence and abundance of mature microRNAs in the mouse brain

PubMed Central

Vesely, Cornelia; Tauber, Stefanie; Sedlazeck, Fritz J.; Tajaddod, Mansoureh; von Haeseler, Arndt; Jantsch, Michael F.

2014-01-01

Adenosine deaminases that act on RNA (ADARs) deaminate adenosines to inosines in double-stranded RNAs including miRNA precursors. A to I editing is widespread and required for normal life. By comparing deep sequencing data of brain miRNAs from wild-type and ADAR2 deficient mouse strains, we detect editing sites and altered miRNA processing at high sensitivity. We detect 48 novel editing events in miRNAs. Some editing events reach frequencies of up to 80%. About half of all editing events depend on ADAR2 while some miRNAs are preferentially edited by ADAR1. Sixty-four percent of all editing events are located within the seed region of mature miRNAs. For the highly edited miR-3099, we experimentally prove retargeting of the edited miRNA to novel 3′ UTRs. We show further that an abundant editing event in miR-497 promotes processing by Drosha of the corresponding pri-miRNA. We also detect reproducible changes in the abundance of specific miRNAs in ADAR2-deficient mice that occur independent of adjacent A to I editing events. This indicates that ADAR2 binding but not editing of miRNA precursors may influence their processing. Correlating with changes in miRNA abundance we find misregulation of putative targets of these miRNAs in the presence or absence of ADAR2. PMID:25260591

The C. elegans neural editome reveals an ADAR target mRNA required for proper chemotaxis

PubMed Central

Deffit, Sarah N; Yee, Brian A; Manning, Aidan C; Rajendren, Suba; Vadlamani, Pranathi; Wheeler, Emily C; Domissy, Alain; Washburn, Michael C

2017-01-01

ADAR proteins alter gene expression both by catalyzing adenosine (A) to inosine (I) RNA editing and binding to regulatory elements in target RNAs. Loss of ADARs affects neuronal function in all animals studied to date. Caenorhabditis elegans lacking ADARs exhibit reduced chemotaxis, but the targets responsible for this phenotype remain unknown. To identify critical neural ADAR targets in C. elegans, we performed an unbiased assessment of the effects of ADR-2, the only A-to-I editing enzyme in C. elegans, on the neural transcriptome. Development and implementation of publicly available software, SAILOR, identified 7361 A-to-I editing events across the neural transcriptome. Intersecting the neural editome with adr-2 associated gene expression changes, revealed an edited mRNA, clec-41, whose neural expression is dependent on deamination. Restoring clec-41 expression in adr-2 deficient neural cells rescued the chemotaxis defect, providing the first evidence that neuronal phenotypes of ADAR mutants can be caused by altered gene expression. PMID:28925356

Structures of human ADAR2 bound to dsRNA reveal base-flipping mechanism and basis for site selectivity

DOE PAGES

Matthews, Melissa M.; Thomas, Justin M.; Zheng, Yuxuan; ...

2016-04-11

Adenosine deaminases acting on RNA (ADARs) are editing enzymes that convert adenosine to inosine in duplex RNA, a modification reaction with wide-ranging consequences in RNA function. Understanding of the ADAR reaction mechanism, the origin of editing-site selectivity, and the effect of mutations is limited by the lack of high-resolution structural data for complexes of ADARs bound to substrate RNAs. In this paper, we describe four crystal structures of the human ADAR2 deaminase domain bound to RNA duplexes bearing a mimic of the deamination reaction intermediate. These structures, together with structure-guided mutagenesis and RNA-modification experiments, explain the basis of the ADARmore » deaminase domain's dsRNA specificity, its base-flipping mechanism, and its nearest-neighbor preferences. In addition, we identified an ADAR2-specific RNA-binding loop near the enzyme active site, thus rationalizing differences in selectivity observed between different ADARs. In conclusion, our results provide a structural framework for understanding the effects of ADAR mutations associated with human disease.« less

RNA editing enzyme ADAR2 is a mediator of neuropathic pain after peripheral nerve injury.

PubMed

Uchida, Hitoshi; Matsumura, Shinji; Okada, Shunpei; Suzuki, Tsutomu; Minami, Toshiaki; Ito, Seiji

2017-05-01

Transcriptional and post-translational regulations are important in peripheral nerve injury-induced neuropathic pain, but little is known about the role of post-transcriptional modification. Our objective was to determine the possible effect of adenosine deaminase acting on RNA (ADAR) enzymes, which catalyze post-transcriptional RNA editing, in tactile allodynia, a hallmark of neuropathic pain. Seven days after L5 spinal nerve transection (SNT) in adult mice, we found an increase in ADAR2 expression and a decrease in ADAR3 expression in the injured, but not in the uninjured, dorsal root ganglions (DRGs). These changes were accompanied by elevated levels of editing at the D site of the serotonin (5-hydroxytryptamine) 2C receptor (5-HT 2C R), at the I/V site of coatomer protein complex subunit α (COPA), and at the R/G site of AMPA receptor subunit GluA2 in the injured DRG. Compared to Adar2 +/+ /Gria2 R/R littermate controls, Adar2 -/- /Gria2 R/R mice completely lacked the increased editing of 5-HT 2C R, COPA, and GluA2 transcripts in the injured DRG and showed attenuated tactile allodynia after SNT. Furthermore, the antidepressant fluoxetine inhibited neuropathic allodynia after injury and reduced the COPA I/V site editing in the injured DRG. These findings suggest that ADAR2 is a mediator of injury-induced tactile allodynia and thus a potential therapeutic target for the treatment of neuropathic pain.-Uchida, H., Matsumura, S., Okada, S., Suzuki, T., Minami, T., Ito, S. RNA editing enzyme ADAR2 is a mediator of neuropathic pain after peripheral nerve injury. © FASEB.

Proteolytic dissection of Zab, the Z-DNA-binding domain of human ADAR1

NASA Technical Reports Server (NTRS)

Schwartz, T.; Lowenhaupt, K.; Kim, Y. G.; Li, L.; Brown, B. A. 2nd; Herbert, A.; Rich, A.

1999-01-01

Zalpha is a peptide motif that binds to Z-DNA with high affinity. This motif binds to alternating dC-dG sequences stabilized in the Z-conformation by means of bromination or supercoiling, but not to B-DNA. Zalpha is part of the N-terminal region of double-stranded RNA adenosine deaminase (ADAR1), a candidate enzyme for nuclear pre-mRNA editing in mammals. Zalpha is conserved in ADAR1 from many species; in each case, there is a second similar motif, Zbeta, separated from Zalpha by a more divergent linker. To investigate the structure-function relationship of Zalpha, its domain structure was studied by limited proteolysis. Proteolytic profiles indicated that Zalpha is part of a domain, Zab, of 229 amino acids (residues 133-361 in human ADAR1). This domain contains both Zalpha and Zbeta as well as a tandem repeat of a 49-amino acid linker module. Prolonged proteolysis revealed a minimal core domain of 77 amino acids (positions 133-209), containing only Zalpha, which is sufficient to bind left-handed Z-DNA; however, the substrate binding is strikingly different from that of Zab. The second motif, Zbeta, retains its structural integrity only in the context of Zab and does not bind Z-DNA as a separate entity. These results suggest that Zalpha and Zbeta act as a single bipartite domain. In the presence of substrate DNA, Zab becomes more resistant to proteases, suggesting that it adopts a more rigid structure when bound to its substrate, possibly with conformational changes in parts of the protein.

Positive correlation between ADAR expression and its targets suggests a complex regulation mediated by RNA editing in the human brain

PubMed Central

Liscovitch, Noa; Bazak, Lily; Levanon, Erez Y; Chechik, Gal

2014-01-01

A-to-I RNA editing by adenosine deaminases acting on RNA is a post-transcriptional modification that is crucial for normal life and development in vertebrates. RNA editing has been shown to be very abundant in the human transcriptome, specifically at the primate-specific Alu elements. The functional role of this wide-spread effect is still not clear; it is believed that editing of transcripts is a mechanism for their down-regulation via processes such as nuclear retention or RNA degradation. Here we combine 2 neural gene expression datasets with genome-level editing information to examine the relation between the expression of ADAR genes with the expression of their target genes. Specifically, we computed the spatial correlation across structures of post-mortem human brains between ADAR and a large set of targets that were found to be edited in their Alu repeats. Surprisingly, we found that a large fraction of the edited genes are positively correlated with ADAR, opposing the assumption that editing would reduce expression. When considering the correlations between ADAR and its targets over development, 2 gene subsets emerge, positively correlated and negatively correlated with ADAR expression. Specifically, in embryonic time points, ADAR is positively correlated with many genes related to RNA processing and regulation of gene expression. These findings imply that the suggested mechanism of regulation of expression by editing is probably not a global one; ADAR expression does not have a genome wide effect reducing the expression of editing targets. It is possible, however, that RNA editing by ADAR in non-coding regions of the gene might be a part of a more complex expression regulation mechanism. PMID:25692240

Positive correlation between ADAR expression and its targets suggests a complex regulation mediated by RNA editing in the human brain.

PubMed

Liscovitch, Noa; Bazak, Lily; Levanon, Erez Y; Chechik, Gal

2014-01-01

A-to-I RNA editing by adenosine deaminases acting on RNA is a post-transcriptional modification that is crucial for normal life and development in vertebrates. RNA editing has been shown to be very abundant in the human transcriptome, specifically at the primate-specific Alu elements. The functional role of this wide-spread effect is still not clear; it is believed that editing of transcripts is a mechanism for their down-regulation via processes such as nuclear retention or RNA degradation. Here we combine 2 neural gene expression datasets with genome-level editing information to examine the relation between the expression of ADAR genes with the expression of their target genes. Specifically, we computed the spatial correlation across structures of post-mortem human brains between ADAR and a large set of targets that were found to be edited in their Alu repeats. Surprisingly, we found that a large fraction of the edited genes are positively correlated with ADAR, opposing the assumption that editing would reduce expression. When considering the correlations between ADAR and its targets over development, 2 gene subsets emerge, positively correlated and negatively correlated with ADAR expression. Specifically, in embryonic time points, ADAR is positively correlated with many genes related to RNA processing and regulation of gene expression. These findings imply that the suggested mechanism of regulation of expression by editing is probably not a global one; ADAR expression does not have a genome wide effect reducing the expression of editing targets. It is possible, however, that RNA editing by ADAR in non-coding regions of the gene might be a part of a more complex expression regulation mechanism.

Deficient RNA-editing enzyme ADAR2 in an amyotrophic lateral sclerosis patient with a FUS(P525L) mutation.

PubMed

Aizawa, Hitoshi; Hideyama, Takuto; Yamashita, Takenari; Kimura, Takashi; Suzuki, Naoki; Aoki, Masashi; Kwak, Shin

2016-10-01

Mutations in the fused in sarcoma (FUS) gene can cause amyotrophic lateral sclerosis (ALS), and FUS gene mutations have been reported in sporadic ALS patients with basophilic cytoplasmic inclusions. Deficiency of adenosine deaminase acting on RNA 2 (ADAR2), an enzyme that specifically catalyzes GluA2 Q/R site-editing, has been reported in considerable proportions of spinal motor neurons of the majority of sporadic ALS patients. We describe the relationship between GluA2 Q/R site-editing efficiency and FUS-positive inclusions in a patient with FUS(P525L). A 24-year-old woman with ALS presented with basophilic cytoplasmic inclusions, significantly reduced GluA2 Q/R site-editing efficiency in the spinal motor neurons, and markedly decreased ADAR2 mRNA levels. Neuropathologic examination showed that not all spinal motor neurons expressed ADAR2 and revealed FUS-positive cytoplasmic inclusions in motor neurons irrespective of ADAR2 immunoreactivity. There were no phosphorylated transactive response (TAR) DNA-binding protein 43 kDa (TDP-43)-positive inclusions, indicating that there was no tight correlation between ADAR2 deficiency and TDP-43 deposition. ADAR2 deficiency can occur in ALS patients with a FUS(P525L) mutation and is unrelated to the presence of FUS-positive inclusions. FUS-associated ALS may share neurodegenerative characteristics with classical sporadic ALS. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nuclear factor 90 uses an ADAR2-like binding mode to recognize specific bases in dsRNA.

PubMed

Jayachandran, Uma; Grey, Heather; Cook, Atlanta G

2016-02-29

Nuclear factors 90 and 45 (NF90 and NF45) form a protein complex involved in the post-transcriptional control of many genes in vertebrates. NF90 is a member of the dsRNA binding domain (dsRBD) family of proteins. RNA binding partners identified so far include elements in 3' untranslated regions of specific mRNAs and several non-coding RNAs. In NF90, a tandem pair of dsRBDs separated by a natively unstructured segment confers dsRNA binding activity. We determined a crystal structure of the tandem dsRBDs of NF90 in complex with a synthetic dsRNA. This complex shows surprising similarity to the tandem dsRBDs from an adenosine-to-inosine editing enzyme, ADAR2 in complex with a substrate RNA. Residues involved in unusual base-specific recognition in the minor groove of dsRNA are conserved between NF90 and ADAR2. These data suggest that, like ADAR2, underlying sequences in dsRNA may influence how NF90 recognizes its target RNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cell death cascade and molecular therapy in ADAR2-deficient motor neurons of ALS.

PubMed

Yamashita, Takenari; Kwak, Shin

2018-06-23

TAR DNA-binding protein (TDP-43) pathology in the motor neurons is the most reliable pathological hallmark of amyotrophic lateral sclerosis (ALS), and motor neurons bearing TDP-43 pathology invariably exhibit failure in RNA editing at the GluA2 glutamine/arginine (Q/R) site due to down-regulation of adenosine deaminase acting on RNA 2 (ADAR2). Conditional ADAR2 knockout (AR2) mice display ALS-like phenotype, including progressive motor dysfunction due to loss of motor neurons. Motor neurons devoid of ADAR2 express Q/R site-unedited GluA2, and AMPA receptors with unedited GluA2 in their subunit assembly are abnormally permeable to Ca 2+ , which results in progressive neuronal death. Moreover, analysis of AR2 mice has demonstrated that exaggerated Ca 2+ influx through the abnormal AMPA receptors overactivates calpain, a Ca 2+ -dependent protease, that cleaves TDP-43 into aggregation-prone fragments, which serve as seeds for TDP-43 pathology. Activated calpain also disrupts nucleo-cytoplasmic transport and gene expression by cleaving molecules involved in nucleocytoplasmic transport, including nucleoporins. These lines of evidence prompted us to develop molecular targeting therapy for ALS by normalization of disrupted intracellular environment due to ADAR2 down-regulation. In this review, we have summarized the work from our group on the cell death cascade in sporadic ALS and discussed a potential therapeutic strategy for ALS. Copyright © 2018 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

Double-stranded-RNA-specific adenosine deaminase 1 (ADAR1) is proposed to contribute to the adaptation of equine infectious anemia virus from horses to donkeys.

PubMed

Tang, Yan-Dong; Zhang, Xiang; Na, Lei; Wang, Xue-Feng; Fu, Li-Hua; Zhu, Chun-Hui; Wang, Xiaojun; Zhou, Jian-Hua

2016-10-01

Equine infectious anemia virus (EIAV) is a member of the genus Lentivirus of the family Retroviridae. Horses are the most susceptible equids to EIAV infection and are therefore the primary hosts of this virus. In contrast, infected donkeys do not develop clinically active equine infectious anemia (EIA). This phenomenon is similar to what has been observed with HIV-1, which fails to induce AIDS in non-human primates. Interestingly, Shen et al. developed a donkey-tropic pathogenic virus strain (EIAVDV117, DV117) by serially passaging a horse-tropic pathogenic strain, EIAVLN40 (LN40), in donkeys. LN40, which was generated by passaging a field isolate in horses, displayed enhanced virulence in horses but caused no clinical symptoms in donkeys. Infection with DV117 induced acute EIA in nearly 100 % of donkeys. Genomic analysis of DV117 revealed a significantly higher frequency of A-to-G substitutions when compared to LN40. Furthermore, detailed analysis of dinucleotide editing showed that A-to-G mutations had a preference for 5'TpA and 5'ApA. These results strongly implicated the activity of the adenosine deaminase, ADAR1, in this type of mutation. Further investigation demonstrated that overexpression of donkey ADAR1 increased A-to-G mutations within the genome of EIAV. Together with our previous finding that multiple mutations in multiple genes are generated in DV117 during its adaptation from horses to donkeys, the present study suggests that ADAR1-induced A-to-G mutations occur during virus adaption to related new hosts contributing to the alteration of EIAV host tropism.

C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.

PubMed

Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L

2018-02-01

Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.

Genome-wide A-to-I RNA editing in fungi independent of ADAR enzymes

PubMed Central

Liu, Huiquan; Wang, Qinhu; He, Yi; Chen, Lingfeng; Hao, Chaofeng; Jiang, Cong; Li, Yang; Dai, Yafeng; Kang, Zhensheng; Xu, Jin-Rong

2016-01-01

Yeasts and filamentous fungi do not have adenosine deaminase acting on RNA (ADAR) orthologs and are believed to lack A-to-I RNA editing, which is the most prevalent editing of mRNA in animals. However, during this study with the PUK1 (FGRRES_01058) pseudokinase gene important for sexual reproduction in Fusarium graminearum, we found that two tandem stop codons, UA1831GUA1834G, in its kinase domain were changed to UG1831GUG1834G by RNA editing in perithecia. To confirm A-to-I editing of PUK1 transcripts, strand-specific RNA-seq data were generated with RNA isolated from conidia, hyphae, and perithecia. PUK1 was almost specifically expressed in perithecia, and 90% of transcripts were edited to UG1831GUG1834G. Genome-wide analysis identified 26,056 perithecium-specific A-to-I editing sites. Unlike those in animals, 70.5% of A-to-I editing sites in F. graminearum occur in coding regions, and more than two-thirds of them result in amino acid changes, including editing of 69 PUK1-like pseudogenes with stop codons in ORFs. PUK1 orthologs and other pseudogenes also displayed stage-specific expression and editing in Neurospora crassa and F. verticillioides. Furthermore, F. graminearum differs from animals in the sequence preference and structure selectivity of A-to-I editing sites. Whereas A's embedded in RNA stems are targeted by ADARs, RNA editing in F. graminearum preferentially targets A's in hairpin loops, which is similar to the anticodon loop of tRNA targeted by adenosine deaminases acting on tRNA (ADATs). Overall, our results showed that A-to-I RNA editing occurs specifically during sexual reproduction and mainly in the coding regions in filamentous ascomycetes, involving adenosine deamination mechanisms distinct from metazoan ADARs. PMID:26934920

The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1).

PubMed

Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu

2009-02-01

The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.

The rise and fall of an ancient Adélie penguin `supercolony' at Cape Adare, Antarctica

NASA Astrophysics Data System (ADS)

Emslie, Steven D.; McKenzie, Ashley; Patterson, William P.

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a `supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin 'supercolony' at Cape Adare, Antarctica.

PubMed

Emslie, Steven D; McKenzie, Ashley; Patterson, William P

2018-04-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin ( Pygoscelis adeliae ) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a 'supercolony') by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there.

The rise and fall of an ancient Adélie penguin ‘supercolony’ at Cape Adare, Antarctica

PubMed Central

McKenzie, Ashley; Patterson, William P.

2018-01-01

We report new discoveries and radiocarbon dates on active and abandoned Adélie penguin (Pygoscelis adeliae) colonies at Cape Adare, Antarctica. This colony, first established at approximately 2000 BP (calendar years before present, i.e. 1950), is currently the largest for this species with approximately 338 000 breeding pairs, most located on low-lying Ridley Beach. We hypothesize that this colony first formed after fast ice began blocking open-water access by breeding penguins to the Scott Coast in the southern Ross Sea during a cooling period also at approximately 2000 BP. Our results suggest that the new colony at Cape Adare continued to grow, expanding to a large upper terrace above Ridley Beach, until it exceeded approximately 500 000 breeding pairs (a ‘supercolony’) by approximately 1200 BP. The high marine productivity associated with the Ross Sea polynya and continental shelf break supported this growth, but the colony collapsed to its present size for unknown reasons after approximately 1200 BP. Ridley Beach will probably be abandoned in the near future due to rising sea level in this region. We predict that penguins will retreat to higher elevations at Cape Adare and that the Scott Coast will be reoccupied by breeding penguins as fast ice continues to dissipate earlier each summer, restoring open-water access to beaches there. PMID:29765656

Bilateral striatal necrosis caused by ADAR mutations in two siblings with dystonia and freckles-like skin changes that should be differentiated from Leigh syndrome.

PubMed

Piekutowska-Abramczuk, Dorota; Mierzewska, Hanna; Bekiesińska-Figatowska, Monika; Ciara, Elżbieta; Trubicka, Joanna; Pronicki, Maciej; Rokicki, Dariusz; Rydzanicz, Małgorzata; Płoski, Rafał; Pronicka, Ewa

2016-01-01

Pathogenic molecular variants in the ADAR gene are a known cause of rare diseases, autosomal recessive Aicardi- Goutières syndrome type 6, severe infantile encephalopathy with intracranial calcifications and dominant dyschromatosis symmetrica hereditaria, demonstrated mainly in Asian adults. Recently, they have been also found in patients with nonsyndromic bilateral striatal necrosis accompanied by skin changes of the freckles-like type. Here, we present Polish siblings with acute onset and slowly progressive extrapyramidal syndrome with preserved intellectual abilities and basal ganglia changes found in MRI. A Leigh syndrome was considered for a long time as the most frequent cause of such lesions in children. Finally, two molecular variants in non-mitochondria-related ADAR gene c.3202+1G>A (p.?) and c.577C>G (p.Pro193Ala) were revealed by whole exome sequencing. We suggest that bilateral striatal necrosis should be always differentiated from LS to prevent the diagnosis delay. The striatal involvement accompanied by the presence of freckles-like skin changes should direct differential diagnosis to the ADAR gene mutations screening.

Basal Adare volcanics, Robertson Bay, North Victoria Land, Antarctica: Late Miocene intraplate basalts of subaqueous origin

USGS Publications Warehouse

Mortimer, N.; Dunlap, W.J.; Isaac, M.J.; Sutherland, R.P.; Faure, K.

2007-01-01

Late Cenozoic lavas and associated hyaloclastite breccias of the Adare volcanics (Hallett volcanic province) in Robertson Bay, North Victoria Land rest unconformably on Paleozoic greywackes. Abundant hyaloclastite breccias are confined to a paleovalley; their primary geological features, and the stable isotope ratios of secondary minerals, are consistent with eruption in a subaqueous environment with calcite formation probably involving seawater. In contrast, the lavas which stratigraphically overlie the hyaloclastites on Mayr Spur probably were erupted subaerially. K-Ar dating of eight samples from this basal sequence confirms the known older age limit (Late Miocene) of the Hallett volcanic province. Geochemical data reveal an ocean island basalt-like affinity, similar to other Cenozoic igneous rocks of the Hallett volcanic province. If a submarine eruptive paleoenvironment is accepted then there has been net tectonic or isostatic post-Late Miocene uplift of a few hundred metres in the Robertson Bay-Adare Peninsula area

Dyschromatosis symmetrica hereditaria with chilblains due to a novel two-amino-acid deletion in the double-stranded RNA binding domain of ADAR1.

PubMed

Kono, M; Suganuma, M; Shimada, T; Ishikura, Y; Watanabe, S; Takeichi, T; Muro, Y; Akiyama, M

2018-05-18

Dyschromatosis symmetrica hereditaria (DSH) is an autosomal dominant skin disease caused by a heterozygous mutation of ADAR1. 1 DSH is characterized by a mixture of hyper- and hypo-pigmented small macules in the extremities. Among the mutations, the pathogenicity of in-frame deletion in regions other than the deaminase domain has not been clarified in DSH. 2 This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

A Phenotypic Screen for Functional Mutants of Human Adenosine Deaminase Acting on RNA 1.

PubMed

Wang, Yuru; Havel, Jocelyn; Beal, Peter A

2015-11-20

Adenosine deaminases acting on RNA (ADARs) are RNA-editing enzymes responsible for the conversion of adenosine to inosine at specific locations in cellular RNAs. ADAR1 and ADAR2 are two members of the family that have been shown to be catalytically active. Earlier, we reported a phenotypic screen for the study of human ADAR2 using budding yeast S. cerevisiae as the host system. While this screen has been successfully applied to the study of ADAR2, it failed with ADAR1. Here, we report a new reporter that uses a novel editing substrate and is suitable for the study of ADAR1. We screened plasmid libraries with randomized codons for two important residues in human ADAR1 (G1007 and E1008). The screening results combined with in vitro deamination assays led to the identification of mutants that are more active than the wild type protein. Furthermore, a screen of the ADAR1 E1008X library with a reporter construct bearing an A•G mismatch at the editing site suggests one role for the residue at position 1008 is to sense the identity of the base pairing partner for the editing site adenosine. This work has provided a starting point for future in vitro evolution studies of ADAR1 and led to new insight into ADAR's editing site selectivity.

MicroRNA profiling of human primary macrophages exposed to dengue virus identifies miRNA-3614-5p as antiviral and regulator of ADAR1 expression

PubMed Central

Echavarría-Consuegra, Liliana; Flipse, Jacky; Fernández, Geysson Javier; Kluiver, Joost; van den Berg, Anke; Urcuqui-Inchima, Silvio; Smit, Jolanda M.

2017-01-01

Background Due to the high burden of dengue disease worldwide, a better understanding of the interactions between dengue virus (DENV) and its human host cells is of the utmost importance. Although microRNAs modulate the outcome of several viral infections, their contribution to DENV replication is poorly understood. Methods and principal findings We investigated the microRNA expression profile of primary human macrophages challenged with DENV and deciphered the contribution of microRNAs to infection. To this end, human primary macrophages were challenged with GFP-expressing DENV and sorted to differentiate between truly infected cells (DENV-positive) and DENV-exposed but non-infected cells (DENV-negative cells). The miRNAome was determined by small RNA-Seq analysis and the effect of differentially expressed microRNAs on DENV yield was examined. Five microRNAs were differentially expressed in human macrophages challenged with DENV. Of these, miR-3614-5p was found upregulated in DENV-negative cells and its overexpression reduced DENV infectivity. The cellular targets of miR-3614-5p were identified by liquid chromatography/mass spectrometry and western blot. Adenosine deaminase acting on RNA 1 (ADAR1) was identified as one of the targets of miR-3614-5p and was shown to promote DENV infectivity at early time points post-infection. Conclusion/Significance Overall, miRNAs appear to play a limited role in DENV replication in primary human macrophages. The miRNAs that were found upregulated in DENV-infected cells did not control the production of infectious virus particles. On the other hand, miR-3614-5p, which was upregulated in DENV-negative macrophages, reduced DENV infectivity and regulated ADAR1 expression, a protein that facilitates viral replication. PMID:29045406

An RNA electrophoretic mobility shift and mutational analysis of rnp-4f 5′-UTR intron splicing regulatory proteins in Drosophila reveals a novel new role for a dADAR protein isoform

PubMed Central

Lakshmi, G. Girija; Ghosh, Sushmita; Jones, Gabriel P.; Parikh, Roshni; Rawlins, Bridgette A.; Vaughn, Jack C.

2014-01-01

Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4,000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA-protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. PMID:23026215

Large-scale prediction of ADAR-mediated effective human A-to-I RNA editing.

PubMed

Yao, Li; Wang, Heming; Song, Yuanyuan; Dai, Zhen; Yu, Hao; Yin, Ming; Wang, Dongxu; Yang, Xin; Wang, Jinlin; Wang, Tiedong; Cao, Nan; Zhu, Jimin; Shen, Xizhong; Song, Guangqi; Zhao, Yicheng

2017-08-10

Adenosine-to-inosine (A-to-I) editing by adenosine deaminase acting on the RNA (ADAR) proteins is one of the most frequent modifications during post- and co-transcription. To facilitate the assignment of biological functions to specific editing sites, we designed an automatic online platform to annotate A-to-I RNA editing sites in pre-mRNA splicing signals, microRNAs (miRNAs) and miRNA target untranslated regions (3' UTRs) from human (Homo sapiens) high-throughput sequencing data and predict their effects based on large-scale bioinformatic analysis. After analysing plenty of previously reported RNA editing events and human normal tissues RNA high-seq data, >60 000 potentially effective RNA editing events on functional genes were found. The RNA Editing Plus platform is available for free at https://www.rnaeditplus.org/, and we believe our platform governing multiple optimized methods will improve further studies of A-to-I-induced editing post-transcriptional regulation. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Inherited variants affecting RNA editing may contribute to ovarian cancer susceptibility: results from a large-scale collaboration.

PubMed

Permuth, Jennifer B; Reid, Brett; Earp, Madalene; Chen, Y Ann; Monteiro, Alvaro N A; Chen, Zhihua; Chenevix-Trench, Georgia; Fasching, Peter A; Beckmann, Matthias W; Lambrechts, Diether; Vanderstichele, Adriaan; Van Niewenhuyse, Els; Vergote, Ignace; Rossing, Mary Anne; Doherty, Jennifer Anne; Chang-Claude, Jenny; Moysich, Kirsten; Odunsi, Kunle; Goodman, Marc T; Shvetsov, Yurii B; Wilkens, Lynne R; Thompson, Pamela J; Dörk, Thilo; Bogdanova, Natalia; Butzow, Ralf; Nevanlinna, Heli; Pelttari, Liisa; Leminen, Arto; Modugno, Francesmary; Edwards, Robert P; Ness, Roberta B; Kelley, Joseph; Heitz, Florian; Karlan, Beth; Lester, Jenny; Kjaer, Susanne K; Jensen, Allan; Giles, Graham; Hildebrandt, Michelle; Liang, Dong; Lu, Karen H; Wu, Xifeng; Levine, Douglas A; Bisogna, Maria; Berchuck, Andrew; Cramer, Daniel W; Terry, Kathryn L; Tworoger, Shelley S; Poole, Elizabeth M; Bandera, Elisa V; Fridley, Brooke; Cunningham, Julie; Winham, Stacey J; Olson, Sara H; Orlow, Irene; Bjorge, Line; Kiemeney, Lambertus A; Massuger, Leon; Pejovic, Tanja; Moffitt, Melissa; Le, Nhu; Cook, Linda S; Brooks-Wilson, Angela; Kelemen, Linda E; Gronwald, Jacek; Lubinski, Jan; Wentzensen, Nicolas; Brinton, Louise A; Lissowska, Jolanta; Yang, Hanna; Hogdall, Estrid; Hogdall, Claus; Lundvall, Lene; Pharoah, Paul D P; Song, Honglin; Campbell, Ian; Eccles, Diana; McNeish, Iain; Whittemore, Alice; McGuire, Valerie; Sieh, Weiva; Rothstein, Joseph; Phelan, Catherine M; Risch, Harvey; Narod, Steven; McLaughlin, John; Anton-Culver, Hoda; Ziogas, Argyrios; Menon, Usha; Gayther, Simon; Ramus, Susan J; Gentry-Maharaj, Aleksandra; Pearce, Celeste Leigh; Wu, Anna H; Kupryjanczyk, Jolanta; Dansonka-Mieszkowska, Agnieszka; Schildkraut, Joellen M; Cheng, Jin Q; Goode, Ellen L; Sellers, Thomas A

2016-11-08

RNA editing in mammals is a form of post-transcriptional modification in which adenosine is converted to inosine by the adenosine deaminases acting on RNA (ADAR) family of enzymes. Based on evidence of altered ADAR expression in epithelial ovarian cancers (EOC), we hypothesized that single nucleotide polymorphisms (SNPs) in ADAR genes modify EOC susceptibility, potentially by altering ovarian tissue gene expression. Using directly genotyped and imputed data from 10,891 invasive EOC cases and 21,693 controls, we evaluated the associations of 5,303 SNPs in ADAD1, ADAR, ADAR2, ADAR3, and SND1. Unconditional logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CI), with adjustment for European ancestry. We conducted gene-level analyses using the Admixture Maximum Likelihood (AML) test and the Sequence-Kernel Association test for common and rare variants (SKAT-CR). Association analysis revealed top risk-associated SNP rs77027562 (OR (95% CI)= 1.39 (1.17-1.64), P=1.0x10-4) in ADAR3 and rs185455523 in SND1 (OR (95% CI)= 0.68 (0.56-0.83), P=2.0x10-4). When restricting to serous histology (n=6,500), the magnitude of association strengthened for rs185455523 (OR=0.60, P=1.0x10-4). Gene-level analyses revealed that variation in ADAR was associated (P<0.05) with EOC susceptibility, with PAML=0.022 and PSKAT-CR=0.020. Expression quantitative trait locus analysis in EOC tissue revealed significant associations (P<0.05) with ADAR expression for several SNPs in ADAR, including rs1127313 (G/A), a SNP in the 3' untranslated region. In summary, germline variation involving RNA editing genes may influence EOC susceptibility, warranting further investigation of inherited and acquired alterations affecting RNA editing.

Inherited variants affecting RNA editing may contribute to ovarian cancer susceptibility: results from a large-scale collaboration

PubMed Central

Permuth, Jennifer B.; Reid, Brett; Earp, Madalene; Chen, Y. Ann; Monteiro, Alvaro N.A.; Chen, Zhihua; Group, AOCS Study; Chenevix-Trench, Georgia; Fasching, Peter A.; Beckmann, Matthias W.; Lambrechts, Diether; Vanderstichele, Adriaan; Niewenhuyse, Els Van; Vergote, Ignace; Rossing, Mary Anne; Doherty, Jennifer Anne; Chang-Claude, Jenny; Moysich, Kirsten; Odunsi, Kunle; Goodman, Marc T.; Shvetsov, Yurii B.; Wilkens, Lynne R.; Thompson, Pamela J.; Dörk, Thilo; Bogdanova, Natalia; Butzow, Ralf; Nevanlinna, Heli; Pelttari, Liisa; Leminen, Arto; Modugno, Francesmary; Edwards, Robert P.; Ness, Roberta B.; Kelley, Joseph; Heitz, Florian; Karlan, Beth; Lester, Jenny; Kjaer, Susanne K.; Jensen, Allan; Giles, Graham; Hildebrandt, Michelle; Liang, Dong; Lu, Karen H.; Wu, Xifeng; Levine, Douglas A.; Bisogna, Maria; Berchuck, Andrew; Cramer, Daniel W.; Terry, Kathryn L.; Tworoger, Shelley S.; Poole, Elizabeth M.; Bandera, Elisa V.; Fridley, Brooke; Cunningham, Julie; Winham, Stacey J.; Olson, Sara H.; Orlow, Irene; Bjorge, Line; Kiemeney, Lambertus A.; Massuger, Leon; Pejovic, Tanja; Moffitt, Melissa; Le, Nhu; Cook, Linda S.; Brooks-Wilson, Angela; Kelemen, Linda E.; Gronwald, Jacek; Lubinski, Jan; Wentzensen, Nicolas; Brinton, Louise A.; Lissowska, Jolanta; Yang, Hanna; Hogdall, Estrid; Hogdall, Claus; Lundvall, Lene; Pharoah, Paul D.P.; Song, Honglin; Campbell, Ian; Eccles, Diana; McNeish, Iain; Whittemore, Alice; McGuire, Valerie; Sieh, Weiva; Rothstein, Joseph; Phelan, Catherine M.; Risch, Harvey; Narod, Steven; McLaughlin, John; Anton-Culver, Hoda; Ziogas, Argyrios; Menon, Usha; Gayther, Simon; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Pearce, Celeste Leigh; Wu, Anna H.; Kupryjanczyk, Jolanta; Dansonka-Mieszkowska, Agnieszka; Schildkraut, Joellen M.; Cheng, Jin Q.; Goode, Ellen L.; Sellers, Thomas A.

2016-01-01

RNA editing in mammals is a form of post-transcriptional modification in which adenosine is converted to inosine by the adenosine deaminases acting on RNA (ADAR) family of enzymes. Based on evidence of altered ADAR expression in epithelial ovarian cancers (EOC), we hypothesized that single nucleotide polymorphisms (SNPs) in ADAR genes modify EOC susceptibility, potentially by altering ovarian tissue gene expression. Using directly genotyped and imputed data from 10,891 invasive EOC cases and 21,693 controls, we evaluated the associations of 5,303 SNPs in ADAD1, ADAR, ADAR2, ADAR3, and SND1. Unconditional logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CI), with adjustment for European ancestry. We conducted gene-level analyses using the Admixture Maximum Likelihood (AML) test and the Sequence-Kernel Association test for common and rare variants (SKAT-CR). Association analysis revealed top risk-associated SNP rs77027562 (OR (95% CI)= 1.39 (1.17-1.64), P=1.0×10−4) in ADAR3 and rs185455523 in SND1 (OR (95% CI)= 0.68 (0.56-0.83), P=2.0×10−4). When restricting to serous histology (n=6,500), the magnitude of association strengthened for rs185455523 (OR=0.60, P=1.0×10−4). Gene-level analyses revealed that variation in ADAR was associated (P<0.05) with EOC susceptibility, with PAML=0.022 and PSKAT-CR=0.020. Expression quantitative trait locus analysis in EOC tissue revealed significant associations (P<0.05) with ADAR expression for several SNPs in ADAR, including rs1127313 (G/A), a SNP in the 3′ untranslated region. In summary, germline variation involving RNA editing genes may influence EOC susceptibility, warranting further investigation of inherited and acquired alterations affecting RNA editing. PMID:27911851

Characterization of Human Disease Phenotypes Associated with Mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR, and IFIH1

PubMed Central

Crow, Yanick J.; Chase, Diana S.; Schmidt, Johanna Lowenstein; Szynkiewicz, Marcin; Forte, Gabriella M.A.; Gornall, Hannah L.; Oojageer, Anthony; Anderson, Beverley; Pizzino, Amy; Helman, Guy; Abdel-Hamid, Mohamed S.; Abdel-Salam, Ghada M.; Ackroyd, Sam; Aeby, Alec; Agosta, Guillermo; Albin, Catherine; Allon-Shalev, Stavit; Arellano, Montse; Ariaudo, Giada; Aswani, Vijay; Babul-Hirji, Riyana; Baildam, Eileen M.; Bahi-Buisson, Nadia; Bailey, Kathryn M.; Barnerias, Christine; Barth, Magalie; Battini, Roberta; Beresford, Michael W.; Bernard, Geneviève; Bianchi, Marika; de Villemeur, Thierry Billette; Blair, Edward M.; Bloom, Miriam; Burlina, Alberto B.; Carpanelli, Maria Luisa; Carvalho, Daniel R.; Castro-Gago, Manuel; Cavallini, Anna; Cereda, Cristina; Chandler, Kate E.; Chitayat, David A.; Collins, Abigail E.; Corcoles, Concepcion Sierra; Cordeiro, Nuno J.V.; Crichiutti, Giovanni; Dabydeen, Lyvia; Dale, Russell C.; D’Arrigo, Stefano; De Goede, Christian G.E.L.; De Laet, Corinne; De Waele, Liesbeth M.H.; Denzler, Ines; Desguerre, Isabelle; Devriendt, Koenraad; Di Rocco, Maja; Fahey, Michael C.; Fazzi, Elisa; Ferrie, Colin D.; Figueiredo, António; Gener, Blanca; Goizet, Cyril; Gowrinathan, Nirmala R.; Gowrishankar, Kalpana; Hanrahan, Donncha; Isidor, Bertrand; Kara, Bülent; Khan, Nasaim; King, Mary D.; Kirk, Edwin P.; Kumar, Ram; Lagae, Lieven; Landrieu, Pierre; Lauffer, Heinz; Laugel, Vincent; La Piana, Roberta; Lim, Ming J.; Lin, Jean-Pierre S.-M.; Linnankivi, Tarja; Mackay, Mark T.; Marom, Daphna R.; Lourenço, Charles Marques; McKee, Shane A.; Moroni, Isabella; Morton, Jenny E.V.; Moutard, Marie-Laure; Murray, Kevin; Nabbout, Rima; Nampoothiri, Sheela; Nunez-Enamorado, Noemi; Oades, Patrick J.; Olivieri, Ivana; Ostergaard, John R.; Pérez-Dueñas, Belén; Prendiville, Julie S.; Ramesh, Venkateswaran; Rasmussen, Magnhild; Régal, Luc; Ricci, Federica; Rio, Marlène; Rodriguez, Diana; Roubertie, Agathe; Salvatici, Elisabetta; Segers, Karin A.; Sinha, Gyanranjan P.; Soler, Doriette; Spiegel, Ronen; Stödberg, Tommy I.; Straussberg, Rachel; Swoboda, Kathryn J.; Suri, Mohnish; Tacke, Uta; Tan, Tiong Y.; Naude, Johann te Water; Teik, Keng Wee; Thomas, Maya Mary; Till, Marianne; Tonduti, Davide; Valente, Enza Maria; Van Coster, Rudy Noel; van der Knaap, Marjo S.; Vassallo, Grace; Vijzelaar, Raymon; Vogt, Julie; Wallace, Geoffrey B.; Wassmer, Evangeline; Webb, Hannah J.; Whitehouse, William P.; Whitney, Robyn N.; Zaki, Maha S.; Zuberi, Sameer M.; Livingston, John H.; Rozenberg, Flore; Lebon, Pierre; Vanderver, Adeline; Orcesi, Simona; Rice, Gillian I.

2015-01-01

Aicardi–Goutières syndrome is an inflammatory disease occurring due to mutations in any of TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR or IFIH1. We report on 374 patients from 299 families with mutations in these seven genes. Most patients conformed to one of two fairly stereotyped clinical profiles; either exhibiting an in utero disease-onset (74 patients; 22.8% of all patients where data were available), or a post-natal presentation, usually within the first year of life (223 patients; 68.6%), characterized by a sub-acute encephalopathy and a loss of previously acquired skills. Other clinically distinct phenotypes were also observed; particularly, bilateral striatal necrosis (13 patients; 3.6%) and non-syndromic spastic paraparesis (12 patients; 3.4%). We recorded 69 deaths (19.3% of patients with follow-up data). Of 285 patients for whom data were available, 210 (73.7%) were profoundly disabled, with no useful motor, speech and intellectual function. Chilblains, glaucoma, hypothyroidism, cardiomyopathy, intracerebral vasculitis, peripheral neuropathy, bowel inflammation and systemic lupus erythematosus were seen frequently enough to be confirmed as real associations with the Aicardi-Goutieres syndrome phenotype. We observed a robust relationship between mutations in all seven genes with increased type I interferon activity in cerebrospinal fluid and serum, and the increased expression of interferon-stimulated gene transcripts in peripheral blood. We recorded a positive correlation between the level of cerebrospinal fluid interferon activity assayed within one year of disease presentation and the degree of subsequent disability. Interferon-stimulated gene transcripts remained high in most patients, indicating an ongoing disease process. On the basis of substantial morbidity and mortality, our data highlight the urgent need to define coherent treatment strategies for the phenotypes associated with mutations in the Aicardi–Goutières syndrome

Extra Double-stranded RNA Binding Domain (dsRBD) in a Squid RNA Editing Enzyme Confers Resistance to High Salt Environment*

PubMed Central

Palavicini, Juan Pablo; Correa-Rojas, Rodrigo A.; Rosenthal, Joshua J. C.

2012-01-01

A-to-I RNA editing is particularly common in coding regions of squid mRNAs. Previously, we isolated a squid editing enzyme (sqADAR2) that shows a unique structural feature when compared with other ADAR2 family members: an additional double-stranded RNA (dsRNA) binding domain (dsRBD). Alternative splicing includes or excludes this motif, generating a novel or a conventional variant termed sqADAR2a and sqADAR2b, respectively. The extra dsRBD of sqADAR2a increases its editing activity in vitro. We hypothesized that the high activity is due to an increase in the affinity of the enzyme for dsRNA. This may be important because protein-RNA interactions can be influenced by physical factors. We became particularly interested in analyzing the effects of salt on interactions between sqADAR2 and RNA because squid cells have a ∼3-fold higher ionic strength and proportionally more Cl− than vertebrate cells. To date, in vitro biochemical analyses of adenosine deamination have been conducted using vertebrate-like ionic strength buffers containing chloride as the major anion, although the vast majority of cellular anions are known to be organic. We found that squid-like salt conditions severely impair the binding affinity of conventional ADAR2s for dsRNA, leading to a decrease in nonspecific and site-specific editing activity. Inhibition of editing was mostly due to high Cl− levels and not to the high concentrations of K+, Na+, and organic anions like glutamate. Interestingly, the extra dsRBD in sqADAR2a conferred resistance to the high Cl− levels found in squid neurons. It does so by increasing the affinity of sqADAR2 for dsRNA by 30- or 100-fold in vertebrate-like or squid-like conditions, respectively. Site-directed mutagenesis of squid ADAR2a showed that its increased affinity and editing activity are directly attributable to the RNA binding activity of the extra dsRBD. PMID:22457361

AZIN1 RNA editing confers cancer stemness and enhances oncogenic potential in colorectal cancer.

PubMed

Shigeyasu, Kunitoshi; Okugawa, Yoshinaga; Toden, Shusuke; Miyoshi, Jinsei; Toiyama, Yuji; Nagasaka, Takeshi; Takahashi, Naoki; Kusunoki, Masato; Takayama, Tetsuji; Yamada, Yasuhide; Fujiwara, Toshiyoshi; Chen, Leilei; Goel, Ajay

2018-06-21

Adenosine-to-inosine (A-to-I) RNA editing, a process mediated by adenosine deaminases that act on the RNA (ADAR) gene family, is a recently discovered epigenetic modification dysregulated in human cancers. However, the clinical significance and the functional role of RNA editing in colorectal cancer (CRC) remain unclear. We have systematically and comprehensively investigated the significance of the expression status of ADAR1 and of the RNA editing levels of antizyme inhibitor 1 (AZIN1), one of the most frequently edited genes in cancers, in 392 colorectal tissues from multiple independent CRC patient cohorts. Both ADAR1 expression and AZIN1 RNA editing levels were significantly elevated in CRC tissues when compared with corresponding normal mucosa. High levels of AZIN1 RNA editing emerged as a prognostic factor for overall survival and disease-free survival and were an independent risk factor for lymph node and distant metastasis. Furthermore, elevated AZIN1 editing identified high-risk stage II CRC patients. Mechanistically, edited AZIN1 enhances stemness and appears to drive the metastatic processes. We have demonstrated that edited AZIN1 functions as an oncogene and a potential therapeutic target in CRC. Moreover, AZIN1 RNA editing status could be used as a clinically relevant prognostic indicator in CRC patients.

Characterization of human disease phenotypes associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR, and IFIH1.

PubMed

Crow, Yanick J; Chase, Diana S; Lowenstein Schmidt, Johanna; Szynkiewicz, Marcin; Forte, Gabriella M A; Gornall, Hannah L; Oojageer, Anthony; Anderson, Beverley; Pizzino, Amy; Helman, Guy; Abdel-Hamid, Mohamed S; Abdel-Salam, Ghada M; Ackroyd, Sam; Aeby, Alec; Agosta, Guillermo; Albin, Catherine; Allon-Shalev, Stavit; Arellano, Montse; Ariaudo, Giada; Aswani, Vijay; Babul-Hirji, Riyana; Baildam, Eileen M; Bahi-Buisson, Nadia; Bailey, Kathryn M; Barnerias, Christine; Barth, Magalie; Battini, Roberta; Beresford, Michael W; Bernard, Geneviève; Bianchi, Marika; Billette de Villemeur, Thierry; Blair, Edward M; Bloom, Miriam; Burlina, Alberto B; Carpanelli, Maria Luisa; Carvalho, Daniel R; Castro-Gago, Manuel; Cavallini, Anna; Cereda, Cristina; Chandler, Kate E; Chitayat, David A; Collins, Abigail E; Sierra Corcoles, Concepcion; Cordeiro, Nuno J V; Crichiutti, Giovanni; Dabydeen, Lyvia; Dale, Russell C; D'Arrigo, Stefano; De Goede, Christian G E L; De Laet, Corinne; De Waele, Liesbeth M H; Denzler, Ines; Desguerre, Isabelle; Devriendt, Koenraad; Di Rocco, Maja; Fahey, Michael C; Fazzi, Elisa; Ferrie, Colin D; Figueiredo, António; Gener, Blanca; Goizet, Cyril; Gowrinathan, Nirmala R; Gowrishankar, Kalpana; Hanrahan, Donncha; Isidor, Bertrand; Kara, Bülent; Khan, Nasaim; King, Mary D; Kirk, Edwin P; Kumar, Ram; Lagae, Lieven; Landrieu, Pierre; Lauffer, Heinz; Laugel, Vincent; La Piana, Roberta; Lim, Ming J; Lin, Jean-Pierre S-M; Linnankivi, Tarja; Mackay, Mark T; Marom, Daphna R; Marques Lourenço, Charles; McKee, Shane A; Moroni, Isabella; Morton, Jenny E V; Moutard, Marie-Laure; Murray, Kevin; Nabbout, Rima; Nampoothiri, Sheela; Nunez-Enamorado, Noemi; Oades, Patrick J; Olivieri, Ivana; Ostergaard, John R; Pérez-Dueñas, Belén; Prendiville, Julie S; Ramesh, Venkateswaran; Rasmussen, Magnhild; Régal, Luc; Ricci, Federica; Rio, Marlène; Rodriguez, Diana; Roubertie, Agathe; Salvatici, Elisabetta; Segers, Karin A; Sinha, Gyanranjan P; Soler, Doriette; Spiegel, Ronen; Stödberg, Tommy I; Straussberg, Rachel; Swoboda, Kathryn J; Suri, Mohnish; Tacke, Uta; Tan, Tiong Y; te Water Naude, Johann; Wee Teik, Keng; Thomas, Maya Mary; Till, Marianne; Tonduti, Davide; Valente, Enza Maria; Van Coster, Rudy Noel; van der Knaap, Marjo S; Vassallo, Grace; Vijzelaar, Raymon; Vogt, Julie; Wallace, Geoffrey B; Wassmer, Evangeline; Webb, Hannah J; Whitehouse, William P; Whitney, Robyn N; Zaki, Maha S; Zuberi, Sameer M; Livingston, John H; Rozenberg, Flore; Lebon, Pierre; Vanderver, Adeline; Orcesi, Simona; Rice, Gillian I

2015-02-01

Aicardi-Goutières syndrome is an inflammatory disease occurring due to mutations in any of TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR or IFIH1. We report on 374 patients from 299 families with mutations in these seven genes. Most patients conformed to one of two fairly stereotyped clinical profiles; either exhibiting an in utero disease-onset (74 patients; 22.8% of all patients where data were available), or a post-natal presentation, usually within the first year of life (223 patients; 68.6%), characterized by a sub-acute encephalopathy and a loss of previously acquired skills. Other clinically distinct phenotypes were also observed; particularly, bilateral striatal necrosis (13 patients; 3.6%) and non-syndromic spastic paraparesis (12 patients; 3.4%). We recorded 69 deaths (19.3% of patients with follow-up data). Of 285 patients for whom data were available, 210 (73.7%) were profoundly disabled, with no useful motor, speech and intellectual function. Chilblains, glaucoma, hypothyroidism, cardiomyopathy, intracerebral vasculitis, peripheral neuropathy, bowel inflammation and systemic lupus erythematosus were seen frequently enough to be confirmed as real associations with the Aicardi-Goutieres syndrome phenotype. We observed a robust relationship between mutations in all seven genes with increased type I interferon activity in cerebrospinal fluid and serum, and the increased expression of interferon-stimulated gene transcripts in peripheral blood. We recorded a positive correlation between the level of cerebrospinal fluid interferon activity assayed within one year of disease presentation and the degree of subsequent disability. Interferon-stimulated gene transcripts remained high in most patients, indicating an ongoing disease process. On the basis of substantial morbidity and mortality, our data highlight the urgent need to define coherent treatment strategies for the phenotypes associated with mutations in the Aicardi-Goutières syndrome-related genes

RNA editing is induced by type I interferon in esophageal squamous cell carcinoma.

PubMed

Zhang, Jinyao; Chen, Zhaoli; Tang, Zefang; Huang, Jianbing; Hu, Xueda; He, Jie

2017-07-01

In recent years, abnormal RNA editing has been shown to play an important role in the development of esophageal squamous cell carcinoma, as such abnormal editing is catalyzed by ADAR (adenosine deaminases acting on RNA). However, the regulatory mechanism of ADAR1 in esophageal squamous cell carcinomas remains largely unknown. In this study, we investigated ADAR1 expression and its association with RNA editing in esophageal squamous cell carcinomas. RNA sequencing applied to esophageal squamous cell carcinoma clinical samples showed that ADAR1 expression was correlated with the expression of STAT1, STAT2, and IRF9. In vitro experiments showed that the abundance of ADAR1 protein was associated with the induced activation of the JAK/STAT pathway by type I interferon. RNA sequencing results showed that treatment with type I interferon caused an increase in the number and degree of RNA editing in esophageal squamous cell carcinoma cell lines. In conclusion, the activation of the JAK/STAT pathway is a regulatory mechanism of ADAR1 expression and causes abnormal RNA editing profile in esophageal squamous cell carcinoma. This mechanism may serve as a new target for esophageal squamous cell carcinoma therapy.

Dynamic landscape and regulation of RNA editing in mammals

PubMed Central

Tan, Meng How; Li, Qin; Shanmugam, Raghuvaran; Piskol, Robert; Kohler, Jennefer; Young, Amy N.; Liu, Kaiwen Ivy; Zhang, Rui; Ramaswami, Gokul; Ariyoshi, Kentaro; Gupte, Ankita; Keegan, Liam P.; George, Cyril X.; Ramu, Avinash; Huang, Ni; Pollina, Elizabeth A.; Leeman, Dena S.; Rustighi, Alessandra; Sharon Goh, Y. P.; Chawla, Ajay; Del Sal, Giannino; Peltz, Gary; Brunet, Anne; Conrad, Donald F.; Samuel, Charles E.; O’Connell, Mary A.; Walkley, Carl R.; Nishikura, Kazuko; Li, Jin Billy

2017-01-01

Adenosine-to-inosine (A-to-I) RNA editing is a conserved post-transcriptional mechanism mediated by ADAR enzymes that diversifies the transcriptome by altering selected nucleotides in RNA molecules1. Although many editing sites have recently been discovered2–7, the extent to which most sites are edited and how the editing is regulated in different biological contexts are not fully understood8–10. Here we report dynamic spatiotemporal patterns and new regulators of RNA editing, discovered through an extensive profiling of A-to-I RNA editing in 8,551 human samples (representing 53 body sites from 552 individuals) from the Genotype-Tissue Expression (GTEx) project and in hundreds of other primate and mouse samples. We show that editing levels in non-repetitive coding regions vary more between tissues than editing levels in repetitive regions. Globally, ADAR1 is the primary editor of repetitive sites and ADAR2 is the primary editor of non-repetitive coding sites, whereas the catalytically inactive ADAR3 predominantly acts as an inhibitor of editing. Cross-species analysis of RNA editing in several tissues revealed that species, rather than tissue type, is the primary determinant of editing levels, suggesting stronger cis-directed regulation of RNA editing for most sites, although the small set of conserved coding sites is under stronger trans-regulation. In addition, we curated an extensive set of ADAR1 and ADAR2 targets and showed that many editing sites display distinct tissue-specific regulation by the ADAR enzymes in vivo. Further analysis of the GTEx data revealed several potential regulators of editing, such as AIMP2, which reduces editing in muscles by enhancing the degradation of the ADAR proteins. Collectively, our work provides insights into the complex cis- and trans-regulation of A-to-I editing. PMID:29022589

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthews, Melissa M.; Thomas, Justin M.; Zheng, Yuxuan

Adenosine deaminases acting on RNA (ADARs) are editing enzymes that convert adenosine to inosine in duplex RNA, a modification reaction with wide-ranging consequences in RNA function. Understanding of the ADAR reaction mechanism, the origin of editing-site selectivity, and the effect of mutations is limited by the lack of high-resolution structural data for complexes of ADARs bound to substrate RNAs. In this paper, we describe four crystal structures of the human ADAR2 deaminase domain bound to RNA duplexes bearing a mimic of the deamination reaction intermediate. These structures, together with structure-guided mutagenesis and RNA-modification experiments, explain the basis of the ADARmore » deaminase domain's dsRNA specificity, its base-flipping mechanism, and its nearest-neighbor preferences. In addition, we identified an ADAR2-specific RNA-binding loop near the enzyme active site, thus rationalizing differences in selectivity observed between different ADARs. In conclusion, our results provide a structural framework for understanding the effects of ADAR mutations associated with human disease.« less

Dynamic landscape and regulation of RNA editing in mammals.

PubMed

Tan, Meng How; Li, Qin; Shanmugam, Raghuvaran; Piskol, Robert; Kohler, Jennefer; Young, Amy N; Liu, Kaiwen Ivy; Zhang, Rui; Ramaswami, Gokul; Ariyoshi, Kentaro; Gupte, Ankita; Keegan, Liam P; George, Cyril X; Ramu, Avinash; Huang, Ni; Pollina, Elizabeth A; Leeman, Dena S; Rustighi, Alessandra; Goh, Y P Sharon; Chawla, Ajay; Del Sal, Giannino; Peltz, Gary; Brunet, Anne; Conrad, Donald F; Samuel, Charles E; O'Connell, Mary A; Walkley, Carl R; Nishikura, Kazuko; Li, Jin Billy

2017-10-11

Adenosine-to-inosine (A-to-I) RNA editing is a conserved post-transcriptional mechanism mediated by ADAR enzymes that diversifies the transcriptome by altering selected nucleotides in RNA molecules. Although many editing sites have recently been discovered, the extent to which most sites are edited and how the editing is regulated in different biological contexts are not fully understood. Here we report dynamic spatiotemporal patterns and new regulators of RNA editing, discovered through an extensive profiling of A-to-I RNA editing in 8,551 human samples (representing 53 body sites from 552 individuals) from the Genotype-Tissue Expression (GTEx) project and in hundreds of other primate and mouse samples. We show that editing levels in non-repetitive coding regions vary more between tissues than editing levels in repetitive regions. Globally, ADAR1 is the primary editor of repetitive sites and ADAR2 is the primary editor of non-repetitive coding sites, whereas the catalytically inactive ADAR3 predominantly acts as an inhibitor of editing. Cross-species analysis of RNA editing in several tissues revealed that species, rather than tissue type, is the primary determinant of editing levels, suggesting stronger cis-directed regulation of RNA editing for most sites, although the small set of conserved coding sites is under stronger trans-regulation. In addition, we curated an extensive set of ADAR1 and ADAR2 targets and showed that many editing sites display distinct tissue-specific regulation by the ADAR enzymes in vivo. Further analysis of the GTEx data revealed several potential regulators of editing, such as AIMP2, which reduces editing in muscles by enhancing the degradation of the ADAR proteins. Collectively, our work provides insights into the complex cis- and trans-regulation of A-to-I editing.

Role of Host-Driven Mutagenesis in Determining Genome Evolution of Sigma Virus (DMelSV; Rhabdoviridae) in Drosophila melanogaster.

PubMed

Piontkivska, Helen; Matos, Luis F; Paul, Sinu; Scharfenberg, Brian; Farmerie, William G; Miyamoto, Michael M; Wayne, Marta L

2016-10-05

Sigma virus (DMelSV) is ubiquitous in natural populations of Drosophila melanogaster. Host-mediated, selective RNA editing of adenosines to inosines (ADAR) may contribute to control of viral infection by preventing transcripts from being transported into the cytoplasm or being translated accurately; or by increasing the viral genomic mutation rate. Previous PCR-based studies showed that ADAR mutations occur in DMelSV at low frequency. Here we use SOLiD TM deep sequencing of flies from a single host population from Athens, GA, USA to comprehensively evaluate patterns of sequence variation in DMelSV with respect to ADAR. GA dinucleotides, which are weak targets of ADAR, are strongly overrepresented in the positive strand of the virus, consistent with selection to generate ADAR resistance on this complement of the transient, double-stranded RNA intermediate in replication and transcription. Potential ADAR sites in a worldwide sample of viruses are more likely to be "resistant" if the sites do not vary among samples. Either variable sites are less constrained and hence are subject to weaker selection than conserved sites, or the variation is driven by ADAR. We also find evidence of mutations segregating within hosts, hereafter referred to as hypervariable sites. Some of these sites were variable only in one or two flies (i.e., rare); others were shared by four or even all five of the flies (i.e., common). Rare and common hypervariable sites were indistinguishable with respect to susceptibility to ADAR; however, polymorphism in rare sites were more likely to be consistent with the action of ADAR than in common ones, again suggesting that ADAR is deleterious to the virus. Thus, in DMelSV, host mutagenesis is constraining viral evolution both within and between hosts. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer.

PubMed

Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Nakajima, Miki

2017-03-24

Dihydrofolate reductase (DHFR) plays a key role in folate metabolism and is a target molecule of methotrexate. An increase in the cellular expression level of DHFR is one of the mechanisms of tumor resistance to methotrexate. The present study investigated the possibility that adenosine-to-inosine RNA editing, which causes nucleotide conversion by adenosine deaminase acting on RNA (ADAR) enzymes, might modulate DHFR expression. In human breast adenocarcinoma-derived MCF-7 cells, 26 RNA editing sites were identified in the 3'-UTR of DHFR. Knockdown of ADAR1 decreased the RNA editing levels of DHFR and resulted in a decrease in the DHFR mRNA and protein levels, indicating that ADAR1 up-regulates DHFR expression. Using a computational analysis, miR-25-3p and miR-125a-3p were predicted to bind to the non-edited 3'-UTR of DHFR but not to the edited sequence. The decrease in DHFR expression by the knockdown of ADAR1 was restored by transfection of antisense oligonucleotides for these miRNAs, suggesting that RNA editing mediated up-regulation of DHFR requires the function of these miRNAs. Interestingly, we observed that the knockdown of ADAR1 decreased cell viability and increased the sensitivity of MCF-7 cells to methotrexate. ADAR1 expression levels and the RNA editing levels in the 3'-UTR of DHFR in breast cancer tissues were higher than those in adjacent normal tissues. Collectively, the present study demonstrated that ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p and miR-125a-3p binding sites in the 3'-UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Absence of the Fragile X Mental Retardation Protein results in defects of RNA editing of neuronal mRNAs in mouse

PubMed Central

Filippini, Alice; Bonini, Daniela; Lacoux, Caroline; Zingariello, Maria; Sancillo, Laura; Bosisio, Daniela; Salvi, Valentina; Mingardi, Jessica; La Via, Luca; Zalfa, Francesca; Bagni, Claudia

2017-01-01

ABSTRACT The fragile X syndrome (FXS), the most common form of inherited intellectual disability, is due to the absence of FMRP, a protein regulating RNA metabolism. Recently, an unexpected function of FMRP in modulating the activity of Adenosine Deaminase Acting on RNA (ADAR) enzymes has been reported both in Drosophila and Zebrafish. ADARs are RNA-binding proteins that increase transcriptional complexity through a post-transcriptional mechanism called RNA editing. To evaluate the ADAR2-FMRP interaction in mammals we analyzed several RNA editing re-coding sites in the fmr1 knockout (KO) mice. Ex vivo and in vitro analysis revealed that absence of FMRP leads to an increase in the editing levels of brain specific mRNAs, indicating that FMRP might act as an inhibitor of editing activity. Proximity Ligation Assay (PLA) in mouse primary cortical neurons and in non-neuronal cells revealed that ADAR2 and FMRP co-localize in the nucleus. The ADAR2-FMRP co-localization was further observed by double-immunogold Electron Microscopy (EM) in the hippocampus. Moreover, ADAR2-FMRP interaction appeared to be RNA independent. Because changes in the editing pattern are associated with neuropsychiatric and neurodevelopmental disorders, we propose that the increased editing observed in the fmr1-KO mice might contribute to the FXS molecular phenotypes. PMID:28640668

Circulating type 1 vaccine-derived poliovirus may evolve under the pressure of adenosine deaminases acting on RNA.

PubMed

Liu, Yanhan; Ma, Tengfei; Liu, Jianzhu; Zhao, Xiaona; Cheng, Ziqiang; Guo, Huijun; Xu, Ruixue; Wang, Shujing

2015-01-01

Poliovirus, the causative agent of poliomyelitis, is a human enterovirus and member of the Picornaviridae family. An effective live-attenuated poliovirus vaccine strain (Sabin 1) has been developed and has protected humans from polio. However, a few cases of vaccine virulence reversion have been documented in several countries. For instance, circulating type 1 vaccine-derived poliovirus is a highly pathogenic poliovirus that evolved from an avirulent strain, but the mechanism by which vaccine strains undergo reversion remains unclear. In this study, vaccine strains exhibited A to G/U to C and G to A/C to U hypermutations in the reversed evolution of Sabin 1. Furthermore, the mutation ratios of U to C and C to U were higher than those of other mutation types. Dinucleotide editing context was then analyzed. Results showed that A to G and U to C mutations exhibited preferences similar to adenosine deaminases acting on RNA (ADAR). Hence, ADARs may participate in poliovirus vaccine evolution.

Tissue-selective restriction of RNA editing of CaV1.3 by splicing factor SRSF9.

PubMed

Huang, Hua; Kapeli, Katannya; Jin, Wenhao; Wong, Yuk Peng; Arumugam, Thiruma Valavan; Koh, Joanne Huifen; Srimasorn, Sumitra; Mallilankaraman, Karthik; Chua, John Jia En; Yeo, Gene W; Soong, Tuck Wah

2018-05-04

Adenosine DeAminases acting on RNA (ADAR) catalyzes adenosine-to-inosine (A-to-I) conversion within RNA duplex structures. While A-to-I editing is often dynamically regulated in a spatial-temporal manner, the mechanisms underlying its tissue-selective restriction remain elusive. We have previously reported that transcripts of voltage-gated calcium channel CaV1.3 are subject to brain-selective A-to-I RNA editing by ADAR2. Here, we show that editing of CaV1.3 mRNA is dependent on a 40 bp RNA duplex formed between exon 41 and an evolutionarily conserved editing site complementary sequence (ECS) located within the preceding intron. Heterologous expression of a mouse minigene that contained the ECS, intermediate intronic sequence and exon 41 with ADAR2 yielded robust editing. Interestingly, editing of CaV1.3 was potently inhibited by serine/arginine-rich splicing factor 9 (SRSF9). Mechanistically, the inhibitory effect of SRSF9 required direct RNA interaction. Selective down-regulation of SRSF9 in neurons provides a basis for the neuron-specific editing of CaV1.3 transcripts.

RNA Editing Modulates Human Hepatic Aryl Hydrocarbon Receptor Expression by Creating MicroRNA Recognition Sequence.

PubMed

Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Takamiya, Masataka; Aoki, Yasuhiro; Nakajima, Miki

2016-01-08

Adenosine to inosine (A-to-I) RNA editing is the most frequent type of post-transcriptional nucleotide conversion in humans, and it is catalyzed by adenosine deaminase acting on RNA (ADAR) enzymes. In this study we investigated the effect of RNA editing on human aryl hydrocarbon receptor (AhR) expression because the AhR transcript potentially forms double-stranded structures, which are targets of ADAR enzymes. In human hepatocellular carcinoma-derived Huh-7 cells, the ADAR1 knockdown reduced the RNA editing levels in the 3'-untranslated region (3'-UTR) of the AhR transcript and increased the AhR protein levels. The ADAR1 knockdown enhanced the ligand-mediated induction of CYP1A1, a gene downstream of AhR. We investigated the possibility that A-to-I RNA editing creates miRNA targeting sites in the AhR mRNA and found that the miR-378-dependent down-regulation of AhR was abolished by ADAR1 knockdown. These results indicated that the ADAR1-mediated down-regulation of AhR could be attributed to the creation of a miR-378 recognition site in the AhR 3'-UTR. The interindividual differences in the RNA editing levels within the AhR 3'-UTR in a panel of 32 human liver samples were relatively small, whereas the differences in ADAR1 expression were large (220-fold). In the human liver samples a significant inverse association was observed between the miR-378 and AhR protein levels, suggesting that the RNA-editing-dependent down-regulation of AhR by miR-378 contributes to the variability in the constitutive hepatic expression of AhR. In conclusion, this study uncovered for the first time that A-to-I RNA editing modulates the potency of xenobiotic metabolism in the human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Dynamic hyper-editing underlies temperature adaptation in Drosophila

PubMed Central

Ashwal-Fluss, Reut; Pandey, Varun; Levanon, Erez Y.; Kadener, Sebastian

2017-01-01

In Drosophila, A-to-I editing is prevalent in the brain, and mutations in the editing enzyme ADAR correlate with specific behavioral defects. Here we demonstrate a role for ADAR in behavioral temperature adaptation in Drosophila. Although there is a higher level of editing at lower temperatures, at 29°C more sites are edited. These sites are less evolutionarily conserved, more disperse, less likely to be involved in secondary structures, and more likely to be located in exons. Interestingly, hypomorph mutants for ADAR display a weaker transcriptional response to temperature changes than wild-type flies and a highly abnormal behavioral response upon temperature increase. In sum, our data shows that ADAR is essential for proper temperature adaptation, a key behavior trait that is essential for survival of flies in the wild. Moreover, our results suggest a more general role of ADAR in regulating RNA secondary structures in vivo. PMID:28746393

A to I editing in disease is not fake news.

PubMed

Bajad, Prajakta; Jantsch, Michael F; Keegan, Liam; O'Connell, Mary

2017-09-02

Adenosine deaminases acting on RNA (ADARs) are zinc-containing enzymes that deaminate adenosine bases to inosines within dsRNA regions in transcripts. In short, structured dsRNA hairpins individual adenosine bases may be targeted specifically and edited with up to one hundred percent efficiency, leading to the production of alternative protein variants. However, the majority of editing events occur within longer stretches of dsRNA formed by pairing of repetitive sequences. Here, many different adenosine bases are potential targets but editing efficiency is usually much lower. Recent work shows that ADAR-mediated RNA editing is also required to prevent aberrant activation of antiviral innate immune sensors that detect viral dsRNA in the cytoplasm. Missense mutations in the ADAR1 RNA editing enzyme cause a fatal auto-inflammatory disease, Aicardi-Goutières syndrome (AGS) in affected children. In addition RNA editing by ADARs has been observed to increase in many cancers and also can contribute to vascular disease. Thus the role of RNA editing in the progression of various diseases can no longer be ignored. The ability of ADARs to alter the sequence of RNAs has also been used to artificially target model RNAs in vitro and in cells for RNA editing. Potentially this approach may be used to repair genetic defects and to alter genetic information at the RNA level. In this review we focus on the role of ADARs in disease development and progression and on their potential use to artificially modify RNAs in a targeted manner.

Auto-Regulatory RNA Editing Fine-Tunes mRNA Re-Coding and Complex Behaviour in Drosophila

PubMed Central

Savva, Yiannis A.; Jepson, James E.C; Sahin, Asli; Sugden, Arthur U.; Dorsky, Jacquelyn S.; Alpert, Lauren; Lawrence, Charles; Reenan, Robert A.

2014-01-01

Auto-regulatory feedback loops are a common molecular strategy used to optimize protein function. In Drosophila many mRNAs involved in neuro-transmission are re-coded at the RNA level by the RNA editing enzyme dADAR, leading to the incorporation of amino acids that are not directly encoded by the genome. dADAR also re-codes its own transcript, but the consequences of this auto-regulation in vivo are unclear. Here we show that hard-wiring or abolishing endogenous dADAR auto-regulation dramatically remodels the landscape of re-coding events in a site-specific manner. These molecular phenotypes correlate with altered localization of dADAR within the nuclear compartment. Furthermore, auto-editing exhibits sexually dimorphic patterns of spatial regulation and can be modified by abiotic environmental factors. Finally, we demonstrate that modifying dAdar auto-editing affects adaptive complex behaviors. Our results reveal the in vivo relevance of auto-regulatory control over post-transcriptional mRNA re-coding events in fine-tuning brain function and organismal behavior. PMID:22531175

77 FR 26048 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978 (Pub. L. 95-541)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-02

...--Cape Adare; ASPA 160--Cape Geology; and, ASPA 171--Narebski Point. Access to these sites will be on an... Shirreff; ASPA 150--Ardley Island; ASPA 158--Cape Adare; ASPA 160--Cape Geology; and, ASPA 171-- Narebski...

Bidirectional regulation of adenosine-to-inosine (A-to-I) RNA editing by DEAH box helicase 9 (DHX9) in cancer.

PubMed

Hong, HuiQi; An, Omer; Chan, Tim H M; Ng, Vanessa H E; Kwok, Hui Si; Lin, Jaymie S; Qi, Lihua; Han, Jian; Tay, Daryl J T; Tang, Sze Jing; Yang, Henry; Song, Yangyang; Bellido Molias, Fernando; Tenen, Daniel G; Chen, Leilei

2018-05-18

Adenosine-to-inosine (A-to-I) RNA editing entails the enzymatic deamination of adenosines to inosines by adenosine deaminases acting on RNA (ADARs). Dysregulated A-to-I editing has been implicated in various diseases, including cancers. However, the precise factors governing the A-to-I editing and their physiopathological implications remain as a long-standing question. Herein, we unravel that DEAH box helicase 9 (DHX9), at least partially dependent of its helicase activity, functions as a bidirectional regulator of A-to-I editing in cancer cells. Intriguingly, the ADAR substrate specificity determines the opposing effects of DHX9 on editing as DHX9 silencing preferentially represses editing of ADAR1-specific substrates, whereas augments ADAR2-specific substrate editing. Analysis of 11 cancer types from The Cancer Genome Atlas (TCGA) reveals a striking overexpression of DHX9 in tumors. Further, tumorigenicity studies demonstrate a helicase-dependent oncogenic role of DHX9 in cancer development. In sum, DHX9 constitutes a bidirectional regulatory mode in A-to-I editing, which is in part responsible for the dysregulated editome profile in cancer.

Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations

PubMed Central

Pfaller, Christian K.; Mastorakos, George M.; Matchett, William E.; Ma, Xiao; Samuel, Charles E.

2015-01-01

ABSTRACT Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. IMPORTANCE Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and

Oligophrenin-1 (OPHN1), a Gene Involved in X-Linked Intellectual Disability, Undergoes RNA Editing and Alternative Splicing during Human Brain Development

PubMed Central

Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela

2014-01-01

Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development. PMID:24637888

Oligophrenin-1 (OPHN1), a gene involved in X-linked intellectual disability, undergoes RNA editing and alternative splicing during human brain development.

PubMed

Barresi, Sabina; Tomaselli, Sara; Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela

2014-01-01

Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development.

Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations.

PubMed

Pfaller, Christian K; Mastorakos, George M; Matchett, William E; Ma, Xiao; Samuel, Charles E; Cattaneo, Roberto

2015-08-01

Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and other infectious

RNA editing in Drosophila melanogaster: new targets and functionalconsequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stapleton, Mark; Carlson, Joseph W.; Celniker, Susan E.

2006-09-05

Adenosine deaminases that act on RNA (ADARs) catalyze the site-specific conversion of adenosine to inosine in primary mRNA transcripts. These re-coding events affect coding potential, splice-sites, and stability of mature mRNAs. ADAR is an essential gene and studies in mouse, C. elegans, and Drosophila suggest its primary function is to modify adult behavior by altering signaling components in the nervous system. By comparing the sequence of isogenic cDNAs to genomic DNA, we have identified and experimentally verified 27 new targets of Drosophila ADAR. Our analyses lead us to identify new classes of genes whose transcripts are targets of ADAR includingmore » components of the actin cytoskeleton, and genes involved in ion homeostasis and signal transduction. Our results indicate that editing in Drosophila increases the diversity of the proteome, and does so in a manner that has direct functional consequences on protein function.« less

Alternative Splicing of STAT3 Is Affected by RNA Editing.

PubMed

Goldberg, Lior; Abutbul-Amitai, Mor; Paret, Gideon; Nevo-Caspi, Yael

2017-05-01

A-to-I RNA editing, carried out by adenosine deaminase acting on RNA (ADAR) enzymes, is an epigenetic phenomenon of posttranscriptional modifications on pre-mRNA. RNA editing in intronic sequences may influence alternative splicing of flanking exons. We have previously shown that conditions that induce editing result in elevated expression of signal transducer and activator of transcription 3 (STAT3), preferentially the alternatively-spliced STAT3β isoform. Mechanisms regulating alternative splicing of STAT3 have not been elucidated. STAT3 undergoes A-to-I RNA editing in an intron residing in proximity to the alternatively spliced exon. We hypothesized that RNA editing plays a role in regulating alternative splicing toward STAT3β. In this study we extend our observation connecting RNA editing to the preferential induction of STAT3β expression. We study the involvement of ADAR1 in STAT3 editing and reveal the connection between editing and alternative splicing of STAT3. Deferoaxamine treatment caused the induction in STAT3 RNA editing and STAT3β expression. Silencing ADAR1 caused a decrease in STAT3 editing and expression with a preferential decrease in STAT3β. Cells transfected with a mutated minigene showed preferential splicing toward the STAT3β transcript. Editing in the STAT3 intron is performed by ADAR1 and affects STAT3 alternative splicing. These results suggest that RNA editing is one of the molecular mechanisms regulating the expression of STAT3β.

Intramolecular Aza-Diels-Alder Reactions of ortho-Quinone Methide Imines: Rapid, Catalytic, and Enantioselective Assembly of Benzannulated Quinolizidines.

PubMed

Kretzschmar, Martin; Hofmann, Fabian; Moock, Daniel; Schneider, Christoph

2018-04-16

Aza-Diels-Alder reactions (ADARs) are powerful processes that furnish N-heterocycles in a straightforward fashion. Intramolecular variants offer the additional possibility of generating bi- and polycyclic systems with high stereoselectivity. We report herein a novel Brønsted acid catalyzed process in which ortho-quinone methide imines tethered to the dienophile via the N substituent react in an intramolecular ADAR to form complex quinolizidines and oxazinoquinolines in a one-step process. The reactions proceed under very mild conditions, with very good yields and good to very good diastereo- and enantioselectivities. Furthermore, the process was extended to a domino reaction that efficiently combines substrate synthesis, ortho-quinone methide imine formation, and ADAR. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Left-handed Z-DNA: structure and function

NASA Technical Reports Server (NTRS)

Herbert, A.; Rich, A.

1999-01-01

Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Hepatitis D virus RNA editing is inhibited by a GFP fusion protein containing a C-terminally deleted delta antigen.

PubMed

Shih, Ko-Nien; Chuang, Ya-Ting; Liu, Hsuan; Lo, Szecheng J

2004-04-01

During its life cycle, hepatitis D virus (HDV) produces two forms of delta antigen (HDAg), small delta antigen (SDAg) and large delta antigen (LDAg), which differ in their C-terminal 19 amino acids. Host enzymes termed ADARs (adenosine deaminases that act on double-stranded RNA) are required for LDAg production. These enzymes change the stop codon (UAG) of SDAg to a tryptophan codon (UGG). However, the temporal and spatial regulation of HDV RNA editing is largely unknown. In this study, we constructed three GFP fusion proteins containing different lengths of SDAg and characterized their cellular localization and effects on HDV replication. One of these fusion proteins, designated D(1-88)-GFP, inhibited LDAg but not SDAg production, suggesting that D(1-88)-GFP inhibits HDV RNA editing. Two experiments further supported this supposition: (i). RT-PCR analysis combined with NcoI restriction enzyme digestion revealed that HDV RNA editing was reduced by 42% in HeLa-D(1-88)-GFP when compared with HeLa cells; and (ii). the ratio of SDAg/LDAg production from the reporter RNAs was reduced in cells co-transfected with ADAR-expressing and reporter plasmids in the presence of D(1-88)-GFP. Double fluorescence microscopy found that D(1-88)-GFP was either associated with SC-35 or was adjacent to PML (premyelocytic leukaemia antigen) at nuclear speckles, but D(1-88)-GFP was not co-localized with ADAR, which was mainly located in the nucleolus. In situ hybridization showing co-localization of HDV RNA with D(1-88)-GFP at nuclear speckles suggested that HDV RNA editing might occur in the nuclear speckles and require other nuclear factor(s), in addition to ADAR.

LINE1 contributes to autoimmunity through both RIG-I- and MDA5-mediated RNA sensing pathways.

PubMed

Zhao, Ke; Du, Juan; Peng, Yanfeng; Li, Peng; Wang, Shaohua; Wang, Yu; Hou, Jingwei; Kang, Jian; Zheng, Wenwen; Hua, Shucheng; Yu, Xiao-Fang

2018-06-01

Improper host immune activation leads to the development of the autoimmune disease Aicardi-Goutières syndrome (AGS), which is attributed to defined genetic mutations in such proteins as TREX1 and ADAR1. The mechanism of immune activation in AGS patients has not been thoroughly elucidated to date. In this study, we report that endogenous LINE1 components trigger IFNβ production in multiple human cell types, including those defective for cGAS/STING-mediated DNA sensing. In these cells, LINE1 DNA synthesis and retrotransposition were not required for LINE1-triggered immune activation, but RNA sensing pathways were essential. LINE1-triggered immune activation could be suppressed by diverse LINE1 inhibitors, including AGS-associated proteins targeting LINE1 RNA or proteins. However, AGS-associated ADAR1 or TREX1 mutants were defective in suppressing LINE1 retrotransposition or LINE1-triggered immune activation. Therefore, we have revealed a new function for LINE1 as an endogenous trigger of innate immune activation, which is important for understanding the molecular basis of IFN-based autoimmune diseases and may offer new intervention strategies. Copyright © 2018 Elsevier Ltd. All rights reserved.

Assessment of interferon-related biomarkers in Aicardi-Goutières syndrome associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR: a case-control study.

PubMed

Rice, Gillian I; Forte, Gabriella M A; Szynkiewicz, Marcin; Chase, Diana S; Aeby, Alec; Abdel-Hamid, Mohamed S; Ackroyd, Sam; Allcock, Rebecca; Bailey, Kathryn M; Balottin, Umberto; Barnerias, Christine; Bernard, Genevieve; Bodemer, Christine; Botella, Maria P; Cereda, Cristina; Chandler, Kate E; Dabydeen, Lyvia; Dale, Russell C; De Laet, Corinne; De Goede, Christian G E L; Del Toro, Mireia; Effat, Laila; Enamorado, Noemi Nunez; Fazzi, Elisa; Gener, Blanca; Haldre, Madli; Lin, Jean-Pierre S-M; Livingston, John H; Lourenco, Charles Marques; Marques, Wilson; Oades, Patrick; Peterson, Pärt; Rasmussen, Magnhild; Roubertie, Agathe; Schmidt, Johanna Loewenstein; Shalev, Stavit A; Simon, Rogelio; Spiegel, Ronen; Swoboda, Kathryn J; Temtamy, Samia A; Vassallo, Grace; Vilain, Catheline N; Vogt, Julie; Wermenbol, Vanessa; Whitehouse, William P; Soler, Doriette; Olivieri, Ivana; Orcesi, Simona; Aglan, Mona S; Zaki, Maha S; Abdel-Salam, Ghada M H; Vanderver, Adeline; Kisand, Kai; Rozenberg, Flore; Lebon, Pierre; Crow, Yanick J

2013-12-01

Aicardi-Goutières syndrome (AGS) is an inflammatory disorder caused by mutations in any of six genes (TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR). The disease is severe and effective treatments are urgently needed. We investigated the status of interferon-related biomarkers in patients with AGS with a view to future use in diagnosis and clinical trials. In this case-control study, samples were collected prospectively from patients with mutation-proven AGS. The expression of six interferon-stimulated genes (ISGs) was measured by quantitative PCR, and the median fold change, when compared with the median of healthy controls, was used to create an interferon score for each patient. Scores higher than the mean of controls plus two SD (>2·466) were designated as positive. Additionally, we collated historical data for interferon activity, measured with a viral cytopathic assay, in CSF and serum from mutation-positive patients with AGS. We also undertook neutralisation assays of interferon activity in serum, and looked for the presence of autoantibodies against a panel of interferon proteins. 74 (90%) of 82 patients had a positive interferon score (median 12·90, IQR 6·14-20·41) compared with two (7%) of 29 controls (median 0·93, IQR 0·57-1·30). Of the eight patients with a negative interferon score, seven had mutations in RNASEH2B (seven [27%] of all 26 patients with mutations in this gene). Repeat sampling in 16 patients was consistent for the presence or absence of an interferon signature on 39 of 41 occasions. Interferon activity (tested in 147 patients) was negatively correlated with age (CSF, r=-0·604; serum, r=-0·289), and was higher in CSF than in serum in 104 of 136 paired samples. Neutralisation assays suggested that measurable antiviral activity was related to interferon α production. We did not record significantly increased concentrations of autoantibodies to interferon subtypes in patients with AGS, or an association between the presence

Assessment of interferon-related biomarkers in Aicardi-Goutières syndrome associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR: a case-control study

PubMed Central

Rice, Gillian I; Forte, Gabriella M A; Szynkiewicz, Marcin; Chase, Diana S; Aeby, Alec; Abdel-Hamid, Mohamed S; Ackroyd, Sam; Allcock, Rebecca; Bailey, Kathryn M; Balottin, Umberto; Barnerias, Christine; Bernard, Genevieve; Bodemer, Christine; Botella, Maria P; Cereda, Cristina; Chandler, Kate E; Dabydeen, Lyvia; Dale, Russell C; De Laet, Corinne; De Goede, Christian G E L; del Toro, Mireia; Effat, Laila; Enamorado, Noemi Nunez; Fazzi, Elisa; Gener, Blanca; Haldre, Madli; Lin, Jean-Pierre S-M; Livingston, John H; Lourenco, Charles Marques; Marques, Wilson; Oades, Patrick; Peterson, Pärt; Rasmussen, Magnhild; Roubertie, Agathe; Schmidt, Johanna Loewenstein; Shalev, Stavit A; Simon, Rogelio; Spiegel, Ronen; Swoboda, Kathryn J; Temtamy, Samia A; Vassallo, Grace; Vilain, Catheline N; Vogt, Julie; Wermenbol, Vanessa; Whitehouse, William P; Soler, Doriette; Olivieri, Ivana; Orcesi, Simona; Aglan, Mona S; Zaki, Maha S; Abdel-Salam, Ghada M H; Vanderver, Adeline; Kisand, Kai; Rozenberg, Flore; Lebon, Pierre; Crow, Yanick J

2015-01-01

Summary Background Aicardi-Goutières syndrome (AGS) is an inflammatory disorder caused by mutations in any of six genes (TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR). The disease is severe and effective treatments are urgently needed. We investigated the status of interferon-related biomarkers in patients with AGS with a view to future use in diagnosis and clinical trials. Methods In this case-control study, samples were collected prospectively from patients with mutation-proven AGS. The expression of six interferon-stimulated genes (ISGs) was measured by quantitative PCR, and the median fold change, when compared with the median of healthy controls, was used to create an interferon score for each patient. Scores higher than the mean of controls plus two SD (>2·466) were designated as positive. Additionally, we collated historical data for interferon activity, measured with a viral cytopathic assay, in CSF and serum from mutation-positive patients with AGS. We also undertook neutralisation assays of interferon activity in serum, and looked for the presence of autoantibodies against a panel of interferon proteins. Findings 74 (90%) of 82 patients had a positive interferon score (median 12·90, IQR 6·14–20·41) compared with two (7%) of 29 controls (median 0·93, IQR 0·57–1·30). Of the eight patients with a negative interferon score, seven had mutations in RNASEH2B (seven [27%] of all 26 patients with mutations in this gene). Repeat sampling in 16 patients was consistent for the presence or absence of an interferon signature on 39 of 41 occasions. Interferon activity (tested in 147 patients) was negatively correlated with age (CSF, r=−0·604; serum, r=−0·289), and was higher in CSF than in serum in 104 of 136 paired samples. Neutralisation assays suggested that measurable antiviral activity was related to interferon α production. We did not record significantly increased concentrations of autoantibodies to interferon subtypes in patients with

Conflict RNA modification, host-parasite co-evolution, and the origins of DNA and DNA-binding proteins1.

PubMed

McLaughlin, Paul J; Keegan, Liam P

2014-08-01

Nearly 150 different enzymatically modified forms of the four canonical residues in RNA have been identified. For instance, enzymes of the ADAR (adenosine deaminase acting on RNA) family convert adenosine residues into inosine in cellular dsRNAs. Recent findings show that DNA endonuclease V enzymes have undergone an evolutionary transition from cleaving 3' to deoxyinosine in DNA and ssDNA to cleaving 3' to inosine in dsRNA and ssRNA in humans. Recent work on dsRNA-binding domains of ADARs and other proteins also shows that a degree of sequence specificity is achieved by direct readout in the minor groove. However, the level of sequence specificity observed is much less than that of DNA major groove-binding helix-turn-helix proteins. We suggest that the evolution of DNA-binding proteins following the RNA to DNA genome transition represents the major advantage that DNA genomes have over RNA genomes. We propose that a hypothetical RNA modification, a RRAR (ribose reductase acting on genomic dsRNA) produced the first stretches of DNA in RNA genomes. We discuss why this is the most satisfactory explanation for the origin of DNA. The evolution of this RNA modification and later steps to DNA genomes are likely to have been driven by cellular genome co-evolution with viruses and intragenomic parasites. RNA modifications continue to be involved in host-virus conflicts; in vertebrates, edited cellular dsRNAs with inosine-uracil base pairs appear to be recognized as self RNA and to suppress activation of innate immune sensors that detect viral dsRNA.

Low Altitude AVIRIS Data for Mapping Landform Types on West Ship Island, Mississippi

NASA Technical Reports Server (NTRS)

Spruce, Joseph; Otvos, Ervin; Giardino, Marco

2002-01-01

A chain of barrier islands provides protection against hurricanes and severe storms along the south and southeastern shores of the United States. Barrier island landform types can be spectrally similar and as small as a few meters across, making highly detailed maps difficult to produce. To determine whether high-resolution airborne hyperspectral imagery could provide detailed maps of barrier island landform types, we used low-altitude hyperspectral and multispectral imagery to map surface environments of West Ship Island, Mississippi. We employed 3.4-meter AVIRIS hyperspectral imagery acquired in July 1999 and 0.5-meter ADAR multispectral data acquired in November 1997. The data were co-registered to digital ortho aerial imagery, and the AVIRIS data was scaled to ground reflectance using ATREM software. Unsupervised classification of AVIRIS and ADAR data proceeded using ISODATA clustering techniques. The resulting landform maps were field-checked and compared to aerial photography and digital elevation maps. Preliminary analyses indicated that the AVIRIS classification mapped more landform types, while the ADAR-based map enabled smaller patches to be identified. Used together, these maps provided a means to assess landform distributions of West Ship Island before and after Hurricane Gorges. Classification accuracy is being addressed through photo-interpretation and field surveys of sample areas selected with stratified random sampling.

Low Altitude AVIRIS Data for Mapping Landform Types on West Ship Island, Mississippi

NASA Technical Reports Server (NTRS)

Spruce, Joseph; Otvos, Ervin; Giardino, Marco

2003-01-01

A chain of barrier islands provides protection against hurricanes and severe storms along the southern and southeastern shores of the Unites States. Barrier island landform types can be spectrally similar and as small as a few meters across, making highly detailed maps difficult to produce. To determine whether high-resolution airborne hyperspectral imagery could provide detailed maps of barrier island landform types, we used low-altitude hyperspectral and multispectral imagery to map surface environments of West Ship Island, Mississippi. We employed 3.4 meter AVIRIS hyperspectral imagery acquired in July 1999 and 0.5 meter ADAR multispectral data acquired in November 1997. The data were co-registered to digital ortho aerial imagery, and the AVIRIS data was scaled to ground reflectance using ATREM software. Unsupervised classification of AVIRIS and ADAR data proceeded using ISODATA clustering techniques. The resulting landform maps were field-checked and compared to aerial photography and digital elevation maps. Preliminary analyses indicated that the AVIRIS classification mapped more landform types, while the ADAR-based map enabled smaller patches to be identified. Used together, these maps provided a means to assess landform distributions of West Ship Island before and after Hurricane Georges. Classification accuracy is being assessed through photo-interpretation and field surveys of sample areas selected with stratified random sampling.

An efficient system for selectively altering genetic information within mRNAs

PubMed Central

Montiel-González, Maria Fernanda; Vallecillo-Viejo, Isabel C.; Rosenthal, Joshua J. C.

2016-01-01

Site-directed RNA editing (SDRE) is a strategy to precisely alter genetic information within mRNAs. By linking the catalytic domain of the RNA editing enzyme ADAR to an antisense guide RNA, specific adenosines can be converted to inosines, biological mimics for guanosine. Previously, we showed that a genetically encoded iteration of SDRE could target adenosines expressed in human cells, but not efficiently. Here we developed a reporter assay to quantify editing, and used it to improve our strategy. By enhancing the linkage between ADAR's catalytic domain and the guide RNA, and by introducing a mutation in the catalytic domain, the efficiency of converting a UAG premature termination codon (PTC) to tryptophan (UGG) was improved from ∼11 % to ∼70 %. Other PTCs were edited, but less efficiently. Numerous off-target edits were identified in the targeted mRNA, but not in randomly selected endogenous messages. Off-target edits could be eliminated by reducing the amount of guide RNA with a reduction in on-target editing. The catalytic rate of SDRE was compared with those for human ADARs on various substrates and found to be within an order of magnitude of most. These data underscore the promise of site-directed RNA editing as a therapeutic or experimental tool. PMID:27557710

Cell type-specific in vivo expression of genes encoding signalling molecules in the brain in response to chronic mild stress and chronic treatment with fluoxetine.

PubMed

Dong, Lu; Li, Baoman; Verkhratsky, Alexei; Peng, Liang

2015-08-01

Previously, we reported that chronic treatment with fluoxetine increased gene expression of 5-hydroxytryptamine receptor 2B (5-HT2BR), cytosolic phospholipase 2α (cPLA2α), glutamate receptor, ionotropic kainate 2 (GluK2) and adenosine deaminase acting on RNA 2 (ADAR2), in cultured astrocytes and astrocytes freshly isolated from transgenic mice tagged with an astrocyte-specific marker. In contrast, neurones isolated from transgenic mice tagged with a neurone-specific marker and exposed to fluoxetine showed an increase in gene expression of glutamate receptor, ionotropic kainate 4 (GluK4) and 5-hydroxytryptamine receptor 2C (5-HT2CR). In a mouse model of anhedonia, the downregulation of 5-HT2BR, cPLA2α, ADAR2 and GluK4 but not GluK2 and 5-HT2CR was detected. To investigate the effects of chronic mild stress (CMS) and/or fluoxetine treatment on gene expression of 5-HT2BR, 5-HT2CR, cPLA2α, ADAR2, GluK2 and GluK4 specifically in astrocytes and neurones. Transgenic mice tagged with either astrocyte- or neurone-specific markers were exposed to the CMS. Real-time PCR was applied to determine expression of messenger RNA (mRNA). We found that (i) mRNAs of the 5-HT2BR and cPLA2α in astrocytes and GluK4 in neurones were significantly reduced in mice that became anhedonic; the mRNA levels were restored by fluoxetine treatment; (ii) ADAR2 in astrocytes was decreased by the CMS but showed no response to fluoxetine in anhedonic animals; (iii) neither GluK2 expression in astrocytes nor 5-HT2CR expression in neurones were affected in anhedonic animals, although expression of 5-HT2CR mRNA was upregulated by fluoxetine. Our results indicate that the effects of chronic treatment with fluoxetine are not only dependent on the cell type studied but also on the development of anhedonia. This suggests that fluoxetine may affect major depression (MD) patients and healthy people in a different manner.

Profiling RNA editing in human tissues: towards the inosinome Atlas

PubMed Central

Picardi, Ernesto; Manzari, Caterina; Mastropasqua, Francesca; Aiello, Italia; D’Erchia, Anna Maria; Pesole, Graziano

2015-01-01

Adenine to Inosine RNA editing is a widespread co- and post-transcriptional mechanism mediated by ADAR enzymes acting on double stranded RNA. It has a plethora of biological effects, appears to be particularly pervasive in humans with respect to other mammals, and is implicated in a number of diverse human pathologies. Here we present the first human inosinome atlas comprising 3,041,422 A-to-I events identified in six tissues from three healthy individuals. Matched directional total-RNA-Seq and whole genome sequence datasets were generated and analysed within a dedicated computational framework, also capable of detecting hyper-edited reads. Inosinome profiles are tissue specific and edited gene sets consistently show enrichment of genes involved in neurological disorders and cancer. Overall frequency of editing also varies, but is strongly correlated with ADAR expression levels. The inosinome database is available at: http://srv00.ibbe.cnr.it/editing/. PMID:26449202

Genome-wide identification and analysis of A-to-I RNA editing events in bovine by transcriptome sequencing

PubMed Central

Salehi, Abdolreza; Rivera, Rocío Melissa

2018-01-01

RNA editing increases the diversity of the transcriptome and proteome. Adenosine-to-inosine (A-to-I) editing is the predominant type of RNA editing in mammals and it is catalyzed by the adenosine deaminases acting on RNA (ADARs) family. Here, we used a largescale computational analysis of transcriptomic data from brain, heart, colon, lung, spleen, kidney, testes, skeletal muscle and liver, from three adult animals in order to identify RNA editing sites in bovine. We developed a computational pipeline and used a rigorous strategy to identify novel editing sites from RNA-Seq data in the absence of corresponding DNA sequence information. Our methods take into account sequencing errors, mapping bias, as well as biological replication to reduce the probability of obtaining a false-positive result. We conducted a detailed characterization of sequence and structural features related to novel candidate sites and found 1,600 novel canonical A-to-I editing sites in the nine bovine tissues analyzed. Results show that these sites 1) occur frequently in clusters and short interspersed nuclear elements (SINE) repeats, 2) have a preference for guanines depletion/enrichment in the flanking 5′/3′ nucleotide, 3) occur less often in coding sequences than other regions of the genome, and 4) have low evolutionary conservation. Further, we found that a positive correlation exists between expression of ADAR family members and tissue-specific RNA editing. Most of the genes with predicted A-to-I editing in each tissue were significantly enriched in biological terms relevant to the function of the corresponding tissue. Lastly, the results highlight the importance of the RNA editome in nervous system regulation. The present study extends the list of RNA editing sites in bovine and provides pipelines that may be used to investigate the editome in other organisms. PMID:29470549

RNA editing of SLC22A3 drives early tumor invasion and metastasis in familial esophageal cancer

PubMed Central

Fu, Li; Qin, Yan-Ru; Ming, Xiao-Yan; Zuo, Xian-Bo; Diao, Yu-Wen; Zhang, Li-Yi; Ai, Jiaoyu; Liu, Bei-Lei; Huang, Tu-Xiong; Cao, Ting-Ting; Tan, Bin-Bin; Xiang, Di; Zeng, Chui-Mian; Gong, Jing; Zhang, Qiangfeng; Dong, Sui-Sui; Chen, Juan; Liu, Haibo; Wu, Jian-Lin; Qi, Robert Z.; Xie, Dan; Wang, Li-Dong

2017-01-01

Like many complex human diseases, esophageal squamous cell carcinoma (ESCC) is known to cluster in families. Familial ESCC cases often show early onset and worse prognosis than the sporadic cases. However, the molecular genetic basis underlying the development of familial ESCC is mostly unknown. We reported that SLC22A3 is significantly down-regulated in nontumor esophageal tissues from patients with familial ESCC compared with tissues from patients with sporadic ESCCs. A-to-I RNA editing of the SLC22A3 gene results in its reduced expression in the nontumor esophageal tissues of familial ESCCs and is significantly correlated with lymph node metastasis. The RNA-editing enzyme ADAR2, a familial ESCC susceptibility gene identified by our post hoc genome-wide association study, is positively correlated with the editing level of SLC22A3. Moreover, functional studies showed that SLC22A3 is a metastasis suppressor in ESCC, and deregulation of SLC22A3 facilitates cell invasion and filopodia formation by reducing its direct association with α-actinin-4 (ACTN4), leading to the increased actin-binding activity of ACTN4 in normal esophageal cells. Collectively, we now show that A-to-I RNA editing of SLC22A3 contributes to the early development and progression of familial esophageal cancer in high-risk individuals. PMID:28533408

Genetic mapping uncovers cis-regulatory landscape of RNA editing.

PubMed

Ramaswami, Gokul; Deng, Patricia; Zhang, Rui; Anna Carbone, Mary; Mackay, Trudy F C; Li, Jin Billy

2015-09-16

Adenosine-to-inosine (A-to-I) RNA editing, catalysed by ADAR enzymes conserved in metazoans, plays an important role in neurological functions. Although the fine-tuning mechanism provided by A-to-I RNA editing is important, the underlying rules governing ADAR substrate recognition are not well understood. We apply a quantitative trait loci (QTL) mapping approach to identify genetic variants associated with variability in RNA editing. With very accurate measurement of RNA editing levels at 789 sites in 131 Drosophila melanogaster strains, here we identify 545 editing QTLs (edQTLs) associated with differences in RNA editing. We demonstrate that many edQTLs can act through changes in the local secondary structure for edited dsRNAs. Furthermore, we find that edQTLs located outside of the edited dsRNA duplex are enriched in secondary structure, suggesting that distal dsRNA structure beyond the editing site duplex affects RNA editing efficiency. Our work will facilitate the understanding of the cis-regulatory code of RNA editing.

Transcriptome-wide identification of A > I RNA editing sites by inosine specific cleavage

PubMed Central

Cattenoz, Pierre B.; Taft, Ryan J.; Westhof, Eric; Mattick, John S.

2013-01-01

Adenosine to inosine (A > I) RNA editing, which is catalyzed by the ADAR family of proteins, is one of the fundamental mechanisms by which transcriptomic diversity is generated. Indeed, a number of genome-wide analyses have shown that A > I editing is not limited to a few mRNAs, as originally thought, but occurs widely across the transcriptome, especially in the brain. Importantly, there is increasing evidence that A > I editing is essential for animal development and nervous system function. To more efficiently characterize the complete catalog of ADAR events in the mammalian transcriptome we developed a high-throughput protocol to identify A > I editing sites, which exploits the capacity of glyoxal to protect guanosine, but not inosine, from RNAse T1 treatment, thus facilitating extraction of RNA fragments with inosine bases at their termini for high-throughput sequencing. Using this method we identified 665 editing sites in mouse brain RNA, including most known sites and suite of novel sites that include nonsynonymous changes to protein-coding genes, hyperediting of genes known to regulate p53, and alterations to non-protein-coding RNAs. This method is applicable to any biological system for the de novo discovery of A > I editing sites, and avoids the complicated informatic and practical issues associated with editing site identification using traditional RNA sequencing data. This approach has the potential to substantially increase our understanding of the extent and function of RNA editing, and thereby to shed light on the role of transcriptional plasticity in evolution, development, and cognition. PMID:23264566

A Review of Marine Geophysical Constraints on the Motion Between East and West Antarctica in the Cenozoic (Invited)

NASA Astrophysics Data System (ADS)

Cande, S. C.; Stock, J. M.

2010-12-01

Motion between East and West Antarctica in the Late Cretaceous and Cenozoic is derived by summing the plate circuit(s) linking East Antarctica to Australia to the Lord Howe Rise to the Pacific plate to West Antarctica (the Aus-Pac plate circuit). We discuss this motion in two parts: motion before and after 42 Ma. For the younger time interval, motion is directly constrained by magnetic anomalies in the Adare Basin, which opened by ultraslow seafloor spreading between 42 and 26 Ma (anomalies 18 to 9). The Adare Basin magnetic anomaly constraints can be combined with magnetic anomaly and fracture zone data from the SEIR (Aus-East Ant to the west of the Balleny FZ and Aus - West Ant to the east) to set up an Aus-East Ant - West Ant three-plate problem. The original solution of this three-plate configuration (Cande et al., 2000) only had data from a very short section of the Adare Basin and obtained an answer with very large uncertainties on the East-West Ant rotation. Better estimates of the East-West Ant rotation have been calculated by adding constraints based on seismically controlled estimates of extension in the Victoria Land Basin (Davey et al., 2006) and constraints from Damaske et al’s (2007) detailed aeromagnetic survey of the Adare Basin and adjacent Northern Basin (Granot et al., 2010). Currently, we are working on improving the accuracy of rotations for the post-42 Ma time interval by taking advantage of an unusual plate geometry that enables us to solve a five-boundary, four-plate configuration. Specifically, motion between the four plates (East Ant, West Ant, Aus and Pac) encompasses two related triple junction systems with five spreading ridge segments (Aus-East Ant, Aus-West Ant, Aus-Pac, Pac-West Ant and East Ant-West Ant) which can be combined and solved simultaneously. For the older, pre-42 Ma time interval, the only way to calculate motion between East and West Antarctica is via the long Aus-Pac plate circuit (although it is possible that

The case for nearly continuous extension of the West Antarctic Rift System, 105-25 Ma (Invited)

NASA Astrophysics Data System (ADS)

Wilson, D. S.; Luyendyk, B. P.

2010-12-01

It is a common perception that extension in the West Antarctic Rift System (WARS) was a two-phase process, with a Cretaceous phase ending when the Campbell Plateau rifted from West Antarctica (~80 Ma), and a mid-Cenozoic phase synchronous with sea floor spreading in the Adare trough (~45-25 Ma). Several lines of evidence indicate that significant extension probably occurred in the intervening 80-45 Ma interval. The strongest evidence comes from subsidence rates on the Central High and Coulman High structures in the central-western Ross Sea, where DSDP Site 270 and other areas with shallow basement have subsided 1 km or more since Oligocene time. With sediment load, these subsidence rates are reasonable for thermal subsidence resulting from extension with a stretching factor of about 2.0-2.5 at about 50-70 Ma, but are hard to reconcile with an extension age around 90 Ma. The seismic velocity structure of the WARS inferred from global surface-wave dispersion is similar to that of oceanic lithosphere of age 40-60 Ma [Ritzwoller et al., 2001 JGR]. Geometric relations of sea floor between Adare Trough and Iselen Bank, northwest Ross Sea, suggest sea floor spreading of about 130 km during early Cenozoic, before the Adare Trough spreading episode started. Numerous cooling ages in the Transantarctic Mountains in the range of 55-45 Ma [Fitzgerald, 1992 Tectonics; Miller et al., 2010 Tectonics] support the interpretation of significant extension prior to 45 Ma. Present crustal thickness of about 22 km near DSDP Site 270 [Trey et al., 1999 Tectonophysics] suggests a pre-extension crustal thickness exceeding 50 km. A simple overall interpretation follows that the WARS has a tectonic history similar to the Basin and Range of western North America: a thick-crust orogenic highland extended for many tens of million years. The main difference between the WARS and the Basin and Range is the post-tectonic cooling and subsidence in the WARS.

Revised East-West Antarctic plate motions since the Middle Eocene

NASA Astrophysics Data System (ADS)

Granot, R.; Cande, S. C.; Stock, J.; Damaske, D.

2010-12-01

The middle Cenozoic (43-26 Ma) rifting between East and West Antarctica is defined by an episode of ultraslow seafloor spreading in the Adare Basin, located off northwestern Ross Sea. The absence of fracture zones and the lack of sufficient well-located magnetic anomaly picks have resulted in a poorly constrained kinematic model (Cande et al., 2000). Here we utilize the results from a dense aeromagnetic survey (Damaske et al., 2007) collected as part of GANOVEX IX 2005/06 campaign to re-evaluate the kinematics of the West Antarctic rift system since the Middle Eocene. We identify marine magnetic anomalies (anomalies 12o, 13o, 16y, and 18o) along a total of 25,000 km of the GPS navigated magnetic profiles. The continuation of these anomalies into the Northern Basin has allowed us to use the entire N-S length of this dataset in our calculations. A distinct curvature in the orientation of the spreading axis provides a strong constraint on our calculated kinematic models. The results from two- (East-West Antarctica) and three- (Australia-East Antarctica-West Antarctica) plate solutions agree well and create a cluster of rotation axes located south of the rift system, near the South Pole. These solutions reveal that spreading rate and direction, and therefore motion between East and West Antarctica, were steady between the Middle Eocene and Early Oligocene. Our kinematic solutions confirm the results of Davey and De Santis (2005) that the Victoria Land Basin has accommodated ~95 km of extension since the Middle Eocene. This magnetic pattern also provides valuable constraints on the post-spreading deformation of the Adare Basin (Granot et al., 2010). The Adare Basin has accommodated very little extension since the Late Oligocene (<7 km), but motion has probably increased southward. The details of this younger phase of motion are still crudely constrained.

Partial agonist clonidine mediates alpha(2)-AR subtypes specific regulation of cAMP accumulation in adenylyl cyclase II transfected DDT1-MF2 cells.

PubMed

Limon-Boulez, I; Bouet-Alard, R; Gettys, T W; Lanier, S M; Maltier, J P; Legrand, C

2001-02-01

alpha2-Adrenergic receptor (alpha(2)-AR) activation in the pregnant rat myometrium at midterm potentiates beta(2)-AR stimulation of adenylyl cyclase (AC) via Gbetagamma regulation of the type II isoform of adenylyl cyclase. However, at term, alpha(2)-AR activation inhibits beta(2)-AR stimulation of AC. This phenomenon is associated with changes in alpha(2)-AR subtype expression (midterm alpha(2A/D)-AR > alpha(2B)-AR; term alpha(2B) >or =alpha(2A/D)-AR), without any change in ACII mRNA, suggesting that alpha(2A/D)- and alpha(2B)-AR differentially regulate beta(2)-cAMP production. To address this issue, we have stably expressed the same density of alpha(2A/D)- or alpha(2B)-AR with AC II in DDT1-MF2 cells. Clonidine (partial agonist) increased beta(2)-AR-stimulated cAMP production in alpha(2A/D)-AR-ACII transfectants but inhibited it in alpha(2B)-AR-ACII transfectants. In contrast, epinephrine (full agonist) enhanced beta(2)-stimulated ACII in both alpha(2A)- and alpha(2B)-ACII clonal cell lines. 4-Azidoanilido-[alpha-(32)P]GTP-labeling of activated G proteins indicated that, in alpha(2B)-AR transfectants, clonidine activated only Gi(2), whereas epinephrine, the full agonist, effectively coupled to Gi(2) and Gi(3). Thus, partial and full agonists selectively activate G proteins that lead to drug specific effects on effectors. Moreover, these data indicate that Gi(3) activation is required for potentiation of beta(2)-AR stimulation of AC by alpha(2A/D) and alpha(2B)-AR in DDT1-MF2 cells. This may reflect an issue of the amount of Gbetagamma released upon receptor activation and/or betagamma composition of Gi(3) versus Gi(2).

Ada(R) Test and Verification System (ATVS)

NASA Technical Reports Server (NTRS)

Strelich, Tom

1986-01-01

The Ada Test and Verification System (ATVS) functional description and high level design are completed and summarized. The ATVS will provide a comprehensive set of test and verification capabilities specifically addressing the features of the Ada language, support for embedded system development, distributed environments, and advanced user interface capabilities. Its design emphasis was on effective software development environment integration and flexibility to ensure its long-term use in the Ada software development community.

Lasers Induced Damage in Optical Materials: 1985. Proceedings of the Symposium on Optical Materials for High-Power Lasers (17th) Held in Boulder, Colorado on October 28-30, 1985

DTIC Science & Technology

1988-07-01

optical coatings.[lj In * single and multilayer anatase TiO 2 coatings, sufficiently intense pulsed laser irradiation at 532 nm led to observation of...temperatures of pulsed laser - irradiated anatase coatings have been computed from Stokes/anti-Stokes band intensity ratios at zero time delay as a function of...Adar Time-Resolved Temperature Determinations from Raman Scattering of TiO𔃼 Coatings During Pulsed Laser Irradiation

Get the Picture?

NASA Technical Reports Server (NTRS)

1998-01-01

Positive Systems has worked in conjunction with Stennis Space Center to design the ADAR System 5500. This is a four-band airborne digital imaging system used to capture multispectral imagery similar to that available from satellite platforms such as Landsat, SPOT and the new generation of high resolution satellites. Positive Systems has provided remote sensing services for the development of digital aerial camera systems and software for commercial aerial imaging applications.

Species composition and distribution of the Antarctic plunderfishes (Pisces, Artedidraconidae) from the Ross Sea off Victoria Land

NASA Astrophysics Data System (ADS)

La Mesa, Mario; Cattaneo-Vietti, Riccardo; Vacchi, Marino

2006-04-01

Among the notothenioid fish, the Antarctic plunderfishes (family Artedidraconidae) are a poorly known component of the bottom fauna of the continental shelf despite their relative importance. The family is composed of 25 small- to medium-sized endemic species and four genera, Artedidraco, Dolloidraco, Histiodraco and Pogonophryne, which are the most benthic and sedentary of the notothenioid fish. In the framework of "Victoria Land Transect Project", several samples of plunderfishes were collected by means of an Agassiz trawl. Sampling activities were carried out between 100 and 500 m depth in five sites over nearly 4° latitude off Victoria Land. Overall, trawling yielded 80 specimens of plunderfish, including all species of Artedidraco reported from the Ross Sea, i.e. Artedidraco glareobarbatus, A. loennbergi, A. orianae, A. shackletoni and A. skottsbergi, and the monotypic genus Histiodraco. The use of multivariate statistical analyses on catch data indicated sampling site as the main factor affecting species composition. Histiodraco velifer and A. skottsbergi were caught almost exclusively in the southernmost sites, characterizing the artedidraconid fauna of Cape Russell. A. orianae was sampled only in the northernmost sites, such as Cape Adare and Hallett Peninsula. A. loennbergi appeared to be a ubiquitous species, whereas A. glareobarbatus was caught only at the Hallett Peninsula. Plunderfishes showed a particular distribution pattern in relation to depth as well. A. glareobarbatus was the shallowest species, being sampled within 100 m. A. orianae and A. shackletoni showed a similar distribution, being caught mostly at 100-200 m, whereas A. skottsbergi was mainly sampled at 200-300 m. H. velifer was caught in a wide depth range, but mostly in deeper waters (400 m). A. loennbergi was eurybathic, showing a wider depth distribution than other species. Univariate measures of diversity indicated Cape Adare as the poorer site in terms of species richness and

Utilization of digital LANDSAT imagery for the study of granitoid bodies in Rondonia: Case example of the Pedra Branca massif

NASA Technical Reports Server (NTRS)

Parada, N. D. J. (Principal Investigator); Almeidafilho, R.; Payolla, B. L.; Depinho, O. G.; Bettencourt, J. S.

1984-01-01

Analysis of digital multispectral MSS-LANDSAT images enhanced through computer techniques and enlarged to a video scale of 1:100.000, show the main geological and structura features of the Pedra Branca granitic massif in Rondonia. These are not observed in aerial photographs or adar images. Field work shows that LANDSAT photogeological units correspond to different facies of granitic rocks in the Pedra Branca massif. Even under the particular characteristics of Amazonia (Tropical Forest, deep weathering, and Quaternary sedimentary covers), an adequate utilization of orbital remote sensing images can be important tools for the orientation of field works.

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome.

PubMed

Rice, Gillian I; Reijns, Martin A M; Coffin, Stephanie R; Forte, Gabriella M A; Anderson, Beverley H; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J; Perrino, Fred W; Jackson, Andrew P; Crow, Yanick J

2013-08-01

Aicardi-Goutières syndrome is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1, or ADAR1. Here, we provide molecular, biochemical, and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. © 2013 WILEY PERIODICALS, INC.

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome

PubMed Central

Rice, Gillian I.; Reijns, Martin A.M.; Coffin, Stephanie R.; Forte, Gabriella M.A.; Anderson, Beverley H.; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P.; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J.; Perrino, Fred W.; Jackson, Andrew P.; Crow, Yanick J.

2013-01-01

Aicardi-Goutières syndrome (AGS) is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1 or ADAR1. Here we provide molecular, biochemical and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. PMID:23592335

An Evolutionary Landscape of A-to-I RNA Editome across Metazoan Species

PubMed Central

Hung, Li-Yuan; Chen, Yen-Ju; Mai, Te-Lun; Chen, Chia-Ying; Yang, Min-Yu; Chiang, Tai-Wei; Wang, Yi-Da

2018-01-01

Abstract Adenosine-to-inosine (A-to-I) editing is widespread across the kingdom Metazoa. However, for the lack of comprehensive analysis in nonmodel animals, the evolutionary history of A-to-I editing remains largely unexplored. Here, we detect high-confidence editing sites using clustering and conservation strategies based on RNA sequencing data alone, without using single-nucleotide polymorphism information or genome sequencing data from the same sample. We thereby unveil the first evolutionary landscape of A-to-I editing maps across 20 metazoan species (from worm to human), providing unprecedented evidence on how the editing mechanism gradually expands its territory and increases its influence along the history of evolution. Our result revealed that highly clustered and conserved editing sites tended to have a higher editing level and a higher magnitude of the ADAR motif. The ratio of the frequencies of nonsynonymous editing to that of synonymous editing remarkably increased with increasing the conservation level of A-to-I editing. These results thus suggest potentially functional benefit of highly clustered and conserved editing sites. In addition, spatiotemporal dynamics analyses reveal a conserved enrichment of editing and ADAR expression in the central nervous system throughout more than 300 Myr of divergent evolution in complex animals and the comparability of editing patterns between invertebrates and between vertebrates during development. This study provides evolutionary and dynamic aspects of A-to-I editome across metazoan species, expanding this important but understudied class of nongenomically encoded events for comprehensive characterization. PMID:29294013

Early Miocene Tectonic Activity in the western Ross Sea (Antarctica)

NASA Astrophysics Data System (ADS)

Sauli, C.; Sorlien, C. C.; Busetti, M.; Geletti, R.; De Santis, L.

2012-12-01

In the framework of the Rossmap Italian PNRA work objectives to compile extended and revised digital maps of the main unconformities in Ross Sea, Antarctica, much additional seismic reflection data, that were not available to previous ANTOSTRAT compilation, were incorporated into a new ROSSMAP interpretation. The correlation across almost all of Ross Sea, from DSDP Site 270 and Site 272 in Eastern Basin to northern Victoria Land Basin, of additional early Miocene and late Oligocene horizons that were not part of ANTOSTRAT allows interpretations to be made of fault activity and glacial erosion or deposition at a finer time resolution. New conclusions include that extensional or transtensional fault activity within the zone between Victoria Land Basin and Northern Basin, initiated by 23 Ma or earlier, and continued after 18 Ma. Steep parallel-striking faults in southern Victoria Land Basin display both reverse and normal separation of 17.5 Ma (from Cape Roberts Program-core 1) and post-16 Ma horizons, suggesting an important strike-slip component. This result may be compared with published papers that proposed post-17 Ma extension in southern Victoria Land Basin, 16-17 Ma extension in the AdareTrough, north of the Ross Sea continental shelf, but no Miocene extension affecting the Northern Basin (Granot et al., 2010). Thus, our evidence for extension through the early Miocene is significant to post-spreading tectonic models. Reference Granot R., Cande S. C., Stock J. M., Davey F. J. and Clayton R. W. (2010) Postspreading rifting in the Adare Basin, Antarctica: Regional tectonic consequences. Geochem. Geophys. Geosyst., 8, Q08005, doi:10.1029/2010GC003105.

Alu elements shape the primate transcriptome by cis-regulation of RNA editing

PubMed Central

2014-01-01

Background RNA editing by adenosine to inosine deamination is a widespread phenomenon, particularly frequent in the human transcriptome, largely due to the presence of inverted Alu repeats and their ability to form double-stranded structures – a requisite for ADAR editing. While several hundred thousand editing sites have been identified within these primate-specific repeats, the function of Alu-editing has yet to be elucidated. Results We show that inverted Alu repeats, expressed in the primate brain, can induce site-selective editing in cis on sites located several hundred nucleotides from the Alu elements. Furthermore, a computational analysis, based on available RNA-seq data, finds that site-selective editing occurs significantly closer to edited Alu elements than expected. These targets are poorly edited upon deletion of the editing inducers, as well as in homologous transcripts from organisms lacking Alus. Sequences surrounding sites near edited Alus in UTRs, have been subjected to a lesser extent of evolutionary selection than those far from edited Alus, indicating that their editing generally depends on cis-acting Alus. Interestingly, we find an enrichment of primate-specific editing within encoded sequence or the UTRs of zinc finger-containing transcription factors. Conclusions We propose a model whereby primate-specific editing is induced by adjacent Alu elements that function as recruitment elements for the ADAR editing enzymes. The enrichment of site-selective editing with potentially functional consequences on the expression of transcription factors indicates that editing contributes more profoundly to the transcriptomic regulation and repertoire in primates than previously thought. PMID:24485196

Prediction of constitutive A-to-I editing sites from human transcriptomes in the absence of genomic sequences

PubMed Central

2013-01-01

Background Adenosine-to-inosine (A-to-I) RNA editing is recognized as a cellular mechanism for generating both RNA and protein diversity. Inosine base pairs with cytidine during reverse transcription and therefore appears as guanosine during sequencing of cDNA. Current approaches of RNA editing identification largely depend on the comparison between transcriptomes and genomic DNA (gDNA) sequencing datasets from the same individuals, and it has been challenging to identify editing candidates from transcriptomes in the absence of gDNA information. Results We have developed a new strategy to accurately predict constitutive RNA editing sites from publicly available human RNA-seq datasets in the absence of relevant genomic sequences. Our approach establishes new parameters to increase the ability to map mismatches and to minimize sequencing/mapping errors and unreported genome variations. We identified 695 novel constitutive A-to-I editing sites that appear in clusters (named “editing boxes”) in multiple samples and which exhibit spatial and dynamic regulation across human tissues. Some of these editing boxes are enriched in non-repetitive regions lacking inverted repeat structures and contain an extremely high conversion frequency of As to Is. We validated a number of editing boxes in multiple human cell lines and confirmed that ADAR1 is responsible for the observed promiscuous editing events in non-repetitive regions, further expanding our knowledge of the catalytic substrate of A-to-I RNA editing by ADAR enzymes. Conclusions The approach we present here provides a novel way of identifying A-to-I RNA editing events by analyzing only RNA-seq datasets. This method has allowed us to gain new insights into RNA editing and should also aid in the identification of more constitutive A-to-I editing sites from additional transcriptomes. PMID:23537002

Molecular Recognition of 6′-N-5-Hexynoate Kanamyin A and RNA 1×1 Internal Loops Containing CA Mismatches

PubMed Central

Tran, Tuan; Disney, Matthew D.

2011-01-01

In our previous study to identify the RNA internal loops that bind an aminoglycoside derivative, we determined that 6′-N-5-hexynoate kanamycin A prefers to bind 1×1 nucleotide internal loops containing C•A mismatches. In this present study, the molecular recognition between a variety of RNAs that are mutated around the C•A loop and the ligand was investigated. Studies show that both loop nucleotides and loop closing pairs affect binding affinity. Most interestingly, it was shown that there is a correlation between the thermodynamic stability of the C•A internal loops and ligand affinity. Specifically, C•A loops that had relatively high or low stability bound the ligand most weakly whereas loops with intermediate stability bound the ligand most tightly. In contrast, there is no correlation between the likelihood that a loop forms a C-A+ pair at lower pH and ligand affinity. It was also found that a 1×1 nucleotide C•A loop that bound to the ligand with the highest affinity is identical to the consensus site in RNAs that are edited by adenosine deaminases acting on RNA type 2 (ADAR2). These studies provide a detailed investigation of factors affecting small molecule recognition of internal loops containing C•A mismatches, which are present in a variety of RNAs that cause disease. PMID:21207945

RNA editing and regulation of Drosophila 4f-rnp expression by sas-10 antisense readthrough mRNA transcripts

PubMed Central

PETERS, NICK T.; ROHRBACH, JUSTIN A.; ZALEWSKI, BRIAN A.; BYRKETT, COLLEEN M.; VAUGHN, JACK C.

2003-01-01

We have previously described an example of extensively A-to-G edited cDNA derived from adult heads of the fruitfly Drosophila melanogaster. In that study, the source of the predicted antisense RNA pairing strand for template recognition by dADAR editase was not identified, and the biological significance of the observed hyperediting was not known. Here, we address each of these questions. 4f-rnp and sas-10 are closely adjacent X-linked genes located on opposite DNA strands that produce convergent transcripts. We show that developmentally regulated antisense sas-10 readthrough mRNA arises by activation of an upstream promoter P2 during the late embryo stage of fly development. The sas-10 readthrough transcripts pair with 4f-rnp mRNA to form double-stranded molecules, as indicated by A-to-G editing observed in both RNA strands. It would be predicted that perfect RNA duplexes would be targeted for modification/degradation by enzyme pathways that recognize double-stranded RNAs, leading to decline in 4f-rnp mRNA levels, and this is what we observe. The observation using quantitative RT-PCR that sas-10 readthrough and 4f-rnp transcript levels are inversely related suggests a role for the antisense RNA in posttranscriptional regulation of 4f-rnp gene expression during development. Potential molecular mechanisms that could lead to this result are discussed, one of which is targeted transcript degradation via the RNAi pathway. Insofar as the dADAR editase and RNAi pathways are known to be constitutive in this system, it is likely that control of antisense RNA transcription is the rate-limiting factor. The results provide insight into roles of naturally occurring antisense RNAs in regulation of eukaryotic gene expression. PMID:12756328

RNA Editome in Rhesus Macaque Shaped by Purifying Selection

PubMed Central

Yang, Xin-Zhuang; Tan, Bertrand Chin-Ming; Fang, Huaying; Liu, Chu-Jun; Shi, Mingming; Ye, Zhi-Qiang; Zhang, Yong E.; Deng, Minghua; Zhang, Xiuqin; Li, Chuan-Yun

2014-01-01

Understanding of the RNA editing process has been broadened considerably by the next generation sequencing technology; however, several issues regarding this regulatory step remain unresolved – the strategies to accurately delineate the editome, the mechanism by which its profile is maintained, and its evolutionary and functional relevance. Here we report an accurate and quantitative profile of the RNA editome for rhesus macaque, a close relative of human. By combining genome and transcriptome sequencing of multiple tissues from the same animal, we identified 31,250 editing sites, of which 99.8% are A-to-G transitions. We verified 96.6% of editing sites in coding regions and 97.5% of randomly selected sites in non-coding regions, as well as the corresponding levels of editing by multiple independent means, demonstrating the feasibility of our experimental paradigm. Several lines of evidence supported the notion that the adenosine deamination is associated with the macaque editome – A-to-G editing sites were flanked by sequences with the attributes of ADAR substrates, and both the sequence context and the expression profile of ADARs are relevant factors in determining the quantitative variance of RNA editing across different sites and tissue types. In support of the functional relevance of some of these editing sites, substitution valley of decreased divergence was detected around the editing site, suggesting the evolutionary constraint in maintaining some of these editing substrates with their double-stranded structure. These findings thus complement the “continuous probing” model that postulates tinkering-based origination of a small proportion of functional editing sites. In conclusion, the macaque editome reported here highlights RNA editing as a widespread functional regulation in primate evolution, and provides an informative framework for further understanding RNA editing in human. PMID:24722121

Lentiginous phenotypes caused by diverse pathogenic genes (SASH1 and PTPN11): clinical and molecular discrimination.

PubMed

Zhang, J; Cheng, R; Liang, J; Ni, C; Li, M; Yao, Z

2016-10-01

Pathogenic mutations in genes (SASH1 and PTPN11) can cause a rare genetic disorder associated with pigmentation defects and the well-known LEOPARD syndrome, respectively. Both conditions presented with lentiginous phenotypes. The aim of this study was to arrive at definite diagnoses of three Chinese boys with clinically suspected lentigines-related syndromes. ADAR1, ABCB6, SASH1 and PTPN11 were candidate genes for mutational screening. Sanger sequencing was performed to identify the mutations, whereas bioinformatic analysis was used to predict the pathogenicity of novel missense mutations. Two novel mutations c.1537A>C (p.Ser513Arg) and 1527_1530dupAAGT (p.Leu511Lysfs*21) in SASH1 and a common p.Thr468Met mutation in PTPN11 were detected in three pediatric patients with lentiginous phenotypes, respectively. Comparisons between clinical presentations showed that SASH1-related phenotypes can exhibit hyper- and hypopigmentation on the trunk and extremities, similar to dyschromatosis, while scattered café au-lait spots usually appeared in PTPN11-related LEOPARD syndrome. Furthermore, the similarity in the clinical presentations of Peutz-Jeghers syndrome, Laugier-Hunziker syndrome, xeroderma pigmentosum, neurofibromatosis type I, suggesting that these conditions should be added into the differential diagnoses of lentiginous phenotypes. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Losses from effluent taxes and quotas under uncertainty

USGS Publications Warehouse

Watson, W.D.; Ridker, R.G.

1984-01-01

Recent theoretical papers by Adar and Griffin (J. Environ. Econ. Manag.3, 178-188 (1976)), Fishelson (J. Environ. Econ. Manag.3, 189-197 (1976)), and Weitzman (Rev. Econ. Studies41, 477-491 (1974)) show that,different expected social losses arise from using effluent taxes and quotas as alternative control instruments when marginal control costs are uncertain. Key assumptions in these analyses are linear marginal cost and benefit functions and an additive error for the marginal cost function (to reflect uncertainty). In this paper, empirically derived nonlinear functions and more realistic multiplicative error terms are used to estimate expected control and damage costs and to identify (empirically) the mix of control instruments that minimizes expected losses. ?? 1984.

Radical anionic versus neutral 2,2'-bipyridyl coordination in uranium complexes supported by amide and ketimide ligands.

PubMed

Diaconescu, Paula L; Cummins, Christopher C

2015-02-14

The synthesis and characterization of (bipy)(2)U(N[t-Bu]Ar)(2) (1-(bipy)(2), bipy = 2,2'-bipyridyl, Ar = 3,5-C(6)H(3)Me(2)), (bipy)U(N[(1)Ad]Ar)(3) (2-bipy), (bipy)(2)U(NC[t-Bu]Mes)(3) (3-(bipy)(2), Mes = 2,4,6-C(6)H(2)Me(3)), and IU(bipy)(NC[t-Bu]Mes)(3) (3-I-bipy) are reported. X-ray crystallography studies indicate that bipy coordinates as a radical anion in 1-(bipy)(2) and 2-bipy, and as a neutral ligand in 3-I-bipy. In 3-(bipy)(2), one of the bipy ligands is best viewed as a radical anion, the other as a neutral ligand. The electronic structure assignments are supported by NMR spectroscopy studies of exchange experiments with 4,4'-dimethyl-2,2'-bipyridyl and also by optical spectroscopy. In all complexes, uranium was assigned a +4 formal oxidation state.

Reduced levels of protein recoding by A-to-I RNA editing in Alzheimer's disease

PubMed Central

Khermesh, Khen; D'Erchia, Anna Maria; Barak, Michal; Annese, Anita; Wachtel, Chaim; Levanon, Erez Y.; Picardi, Ernesto; Eisenberg, Eli

2016-01-01

Adenosine to inosine (A-to-I) RNA editing, catalyzed by the ADAR enzyme family, acts on dsRNA structures within pre-mRNA molecules. Editing of the coding part of the mRNA may lead to recoding, amino acid substitution in the resulting protein, possibly modifying its biochemical and biophysical properties. Altered RNA editing patterns have been observed in various neurological pathologies. Here, we present a comprehensive study of recoding by RNA editing in Alzheimer's disease (AD), the most common cause of irreversible dementia. We have used a targeted resequencing approach supplemented by a microfluidic-based high-throughput PCR coupled with next-generation sequencing to accurately quantify A-to-I RNA editing levels in a preselected set of target sites, mostly located within the coding sequence of synaptic genes. Overall, editing levels decreased in AD patients’ brain tissues, mainly in the hippocampus and to a lesser degree in the temporal and frontal lobes. Differential RNA editing levels were observed in 35 target sites within 22 genes. These results may shed light on a possible association between the neurodegenerative processes typical for AD and deficient RNA editing. PMID:26655226

MDA5-Associated Neuroinflammation and the Singleton–Merten Syndrome: Two Faces of the Same Type I Interferonopathy Spectrum

PubMed Central

Buers, Insa; Rice, Gillian I.; Crow, Yanick J.

2017-01-01

In 1973, Singleton and Merten described a new syndrome in 2 female probands with aortic and cardiac valve calcifications, early loss of secondary dentition, and widened medullary cavities of the phalanges. In 1984, Aicardi and Goutières defined a phenotype resembling congenital viral infection with basal ganglia calcification and increased protein content in the cerebrospinal fluid. Between 2006 and 2012, mutations in 6 different genes were described to be associated with Aicardi–Goutières syndrome, specifically—TREX1, RNASEH2A, RNASEH2B, RNASEH2C, ADAR, and SAMHD1. More recently, mutations in IFIH1 were reported in a variety of neuroimmunological phenotypes, including Aicardi–Goutières syndrome, while a specific Arg822Gln mutation in IFIH1 was described in 3 discrete families with Singleton–Merten syndrome (SMS). IFIH1 encodes for melanoma differentiation-associated gene 5 (MDA5), and all mutations identified to date have been associated with an enhanced interferon response in affected individuals. In this study, we present a male child demonstrating recurrent febrile episodes, spasticity, and basal ganglia calcification suggestive of Aicardi–Goutières syndrome, who carries the same Arg822Gln mutation in IFIH1 previously associated with SMS. We conclude that both diseases are part of the interferonopathy grouping and that the Arg822Gln mutation in IFIH1 can cause a spectrum of disease, including neurological involvement. PMID:28475458

Remote Sensing of Vineyard FPAR, with Implications for Irrigation Scheduling

NASA Technical Reports Server (NTRS)

Johnson, Lee F.; Scholasch, Thibaut

2004-01-01

Normalized difference vegetation index (NDVI) data, acquired at two-meter resolution by an airborne ADAR System 5500, were compared with fraction of photosynthetically active radiation (FPAR) absorbed by commercial vineyards in Napa Valley, California. An empirical line correction was used to transform image digital counts to surface reflectance. "Apparent" NDVI (generated from digital counts) and "corrected" NDVI (from reflectance) were both strongly related to FPAR of range 0.14-0.50 (both r(sup 2) = 0.97, P < 0.01). By suppressing noise, corrected NDVI should form a more spatially and temporally stable relationship with FPAR, reducing the need for repeated field support. Study results suggest the possibility of using optical remote sensing to monitor the transpiration crop coefficient, thus providing an enhanced spatial resolution component to crop water budget calculations and irrigation management.

RNA Editing with CRISPR-Cas13

PubMed Central

Cox, David B.T.; Gootenberg, Jonathan S.; Abudayyeh, Omar O.; Franklin, Brian; Kellner, Max J.; Joung, Julia; Zhang, Feng

2017-01-01

Nucleic acid editing holds promise for treating genetic disease, particularly at the RNA level, where disease-relevant sequences can be rescued to yield functional protein products. Type VI CRISPR-Cas systems contain the programmable single-effector RNA-guided RNases Cas13. Here, we profile Type VI systems to engineer a Cas13 ortholog capable of robust knockdown and demonstrate RNA editing by using catalytically-inactive Cas13 (dCas13) to direct adenosine to inosine deaminase activity by ADAR2 to transcripts in mammalian cells. This system, referred to as RNA Editing for Programmable A to I Replacement (REPAIR), has no strict sequence constraints, can be used to edit full-length transcripts containing pathogenic mutations. We further engineer this system to create a high specificity variant, REPAIRv2, that is 919 times more specific than REPAIRv1 as well as minimize the system to ease viral delivery. REPAIR presents a promising RNA editing platform with broad applicability for research, therapeutics, and biotechnology. PMID:29070703

Similarity indices based on link weight assignment for link prediction of unweighted complex networks

NASA Astrophysics Data System (ADS)

Liu, Shuxin; Ji, Xinsheng; Liu, Caixia; Bai, Yi

2017-01-01

Many link prediction methods have been proposed for predicting the likelihood that a link exists between two nodes in complex networks. Among these methods, similarity indices are receiving close attention. Most similarity-based methods assume that the contribution of links with different topological structures is the same in the similarity calculations. This paper proposes a local weighted method, which weights the strength of connection between each pair of nodes. Based on the local weighted method, six local weighted similarity indices extended from unweighted similarity indices (including Common Neighbor (CN), Adamic-Adar (AA), Resource Allocation (RA), Salton, Jaccard and Local Path (LP) index) are proposed. Empirical study has shown that the local weighted method can significantly improve the prediction accuracy of these unweighted similarity indices and that in sparse and weakly clustered networks, the indices perform even better.

The significance of Antarctica for studies of global geodynamics

USGS Publications Warehouse

Sutherland, R.

2007-01-01

Antarctica has geometric significance for global plate kinematic studies, because it links seafloor spreading systems of the African hemisphere (Indian and Atlantic Oceans) with those of the Pacific. Inferences of plate motions back to 44 Ma, around the onset of rapid spreading south of Australia and formation of a new boundary through New Zealand, are consistent with Antarctic rifting and formation of the Adare Basin during 44-26 Ma (i.e., no additional plate motions are required in the South Pacific). The time period 52-44 Ma represents a profound global and South Pacific tectonic change, and significant details remain unresolved. For 74 Ma a significant nonclosure of the South Pacific plate-motion circuit is identified if Antarctic motion is not included. Alternate inferences of motion through Antarctica during the interval 74-44 Ma imply significantly different subduction volumes and directions around the Pacific, and imply different relative motions between hotspots

An improved game-theoretic approach to uncover overlapping communities

NASA Astrophysics Data System (ADS)

Sun, Hong-Liang; Ch'Ng, Eugene; Yong, Xi; Garibaldi, Jonathan M.; See, Simon; Chen, Duan-Bing

How can we uncover overlapping communities from complex networks to understand the inherent structures and functions? Chen et al. firstly proposed a community game (Game) to study this problem, and the overlapping communities have been discovered when the game is convergent. It is based on the assumption that each vertex of the underlying network is a rational game player to maximize its utility. In this paper, we investigate how similar vertices affect the formation of community game. The Adamic-Adar Index (AA Index) has been employed to define the new utility function. This novel method has been evaluated on both synthetic and real-world networks. Experimental study shows that it has significant improvement of accuracy (from 4.8% to 37.6%) compared with the Game on 10 real networks. It is more efficient on Facebook networks (FN) and Amazon co-purchasing networks than on other networks. This result implicates that “friend circles of friends” of Facebook are valuable to understand the overlapping community division.

Synthesis of native-like crosslinked duplex RNA and study of its properties.

PubMed

Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

2017-04-01

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.

In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

PubMed

Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L

2008-01-01

C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4

PubMed Central

Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.

2008-01-01

C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503

A-to-I RNA editing occurs at over a hundred million genomic sites, located in a majority of human genes.

PubMed

Bazak, Lily; Haviv, Ami; Barak, Michal; Jacob-Hirsch, Jasmine; Deng, Patricia; Zhang, Rui; Isaacs, Farren J; Rechavi, Gideon; Li, Jin Billy; Eisenberg, Eli; Levanon, Erez Y

2014-03-01

RNA molecules transmit the information encoded in the genome and generally reflect its content. Adenosine-to-inosine (A-to-I) RNA editing by ADAR proteins converts a genomically encoded adenosine into inosine. It is known that most RNA editing in human takes place in the primate-specific Alu sequences, but the extent of this phenomenon and its effect on transcriptome diversity are not yet clear. Here, we analyzed large-scale RNA-seq data and detected ∼1.6 million editing sites. As detection sensitivity increases with sequencing coverage, we performed ultradeep sequencing of selected Alu sequences and showed that the scope of editing is much larger than anticipated. We found that virtually all adenosines within Alu repeats that form double-stranded RNA undergo A-to-I editing, although most sites exhibit editing at only low levels (<1%). Moreover, using high coverage sequencing, we observed editing of transcripts resulting from residual antisense expression, doubling the number of edited sites in the human genome. Based on bioinformatic analyses and deep targeted sequencing, we estimate that there are over 100 million human Alu RNA editing sites, located in the majority of human genes. These findings set the stage for exploring how this primate-specific massive diversification of the transcriptome is utilized.

Acetylated adipate of retrograded starch as RS 3/4 type resistant starch.

PubMed

Kapelko-Żeberska, M; Zięba, T; Spychaj, R; Gryszkin, A

2015-12-01

This study was aimed at producing acetylated adipate of retrograded starch (ADA-R) with various degrees of substitution with functional groups and at determining the effect of esterification degree on resistance and pasting characteristics of the produced preparations. Paste was prepared from native potato starch, and afterwards frozen and defrosted. After drying and disintegration, the paste was acetylated and crosslinked using various doses of reagents. An increase in the total degree of esterification of the produced ADA-R-preparation caused an increase in its resistance to the action of amyloglucosidase. Viscosity of the paste produced from ADA-R-preparation in a wide range of acetylation degrees was increasing along with increasing crosslinking of starch. The study demonstrated that acetylated adipate of retrograded starch may be classified as a preparation of RS 3/4 type resistant starch (retrograded starch/chemically-modified starch) with good texture-forming properties. The conducted modification offers the possibility of modeling the level of resistance of the produced preparation. Copyright © 2015 Elsevier Ltd. All rights reserved.

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA

PubMed Central

Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo

2015-01-01

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. PMID:26674414

RNA editing with CRISPR-Cas13.

PubMed

Cox, David B T; Gootenberg, Jonathan S; Abudayyeh, Omar O; Franklin, Brian; Kellner, Max J; Joung, Julia; Zhang, Feng

2017-11-24

Nucleic acid editing holds promise for treating genetic disease, particularly at the RNA level, where disease-relevant sequences can be rescued to yield functional protein products. Type VI CRISPR-Cas systems contain the programmable single-effector RNA-guided ribonuclease Cas13. We profiled type VI systems in order to engineer a Cas13 ortholog capable of robust knockdown and demonstrated RNA editing by using catalytically inactive Cas13 (dCas13) to direct adenosine-to-inosine deaminase activity by ADAR2 (adenosine deaminase acting on RNA type 2) to transcripts in mammalian cells. This system, referred to as RNA Editing for Programmable A to I Replacement (REPAIR), which has no strict sequence constraints, can be used to edit full-length transcripts containing pathogenic mutations. We further engineered this system to create a high-specificity variant and minimized the system to facilitate viral delivery. REPAIR presents a promising RNA-editing platform with broad applicability for research, therapeutics, and biotechnology. Copyright © 2017, American Association for the Advancement of Science.

In-flight edge response measurements for high-spatial-resolution remote sensing systems

NASA Astrophysics Data System (ADS)

Blonski, Slawomir; Pagnutti, Mary A.; Ryan, Robert; Zanoni, Vickie

2002-09-01

In-flight measurements of spatial resolution were conducted as part of the NASA Scientific Data Purchase Verification and Validation process. Characterization included remote sensing image products with ground sample distance of 1 meter or less, such as those acquired with the panchromatic imager onboard the IKONOS satellite and the airborne ADAR System 5500 multispectral instrument. Final image products were used to evaluate the effects of both the image acquisition system and image post-processing. Spatial resolution was characterized by full width at half maximum of an edge-response-derived line spread function. The edge responses were analyzed using the tilted-edge technique that overcomes the spatial sampling limitations of the digital imaging systems. As an enhancement to existing algorithms, the slope of the edge response and the orientation of the edge target were determined by a single computational process. Adjacent black and white square panels, either painted on a flat surface or deployed as tarps, formed the ground-based edge targets used in the tests. Orientation of the deployable tarps was optimized beforehand, based on simulations of the imaging system. The effects of such factors as acquisition geometry, temporal variability, Modulation Transfer Function compensation, and ground sample distance on spatial resolution were investigated.

RNA editing of non-coding RNA and its role in gene regulation.

PubMed

Daniel, Chammiran; Lagergren, Jens; Öhman, Marie

2015-10-01

It has for a long time been known that repetitive elements, particularly Alu sequences in human, are edited by the adenosine deaminases acting on RNA, ADAR, family. The functional interpretation of these events has been even more difficult than that of editing events in coding sequences, but today there is an emerging understanding of their downstream effects. A surprisingly large fraction of the human transcriptome contains inverted Alu repeats, often forming long double stranded structures in RNA transcripts, typically occurring in introns and UTRs of protein coding genes. Alu repeats are also common in other primates, and similar inverted repeats can frequently be found in non-primates, although the latter are less prone to duplex formation. In human, as many as 700,000 Alu elements have been identified as substrates for RNA editing, of which many are edited at several sites. In fact, recent advancements in transcriptome sequencing techniques and bioinformatics have revealed that the human editome comprises at least a hundred million adenosine to inosine (A-to-I) editing sites in Alu sequences. Although substantial additional efforts are required in order to map the editome, already present knowledge provides an excellent starting point for studying cis-regulation of editing. In this review, we will focus on editing of long stem loop structures in the human transcriptome and how it can effect gene expression. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

A biochemical landscape of A-to-I RNA editing in the human brain transcriptome

PubMed Central

Sakurai, Masayuki; Ueda, Hiroki; Yano, Takanori; Okada, Shunpei; Terajima, Hideki; Mitsuyama, Toutai; Toyoda, Atsushi; Fujiyama, Asao; Kawabata, Hitomi; Suzuki, Tsutomu

2014-01-01

Inosine is an abundant RNA modification in the human transcriptome and is essential for many biological processes in modulating gene expression at the post-transcriptional level. Adenosine deaminases acting on RNA (ADARs) catalyze the hydrolytic deamination of adenosines to inosines (A-to-I editing) in double-stranded regions. We previously established a biochemical method called “inosine chemical erasing” (ICE) to directly identify inosines on RNA strands with high reliability. Here, we have applied the ICE method combined with deep sequencing (ICE-seq) to conduct an unbiased genome-wide screening of A-to-I editing sites in the transcriptome of human adult brain. Taken together with the sites identified by the conventional ICE method, we mapped 19,791 novel sites and newly found 1258 edited mRNAs, including 66 novel sites in coding regions, 41 of which cause altered amino acid assignment. ICE-seq detected novel editing sites in various repeat elements as well as in short hairpins. Gene ontology analysis revealed that these edited mRNAs are associated with transcription, energy metabolism, and neurological disorders, providing new insights into various aspects of human brain functions. PMID:24407955

The degree-related clustering coefficient and its application to link prediction

NASA Astrophysics Data System (ADS)

Liu, Yangyang; Zhao, Chengli; Wang, Xiaojie; Huang, Qiangjuan; Zhang, Xue; Yi, Dongyun

2016-07-01

Link prediction plays a significant role in explaining the evolution of networks. However it is still a challenging problem that has been addressed only with topological information in recent years. Based on the belief that network nodes with a great number of common neighbors are more likely to be connected, many similarity indices have achieved considerable accuracy and efficiency. Motivated by the natural assumption that the effect of missing links on the estimation of a node's clustering ability could be related to node degree, in this paper, we propose a degree-related clustering coefficient index to quantify the clustering ability of nodes. Unlike the classical clustering coefficient, our new coefficient is highly robust when the observed bias of links is considered. Furthermore, we propose a degree-related clustering ability path (DCP) index, which applies the proposed coefficient to the link prediction problem. Experiments on 12 real-world networks show that our proposed method is highly accurate and robust compared with four common-neighbor-based similarity indices (Common Neighbors(CN), Adamic-Adar(AA), Resource Allocation(RA), and Preferential Attachment(PA)), and the recently introduced clustering ability (CA) index.

Note On The Ross Sea Shelf Water Downflow Processes (antarctica)

NASA Astrophysics Data System (ADS)

Bergamasco, A.; Defendi, V.; Spezie, G.; Budillon, G.; Carniel, S.

In the framework of the CLIMA Project of the Italian National Program for Research in Antarctica, three different experimental data sets were acquired along the continental shelf break; two of them (in 1997 and 2001) close to Cape Adare, the 1998 one in the middle of the Ross Sea (i.e. 75 S, 177 W). The investigations were chosen in order to explore the downslope flow of the bottom waters produced in the Ross Sea, namely the High Salinity Shelf Water (HSSW, the densest water mass of the southern ocean coming from its formation site in the polynya region in Terra Nova bay), and the Ice Shelf Water (ISW, originated below the Ross Ice Shelf and outflowing northward). Both bottom waters spill over the shelf edge and mix with the Circumpolar Deep Water (CDW) contributing to the formation of the Antarctic Bottom Waters (AABW). Interpreting temperature, salinity and density maps in terms of cascading processes, both HSSW and ISW overflows are evidenced during, respectively, 1997 and 1998. During the 2001 acquisition there is no presence of HSSW along the shelf break, nevertheless distribution captures the evidence of a downslope flow process.

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA.

PubMed

Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo

2015-12-01

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. © 2015 The Authors.

DNA and RNA editing of retrotransposons accelerate mammalian genome evolution.

PubMed

Knisbacher, Binyamin A; Levanon, Erez Y

2015-04-01

Genome evolution is commonly viewed as a gradual process that is driven by random mutations that accumulate over time. However, DNA- and RNA-editing enzymes have been identified that can accelerate evolution by actively modifying the genomically encoded information. The apolipoprotein B mRNA editing enzymes, catalytic polypeptide-like (APOBECs) are potent restriction factors that can inhibit retroelements by cytosine-to-uridine editing of retroelement DNA after reverse transcription. In some cases, a retroelement may successfully integrate into the genome despite being hypermutated. Such events introduce unique sequences into the genome and are thus a source of genomic innovation. adenosine deaminases that act on RNA (ADARs) catalyze adenosine-to-inosine editing in double-stranded RNA, commonly formed by oppositely oriented retroelements. The RNA editing confers plasticity to the transcriptome by generating many transcript variants from a single genomic locus. If the editing produces a beneficial variant, the genome may maintain the locus that produces the RNA-edited transcript for its novel function. Here, we discuss how these two powerful editing mechanisms, which both target inserted retroelements, facilitate expedited genome evolution. © 2015 New York Academy of Sciences.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

2014-01-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

PubMed

Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

2014-11-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

26 CFR 1.262-1 - Personal, living, and family expenses.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 3 2011-04-01 2011-04-01 false Personal, living, and family expenses. 1.262-1... TAX (CONTINUED) INCOME TAXES (CONTINUED) Items Not Deductible § 1.262-1 Personal, living, and family... expressly provided in chapter 1 of the Code, for personal, living, and family expenses. (b) Examples of...

Comparison of Euphausia superba, Euphausia crystallorophias, Pleuragramma antarcticum and Environmental Distributions in the Western Ross Sea

NASA Astrophysics Data System (ADS)

Davis, L.; Hofmann, E. E.; Klinck, J. M., II; Dinniman, M.; Pinones, M. A.

2016-02-01

Distributions of Antarctic krill (Euphausia superba), crystal krill (Euphausia crystallorophias), and Antarctic silverfish (Pleuragramma antarcticum) were constructed using observations collected in the western Ross Sea from 1988-2004. Distributions of mixed layer depth (MLD), water temperature below 200 m (an indicator for Circumpolar Deep Water, CDW), and surface speed were obtained from a Ross Sea circulation model; surface chlorophyll and percent sea ice coverage were obtained from satellite observations. The species and environmental distributions were analyzed to determine patterns and correlations. Statistical analyses of the distributions show that the three species are concentrated in specific regions and that their habitats have limited overlap. Antarctic krill are concentrated along the shelf break near Cape Adare and are associated with temperatures >0.5°C and -2°C to -0.75°C, 19-32% sea ice coverage, and high surface flow speeds. Crystal krill are concentrated in Terra Nova Bay in areas with depths of 400-600 m, temperatures < -1.3°, 50% or more sea ice coverage, shallow MLDs (2-36 m), moderate concentrations of chlorophyll (0.44 μg m-3) and low surface speeds (0.08 m s-1). Similarly, Antarctic silverfish are concentrated in Terra Nova Bay and are also found over the continental shelf in areas with depths of 500 m and temperatures of -2°C to -1°C. Additional statistical analyses provide insights into the relative contribution of the different environmental features to producing the distributions of the three species.

26 CFR 1.262-1 - Personal, living, and family expenses.

Code of Federal Regulations, 2010 CFR

2010-04-01

... trade or business expenses). (c) Cross references. Certain items of a personal, living, or family nature... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Personal, living, and family expenses. 1.262-1... TAX (CONTINUED) INCOME TAXES Items Not Deductible § 1.262-1 Personal, living, and family expenses. (a...

Chemical evidence of the changes of the Antarctic Bottom Water ventilation in the western Ross Sea between 1997 and 2003

NASA Astrophysics Data System (ADS)

Rivaro, Paola; Massolo, Serena; Bergamasco, Andrea; Castagno, Pasquale; Budillon, Giorgio

2010-05-01

Data from three Italian CLIMA project cruises between 1997 and 2003 were used to obtain sections of the hydrographic and chemical properties of the main water masses across the shelf break off Cape Adare (western Ross Sea, Antarctica). Dissolved oxygen, nitrate and phosphate data were combined on the basis of the Redfield ratio to obtain the quasi-conservative tracers NO (9[NO 3]+[O 2]), PO (135[PO 4]+[O 2]) and phosphate star PO4* ( PO4*=[PO 4]+[O 2]/175-1.95). In 1997 and 2003 the presence of the High Salinity Shelf Water at the bottom depth near the sill was traced by both physical and chemical measurements. In 2001 the Modified Shelf Water, characterized by warmer temperature and by a lower dissolved oxygen content than High Salinity Shelf Water, was observed at the shelf edge. The distribution of the chemical tracers together with the hydrographic observations showed recently formed Antarctic Bottom Water on the continental slope during all of the cruises. These observations were confirmed by the extended optimum multiparameter analysis. The calculated thickness of the new Antarctic Bottom Water, as well as the tracer content, were variable in time and in space. The estimated volume of the new Antarctic Bottom Water and the export of dissolved oxygen and nutrient associated with the overflowing water were different over the examined period. In particular, a lower (˜55%) export was evidenced in 2001 compared to 1997.

Expression of SMARCB1 (INI1) mutations in familial schwannomatosis

PubMed Central

Smith, Miriam J.; Walker, James A.; Shen, Yiping; Stemmer-Rachamimov, Anat; Gusella, James F.; Plotkin, Scott R.

2012-01-01

Genetic changes in the SMARCB1 tumor suppressor gene have recently been reported in tumors and blood from families with schwannomatosis. Exon scanning of all nine SMARCB1 exons in genomic DNA from our cohort of families meeting the criteria for ‘definite’ or ‘presumptive’ schwannomatosis previously revealed constitutional alterations in 13 of 19 families (68%). Screening of four new familial schwannomatosis probands identified one additional constitutional alteration. We confirmed the presence of mRNA transcripts for two missense alterations, four mutations of conserved splice motifs and two additional mutations, in less conserved sequences, which also affect splicing. Furthermore, we found that transcripts for a rare 3′-untranslated region (c.*82C > T) alteration shared by four unrelated families did not produce splice variants but did show unequal allelic expression, suggesting that the alteration is either causative itself or linked to an unidentified causative mutation. Overexpression studies in cells lacking SMARCB1 suggest that mutant SMARCB1 proteins, like wild-type SMARCB1 protein, retain the ability to suppress cyclin D1 activity. These data, together with the expression of SMARCB1 protein in a proportion of cells from schwannomatosis-related schwannomas, suggest that these tumors develop through a mechanism that is distinct from that of rhabdoid tumors in which SMARCB1 protein is completely absent in tumor cells. PMID:22949514

Expression of SMARCB1 (INI1) mutations in familial schwannomatosis.

PubMed

Smith, Miriam J; Walker, James A; Shen, Yiping; Stemmer-Rachamimov, Anat; Gusella, James F; Plotkin, Scott R

2012-12-15

Genetic changes in the SMARCB1 tumor suppressor gene have recently been reported in tumors and blood from families with schwannomatosis. Exon scanning of all nine SMARCB1 exons in genomic DNA from our cohort of families meeting the criteria for 'definite' or 'presumptive' schwannomatosis previously revealed constitutional alterations in 13 of 19 families (68%). Screening of four new familial schwannomatosis probands identified one additional constitutional alteration. We confirmed the presence of mRNA transcripts for two missense alterations, four mutations of conserved splice motifs and two additional mutations, in less conserved sequences, which also affect splicing. Furthermore, we found that transcripts for a rare 3'-untranslated region (c.*82C > T) alteration shared by four unrelated families did not produce splice variants but did show unequal allelic expression, suggesting that the alteration is either causative itself or linked to an unidentified causative mutation. Overexpression studies in cells lacking SMARCB1 suggest that mutant SMARCB1 proteins, like wild-type SMARCB1 protein, retain the ability to suppress cyclin D1 activity. These data, together with the expression of SMARCB1 protein in a proportion of cells from schwannomatosis-related schwannomas, suggest that these tumors develop through a mechanism that is distinct from that of rhabdoid tumors in which SMARCB1 protein is completely absent in tumor cells.

Regulatory factors governing adenosine-to-inosine (A-to-I) RNA editing.

PubMed

Hong, HuiQi; Lin, Jaymie Siqi; Chen, Leilei

2015-03-31

Adenosine-to-inosine (A-to-I) RNA editing, the most prevalent mode of transcript modification in higher eukaryotes, is catalysed by the adenosine deaminases acting on RNA (ADARs). A-to-I editing imposes an additional layer of gene regulation as it dictates various aspects of RNA metabolism, including RNA folding, processing, localization and degradation. Furthermore, editing events in exonic regions contribute to proteome diversity as translational machinery decodes inosine as guanosine. Although it has been demonstrated that dysregulated A-to-I editing contributes to various diseases, the precise regulatory mechanisms governing this critical cellular process have yet to be fully elucidated. However, integration of previous studies revealed that regulation of A-to-I editing is multifaceted, weaving an intricate network of auto- and transregulations, including the involvement of virus-originated factors like adenovirus-associated RNA. Taken together, it is apparent that tipping of any regulatory components will have profound effects on A-to-I editing, which in turn contributes to both normal and aberrant physiological conditions. A complete understanding of this intricate regulatory network may ultimately be translated into new therapeutic strategies against diseases driven by perturbed RNA editing events. Herein, we review the current state of knowledge on the regulatory mechanisms governing A-to-I editing and propose the role of other co-factors that may be involved in this complex regulatory process.

Detection of eight BRCA1 mutations in 10 breast/ovarian cancer families, including 1 family with male breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sruewing, J.P.; Brody, L.C.; Erdos, M.R.

Genetic epidemiological evidence suggests that mutations in BRCA1 may be responsible for approximately one half of early onset familial breast cancer and the majority of familial breast/ovarian cancer. The recent cloning of BRCA1 allows for the direct detection of mutations, but the feasibility of presymptomatic screening for cancer susceptibility is unknown. We analyzed genomic DNA from one affected individual from each of 24 families with at least three cases of ovarian or breast cancer, using SSCP assays. Variant SSCP bands were subcloned and sequenced. Allele-specific oligonucleotide hybridization was used to verify sequence changes and to screen DNA from control individuals.more » Six frameshift and two missense mutations were detected in 10 different families. A frameshift mutation was detected in a male proband affected with both breast and prostate cancer. A 40-bp deletion was detected in a patient who developed intra-abdominal carcinomatosis 1 year after prophylactic oophorectomy. Mutations were detected throughout the gene, and only one was detected in more than a single family. These results provide further evidence that inherited breast and ovarian cancer can occur as a consequence of a wide array of BRCA1 mutations. These results suggests that development of a screening test for BRCA1 mutations will be technically challenging. The finding of a mutation in a family with male breast cancer, not previously thought to be related to BRCA1, also illustrates the potential difficulties of genetic counseling for individuals known to carry mutations. 37 refs., 1 fig., 1 tab.« less

pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

PubMed

Wilcox, Jennifer L; Bevilacqua, Philip C

2013-10-22

Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

Investigating Local and Remote Terrestrial Influence on Air Masses at Contrasting Antarctic Sites Using Radon-222 and Back Trajectories

NASA Astrophysics Data System (ADS)

Chambers, S. D.; Choi, T.; Park, S.-J.; Williams, A. G.; Hong, S.-B.; Tositti, L.; Griffiths, A. D.; Crawford, J.; Pereira, E.

2017-12-01

We report on the first summer of high-sensitivity radon measurements from a two-filter detector at Jang Bogo Station (Terra Nova Bay) and contrast them with simultaneous observations at King Sejong Station (King George Island). King Sejong radon concentrations were characteristic of a marine baseline station (0.02-0.3 Bq m-3), whereas Jang Bogo values were highly variable (0.06-5.2 Bq m-3), mainly due to emissions from exposed coastal ground (estimated mean flux 0.09-0.11 atoms cm-2 s-1) and shallow atmospheric mixing depths. For wind speeds of ≤3.5 m s-1 the influence of local radon emissions became increasingly more prominent at both sites. A cluster analysis of back trajectories from King Sejong (62°S) revealed a fairly even distribution between air masses that had passed recently over South America, the Southern Ocean, and Antarctica, whereas at Jang Bogo (75°S) 80% of events had recently passed over the Ross Ice Shelf and West Antarctica, 12% were synoptically forced over Cape Adare, and 8% were associated with subsidence over the Antarctic interior and katabatic flow to the station. When cross-checked against radon concentrations, only half of the back trajectories ending at Jang Bogo that had indicated distant contact with nonpolar southern hemisphere continents within the past 10 days showed actual signs of terrestrial influence. A simple-to-implement technique based on high-pass filtered absolute humidity is developed to distinguish between predominantly katabatic, oceanic, and near-coastal air masses for characterization of trace gas and aerosol measurements at coastal East Antarctic sites.

Common Variant Burden Contributes to the Familial Aggregation of Migraine in 1,589 Families.

PubMed

Gormley, Padhraig; Kurki, Mitja I; Hiekkala, Marjo Eveliina; Veerapen, Kumar; Häppölä, Paavo; Mitchell, Adele A; Lal, Dennis; Palta, Priit; Surakka, Ida; Kaunisto, Mari Anneli; Hämäläinen, Eija; Vepsäläinen, Salli; Havanka, Hannele; Harno, Hanna; Ilmavirta, Matti; Nissilä, Markku; Säkö, Erkki; Sumelahti, Marja-Liisa; Liukkonen, Jarmo; Sillanpää, Matti; Metsähonkala, Liisa; Koskinen, Seppo; Lehtimäki, Terho; Raitakari, Olli; Männikkö, Minna; Ran, Caroline; Belin, Andrea Carmine; Jousilahti, Pekka; Anttila, Verneri; Salomaa, Veikko; Artto, Ville; Färkkilä, Markus; Runz, Heiko; Daly, Mark J; Neale, Benjamin M; Ripatti, Samuli; Kallela, Mikko; Wessman, Maija; Palotie, Aarno

2018-05-16

Complex traits, including migraine, often aggregate in families, but the underlying genetic architecture behind this is not well understood. The aggregation could be explained by rare, penetrant variants that segregate according to Mendelian inheritance or by the sufficient polygenic accumulation of common variants, each with an individually small effect, or a combination of the two hypotheses. In 8,319 individuals across 1,589 migraine families, we calculated migraine polygenic risk scores (PRS) and found a significantly higher common variant burden in familial cases (n = 5,317, OR = 1.76, 95% CI = 1.71-1.81, p = 1.7 × 10 -109 ) compared to population cases from the FINRISK cohort (n = 1,101, OR = 1.32, 95% CI = 1.25-1.38, p = 7.2 × 10 -17 ). The PRS explained 1.6% of the phenotypic variance in the population cases and 3.5% in the familial cases (including 2.9% for migraine without aura, 5.5% for migraine with typical aura, and 8.2% for hemiplegic migraine). The results demonstrate a significant contribution of common polygenic variation to the familial aggregation of migraine. Copyright © 2018 Elsevier Inc. All rights reserved.

A-to-I RNA editing is developmentally regulated and generally adaptive for sexual reproduction in Neurospora crassa

PubMed Central

Li, Yang; Chen, Daipeng; Qi, Zhaomei; Wang, Qinhu; Wang, Jianhua; Jiang, Cong; Xu, Jin-Rong

2017-01-01

Although fungi lack adenosine deaminase acting on RNA (ADAR) enzymes, adenosine to inosine (A-to-I) RNA editing was reported recently in Fusarium graminearum during sexual reproduction. In this study, we profiled the A-to-I editing landscape and characterized its functional and adaptive properties in the model filamentous fungus Neurospora crassa. A total of 40,677 A-to-I editing sites were identified, and approximately half of them displayed stage-specific editing or editing levels at different sexual stages. RNA-sequencing analysis with the Δstc-1 and Δsad-1 mutants confirmed A-to-I editing occurred before ascus development but became more prevalent during ascosporogenesis. Besides fungal-specific sequence and secondary structure preference, 63.5% of A-to-I editing sites were in the coding regions and 81.3% of them resulted in nonsynonymous recoding, resulting in a significant increase in the proteome complexity. Many genes involved in RNA silencing, DNA methylation, and histone modifications had extensive recoding, including sad-1, sms-3, qde-1, and dim-2. Fifty pseudogenes harbor premature stop codons that require A-to-I editing to encode full-length proteins. Unlike in humans, nonsynonymous editing events in N. crassa are generally beneficial and favored by positive selection. Almost half of the nonsynonymous editing sites in N. crassa are conserved and edited in Neurospora tetrasperma. Furthermore, hundreds of them are conserved in F. graminearum and had higher editing levels. Two unknown genes with editing sites conserved between Neurospora and Fusarium were experimentally shown to be important for ascosporogenesis. This study comprehensively analyzed A-to-I editing in N. crassa and showed that RNA editing is stage-specific and generally adaptive, and may be functionally related to repeat induced point mutation and meiotic silencing by unpaired DNA. PMID:28847945

Survey of familial glaucoma shows a high incidence of cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in non-consanguineous congenital forms in a Spanish population

PubMed Central

Millá, Elena; Mañé, Begoña; Duch, Susana; Hernan, Imma; Borràs, Emma; Planas, Ester; Dias, Miguel de Sousa; Carballo, Miguel

2013-01-01

Purpose To identify myocilin (MYOC) and cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in a Spanish population with different clinical forms of familial glaucoma or ocular hypertension (OHT). Methods Index patients from 226 families participated in this study. Patients were diagnosed with familial glaucoma or OHT by complete ophthalmologic examination. Screening for MYOC mutations was performed in 207 index patients: 96 with adult-onset primary open-angle glaucoma (POAG), 21 with primary congenital glaucoma (PCG), 18 with juvenile-onset open-angle glaucoma (JOAG), five with Axenfeld-Rieger syndrome (ARS), and 67 with other types of glaucoma. One hundred two of the families (including all those in whom a MYOC mutation was detected) were also screened for CYP1B1 mutations: 45 POAG, 25 PCG, 21 JOAG, four ARS, and seven others. Results We examined 292 individuals (patients and relatives) with a positive family history of glaucoma or OHT. We identified two novel MYOC variants, p.Lys39Arg and p.Glu218Lys, in two families with POAG, and six previously reported MYOC mutations in seven families with POAG (four), JOAG (one), PCG (one), and normotensive glaucoma (one). CYP1B1 mutations were found in 16 index patients with PCG (nine), POAG (three), JOAG (two), and ARS (two). Conclusions The high percentage (9/25=36%) of mutations in CYP1B1 found in non-consanguineous patients with congenital glaucoma mandates genetic testing. However, the percentage of mutations (9/207=4.4%) in MYOC associated with glaucoma is relatively low in our population. The variable phenotype expression of glaucoma, even in families, cannot be explained with a digenic mechanism between MYOC and CYP1B1. PMID:23922489

The MPS1 family of protein kinases.

PubMed

Liu, Xuedong; Winey, Mark

2012-01-01

MPS1 protein kinases are found widely, but not ubiquitously, in eukaryotes. This family of potentially dual-specific protein kinases is among several that regulate a number of steps of mitosis. The most widely conserved MPS1 kinase functions involve activities at the kinetochore in both the chromosome attachment and the spindle checkpoint. MPS1 kinases also function at centrosomes. Beyond mitosis, MPS1 kinases have been implicated in development, cytokinesis, and several different signaling pathways. Family members are identified by virtue of a conserved C-terminal kinase domain, though the N-terminal domain is quite divergent. The kinase domain of the human enzyme has been crystallized, revealing an unusual ATP-binding pocket. The activity, level, and subcellular localization of Mps1 family members are tightly regulated during cell-cycle progression. The mitotic functions of Mps1 kinases and their overexpression in some tumors have prompted the identification of Mps1 inhibitors and their active development as anticancer drugs.

The MPS1 Family of Protein Kinases

PubMed Central

Liu, Xuedong; Winey, Mark

2014-01-01

MPS1 protein kinases are found widely, but not ubiquitously, in eukaryotes. This family of potentially dual-specific protein kinases is among several that regulate a number of steps of mitosis. The most widely conserved MPS1 kinase functions involve activities at the kinetochore in both the chromosome attachment and the spindle checkpoint. MPS1 kinases also function at centrosomes. Beyond mitosis, MPS1 kinases have been implicated in development, cytokinesis, and several different signaling pathways. Family members are identified by virtue of a conserved C-terminal kinase domain, though the N-terminal domain is quite divergent. The kinase domain of the human enzyme has been crystallized, revealing an unusual ATP-binding pocket. The activity, level, and subcellular localization of Mps1 family members are tightly regulated during cell-cycle progression. The mitotic functions of Mps1 kinases and their overexpression in some tumors have prompted the identification of Mps1 inhibitors and their active development as anticancer drugs. PMID:22482908

26 CFR 1.1366-3 - Treatment of family groups.

Code of Federal Regulations, 2010 CFR

2010-04-01

... (CONTINUED) INCOME TAXES Small Business Corporations and Their Shareholders § 1.1366-3 Treatment of family groups. (a) In general. Under section 1366(e), if an individual, who is a member of the family of one or... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Treatment of family groups. 1.1366-3 Section 1...

26 CFR 1.1366-3 - Treatment of family groups.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 11 2011-04-01 2011-04-01 false Treatment of family groups. 1.1366-3 Section 1... of family groups. (a) In general. Under section 1366(e), if an individual, who is a member of the family of one or more shareholders of an S corporation, renders services for, or furnishes capital to...

Associations of family meal frequency with family meal habits and meal preparation characteristics among families of youth with type 1 diabetes.

PubMed

Kornides, M L; Nansel, T R; Quick, V; Haynie, D L; Lipsky, L M; Laffel, L M B; Mehta, S N

2014-05-01

While benefits of family mealtimes, such as improved dietary quality and increased family communication, have been well-documented in the general population, less is known about family meal habits that contribute to more frequent family meals in youth with type 1 diabetes. This cross-sectional study surveyed 282 youth ages 8-18 years with type 1 diabetes and their parents on measures regarding diabetes-related and dietary behaviours. T-tests determined significant differences in youth's diet quality, adherence to diabetes management and glycaemic control between those with and without regular family meals (defined as ≥ 5 meals per week). Logistic regression analyses determined unadjusted and adjusted associations of age, socio-demographics, family meal habits, and family meal preparation characteristics with regular family meals. 57% of parents reported having regular family meals. Families with regular family meals had significantly better diet quality as measured by the Healthy Eating Index (P < 0.05) and the NRF9.3 (P < 0.01), and adherence to diabetes management (P < 0.001); the difference in glycaemic control approached statistical significance (P = 0.06). Priority placed on, pleasant atmosphere and greater structure around family meals were each associated with regular family meals (P < 0.05). Meals prepared at home were positively associated with regular family meals, while convenience and fast foods were negatively associated (P < 0.05). Families in which at least one parent worked part-time or stayed at home were significantly more likely to have regular family meals than families in which both parents worked full-time (P < 0.05). In the multivariate logistic regression model, greater parental priority given to family mealtimes (P < 0.001) and more home-prepared meals (P < 0.001) predicted occurrence of regular family meals; adjusting for parent work status and other family meal habits. Strategies for promoting families meals should not only highlight

Associations of family meal frequency with family meal habits and meal preparation characteristics among families of youth with type 1 diabetes

PubMed Central

Kornides, M. L.; Nansel, T. R.; Quick, V.; Haynie, D. L.; Lipsky, L. M.; Laffel, L. M. B.; Mehta, S. N.

2014-01-01

Background While benefits of family mealtimes, such as improved dietary quality and increased family communication, have been well-documented in the general population, less is known about family meal habits that contribute to more frequent family meals in youth with type 1 diabetes. Methods This cross-sectional study surveyed 282 youth ages 8–18 years with type 1 diabetes and their parents on measures regarding diabetes-related and dietary behaviours. T-tests determined significant differences in youth's diet quality, adherence to diabetes management and glycaemic control between those with and without regular family meals (defined as ≥5 meals per week). Logistic regression analyses determined unadjusted and adjusted associations of age, socio-demographics, family meal habits, and family meal preparation characteristics with regular family meals. Results 57% of parents reported having regular family meals. Families with regular family meals had significantly better diet quality as measured by the Healthy Eating Index (P < 0.05) and the NRF9.3 (P < 0.01), and adherence to diabetes management (P < 0.001); the difference in glycaemic control approached statistical significance (P = 0.06). Priority placed on, pleasant atmosphere and greater structure around family meals were each associated with regular family meals (P < 0.05). Meals prepared at home were positively associated with regular family meals, while convenience and fast foods were negatively associated (P < 0.05). Families in which at least one parent worked part-time or stayed at home were significantly more likely to have regular family meals than families in which both parents worked full-time (P < 0.05). In the multivariate logistic regression model, greater parental priority given to family mealtimes (P < 0.001) and more home-prepared meals (P < 0.001) predicted occurrence of regular family meals; adjusting for parent work status and other family meal habits. Conclusions Strategies for promoting

24 CFR 510.1 - Multi-family property loans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Multi-family property loans. 510.1 Section 510.1 Housing and Urban Development Regulations Relating to Housing and Urban Development...-family property loans. (a) In cases in which a corporation is a borrower on a section 312 loan, the...

Extreme variability among mammalian V1R gene families.

PubMed

Young, Janet M; Massa, Hillary F; Hsu, Li; Trask, Barbara J

2010-01-01

We report an evolutionary analysis of the V1R gene family across 37 mammalian genomes. V1Rs comprise one of three chemosensory receptor families expressed in the vomeronasal organ, and contribute to pheromone detection. We first demonstrate that Trace Archive data can be used effectively to determine V1R family sizes and to obtain sequences of most V1R family members. Analyses of V1R sequences from trace data and genome assemblies show that species-specific expansions previously observed in only eight species were prevalent throughout mammalian evolution, resulting in "semi-private" V1R repertoires for most mammals. The largest families are found in mouse and platypus, whose V1R repertoires have been published previously, followed by mouse lemur and rabbit (approximately 215 and approximately 160 intact V1Rs, respectively). In contrast, two bat species and dolphin possess no functional V1Rs, only pseudogenes, and suffered inactivating mutations in the vomeronasal signal transduction gene Trpc2. We show that primate V1R decline happened prior to acquisition of trichromatic vision, earlier during evolution than was previously thought. We also show that it is extremely unlikely that decline of the dog V1R repertoire occurred in response to selective pressures imposed by humans during domestication. Functional repertoire sizes in each species correlate roughly with anatomical observations of vomeronasal organ size and quality; however, no single ecological correlate explains the very diverse fates of this gene family in different mammalian genomes. V1Rs provide one of the most extreme examples observed to date of massive gene duplication in some genomes, with loss of all functional genes in other species.

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African

Nucleic Acid Immunity.

PubMed

Hartmann, G

2017-01-01

Organisms throughout biology need to maintain the integrity of their genome. From bacteria to vertebrates, life has established sophisticated mechanisms to detect and eliminate foreign genetic material or to restrict its function and replication. Tremendous progress has been made in the understanding of these mechanisms which keep foreign or unwanted nucleic acids from viruses or phages in check. Mechanisms reach from restriction-modification systems and CRISPR/Cas in bacteria and archaea to RNA interference and immune sensing of nucleic acids, altogether integral parts of a system which is now appreciated as nucleic acid immunity. With inherited receptors and acquired sequence information, nucleic acid immunity comprises innate and adaptive components. Effector functions include diverse nuclease systems, intrinsic activities to directly restrict the function of foreign nucleic acids (e.g., PKR, ADAR1, IFIT1), and extrinsic pathways to alert the immune system and to elicit cytotoxic immune responses. These effects act in concert to restrict viral replication and to eliminate virus-infected cells. The principles of nucleic acid immunity are highly relevant for human disease. Besides its essential contribution to antiviral defense and restriction of endogenous retroelements, dysregulation of nucleic acid immunity can also lead to erroneous detection and response to self nucleic acids then causing sterile inflammation and autoimmunity. Even mechanisms of nucleic acid immunity which are not established in vertebrates are relevant for human disease when they are present in pathogens such as bacteria, parasites, or helminths or in pathogen-transmitting organisms such as insects. This review aims to provide an overview of the diverse mechanisms of nucleic acid immunity which mostly have been looked at separately in the past and to integrate them under the framework nucleic acid immunity as a basic principle of life, the understanding of which has great potential to

Familial recurrences of FOXG1-related disorder: Evidence for mosaicism.

PubMed

McMahon, Kelly Q; Papandreou, Apostolos; Ma, Mandy; Barry, Brenda J; Mirzaa, Ghayda M; Dobyns, William B; Scott, Richard H; Trump, Natalie; Kurian, Manju A; Paciorkowski, Alex R

2015-12-01

FOXG1-related disorders are caused by heterozygous mutations in FOXG1 and result in a spectrum of neurodevelopmental phenotypes including postnatal microcephaly, intellectual disability with absent speech, epilepsy, chorea, and corpus callosum abnormalities. The recurrence risk for de novo mutations in FOXG1-related disorders is assumed to be low. Here, we describe three unrelated sets of full siblings with mutations in FOXG1 (c.515_577del63, c.460dupG, and c.572T > G), representing familial recurrence of the disorder. In one family, we have documented maternal somatic mosaicism for the FOXG1 mutation, and all of the families presumably represent parental gonadal (or germline) mosaicism. To our knowledge, mosaicism has not been previously reported in FOXG1-related disorders. Therefore, this report provides evidence that germline mosaicism for FOXG1 mutations is a likely explanation for familial recurrence and should be considered during recurrence risk counseling for families of children with FOXG1-related disorders. © 2015 Wiley Periodicals, Inc.

TIM-family proteins inhibit HIV-1 release

PubMed Central

Li, Minghua; Ablan, Sherimay D.; Miao, Chunhui; Zheng, Yi-Min; Fuller, Matthew S.; Rennert, Paul D.; Maury, Wendy; Johnson, Marc C.; Freed, Eric O.; Liu, Shan-Lu

2014-01-01

Accumulating evidence indicates that T-cell immunoglobulin (Ig) and mucin domain (TIM) proteins play critical roles in viral infections. Herein, we report that the TIM-family proteins strongly inhibit HIV-1 release, resulting in diminished viral production and replication. Expression of TIM-1 causes HIV-1 Gag and mature viral particles to accumulate on the plasma membrane. Mutation of the phosphatidylserine (PS) binding sites of TIM-1 abolishes its ability to block HIV-1 release. TIM-1, but to a much lesser extent PS-binding deficient mutants, induces PS flipping onto the cell surface; TIM-1 is also found to be incorporated into HIV-1 virions. Importantly, TIM-1 inhibits HIV-1 replication in CD4-positive Jurkat cells, despite its capability of up-regulating CD4 and promoting HIV-1 entry. In addition to TIM-1, TIM-3 and TIM-4 also block the release of HIV-1, as well as that of murine leukemia virus (MLV) and Ebola virus (EBOV); knockdown of TIM-3 in differentiated monocyte-derived macrophages (MDMs) enhances HIV-1 production. The inhibitory effects of TIM-family proteins on virus release are extended to other PS receptors, such as Axl and RAGE. Overall, our study uncovers a novel ability of TIM-family proteins to block the release of HIV-1 and other viruses by interaction with virion- and cell-associated PS. Our work provides new insights into a virus-cell interaction that is mediated by TIMs and PS receptors. PMID:25136083

BRCA1-linked marker in postmenopausal breast cancer families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folsom, A.R.; Chen, P.L.; Sellers, T.A.

1994-09-01

A majority of breast and ovarian cancer families and half of the early-onset breast cancer families are linked to markers on 17q (BRCA1). While linkage has been demonstrated in families with premenopausal disease, few studies have tested these markers in families with postmenopausal breast cancer. In the Iowa Women`s Health Study, a population-based study of over 42,000 women, an association of waist-to-hip ratio (WHR) with the risk of postmenopausal breast cancer was found predominantly in women with a positive family history -- this interaction was associated with a 3.2-fold elevated risk. This effect was even more pronounced when the definitionmore » of family history included breast and ovarian cancer, known to be linked to 17q markers. We evaluated evidence for linkage with D17S579, a BRCA-1-linked marker, in 13 families in which the index case had postmenopausal breast cancer. Genotyping for alleles at D17S579 was performed on 84 blood samples. Linkage analysis assumed that the breast cancer trait had an autosomal dominant mode of inheritance with a penetrance of 80%. For the 13 families studied, the maximum lod score was 0.29 at a theta of 0.27. There was significant evidence against tight linkage of breast cancer with D17S579 (theta<0.4). Heterogeneity analysis suggested evidence for the presence of both linked and unlinked families. Partitioning informative families on WHR of the index case suggested heterogeneity. These data suggest that, in a subset of families identified by a postmenopausal breast cancer proband, risk of breast cancer may be mediated by BRCA1, with heterogeneity defined by WHR.« less

Chlamydomonas reinhardtii LFO1 Is an IsdG Family Heme Oxygenase

DOE PAGES

Lojek, Lisa J.; Farrand, Allison J.; Wisecaver, Jennifer H.; ...

2017-08-16

Heme is essential for respiration across all domains of life. However, heme accumulation can lead to toxicity if cells are unable to either degrade or export heme or its toxic by-products. Under aerobic conditions, heme degradation is performed by heme oxygenases, enzymes which utilize oxygen to cleave the tetrapyrrole ring of heme. The HO-1 family of heme oxygenases has been identified in both bacterial and eukaryotic cells, whereas the IsdG family has thus far been described only in bacteria. We identified a hypothetical protein in the eukaryotic green alga Chlamydomonas reinhardtii, which encodes a protein containing an antibiotic biosynthesis monooxygenasemore » (ABM) domain consistent with those associated with IsdG family members. This protein, which we have named LFO1, degrades heme, contains similarities in predicted secondary structures to IsdG family members, and retains the functionally conserved catalytic residues found in all IsdG family heme oxygenases. These data establish LFO1 as an IsdG family member and extend our knowledge of the distribution of IsdG family members beyond bacteria. To gain further insight into the distribution of the IsdG family, we used the LFO1 sequence to identify 866 IsdG family members, including representatives from all domains of life. These results indicate that the distribution of IsdG family heme oxygenases is more expansive than previously appreciated, underscoring the broad relevance of this enzyme family. This work establishes a protein in the freshwater alga Chlamydomonas reinhardtii as an IsdG family heme oxygenase. This protein, LFO1, exhibits predicted secondary structure and catalytic residues conserved in IsdG family members, in addition to a chloroplast localization sequence. Additionally, the catabolite that results from the degradation of heme by LFO1 is distinct from that of other heme degradation products. Using LFO1 as a seed, we performed phylogenetic analysis, revealing that the IsdG family is

Chlamydomonas reinhardtii LFO1 Is an IsdG Family Heme Oxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lojek, Lisa J.; Farrand, Allison J.; Wisecaver, Jennifer H.

Heme is essential for respiration across all domains of life. However, heme accumulation can lead to toxicity if cells are unable to either degrade or export heme or its toxic by-products. Under aerobic conditions, heme degradation is performed by heme oxygenases, enzymes which utilize oxygen to cleave the tetrapyrrole ring of heme. The HO-1 family of heme oxygenases has been identified in both bacterial and eukaryotic cells, whereas the IsdG family has thus far been described only in bacteria. We identified a hypothetical protein in the eukaryotic green alga Chlamydomonas reinhardtii, which encodes a protein containing an antibiotic biosynthesis monooxygenasemore » (ABM) domain consistent with those associated with IsdG family members. This protein, which we have named LFO1, degrades heme, contains similarities in predicted secondary structures to IsdG family members, and retains the functionally conserved catalytic residues found in all IsdG family heme oxygenases. These data establish LFO1 as an IsdG family member and extend our knowledge of the distribution of IsdG family members beyond bacteria. To gain further insight into the distribution of the IsdG family, we used the LFO1 sequence to identify 866 IsdG family members, including representatives from all domains of life. These results indicate that the distribution of IsdG family heme oxygenases is more expansive than previously appreciated, underscoring the broad relevance of this enzyme family. This work establishes a protein in the freshwater alga Chlamydomonas reinhardtii as an IsdG family heme oxygenase. This protein, LFO1, exhibits predicted secondary structure and catalytic residues conserved in IsdG family members, in addition to a chloroplast localization sequence. Additionally, the catabolite that results from the degradation of heme by LFO1 is distinct from that of other heme degradation products. Using LFO1 as a seed, we performed phylogenetic analysis, revealing that the IsdG family is

Community forum. 1. Family planning. Palaces of advice.

PubMed

Bunting, J

1983-01-19

Completed questionnaires were collected from 130 respondents attending child health clinics (CHCs) in Corringham, Stanford, East Tilbury, and Billericay to investigate the source chosen by patients using CHCs for family planning information and materials, and why they made this choice. Criteria for inclusion were that all subjects were attending a CHC and by definition had at least 1 child; all subjects were female and of reproductive age; and all were at that time using some family planning method. 23 respondents indicated that they went to more than 1 source for advice. No respondents went to their midwife and only 4% sought the advice of their health visitor. Approximately equal proportions of respondents indicated that they went to their general practitioner and to family planning clinics, these 2 groups together forming 4/5 of all answers. 8% of respondents indicated they were dissatisfied with the advice given or obtained. 24 respondents (partners) used the condom, 56 oral contraceptives, 5 the IUD, 9 the diaphragm, 2 the condom and rhythm, 1 the condom and withdrawal, 1 withdrawal, and 2 partners had had a vasectomy. In the Essex statistics, in addition 5% were not using any method of contraception and 1% were using chemicals only. The most interesting variation between this study and the Essex Family Planning Center statistics are: almost twice as many study respondents use the condom and 3 times as many Essex clients as survey patients use the IUD. 1/5 expressed dissatisfaction with their method of contraception. Respondents obtained their supplies free in equal numbers from the Family Planning Center and family doctor, but 19% chose or were forced by circumstances to pay for their supplies. 73% reported no problems in getting supplies; 7% indicated problems and 20% did not respond to this question. Criticism can be divided into 3 categories: variation in cost of supplies between sources of service; clinic too far away; and occasionally an overnight wait

Function of the family-9 and family-22 carbohydrate-binding modules in a modular beta-1,3-1,4-glucanase/xylanase derived from Clostridium stercorarium Xyn10B.

PubMed

Zhao, Guangshan; Ali, Ehsan; Araki, Rie; Sakka, Makiko; Kimura, Tetsuya; Sakka, Kazuo

2005-08-01

Clostridium stercorarium Xyn10B having hydrolytic activities on xylan and beta-1,3-1,4-glucan is a modular enzyme composed of two family-22 carbohydrate-binding modules (CBMs), a family-10 catalytic module of the glycoside hydrolases, a family-9 CBM, and two S-layer homologous modules, consecutively from the N-terminus. We investigated the function of family-9 and family-22 CBMs in a modular enzyme by comparing the enzymatic properties of a truncated enzyme composed of two family-22 CBMs and the catalytic module (rCBM22-CM), an enzyme composed of the catalytic module and family-9 CBM (rCM-CBM9), an enzyme composed of two family-22 CBMs, the catalytic module, and family-9 CBM (rCBM22-CM-CBM9), and the catalytic module polypeptide (rCM). Although the addition of family-9 CBM to rCM and rCBM22-CM did not significantly change catalytic activity toward xylan and beta-1,3-1,4-glucan, the addition of family-22 CBM to rCM and rCM-CBM9 drastically enhanced catalytic activity toward xylan and especially beta-1,3-1,4-glucan. Furthermore, the addition of family-22 CBM to rCM and rCM-CBM9 shifted the optimum temperature from 65 degrees C to 75 degrees C, but that of family-9 CBM to rCM and rCBM22-CM did not affect the optimum temperature. These facts suggest that the enzyme properties of Xyn10B were mainly dependent on the presence of the family-22 CBMs but not family-9 CBM.

Family resources study: part 1: family resources, family function and caregiver strain in childhood cancer

PubMed Central

2011-01-01

Background Severe illness can disrupt family life, cause family dysfunction, strain resources, and cause caregiver burden. The family's ability to cope with crises depends on their resources. This study sought to assess families of children with cancer in terms of family function-dysfunction, family caregiver strain and the adequacy of family resources using a new family resources assessment instrument. Methods This is a cross-sectional study involving 90 Filipino family caregivers of children undergoing cancer treatment. This used a self-administered questionnaire composed of a new 12-item family resources questionnaire (SCREEM-RES) based on the SCREEM method of analysis, Family APGAR to assess family function-dysfunction; and Modified Caregiver Strain Index to assess strain in caring for the patient. Results More than half of families were either moderately or severely dysfunctional. Close to half of caregivers were either predisposed to strain or experienced severe strain, majority disclosed that their families have inadequate economic resources; many also report inaccessibility to medical help in the community and insufficient educational resources to understand and care for their patients. Resources most often reported as adequate were: family's faith and religion; help from within the family and from health providers. SCREEM-RES showed to be reliable with Cronbach's alpha of 0.80. There is good inter-item correlation between items in each domain: 0.24-0.70. Internal consistency reliability for each domain was also good: 0.40-0.92. Using 2-point scoring system, Cronbach's alpha were slightly lower: full scale (0.70) and for each domain 0.26-.82. Results showed evidence of association between family resources and family function based on the family APGAR but none between family resources and caregiver strain and between family function and caregiver strain. Conclusion Many Filipino families of children with cancer have inadequate resources, especially economic

Family resources study: part 1: family resources, family function and caregiver strain in childhood cancer.

PubMed

Panganiban-Corales, Avegeille T; Medina, Manuel F

2011-10-31

Severe illness can disrupt family life, cause family dysfunction, strain resources, and cause caregiver burden. The family's ability to cope with crises depends on their resources. This study sought to assess families of children with cancer in terms of family function-dysfunction, family caregiver strain and the adequacy of family resources using a new family resources assessment instrument. This is a cross-sectional study involving 90 Filipino family caregivers of children undergoing cancer treatment. This used a self-administered questionnaire composed of a new 12-item family resources questionnaire (SCREEM-RES) based on the SCREEM method of analysis, Family APGAR to assess family function-dysfunction; and Modified Caregiver Strain Index to assess strain in caring for the patient. More than half of families were either moderately or severely dysfunctional. Close to half of caregivers were either predisposed to strain or experienced severe strain, majority disclosed that their families have inadequate economic resources; many also report inaccessibility to medical help in the community and insufficient educational resources to understand and care for their patients. Resources most often reported as adequate were: family's faith and religion; help from within the family and from health providers. SCREEM-RES showed to be reliable with Cronbach's alpha of 0.80. There is good inter-item correlation between items in each domain: 0.24-0.70. Internal consistency reliability for each domain was also good: 0.40-0.92. Using 2-point scoring system, Cronbach's alpha were slightly lower: full scale (0.70) and for each domain 0.26-.82. Results showed evidence of association between family resources and family function based on the family APGAR but none between family resources and caregiver strain and between family function and caregiver strain. Many Filipino families of children with cancer have inadequate resources, especially economic; and are moderately or severely

Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

PubMed

Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

2017-06-09

Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

26 CFR 1.1366-3 - Treatment of family groups.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 11 2014-04-01 2014-04-01 false Treatment of family groups. 1.1366-3 Section 1.1366-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX... of family groups. (a) In general. Under section 1366(e), if an individual, who is a member of the...

26 CFR 1.1366-3 - Treatment of family groups.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 11 2012-04-01 2012-04-01 false Treatment of family groups. 1.1366-3 Section 1.1366-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX... of family groups. (a) In general. Under section 1366(e), if an individual, who is a member of the...

An unconventional family 1 uracil DNA glycosylase in Nitratifractor salsuginis.

PubMed

Li, Jing; Chen, Ran; Yang, Ye; Zhang, Zhemin; Fang, Guang-Chen; Xie, Wei; Cao, Weiguo

2017-12-01

The uracil DNA glycosylase superfamily consists of at least six families with a diverse specificity toward DNA base damage. Family 1 uracil N-glycosylase (UNG) exhibits exclusive specificity on uracil-containing DNA. Here, we report a family 1 UNG homolog from Nitratifractor salsuginis with distinct biochemical features that differentiate it from conventional family 1 UNGs. Globally, the crystal structure of N. salsuginisUNG shows a few additional secondary structural elements. Biochemical and enzyme kinetic analysis, coupled with structural determination, molecular modeling, and molecular dynamics simulations, shows that N. salsuginisUNG contains a salt bridge network that plays an important role in DNA backbone interactions. Disruption of the amino acid residues involved in the salt bridges greatly impedes the enzymatic activity. A tyrosine residue in motif 1 (GQDPY) is one of the distinct sequence features setting family 1 UNG apart from other families. The crystal structure of Y81G mutant indicates that several subtle changes may account for its inactivity. Unlike the conventional family 1 UNG enzymes, N. salsuginisUNG is not inhibited by Ugi, a potent inhibitor specific for family 1 UNG. This study underscores the diversity of paths that a uracil DNA glycosylase may take to acquire its unique structural and biochemical properties during evolution. Structure data are available in the PDB under accession numbers 5X3G and 5X3H. © 2017 Federation of European Biochemical Societies.

Family Aggregation of Human T-Lymphotropic Virus 1-Associated Diseases: A Systematic Review

PubMed Central

Alvarez, Carolina; Gotuzzo, Eduardo; Vandamme, Anne-Mieke; Verdonck, Kristien

2016-01-01

Human T-lymphotropic virus 1 (HTLV-1) is a retrovirus that produces a persistent infection. Two transmission routes (from mother to child and via sexual intercourse) favor familial clustering of HTLV-1. It is yet unknown why most HTLV-1 carriers remain asymptomatic while about 10% of them develop complications. HTLV-1 associated diseases were originally described as sporadic entities, but familial presentations have been reported. To explore what is known about family aggregation of HTLV-1-associated diseases we undertook a systematic review. We aimed at answering whether, when, and where family aggregation of HTLV-1-associated diseases was reported, which relatives were affected and which hypotheses were proposed to explain aggregation. We searched MEDLINE, abstract books of HTLV conferences and reference lists of selected papers. Search terms used referred to HTLV-1 infection, and HTLV-1-associated diseases, and family studies. HTLV-1-associated diseases considered are adult T-cell leukemia/lymphoma (ATLL), HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), HTLV-1-associated uveitis, and infective dermatitis. Seventy-four records reported HTLV-1-associated diseases in more than one member of the same family and were included. Most reports came from HTLV-1-endemic countries, mainly Japan (n = 30) and Brazil (n = 10). These reports described a total of 270 families in which more than one relative had HTLV-1-associated diseases. In most families, different family members suffered from the same disease (n = 223). The diseases most frequently reported were ATLL (115 families) and HAM/TSP (102 families). Most families (n = 144) included two to four affected individuals. The proportion of ATLL patients with family history of ATLL ranged from 2 to 26%. The proportion of HAM/TSP patients with family history of HAM/TSP ranged from 1 to 48%. The predominant cluster types for ATLL were clusters of siblings and parent-child pairs and for HAM/TSP, an affected

Family Aggregation of Human T-Lymphotropic Virus 1-Associated Diseases: A Systematic Review.

PubMed

Alvarez, Carolina; Gotuzzo, Eduardo; Vandamme, Anne-Mieke; Verdonck, Kristien

2016-01-01

Human T-lymphotropic virus 1 (HTLV-1) is a retrovirus that produces a persistent infection. Two transmission routes (from mother to child and via sexual intercourse) favor familial clustering of HTLV-1. It is yet unknown why most HTLV-1 carriers remain asymptomatic while about 10% of them develop complications. HTLV-1 associated diseases were originally described as sporadic entities, but familial presentations have been reported. To explore what is known about family aggregation of HTLV-1-associated diseases we undertook a systematic review. We aimed at answering whether, when, and where family aggregation of HTLV-1-associated diseases was reported, which relatives were affected and which hypotheses were proposed to explain aggregation. We searched MEDLINE, abstract books of HTLV conferences and reference lists of selected papers. Search terms used referred to HTLV-1 infection, and HTLV-1-associated diseases, and family studies. HTLV-1-associated diseases considered are adult T-cell leukemia/lymphoma (ATLL), HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), HTLV-1-associated uveitis, and infective dermatitis. Seventy-four records reported HTLV-1-associated diseases in more than one member of the same family and were included. Most reports came from HTLV-1-endemic countries, mainly Japan ( n = 30) and Brazil ( n = 10). These reports described a total of 270 families in which more than one relative had HTLV-1-associated diseases. In most families, different family members suffered from the same disease ( n = 223). The diseases most frequently reported were ATLL (115 families) and HAM/TSP (102 families). Most families ( n = 144) included two to four affected individuals. The proportion of ATLL patients with family history of ATLL ranged from 2 to 26%. The proportion of HAM/TSP patients with family history of HAM/TSP ranged from 1 to 48%. The predominant cluster types for ATLL were clusters of siblings and parent-child pairs and for HAM/TSP, an

Impact of type 1 diabetes mellitus on the family is reduced with the medical home, care coordination, and family-centered care.

PubMed

Katz, Michelle L; Laffel, Lori M; Perrin, James M; Kuhlthau, Karen

2012-05-01

To examine whether the medical home, care coordination, or family-centered care was associated with less impact of type 1 diabetes mellitus (T1D) on families' work, finances, time, and school attendance. With the 2005 to 2006 National Survey of Children with Special Health Care Needs, we compared impact in children with T1D (n = 583) with that in children with other special health care needs (n = 39 944) and children without special health care needs (n = 4945). We modeled the associations of the medical home, care coordination, and family-centered care with family impact in T1D. Seventy-five percent of families of children with T1D reported a major impact compared with 45% of families of children with special health care needs (P < .0001) and 17% of families of children without special health care needs (P < .0001). In families of children with T1D, 35% reported restricting work, 38% reported financial impact, 41% reported medical expenses >$1000/year, 24% reported spending ≥11 hours/week caring or coordination care, and 20% reported ≥11 school absences/year. The medical home, care coordination, and family-centered care were associated with less work and financial impact. In childhood T1D, most families experience major impact. Better systems of health care delivery may help families reduce some of this impact. Copyright © 2012 Mosby, Inc. All rights reserved.

Familial cancer associated with a polymorphism in ARLTS1.

PubMed

Calin, George Adrian; Trapasso, Francesco; Shimizu, Masayoshi; Dumitru, Calin Dan; Yendamuri, Sai; Godwin, Andrew K; Ferracin, Manuela; Bernardi, Guido; Chatterjee, Devjani; Baldassarre, Gustavo; Rattan, Shashi; Alder, Hansjuerg; Mabuchi, Hideaki; Shiraishi, Takeshi; Hansen, Lise Lotte; Overgaard, Jens; Herlea, Vlad; Mauro, Francesca Romana; Dighiero, Guillaume; Movsas, Benjamin; Rassenti, Laura; Kipps, Thomas; Baffa, Raffaele; Fusco, Alfredo; Mori, Masaki; Russo, Giandomenico; Liu, Chang-Gong; Neuberg, Donna; Bullrich, Florencia; Negrini, Massimo; Croce, Carlo M

2005-04-21

The finding of hemizygous or homozygous deletions at band 14 on chromosome 13 in a variety of neoplasms suggests the presence of a tumor-suppressor locus telomeric to the RB1 gene. We studied samples from 216 patients with various types of sporadic tumors or idiopathic pancytopenia, peripheral-blood samples from 109 patients with familial cancer or multiple cancers, and control blood samples from 475 healthy people or patients with diseases other than cancer. We performed functional studies of cell lines lacking ARLTS1 expression with the use of both the full-length ARLTS1 gene and a truncated variant. We found a gene at 13q14, ARLTS1, a member of the ADP-ribosylation factor family, with properties of a tumor-suppressor gene. We analyzed 800 DNA samples from tumors and blood cells from patients with sporadic or familial cancer and controls and found that the frequency of a nonsense polymorphism, G446A (Trp149Stop), was similar in controls and patients with sporadic tumors but was significantly more common among patients with familial cancer than among those in the other two groups (P=0.02; odds ratio, 5.7; 95 percent confidence interval, 1.3 to 24.8). ARLTS1 was down-regulated by promoter methylation in 25 percent of the primary tumors we analyzed. Transfection of wild-type ARLTS1 into A549 lung-cancer cells suppressed tumor formation in immunodeficient mice and induced apoptosis, whereas transfection of truncated ARLTS1 had a limited effect on apoptosis and tumor suppression. Microarray analysis revealed that the wild-type and Trp149Stop-transfected clones had different expression profiles. A genetic variant of ARLTS1 predisposes patients to familial cancer. Copyright 2005 Massachusetts Medical Society.

New constraints on the Neogene plate kinematics of West and East Antarctica

NASA Astrophysics Data System (ADS)

Granot, R.; Dyment, J.; Szitkar, F.

2016-12-01

The motion between East and West Antarctic Plates during the last 26 million years (post-Adare seafloor spreading) is loosely constrained, and although it is often considered negligible, accumulating observations from along the rift system suggest that significant faulting and transtensional motion have occurred in that period. Part of the reason for this uncertainty is the complicated kinematic evolution of the oceanic crust found north of the Ross Sea and the lack of proper magnetic anomaly data at key tectonic locations. We have conducted a series of two cruises (TACT project) aboard M/V L'Astrolabe, the supply ship of Dumont d'Urville French Antarctic station, in February-March of 2012 and 2016 during which we have acquired total field magnetic profiles oriented along flowline direction and straddling the Tasman spreading corridor, located between Tasmania and the Balleny Islands and the Tasman and Balleny FZs. The new data allow us to refine the overall motion of the Macquarie Plate relative to Australia. After correction of this motion, the Tasman corridor, lying west of the Balleny FZ uncovers the Australia-East Antarctic plate motion, and the Balleny corridor, lying east of the FZ uncovers the Australia-West Antarctic plate motion, reveal a mismatched anomaly pattern that result from the Neogene relative plate motion between East and West Antarctica. We combine these new observations together with geological constraints from within the west Antarctic rift system to compute new rotation parameters that describe the relative plate motion between West and East Antarctica for the last 26 million years.

17 CFR 275.202(a)(11)(G)-1 - Family offices.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Family offices. 275.202(a)(11)(G)-1 Section 275.202(a)(11)(G)-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT ADVISERS ACT OF 1940 § 275.202(a)(11)(G)-1 Family...

Spectrum of SMARCB1/INI1 Mutations in Familial and Sporadic Rhabdoid Tumors

PubMed Central

Eaton, Katherine W.; Tooke, Laura S.; Wainwright, Luanne M.; Judkins, Alexander R.; Biegel, Jaclyn A.

2011-01-01

Background Germline mutations and deletions of SMARCB1/INI1 in chromosome band 22q11.2 predispose patients to rhabdoid tumor and schwannomatosis. Previous estimates suggested that 15–20% of rhabdoid tumors were caused by an underlying germline abnormality of SMARCB1. However, these studies were limited by case selection and an inability to detect intragenic deletions and duplications. Procedure One hundred matched tumor and blood samples from patients with rhabdoid tumors of the brain, kidney, or soft tissues were analyzed for mutations and deletions of SMARCB1 by FISH, multiplex ligation-dependent probe amplification (MLPA), sequence analysis and high resolution Illumina 610K SNP based oligonucleotide array studies. Results Thirty-five of 100 patients were found to have a germline SMARCB1 abnormality. These abnormalities included point and frameshift mutations, intragenic deletions and duplications, and larger deletions including regions both proximal and distal to SMARCB1. There were 9 cases that demonstrated parent to child transmission of a mutated copy of SMARCB1. In 8 of the 9 cases, one or more family members were also diagnosed with rhabdoid tumor or schwannoma, and 2 of the 8 families presented with multiple affected children in a manner consistent with gonadal mosaicism. Conclusions Approximately one third of newly diagnosed patients with rhabdoid tumor have an underlying genetic predisposition to tumors due to a germline SMARCB1 alteration. Families may demonstrate incomplete penetrance and gonadal mosaicism, which must be considered when counseling families of patients with rhabdoid tumor. PMID:21108436

[Prenatal diagnosis of Thailand deletion of α-thalassemia 1 families].

PubMed

Lin, N; Lin, Y; Huang, H L; Lin, X L; He, D Q; He, S Q; Guo, D H; Li, Y; Xu, L P

2016-06-28

To conduct analysis and prenatal diagnosis on 11 couples carrying Thailand deletion (--(THΑI)) α-thalassemia 1, so as to provide information for clinical genetic counseling on α-thalassemia 1. Altogether 11 Thailand deletion (--(THΑI)) α-thalassemia 1 families were collected from Fujian Maternal and Children Health Hospital from May 2009 to September 2015. Gap-polymerase chain reaction (gap-PCR) and reverse dot blot (RDB) technology were used to detect the thalassemia mutations in the couples and fetuses. In one family, Thailand deletion α-thalassemia 1 was detected in both the pregnant woman and her husband. In 10 families, Thailand deletion α-thalassemia 1 was detected in either the pregnant women or the husband, while the spouses had α-thalassemia heterozygote (1 combined with β thalassemia heterozygote). Thailand deletion α-thalassemia 1 family members all had lower mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH). In prenatal diagnosis of the 12 fetuses, 4 fetuses were found with hemoglobin(Hb) Bart's hydrops fetalis syndrome, 5 were with α-thalassemia heterozygote, and 3 were normal. For couples with positive hematological phenotype but normal results in routine genetic examination of α-thalassemia, attention should be paid especially for with a history of having babies of hydrops fetalis syndrome or hemoglobin H disease. It is necessary to consider the possibility of the rare Thailand deletion (--(THΑI)) α-thalassemia 1. Prenatal diagnosis for high-risk families plays an important role.

Rare Variants in RTEL1 Are Associated with Familial Interstitial Pneumonia

PubMed Central

Cogan, Joy D.; Zhao, Min; Mitchell, Daphne B.; Rives, Lynette; Markin, Cheryl; Garnett, Errine T.; Montgomery, Keri H.; Mason, Wendi R.; McKean, David F.; Powers, Julia; Murphy, Elissa; Olson, Lana M.; Choi, Leena; Cheng, Dong-Sheng; Blue, Elizabeth Marchani; Young, Lisa R.; Lancaster, Lisa H.; Steele, Mark P.; Brown, Kevin K.; Schwarz, Marvin I.; Fingerlin, Tasha E.; Schwartz, David A.; Lawson, William E.; Loyd, James E.; Zhao, Zhongming; Phillips, John A.; Blackwell, Timothy S.

2015-01-01

Rationale: Up to 20% of cases of idiopathic interstitial pneumonia cluster in families, comprising the syndrome of familial interstitial pneumonia (FIP); however, the genetic basis of FIP remains uncertain in most families. Objectives: To determine if new disease-causing rare genetic variants could be identified using whole-exome sequencing of affected members from FIP families, providing additional insights into disease pathogenesis. Methods: Affected subjects from 25 kindreds were selected from an ongoing FIP registry for whole-exome sequencing from genomic DNA. Candidate rare variants were confirmed by Sanger sequencing, and cosegregation analysis was performed in families, followed by additional sequencing of affected individuals from another 163 kindreds. Measurements and Main Results: We identified a potentially damaging rare variant in the gene encoding for regulator of telomere elongation helicase 1 (RTEL1) that segregated with disease and was associated with very short telomeres in peripheral blood mononuclear cells in 1 of 25 families in our original whole-exome sequencing cohort. Evaluation of affected individuals in 163 additional kindreds revealed another eight families (4.7%) with heterozygous rare variants in RTEL1 that segregated with clinical FIP. Probands and unaffected carriers of these rare variants had short telomeres (<10% for age) in peripheral blood mononuclear cells and increased T-circle formation, suggesting impaired RTEL1 function. Conclusions: Rare loss-of-function variants in RTEL1 represent a newly defined genetic predisposition for FIP, supporting the importance of telomere-related pathways in pulmonary fibrosis. PMID:25607374

Rare variants in RTEL1 are associated with familial interstitial pneumonia.

PubMed

Cogan, Joy D; Kropski, Jonathan A; Zhao, Min; Mitchell, Daphne B; Rives, Lynette; Markin, Cheryl; Garnett, Errine T; Montgomery, Keri H; Mason, Wendi R; McKean, David F; Powers, Julia; Murphy, Elissa; Olson, Lana M; Choi, Leena; Cheng, Dong-Sheng; Blue, Elizabeth Marchani; Young, Lisa R; Lancaster, Lisa H; Steele, Mark P; Brown, Kevin K; Schwarz, Marvin I; Fingerlin, Tasha E; Schwartz, David A; Lawson, William E; Loyd, James E; Zhao, Zhongming; Phillips, John A; Blackwell, Timothy S

2015-03-15

Up to 20% of cases of idiopathic interstitial pneumonia cluster in families, comprising the syndrome of familial interstitial pneumonia (FIP); however, the genetic basis of FIP remains uncertain in most families. To determine if new disease-causing rare genetic variants could be identified using whole-exome sequencing of affected members from FIP families, providing additional insights into disease pathogenesis. Affected subjects from 25 kindreds were selected from an ongoing FIP registry for whole-exome sequencing from genomic DNA. Candidate rare variants were confirmed by Sanger sequencing, and cosegregation analysis was performed in families, followed by additional sequencing of affected individuals from another 163 kindreds. We identified a potentially damaging rare variant in the gene encoding for regulator of telomere elongation helicase 1 (RTEL1) that segregated with disease and was associated with very short telomeres in peripheral blood mononuclear cells in 1 of 25 families in our original whole-exome sequencing cohort. Evaluation of affected individuals in 163 additional kindreds revealed another eight families (4.7%) with heterozygous rare variants in RTEL1 that segregated with clinical FIP. Probands and unaffected carriers of these rare variants had short telomeres (<10% for age) in peripheral blood mononuclear cells and increased T-circle formation, suggesting impaired RTEL1 function. Rare loss-of-function variants in RTEL1 represent a newly defined genetic predisposition for FIP, supporting the importance of telomere-related pathways in pulmonary fibrosis.

The family B1 GPCR: structural aspects and interaction with accessory proteins.

PubMed

Couvineau, Alain; Laburthe, Marc

2012-01-01

G protein coupled receptors (GPCRs) play a crucial role in physiology and pathophysiology in humans. Beside the large family A (rhodopsin-like receptors) and family C GPCR (metabotropic glutamate receptors), the small family B1 GPCR (secretin-like receptors) includes important receptors such as vasoactive intestinal peptide receptors (VPAC), pituitary adenylyl cyclase activating peptide receptor (PAC1R), secretin receptor (SECR), growth hormone releasing factor receptor (GRFR), glucagon receptor (GCGR), glucagon like-peptide 1 and 2 receptors (GLPR), gastric inhibitory peptide receptor (GIPR), parathyroid hormone receptors (PTHR), calcitonin receptors (CTR) and corticotropin-releasing factor receptors (CRFR). They represent very promising targets for the development of drugs having therapeutical impact on many diseases such as chronic inflammation, neurodegeneration, diabetes, stress and osteoporosis. Over the past decade, structure-function relationship studies have demonstrated that the N-terminal ectodomain (N-ted) of family B1 receptors plays a pivotal role in natural ligand recognition. Structural analysis of some family B1 GPCR N-teds revealed the existence of a Sushi domain fold consisting of two antiparallel β sheets stabilized by three disulfide bonds and a salt bridge. The family B1 GPCRs promote cellular responses through a signaling pathway including predominantly the Gsadenylyl cyclase-cAMP pathway activation. Family B1 GPCRs also interact with a few accessory proteins which play a role in cell signaling, receptor expression and/or pharmacological profiles of receptors. These accessory proteins may represent new targets for the design of new drugs. Here, we review the current knowledge regarding: i) the structure of family B1 GPCR binding domain for natural ligands and ii) the interaction of family B1 GPCRs with accessory proteins.

CHEK2*1100delC Variant and BRCA1/2-Negative Familial Breast Cancer - A Family-Based Genetic Association Study

DTIC Science & Technology

2007-10-01

AD_________________ Award Number: DAMD17-03-1-0774 TITLE: CHEK2 *1100delC Variant and BRCA1/2...NUMBER CHEK2 *1100delC Variant and BRCA1/2-Negative Familial Breast Cancer - A Family- Based Genetic Association Study 5b. GRANT NUMBER DAMD17...association between the CHEK2 *1100delC gene variant and breast cancer among BRCA1/2-negative families. Vital to DNA replication and normal growth of breast

A novel COL1A1 mutation in a family with osteogenesis imperfecta associated with phenotypic variabilities

PubMed Central

Seto, Toshiyuki; Yamamoto, Toshiyuki; Shimojima, Keiko; Shintaku, Haruo

2017-01-01

Osteogenesis imperfecta (OI) is a heterogeneous disorder that is characterized by bone fragility and systemic complications, and is mainly caused by gene mutations in COL1A1 or COL1A2. A novel COL1A1 splicing mutation, c.750+2T>A, was identified in a Japanese OI family. Only the proband in this family showed various complications, such as heart valve diseases and severe scoliosis. The clinical heterogeneity in the family is discussed in this study. PMID:28326186

Spinal neurofibromatosis in a family with classical neurofibromatosis type 1 and a novel NF1 gene mutation.

PubMed

Nicita, Francesco; Torrente, Isabella; Spalice, Alberto; Bottillo, Irene; Papetti, Laura; Pinna, Valentina; Ursitti, Fabiana; Ruggieri, Martino

2014-02-01

Familial spinal neurofibromatosis (FSNF) is a rare form of neurofibromatosis type 1 (NF1) characterized by multiple, histologically proven neurofibromas of the spinal roots leaving no intact segments and associated neurofibromas of major peripheral nerves. It is sometimes associated with other NF1 stigmata. Most patients have NF1 gene mutations. We describe a patient who fulfilled the diagnostic criteria for spinal neurofibromatosis and belonged to a family in which other affected members exhibited classical NF1 stigmata. A novel missense (c.7109 T>A; p.Val2370Asp) mutation in exon 39 of the NF1 gene was present in the affected family members. The family displayed extreme phenotypic variability in the spectrum of NF1. To our knowledge, this is the first patient with spinal neurofibromatosis in the context of classical NF1 with an NF1 gene mutation. The term FSNF is inaccurate as this condition simply reflects the typical autosomal dominant pattern of NF1 inheritance with phenotypoc variability and does not encompass patients with sporadic disease or those in the context of a classical NF1 phenotype as reported in the present family. The term could be replaced by "spinal neurofibromatosis". Copyright © 2013 Elsevier Ltd. All rights reserved.

Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.

PubMed

Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar

2011-01-01

This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.

24 CFR 510.1 - Multi-family property loans.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 3 2011-04-01 2010-04-01 true Multi-family property loans. 510.1 Section 510.1 Housing and Urban Development Regulations Relating to Housing and Urban Development... URBAN DEVELOPMENT SLUM CLEARANCE AND URBAN RENEWAL SECTION 312 REHABILITATION LOAN PROGRAM § 510.1 Multi...

Rare missense variants in POT1 predispose to familial cutaneous malignant melanoma

PubMed Central

Shi, Jianxin; Yang, Xiaohong R.; Ballew, Bari; Rotunno, Melissa; Calista, Donato; Fargnoli, Maria Concetta; Ghiorzo, Paola; Paillerets, Brigitte Bressac-de; Nagore, Eduardo; Avril, Marie Francoise; Caporaso, Neil E.; McMaster, Mary L.; Cullen, Michael; Wang, Zhaoming; Zhang, Xijun; Bruno, William; Pastorino, Lorenza; Queirolo, Paola; Banuls-Roca, Jose; Garcia-Casado, Zaida; Vaysse, Amaury; Mohamdi, Hamida; Riazalhosseini, Yasser; Foglio, Mario; Jouenne, Fanélie; Hua, Xing; Hyland, Paula L.; Yin, Jinhu; Vallabhaneni, Haritha; Chai, Weihang; Minghetti, Paola; Pellegrini, Cristina; Ravichandran, Sarangan; Eggermont, Alexander; Lathrop, Mark; Peris, Ketty; Scarra, Giovanna Bianchi; Landi, Giorgio; Savage, Sharon A.; Sampson, Joshua N.; He, Ji; Yeager, Meredith; Goldin, Lynn R.; Demenais, Florence; Chanock, Stephen J.; Tucker, Margaret A.; Goldstein, Alisa M.; Liu, Yie; Landi, Maria Teresa

2014-01-01

Although CDKN2A is the most frequent high-risk melanoma susceptibility gene, the underlying genetic factors for most melanoma-prone families remain unknown. Using whole exome sequencing, we identified a rare variant that arose as a founder mutation in the telomere shelterin POT1 gene (g.7:124493086 C>T, Ser270Asn) in five unrelated melanoma-prone families from Romagna, Italy. Carriers of this variant had increased telomere length and elevated fragile telomeres suggesting that this variant perturbs telomere maintenance. Two additional rare POT1 variants were identified in all cases sequenced in two other Italian families, yielding a frequency of POT1 variants comparable to that of CDKN2A mutations in this population. These variants were not found in public databases or in 2,038 genotyped Italian controls. We also identified two rare recurrent POT1 variants in American and French familial melanoma cases. Our findings suggest that POT1 is a major susceptibility gene for familial melanoma in several populations. PMID:24686846

Identification of rare genetic variation of NLRP1 gene in familial multiple sclerosis.

PubMed

Maver, Ales; Lavtar, Polona; Ristić, Smiljana; Stopinšek, Sanja; Simčič, Saša; Hočevar, Keli; Sepčić, Juraj; Drulović, Jelena; Pekmezović, Tatjana; Novaković, Ivana; Alenka, Hodžić; Rudolf, Gorazd; Šega, Saša; Starčević-Čizmarević, Nada; Palandačić, Anja; Zamolo, Gordana; Kapović, Miljenko; Likar, Tina; Peterlin, Borut

2017-06-16

The genetic etiology and the contribution of rare genetic variation in multiple sclerosis (MS) has not yet been elucidated. Although familial forms of MS have been described, no convincing rare and penetrant variants have been reported to date. We aimed to characterize the contribution of rare genetic variation in familial and sporadic MS and have identified a family with two sibs affected by concomitant MS and malignant melanoma (MM). We performed whole exome sequencing in this primary family and 38 multiplex MS families and 44 sporadic MS cases and performed transcriptional and immunologic assessment of the identified variants. We identified a potentially causative homozygous missense variant in NLRP1 gene (Gly587Ser) in the primary family. Further possibly pathogenic NLRP1 variants were identified in the expanded cohort of patients. Stimulation of peripheral blood mononuclear cells from MS patients with putatively pathogenic NLRP1 variants showed an increase in IL-1B gene expression and active cytokine IL-1β production, as well as global activation of NLRP1-driven immunologic pathways. We report a novel familial association of MS and MM, and propose a possible underlying genetic basis in NLRP1 gene. Furthermore, we provide initial evidence of the broader implications of NLRP1-related pathway dysfunction in MS.

Schwannomatosis associated with multiple meningiomas due to a familial SMARCB1 mutation.

PubMed

Bacci, Costanza; Sestini, Roberta; Provenzano, Aldesia; Paganini, Irene; Mancini, Irene; Porfirio, Berardino; Vivarelli, Rossella; Genuardi, Maurizio; Papi, Laura

2010-02-01

Schwannomatosis (MIM 162091) is a condition predisposing to the development of central and peripheral schwannomas; most cases are sporadic without a clear family history but a few families with a clear autosomal dominant pattern of transmission have been described. Germline mutations in SMARCB1 are associated with schwannomatosis. We report a family with multiple schwannomas and meningiomas. A SMARCB1 germline mutation in exon 1 was identified. The mutation, c.92A>T (p.Glu31Val), occurs in a highly conserved amino acid in the SMARCB1 protein. In addition, in silico analysis demonstrated that the mutation disrupts the donor consensus sequence of exon 1. RNA studies verified the absence of mRNA transcribed by the mutant allele. This is the first report of a SMARCB1 germline mutation in a family with schwannomatosis characterized by the development of multiple meningiomas.

Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

PubMed

Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

2016-12-01

Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

Pathways family intervention for third-grade American Indian children1–3

PubMed Central

Teufel, Nicolette I; Perry, Cheryl L; Story, Mary; Flint-Wagner, Hilary G; Levin, Sarah; Clay, Theresa E; Davis, Sally M; Gittelsohn, Joel; Altaha, Jackie; Pablo, Juanita L

2016-01-01

The goal of the feasibility phase of the Pathways family intervention was to work with families of third-grade American Indian children to reinforce health behaviors being promoted by the curriculum, food service, and physical activity components of this school-based obesity prevention intervention. Family behaviors regarding food choices and physical activity were identified and ranked according to priority by using formative assessment and a literature review of school-based programs that included a family component. The family intervention involved 3 primary strategies designed to create an informed home environment supportive of behavioral change: 1) giving the children “family packs” containing worksheets, interactive assignments, healthful snacks, and low-fat tips and recipes to take home to share with their families; 2) implementing family events at the school to provide a fun atmosphere in which health education concepts could be introduced and reinforced; and 3) forming school-based family advisory councils composed of family members and community volunteers who provided feedback on Pathways strategies, helped negotiate barriers, and explored ideas for continued family participation. For strategy 2, a kick-off Family Fun Night provided a series of learning booths that presented the healthful behaviors taught by Pathways. At an end-of-year Family Celebration, a healthy meal was served, students demonstrated newly learned Pathways activities, and certificates were presented in recognition of completion of the Pathways curriculum. Based on evaluation forms and attendance rosters, strategies 1 and 2 were more easily implemented and better received than strategy 3. Implications for developing family involvement strategies for intervention programs are discussed. PMID:10195606

Molecular characterisation of SMARCB1 and NF2 in familial and sporadic schwannomatosis.

PubMed

Hadfield, K D; Newman, W G; Bowers, N L; Wallace, A; Bolger, C; Colley, A; McCann, E; Trump, D; Prescott, T; Evans, D G R

2008-06-01

Schwannomatosis is a rare condition characterised by multiple schwannomas and lack of involvement of the vestibular nerve. A recent report identified bi-allelic mutations in the SMARCB1/INI1 gene in a single family with schwannomatosis. We aimed to establish the contribution of the SMARCB1 and the NF2 genes to sporadic and familial schwannomatosis in our cohort. We performed DNA sequence and dosage analysis of SMARCB1 and NF2 in 28 sporadic cases and 15 families with schwannomatosis. We identified germline mutations in SMARCB1 in 5 of 15 (33.3%) families with schwannomatosis and 2 of 28 (7.1%) individuals with sporadic schwannomatosis. In all individuals with a germline mutation in SMARCB1 in whom tumour tissue was available, we detected a second hit with loss of SMARCB1. In addition, in all affected individuals with SMARCB1 mutations and available tumour tissue, we detected bi-allelic somatic inactivation of the NF2 gene. SMARCB1 mutations were associated with a higher number of spinal tumours in patients with a positive family history (p = 0.004). In contrast to the recent report where no NF2 mutations were identified in a schwannomatosis family with SMARCB1 mutations, in our cohort, a four hit model with mutations in both SMARCB1 and NF2 define a subset of patients with schwannomatosis.

BRCA1 mutations in South African breast and/or ovarian cancer families: evidence of a novel founder mutation in Afrikaner families.

PubMed

Reeves, Michelle D; Yawitch, Tali M; van der Merwe, Nerina C; van den Berg, Hester J; Dreyer, Greta; van Rensburg, Elizabeth J

2004-07-10

Germ-line mutations within BRCA1 are responsible for different proportions of inherited susceptibility to breast/ovarian cancer, and the spectrum of mutations within this gene is often unique to certain populations. At this time, there have been no reports regarding the role of BRCA1 in South African breast and/or ovarian cancer families. We therefore screened 90 South African breast/ovarian cancer families for BRCA1 mutations by means of PCR-based mutation detection assays. Eighteen families (20%) were identified with BRCA1 disease-causing mutations. Four Ashkenazi Jewish families were identified with the 185delAG mutation, whereas 2 Afrikaner and 1 Ashkenazi Jewish family were found to harbor the 5382insC mutation. Five of the families (5.56%), all of whom are Afrikaners, were found to carry the novel E881X mutation. Genotype analyses show that these patients share a common ancestor. Genealogic studies have identified 3 possible founding couples for this mutation, all of whom arrived in the Cape from France in the late 1600s. Of the remaining mutations detected, 3 have not been reported previously and include the S451X, 1493delC (detected twice) and 4957insC mutations. Copyright 2004 Wiley-Liss, Inc.

Perception of the impact of type 1 diabetes on low-income families.

PubMed

Edmonds-Myles, Sadiqa; Tamborlane, William V; Grey, Margaret

2010-01-01

The purpose of this study was to explore the psychosocial impact of type 1 diabetes (T1DM) on low-income families of various racial/ethnic backgrounds. A qualitative study using qualitative descriptive methods was conducted with a total of 21 patient-parent dyads from African American, Hispanic, and white heritage, respectively. An interview guide was developed to explore each family's attitudes and beliefs related to diabetes. Although all subjects were in excellent metabolic control (mean A1C levels were between 7.3% and 7.6%), there were a number of identifiable differences in the perception of the impact of T1DM among the 3 groups. Themes in the data demonstrated differences in the following areas: (1) view of diabetes and its effects on the family; (2) ability to successfully treat diabetes; (3) ability to cope with diabetes; and (4) experiences with the health care system. Most notable themes include a disparity across racial/ethnic groups in the preoccupation with the disease after diagnosis, cultural and financial factors identified, and differences in treatment modalities and reasons for their use. Diabetes education and care need to carefully address such differences. Although these differences are likely multifactorial, with components of socioeconomic status, family structure, and family experiences involved, it is evident that ethnicity itself is an important factor that can affect the ability of families to manage and cope with diabetes.

Mutation analysis of FANCD2, BRIP1/BACH1, LMO4 and SFN in familial breast cancer.

PubMed

Lewis, Aaron G; Flanagan, James; Marsh, Anna; Pupo, Gulietta M; Mann, Graham; Spurdle, Amanda B; Lindeman, Geoffrey J; Visvader, Jane E; Brown, Melissa A; Chenevix-Trench, Georgia

2005-01-01

Mutations in known predisposition genes account for only about a third of all multiple-case breast cancer families. We hypothesized that germline mutations in FANCD2, BRIP1/BACH1, LMO4 and SFN may account for some of the unexplained multiple-case breast cancer families. The families used in this study were ascertained through the Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer (kConFab). Denaturing high performance liquid chromatography (DHPLC) analysis of the coding regions of these four genes was conducted in the youngest affected cases of 30 to 267 non-BRCA1/2 breast cancer families. In addition, a further 399 index cases were also screened for mutations in two functionally significant regions of the FANCD2 gene and 253 index cases were screened for two previously reported mutations in BACH1 (p. P47A and p. M299I). DHPLC analysis of FANCD2 identified six silent exonic variants, and a large number of intronic variants, which tagged two common haplotypes. One protein truncating variant was found in BRIP1/BACH1, as well as four missense variants, a silent change and a variant in the 3' untranslated region. No missense or splice site mutations were found in LMO4 or SFN. Analysis of the missense, silent and frameshift variants of FANCD2 and BACH1 in relatives of the index cases, and in a panel of controls, found no evidence suggestive of pathogenicity. There is no evidence that highly penetrant exonic or splice site mutations in FANCD2, BRIP1/BACH1, LMO4 or SFN contribute to familial breast cancer. Large scale association studies will be necessary to determine whether any of the polymorphisms or haplotypes identified in these genes contributes to breast cancer risk.

Phenotypic analysis of familial breast cancer: comparison of BRCAx tumors with BRCA1-, BRCA2-carriers and non-familial breast cancer.

PubMed

Aloraifi, F; Alshehhi, M; McDevitt, T; Cody, N; Meany, M; O'Doherty, A; Quinn, C M; Green, A J; Bracken, A; Geraghty, J G

2015-05-01

Women with inherited pathogenic mutations in the BRCA1 or BRCA2 genes have up to an 85% risk of developing breast cancer in their lifetime. However, only about 20% of familial breast cancer is attributed to mutations in BRCA1 and BRCA2, while a further 5-10% are attributed to mutations in other rare susceptibility genes such as TP53, STK11, PTEN, ATM and CHEK2. Despite extensive efforts to explain the missing heritability of this disease, the majority of familial clustering in breast cancer remains largely unexplained. We aim to analyze the pathology of familial cases of which no pathogenic mutation is yet identified. We compared the pathological phenotype of BRCA1/BRCA2 negative familial breast cancer (BRCAx) to BRCA1-positive, BRCA2-positive and sporadic cases without a family history. Age-adjusted analysis is summarized in odd's ratios and confidence intervals for tumor type, grade, lymph node, ER and HER2 status. We found non-familial cases to be more likely to be ER positive (P = 0.041) as compared with BRCAx tumors. More cases of lobular carcinoma were found with BRCAx as compared to BRCA1 tumors (P = 0.05). After multivariate logistic regression analysis, BRCAx tumors are more likely ER positive (P = 0.001) and HER2 positive (P = 0.047) in comparison to BRCA1. Conversely, BRCAx cases are less likely to be ER positive (P = 0.02) but more likely to be HER2 positive (P = 0.021) as compared with BRCA2 tumors. Our findings suggest that BRCA1, BRCA2 and BRCAx tumors differ in phenotype from non-familial and familial BRCA1-positive and BRCA2-positive tumors. Further studies will need to be performed in this important population in order to develop strategies for early detection and prevention. Copyright © 2015 Elsevier Ltd. All rights reserved.

Ross sea ice motion, area flux, and deformation

NASA Technical Reports Server (NTRS)

kwok, Ron

2005-01-01

The sea ice motion, area export, and deformation of the Ross Sea ice cover are examined with satellite passive microwave and RADARSAT observations. The record of high-resolution synthetic aperture radar (SAR) data, from 1998 and 2000, allows the estimation of the variability of ice deformation at the small scale (10 km) and to assess the quality of the longer record of passive microwave ice motion. Daily and subdaily deformation fields and RADARSAT imagery highlight the variability of motion and deformation in the Ross Sea. With the passive microwave ice motion, the area export at a flux gate positioned between Cape Adare and Land Bay is estimated. Between 1992 and 2003, a positive trend can be seen in the winter (March-November) ice area flux that has a mean of 990 x 103 km2 and ranges from a low of 600 x 103 km2 in 1992 to a peak of 1600 x 103 km2 in 2001. In the mean, the southern Ross Sea produces almost twice its own area of sea ice during the winter. Cross-gate sea level pressure (SLP) gradients explain 60% of the variance in the ice area flux. A positive trend in this gradient, from reanalysis products, suggests a 'spinup' of the Ross Sea Gyre over the past 12 yr. In both the NCEP-NCAR and ERA-40 surface pressure fields, longer-term trends in this gradient and mean SLP between 1979 and 2002 are explored along with positive anomalies in the monthly cross-gate SLP gradient associated with the positive phase of the Southern Hemisphere annular mode and the extrapolar Southern Oscillation.

Detection of canonical A-to-G editing events at 3′ UTRs and microRNA target sites in human lungs using next-generation sequencing

PubMed Central

Soundararajan, Ramani; Stearns, Timothy M.; Griswold, Anthony J.; Mehta, Arpit; Czachor, Alexander; Fukumoto, Jutaro; Lockey, Richard F.; King, Benjamin L.; Kolliputi, Narasaiah

2015-01-01

RNA editing is a post-transcriptional modification of RNA. The majority of these changes result from adenosine deaminase acting on RNA (ADARs) catalyzing the conversion of adenosine residues to inosine in double-stranded RNAs (dsRNAs). Massively parallel sequencing has enabled the identification of RNA editing sites in human transcriptomes. In this study, we sequenced DNA and RNA from human lungs and identified RNA editing sites with high confidence via a computational pipeline utilizing stringent analysis thresholds. We identified a total of 3,447 editing sites that overlapped in three human lung samples, and with 50% of these sites having canonical A-to-G base changes. Approximately 27% of the edited sites overlapped with Alu repeats, and showed A-to-G clustering (>3 clusters in 100 bp). The majority of edited sites mapped to either 3′ untranslated regions (UTRs) or introns close to splice sites; whereas, only few sites were in exons resulting in non-synonymous amino acid changes. Interestingly, we identified 652 A-to-G editing events in the 3′ UTR of 205 target genes that mapped to 932 potential miRNA target binding sites. Several of these miRNA edited sites were validated in silico. Additionally, we validated several A-to-G edited sites by Sanger sequencing. Altogether, our study suggests a role for RNA editing in miRNA-mediated gene regulation and splicing in human lungs. In this study, we have generated a RNA editome of human lung tissue that can be compared with other RNA editomes across different lung tissues to delineate a role for RNA editing in normal and diseased states. PMID:26486088

Detection of canonical A-to-G editing events at 3' UTRs and microRNA target sites in human lungs using next-generation sequencing.

PubMed

Soundararajan, Ramani; Stearns, Timothy M; Griswold, Anthony L; Mehta, Arpit; Czachor, Alexander; Fukumoto, Jutaro; Lockey, Richard F; King, Benjamin L; Kolliputi, Narasaiah

2015-11-03

RNA editing is a post-transcriptional modification of RNA. The majority of these changes result from adenosine deaminase acting on RNA (ADARs) catalyzing the conversion of adenosine residues to inosine in double-stranded RNAs (dsRNAs). Massively parallel sequencing has enabled the identification of RNA editing sites in human transcriptomes. In this study, we sequenced DNA and RNA from human lungs and identified RNA editing sites with high confidence via a computational pipeline utilizing stringent analysis thresholds. We identified a total of 3,447 editing sites that overlapped in three human lung samples, and with 50% of these sites having canonical A-to-G base changes. Approximately 27% of the edited sites overlapped with Alu repeats, and showed A-to-G clustering (>3 clusters in 100 bp). The majority of edited sites mapped to either 3' untranslated regions (UTRs) or introns close to splice sites; whereas, only few sites were in exons resulting in non-synonymous amino acid changes. Interestingly, we identified 652 A-to-G editing events in the 3' UTR of 205 target genes that mapped to 932 potential miRNA target binding sites. Several of these miRNA edited sites were validated in silico. Additionally, we validated several A-to-G edited sites by Sanger sequencing. Altogether, our study suggests a role for RNA editing in miRNA-mediated gene regulation and splicing in human lungs. In this study, we have generated a RNA editome of human lung tissue that can be compared with other RNA editomes across different lung tissues to delineate a role for RNA editing in normal and diseased states.

Heterozygous RTEL1 mutations are associated with familial pulmonary fibrosis.

PubMed

Kannengiesser, Caroline; Borie, Raphael; Ménard, Christelle; Réocreux, Marion; Nitschké, Patrick; Gazal, Steven; Mal, Hervé; Taillé, Camille; Cadranel, Jacques; Nunes, Hilario; Valeyre, Dominique; Cordier, Jean François; Callebaut, Isabelle; Boileau, Catherine; Cottin, Vincent; Grandchamp, Bernard; Revy, Patrick; Crestani, Bruno

2015-08-01

Pulmonary fibrosis is a fatal disease with progressive loss of respiratory function. Defective telomere maintenance leading to telomere shortening is a cause of pulmonary fibrosis, as mutations in the telomerase component genes TERT (reverse transcriptase) and TERC (RNA component) are found in 15% of familial pulmonary fibrosis (FPF) cases. However, so far, about 85% of FPF remain genetically uncharacterised.Here, in order to identify new genetic causes of FPF, we performed whole-exome sequencing, with a candidate-gene approach, of 47 affected subjects from 35 families with FPF without TERT and TERC mutations.We identified heterozygous mutations in regulator of telomere elongation helicase 1 (RTEL1) in four families. RTEL1 is a DNA helicase with roles in DNA replication, genome stability, DNA repair and telomere maintenance. The heterozygous RTEL1 mutations segregated as an autosomal dominant trait in FPF, and were predicted by structural analyses to severely affect the function and/or stability of RTEL1. In agreement with this, RTEL1-mutated patients exhibited short telomeres in comparison with age-matched controls.Our results provide evidence that heterozygous RTEL1 mutations are responsible for FPF and, thereby, extend the clinical spectrum of RTEL1 deficiency. Thus, RTEL1 enlarges the number of telomere-associated genes implicated in FPF. Copyright ©ERS 2015.

Linkage analysis in Usher syndrome type I (USH1) families from Spain.

PubMed Central

Espinós, C; Nájera, C; Millán, J M; Ayuso, C; Baiget, M; Pérez-Garrigues, H; Rodrigo, O; Vilela, C; Beneyto, M

1998-01-01

Usher syndrome (USH) is an autosomal recessive hereditary disorder characterised by congenital sensorineural hearing loss and gradual visual impairment secondary to retinitis pigmentosa (RP). The disorder is clinically and genetically heterogeneous. With regard to Usher type I (USH1), several subtypes have been described, the most frequent being USH1B located on chromosome 11q13.5. Of 18 USH1 families studied by linkage analysis, 12 (67%) showed significant lod score values for locus D11S527 (Zmax=14.032, theta=0.000) situated on chromosome 11q. Our findings suggest considerable genetic heterogeneity in the Spanish USH1 population. It is important to note that one of our families linked to the USH1B locus shows interesting intrafamilial clinical variability. As regards the remaining six USH1 families, the linkage analysis did not provide conclusive data, although two of them show slight linkage to markers located on chromosome 3q (Zmax=1.880, theta=0.000 for D3S1279), the same location that had previously been assigned to some USH3 families. Images PMID:9610802

Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

PubMed Central

Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

2007-01-01

Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

APC promoter 1B deletion in seven American families with familial adenomatous polyposis.

PubMed

Snow, A K; Tuohy, T M F; Sargent, N R; Smith, L J; Burt, R W; Neklason, D W

2015-10-01

Familial adenomatous polyposis (FAP) is a colorectal cancer predisposition syndrome caused by mutations in the adenomatous polyposis coli (APC) gene. Clinical genetic testing fails to identify disease causing mutations in up to 20% of clinically apparent FAP cases. Following the inclusion of multiplex ligation-dependent probe amplification (MLPA) probes specific for APC promoter 1B, seven probands were identified with a deletion of promoter 1B. Using haplotype analysis spanning the APC locus, the seven families appear to be identical by descent from a common founder. The clinical phenotype of 19 mutation carriers is classical FAP with colectomy at an average age of 24. The majority of cases had a large number of duodenal and gastric polyps. Measurements of allele-specific expression of APC mRNA using TaqMan assay confirmed that relative expression in the allele containing the promoter 1B deletion was reduced 42-98%, depending on tissue type. This study confirms the importance of APC promoter deletions as a cause of FAP and identifies a founder mutation in FAP patients from the United States. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Heredity of port-wine stains: investigation of families without a RASA1 mutation.

PubMed

Troilius Rubin, Agneta; Lauritzen, Edgar; Ljunggren, Bo; Revencu, Nicole; Vikkula, Mikka; Svensson, Åke

2015-01-01

The prevalence of capillary malformations, also known as port-wine stains (PWS), is 0.3%. Familial segregation can occur. The capillary malformation-arteriovenous malformation (CM-AVM) phenotype is caused by mutations in the RASA1 gene. In PWS familial cases, the inheritance is considered to be autosomal dominant with variable penetrance. Investigation of the heredity of PWS among patients who attended the vascular anomaly section at the Department of Dermatology in Malmoe, Southern Sweden, between 1993 and 2004 and to study the involvement of the RASA1 gene in patients with a positive family history of PWS. A total of 254 patients were examined and given a questionnaire regarding family history of PWS. The first group of 175 patients (109 females and 66 males) reported a negative family history. The other group of 65 patients (46 females and 19 males) reported a positive family history (50% parents or brothers and sisters). The heredity of PWS was 27% (65/240). Twenty-one patients with a positive family history and relatives had no CM-AVM phenotype for mutations in the RASA1 gene. PWS may have a stronger heredity component than it was reported earlier and inheritance should be considered when counseling a patient. RASA1 mutations do not explain the PWS in our patients.

Mentalizing Family Violence Part 1: Conceptual Framework.

PubMed

Asen, Eia; Fonagy, Peter

2017-03-01

This is the first of two companion papers describing concepts and techniques of a mentalization-based approach to understanding and managing family violence. We review evidence that attachment difficulties, sudden high levels of arousal, and poor affect control contribute to a loss of mentalizing capacity, which, in turn, undermines social learning and can favor the transgenerational transmission of violent interaction patterns. It is suggested that physically violent acts are only possible if mentalizing is temporarily inhibited or decoupled. However, being mentalized in the context of attachment relationships in the family generates epistemic trust within the family unit and reduces the likelihood of family violence. The implications of this framework for therapeutic work with families are discussed. © 2016 Family Process Institute.

Frequency of SMARCB1 mutations in familial and sporadic schwannomatosis.

PubMed

Smith, Miriam J; Wallace, Andrew J; Bowers, Naomi L; Rustad, Cecilie F; Woods, C Geoff; Leschziner, Guy D; Ferner, Rosalie E; Evans, D Gareth R

2012-05-01

Mutations of the SMARCB1 gene have been implicated in several human tumour predisposing syndromes. They have recently been identified as an underlying cause of the tumour suppressor syndrome schwannomatosis. There is a much higher rate of mutation detection in familial disease than in sporadic disease. We have carried out extensive genetic testing on a cohort of familial and sporadic patients who fulfilled clinical diagnostic criteria for schwannomatosis. In our current cohort, we identified novel mutations within the SMARCB1 gene and detected several mutations that have been previously identified in other schwannomatosis cohorts. Of the schwannomatosis screens reported to date, including our current dataset, SMARCB1 mutations have been found in 45 % of familial probands and 7 % of sporadic patients. The exon 1 mutation, c.41C >A, and the 3' untranslated region mutation, c.*82C >T, are the most common changes reported in schwannomatosis disease so far, indicating mutation hotspots at both 5' and 3' portions of the gene. SMARCB1 mutations are found in a significant proportion of schwannomatosis patients, but there remains the possibility that further causative genes remain to be found.

Kindler syndrome pathogenesis and fermitin family homologue 1 (kindlin-1) function.

PubMed

D'Souza, Maria-Anna M A; Kimble, Roy M; McMillan, James R

2010-01-01

Kindler syndrome is caused by genetic defects in the focal contact-associated protein, fermitin family homologue 1 (FFH1), encoded by the gene FERMT1 (known as KIND1). Defects in FFH1 lead to abnormal integrin activation and loss of keratinocyte epidermal adhesion to the underlying basal lamina, disruption in normal cell cytoskeleton within keratinocytes, and altered signaling pathways, leading to increased extracellular matrix production. Null mutations in FERMT1 result in skin blistering from birth and early childhood progressive poikiloderma, mucosal fragility, and increased risk of cancer. The complete range of FFH1 functions in skin and other epithelia has yet to be determined.

Offering the opportunity for family to be present during cardiopulmonary resuscitation: 1-year assessment.

PubMed

Jabre, Patricia; Tazarourte, Karim; Azoulay, Elie; Borron, Stephen W; Belpomme, Vanessa; Jacob, Line; Bertrand, Lionel; Lapostolle, Frederic; Combes, Xavier; Galinski, Michel; Pinaud, Virginie; Destefano, Carla; Normand, Domitille; Beltramini, Alexandra; Assez, Nathalie; Vivien, Benoit; Vicaut, Eric; Adnet, Frederic

2014-07-01

To evaluate the psychological consequences among family members given the option to be present during the CPR of a relative, compared with those not routinely offered the option. Prospective, cluster-randomized, controlled trial involving 15 prehospital emergency medical services units in France, comparing systematic offer for a relative to witness CPR with the traditional practice among 570 family members. Main outcome measure was 1-year assessment included proportion suffering post-traumatic stress disorder (PTSD), anxiety and depression symptoms, and/or complicated grief. Among the 570 family members [intention to treat (ITT) population], 408 (72%) were evaluated at 1 year. In the ITT population (N = 570), family members had PTSD-related symptoms significantly more frequently in the control group than in the intervention group [adjusted odds ratio, 1.8; 95% confidence interval (CI) 1.1-3.0; P = 0.02] as did family members to whom physicians did not propose witnessing CPR [adjusted odds ratio, 1.7; 95% CI 1.1-2.6; P = 0.02]. In the observed cases population (N = 408), the proportion of family members experiencing a major depressive episode was significantly higher in the control group (31 vs. 23%; P = 0.02) and among family members to whom physicians did not propose the opportunity to witness CPR (31 vs. 24%; P = 0.03). The presence of complicated grief was significantly greater in the control group (36 vs. 21%; P = 0.005) and among family members to whom physicians did not propose the opportunity to witness resuscitation (37 vs. 23%; P = 0.003). At 1 year after the event, psychological benefits persist for those family members offered the possibility to witness the CPR of a relative in cardiac arrest.

MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

PubMed

Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng

2013-01-01

The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during

Sporadic and familial glut1ds Italian patients: A wide clinical variability.

PubMed

De Giorgis, Valentina; Teutonico, Federica; Cereda, Cristina; Balottin, Umberto; Bianchi, Marika; Giordano, Lucio; Olivotto, Sara; Ragona, Francesca; Tagliabue, Anna; Zorzi, Giovanna; Nardocci, Nardo; Veggiotti, Pierangelo

2015-01-01

GLUT1 deficiency syndrome is a treatable neurological disorder characterized by developmental delay, movement disorders and epilepsy. It is caused by mutations in the SLC2A1 gene inherited as an autosomal dominant trait with complete penetrance, even if most detected SCL2A1 mutations are de novo. Our aim is to present a wide series of Italian patients to highlight the differences among subjects with de novo mutations and those with familial transmission. We present clinical and genetic features in a series of 22 GLUT1DS Italian patients. Our patients were classified in two different groups: familial cases including GLUT1DS patients with genetically confirmed affected relatives and sporadic cases with detection of SLC2A1 de novo mutation. We found remarkable differences in the severity of the clinical picture regarding the type of genetic inheritance (sporadic versus familial): sporadic patients were characterized by an earlier epilepsy-onset and higher degree of intellectual disability. No significant differences were found in terms of type of movement disorder, whilst Paroxysmal Exertion-induced Dyskinesia (PED) is confirmed to be the most characteristic movement disorder type in GLUT1DS. In familial cases the clinical manifestation of the disease was particularly variable and heterogeneous, also including asymptomatic patients or those with minimal-symptoms. The finding of a "mild" phenotype in familial GLUT1DS gives rise to several questions: the real incidence of the disease, treatment option with ketogenic diet in adult patients and genetic counseling. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Family functioning in the families of psychiatric patients: a comparison with nonclinical families.

PubMed

Trangkasombat, Umaporn

2006-11-01

To examine family functioning in the families of psychiatric patients. Families of psychiatric patients and nonclinical families were compared. There were 60 families in each group. The instrument included a semistructured interview of family functioning and the Chulalongkorn Family Inventory (CFI), a self-report questionnaire designed to assess the perception of one's family. From the assessment by semistructured interview, 83.3% of psychiatric families and 45.0% of nonclinical families were found to be dysfunctional in at least one dimension. The difference was statistically significant (p < 0.001). The average number of dysfunctional dimensions in the psychiatric families was significantly higher than in the nonclinical control group, 3.5 +/- 1.9 and 0.98 +/- 1.5 respectively, p < 0.0001. The CFI scores of the psychiatric families were significantly lower than the control group, reflecting poor family functioning. The dysfunctions were mostly in the following dimensions: problem-solving, communication, affective responsiveness, affective involvement, and behavior control. Psychiatric families faced more psychosocial stressors and the average number of stressors was higher than the control families, 88.3% vs. 56.7% and 4.2 +/- 2.7 vs. 1.3 +/- 1.47 stressors respectively, p < 0.0001. Family functioning of psychiatric patients was less healthy than the nonclinical control. The present study underlined the significance of family assessment and family intervention in the comprehensive care of psychiatric patients.

Deletion of RUNX1 exons 1 and 2 associated with familial platelet disorder with propensity to acute myeloid leukemia.

PubMed

Cavalcante de Andrade Silva, Marcela; Krepischi, Ana Cristina Victorino; Kulikowski, Leslie Domenici; Zanardo, Evelin Aline; Nardinelli, Luciana; Leal, Aline Medeiros; Costa, Silvia Souza; Muto, Nair Hideki; Rocha, Vanderson; Velloso, Elvira Deolinda Rodrigues Pereira

2018-04-01

Familial platelet disorder with propensity to acute myeloid leukemia (FPD/AML) associated with RUNX1 mutations is an autosomal dominant disorder included in the group of the myeloid neoplasms with germ line predisposition. We describe two brothers who were diagnosed with hematological malignancies (one with AML and the other with T-cell lymphoblastic lymphoma). There was a history of leukemia in the paternal family and two of their siblings presented with low platelet counts and no history of significant bleeding. A microdeletion encompassing exons 1-2 of RUNX1 (outside the cluster region of the Runt Homology domain and the transactivation domain) was detected in six family members using array-CGH and MLPA validation. A low platelet count was not present in all deletion carriers and, therefore, it should not be used as an indication for screening in suspected families and family members. Copyright © 2018 Elsevier Inc. All rights reserved.

Familial schwannomatosis with a germline mutation of SMARCB1 in Japan.

PubMed

Asai, Katsunori; Tani, Shoichi; Mineharu, Yohei; Tsurusaki, Yoshinori; Imai, Yukihiro; Agawa, Yuji; Iwaki, Koichi; Matsumoto, Naomichi; Sakai, Nobuyuki

2015-07-01

Schwannomatosis is the third major form of neurofibromatosis (NF) and is distinct from NF1 and NF2. The disease is not well recognized in Asian countries and the role of germline SMARCB1 mutations requires investigation. A 35-year-old Japanese man complaining of headache underwent an MRI examination, which showed a cystic tumor at the left cerebellopontine angle. The tumor was surgically removed and diagnosed as vagus nerve schwannoma. He had a past medical history of multiple schwannomas of the neck, groin and intercostal nerves, which were also treated surgically. He had a family history of multiple schwannomas for his father and sister. Systemic examinations of these family members ruled out a diagnosis of NF1 or NF2, and thus schwannomatosis was suspected. Genetic analysis revealed a germline mutation (c. *82C > T) of SMARCB1, and a somatic mutation of NF2 without loss of heterozygosity at the chromosome 22 locus. This is the first report of familial schwannomatosis associated with a germline mutation of SMARCB1 in an Asian country.

Identification of a novel IL-1 cytokine family member in teleost fish.

PubMed

Wang, Tiehui; Bird, Steve; Koussounadis, Antonis; Holland, Jason W; Carrington, Allison; Zou, Jun; Secombes, Christopher J

2009-07-15

A novel IL-1 family member (nIL-1F) has been discovered in fish, adding a further member to this cytokine family. The unique gene organization of nIL-1F, together with its location in the genome and low homology to known family members, suggests that this molecule is not homologous to known IL-1F. Nevertheless, it contains a predicted C-terminal beta-trefoil structure, an IL-1F signature region within the final exon, a potential IL-1 converting enzyme cut site, and its expression level is clearly increased following infection, or stimulation of macrophages with LPS or IL-1beta. A thrombin cut site is also present and may have functional relevance. The C-terminal recombinant protein antagonized the effects of rainbow trout rIL-1beta on inflammatory gene expression in a trout macrophage cell line, suggesting it is an IL-1beta antagonist. Modeling studies confirmed that nIL-1F has the potential to bind to the trout IL-1RI receptor protein, and may be a novel IL-1 receptor antagonist.

Substantial proportion of MODY among multiplex families participating in a Type 1 diabetes prediction programme.

PubMed

Petruzelkova, L; Dusatkova, P; Cinek, O; Sumnik, Z; Pruhova, S; Hradsky, O; Vcelakova, J; Lebl, J; Kolouskova, S

2016-12-01

Patients with maturity-onset diabetes of the young (MODY) might be over-represented in families with histories of Type 1 diabetes. Our aim was to re-evaluate families participating in the Czech T1D Prediction Programme (PREDIA.CZ) with at least two members affected with diabetes to assess the proportion of MODY among these families and determine its most significant clinical predictors. Of the 557 families followed up by the PREDIA.CZ, 53 (9.5%) had two or more family members with diabetes. One proband with diabetes from these families was chosen for direct sequencing of the GCK, HNF1A, HNF4A and INS genes. Non-parametric tests and a linear logistic regression model were used to evaluate differences between MODY and non-MODY families. MODY was genetically diagnosed in 24 of the 53 families with multiple occurrences of diabetes (45%). Mutations were detected most frequently in GCK (58%), followed by HNF1A (38%) and INS (4%). MODY families were more likely to have a parent with diabetes and had a higher proportion of females with diabetes than non-MODY families. Higher age (P < 0.001), a lower level of HbA 1c (P < 0.001) at clinical onset and at least two generations affected by diabetes were the variables most predictive for probands of MODY families already presenting with diabetes. A prediction programme for Type 1 diabetes would provide a useful new source of patients with MODY most likely to benefit from an accurate diagnosis. This identification has implications for patient treatment and disease prognosis. © 2015 Diabetes UK.

Histomorphologic spectrum of BAP1 negative melanocytic neoplasms in a family with BAP1-associated cancer susceptibility syndrome.

PubMed

Marušić, Zlatko; Buljan, Marija; Busam, Klaus J

2015-06-01

Multiple BAP1 negative melanocytic neoplasms are a hallmark of familial cancer susceptibility syndrome caused by BAP1 germline mutation. The syndrome is characterized by increased incidence of renal cell carcinoma, mesothelioma, cholangiocarcinoma, cutaneous and uveal melanoma and some other neoplasms. We report histomorphologic characteristics of six cutaneous melanocytic neoplasms with loss of BAP1 expression in two members of a family with BAP1-associated cancer susceptibility syndrome. The neoplasms were dermal melanocytic nevi characterized by a proliferation of large epithelioid (spitzoid) melanocytes, and adipocytic metaplasia. Nuclear pseudoinclusions and multinucleated melanocytes were present in most neoplasms. In two of the cases, a nodular melanoma was found associated with a dermal nevus. None of the melanomas recurred or metastasized after 6 and 3 years of follow up. We report two new cases of melanoma arising in a BAP1-deficient melanocytic nevus in the setting of familial tumor predisposition syndrome. Adipocytic metaplasia and nuclear pseudoinclusions may be additional morphologic clues to a BAP1-deficient nevus. It remains to be seen whether these features are more common in familial than sporadic lesions. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

3 CFR 8743 - Proclamation 8743 of November 1, 2011. Military Family Month, 2011

Code of Federal Regulations, 2012 CFR

2012-01-01

... make America’s military the finest in the world, their family members embody the resilience and... November 1, 2011 Proc. 8743 Military Family Month, 2011By the President of the United States of America A... 3 The President 1 2012-01-01 2012-01-01 false Proclamation 8743 of November 1, 2011. Military...

Biology of Three ICE Families: SXT/R391, ICEBs1, and ICESt1/ICESt3.

PubMed

Carraro, Nicolas; Burrus, Vincent

2014-12-01

Integrative and Conjugative Elements (ICEs) are bacterial mobile genetic elements that play a key role in bacterial genomes dynamics and evolution. ICEs are widely distributed among virtually all bacterial genera. Recent extensive studies have unraveled their high diversity and complexity. The present review depicts the general conserved features of ICEs and describes more precisely three major families of ICEs that have been extensively studied in the past decade for their biology, their evolution and their impact on genomes dynamics. First, the large SXT/R391 family of ICEs disseminates antibiotic resistance genes and drives the exchange of mobilizable genomic islands (MGIs) between many enteric pathogens such as Vibrio cholerae. Second, ICEBs1 of Bacillus subtilis is the most well understood ICE of Gram-positive bacteria, notably regarding the regulation of its dissemination and its initially unforeseen extrachromosomal replication, which could be a common feature of ICEs of both Gram-positive and Gram-negative bacteria. Finally, ICESt1 and ICESt3 of Streptococcus thermophilus are the prototypes of a large family of ICEs widely distributed among various streptococci. These ICEs carry an original regulation module that associates regulators related to those of both SXT/R391 and ICEBs1. Study of ICESt1 and ICESt3 uncovered the cis-mobilization of related genomic islands (CIMEs) by a mechanism called accretion-mobilization, which likely represents a paradigm for the evolution of many ICEs and genomic islands. These three major families of ICEs give a glimpse about ICEs dynamics and their high impact on bacterial adaptation.

The Greek family system when a child has diabetes mellitus type 1.

PubMed

Tsamparli, A; Kounenou, K

2004-12-01

To depict the characteristic ways that families who have a child suffering from diabetes and face difficulties with metabolic control function. In addition, to reveal the ways that this functioning is related to metabolic control problems. Qualitative methods were used, including an in-depth interview and observation of 30 Greek families having one child suffering from diabetes mellitus type 1 and facing difficulties with metabolic control. An average of 10 meetings were conducted with each family, including separate meetings with each individual family member, the parental couple and the family as a whole. Methods were based on thematic categories provided by the model of the "psychosomatic family". The presence of the disease and the requirements of the treatment regimen seemed to be associated with certain family characteristics: enmeshed relationships, ambiguous roles and rules, break down of hierarchy, coalition between mother and patient, absence of father's involvement and "infantilization" of the suffering child. Also in such families, healthy siblings are assigned parental roles and, finally, the families present signs of social exclusion. The study provides important findings concerning the psychological characteristics of the families under study. The present ways of functioning are associated with the difficulties families face when coping with the treatment regimen.

Prediction of Adolescents’ Glycemic Control 1 Year After Diabetes-Specific Family Conflict

PubMed Central

Hilliard, Marisa E.; Guilfoyle, Shanna M.; Dolan, Lawrence M.; Hood, Korey K.

2015-01-01

Objective To test adherence to blood glucose monitoring (BGM) as a mediator between diabetes-specific family conflict and glycemic control (hemoglobin A1c [HbA1c] levels) for 1 year. Design Three waves of prospective data spanning 1 year. Setting Diabetes clinic in a large tertiary care children’s hospital in the Midwestern United States. Participants One hundred forty-five dyads composed of an adolescent (aged 13–18 years) with type 1 diabetes mellitus and a parent. Main Exposures Adolescent- and parent-rated diabetes-specific family conflict and mean daily BGM frequency obtained through meter downloads. Main Outcome Measure Levels of HbA1c, abstracted from the medical record. Results In separate general linear models, higher adolescent-rated family conflict scores at baseline predicted less frequent BGM at 6 months (β=−0.08 [P=.01]) and higher HbA1c levels at 12 months (β=0.08 [P=.02]). In the multivariate model including baseline conflict and BGM as predictors of HbA1c levels, BGM was a significant predictor (β=−0.24 [P=.007]) and conflict was no longer significant (β=0.05 [P=.11]), supporting the mediation hypothesis. Post hoc probing showed that BGM explained 24% of the variance in the conflict-HbA1c link. The mediation between parent-reported conflict andHbA1c levels via BGM adherence was partially supported (conflict predicting HbA1c in the zero-order equation, β=−0.24 [P=.004]; multivariate equation, β=0.06 [P=.02]), and BGM frequency explained 16% of the conflict-HbA1c link. Conclusions Diabetes-specific family conflict in adolescence predicts deteriorations in BGM and subsequent glycemic control for at least 1 year. Results support ongoing intervention research designed to reduce family conflict and thus prevent a trajectory of declining adherence and glycemic control across adolescence. PMID:21727273

The Sla2p/HIP1/HIP1R family: similar structure, similar function in endocytosis?

PubMed

Gottfried, Irit; Ehrlich, Marcelo; Ashery, Uri

2010-02-01

HIP1 (huntingtin interacting protein 1) has two close relatives: HIP1R (HIP1-related) and yeast Sla2p. All three members of the family have a conserved domain structure, suggesting a common function. Over the past decade, a number of studies have characterized these proteins using a combination of biochemical, imaging, structural and genetic techniques. These studies provide valuable information on binding partners, structure and dynamics of HIP1/HIP1R/Sla2p. In general, all suggest a role in CME (clathrin-mediated endocytosis) for the three proteins, though some differences have emerged. In this mini-review we summarize the current views on the roles of these proteins, while emphasizing the unique attributes of each family member.

Family interactions in adoptive compared to nonadoptive families.

PubMed

Rueter, Martha A; Keyes, Margaret A; Iacono, William G; McGue, Matt

2009-02-01

Despite the large and growing numbers of adoptive families, little research describes interactions in families with adopted adolescents. Yet, adopted adolescents' increased risk for adjustment problems, combined with the association between family interactions and adolescent adjustment in nonadoptive families, raises questions about differences in adoptive and nonadoptive family interactions. We compared observed and self-reported family interactions between 284 adoptive and 208 nonadoptive families and within 123 families with 1 adopted and 1 nonadopted adolescent. Adolescents averaged 14.9 years of age. Comparisons were made using analysis of variance incorporating hierarchical linear methods in SAS PROC MIXED to control family-related correlations in the data. Parents and children reported more conflict in adoptive families when compared with nonadoptive families. Families with 1 adopted and 1 nonadopted adolescent reported more conflict between parents and adopted adolescents. Observed parental behavior was similar across adoptive and nonadoptive children although adopted adolescents were less warm and, in families with 2 adopted children, more conflictual than nonadopted adolescents. These findings suggest a need for further investigation of the association between family interactions and adopted adolescent problem behavior. Copyright 2009 APA, all rights reserved.

Family Interactions in Adoptive Compared to Nonadoptive Families

PubMed Central

Rueter, Martha A.; Keyes, Margaret A.; Iacono, William G.; McGue, Matt

2009-01-01

Despite the large and growing numbers of adoptive families, little research describes interactions in families with adopted adolescents. Yet, adopted adolescents’ increased risk for adjustment problems, combined with the association between family interactions and adolescent adjustment in nonadoptive families, raises questions about differences in adoptive and nonadoptive family interactions. We compared observed and self-reported family interactions between 284 adoptive and 208 nonadoptive families and within 123 families with 1 adopted and 1 nonadopted adolescent. Adolescents averaged 14.9 years of age. Comparisons were made using analysis of variance incorporating hierarchical linear methods in SAS PROC MIXED to control family-related correlations in the data. Parents and children reported more conflict in adoptive families when compared with nonadoptive families. Families with 1 adopted and 1 nonadopted adolescent reported more conflict between parents and adopted adolescents. Observed parental behavior was similar across adoptive and nonadoptive children although adopted adolescents were less warm and, in families with 2 adopted children, more conflictual than nonadopted adolescents. These findings suggest a need for further investigation of the association between family interactions and adopted adolescent problem behavior. PMID:19203160

Two novel mutations of fibrillin-1 gene correlate with different phenotypes of Marfan syndrome in Chinese families.

PubMed

Zhao, Feng; Pan, Xinyuan; Zhao, Kanxing; Zhao, Chen

2013-01-01

To identify the causative mutations in two Chinese families with autosomal dominant Marfan syndrome and to describe the associated phenotypes. Complete physical, ophthalmic, and cardiovascular examinations were given to the patients and unaffected individuals in the two families. Exclusive linkage mapping was performed for transforming growth factor beta receptor II (TGFBR2) and fibrillin-1 (FBN1) loci in both families. The entire coding region and flanking splice sites of the FBN1 gene were screened for mutations in the two families with Sanger sequencing. The potential mutations of FBN1 were tested in 100 normal controls. Lens dislocation was observed in two out of ten patients in the MF1 family and all patients in the MF2 family. However, the MF1 family displayed more severe cardiovascular and skeletal system involvement compared with the MF2 family. The transforming growth factor beta receptor II locus was excluded in both families by linkage analysis. A maximum multipoint lod score score of 2.83 was obtained for marker D15S992 (located in the FBN1 gene) in the MF1 family and 1.51 for the same marker in the MF2 family. Two novel mutations of FBN1, p.C271* and p.C637Y, were identified in the MF1 and MF2 families, respectively. Genotype-phenotype correlations in this study indicate that nonsense mutations of FBN1 may correlate with relatively severe systemic phenotypes when compared with cysteine substitutions, the most common type of FBN1 mutations. Genetic diagnosis for patients with Marfan syndrome would help with genetic counseling, clinical intervention, and prognosis.

Two novel mutations of fibrillin-1 gene correlate with different phenotypes of Marfan syndrome in Chinese families

PubMed Central

Zhao, Feng; Pan, Xinyuan; Zhao, Kanxing

2013-01-01

Purpose To identify the causative mutations in two Chinese families with autosomal dominant Marfan syndrome and to describe the associated phenotypes. Methods Complete physical, ophthalmic, and cardiovascular examinations were given to the patients and unaffected individuals in the two families. Exclusive linkage mapping was performed for transforming growth factor beta receptor II (TGFBR2) and fibrillin-1 (FBN1) loci in both families. The entire coding region and flanking splice sites of the FBN1 gene were screened for mutations in the two families with Sanger sequencing. The potential mutations of FBN1 were tested in 100 normal controls. Results Lens dislocation was observed in two out of ten patients in the MF1 family and all patients in the MF2 family. However, the MF1 family displayed more severe cardiovascular and skeletal system involvement compared with the MF2 family. The transforming growth factor beta receptor II locus was excluded in both families by linkage analysis. A maximum multipoint lod score score of 2.83 was obtained for marker D15S992 (located in the FBN1 gene) in the MF1 family and 1.51 for the same marker in the MF2 family. Two novel mutations of FBN1, p.C271* and p.C637Y, were identified in the MF1 and MF2 families, respectively. Conclusions Genotype-phenotype correlations in this study indicate that nonsense mutations of FBN1 may correlate with relatively severe systemic phenotypes when compared with cysteine substitutions, the most common type of FBN1 mutations. Genetic diagnosis for patients with Marfan syndrome would help with genetic counseling, clinical intervention, and prognosis. PMID:23592911

Factors associated with young adults' knowledge regarding family history of Stroke 1

PubMed Central

Lima, Maria Jose Melo Ramos; Moreira, Thereza Maria Magalhães; Florêncio, Raquel Sampaio; Braga, Predro

2016-01-01

ABSTRACT Objective: to analyze the factors associated with young adults' knowledge regarding family history of stroke. Method: an analytical transversal study, with 579 young adults from state schools, with collection of sociodemographic, clinical and risk factor-related variables, analyzed using logistic regression (backward elimination). Results: a statistical association was detected between age, civil status, and classification of arterial blood pressure and abdominal circumference with knowledge of family history of stroke. In the final logistic regression model, a statistical association was observed between knowledge regarding family history of stroke and the civil status of having a partner (ORa=1.61[1.07-2.42]; p=0.023), abdominal circumference (ORa=0.98[0.96-0.99]; p=0.012) and normal arterial blood pressure (ORa=2.56[1.19-5.52]; p=0.016). Conclusion: an association was observed between socioeconomic factors and risk factors for stroke and knowledge of family history of stroke, suggesting the need for health education or even educational programs on this topic for the clientele in question. PMID:27878217

Work and Family Life. Phase 1. Final Report.

ERIC Educational Resources Information Center

Lein, Laura; And Others

This is the first of a series of working papers and reports on aspects of modern American families. It investigates the issues and problems facing families with preschool children, when both of the parents are employed. The composite portrait of family styles within a sample of 14 young families begins with a project history. The literature is…

H1-MAPT and the Risk for Familial Essential Tremor

PubMed Central

García-Martín, Elena; Martínez, Carmen; Alonso-Navarro, Hortensia; Benito-León, Julián; Lorenzo-Betancor, Oswaldo; Pastor, Pau; López-Alburquerque, Tomás; Samaranch, Lluis; Lorenzo, Elena; Agúndez, José A. G.; Jiménez-Jiménez, Félix Javier

2012-01-01

The most frequent MAPT H1 haplotype is associated with the risk for developing progressive supranuclear palsy and other neurodegenerative diseases such as Parkinson’s disease. A recent report suggests that the MAPT H1 is associated with the risk for developing essential tremor. We wanted to confirm this association in a different population. We analyzed the distribution of allelic and genotype frequencies of rs1052553, which is an H1/H2 SNP, in 200 subjects with familial ET and 291 healthy controls. rs1052553 genotype and allelic frequencies did not differ significantly between subjects with ET and controls and were unrelated with the age at onset of tremor or gender, and with the presence of head, voice, chin, and tongue tremor. Our study suggests that the MAPT H1 rs1052553 is not associated with the risk for developing familial ET in the Spanish population. PMID:22911817

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

INS VNTR is not associated with childhood obesity in 1,023 families: a family-based study.

PubMed

Bouatia-Naji, Nabila; De Graeve, Franck; Brönner, Günter; Lecoeur, Cécile; Vatin, Vincent; Durand, Emmanuelle; Lichtner, Peter; Nguyen, Thuy T; Heude, Barbara; Weill, Jacques; Lévy-Marchal, Claire; Hebebrand, Johannes; Froguel, Philippe; Meyre, David

2008-06-01

Previous studies have described genetic associations of the insulin gene variable number tandem repeat (INS VNTR) variant with childhood obesity and associated phenotypes. We aimed to assess the contribution of INS VNTR genotypes to childhood obesity and variance of insulin resistance, insulin secretion, and birth weight using family-based design. Participants were either French or German whites. We used transmission disequilibrium tests (TDTs) for assessing binary traits and quantitative pedigree disequilibrium tests for assessing continuous traits. In contrast to previous findings, we did not observe any familial association with childhood obesity (T = 50%, P = 0.77) in the 1,023 families tested. In French obese children, INS VNTR did not associate with fasting insulin levels (P = 0.23) and class I allele showed only borderline association with increased insulin secretion index at 30 min (P = 0.03). INS VNTR did not associate with birth weight in obese children (P = 0.98) and TDT analyses in 350 French families with history of low birth weight (LBW) showed no association with this condition (P = 0.92). In summary, our study, the largest performed so far, does not support the previously reported associations between INS VNTR and childhood obesity, insulin resistance, or birth weight, and does not suggest any major role for this variant in modulating these traits.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

PubMed

Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

Loss-of-function FERMT1 mutations in kindler syndrome implicate a role for fermitin family homolog-1 in integrin activation.

PubMed

Lai-Cheong, Joey E; Parsons, Maddy; Tanaka, Akio; Ussar, Siegfried; South, Andrew P; Gomathy, Sethuraman; Mee, John B; Barbaroux, Jean-Baptiste; Techanukul, Tanasit; Almaani, Noor; Clements, Suzanne E; Hart, Ian R; McGrath, John A

2009-10-01

Kindler syndrome is an autosomal recessive disorder characterized by skin atrophy and blistering. It results from loss-of-function mutations in the FERMT1 gene encoding the focal adhesion protein, fermitin family homolog-1. How and why deficiency of fermitin family homolog-1 results in skin atrophy and blistering are unclear. In this study, we investigated the epidermal basement membrane and keratinocyte biology abnormalities in Kindler syndrome. We identified altered distribution of several basement membrane proteins, including types IV, VII, and XVII collagens and laminin-332 in Kindler syndrome skin. In addition, reduced immunolabeling intensity of epidermal cell markers such as beta1 and alpha6 integrins and cytokeratin 15 was noted. At the cellular level, there was loss of beta4 integrin immunolocalization and random distribution of laminin-332 in Kindler syndrome keratinocytes. Of note, active beta1 integrin was reduced but overexpression of fermitin family homolog-1 restored integrin activation and partially rescued the Kindler syndrome cellular phenotype. This study provides evidence that fermitin family homolog-1 is implicated in integrin activation and demonstrates that lack of this protein leads to pathological changes beyond focal adhesions, with disruption of several hemidesmosomal components and reduced expression of keratinocyte stem cell markers. These findings collectively provide novel data on the role of fermitin family homolog-1 in skin and further insight into the pathophysiology of Kindler syndrome.

Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation.

PubMed

Jesús, A Gómez-De; Romano-Baez, F J; Leyva-Amezcua, L; Juárez-Ramírez, C; Ruiz-Ordaz, N; Galíndez-Mayer, J

2009-01-30

For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high A(D)/A(R) ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values epsilon(G), and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies ( approximately 95%), and by the stoichiometric release of chloride ions from the halogenated compound ( approximately 80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions).

Intestinal parasitic infections among children under five years of age presenting with diarrhoeal diseases to two public health facilities in Hawassa, South Ethiopia.

PubMed

Mulatu, Getamesay; Zeynudin, Ahmed; Zemene, Endalew; Debalke, Serkadis; Beyene, Getenet

2015-11-04

Diarrhoea is the leading cause of morbidity and mortality in children under 5 years of age in developing countries, including Ethiopia. It is caused by a wide range of pathogens, including parasites, bacteria and viruses. The aim of this study was to determine the prevalence of infection with intestinal parasites (IPs) (and types) among children under 5 years of age with diarrhoeal diseases. A cross-sectional study was conducted at Adare Hospital and Millennium Health Centre, both located in Hawassa, South Ethiopia, from June 6 to October 28, 2011. Children under 5 years of age with diarrhoea who visited these health facilities during the study period were included in the study. Data relating to demography and risk factors associated with intestinal parasitic infections (IPIs) were gathered using a structured questionnaire. Single, fresh stool specimens were examined for IPs using the direct wet mount examination, followed by Ziehl-Neelsen staining of formol-ether concentrated samples, as per standard procedures. Data were analysed using SPSS Statistics 20 software. A total of 158 children (51.3 % male and 48.7 % female) participated in the study. Overall, the prevalence of IPs was 26.6 % (42/158). Two species of IPs were detected in six children (3.8 %). Entamoeba histolytica/dispar/moshkovskii was the predominant parasite identified (11.4 %), followed by Giardia duodenalis (7.0 %). The multivariable analysis revealed that the age group ≥24 months was significantly associated (AOR = 0.221, 95 %CI: 0.085-0.576) with prevalence of IPIs. This study found that intestinal parasites are common among children with diarrheal diseases. The most frequently detected species was E. histolytica/dispar/moshkovskii. Health information about how to prevent diarrheal diseases in general and IPIs in particular should be provided to parents of young children.

Pathogenic mutations in TULP1 responsible for retinitis pigmentosa identified in consanguineous familial cases

PubMed Central

Ullah, Inayat; Kabir, Firoz; Iqbal, Muhammad; Gottsch, Clare Brooks S.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

2016-01-01

Purpose To identify pathogenic mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous familial cases. Methods Seven large familial cases with multiple individuals diagnosed with retinitis pigmentosa were included in the study. Affected individuals in these families underwent ophthalmic examinations to document the symptoms and confirm the initial diagnosis. Blood samples were collected from all participating members, and genomic DNA was extracted. An exclusion analysis with microsatellite markers spanning the TULP1 locus on chromosome 6p was performed, and two-point logarithm of odds (LOD) scores were calculated. All coding exons along with the exon–intron boundaries of TULP1 were sequenced bidirectionally. We constructed a single nucleotide polymorphism (SNP) haplotype for the four familial cases harboring the K489R allele and estimated the likelihood of a founder effect. Results The ophthalmic examinations of the affected individuals in these familial cases were suggestive of RP. Exclusion analyses confirmed linkage to chromosome 6p harboring TULP1 with positive two-point LOD scores. Subsequent Sanger sequencing identified the single base pair substitution in exon14, c.1466A>G (p.K489R), in four families. Additionally, we identified a two-base deletion in exon 4, c.286_287delGA (p.E96Gfs77*); a homozygous splice site variant in intron 14, c.1495+4A>C; and a novel missense variation in exon 15, c.1561C>T (p.P521S). All mutations segregated with the disease phenotype in the respective families and were absent in ethnically matched control chromosomes. Haplotype analysis suggested (p<10−6) that affected individuals inherited the causal mutation from a common ancestor. Conclusions Pathogenic mutations in TULP1 are responsible for the RP phenotype in seven familial cases with a common ancestral mutation responsible for the disease phenotype in four of the seven families. PMID:27440997

Rare human leukocyte antigen genotype in two siblings with type 1 diabetes in a Japanese family clustered with type 1 diabetes.

PubMed

Ina, Yujiro; Kawabata, Yumiko; Sakamoto, Ryuichi; Sekiguchi, Naotaka; Ikegami, Hiroshi

2017-11-01

Multiplex families with type 1 diabetes are important for identification of rare variants that cannot be identified in case-control association studies. The very low incidence of type 1 diabetes in the Japanese population, however, makes identification of such families difficult. We identified a Japanese family in which three members developed type 1 diabetes, and studied the genotype of the human leukocyte antigen. All three members with type 1 diabetes had the DRB1*08:02-DQB1*03:02 haplotype, which is specific to the Asian population and strongly susceptible for type 1 diabetes. In particular, a proband and his sister had the same genotype, DRB1*08:02-DQB1*03:02/DRB1*08:02-DQB1*03:02, which is extremely rare even in the Japanese population. Both parents also had DRB1*08:02-DQB1*03:02, but in combination with different human leukocyte antigen haplotypes. Weakly susceptible DRB1*13:02-DQB1*06:04 was present in the affected mother, and resistant DRB1*15:01-DQB1*06:02 in the unaffected father. These data suggest DRB1*08:02-DQB1*03:02 to be a contributing factor for familial clustering of type 1 diabetes in this family. © 2017 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

Family Communication, Risk Perception and Cancer Knowledge of Young Adults from BRCA1/2 Families: a Systematic Review.

PubMed

Young, Alison L; Butow, Phyllis N; Vetsch, Janine; Quinn, Veronica F; Patenaude, Andrea F; Tucker, Katherine M; Wakefield, Claire E

2017-12-01

Understanding challenges in familial communication of cancer risk has informed genetic service delivery. Parent-child interactions have received considerable attention, but few studies focus on young adulthood experiences within BRCA1/2 families. Young adults are approaching, or at a life stage where awareness of hereditary cancer risk is vital for informed choice of risk management options. This review assesses family communication, risk perception and cancer knowledge held by 18-40 year old individuals who have a parent with a BRCA1/2 gene mutation or carry the gene mutation themselves. Thirteen papers met the inclusion criteria. One utilized a 'mixed methods' methodology and the remaining used a qualitative approach. Findings were synthesized into themes and reported narratively. In general, parents are communicating openly about genetic risk with young adult offspring, but there is evidence that some young adults are withholding information from their parents about their own test results. Risk perception is influenced by a family history of cancer, childbearing plans and health providers' advice. Misconceptions about genetic risk appear to be common and gaps in hereditary cancer knowledge are evident. It is unclear whether incorrect knowledge was passed from parents to offspring. Health providers need to provide developmentally appropriate services for emerging adults (18-25 years old), with particular support in navigating through risk management options.

Phenotypic Heterogeneity in a DFNA20/26 family segregating a novel ACTG1 mutation.

PubMed

Yuan, Yongyi; Gao, Xue; Huang, Bangqing; Lu, Jingqiao; Wang, Guojian; Lin, Xi; Qu, Yan; Dai, Pu

2016-02-01

Genetic factors play an important role in hearing loss, contributing to approximately 60% of cases of congenital hearing loss. Autosomal dominant deafness accounts for approximately 20% of cases of hereditary hearing loss. Diseases with autosomal dominant inheritance often show pleiotropy, different degrees of penetrance, and variable expressivity. A three-generation Chinese family with autosomal dominant nonsyndromic hearing impairment (ADNSHI) was enrolled in this study. Audiometric data and blood samples were collected from the family. In total, 129 known human deafness genes were sequenced using next-generation sequencing (NGS) to identify the responsible gene mutation in the family. Whole Exome Sequencing (WES) was performed to exclude any other variant that cosegregated with the phenotype. The age of onset of the affected family members was the second decade of life. The condition began with high-frequency hearing impairment in all family members excluding III:2. The novel ACTG1 c.638A > G (p.K213R) mutation was found in all affected family members and was not found in the unaffected family members. A heterozygous c.638A > G mutation in ACTG1 and homozygous c.109G > A (p.V37I) mutation in GJB2 were found in III:2, who was born with hearing loss. The WES result concurred with that of targeted sequencing of known deafness genes. The novel mutation p.K213R in ACTG1 was found to be co-segregated with hearing loss and the genetic cause of ADNSHI in this family. A homozygous mutation associated with recessive inheritance only rarely co-acts with a dominant mutation to result in hearing loss in a dominant family. In such cases, the mutations in the two genes, as in ACTG1 and GJB2 in the present study, may result in a more severe phenotype. Targeted sequencing of known deafness genes is one of the best choices to identify the genetic cause in hereditary hearing loss families.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

PubMed Central

Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

Biochemical reconstitution and phylogenetic comparison of human SET1 family core complexes involved in histone methylation.

PubMed

Shinsky, Stephen A; Monteith, Kelsey E; Viggiano, Susan; Cosgrove, Michael S

2015-03-06

Mixed lineage leukemia protein-1 (MLL1) is a member of the SET1 family of histone H3 lysine 4 (H3K4) methyltransferases that are required for metazoan development. MLL1 is the best characterized human SET1 family member, which includes MLL1-4 and SETd1A/B. MLL1 assembles with WDR5, RBBP5, ASH2L, DPY-30 (WRAD) to form the MLL1 core complex, which is required for H3K4 dimethylation and transcriptional activation. Because all SET1 family proteins interact with WRAD in vivo, it is hypothesized they are regulated by similar mechanisms. However, recent evidence suggests differences among family members that may reflect unique regulatory inputs in the cell. Missing is an understanding of the intrinsic enzymatic activities of different SET1 family complexes under standard conditions. In this investigation, we reconstituted each human SET1 family core complex and compared subunit assembly and enzymatic activities. We found that in the absence of WRAD, all but one SET domain catalyzes at least weak H3K4 monomethylation. In the presence of WRAD, all SET1 family members showed stimulated monomethyltransferase activity but differed in their di- and trimethylation activities. We found that these differences are correlated with evolutionary lineage, suggesting these enzyme complexes have evolved to accomplish unique tasks within metazoan genomes. To understand the structural basis for these differences, we employed a "phylogenetic scanning mutagenesis" assay and identified a cluster of amino acid substitutions that confer a WRAD-dependent gain-of-function dimethylation activity on complexes assembled with the MLL3 or Drosophila trithorax proteins. These results form the basis for understanding how WRAD differentially regulates SET1 family complexes in vivo. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Comparison of the Heritability of Schizophrenia and Endophenotypes in the COGS-1 Family Study

PubMed Central

Light, Gregory; Greenwood, Tiffany A.; Swerdlow, Neal R.; Calkins, Monica E.; Freedman, Robert; Green, Michael F.; Gur, Raquel E.; Gur, Ruben C.; Lazzeroni, Laura C.; Nuechterlein, Keith H.; Olincy, Ann; Radant, Allen D.; Seidman, Larry J.; Siever, Larry J.; Silverman, Jeremy M.; Sprock, Joyce; Stone, William S.; Sugar, Catherine A.; Tsuang, Debby W.; Tsuang, Ming T.; Turetsky, Bruce I.; Braff, David L.

2014-01-01

Background: Twin and multiplex family studies have established significant heritability for schizophrenia (SZ), often summarized as 81%. The Consortium on the Genetics of Schizophrenia (COGS-1) family study was designed to deconstruct the genetic architecture of SZ using neurocognitive and neurophysiological endophenotypes, for which heritability estimates ranged from 18% to 50% (mean = 30%). This study assessed the heritability of SZ in these families to determine whether there is a “heritability gap” between the diagnosis and related endophenotypes. Methods: Nuclear families (N = 296) with a SZ proband, an unaffected sibling, and both parents (n = 1366 subjects; mean family size = 4.6) underwent comprehensive endophenotype and clinical characterization. The Family Interview for Genetic Studies was administered to all participants and used to obtain convergent psychiatric symptom information for additional first-degree relatives of interviewed subjects (N = 3304 subjects; mean family size = 11.2). Heritability estimates of psychotic disorders were computed for both nuclear and extended families. Results: The heritability of SZ was 31% and 44% for nuclear and extended families. The inclusion of bipolar disorder increased the heritability to 37% for the nuclear families. When major depression was added, heritability estimates dropped to 34% and 20% for nuclear and extended families, respectively. Conclusions: Endophenotypes and psychotic disorders exhibit comparable levels of heritability in the COGS-1 family sample. The ascertainment of families with discordant sibpairs to increase endophenotypic contrast may underestimate diagnostic heritability relative to other studies. However, population-based studies also report significantly lower heritability estimates for SZ. Collectively, these findings support the importance of endophenotype-based strategies and the dimensional view of psychosis. PMID:24903414

Comparison of the heritability of schizophrenia and endophenotypes in the COGS-1 family study.

PubMed

Light, Gregory; Greenwood, Tiffany A; Swerdlow, Neal R; Calkins, Monica E; Freedman, Robert; Green, Michael F; Gur, Raquel E; Gur, Ruben C; Lazzeroni, Laura C; Nuechterlein, Keith H; Olincy, Ann; Radant, Allen D; Seidman, Larry J; Siever, Larry J; Silverman, Jeremy M; Sprock, Joyce; Stone, William S; Sugar, Catherine A; Tsuang, Debby W; Tsuang, Ming T; Turetsky, Bruce I; Braff, David L

2014-11-01

Twin and multiplex family studies have established significant heritability for schizophrenia (SZ), often summarized as 81%. The Consortium on the Genetics of Schizophrenia (COGS-1) family study was designed to deconstruct the genetic architecture of SZ using neurocognitive and neurophysiological endophenotypes, for which heritability estimates ranged from 18% to 50% (mean = 30%). This study assessed the heritability of SZ in these families to determine whether there is a "heritability gap" between the diagnosis and related endophenotypes. Nuclear families (N = 296) with a SZ proband, an unaffected sibling, and both parents (n = 1366 subjects; mean family size = 4.6) underwent comprehensive endophenotype and clinical characterization. The Family Interview for Genetic Studies was administered to all participants and used to obtain convergent psychiatric symptom information for additional first-degree relatives of interviewed subjects (N = 3304 subjects; mean family size = 11.2). Heritability estimates of psychotic disorders were computed for both nuclear and extended families. The heritability of SZ was 31% and 44% for nuclear and extended families. The inclusion of bipolar disorder increased the heritability to 37% for the nuclear families. When major depression was added, heritability estimates dropped to 34% and 20% for nuclear and extended families, respectively. Endophenotypes and psychotic disorders exhibit comparable levels of heritability in the COGS-1 family sample. The ascertainment of families with discordant sibpairs to increase endophenotypic contrast may underestimate diagnostic heritability relative to other studies. However, population-based studies also report significantly lower heritability estimates for SZ. Collectively, these findings support the importance of endophenotype-based strategies and the dimensional view of psychosis. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center 2014.

Mutation analysis for DJ-1 in sporadic and familial parkinsonism: screening strategy in parkinsonism.

PubMed

Tomiyama, Hiroyuki; Li, Yuanzhe; Yoshino, Hiroyo; Mizuno, Yoshikuni; Kubo, Shin-Ichiro; Toda, Tatsushi; Hattori, Nobutaka

2009-05-22

DJ-1 mutations cause autosomal recessive parkinsonism (ARP). Although some reports of DJ-1 mutations have been published, there is lack of information on the prevalence of these mutations in large-scale studies of both familial and sporadic parkinsonism. In this genetic screening study, we analyzed the distribution and frequency of DJ-1 mutations by direct nucleotide sequencing of coding exons and exon-intron boundaries of DJ-1, in 386 parkin-negative parkinsonism patients (371 index cases: 67 probands of autosomal recessive parkinsonism families, 90 probands of autosomal dominant parkinsonism families, 201 patients with sporadic parkinsonism, and 13 with unknown family histories) from 12 countries (Japan 283, China 27, Taiwan 22, Korea 22, Israel 16, Turkey 5, Philippines 2, Bulgaria 2, Greece 2, Tunisia 1, USA 2, Ukraine 1, unknown 1). None had causative mutation in DJ-1, suggesting DJ-1 mutation is very rare among patients with familial and sporadic parkinsonism from Asian countries and those with other ethnic background. This is in contrast to the higher frequencies and worldwide distribution of parkin- and PINK1-related parkinsonism in ARP and sporadic parkinsonism. Thus, after obtaining clinical information, screening for mutations in (1) parkin, (2) PINK1, (3) DJ-1, (4) ATP13A2 should be conducted in that order, in ARP and sporadic parkinsonism, based on their reported frequencies. In addition, haplotype analysis should be employed to check for homozygosity of 1p36, which harbors a cluster of causative genes for ARP such as DJ-1, PINK1 and ATP13A2 in ARP and sporadic parkinsonism, especially in parkinsonism with consanguinity.

Violence toward a family member, angry adult conflict, and child adjustment difficulties: relations in families with 1- to 3-year-old children.

PubMed

McDonald, Renee; Jouriles, Ernest N; Briggs-Gowan, Margaret J; Rosenfield, David; Carter, Alice S

2007-06-01

In this study, the authors examined whether witnessing violence toward a family member increases the risk for adjustment difficulties among children in the 1- to 3-year age range, beyond the risk attributable to witnessing nonviolent, angry adult conflict. Participants were 1,152 caregivers of 1- to 3-year-old children, randomly selected from birth records and recruited from the community. Caregivers indicated whether their children had witnessed violence toward a family member and/or angry adult conflict. They also completed a comprehensive measure of child adjustment difficulties. Exposure to violence toward a family member and exposure to angry adult conflict were each uniquely associated with increased risk for adjustment problems. These results emerged after accounting for pertinent demographic variables and for caregiver distress variables.

Associations of disordered eating behavior with the family diabetes environment in adolescents with Type 1 diabetes.

PubMed

Caccavale, Laura J; Nansel, Tonja R; Quick, Virginia; Lipsky, Leah M; Laffel, Lori M B; Mehta, Sanjeev N

2015-01-01

To examine associations of disordered eating behaviors with aspects of the family eating and diabetes management environments among adolescents with Type 1 diabetes (T1D). Data were collected from 151 adolescents (mean age = 15.6 years) with T1D and their parents. Adolescents and parents completed self-report measures of the family eating environment (priority, atmosphere and structure/rules surrounding family meals, and the presence of restricted and special foods in the household) and diabetes family management environment (diabetes family conflict and responsibility sharing). Adolescents completed measures of parent modeling of healthy eating and disordered eating behaviors. Linear regression models were used to assess the relationship of disordered eating behaviors with aspects of the family eating and diabetes management environments. In unadjusted models, adolescent, but not parent, report of aspects of the family eating environment was associated with adolescents' disordered eating behaviors. Both adolescent and parent report of diabetes family conflict were positively associated with disordered eating behaviors. The adjusted adolescent model including all family eating and diabetes management variables accounted for 20.8% of the variance in disordered eating behaviors (p < .001, R² = .208). Factors associated with greater risk of disordered eating included being female (β = .168, p = .029), lower priority placed on family meals (β = -.273, p = .003), less parental modeling of healthy eating (β = -.197, p = .027), more food restrictions in the household β = .223, (p = .005), and greater diabetes family conflict (β = .195, p = .011). Findings suggest that aspects of the family eating environment and diabetes family conflict may represent important factors for disordered eating risk in adolescents with T1D.

Associations of disordered eating behavior with the family diabetes environment in adolescents with type 1 diabetes

PubMed Central

Caccavale, Laura J.; Nansel, Tonja R.; Quick, Virginia; Lipsky, Leah M.; Laffel, Lori M.B.; Mehta, Sanjeev N.

2014-01-01

Objective To examine associations of disordered eating behaviors with aspects of the family eating and diabetes management environments among adolescents with type 1 diabetes (T1D). Method Data were collected from 151 adolescents (M age = 15.6 years) with T1D and their parents. Adolescents and parents completed self-report measures of the family eating environment (priority, atmosphere and structure/rules surrounding family meals, and presence of restricted and special foods in the household), and diabetes family management environment (diabetes family conflict and responsibility sharing). Adolescents completed measures of parent modeling of healthy eating and disordered eating behaviors. Linear regression models were used to assess the relationship of disordered eating behaviors with aspects of the family eating and diabetes management environments. Results In unadjusted models, adolescent, but not parent, report of aspects of the family eating environment were associated with adolescents' disordered eating behaviors. Both adolescent and parent report of diabetes family conflict were positively associated with disordered eating behaviors. The adjusted adolescent model including all family eating and diabetes management variables accounted for 20.8% of the variance in disordered eating behaviors (p<.001, R2=.208). Factors associated with greater risk of disordered eating included being female (β=.168, p=.029), lower priority placed on family meals (β=-.273, p=.003), less parental modeling of healthy eating (β=-.197, p=.027), more food restrictions in the household β=.223, (p=.005), and greater diabetes family conflict (β=.195, p=.011). Conclusions Findings suggest that aspects of the family eating environment and diabetes family conflict may represent important factors for disordered eating risk in adolescents with T1D. PMID:25493461

Infantile Pain Episodes Associated with Novel Nav1.9 Mutations in Familial Episodic Pain Syndrome in Japanese Families.

PubMed

Okuda, Hiroko; Noguchi, Atsuko; Kobayashi, Hatasu; Kondo, Daiki; Harada, Kouji H; Youssefian, Shohab; Shioi, Hirotomo; Kabata, Risako; Domon, Yuki; Kubota, Kazufumi; Kitano, Yutaka; Takayama, Yasunori; Hitomi, Toshiaki; Ohno, Kousaku; Saito, Yoshiaki; Asano, Takeshi; Tominaga, Makoto; Takahashi, Tsutomu; Koizumi, Akio

2016-01-01

Painful peripheral neuropathy has been correlated with various voltage-gated sodium channel mutations in sensory neurons. Recently Nav1.9, a voltage-gated sodium channel subtype, has been established as a genetic influence for certain peripheral pain syndromes. In this study, we performed a genetic study in six unrelated multigenerational Japanese families with episodic pain syndrome. Affected participants (n = 23) were characterized by infantile recurrent pain episodes with spontaneous mitigation around adolescence. This unique phenotype was inherited in an autosomal-dominant mode. Linkage analysis was performed for two families with 12 affected and nine unaffected members, and a single locus was identified on 3p22 (LOD score 4.32). Exome analysis (n = 14) was performed for affected and unaffected members in these two families and an additional family. Two missense variants were identified: R222H and R222S in SCN11A. Next, we generated a knock-in mouse model harboring one of the mutations (R222S). Behavioral tests (Hargreaves test and cold plate test) using R222S and wild-type C57BL/6 (WT) mice, young (8-9 weeks old; n = 10-12 for each group) and mature (36-38 weeks old; n = 5-6 for each group), showed that R222S mice were significantly (p < 0.05) more hypersensitive to hot and cold stimuli than WT mice. Electrophysiological studies using dorsal root ganglion neurons from 8-9-week-old mice showed no significant difference in resting membrane potential, but input impedance and firing frequency of evoked action potentials were significantly increased in R222S mice compared with WT mice. However, there was no significant difference among Nav1.9 (WT, R222S, and R222H)-overexpressing ND7/23 cell lines. These results suggest that our novel mutation is a gain-of-function mutation that causes infantile familial episodic pain. The mouse model developed here will be useful for drug screening for familial episodic pain syndrome associated with SCN11A mutations.

Family-based association study of HLA class II with type 1 diabetes in Moroccans.

PubMed

Drissi Bourhanbour, A; Benseffaj, N; Ouadghiri, S; Razine, R; Touzani, A; Belafraj, A; Essakalli, M

2015-04-01

The T1D is a multifactorial disease; with a strong genetic control. The human leukocyte antigen (HLA) system plays a crucial role in the autoimmune process leading to childhood diabetes. About 440,000 of the childhood population of the world (1.8 billion children under 14 years of age), have type 1 diabetes, and each year an additional 70,000 develop this disorder. The objective of this study was to investigate the distribution of HLA class II in Moroccan families of diabetic children to identify susceptibility alleles of the Moroccan population. We included in this study, Moroccan families who have at least one child with T1D. The age of onset of diabetes was less than 15 years. HLA class II (DRB1* and DQB1*) was carried out by molecular biology techniques (PCR-SSP and PCR-SSO). The FBAT test (family-based association test) was used to highlight the association between T1D and the HLA-DRB1* and -DQB1* polymorphism. The association of HLA class II (DRB1*, DQB1*) in type 1 diabetes was analyzed in fifty-one Moroccan families, including 90 diabetics. The results revealed that the most susceptible haplotypes are the DRB1*03:01-DQB1*02:01, DRB1*04:05-DQB1*03:02 (Z=3.674, P=0.000239; Z=2.828, P=0.004678, respectively). And the most protective haplotype is the DRB1*15-DQB1*06. This is the first family-based association study searching for an association between HLA class II and T1D in a Moroccan population. Despite the different ethnic groups forming Morocco, Moroccan diabetics share the most susceptible and protective HLA haplotypes with other Caucasians populations, specifically the European and Mediterranean populations. Copyright © 2014. Published by Elsevier SAS.

Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis.

PubMed

Wu, Chi-Hong; Fallini, Claudia; Ticozzi, Nicola; Keagle, Pamela J; Sapp, Peter C; Piotrowska, Katarzyna; Lowe, Patrick; Koppers, Max; McKenna-Yasek, Diane; Baron, Desiree M; Kost, Jason E; Gonzalez-Perez, Paloma; Fox, Andrew D; Adams, Jenni; Taroni, Franco; Tiloca, Cinzia; Leclerc, Ashley Lyn; Chafe, Shawn C; Mangroo, Dev; Moore, Melissa J; Zitzewitz, Jill A; Xu, Zuo-Shang; van den Berg, Leonard H; Glass, Jonathan D; Siciliano, Gabriele; Cirulli, Elizabeth T; Goldstein, David B; Salachas, Francois; Meininger, Vincent; Rossoll, Wilfried; Ratti, Antonia; Gellera, Cinzia; Bosco, Daryl A; Bassell, Gary J; Silani, Vincenzo; Drory, Vivian E; Brown, Robert H; Landers, John E

2012-08-23

Amyotrophic lateral sclerosis (ALS) is a late-onset neurodegenerative disorder resulting from motor neuron death. Approximately 10% of cases are familial (FALS), typically with a dominant inheritance mode. Despite numerous advances in recent years, nearly 50% of FALS cases have unknown genetic aetiology. Here we show that mutations within the profilin 1 (PFN1) gene can cause FALS. PFN1 is crucial for the conversion of monomeric (G)-actin to filamentous (F)-actin. Exome sequencing of two large ALS families showed different mutations within the PFN1 gene. Further sequence analysis identified 4 mutations in 7 out of 274 FALS cases. Cells expressing PFN1 mutants contain ubiquitinated, insoluble aggregates that in many cases contain the ALS-associated protein TDP-43. PFN1 mutants also display decreased bound actin levels and can inhibit axon outgrowth. Furthermore, primary motor neurons expressing mutant PFN1 display smaller growth cones with a reduced F/G-actin ratio. These observations further document that cytoskeletal pathway alterations contribute to ALS pathogenesis.

G1 arrest and differentiation can occur independently of Rb family function

PubMed Central

Wirt, Stacey E.; Adler, Adam S.; Gebala, Véronique; Weimann, James M.; Schaffer, Bethany E.; Saddic, Louis A.; Viatour, Patrick; Vogel, Hannes; Chang, Howard Y.; Meissner, Alex

2010-01-01

The ability of progenitor cells to exit the cell cycle is essential for proper embryonic development and homeostasis, but the mechanisms governing cell cycle exit are still not fully understood. Here, we tested the requirement for the retinoblastoma (Rb) protein and its family members p107 and p130 in G0/G1 arrest and differentiation in mammalian cells. We found that Rb family triple knockout (TKO) mouse embryos survive until days 9–11 of gestation. Strikingly, some TKO cells, including in epithelial and neural lineages, are able to exit the cell cycle in G0/G1 and differentiate in teratomas and in culture. This ability of TKO cells to arrest in G0/G1 is associated with the repression of key E2F target genes. Thus, G1 arrest is not always dependent on Rb family members, which illustrates the robustness of cell cycle regulatory networks during differentiation and allows for the identification of candidate pathways to inhibit the expansion of cancer cells with mutations in the Rb pathway. PMID:21059851

National Woodland Owner Survey: family forest ownerships with 1 to 9 acres, 2011-2013

Treesearch

Brett J. Butler; Stephanie A. Snyder

2017-01-01

This report summarizes results from the 2011-2013 National Woodland Owner Survey (NWOS) conducted by the U.S. Forest Service, Forest Inventory and Analysis program for family forest ownerships with forest holdings of 1-9 acres. Summaries are based on responses from 1,025 family ownerships with 1-9 acres of forest across 39 U.S. states. Survey summary tables are...

RNA-based analysis of two SMARCB1 mutations associated with familial schwannomatosis with meningiomas.

PubMed

Melean, German; Velasco, Ana; Hernández-Imaz, Elisabete; Rodríguez-Álvarez, Francisco Javier; Martín, Yolanda; Valero, Ana; Hernández-Chico, Concepción

2012-08-01

Germline mutations in the SMARCB1 gene cause familial schwannomatosis, a condition characterized by the presence of multiple schwannomas, although mutations in SMARCB1 have also been associated with rhadboid tumor predisposition syndrome 1 (RTPS1). Both schwannomatosis and RTPS1 are autosomal dominant conditions that predispose individuals to develop distinct types of tumors. We clinically and genetically characterized two families with schwannomatosis associated with SMARCB1 mutations. Eight affected members of these families developed different numbers of schwannomas and/or meningiomas at distinct ages, evidence that meningiomas are variably expressed in this condition. We identified two germline mutations in SMARCB1 associated with the familial disease, c.233-1G>A and the novel c.207_208dupTA mutation, which both proved to affect the main SMARCB1 isoforms at the RNA level distinctly. Interestingly, the c.207_208dupTA mutation had no effect on the coding sequence, pre-mRNA splicing or the level of expression of the SMARCB1 isoform 2. Furthermore, SMARCB1 isoforms harboring a premature termination codon were largely eliminated via the nonsense-mediated mRNA decay pathway. Our results highlight the importance of RNA-based studies to characterize SMARCB1 germline mutations in order to determine their impact on protein expression and gain further insight into the genetic basis of conditions associated with SMARCB1 mutations.

[The child from families with type 1 diabetes].

PubMed

Wasikowa, Renata; Suchańska, Dorota; Suchańska, Danuta; Basiak, Aleksander; Noczyńska, Anna; Stasińska, Teresa

2005-01-01

Diabetes type 1 is observed in individuals with a genetic predisposition to the disease. Observed is a 3-5 fold risk for congenital defects, therefore diabetes type 1 is one of the highest known teratogenic risk factor. The main factor responsible for the development of congenital defects is hyperglycemia. Observed are congenital defects of the central nervous system, the bones, urinary and digestive tract. Characteristic is macrosomia. Observed are hypocalcemia, hypomagnesemia, polycythemia, hyperbilirubinemia, hypertrophic cardiomyopathy, respiratory disturbances. Children from families with diabetes type 1 are at high risk for the development of the disease in the newborn period, additional diseases. They must be in permanent medical control.

Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

PubMed

Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

2017-10-26

Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

Predictors of associated autoimmune diseases (AAID) in families with type 1 diabetes (T1D). Results from the Type 1 Diabetes Genetics Consortium (T1DGC)

PubMed Central

Wägner, Ana M; Santana, Ángelo; Hernández, Marta; Wiebe, Julia C; Nóvoa, Javier; Mauricio, Didac

2011-01-01

Background Type 1 diabetes (T1D) is a clinically heterogeneous disease. The presence of associated autoimmune diseases (AAID) may represent a distinct form of autoimmune diabetes, with involvement of specific mechanisms. The aim of this study was to find predictors of AAID in the Type 1 Diabetes Genetics Consortium (T1DGC) data set. Methods 3263 families with at least 2 siblings with T1D were included. Clinical information was obtained using questionnaires, anti-GAD and anti-IA-2 were measured and HLA-genotyping was performed. Siblings with T1D with and without AAID were compared and a multivariate regression analysis was performed to find predictors of AAID. T1D-associated HLA haplotypes were defined as the 4 most susceptible and protective, respectively. Results AAID was present in 14.4% of the T1D affected siblings. Age of diabetes onset, current age and time since diagnosis were higher, and there was a female predominance and more family history of AAID in the group with AAID, as well as more frequent anti-GAD and less frequent anti-IA2 positivity. Risk and protective HLA haplotype distributions were similar, though DRB1*0301-DQA1*0501-DQB1*0201 was more frequent in the group with AAID. In the multivariate analysis, female gender, age of onset, family history of AAID, time since diagnosis and anti-GAD positivity were significantly associated with AAID. Conclusions In patients with T1D, the presence of AAID is associated with female predominance, more frequent family history of AAID, later onset of T1D and more anti-GAD antibodies, despite longer duration of the disease. The predominance of certain HLA haplotypes suggests that specific mechanisms of disease may be involved. PMID:21744463

Women receiving news of a family BRCA1/2 mutation: messages of fear and empowerment.

PubMed

Crotser, Cheryl B; Dickerson, Suzanne S

2010-12-01

Communication of genetic test results to healthy at-risk family members is complicated considering family dynamics and the complexity of cancer genetics. The purpose of this study was to understand the experience of family communication of BRCA1/2 results from the perspective of young and middle-aged women receiving the news. THEORETICAL RATIONALE: Individuals are self-interpretive beings influenced by family culture, history, and communication patterns. Humans express meaning through language and stories. Heideggerian hermeneutics guided in-depth interviews and team interpretation of data. Using purposive and network sampling, 19 women 18 to 50 years of age who received news of a family BRCA1/2 mutation from a biologic relative were recruited from support groups and two health facilities in upstate New York. Five themes emerged: (a) situating the story, (b) receiving the message from family, (c) responding to receipt of the message, (d) impacting family communication, and (e) advice for communicating risk. Two constitutive patterns were identified: (a) communicating risk as a message of fear and empowerment and (b) integrating the message by taking one step at a time. Healthcare professionals (HCPs) have an important role in provision of anticipatory guidance for communication of genetic test results, including the potential behavioral and emotional responses to family risk communication. Future research is indicated to understand the role of HCPs in family risk communication. Presentation of comprehensive and balanced information and the use of patient-centered communication is essential. HCPs need to view women as whole rather than as a person at risk. Continued support is needed for women who subsequently test positive or negative for the family BRCA1/2 mutation from HCPs and others, often outside the family network. © 2010 Sigma Theta Tau International.

A FBN1 mutation association with different phenotypes of Marfan syndrome in a Chinese family.

PubMed

Li, Yapeng; Xu, Jianhua; Chen, Mingjie; Du, Binbin; Li, Qiaoli; Xing, Qinghe; Zhang, Yanzhou

2016-09-01

Previous studies demonstrated that patients with different FBN1 mutations often present more considerable phenotypic variation compared to different members of the related family carrying a same mutation. The purpose of our study was to identify pathogenic mutation and provide more information about genotype-phenotypic correlations in a large Chinese family with Marfan syndrome. 15 related family members from a Chinese 4-generation pedigree with Marfan syndrome underwent physical, ophthalmologic, radiological and cardiovascular examinations. The propositus has De Bakey III aortic dissection and didn't fulfill the revised Ghent criteria for Marfan syndrome. Nine family members have ectopia lentis and their echocardiogram was normal. Five other family members have no evidence of Marfan syndrome. Genomic DNA was isolated from blood leukocytes. The exome sequencing was employed on the propositus, then the Sanger sequencing was conducted for mutation verification in other 14 participants of this family. The causative mutation in FBN1 discovered in the propositus was a known heterozygous missense mutation, c.1633T>G (p.R545C), in exon 14 (NM 000138). This same mutation was also identified in all 9 ectopia lentis patients and one unaffected 8-year-old girl. However, the same mutation was not discovered in other 4 unaffected family members. Our data enhance the information of genotype-phenotype correlation owing to FBN1 mutations. To our current knowledge, we firstly reported that the same FBN1 mutation, c. 1633C>T (Arg545Cys), was detected simultaneously in three different cardinal phenotypes (ectopia lentis, aortic dissection and unaffected) within one family. The unaffected girl with FBN1 mutation may presumably represent a rare case of nonpenetrance. Copyright © 2016 Elsevier B.V. All rights reserved.

Psychological response of family members of patients hospitalised for influenza A/H1N1 in Oaxaca, Mexico.

PubMed

Elizarrarás-Rivas, Jesús; Vargas-Mendoza, Jaime E; Mayoral-García, Maurilio; Matadamas-Zarate, Cuauhtémoc; Elizarrarás-Cruz, Anaid; Taylor, Melanie; Agho, Kingsley

2010-12-03

The A/H1N1 pandemic originated in Mexico in April 2009, amid high uncertainty, social and economic disruption, and media reports of panic. The aim of this research project was to evaluate the psychological response of family primary caregivers of patients hospitalised in the Intensive Care Unit (ICU) with suspected influenza A/H1N1 to establish whether there was empirical evidence of high adverse psychological response, and to identify risk factors for such a response. If such evidence was found, a secondary aim was to develop a specific early intervention of psychological support for these individuals, to reduce distress and possibly lessen the likelihood of post-traumatic stress disorder (PTSD) in the longer term. Psychological assessment questionnaires were administered to the family primary caregivers of patients hospitalised in the ICU in the General Hospital of Zone 1 of the Mexican Institute for Social Security (IMSS), Oaxaca, Mexico with suspected influenza A/H1N1, during the month of November 2009. The main outcome measures were ratings of reported perceived stress (PSS-10), depression (CES-D), and death anxiety (DAQ). Data were subjected to simple and multiple linear regression analysis to identify risk factors for adverse psychological response. Elevated levels of perceived stress and depression, compared to population normative data, and moderate levels of death anxiety were noted. Levels of depression were similar to those found in comparable studies of family members of ICU patients admitted for other conditions. Multiple regression analysis indicated that increasing age and non-spousal family relationship were significantly associated with depression and perceived stress. Female gender, increasing age, and higher levels of education were significantly associated with high death anxiety. Comparisons with data collected in previous studies in the same hospital ICU with groups affected by a range of other medical conditions indicated that the

Psychological response of family members of patients hospitalised for influenza A/H1N1 in Oaxaca, Mexico

PubMed Central

2010-01-01

Background The A/H1N1 pandemic originated in Mexico in April 2009, amid high uncertainty, social and economic disruption, and media reports of panic. The aim of this research project was to evaluate the psychological response of family primary caregivers of patients hospitalised in the Intensive Care Unit (ICU) with suspected influenza A/H1N1 to establish whether there was empirical evidence of high adverse psychological response, and to identify risk factors for such a response. If such evidence was found, a secondary aim was to develop a specific early intervention of psychological support for these individuals, to reduce distress and possibly lessen the likelihood of post-traumatic stress disorder (PTSD) in the longer term. Methods Psychological assessment questionnaires were administered to the family primary caregivers of patients hospitalised in the ICU in the General Hospital of Zone 1 of the Mexican Institute for Social Security (IMSS), Oaxaca, Mexico with suspected influenza A/H1N1, during the month of November 2009. The main outcome measures were ratings of reported perceived stress (PSS-10), depression (CES-D), and death anxiety (DAQ). Data were subjected to simple and multiple linear regression analysis to identify risk factors for adverse psychological response. Results Elevated levels of perceived stress and depression, compared to population normative data, and moderate levels of death anxiety were noted. Levels of depression were similar to those found in comparable studies of family members of ICU patients admitted for other conditions. Multiple regression analysis indicated that increasing age and non-spousal family relationship were significantly associated with depression and perceived stress. Female gender, increasing age, and higher levels of education were significantly associated with high death anxiety. Comparisons with data collected in previous studies in the same hospital ICU with groups affected by a range of other medical conditions

Novel association of neurofibromatosis type 1-causing mutations in families with neurofibromatosis-Noonan syndrome.

PubMed

Ekvall, Sara; Sjörs, Kerstin; Jonzon, Anders; Vihinen, Mauno; Annerén, Göran; Bondeson, Marie-Louise

2014-03-01

Neurofibromatosis-Noonan syndrome (NFNS) is a rare condition with clinical features of both neurofibromatosis type 1 (NF1) and Noonan syndrome (NS). All three syndromes belong to the RASopathies, which are caused by dysregulation of the RAS-MAPK pathway. The major gene involved in NFNS is NF1, but co-occurring NF1 and PTPN11 mutations in NFNS have been reported. Knowledge about possible involvement of additional RASopathy-associated genes in NFNS is, however, very limited. We present a comprehensive clinical and molecular analysis of eight affected individuals from three unrelated families displaying features of NF1 and NFNS. The genetic etiology of the clinical phenotypes was investigated by mutation analysis, including NF1, PTPN11, SOS1, KRAS, NRAS, BRAF, RAF1, SHOC2, SPRED1, MAP2K1, MAP2K2, and CBL. All three families harbored a heterozygous NF1 variant, where the first family had a missense variant, c.5425C>T;p.R1809C, the second family a recurrent 4bp-deletion, c.6789_6792delTTAC;p.Y2264Tfs*6, and the third family a splice-site variant, c.2991-1G>A, resulting in skipping of exon 18 and an in-frame deletion of 41 amino acids. These NF1 variants have all previously been reported in NF1 patients. Surprisingly, both c.6789_6792delTTAC and c.2991-1G>A are frequently associated with NF1, but association to NFNS has, to our knowledge, not previously been reported. Our results support the notion that NFNS represents a variant of NF1, genetically distinct from NS, and is caused by mutations in NF1, some of which also cause classical NF1. Due to phenotypic overlap between NFNS and NS, we propose screening for NF1 mutations in NS patients, preferentially when café-au-lait spots are present. © 2013 Wiley Periodicals, Inc.

Novel and recurrent XYLT1 mutations in two Turkish families with Desbuquois dysplasia, type 2.

PubMed

Guo, Long; Elcioglu, Nursel H; Iida, Aritoshi; Demirkol, Yasemin K; Aras, Seda; Matsumoto, Naomichi; Nishimura, Gen; Miyake, Noriko; Ikegawa, Shiro

2017-03-01

Desbuquois dysplasia (DBQD) is an autosomal recessive skeletal disorder characterized by growth retardation, joint laxity, short extremities, and progressive scoliosis. DBQD is classified into two types based on the presence (DBQD1) or absence (DBQD2) of characteristic hand abnormalities. CANT1 mutations have been reported in both DBQD1 and DBQD2. Recently, mutations in the gene encoding xylosyltransferase 1 (XYLT1) were identified in several families with DBQD2. In this study, we performed whole-exome sequencing in two Turkish families with DBQD2. We found a novel and a recurrent XYLT1 mutation in each family. The patients were homozygous for the mutations. Our results further support that XYLT1 is responsible for a major subset of DBQD2.

Genetic analysis of SIGMAR1 as a cause of familial ALS with dementia

PubMed Central

Belzil, Véronique V; Daoud, Hussein; Camu, William; Strong, Michael J; Dion, Patrick A; Rouleau, Guy A

2013-01-01

Amyotrophic lateral sclerosis (ALS) is the most common motor neuron diseases (MND), while frontotemporal lobar degeneration (FTLD) is the second most common cause of early-onset dementia. Many ALS families segregating FTLD have been reported, particularly over the last decade. Recently, mutations in TARDBP, FUS/TLS, and C9ORF72 have been identified in both ALS and FTLD patients, while mutations in VCP, a FTLD associated gene, have been found in ALS families. Distinct variants located in the 3′-untranslated region (UTR) of the SIGMAR1 gene were previously reported in three unrelated FTLD or FTLD–MND families. We directly sequenced the coding and UTR regions of the SIGMAR1 gene in a targeted cohort of 25 individual familial ALS cases of Caucasian origin with a history of cognitive impairments. This screening identified one variant in the 3′-UTR of the SIGMAR1 gene in one ALS patient, but the same variant was also observed in 1 out of 380 control chromosomes. Subsequently, we screened the same samples for a C9ORF72 repeat expansion: 52% of this cohort was found expanded, including the sample with the SIGMAR1 3′-UTR variant. Consequently, coding and noncoding variants located in the 3′-UTR region of the SIGMAR1 gene are not the cause of FTLD–MND in our cohort, and more than half of this targeted cohort is genetically explained by C9ORF72 repeat expansions. PMID:22739338

Genetic analysis of SIGMAR1 as a cause of familial ALS with dementia.

PubMed

Belzil, Véronique V; Daoud, Hussein; Camu, William; Strong, Michael J; Dion, Patrick A; Rouleau, Guy A

2013-02-01

Amyotrophic lateral sclerosis (ALS) is the most common motor neuron diseases (MND), while frontotemporal lobar degeneration (FTLD) is the second most common cause of early-onset dementia. Many ALS families segregating FTLD have been reported, particularly over the last decade. Recently, mutations in TARDBP, FUS/TLS, and C9ORF72 have been identified in both ALS and FTLD patients, while mutations in VCP, a FTLD associated gene, have been found in ALS families. Distinct variants located in the 3'-untranslated region (UTR) of the SIGMAR1 gene were previously reported in three unrelated FTLD or FTLD-MND families. We directly sequenced the coding and UTR regions of the SIGMAR1 gene in a targeted cohort of 25 individual familial ALS cases of Caucasian origin with a history of cognitive impairments. This screening identified one variant in the 3'-UTR of the SIGMAR1 gene in one ALS patient, but the same variant was also observed in 1 out of 380 control chromosomes. Subsequently, we screened the same samples for a C9ORF72 repeat expansion: 52% of this cohort was found expanded, including the sample with the SIGMAR1 3'-UTR variant. Consequently, coding and noncoding variants located in the 3'-UTR region of the SIGMAR1 gene are not the cause of FTLD-MND in our cohort, and more than half of this targeted cohort is genetically explained by C9ORF72 repeat expansions.

Endo-(1,4)-β-Glucanase gene families in the grasses: temporal and spatial Co-transcription of orthologous genes1

PubMed Central

2012-01-01

Background Endo-(1,4)-β-glucanase (cellulase) glycosyl hydrolase GH9 enzymes have been implicated in several aspects of cell wall metabolism in higher plants, including cellulose biosynthesis and degradation, modification of other wall polysaccharides that contain contiguous (1,4)-β-glucosyl residues, and wall loosening during cell elongation. Results The endo-(1,4)-β-glucanase gene families from barley (Hordeum vulgare), maize (Zea mays), sorghum (Sorghum bicolor), rice (Oryza sativa) and Brachypodium (Brachypodium distachyon) range in size from 23 to 29 members. Phylogenetic analyses show variations in clade structure between the grasses and Arabidopsis, and indicate differential gene loss and gain during evolution. Map positions and comparative studies of gene structures allow orthologous genes in the five species to be identified and synteny between the grasses is found to be high. It is also possible to differentiate between homoeologues resulting from ancient polyploidizations of the maize genome. Transcript analyses using microarray, massively parallel signature sequencing and quantitative PCR data for barley, rice and maize indicate that certain members of the endo-(1,4)-β-glucanase gene family are transcribed across a wide range of tissues, while others are specifically transcribed in particular tissues. There are strong correlations between transcript levels of several members of the endo-(1,4)-β-glucanase family and the data suggest that evolutionary conservation of transcription exists between orthologues across the grass family. There are also strong correlations between certain members of the endo-(1,4)-β-glucanase family and other genes known to be involved in cell wall loosening and cell expansion, such as expansins and xyloglucan endotransglycosylases. Conclusions The identification of these groups of genes will now allow us to test hypotheses regarding their functions and joint participation in wall synthesis, re-modelling and degradation

FAMILY STRUCTURE, DYNAMICS AND PSYCHIATRIC DISORDER IN INDIA1

PubMed Central

Chopra, H.D.

1984-01-01

SUMMARY This paper briefly reviews the literature on family structure, dynamics and relationships between family-jointness and different psychiatric disorders in India. Many recent studies indicate that the nuclear families are more vulnerable and plea is made for maintaining the traditional joint family system, even in some modified forms, because of its “built-in-immunity” and supportive networks. PMID:21966010

A stability study of asteroid families near the 3:1 and 5:2 resonance with Jupiter

NASA Astrophysics Data System (ADS)

Hahn, G.; Lagerkvist, C.-I.; Lindblad, B. A.

1993-06-01

The stability and homogeneity of three asteroid families from Lindblad's list (1992) are studied using numerical integration techniques. These families include the Maria family, which lies close to the 3:1 mean motion resonance with Jupiter, the Oppavia-Gefion, and Dora families which are close to the 5:2 resonance. The study is based on a simplified solar system model, which takes into account the perturbations only by Jupiter and Saturn, and Everhart's variable stepsize integrator RA15. Preliminary results indicate that the stability of the orbits of all family members are not affected by the proximity to the 3:1 and 5:2 mean motion resonance with Jupiter.

A Japanese Family with Central Hypothyroidism Caused by a Novel IGSF1 Mutation.

PubMed

Nishigaki, Satsuki; Hamazaki, Takashi; Fujita, Keinosuke; Morikawa, Shuntaro; Tajima, Toshihiro; Shintaku, Haruo

2016-12-01

Hemizygous mutations in the immunoglobulin superfamily member 1 (IGSF1) gene have been demonstrated to cause congenital central hypothyroidism in males. This study reports a family with a novel mutation in the IGSF1 gene located on the long arm of the X chromosome. A two-month-old boy was diagnosed with central hypothyroidism because of prolonged jaundice. A thyrotropin-releasing hormone (TRH) stimulation test indicated dysfunction in both the hypothalamus and the pituitary gland, and prompted the IGSF1 gene to be analyzed. The patient had a novel nonsense variant, c.2713C>T (p.Q905X), in exon 14 of the IGSF1 gene. Studies of the family revealed that the patient's sister and mother were heterozygous carriers of the IGSF1 mutation. The patient's maternal uncle carried the same mutation as the proband but had no overt symptoms. The mother and uncle started levothyroxine supplementation because of subclinical hypothyroidism. A novel mutation (c.2713C>T, p.Q905X) of the IGSF1 gene was identified that causes congenital central hypothyroidism in a Japanese family. The findings further expand the clinical heterogeneity of this entity.

Family Centers

DTIC Science & Technology

1992-12-30

34 Family Policy," December 30, 1988 o / (b) DoD Directive 4001.1, "Installation Management ,, September 4, 1986 (c) DoD 4165.63-M, "DoD Housing Management ... managing the competing demands of the military mission and the family . They shall provide the information and family services necessary to support single...effectiveness of Family Centers. The evaluation system shall include: (1) A management information report to allow Family Centers to reflect actual workloads

Predictors of associated autoimmune diseases in families with type 1 diabetes: results from the Type 1 Diabetes Genetics Consortium.

PubMed

Wägner, Ana M; Santana, Angelo; Herńndez, Marta; Wiebe, Julia C; Nóvoa, Javier; Mauricio, Dídac

2011-07-01

Type 1 diabetes (T1D) is a clinically heterogeneous disease. The presence of associated autoimmune diseases (AAIDs) may represent a distinct form of autoimmune diabetes, with involvement of specific mechanisms. The aim of this study was to find predictors of AAIDs in the Type 1 Diabetes Genetics Consortium data set. Three thousand two hundred and sixty-three families with at least two siblings with T1D were included. Clinical information was obtained using questionnaires, anti-GAD (glutamic acid decarboxylase) and anti-protein tyrosine phosphatase (IA-2) were measured and human leukocyte antigen (HLA) genotyping was performed. Siblings with T1D with and without AAIDs were compared and a multivariate regression analysis was performed to find predictors of AAIDs. T1D-associated HLA haplotypes were defined as the four most susceptible and protective, respectively. One or more AAIDs were present in 14.4% of the T1D affected siblings. Age of diabetes onset, current age and time since diagnosis were higher, there was a female predominance and more family history of AAIDs in the group with AAIDs, as well as more frequent anti-GAD and less frequent anti-IA-2 antibodies. Risk and protective HLA haplotype distributions were similar, though DRB1*0301-DQA1*0501-DQB1*0201 was more frequent in the group with AAIDs. In the multivariate analysis, female gender, age of onset, family history of AAID, time since diagnosis and anti-GAD positivity were significantly associated with AAIDs. In patients with T1D, the presence of AAIDs is associated with female predominance, more frequent family history of AAIDs, later onset of T1D and more anti-GAD antibodies, despite longer duration of the disease. The predominance of certain HLA haplotypes suggests that specific mechanisms of disease may be involved. Copyright © 2011 John Wiley & Sons, Ltd.

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Low penetrance of autosomal dominant lateral temporal epilepsy in Italian families without LGI1 mutations.

PubMed

Michelucci, Roberto; Pasini, Elena; Malacrida, Sandro; Striano, Pasquale; Bonaventura, Carlo Di; Pulitano, Patrizia; Bisulli, Francesca; Egeo, Gabriella; Santulli, Lia; Sofia, Vito; Gambardella, Antonio; Elia, Maurizio; de Falco, Arturo; Neve, Angela la; Banfi, Paola; Coppola, Giangennaro; Avoni, Patrizia; Binelli, Simona; Boniver, Clementina; Pisano, Tiziana; Marchini, Marco; Dazzo, Emanuela; Fanciulli, Manuela; Bartolini, Yerma; Riguzzi, Patrizia; Volpi, Lilia; de Falco, Fabrizio A; Giallonardo, Anna Teresa; Mecarelli, Oriano; Striano, Salvatore; Tinuper, Paolo; Nobile, Carlo

2013-07-01

In relatively small series, autosomal dominant lateral temporal epilepsy (ADLTE) has been associated with leucine-rich, glioma-inactivated 1 (LGI1) mutations in about 50% of the families, this genetic heterogeneity being probably caused by differences in the clinical characteristics of the families. In this article we report the overall clinical and genetic spectrum of ADLTE in Italy with the aim to provide new insight into its nosology and genetic basis. In a collaborative study of the Commission of Genetics of the Italian League Against Epilepsy (LICE) encompassing a 10-year period (2000-2010), we collected 33 ADLTE families, selected on the basis of the following criteria: presence of at least two members concordant for unprovoked partial seizures with prominent auditory and or aphasic symptoms, absence of any known structural brain pathology or etiology, and normal neurologic examination. The clinical, neurophysiologic, and neuroradiologic findings of all patients were analyzed and a genealogic tree was built for each pedigree. The probands' DNA was tested for LGI1 mutations by direct sequencing and, if negative, were genotyped with single-nucleotide polymorphism (SNP) array to search for disease-linked copy-number variation CNV. The disease penetrance in mutated and nonmutated families was assessed as a proportion of obligate carriers who were affected. The 33 families included a total of 127 affected individuals (61 male, 66 female, 22 deceased). The age at onset ranged between 2 and 60 years (mean 18.7 years). Ninety-one patients (72%) had clear-cut focal (elementary, complex, or secondarily generalized) seizures, characterized by prominent auditory auras in 68% of the cases. Other symptoms included complex visual hallucinations, vertigo, and déjà vu. Aphasic seizures, associated or not with auditory features, were observed in 20% of the cases, whereas tonic-clonic seizures occurred in 86% of the overall series. Sudden noises could precipitate the seizures

Disentangling the roles of parental monitoring and family conflict in adolescents' management of type 1 diabetes.

PubMed

Hilliard, Marisa E; Holmes, Clarissa S; Chen, Rusan; Maher, Kathryn; Robinson, Elizabeth; Streisand, Randi

2013-04-01

Less parental monitoring of adolescents' diabetes self-care and more family conflict are each associated with poorer diabetes outcomes. However, little is known about how these two family factors relate with one another in the context of self-care and glycemic control. Diabetes self-care was evaluated as a mediator of the associations among parental monitoring, family conflict, and glycemic control in early adolescents with type 1 diabetes. Adolescent-parent dyads (n = 257) reported on the frequency of parental monitoring, family conflict, and diabetes self-care. Hemoglobin A1c was abstracted from medical charts. Structural equation modeling was used for mediation analysis. A mediation model linking parental involvement and family conflict with A1c through diabetes self-care fit the data well. Monitoring and conflict were inversely correlated (β = -0.23, p < .05) and each demonstrated indirect associations with A1c (standardized indirect effects -0.13 and 0.07, respectively) through their direct associations with self-care (β = 0.39, p < .001 and β = -0.19, p < .05, respectively). Conflict also was positively associated with higher A1c (β = 0.31, p < .01). Elevated family conflict and less parental monitoring are risk factors for poorer glycemic control, and diabetes self-care is one mediator linking these variables. Interventions to promote parental monitoring of diabetes management during early adolescence may benefit from emphasizing strategies to prevent or reduce family conflict. 2013 APA, all rights reserved

Lentivirus-Mediated knockdown of tectonic family member 1 inhibits medulloblastoma cell proliferation

PubMed Central

Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie

2015-01-01

Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235

NYX mutations in four families with high myopia with or without CSNB1

PubMed Central

Zhou, Lin; Song, Xiusheng; Li, Yin; Li, Hongyan; Dan, Handong

2015-01-01

Purpose Mutations in the NYX gene are known to cause complete congenital stationary night blindness (CSNB1), which is always accompanied by high myopia. In this study, we aimed to investigate the association between NYX mutations and high myopia with or without CSNB1. Methods Four Chinese families having high myopia with or without CSNB1 and 96 normal controls were recruited. We searched for mutations in the NYX gene using Sanger sequencing. Further analyses of the detected variations in the available family members were performed, and the frequencies of the detected variations in 96 normal controls were determined to verify our deduction. The effect of each variation on the nyctalopin protein was predicted using online tools. Results Four potential pathogenic variations in the NYX gene were found in four families with high myopia with or without CSNB1. Three of the four variants were novel (c.626G>C; c.121delG; c.335T>C). The previously identified variant, c.529_530delGCinsAT, was found in an isolated highly myopic patient and an affected brother, but the other affected brother did not carry the same variation. Further linkage analyses of this family showed a coinheritance of markers at MYP1. These four mutations were not identified in the 96 normal controls. Conclusions Our study expands the mutation spectrum of NYX for cases of high myopia with CSNB1; however, more evidence is needed to elucidate the pathogenic effects of NYX on isolated high myopia. PMID:25802485

Progressive familial intrahepatic cholestasis type 1.

PubMed

Paulusma, Coen C; Elferink, Ronald P J Oude; Jansen, Peter L M

2010-05-01

Progressive familial intrahepatic cholestasis type 1 is a rare genetic liver disease that presents in the first year of life. Bile salts are elevated and these patients are often jaundiced. Despite the cholestasis, serum gamma-glutamyltransferase activity is normal or reduced. Pruritus is a major symptom in these patients. Partial external biliary diversion is helpful in several patients as it reduces the pruritus and postpones or even avoids liver transplantation. The disease is caused by mutations in the gene ATP8B1 that preclude the normal expression of ATP8B1. ATP8B1 is a protein that acts as a lipid flippase, transporting phosphatidylserine from the exoplasmic to the cytoplasmic leaflet of the canalicular membrane of hepatocytes. The authors have shown that the canalicular membrane of ATP8B1-deficient hepatocytes is less stable as evidenced by enhanced extraction of membrane constituents by bile salts. Recent evidence suggests membrane instability in ATP8B1-deficient hair cells of the ear, providing an explanation for hearing loss in ATP8B1 deficiency. Although the exact etiology of cholestasis is incompletely understood, it is hypothesized that ATP8B1 deficiency results in enhanced cholesterol extraction from the canalicular membrane, which impairs the function of the bile salt export pump (BSEP), resulting in cholestasis. Mutations in ATP8B1 also cause benign recurrent intrahepatic cholestasis, a milder variant of the disease characterized by episodes of cholestasis. The onset and resolution of the cholestatic episodes in these patients is still not well understood.

Pleiotropic Effects of DCDC2 and DYX1C1 Genes on Language and Mathematics Traits in Nuclear Families of Developmental Dyslexia

PubMed Central

Mascheretti, Sara; Riva, Valentina; Cattaneo, Francesca; Rigoletto, Catia; Rusconi, Marianna; Gruen, Jeffrey R.; Giorda, Roberto; Lazazzera, Claudio; Molteni, Massimo

2014-01-01

Converging evidence indicates that developmental problems in oral language and mathematics can predate or co-occur with developmental dyslexia (DD). Substantial genetic correlations have been found between language, mathematics and reading traits, independent of the method of sampling. We tested for association of variants of two DD susceptibility genes, DCDC2 and DYX1C1, in nuclear families ascertained through a proband with DD using concurrent measurements of language and mathematics in both probands and siblings by the Quantitative Transmission Disequilibrium Test. Evidence for significant associations was found between DCDC2 and ‘Numerical Facts’ (p value = 0.02, with 85 informative families, genetic effect = 0.57) and between ‘Mental Calculation’ and DYX1C1 markers −3GA (p value = 0.05, with 40 informative families, genetic effect = −0.67) and 1249GT (p value = 0.02, with 49 informative families, genetic effect = −0.65). No statistically significant associations were found between DCDC2 or DYX1C1 and language phenotypes. Both DCDC2 and DYX1C1 DD susceptibility genes appear to have a pleiotropic role on mathematics but not language phenotypes. PMID:21046216

Pleiotropic effects of DCDC2 and DYX1C1 genes on language and mathematics traits in nuclear families of developmental dyslexia.

PubMed

Marino, Cecilia; Mascheretti, Sara; Riva, Valentina; Cattaneo, Francesca; Rigoletto, Catia; Rusconi, Marianna; Gruen, Jeffrey R; Giorda, Roberto; Lazazzera, Claudio; Molteni, Massimo

2011-01-01

Converging evidence indicates that developmental problems in oral language and mathematics can predate or co-occur with developmental dyslexia (DD). Substantial genetic correlations have been found between language, mathematics and reading traits, independent of the method of sampling. We tested for association of variants of two DD susceptibility genes, DCDC2 and DYX1C1, in nuclear families ascertained through a proband with DD using concurrent measurements of language and mathematics in both probands and siblings by the Quantitative Transmission Disequilibrium Test. Evidence for significant associations was found between DCDC2 and 'Numerical Facts' (p value = 0.02, with 85 informative families, genetic effect = 0.57) and between 'Mental Calculation' and DYX1C1 markers -3GA (p value = 0.05, with 40 informative families, genetic effect = -0.67) and 1249GT (p value = 0.02, with 49 informative families, genetic effect = -0.65). No statistically significant associations were found between DCDC2 or DYX1C1 and language phenotypes. Both DCDC2 and DYX1C1 DD susceptibility genes appear to have a pleiotropic role on mathematics but not language phenotypes.

Public opinion concerning residential sprinkler systems for 1- and 2-family homes.

PubMed

Frattaroli, Shannon; Pollack, Keshia M; Cook, Phillip J; Salomon, Michele; Omaki, Elise; Gielen, Andrea C

Residential sprinkler systems (RSS) are one intervention to prevent fire injury and death, yet there is no literature documenting why RSS homeowners opt to purchase a sprinkler-equipped home. This manuscript describes homeowners' decisions to purchase homes with residential sprinkler systems (RSS) and their experiences with the technology. It also compares how RSS homeowners and owners of homes without RSS value sprinklers and their levels of support for policies to mandate RSS in new homes. We used a national online web panel to sample owners of 1- and 2-family homes, and descriptive methods to analyze the resulting data. Our final sample included 1,357 homeowners of 1- and 2-family homes without RSS and 976 homeowners with RSS. RSS homeowners were more likely than owners of non-RSS homes to indicate they would buy an RSS home in the future (75 % vs. 30 %), and more often indicated a willingness to pay for sprinklers (70 % vs. 40 %). RSS homeowners also expressed higher levels of support for policies to mandate RSS in all new 1- and 2-family homes (48 % vs. 19 %). The findings offer insight into educational and policy strategies to promote RSS in all new homes, and provide a foundation for future research in this area.

The Barley Genome Sequence Assembly Reveals Three Additional Members of the CslF (1,3;1,4)-β-Glucan Synthase Gene Family

PubMed Central

Schreiber, Miriam; Wright, Frank; MacKenzie, Katrin; Hedley, Pete E.; Schwerdt, Julian G.; Little, Alan; Burton, Rachel A.; Fincher, Geoffrey B.; Marshall, David; Waugh, Robbie; Halpin, Claire

2014-01-01

An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4)-β- glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl) F gene family have been shown to be involved in (1,3;1,4)-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13) which may be involved in (1,3;1,4)-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4)-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4)-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls. PMID:24595438

Novel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese families.

PubMed

Ma, Xiang; Li, Xiaoxin; Wang, Lihua

2008-01-01

To investigate various XLRS1 (RS1) gene mutations in Chinese families with X-linked juvenile retinoschisis (XLRS or RS). Genomic DNA was isolated from leukocytes of 29 male patients with X-linked juvenile retinoschisis, 38 female carriers, and 100 normal controls. All 6 exons of the RS1 gene were amplified by polymerase chain reaction, and the RS1 gene mutations were determined by direct sequencing. Eleven different RS1 mutations in 12 families were identified in the 29 male patients. The mutations comprised eight missense, two frameshift, and one splice donor site mutation. Four of these mutations, one frameshift mutation (26 del T) in exon 1, one frameshift mutation (488 del G) in exon 5, Asp145His and Arg156Gly in exon 5, have not been previously described. One novel non-disease-related polymorphism, 576C to T (Pro192Pro) in exon 6, was also found. Six recurrent mutations, Ser73Pro and Arg102Gln mutations in exon 4 and Arg200Cys, Arg209His, Arg213Gln, and Cys223Arg mutations in exon 6, were also identified in this study. RS1 gene mutations caused X-linked juvenile retinoschisis in these Chinese families.

SYNE1 related cerebellar ataxia presents with variable phenotypes in a consanguineous family from Turkey.

PubMed

Yucesan, E; Ugur Iseri, Sibel A; Bilgic, B; Gormez, Z; Bakir Gungor, B; Sarac, A; Ozdemir, O; Sagiroglu, M; Gurvit, H; Hanagasi, H; Ozbek, U

2017-12-01

SYNE1 related autosomal recessive cerebellar ataxia type 1 (ARCA1) is a late-onset cerebellar ataxia with slow progression originally demonstrated in French-Canadian populations of Quebec, Canada. Nevertheless, recent studies on SYNE1 ataxia have conveyed the condition from a geographically limited pure cerebellar recessive ataxia to a complex multisystem phenotype that is relatively common on the global scale. To determine the underlying genetic cause of the ataxia phenotype in a consanguineous family from Turkey presenting with very slow progressive cerebellar symptoms including dysarthria, dysmetria, and gait ataxia, we performed SNP-based linkage analysis in the family along with whole exome sequencing (WES) in two affected siblings. We identified a homozygous variant in SYNE1 (NM_033071.3: c.13086delC; p.His4362GlnfsX2) in all four affected siblings. This variant presented herein has originally been associated with only pure ataxia in a single case. We thus present segregation and phenotypic manifestations of this variant in four affected family members and further extend the pure ataxia phenotype with upper motor neuron involvement and peripheral neuropathy. Our findings in turn established a precise molecular diagnosis in this family, demonstrating the use of WES combined with linkage analysis in families as a powerful tool for establishing a quick and precise genetic diagnosis of complex neurological phenotypes.

The interleukin (IL)-1 cytokine family--Balance between agonists and antagonists in inflammatory diseases.

PubMed

Palomo, Jennifer; Dietrich, Damien; Martin, Praxedis; Palmer, Gaby; Gabay, Cem

2015-11-01

The interleukin (IL)-1 family of cytokines comprises 11 members, including 7 pro-inflammatory agonists (IL-1α, IL-1β, IL-18, IL-33, IL-36α, IL-36β, IL-36γ) and 4 defined or putative antagonists (IL-1R antagonist (IL-1Ra), IL-36Ra, IL-37, and IL-38) exerting anti-inflammatory activities. Except for IL-1Ra, IL-1 cytokines do not possess a leader sequence and are secreted via an unconventional pathway. In addition, IL-1β and IL-18 are produced as biologically inert pro-peptides that require cleavage by caspase-1 in their N-terminal region to generate active proteins. N-terminal processing is also required for full activity of IL-36 cytokines. The IL-1 receptor (IL-1R) family comprises 10 members and includes cytokine-specific receptors, co-receptors and inhibitory receptors. The signaling IL-1Rs share a common structure with three extracellular immunoglobulin (Ig) domains and an intracellular Toll-like/IL-1R (TIR) domain. IL-1 cytokines bind to their specific receptor, which leads to the recruitment of a co-receptor and intracellular signaling. IL-1 cytokines induce potent inflammatory responses and their activity is tightly controlled at the level of production, protein processing and maturation, receptor binding and post-receptor signaling by naturally occurring inhibitors. Some of these inhibitors are IL-1 family antagonists, while others are IL-1R family members acting as membrane-bound or soluble decoy receptors. An imbalance between agonist and antagonist levels can lead to exaggerated inflammatory responses. Several genetic modifications or mutations associated with dysregulated IL-1 activity and autoinflammatory disorders were identified in mouse models and in patients. These findings paved the road to the successful use of IL-1 inhibitors in diseases that were previously considered as untreatable. Copyright © 2015 Elsevier Ltd. All rights reserved.

Individual and family characteristics associated with BRCA1/2 genetic testing in high-risk families.

PubMed

Katapodi, Maria C; Northouse, Laurel L; Milliron, Kara J; Liu, Guipeng; Merajver, Sofia D

2013-06-01

Little is known about family members' interrelated decisions to seek genetic testing for breast cancer susceptibility. The specific aims of this cross-sectional, descriptive, cohort study were (i) to examine whether individual and family characteristics have a direct effect on women's decisions to use genetic testing for hereditary susceptibility to breast cancer and (ii) to explore whether family characteristics moderate the relationships between individual characteristics and the decision to use genetic testing. Participants were women (>18 years old) who (i) received genetic testing for hereditary breast cancer and who agreed to invite one of their female relatives into the study and (ii) female relatives who had NOT obtained genetic testing and were identified by pedigree analysis as having >10% chances of hereditary susceptibility to breast cancer. The final sample consisted of 168 English-speaking, family dyads who completed self-administered, mailed surveys with validated instruments. Multivariate conditional logistic regression analyses showed that the proposed model explained 62% of the variance in genetic testing. The factors most significantly associated with genetic testing were having a personal history of cancer; perceiving genetic testing to have more benefits than barriers; having greater family hardiness; and perceiving fewer negative consequences associated with a breast cancer diagnosis. No significant interaction effects were observed. Findings suggest that both individual and family characteristics are associated with the decision to obtain genetic testing for hereditary breast cancer; hence, there is a need for interventions that foster a supportive family environment for patients and their high-risk relatives. Copyright © 2012 John Wiley & Sons, Ltd.

BRCA 1 & 2 mutations in Sudanese secondary school girls with known breast cancer in their families

PubMed Central

Elnour, Ahmed M; Elderdery, Abozer Y; Mills, Jeremy; Mohammed, Babiker A; ElbietAbdelaal, Daw; Mohamed, Abdelraheem Osman; Elhassan, Kamal Eldin H; A, Abdel Hady; Wahab, Abdel; Cooper, Alan

2012-01-01

Objective Breast cancer is a major cause of morbidity and mortality in women worldwide. In Sudan, it is the most commonly diagnosed cancer. This study assesses the prevalence of BRCA1 and BRCA2 mutations among female students with a family history of breast cancer, in secondary schools of Marawi Locality, Northern State, Sudan. Methods From a survey of 2370 students, 67 cases (47 with family history and 20 controls) were analyzed for BRCA1 and BRCA2 mutations with a single-stranded conformation polymorphism (SSCP) mutation detection method applied to peripheral blood. Eighteen subjects knew of first degree female relatives with breast cancer, 23 with second degree female family members affected and 6 with related male sufferers. Twenty randomly selected girls from the remainder of the survey population with no known family history were also tested. Results The breast cancer susceptibility genes BRCA1 and BRCA2 accounted, respectively, for 1.21% of responders or 51% of those claiming a family history. Mutations were found in 20% of the group selected with no family history. Only 2 BRCA 2 mutations were found, both in girls with no known afflicted relatives. Six girls knew of male relatives with breast cancer; five of these girls carried mutant BRCA 1. Most of the BRCA1- mutations located to exon 11 fragments 11.9 and 11.1. Conclusion The study indicates a high prevalence of genetically associated breast cancer in the Marawi locality suggesting a need to focus on the two mutation sites in developing screening protocols for at least this area of Sudan. PMID:23267305

Western Ross Sea continental slope gravity currents

NASA Astrophysics Data System (ADS)

Gordon, Arnold L.; Orsi, Alejandro H.; Muench, Robin; Huber, Bruce A.; Zambianchi, Enrico; Visbeck, Martin

2009-06-01

difference, if real, may reflect the influence of the large iceberg C-19 over Drygalski Trough until its departure in mid-May 2003, when there was a marked decrease in the coldest, saltiest gravity current adjacent to Drygalski Trough. Northward transport of cold, saline, recently ventilated Antarctic Bottom Water observed in March 2004 off Cape Adare was ˜1.7 Sv, including ˜0.4 Sv of High Salinity Shelf Water.

Trace amine-associated receptor 1-Family archetype or iconoclast?

PubMed

Grandy, David K

2007-12-01

Interest has recently been rekindled in receptors that are activated by low molecular weight, noncatecholic, biogenic amines that are typically found as trace constituents of various vertebrate and invertebrate tissues and fluids. The timing of this resurgent focus on receptors activated by the "trace amines" (TA) beta-phenylethylamine (PEA), tyramine (TYR), octopamine (OCT), synephrine (SYN), and tryptamine (TRYP) is the direct result of 2 publications that appeared in 2001 describing the cloning of a novel G protein-coupled receptor (GPCR) referred to by their discoverers Borowsky et al. as TA1 and Bunzow et al. as TA receptor 1 (TAR1). When heterologously expressed in Xenopus laevis oocytes and various eukaryotic cell lines, recombinant rodent and human TAR dose-dependently couple to the stimulation of adenosine 3',5'-monophosphate (cAMP) production. Structure-activity profiling based on this functional response has revealed that in addition to the TA, other biologically active compounds containing a 2-carbon aliphatic side chain linking an amino group to at least 1 benzene ring are potent and efficacious TA receptor agonists with amphetamine (AMPH), methamphetamine, 3-iodothyronamine, thyronamine, and dopamine (DA) among the most notable. Almost 100 years after the search for TAR began, numerous TA1/TAR1-related sequences, now called TA-associated receptors (TAAR), have been identified in the genome of every species of vertebrate examined to date. Consequently, even though heterologously expressed TAAR1 fits the pharmacological criteria established for a bona fide TAR, a major challenge for those working in the field is to discern the in vivo pharmacology and physiology of each purported member of this extended family of GPCR. Only then will it be possible to establish whether TAAR1 is the family archetype or an iconoclast.

Leaving Homelessness Behind: Housing Decisions among Families Exiting Shelter1

PubMed Central

Fisher, Benjamin W.; Mayberry, Lindsay; Shinn, Marybeth; Khadduri, Jill

2014-01-01

Because homelessness assistance programs are designed to help families, it is important for policymakers and practitioners to understand how families experiencing homelessness make housing decisions, particularly when they decide not to use available services. This study explores those decisions using in-depth qualitative interviews with 80 families recruited in shelters across four sites approximately six months after they were assigned to one of four conditions (permanent housing subsidies, project-based transitional housing, community-based rapid re-housing, and usual care). Familiar neighborhoods near children’s schools, transportation, family and friends, and stability were important to families across conditions. Program restrictions on eligibility constrained family choices. Subsidized housing was the most desired intervention and families leased up at higher rates than in other studies of poor families. Respondents were least comfortable in and most likely to leave transitional housing. Uncertainty associated with community-based rapid re-housing generated considerable anxiety. Across interventions, many families had to make unhappy compromises, often leading to further moves. Policy recommendations are offered. PMID:25258503

KDF1, encoding keratinocyte differentiation factor 1, is mutated in a multigenerational family with ectodermal dysplasia.

PubMed

Shamseldin, Hanan E; Khalifa, Ola; Binamer, Yousef M; Almutawa, Abdulmonem; Arold, Stefan T; Zaidan, Hamad; Alkuraya, Fowzan S

2017-01-01

Ectodermal dysplasia is a highly heterogeneous group of disorders that variably affect the derivatives of the ectoderm, primarily skin, hair, nails and teeth. TP63, itself mutated in ectodermal dysplasia, links many other ectodermal dysplasia disease genes through a regulatory network that maintains the balance between proliferation and differentiation of the epidermis and other ectodermal derivatives. The ectodermal knockout phenotype of five mouse genes that regulate and/or are regulated by TP63 (Irf6, Ikkα, Ripk4, Stratifin, and Kdf1) is strikingly similar and involves abnormal balance towards proliferation at the expense of differentiation, but only the first three have corresponding ectodermal phenotypes in humans. We describe a multigenerational Saudi family with an autosomal dominant form of hypohidrotic ectodermal dysplasia in which positional mapping and exome sequencing identified a novel variant in KDF1 that fully segregates with the phenotype. The recapitulation of the phenotype we observe in this family by the Kdf1-/- mouse suggests a causal role played by the KDF1 variant.

The DUF1669 domain of FAM83 family proteins anchor casein kinase 1 isoforms.

PubMed

Fulcher, Luke J; Bozatzi, Polyxeni; Tachie-Menson, Theresa; Wu, Kevin Z L; Cummins, Timothy D; Bufton, Joshua C; Pinkas, Daniel M; Dunbar, Karen; Shrestha, Sabin; Wood, Nicola T; Weidlich, Simone; Macartney, Thomas J; Varghese, Joby; Gourlay, Robert; Campbell, David G; Dingwell, Kevin S; Smith, James C; Bullock, Alex N; Sapkota, Gopal P

2018-05-22

Members of the casein kinase 1 (CK1) family of serine-threonine protein kinases are implicated in the regulation of many cellular processes, including the cell cycle, circadian rhythms, and Wnt and Hedgehog signaling. Because these kinases exhibit constitutive activity in biochemical assays, it is likely that their activity in cells is controlled by subcellular localization, interactions with inhibitory proteins, targeted degradation, or combinations of these mechanisms. We identified members of the FAM83 family of proteins as partners of CK1 in cells. All eight members of the FAM83 family (FAM83A to FAM83H) interacted with the α and α-like isoforms of CK1; FAM83A, FAM83B, FAM83E, and FAM83H also interacted with the δ and ε isoforms of CK1. We detected no interaction between any FAM83 member and the related CK1γ1, CK1γ2, and CK1γ3 isoforms. Each FAM83 protein exhibited a distinct pattern of subcellular distribution and colocalized with the CK1 isoform(s) to which it bound. The interaction of FAM83 proteins with CK1 isoforms was mediated by the conserved domain of unknown function 1669 (DUF1669) that characterizes the FAM83 family. Mutations in FAM83 proteins that prevented them from binding to CK1 interfered with the proper subcellular localization and cellular functions of both the FAM83 proteins and their CK1 binding partners. On the basis of its function, we propose that DUF1669 be renamed the polypeptide anchor of CK1 domain. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.

PubMed

Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima

2011-11-01

To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.

Interleukin (IL)-33 and the IL-1 Family of Cytokines-Regulators of Inflammation and Tissue Homeostasis.

PubMed

Vasanthakumar, Ajithkumar; Kallies, Axel

2017-11-03

Cytokines play an integral role in shaping innate and adaptive immune responses. Members of the interleukin (IL)-1 family regulate a plethora of immune-cell-mediated processes, which include pathogen defense and tissue homeostasis. Notably, the IL-1 family cytokine IL-33 promotes adaptive and innate type 2 immune responses, confers viral protection and facilitates glucose metabolism and tissue repair. At the cellular level, IL-33 stimulates differentiation, maintenance, and function of various immune cell types, including regulatory T cells, effector CD4 + and CD8 + T cells, macrophages, and type 2 innate lymphoid cells (ILC2s). Other IL-1 family members, such as IL-1β and IL-18 promote type 1 responses, while IL-37 limits immune activation. Although IL-1 cytokines play critical roles in immunity and tissue repair, their deregulated expression is often linked to autoimmune and inflammatory diseases. Therefore, IL-1 cytokines are regulated tightly by posttranscriptional mechanisms and decoy receptors. In this review, we discuss the biology and function of IL-1 family cytokines, with a specific focus on regulation and function of IL-33 in immune and tissue homeostasis. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

A large GLC1C Greek family with a myocilin T377M mutation: inheritance and phenotypic variability.

PubMed

Petersen, Michael B; Kitsos, George; Samples, John R; Gaudette, N Donna; Economou-Petersen, Effrosini; Sykes, Renée; Rust, Kristal; Grigoriadou, Maria; Aperis, George; Choi, Dongseok; Psilas, Konstantinos; Craig, Jamie E; Kramer, Patricia L; Mackey, David A; Wirtz, Mary K

2006-02-01

POAG is a complex disease; therefore, families in which a glaucoma gene has been mapped may carry additional POAG genes. The goal of this study was to determine whether mutations in the myocilin (MYOC) gene on chromosome 1 are present in two POAG families, which have previously been mapped to the GLC1C locus on chromosome 3. The three exons of MYOC were screened by denaturing (d)HPLC. Samples with heteroduplex peaks were sequenced. Clinical findings were compared with genotype status in all available family members over the age of 20 years. A T377M coding sequence change in MYOC was identified in family members of the Greek GLC1C family but not in the Oregon GLC1C family. Individuals carrying both the MYOC T377M variant and the GLC1C haplotype were more severely affected at an earlier age than individuals with just one of the POAG genes, suggesting that these two genes interact or that both contribute to the POAG phenotype in a cumulative way.

[Linkage analysis of a family with familial hypertriglyceridemia].

PubMed

Tang, Xin; Lin, Ying; Liu, Bing; Ma, Shi; Yang, Yang; Yang, Zheng-lin

2009-10-01

To perform linkage analysis and mutation screening in a Chinese family with familial hpertriglyceridemia (FHTG). Thirty-two family members including 12 hypertriglyceridemia patients participated in the study. Genotyping and haplotype analysis for 22 subjects were performed using short tandem repeat (STR) microsatellite polymorphism markers on 16 candidate genes and/or loci related to lipid metabolism. Two of the sixteen known candidate genes, APOA2 and USF1 were screened for mutation by direct DNA sequencing. No linkage was found between the candidate genes/loci of APOA5, LIPI, RP1, APOC2, ABC1, LMF1, APOA1-APOC3-APOA4, LPL, APOB, CETP, LCAT, LDLR, APOE and the phenotype in this family. The two-point Lod scores (theta =0) were all less than-1.0 for all the markers tested. Linkage analysis suggested linkage to chromosome 1q23.3-24.2 between the disease phenotype and STR marker D1S194 with a two-point maximum Lod score of 2.44 at theta =0. Fine mapping indicated that the disease gene was localized to a 5.87 cM interval between D1S104 and D1S196. No disease-causing mutation was detected in the APOA2 and USF1 genes. The above mentioned candidate genes were excluded as the disease causing genes for this family. The results implied that there might be a novel gene/locus for FHTG on chromosome 1q23.3-1q24.2.

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in

A founder mutation in presenilin 1 causing early-onset Alzheimer disease in unrelated Caribbean Hispanic families.

PubMed

Athan, E S; Williamson, J; Ciappa, A; Santana, V; Romas, S N; Lee, J H; Rondon, H; Lantigua, R A; Medrano, M; Torres, M; Arawaka, S; Rogaeva, E; Song, Y Q; Sato, C; Kawarai, T; Fafel, K C; Boss, M A; Seltzer, W K; Stern, Y; St George-Hyslop, P; Tycko, B; Mayeux, R

2001-11-14

Genetic determinants of Alzheimer disease (AD) have not been comprehensively examined in Caribbean Hispanics, a population in the United States in whom the frequency of AD is higher compared with non-Hispanic whites. To identify variant alleles in genes related to familial early-onset AD among Caribbean Hispanics. Family-based case series conducted in 1998-2001 at an AD research center in New York, NY, and clinics in the Dominican Republic. Among 206 Caribbean Hispanic families with 2 or more living members with AD who were identified, 19 (9.2%) had at least 1 individual with onset of AD before the age of 55 years. The entire coding region of the presenilin 1 gene and exons 16 and 17 of the amyloid precursor protein gene were sequenced in probands from the 19 families and their living relatives. A G-to-C nucleotide change resulting in a glycine-alanine amino acid substitution at codon 206 (Gly206Ala) in exon 7 of presenilin 1 was observed in 23 individuals from 8 (42%) of the 19 families. A Caribbean Hispanic individual with the Gly206Ala mutation and early-onset familial disease was also found by sequencing the corresponding genes of 319 unrelated individuals in New York City. The Gly206Ala mutation was not found in public genetic databases but was reported in 5 individuals from 4 Hispanic families with AD referred for genetic testing. None of the members of these families were related to one another, yet all carriers of the Gly206Ala mutation tested shared a variant allele at 2 nearby microsatellite polymorphisms, indicating a common ancestor. No mutations were found in the amyloid precursor protein gene. The Gly206Ala mutation was found in 8 of 19 unrelated Caribbean Hispanic families with early-onset familial AD. This genetic change may be a prevalent cause of early-onset familial AD in the Caribbean Hispanic population.

MCAT elements and the TEF-1 family of transcription factors in muscle development and disease.

PubMed

Yoshida, Tadashi

2008-01-01

MCAT elements are located in the promoter-enhancer regions of cardiac, smooth, and skeletal muscle-specific genes including cardiac troponin T, beta-myosin heavy chain, smooth muscle alpha-actin, and skeletal alpha-actin, and play a key role in the regulation of these genes during muscle development and disease. The binding factors of MCAT elements are members of the transcriptional enhancer factor-1 (TEF-1) family. However, it has not been fully understood how these transcription factors confer cell-specific expression in muscle, because their expression patterns are relatively broad. Results of recent studies revealed multiple mechanisms whereby TEF-1 family members control MCAT element-dependent muscle-specific gene expression, including posttranslational modifications of TEF-1 family members, the presence of muscle-selective TEF-1 cofactors, and cell-selective control of TEF-1 accessibility to MCAT elements. In addition, of particular interest, recent studies regarding MCAT element-dependent transcription of the myocardin gene and the smooth muscle alpha-actin gene in muscle provide evidence for the transcriptional diversity among distinct cell types and subtypes. This article summarizes the role of MCAT elements and the TEF-1 family of transcription factors in muscle development and disease, and reviews recent progress in our understanding of the transcriptional regulatory mechanisms involved in MCAT element-dependent muscle-specific gene expression.

Perceived Family Functioning and Family Resources of Hong Kong Families: Implications for Social Work Practice

ERIC Educational Resources Information Center

Ma, Joyce L. C.; Wong, Timothy K. Y.; Lau, Luk King; Pun, Shuk Han

2009-01-01

This article reports the results of a telephone survey (n = 1,015 respondents) that aims to identify the perceived general family functioning and family resources of Hong Kong Chinese families and their linkage to each other in a rapidly transforming society. The perceived general family functioning of the respondents was average, and the five…

The LSD1 Family of Histone Demethylases and the Pumilio Posttranscriptional Repressor Function in a Complex Regulatory Feedback Loop

PubMed Central

Miles, Wayne O.; Lepesant, Julie M. J.; Bourdeaux, Jessie; Texier, Manuela; Kerenyi, Marc A.; Nakakido, Makoto; Hamamoto, Ryuji; Orkin, Stuart H.; Dyson, Nicholas J.

2015-01-01

The lysine (K)-specific demethylase (LSD1) family of histone demethylases regulates chromatin structure and the transcriptional potential of genes. LSD1 is frequently deregulated in tumors, and depletion of LSD1 family members causes developmental defects. Here, we report that reductions in the expression of the Pumilio (PUM) translational repressor complex enhanced phenotypes due to dLsd1 depletion in Drosophila. We show that the PUM complex is a target of LSD1 regulation in fly and mammalian cells and that its expression is inversely correlated with LSD1 levels in human bladder carcinoma. Unexpectedly, we find that PUM posttranscriptionally regulates LSD1 family protein levels in flies and human cells, indicating the existence of feedback loops between the LSD1 family and the PUM complex. Our results highlight a new posttranscriptional mechanism regulating LSD1 activity and suggest that the feedback loop between the LSD1 family and the PUM complex may be functionally important during development and in human malignancies. PMID:26438601

Loss-of-function thrombospondin-1 mutations in familial pulmonary hypertension

PubMed Central

Stearman, Robert S.; Bull, Todd M.; Calabrese, David W.; Tripp-Addison, Megan L.; Wick, Marilee J.; Broeckel, Ulrich; Robbins, Ivan M.; Wheeler, Lisa A.; Cogan, Joy D.; Loyd, James E.

2012-01-01

Most patients with familial pulmonary arterial hypertension (FPAH) carry mutations in the bone morphogenic protein receptor 2 gene (BMPR2). Yet carriers have only a 20% risk of disease, suggesting that other factors influence penetrance. Thrombospondin-1 (TSP1) regulates activation of TGF-β and inhibits endothelial and smooth muscle cell proliferation, pathways coincidentally altered in pulmonary arterial hypertension (PAH). To determine whether a subset of FPAH patients also have mutations in the TSP1 gene (THBS1) we resequenced the type I repeats of THBS1 encoding the TGF-β regulation and cell growth inhibition domains in 60 FPAH probands, 70 nonfamilial PAH subjects, and in large control groups. We identified THBS1 mutations in three families: a novel missense mutation in two (Asp362Asn), and an intronic mutation in a third (IVS8+255 G/A). Neither mutation was detected in population controls. Mutant 362Asn TSP1 had less than half of the ability of wild-type TSP1 to activate TGF-β. Mutant 362Asn TSP1 also lost the ability to inhibit growth of pulmonary arterial smooth muscle cells and was over threefold less effective at inhibiting endothelial cell growth. The IVS8+255 G/A mutation decreased and/or eliminated local binding of the transcription factors SP1 and MAZ but did not affect RNA splicing. These novel mutations implicate THBS1 as a modifier gene in FPAH. These THBS1 mutations have implications in the genetic evaluation of FPAH patients. However, since FPAH is rare, these data are most relevant as evidence for the importance of TSP1 in pulmonary vascular homeostasis. Further examination of THBS1 in the pathogenesis of PAH is warranted. PMID:22198906

Novel mutations and phenotypic associations identified through APC, MUTYH, NTHL1, POLD1, POLE gene analysis in Indian Familial Adenomatous Polyposis cohort.

PubMed

Khan, Nikhat; Lipsa, Anuja; Arunachal, Gautham; Ramadwar, Mukta; Sarin, Rajiv

2017-05-22

Colo-Rectal Cancer is a common cancer worldwide with 5-10% cases being hereditary. Familial Adenomatous Polyposis (FAP) syndrome is due to germline mutations in the APC or rarely MUTYH gene. NTHL1, POLD1, POLE have been recently reported in previously unexplained FAP cases. Unlike the Caucasian population, FAP phenotype and its genotypic associations have not been widely studied in several geoethnic groups. We report the first FAP cohort from South Asia and the only non-Caucasian cohort with comprehensive analysis of APC, MUTYH, NTHL1, POLD1, POLE genes. In this cohort of 112 individuals from 53 FAP families, we detected germline APC mutations in 60 individuals (45 families) and biallelic MUTYH mutations in 4 individuals (2 families). No NTHL1, POLD1, POLE mutations were identified. Fifteen novel APC mutations and a new Indian APC mutational hotspot at codon 935 were identified. Eight very rare FAP phenotype or phenotypes rarely associated with mutations outside specific APC regions were observed. APC genotype-phenotype association studies in different geo-ethnic groups can enrich the existing knowledge about phenotypic consequences of distinct APC mutations and guide counseling and risk management in different populations. A stepwise cost-effective mutation screening approach is proposed for genetic testing of south Asian FAP patients.

Effects of diabetes-related family stress on glycemic control in young patients with type 1 diabetes: Systematic review.

PubMed

Tsiouli, Elina; Alexopoulos, Evangelos C; Stefanaki, Charikleia; Darviri, Christina; Chrousos, George P

2013-02-01

To investigate the way that family stress influences glycemic control among patients with diabetes who are younger than 18 years of age. PubMed and Scopus were searched for relevant studies published since 1990 using the following key words: diabetes type 1, glycemic control, family stress, family conflict, and family function. In total, 1478 papers were identified in the initial search. The final review included 6 cohort studies, 3 cross-sectional studies, and 1 qualitative review in which family stress was assessed using specific diabetes-related conflict measurement instruments, and glycemic control was evaluated by glycosylated hemoglobin measurement. In most studies family stress was negatively correlated with patients' glycemic control. Family function was strongly related to patients' glycemic control, while family conflict was adversely associated with glycemic control. Families of low socioeconomic status, those of adolescents with diabetes, and those of single parents were more prone to diabetes-related stress and thus more susceptible to worse glycemic control. Therapeutic psychological interventions and educational programs can help alleviate family diabetes-related stress and will likely improve glycemic control.

[Atypical manifestations in familial type 1 Waardenburg syndrome].

PubMed

Sans, B; Calvas, P; Bazex, J

1998-01-01

Waardenburg syndrome is an uncommon genetic disorder. Four clinical types are recognized. Three responsible genes have been identified (PAX 3: for type I syndrome, MITF and EDN3 for types II and IV respectively). We report the case of a patient with Waardenburg type I morphotype who had atypical neurological manifestations. Decisive elements for diagnosis were the presence of Waardenburg syndrome in the family and, in affected kin, a mutation causing a shift in PAX 3 gene reading. This case confirms the variability of Waardenburg signs within one family. The association of unusual neurological manifestations in the proband suggested that Vogt Koyanagi Harada disease may have been associated and may show some relationship with familial Waardenburg syndrome.

Shopping behaviors of low-income families during a 1-month period of time.

PubMed

Darko, Janice; Eggett, Dennis L; Richards, Rickelle

2013-01-01

To explore food shopping behaviors among low-income families over the course of the month. Two researchers conducted 13 90-minute focus groups. Two community organizations serving low-income populations and a university campus. Low-income adults (n = 72) who were the primary household food shoppers and who had at least 1 child less than 18 years old. Shopping behavior changes during 1 month. Focus groups were recorded, transcribed, and coded independently by 2 researchers. Descriptive statistics were used to evaluate sociodemographic variables such as age, sex, race/ethnicity, and participation in food assistance programs. Economics played a key role in participants' food shopping behaviors and influenced food availability throughout the month. To overcome economic barriers, participants used food and emergency assistance programs and engaged in menu planning, price matching, storing food, using credit cards, and receiving financial assistance from family members and/or neighbors. Low-income families made strategic decisions to maintain a food supply throughout the month. These results suggest limited economics throughout the month may hinder families' ability to consume a varied, nutrient-rich diet, which may have an impact on future health status. Copyright © 2013 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

PubMed

Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

2013-12-01

Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

Analysis of four families with the Stickler syndrome by linkage studies. Identification of a new premature stop codon in the COL2A1 gene in a family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonaventure, J.; Lasselin, C.; Toutain, A.

1994-09-01

The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximalmore » value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.« less

A KCNQ1 Mutation Causes a High Penetrance for Familial Atrial Fibrillation

PubMed Central

Bartos, Daniel C.; Anderson, Jeffrey B.; Bastiaenen, Rachel; Johnson, Jonathan N.; Gollob, Michael H; Tester, David J.; Burgess, Don E.; Homfray, Tessa; Behr, Elijah R.; Ackerman, Michael J.; Guicheney, Pascale; Delisle, Brian P.

2012-01-01

Background Atrial fibrillation (AF) is the most common cardiac arrhythmia, and its incidence is expected to grow. A genetic predisposition for AF has long been recognized, but its manifestation in these patients likely involves a combination of rare and common genetic variants. Identifying genetic variants that associate with a high penetrance for AF would represent a significant breakthrough for understanding the mechanisms that associate with disease. Method and Results Candidate gene sequencing in five unrelated families with familial AF identified the KCNQ1 missense mutation p.Arg231His (R231H). In addition to AF, several of the family members have abnormal QTc intervals, syncope, or experienced sudden cardiac arrest or death. KCNQ1 encodes the voltage-gated K+ channel that conducts the slowly activating delayed rectifier K+ current in the heart. Functional and computational analyses suggested that R231H increases KCNQ1 current (IKCNQ1) to shorten the atrial action potential (AP) duration. R231H is predicted to minimally affect ventricular excitability, but it prevented the increase in IKCNQ1 following PKA activation. The unique properties of R231H appeared to be caused by a loss in voltage-dependent gating. Conclusions The R231H variant causes a high penetrance for interfamilial early-onset AF. Our study indicates R231H likely shortens atrial refractoriness to promote a substrate for reentry. Additionally, R231H might cause abnormal ventricular repolarization by disrupting PKA activation of IKCNQ1. We conclude genetic variants, which increase IKs during the atrial AP, decrease the atrial AP duration, and/or shorten atrial refractoriness, present a high risk for interfamilial AF. PMID:23350853

Epigenetic regulation of planarian stem cells by the SET1/MLL family of histone methyltransferases.

PubMed

Hubert, Amy; Henderson, Jordana M; Ross, Kelly G; Cowles, Martis W; Torres, Jessica; Zayas, Ricardo M

2013-01-01

Chromatin regulation is a fundamental mechanism underlying stem cell pluripotency, differentiation, and the establishment of cell type-specific gene expression profiles. To examine the role of chromatin regulation in stem cells in vivo, we study regeneration in the freshwater planarian Schmidtea mediterranea. These animals possess a high concentration of pluripotent stem cells, which are capable of restoring any damaged or lost tissues after injury or amputation. Here, we identify the S. mediterranea homologs of the SET1/MLL family of histone methyltransferases and COMPASS and COMPASS-like complex proteins and investigate their role in stem cell function during regeneration. We identified six S. mediterranea homologs of the SET1/MLL family (set1, mll1/2, trr-1, trr-2, mll5-1 and mll5-2), characterized their patterns of expression in the animal, and examined their function by RNAi. All members of this family are expressed in the stem cell population and differentiated tissues. We show that set1, mll1/2, trr-1, and mll5-2 are required for regeneration and that set1, trr-1 and mll5-2 play roles in the regulation of mitosis. Most notably, knockdown of the planarian set1 homolog leads to stem cell depletion. A subset of planarian homologs of COMPASS and COMPASS-like complex proteins are also expressed in stem cells and implicated in regeneration, but the knockdown phenotypes suggest that some complex members also function in other aspects of planarian biology. This work characterizes the function of the SET1/MLL family in the context of planarian regeneration and provides insight into the role of these enzymes in adult stem cell regulation in vivo.

Body image mediates negative family climate and deteriorating glycemic control for single adolescents with type 1 diabetes.

PubMed

Hartl, Amy C; Seiffge-Krenke, Inge; Laursen, Brett

2015-12-01

Glycemic control declines during adolescence, as youth with diabetes struggle with pubertal changes and a changing social world. The present study tests whether body image mediates longitudinal links between family climate and changes in adolescent glycemic control. Mediation was hypothesized for nondating adolescents but not for dating adolescents, because the former are thought to remain more family oriented than the latter. Participants were German adolescents with Type 1 diabetes (51 girls, 58 boys; M = 15.84 years, SD = 1.44). Participants reported body image and family climate. Physicians assayed blood HbA1c levels (M = 8.22%, SD = 1.80%) to measure glycemic control. For nondating adolescents, body image mediated associations between family climate and longitudinal changes in glycemic control. Poorer family climate was associated with poorer body image, which predicted deteriorating glycemic control. For dating adolescents, family climate was unassociated with changes in glycemic control. Nondating adolescents may look to parents for feedback on body image, which affects how they manage the challenges of diabetes. Parents and practitioners alike should be alert to the fact that family climate continues to be an important determinant of adolescent adjustment, particularly for those who have not moved into romantic relationships. We know that body image matters to adolescents, but for some youth, body image may be the difference between health and serious physical problems. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

A Novel Interaction between the SH2 Domain of Signaling Adaptor Protein Nck-1 and the Upstream Regulator of the Rho Family GTPase Rac1 Engulfment and Cell Motility 1 (ELMO1) Promotes Rac1 Activation and Cell Motility*

PubMed Central

Zhang, Guo; Chen, Xia; Qiu, Fanghua; Zhu, Fengxin; Lei, Wenjing; Nie, Jing

2014-01-01

Nck family proteins function as adaptors to couple tyrosine phosphorylation signals to actin cytoskeleton reorganization. Several lines of evidence indicate that Nck family proteins involve in regulating the activity of Rho family GTPases. In the present study, we characterized a novel interaction between Nck-1 with engulfment and cell motility 1 (ELMO1). GST pull-down and co-immunoprecipitation assay demonstrated that the Nck-1-ELMO1 interaction is mediated by the SH2 domain of Nck-1 and the phosphotyrosine residues at position 18, 216, 395, and 511 of ELMO1. A R308K mutant of Nck-1 (in which the SH2 domain was inactive), or a 4YF mutant of ELMO1 lacking these four phosphotyrosine residues, diminished Nck-1-ELMO1 interaction. Conversely, tyrosine phosphatase inhibitor treatment and overexpression of Src family kinase Hck significantly enhanced Nck-1-ELMO1 interaction. Moreover, wild type Nck-1, but not R308K mutant, significantly augmented the interaction between ELMO1 and constitutively active RhoG (RhoGV12A), thus promoted Rac1 activation and cell motility. Taken together, the present study characterized a novel Nck-1-ELMO1 interaction and defined a new role for Nck-1 in regulating Rac1 activity. PMID:24928514

Familial Risks of Kidney Failure in Sweden: A Nationwide Family Study

PubMed Central

Akrawi, Delshad Saleh; Li, Xinjun; Sundquist, Jan; Sundquist, Kristina; Zöller, Bengt

2014-01-01

Background The value of family history as a risk factor for kidney failure has not been determined in a nationwide setting. Aim This nationwide family study aimed to determine familial risks for kidney failure in Sweden. Methods The Swedish multi-generation register on 0–78-year-old subjects were linked to the Swedish patient register and the Cause of death register for 1987–2010. Individuals diagnosed with acute kidney failure (n = 10063), chronic kidney failure (n = 18668), or unspecified kidney failure (n = 3731) were included. Kidney failure patients with cystic kidney disease, congenital kidney and urinary tract malformations, urolithiasis, and rare inherited kidney syndromes, and hyperoxaluria were excluded. Standardized incidence ratios (SIRs) were calculated for individuals whose parents/siblings were diagnosed with kidney failure compared to those whose parents or siblings were not. Results The concordant (same disease) familial risks (sibling/parent history) were increased for chronic kidney failure SIR = 2.02 (95% confidence interval, CI 1.90–2.14) but not for acute kidney failure SIR = 1.08 (95% CI 0.94–1.22) and for unspecified kidney failure SIR = 1.25 (95% CI 0.94–1.63). However, the discordant (different disease) familial risk for acute kidney failure SIR = 1.19 (95% CI 1.06–1.32) and unspecified kidney failure SIR = 1.63 (95% CI 1.40–1.90) was significantly increased in individuals with a family history of chronic kidney failure. The familial risk for chronic kidney failure was similar for males SIR = 2.04 (95% CI 1.90–2.20) and females SIR = 1.97 (95% CI 1.78–2.17). Familial risks for chronic kidney failure were highest at age of 10–19 years SIR = 6.33 (95% CI 4.16–9.22). Conclusions The present study shows that family history is an important risk factor for chronic kidney failure but to a lower degree for acute kidney failure and unspecified kidney failure. PMID:25423475

Mothe-Diniz Asteroid Dynamical Families V1.0

NASA Astrophysics Data System (ADS)

Mothe-Diniz, T.; Roig, F.; Carvano, J. M.

2006-03-01

This dataset contains an updated compilation of asteroid families and clusters, resulting from the application of the Hierarchical Clustering Method (HCM) on a set of around 120,000 asteroids with available proper elements. Whenever available, the classification in the Bus taxonomy is provided for family members, based on spectra from the SMASS, SMASS2 and S3OS2 spectroscopic surveys.

RAPD linkage mapping in a longleaf pine × slash pine F1 family

Treesearch

Thomas L. Kubisiak; C. Dana. Nelson; W.L. Nance; M. Stine

1995-01-01

Random amplified polymorphic DNAs (RAPDs) were used to construct linkage maps of the parents of a longleaf pine (Pinus palustris Mill.) slash pine (Pinus elliottii Englm.) F1 family. A total of 247 segregating loci [233 (1:1), 14 (3:1)] and 87 polymorphic (between-parents), but non-segregating, loci were...

R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family.

PubMed

Xu, Jun; Gu, Hong; Ma, Kai; Liu, Xipu; Snellingen, Torkel; Sun, Erdan; Wang, Ningli; Liu, Ningpu

2010-08-12

We identified a large Chinese family with X-linked juvenile retinoschisis. The purpose of this study was to report the clinical findings of the family and to identify the genetic mutation by screening the retinoschisis 1 (RS1) gene. Family history was collected and all family members underwent routine ophthalmic examination. Venous blood was collected from family members and genomic DNA was extracted. The exons of RS1 were screened by PCR followed by direct sequencing and/or restriction enzyme digestion. The pedigree of interest was a four-generation family with 52 family members, including seven affected individuals. The proband was a 5-year-old boy showing highly elevated bullous retinoschisis with moderate vitreous hemorrhage in both eyes. Vitrectomy was performed in the left eye of the proband. Five affected males showed large peripheral retinoschisis in both eyes, either involving the macula or combined with foveal stellate cystic change. One of the affected family members showed only a foveal stellate cystic change in both eyes without periphery retinoschisis. Visual acuity of affected individuals ranged from hand motion to 0.4. The R213W mutation in exon 6 of RS1 was identified in all affected individuals, predicting an amino acid substitution of arginine to tryptophan at codon 213. Our data show that the R213W mutation in RS1 causes various severities of retinoschisis in a large Chinese family, providing further evidence for X-linked juvenile retinoschisis phenotypic variability.

R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family

PubMed Central

Xu, Jun; Gu, Hong; Ma, Kai; Liu, Xipu; Snellingen, Torkel; Sun, Erdan; Wang, Ningli

2010-01-01

Purpose We identified a large Chinese family with X-linked juvenile retinoschisis. The purpose of this study was to report the clinical findings of the family and to identify the genetic mutation by screening the retinoschisis 1 (RS1) gene. Methods Family history was collected and all family members underwent routine ophthalmic examination. Venous blood was collected from family members and genomic DNA was extracted. The exons of RS1 were screened by PCR followed by direct sequencing and/or restriction enzyme digestion. Results The pedigree of interest was a four-generation family with 52 family members, including seven affected individuals. The proband was a 5-year-old boy showing highly elevated bullous retinoschisis with moderate vitreous hemorrhage in both eyes. Vitrectomy was performed in the left eye of the proband. Five affected males showed large peripheral retinoschisis in both eyes, either involving the macula or combined with foveal stellate cystic change. One of the affected family members showed only a foveal stellate cystic change in both eyes without periphery retinoschisis. Visual acuity of affected individuals ranged from hand motion to 0.4. The R213W mutation in exon 6 of RS1 was identified in all affected individuals, predicting an amino acid substitution of arginine to tryptophan at codon 213. Conclusions Our data show that the R213W mutation in RS1 causes various severities of retinoschisis in a large Chinese family, providing further evidence for X-linked juvenile retinoschisis phenotypic variability. PMID:20806044

Autoimmune Disease in a DFNA6/14/38 Family carrying a Novel Missense Mutation in WFS1

PubMed Central

Hildebrand, Michael S.; Sorensen, Jessica L.; Jensen, Maren; Kimberling, William J.; Smith, Richard J.H.

2008-01-01

Most familial cases of autosomal dominant low frequency sensorineural hearing loss (LFSNHL) are attributable to mutations in the Wolframin syndrome 1 (WFS1) gene at the DFNA6/14/38 locus. WFS1 mutations at this locus were first described in 2001 in six families segregating LFSNHL that was non-progressive below 2000 Hz; the causative mutations all clustered in the C-terminal domain of the wolframin protein. Mutations in WFS1 also cause Wolfram syndrome (WS), an autosomal recessive neurodegenerative disorder defined by diabetes mellitus, optic atrophy and often deafness, while numerous single nucleotide polymorphisms (SNPs) in WFS1 have been associated with increased risk for diabetes mellitus, psychiatric illnesses and Parkinson’s disease. This study was conducted in an American family segregating autosomal dominant LFSNHL. Two hearing impaired family members also had autoimmune diseases - Graves disease (GD) and Crohn’s disease (CD). Based on the low frequency audioprofile, mutation screening of WFS1 was completed and a novel missense mutation (c.2576G→A) that results in an arginine-to-glutamine substitution (p.R859Q) was identified in the C-terminal domain of the wolframin protein where most LFSNHL-causing mutations cluster. The family member with GD also carried polymorphisms in WFS1 that have been associated with other autoimmune diseases. PMID:18688868

Association and Promoter Analysis of AVPR1A in Finnish Autism Families.

PubMed

Kantojärvi, Katri; Oikkonen, Jaana; Kotala, Ilona; Kallela, Jenni; Vanhala, Raija; Onkamo, Päivi; Järvelä, Irma

2015-10-01

The arginine vasopressin receptor 1A gene (AVPR1A) is known to affect social communication and has been reported to associate with autism in several studies. Given that the microsatellite RS1 and a few SNPs in the promoter region of the AVPR1A have repeatedly associated with several traits, including autism it is rather surprising that the molecular explanation for these associations has remained unknown, although it has been reported that the allele length of the AVPR1A microsatellites might affect disease risk. Here we carried out an extended association analysis of three microsatellites and 12 tag single nucleotide polymorphisms (SNPs) in and around the AVPR1A gene in 205 Finnish families followed by promoter analysis. FBAT version v2.0.3 was used for family-based genetic association analyses of AVPR1A microsatellites and SNPs. The nearby microsatellite RS1 was found to harbor the best association. Interestingly, there are two potentially relevant transcription factor (TF) binding sites at RS1: for MEF2C and PBX, predicted with the Match algorithm in the TRANSFAC database. Sequence variations changing the affinity of these TFs might partly explain the AVPR1A promoter region associations shown in autism. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.

Bibliography of Family Planning and Population, Volume 1 Number 3.

ERIC Educational Resources Information Center

Linzell, Dinah, Comp.

Compiled from the world's research literature, this bi-monthly classified list of references on population and family planning emphasizes recently published material, primarily journal literature. Topics covered include: population and fertility; reproductive behaviour; the family; education in population, family planning, and sex; family…

Presentation of Class 1 designs for a family of commuter airplanes

NASA Technical Reports Server (NTRS)

Creighton, Tom; Dragush, George; Hendrich, Louis; Hensley, Doug; Morgan, Louise; Oxendine, Charles; Remen, John; Robinson, Terry; Russell, Mark; Swift, Jerry

1986-01-01

The Class 1 configuration designs of a family of commuter aircraft are presented. The proposed aircraft will have a capacity of from 25 to 100 passengers. They are to have the following common features: (1) 2 aft fuselage mounted engines; (2) a low wing; (3) a T-tail type empennage; and (4) a tricycle type landing gear. A family concept is introduced to achieve structural, systems and handling quality commonality throughout. Implementing commonality can substantially reduce manufacturing and production costs. By achieving common system designs, maintenance costs can be reduced by permitting airlines to stock a smaller inventory of spares. Therefore, the higher degree of commonality, the lower the direct operating and life cycle costs. The attempt to implement some of the commonality requirements has caused configuration design problems, i.e., the twin-body concept was introduced. Design data are compared to existing aircraft, and the extent of structural, systems and handling qualities achieved are reviewed.

Family history and its association to curve size and treatment in 1,463 patients with idiopathic scoliosis.

PubMed

Grauers, Anna; Danielsson, Aina; Karlsson, Magnus; Ohlin, Acke; Gerdhem, Paul

2013-11-01

To study family history in relation to curve severity, gender, age at diagnosis and treatment in idiopathic scoliosis. A self-assessment questionnaire on family history of scoliosis was administered to 1,463 untreated, brace or surgically treated idiopathic scoliosis patients. Out of the 1,463 patients, 51 % had one or more relatives with scoliosis. There was no significant difference between females and males, nor between juvenile and adolescent study participants in this respect (p = 0.939 and 0.110, respectively). There was a significant difference in maximum curve size between patients with one or more relatives with scoliosis (median 35°, interquartile range 25) and patients without any relative with scoliosis (median 32°, interquartile range 23) (p = 0.022). When stratifying patients according to treatment (observation, brace treatment or surgery), we found that it was more common to have a relative with scoliosis among the treated patients (p = 0.011). The OR for being treated was 1.32 (95% CI 1.06-1.64) when the patient had a relative with scoliosis, compared to not having. Larger curve sizes were found in patients with a family history of scoliosis than in the ones without. No relation between family history and gender or between family history and age at onset of idiopathic scoliosis was found. Although the presence of a family history of scoliosis may not be a strong prognostic risk factor, it indicates that these patients are at higher risk of developing a more severe curve.

Families Today: A Research Sampler on Families and Children. Volume II. NIMH Science Monographs 1.

ERIC Educational Resources Information Center

Corfman, Eunice, Ed.

The second of two volumes, this book contains 21 studies of children and families. Selections, grouped into three sections, are intended to provide a representative sample of current research, including case studies and less formal reports. The first section reports on families in distress. Articles focus on adults who were antisocial children,…

Familial risks of glomerulonephritis - a nationwide family study in Sweden.

PubMed

Akrawi, Delshad Saleh; Li, Xinjun; Sundquist, Jan; Fjellstedt, Erik; Sundquist, Kristina; Zöller, Bengt

2016-08-01

Familial risks of glomerulonephritis (acute, chronic and unspecified glomerulonephritis) have not been studied. This study aims to determine the familial risks of glomerulonephritis. Individuals born from1932 onwards diagnosed with glomerulonephritis (acute [n = 7011], chronic [n = 10,242] and unspecified glomerulonephritis [n = 5762]) were included. The familial risk (Standardized incidence ratio = SIR) was calculated for individuals whose parents/full-siblings were diagnosed with glomerulonephritis compared to those whose parents/full-siblings were not. The procedure was repeated for spouses. Familial concordant risk (same disease in proband and exposed relative) and discordant risk (different disease in proband and exposed relative) of glomerulonephritis were determined. Familial concordant risks (parents/full-sibling history) were: SIR = 3.57 (95% confidence interval, 2.77-4.53) for acute glomerulonephritis, SIR = 3.84 (3.37-4.36) for chronic glomerulonephritis and SIR = 3.75 (2.85-4.83) for unspecified glomerulonephritis. High familial risks were observed if two or more relatives were affected; the SIR was 209.83 (150.51-284.87) in individuals with at least one affected parent as well as one full-sibling. The spouse risk was only moderately increased (SIR = 1.53, 1.33-1.75). Family history of glomerulonephritis is a strong predictor for glomerulonephritis, and is a potentially useful tool in clinical risk assessment. Our data emphasize the contribution of familial factors to the glomerulonephritis burden in the community. Key Messages The familial risks (full-sibling/parent history) of glomerulonephritis (acute, chronic and unspecified glomerulonephritis) have not been determined previously. The familial risks of glomerulonephritis were increased among individuals with family history of acute, chronic or unspecified glomerulonephritis. The familial risks of glomerulonephritis were slightly increased among spouses indicating a

Mutations in ALDH1A3 represent a frequent cause of microphthalmia/anophthalmia in consanguineous families.

PubMed

Abouzeid, Hana; Favez, Tatiana; Schmid, Angélique; Agosti, Céline; Youssef, Mohammed; Marzouk, Iman; El Shakankiry, Nihal; Bayoumi, Nader; Munier, Francis L; Schorderet, Daniel F

2014-08-01

Anophthalmia or microphthalmia (A/M), characterized by absent or small eye, can be unilateral or bilateral and represent developmental anomalies due to the mutations in several genes. Recently, mutations in aldehyde dehydrogenase family 1, member A3 (ALDH1A3) also known as retinaldehyde dehydrogenase 3, have been reported to cause A/M. Here, we screened a cohort of 75 patients with A/M and showed that mutations in ALDH1A3 occurred in six families. Based on this series, we estimate that mutations in ALDH1A3 represent a major cause of A/M in consanguineous families, and may be responsible for approximately 10% of the cases. Screening of this gene should be performed in a first line of investigation, together with SOX2. © 2014 WILEY PERIODICALS, INC.

Talking (or not) about family health history in families of Latino young adults.

PubMed

Corona, Rosalie; Rodríguez, Vivian; Quillin, John; Gyure, Maria; Bodurtha, Joann

2013-10-01

Although individuals recognize the importance of knowing their family's health history for their own health, relatively few people (e.g., less than a third in one national survey) collect this type of information. This study examines the rates of family communication about family health history of cancer, and predictors of communication in a sample of English-speaking Latino young adults. A total of 224 Latino young adults completed a survey that included measures on family communication, cultural factors, religious commitment, and cancer worry. We found that few Latino young adults reported collecting information from their families for the purposes of creating a family health history (18%) or sharing information about hereditary cancer risk with family members (16%). In contrast, slightly more than half of the participants reported generally "talking with their mothers about their family's health history of cancer." Logistic regression results indicated that cancer worry (odds ratio [OR] = 2.31; 95% confidence interval [CI] = 1.08-4.93), being female (OR = 3.12; 95% CI = 1.02-8.08), and being older (OR = 1.33; 95% CI = 1.01-1.76) were associated with increased rates of collecting information from family members. In contrast, orientation to the Latino culture (OR = 2.81; 95% CI = 1.33-5.94) and religious commitment (OR = 1.54; 95% CI = 1.02-2.32) were associated with increased rates of giving cancer information. Results highlight the need for prevention programs to help further general discussions about a family's history of cancer to more specific information related to family health history.

A Novel Mutation in the XLRS1 Gene in a Korean Family with X-linked Retinoschisis

PubMed Central

Jwa, Nam Soo; Kim, Sung Soo; Lee, Sung Chul; Kwon, Oh Woong

2006-01-01

Purpose To report a novel missense mutation in the XLRS1 gene in a Korean family with X-linked retinoschisis. Methods Observation case report of a family with a proband with X-linked retinoschisis underwent complete ophthalmologic examination. Genomic DNA was excluded from the family's blood and all exons of the XLRS1 gene were amplified by polymerase chain reaction and analyzed using a direct sequencing method. Results A novel Leu103Phe missense mutation was identified. Conclusions A novel Leu103Phe mutation is an additional missense mutation which is responsible for the pathogenesis of X-linked retinoschisis. PMID:16768192

Loss-of-Function Mutations in APPL1 in Familial Diabetes Mellitus

PubMed Central

Prudente, Sabrina; Jungtrakoon, Prapaporn; Marucci, Antonella; Ludovico, Ornella; Buranasupkajorn, Patinut; Mazza, Tommaso; Hastings, Timothy; Milano, Teresa; Morini, Eleonora; Mercuri, Luana; Bailetti, Diego; Mendonca, Christine; Alberico, Federica; Basile, Giorgio; Romani, Marta; Miccinilli, Elide; Pizzuti, Antonio; Carella, Massimo; Barbetti, Fabrizio; Pascarella, Stefano; Marchetti, Piero; Trischitta, Vincenzo; Di Paola, Rosa; Doria, Alessandro

2015-01-01

Diabetes mellitus is a highly heterogeneous disorder encompassing several distinct forms with different clinical manifestations including a wide spectrum of age at onset. Despite many advances, the causal genetic defect remains unknown for many subtypes of the disease, including some of those forms with an apparent Mendelian mode of inheritance. Here we report two loss-of-function mutations (c.1655T>A [p.Leu552∗] and c.280G>A [p.Asp94Asn]) in the gene for the Adaptor Protein, Phosphotyrosine Interaction, PH domain, and leucine zipper containing 1 (APPL1) that were identified by means of whole-exome sequencing in two large families with a high prevalence of diabetes not due to mutations in known genes involved in maturity onset diabetes of the young (MODY). APPL1 binds to AKT2, a key molecule in the insulin signaling pathway, thereby enhancing insulin-induced AKT2 activation and downstream signaling leading to insulin action and secretion. Both mutations cause APPL1 loss of function. The p.Leu552∗ alteration totally abolishes APPL1 protein expression in HepG2 transfected cells and the p.Asp94Asn alteration causes significant reduction in the enhancement of the insulin-stimulated AKT2 and GSK3β phosphorylation that is observed after wild-type APPL1 transfection. These findings—linking APPL1 mutations to familial forms of diabetes—reaffirm the critical role of APPL1 in glucose homeostasis. PMID:26073777

Epigenetic regulation of planarian stem cells by the SET1/MLL family of histone methyltransferases

PubMed Central

Hubert, Amy; Henderson, Jordana M.; Ross, Kelly G.; Cowles, Martis W.; Torres, Jessica; Zayas, Ricardo M.

2013-01-01

Chromatin regulation is a fundamental mechanism underlying stem cell pluripotency, differentiation, and the establishment of cell type-specific gene expression profiles. To examine the role of chromatin regulation in stem cells in vivo, we study regeneration in the freshwater planarian Schmidtea mediterranea. These animals possess a high concentration of pluripotent stem cells, which are capable of restoring any damaged or lost tissues after injury or amputation. Here, we identify the S. mediterranea homologs of the SET1/MLL family of histone methyltransferases and COMPASS and COMPASS-like complex proteins and investigate their role in stem cell function during regeneration. We identified six S. mediterranea homologs of the SET1/MLL family (set1, mll1/2, trr-1, trr-2, mll5–1 and mll5–2), characterized their patterns of expression in the animal, and examined their function by RNAi. All members of this family are expressed in the stem cell population and differentiated tissues. We show that set1, mll1/2, trr-1, and mll5–2 are required for regeneration and that set1, trr-1 and mll5–2 play roles in the regulation of mitosis. Most notably, knockdown of the planarian set1 homolog leads to stem cell depletion. A subset of planarian homologs of COMPASS and COMPASS-like complex proteins are also expressed in stem cells and implicated in regeneration, but the knockdown phenotypes suggest that some complex members also function in other aspects of planarian biology. This work characterizes the function of the SET1/MLL family in the context of planarian regeneration and provides insight into the role of these enzymes in adult stem cell regulation in vivo. PMID:23235145

Family environment interacts with CRHR1 rs17689918 to predict mental health and behavioral outcomes.

PubMed

Roy, Arunima; Laas, Kariina; Kurrikoff, Triin; Reif, Andreas; Veidebaum, Toomas; Lesch, Klaus-Peter; Harro, Jaanus

2018-05-14

Corticotrophin-releasing hormone receptor-1 gene (CRHR1) variants have been implicated in mental health. However, little is known of the effects of CRHR1 on long-term mental health and behavior in presence of environmental stressors. We assess the effects of CRHR1 variant (rs17689918)-by-environment interactions on emotionality and behavioral traits, including anxiety, depression, aggression and antisocial behaviors. We also determine effects of rs17689918-by-environment-by-sex interactions on the above-mentioned outcomes. Genotypic assessments were carried out in 564 children (mean age 10 years, 52.5% females) from the ongoing longitudinal Estonian Children Personality Behaviour and Health Study (ECPBHS). Information on stressful life events and family relationships were available at baseline and information on behavioral and mental health outcomes (self- and parent-reports) were available at follow-up ages of 18 and 25 years. ANOVAs were used to determine associations of two-way CRHR1-by-environment and three-way CRHR1-by-sex-by-environment interactions on behavioral and mental health outcomes. Two-way CRHR1 interaction effects showed associations between low familial warmth and hostility in individuals with the GG genotype. Associations of low familial warmth with aggression, of higher number of stressful life events with aggression, and of stressful live events with anxious-depressive symptoms were noted in male A-allele carriers and female GG homozygotes. CRHR1-by-familial environment interactions influence both outwardly-directed aggression as well as mood and anxiety disorder symptoms in a sex-specific manner. The type of environmental stressor can also influence effects of CRHR1 on behavioral and mental health outcomes. Copyright © 2018 Elsevier Inc. All rights reserved.

Families and Education: An Educator's Resource for Family Involvement. (Revised Edition).

ERIC Educational Resources Information Center

App, Marie, Comp.; Grinde, Jane, Comp.

This handbook for educators offers guidance on ways to understand families, family-teacher communication, the process of reinforcing classwork at home, caring for the whole child, and selected resources. Chapter 1 discusses the climate for family involvement, different perceptions of teachers and families, what families want to know, today's…

Child outcomes and family characteristics 1 year after severe inflicted or noninflicted traumatic brain injury.

PubMed

Keenan, Heather T; Runyan, Desmond K; Nocera, Maryalice

2006-02-01

To assess outcomes 1 year after severe traumatic brain injury (TBI) among young children and to compare outcomes between children with inflicted versus noninflicted injuries. Prospective cohort study. All North Carolina-resident children who were hospitalized between January 2000 and December 2001 in any of the state's 9 PICUs and who survived a severe TBI that occurred on or before their second birthday were eligible to participate. Child health status, child use of ancillary medical resources, and family characteristics were determined through maternal caregiver interviews approximately 1 year after injury. Comparisons were made between family characteristics and child outcomes according to injury type. Seventy-two interviews of maternal caregivers were completed among 112 survivors (64.3%). Children with inflicted injuries (n = 41) had worse outcomes than did children with noninflicted injuries (n = 31), as measured with the Pediatric Outcome Performance Category and Stein-Jessup Functional Status II (Revised) tools. However, approximately 50% of children with inflicted injuries had only mild deficits or better. Children with inflicted injuries had a higher use of ancillary medical resources. Families caring for the children did not differ substantively, with a large proportion of single, working, minority mothers. Children with inflicted TBIs had worse outcomes than did children with other TBIs 1 year after injury. However, outcomes for these children were better than those reported previously. Many families caring for children after severe TBI are socially disadvantaged. Interventions to improve child outcomes may include enhanced family support.

We Are Family: Using Diverse Family Structure Literature with Children

ERIC Educational Resources Information Center

Gilmore, Deanna Peterschick; Bell, Kari

2006-01-01

The structure of the American family has changed over the years. Although the traditional father, mother, child structure still dominates, other family patterns are emerging. In this article the authors present: (1) current statistics relating to diverse family structures; (2) reasons for using diverse family structure literature with children;…

Two novel CHN1 mutations in two families with Duane’s retraction syndrome

PubMed Central

Chan, Wai-Man; Miyake, Noriko; Zhu-Tam, Lily; Andrews, Caroline; Engle, Elizabeth C.

2012-01-01

Objective To determine the genetic cause of Duane’s retraction syndrome (DRS) in two families segregating DRS as an autosomal dominant trait. Method Members of two unrelated pedigrees were enrolled in an ongoing genetic study. Linkage analysis was performed using fluorescent microsatellite markers flanking the CHN1 locus. Probands and family members were screened for CHN1 mutations. Results Of the six clinically affected individuals in the two pedigrees, three have bilateral and three have unilateral DRS. Both pedigrees are consistent with linkage to the DURS2 locus, one with complete and one with incomplete penetrance. Sequence analysis revealed the pedigrees segregate novel heterozygous missense CHN1 mutations, c.422C>T and c.754C>T, predicted to result in α2-chimaerin amino acid substitutions P141L and P252S, respectively. Conclusion Genetic analysis of two pedigrees segregating nonsyndromic DRS reveals two novel mutations in CHN1, bringing the number of DRS pedigrees know to harbor CHN1 mutations, and the number of unique CHN1 mutations, from seven to nine. Both mutations identified in this study alter residues that participate in intramolecular interactions that stabilize the inactive, closed conformation of α2-chimerin, and thus are predicted to result in its hyper-activation. Moreover, amino acid residue P252 was altered to a different residue in a previously reported DRS pedigree; thus, this is the first report of two CHN1 mutations altering the same residue, further supporting a gain-of-function etiology. Clinical Relevance Members of families segregating DRS as an autosomal dominant trait should be screened for mutations in the CHN1 gene, enhancing genetic counseling and permitting earlier diagnosis. PMID:21555619

Clinical heterogeneity and phenotype/genotype findings in 5 families with GYG1 deficiency

PubMed Central

Ben Yaou, Rabah; Hubert, Aurélie; Nelson, Isabelle; Dahlqvist, Julia R.; Gaist, David; Streichenberger, Nathalie; Beuvin, Maud; Krahn, Martin; Petiot, Philippe; Parisot, Frédéric; Michel, Fabrice; Malfatti, Edoardo; Romero, Norma; Carlier, Robert Yves; Eymard, Bruno; Labrune, Philippe; Duno, Morten; Krag, Thomas; Cerino, Mathieu; Bartoli, Marc; Bonne, Gisèle; Vissing, John; Laforet, Pascal

2017-01-01

Objective: To describe the variability of muscle symptoms in patients carrying mutations in the GYG1 gene, encoding glycogenin-1, an enzyme involved in the biosynthesis of glycogen, and to discuss genotype-phenotype relations. Methods: We describe 9 patients from 5 families in whom muscle biopsies showed vacuoles with an abnormal accumulation of glycogen in muscle fibers, partially α-amylase resistant suggesting polyglucosan bodies. The patients had either progressive early-onset limb-girdle weakness or late-onset distal or scapuloperoneal muscle affection as shown by muscle imaging. No clear definite cardiac disease was found. Histologic and protein analysis investigations were performed on muscle. Results: Genetic analyses by direct or exome sequencing of the GYG1 gene revealed 6 different GYG1 mutations. Four of the mutations were novel. They were compound heterozygous in 3 families and homozygous in 2. Protein analysis revealed either the absence of glycogenin-1 or reduced glycogenin-1 expression with impaired glucosylation. Conclusions: Our report extends the genetic and clinical spectrum of glycogenin-1–related myopathies to include scapuloperoneal and distal affection with glycogen accumulation. PMID:29264399

Clinical heterogeneity and phenotype/genotype findings in 5 families with GYG1 deficiency.

PubMed

Ben Yaou, Rabah; Hubert, Aurélie; Nelson, Isabelle; Dahlqvist, Julia R; Gaist, David; Streichenberger, Nathalie; Beuvin, Maud; Krahn, Martin; Petiot, Philippe; Parisot, Frédéric; Michel, Fabrice; Malfatti, Edoardo; Romero, Norma; Carlier, Robert Yves; Eymard, Bruno; Labrune, Philippe; Duno, Morten; Krag, Thomas; Cerino, Mathieu; Bartoli, Marc; Bonne, Gisèle; Vissing, John; Laforet, Pascal; Petit, François M

2017-12-01

To describe the variability of muscle symptoms in patients carrying mutations in the GYG1 gene, encoding glycogenin-1, an enzyme involved in the biosynthesis of glycogen, and to discuss genotype-phenotype relations. We describe 9 patients from 5 families in whom muscle biopsies showed vacuoles with an abnormal accumulation of glycogen in muscle fibers, partially α-amylase resistant suggesting polyglucosan bodies. The patients had either progressive early-onset limb-girdle weakness or late-onset distal or scapuloperoneal muscle affection as shown by muscle imaging. No clear definite cardiac disease was found. Histologic and protein analysis investigations were performed on muscle. Genetic analyses by direct or exome sequencing of the GYG1 gene revealed 6 different GYG1 mutations. Four of the mutations were novel. They were compound heterozygous in 3 families and homozygous in 2. Protein analysis revealed either the absence of glycogenin-1 or reduced glycogenin-1 expression with impaired glucosylation. Our report extends the genetic and clinical spectrum of glycogenin-1-related myopathies to include scapuloperoneal and distal affection with glycogen accumulation.

3 CFR 8895 - Proclamation 8895 of November 1, 2012. Military Family Month, 2012

Code of Federal Regulations, 2013 CFR

2013-01-01

... November 1, 2012 Proc. 8895 Military Family Month, 2012By the President of the United States of America A Proclamation Since our Nation's earliest days, courageous men and women of all backgrounds and beliefs have... 3 The President 1 2013-01-01 2013-01-01 false Proclamation 8895 of November 1, 2012. Military...

Src family kinase expression and subcellular localization in macrophages: implications for their role in CSF-1-induced macrophage migration.

PubMed

Dwyer, Amy R; Mouchemore, Kellie A; Steer, James H; Sunderland, Andrew J; Sampaio, Natalia G; Greenland, Eloise L; Joyce, David A; Pixley, Fiona J

2016-07-01

A major role of colony-stimulating factor-1 is to stimulate the differentiation of mononuclear phagocytic lineage cells into adherent, motile, mature macrophages. The colony-stimulating factor-1 receptor transduces colony-stimulating factor-1 signaling, and we have shown previously that phosphatidylinositol 3-kinase p110δ is a critical mediator of colony-stimulating factor-1-stimulated motility through the colony-stimulating factor-1 receptor pY721 motif. Src family kinases are also implicated in the regulation of macrophage motility and in colony-stimulating factor-1 receptor signaling, although functional redundancy of the multiple SFKs expressed in macrophages makes it challenging to delineate their specific functions. We report a comprehensive analysis of individual Src family kinase expression in macrophage cell lines and primary macrophages and demonstrate colony-stimulating factor-1-induced changes in Src family kinase subcellular localization, which provides clues to their distinct and redundant functions in macrophages. Moreover, expression of individual Src family kinases is both species specific and dependent on colony-stimulating factor-1-induced macrophage differentiation. Hck associated with the activated colony-stimulating factor-1 receptor, whereas Lyn associated with the receptor in a constitutive manner. Consistent with this, inhibitor studies revealed that Src family kinases were important for both colony-stimulating factor-1 receptor activation and colony-stimulating factor-1-induced macrophage spreading, motility, and invasion. Distinct colony-stimulating factor-1-induced changes in the subcellular localization of individual SFKs suggest specific roles for these Src family kinases in the macrophage response to colony-stimulating factor-1. © Society for Leukocyte Biology.

Family planning education.

PubMed

Hamburg, M V

1983-02-01

17 days were spent devoted to the effort of learning about China's educational approach to family planning in the hope of discovering how they are achieving their remarkable success in reducing population growth. As a member of the 1981 New York University/SIECUS Colloquim in China, it was necessary to rely on the translation provided by the excellent guides. Discussions were focused on questions prepared in advance about the topics that concerned the group. These observations, based on a short and limited exposure, cover the following areas: marriage and family planning policies; the family planning program; school programs; adult education; family planning workers; and unique aspects of the program. China has an official position on marriage and family planning that continues to undergo revisions. The new marriage law sets the minimum ages of marriage at 22 for men and 20 for women. Almost everyone marries, and an unmarried person over age 28 is a rarity. The family planning program in China is carried out by an extensive organizational network at national, provincial, and local government levels. Officials termed it a "propaganda campaign." Hospitals, clinics, and factories invariably displayed posters; a popular set of four presents the advantages of the 1 child family as follows: late marriage is best, for it allows more time to work and study; 1 child is best for the health of the mother; one gets free medical care for his/her child if a family has only 1 child; and there is more time to teach 1 child. The state operated television regularly explains the 1 child policy utilizing special films. According to 1 family planning official, "before marriage there is little sex." There are few abortions for unmarried women. Education about sex is for adults, for those persons who are about to be married. There is little if any sex education in schools. Sexual teaching is not generally acceptable, especially in the rural areas. By contrast, in Shanghai the physiology