Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

Solvent-shared pairs of densely charged ions induce intense but short-range supra-additive slowdown of water rotation.

PubMed

Vila Verde, Ana; Santer, Mark; Lipowsky, Reinhard

2016-01-21

The question "Can ions exert supra-additive effects on water dynamics?" has had several opposing answers from both simulation and experiment. We address this ongoing controversy by investigating water reorientation in aqueous solutions of two salts with large (magnesium sulfate) and small (cesium chloride) effects on water dynamics using molecular dynamics simulations and classical, polarizable models. The salt models are reparameterized to reproduce properties of both dilute and concentrated solutions. We demonstrate that water rotation in concentrated MgSO4 solutions is unexpectedly slow, in agreement with experiment, and that the slowdown is supra-additive: the observed slowdown is larger than that predicted by assuming that the resultant of the extra forces induced by the ions on the rotating water molecules tilts the free energy landscape associated with water rotation. Supra-additive slow down is very intense but short-range, and is strongly ion-specific: in contrast to the long-range picture initially proposed based on experiment, we find that intense supra-additivity is limited to water molecules directly bridging two ions in solvent-shared ion pair configuration; in contrast to a non-ion-specific origin to supra-additive effects proposed from simulations, we find that the magnitude of supra-additive slowdown strongly depends on the identity of the cations and anions. Supra-additive slowdown of water dynamics requires long-lived solvent-shared ion pairs; long-lived ion pairs should be typical for salts of multivalent ions. We discuss the origin of the apparent disagreement between the various studies on this topic and show that the short-range cooperative slowdown scenario proposed here resolves the existing controversy.

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Analysis of a variety of inorganic and organic additives in food products by ion-pairing liquid chromatography coupled to high-resolution mass spectrometry.

PubMed

Kaufmann, Anton; Widmer, Mirjam; Maden, Kathryn; Butcher, Patrick; Walker, Stephan

2018-03-05

A reversed-phase ion-pairing chromatographic method was developed for the detection and quantification of inorganic and organic anionic food additives. A single-stage high-resolution mass spectrometer (orbitrap ion trap, Orbitrap) was used to detect the accurate masses of the unfragmented analyte ions. The developed ion-pairing chromatography method was based on a dibutylamine/hexafluoro-2-propanol buffer. Dibutylamine can be charged to serve as a chromatographic ion-pairing agent. This ensures sufficient retention of inorganic and organic anions. Yet, unlike quaternary amines, it can be de-charged in the electrospray to prevent the formation of neutral analyte ion-pairing agent adducts. This process is significantly facilitated by the added hexafluoro-2-propanol. This approach permits the sensitive detection and quantification of additives like nitrate and mono-, di-, and triphosphate as well as citric acid, a number of artificial sweeteners like cyclamate and aspartame, flavor enhancers like glutamate, and preservatives like sorbic acid. This is a major advantage, since the currently used analytical methods as utilized in food safety laboratories are only capable in monitoring a few compounds or a particular category of food additives. Graphical abstract Deptotonation of ion pair agent in the electrospray interface.

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

PubMed

Nonin, S; Jiang, F; Patel, D J

1997-05-02

We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

PubMed

De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

2018-06-05

Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

PubMed Central

Liu, Ning; Tian, Ru; Loeb, Daniel D.

2003-01-01

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

PubMed

Liu, Ning; Tian, Ru; Loeb, Daniel D

2003-02-18

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

The electrostatic characteristics of G·U wobble base pairs

PubMed Central

Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

2007-01-01

G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

Recruitment of Additional Corticospinal Pathways in the Human Brain with State-Dependent Paired Associative Stimulation.

PubMed

Kraus, Dominic; Naros, Georgios; Guggenberger, Robert; Leão, Maria Teresa; Ziemann, Ulf; Gharabaghi, Alireza

2018-02-07

Standard brain stimulation protocols modify human motor cortex excitability by modulating the gain of the activated corticospinal pathways. However, the restoration of motor function following lesions of the corticospinal tract requires also the recruitment of additional neurons to increase the net corticospinal output. For this purpose, we investigated a novel protocol based on brain state-dependent paired associative stimulation.Motor imagery (MI)-related electroencephalography was recorded in healthy males and females for brain state-dependent control of both cortical and peripheral stimulation in a brain-machine interface environment. State-dependency was investigated with concurrent, delayed, and independent stimulation relative to the MI task. Specifically, sensorimotor event-related desynchronization (ERD) in the β-band (16-22 Hz) triggered peripheral stimulation through passive hand opening by a robotic orthosis and transcranial magnetic stimulation to the respective cortical motor representation, either synchronously or subsequently. These MI-related paradigms were compared with paired cortical and peripheral input applied independent of the brain state. Cortical stimulation resulted in a significant increase in corticospinal excitability only when applied brain state-dependently and synchronously to peripheral input. These gains were resistant to a depotentiation task, revealed a nonlinear evolution of plasticity, and were mediated via the recruitment of additional corticospinal neurons rather than via synchronization of neuronal firing. Recruitment of additional corticospinal pathways may be achieved when cortical and peripheral inputs are applied concurrently, and during β-ERD. These findings resemble a gating mechanism and are potentially important for developing closed-loop brain stimulation for the treatment of hand paralysis following lesions of the corticospinal tract. SIGNIFICANCE STATEMENT The activity state of the motor system influences the

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

PubMed

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

PubMed Central

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

DOE PAGES

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

2015-01-29

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

PubMed Central

Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

2013-01-01

We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

NASA Technical Reports Server (NTRS)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

PubMed

Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

2012-08-14

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

Understanding the kinetic mechanism of RNA single base pair formation

PubMed Central

Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

2016-01-01

RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

PubMed

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Orbital selective pairing and gap structures of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

Orbital selective pairing and gap structures of iron-based superconductors

DOE PAGES

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

2017-05-08

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

PubMed

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

Non-additive interactions involving two distinct elements mediate sloppy-paired regulation by pair-rule transcription factors

PubMed Central

Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter

2010-01-01

The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

Efficient Implementation of the Pairing on Mobilephones Using BREW

NASA Astrophysics Data System (ADS)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

PubMed Central

Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

2010-01-01

It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

Physics of base-pairing dynamics in DNA

NASA Astrophysics Data System (ADS)

Manghi, Manoel; Destainville, Nicolas

2016-05-01

As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

The solvability of quantum k-pair network in a measurement-based way.

PubMed

Li, Jing; Xu, Gang; Chen, Xiu-Bo; Qu, Zhiguo; Niu, Xin-Xin; Yang, Yi-Xian

2017-12-01

Network coding is an effective means to enhance the communication efficiency. The characterization of network solvability is one of the most important topic in this field. However, for general network, the solvability conditions are still a challenge. In this paper, we consider the solvability of general quantum k-pair network in measurement-based framework. For the first time, a detailed account of measurement-based quantum network coding(MB-QNC) is specified systematically. Differing from existing coding schemes, single qubit measurements on a pre-shared graph state are the only allowed coding operations. Since no control operations are concluded, it makes MB-QNC schemes more feasible. Further, the sufficient conditions formulating by eigenvalue equations and stabilizer matrix are presented, which build an unambiguous relation among the solvability and the general network. And this result can also analyze the feasibility of sharing k EPR pairs task in large-scale networks. Finally, in the presence of noise, we analyze the advantage of MB-QNC in contrast to gate-based way. By an instance network [Formula: see text], we show that MB-QNC allows higher error thresholds. Specially, for X error, the error threshold is about 30% higher than 10% in gate-based way. In addition, the specific expressions of fidelity subject to some constraint conditions are given.

Error simulation of paired-comparison-based scaling methods

NASA Astrophysics Data System (ADS)

Cui, Chengwu

2000-12-01

Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Use of decimal assay for additivity to demonstrate synergy in pair combinations of econazole, nikkomycin Z, and ibuprofen against Candida albicans in vitro.

PubMed Central

Tariq, V N; Scott, E M; McCain, N E

1995-01-01

Interactions between six compounds (econazole, miconazole, amphotericin B, nystatin, nikkomycin Z, and ibuprofen) were investigated for their antifungal activities against Candida albicans by using pair combinations in an in vitro decimal assay for additivity based on disk diffusion. Additive interactions were observed between miconazole and econazole, amphotericin B and nystatin, and amphotericin B and ibuprofen, while an antagonistic interaction was observed between econazole and amphotericin B. Synergistic interactions were recorded for the combinations of econazole and ibuprofen, econazole and nikkomycin Z, and ibuprofen and nikkomycin Z. PMID:8592989

Multi-hop teleportation based on W state and EPR pairs

NASA Astrophysics Data System (ADS)

Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

2016-05-01

Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

Method for sequencing DNA base pairs

DOEpatents

Sessler, Andrew M.; Dawson, John

1993-01-01

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

Method for sequencing DNA base pairs

DOEpatents

Sessler, A.M.; Dawson, J.

1993-12-14

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

Signature scheme based on bilinear pairs

NASA Astrophysics Data System (ADS)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

FEMALE AND MALE GENETIC EFFECTS ON OFFSPRING PATERNITY: ADDITIVE GENETIC (CO)VARIANCES IN FEMALE EXTRA-PAIR REPRODUCTION AND MALE PATERNITY SUCCESS IN SONG SPARROWS (MELOSPIZA MELODIA)

PubMed Central

Reid, Jane M; Arcese, Peter; Keller, Lukas F; Losdat, Sylvain

2014-01-01

Ongoing evolution of polyandry, and consequent extra-pair reproduction in socially monogamous systems, is hypothesized to be facilitated by indirect selection stemming from cross-sex genetic covariances with components of male fitness. Specifically, polyandry is hypothesized to create positive genetic covariance with male paternity success due to inevitable assortative reproduction, driving ongoing coevolution. However, it remains unclear whether such covariances could or do emerge within complex polyandrous systems. First, we illustrate that genetic covariances between female extra-pair reproduction and male within-pair paternity success might be constrained in socially monogamous systems where female and male additive genetic effects can have opposing impacts on the paternity of jointly reared offspring. Second, we demonstrate nonzero additive genetic variance in female liability for extra-pair reproduction and male liability for within-pair paternity success, modeled as direct and associative genetic effects on offspring paternity, respectively, in free-living song sparrows (Melospiza melodia). The posterior mean additive genetic covariance between these liabilities was slightly positive, but the credible interval was wide and overlapped zero. Therefore, although substantial total additive genetic variance exists, the hypothesis that ongoing evolution of female extra-pair reproduction is facilitated by genetic covariance with male within-pair paternity success cannot yet be definitively supported or rejected either conceptually or empirically. PMID:24724612

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

NASA Technical Reports Server (NTRS)

Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

2003-01-01

Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

DTIC Science & Technology

2016-04-01

DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

The influence of addition of ion-pairing acid and organic modifier of the mobile phase on retention and migration of peptides in pressurized planar electrochromatography system with octadecyl silica-based adsorbent.

PubMed

Gwarda, Radosław Ł; Dzido, Tadeusz H

2018-07-13

In our previous papers we have investigated the influence of the mobile phase composition on mechanism of retention, selectivity and efficiency of peptide separation in various high-performance thin-layer chromatography (HPTLC) systems with commercially available silica-based adsorbents. We have also investigated the influence of pH of the mobile phase buffer on migration and separation of peptides in pressurized planar electrochromatography (PPEC). Here we investigate the influence of concentration of ion-pairing additive, and concentration and type of organic modifier of the mobile phase on migration of peptides in PPEC system with octadecyl silica-based adsorbent, and with the same set of the solutes as before. We compare our current results with the results obtained before for similar HPTLC and PPEC systems, and discuss the influence of particular variables on retention, electrophoretic mobility of solutes and electroosmotic flow of the mobile phase. We show, that the final selectivity of peptide separation results from co-influence of all the three factors mentioned. Concentration of organic modifier of the mobile phase, as well as concentration of ion-pairing additive, affect the retention, the electrophoretic mobility, and the electroosmotic flow simultaneously. This makes independent optimization of these factors rather difficult. Anyway PPEC offers much faster separation of peptides with quite different selectivity, in comparison to HPTLC, with similar adsorbents and similar mobile phase composition. However, we also present and discuss the issue of extensive tailing of peptide zones in the PPEC in comparison to similar HPTLC systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Female and male genetic effects on offspring paternity: additive genetic (co)variances in female extra-pair reproduction and male paternity success in song sparrows (Melospiza melodia).

PubMed

Reid, Jane M; Arcese, Peter; Keller, Lukas F; Losdat, Sylvain

2014-08-01

Ongoing evolution of polyandry, and consequent extra-pair reproduction in socially monogamous systems, is hypothesized to be facilitated by indirect selection stemming from cross-sex genetic covariances with components of male fitness. Specifically, polyandry is hypothesized to create positive genetic covariance with male paternity success due to inevitable assortative reproduction, driving ongoing coevolution. However, it remains unclear whether such covariances could or do emerge within complex polyandrous systems. First, we illustrate that genetic covariances between female extra-pair reproduction and male within-pair paternity success might be constrained in socially monogamous systems where female and male additive genetic effects can have opposing impacts on the paternity of jointly reared offspring. Second, we demonstrate nonzero additive genetic variance in female liability for extra-pair reproduction and male liability for within-pair paternity success, modeled as direct and associative genetic effects on offspring paternity, respectively, in free-living song sparrows (Melospiza melodia). The posterior mean additive genetic covariance between these liabilities was slightly positive, but the credible interval was wide and overlapped zero. Therefore, although substantial total additive genetic variance exists, the hypothesis that ongoing evolution of female extra-pair reproduction is facilitated by genetic covariance with male within-pair paternity success cannot yet be definitively supported or rejected either conceptually or empirically. © 2014 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

Configurations of base-pair complexes in solutions. [nucleotide chemistry

NASA Technical Reports Server (NTRS)

Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

1978-01-01

A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

PubMed

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

PubMed

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

An efficient and near linear scaling pair natural orbital based local coupled cluster method.

PubMed

Riplinger, Christoph; Neese, Frank

2013-01-21

In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on

Design and Applications of Noncanonical DNA Base Pairs.

PubMed

Jissy, A K; Datta, Ayan

2014-01-02

While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

Genetic covariance between components of male reproductive success: within-pair vs. extra-pair paternity in song sparrows

PubMed Central

Reid, J M; Arcese, P; Losdat, S

2014-01-01

The evolutionary trajectories of reproductive systems, including both male and female multiple mating and hence polygyny and polyandry, are expected to depend on the additive genetic variances and covariances in and among components of male reproductive success achieved through different reproductive tactics. However, genetic covariances among key components of male reproductive success have not been estimated in wild populations. We used comprehensive paternity data from socially monogamous but genetically polygynandrous song sparrows (Melospiza melodia) to estimate additive genetic variance and covariance in the total number of offspring a male sired per year outside his social pairings (i.e. his total extra-pair reproductive success achieved through multiple mating) and his liability to sire offspring produced by his socially paired female (i.e. his success in defending within-pair paternity). Both components of male fitness showed nonzero additive genetic variance, and the estimated genetic covariance was positive, implying that males with high additive genetic value for extra-pair reproduction also have high additive genetic propensity to sire their socially paired female's offspring. There was consequently no evidence of a genetic or phenotypic trade-off between male within-pair paternity success and extra-pair reproductive success. Such positive genetic covariance might be expected to facilitate ongoing evolution of polygyny and could also shape the ongoing evolution of polyandry through indirect selection. PMID:25186454

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

PubMed

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

PubMed Central

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

PubMed Central

Yusupov, Marat; Yusupova, Gulnara

2014-01-01

The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

PubMed Central

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eliav, E.; Kaldor, U.; Ishikawa, Y.

1994-12-31

Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

PubMed Central

Lee, Alex H. F.; Kool, Eric T.

2008-01-01

A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

Multi-user distribution of polarization entangled photon pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trapateau, J.; Orieux, A.; Diamanti, E.

We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

PubMed

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

PubMed

Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

2016-02-22

We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

PubMed

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

PubMed

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

PubMed Central

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

DOE PAGES

Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

2015-02-27

The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

PubMed Central

Been, M D; Perrotta, A T

1995-01-01

A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Synthesis, base pairing and structure studies of geranylated RNA

PubMed Central

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-01-01

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

PubMed

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Orbital-selective pairing and superconductivity in iron selenides

NASA Astrophysics Data System (ADS)

Nica, Emilian M.; Yu, Rong; Si, Qimiao

2017-12-01

An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE PAGES

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-02

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

PubMed

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

Free-energy based pair-additive potentials for bulk Ni-Al systems: Application to study Ni-Al reactive alloying

NASA Astrophysics Data System (ADS)

Izvekov, Sergei; Rice, Betsy M.

2012-09-01

We present new numerical pair-additive Al, Ni, and Al-Ni potentials by force-matching (FM) ionic force and virial data from single (bulk liquid) phase ab initio molecular dynamics (MD) simulations using the Born-Oppenheimer method. The potentials are represented by piece-wise functions (splines) and, therefore, are not constrained to a particular choice of analytical functional form. The FM method with virial constraint naturally yields a potential which maps out the ionic free-energy surface of the reference ensemble. To further improve the free energetics of the FM ensemble, the FM procedure is modified to bias the potentials to reproduce the experimental melting temperatures of the reference (FCC-Al, FCC-Ni, B2-NiAl) phases, the only macroscopic data included in the fitting set. The performance of the resultant potentials in simulating bulk metallic phases is then evaluated. The new model is applied to perform MD simulations of self-propagating exothermic reaction in Ni-Al bilayers at P = 0-5 GPa initiated at T = 1300 K. Consistent with experimental observations, the new model describes realistically a sequence of peritectic phase transformations throughout the reaction and at a realistic rate. The reaction proceeds through interlayer diffusion of Al and Ni atoms at the interface with formation of B2-NiAl in the Al melt. Such material responses have, in the past, been proven to be difficult to observe with then-existing potentials.

Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

PubMed

Li, Hai; Zhao, Yuan Yuan

2017-11-22

In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

PubMed

Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

2004-05-01

In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

Synthesis, base pairing and structure studies of geranylated RNA.

PubMed

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-07-27

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

DTIC Science & Technology

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Majorana edge States in atomic wires coupled by pair hopping.

PubMed

Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

2013-10-25

We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

ERIC Educational Resources Information Center

Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

2012-01-01

In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

PubMed

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Pair-correlations in swimmer suspensions

NASA Astrophysics Data System (ADS)

Nambiar, Sankalp; Subramanian, Ganesh

2017-11-01

Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r << L to a far-field decay of O(1/r2) for r >> L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

Pair production of scalar dyons in Kerr-Newman black holes

NASA Astrophysics Data System (ADS)

Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi

2018-06-01

We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

PubMed Central

2018-01-01

Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

ERIC Educational Resources Information Center

Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

2010-01-01

This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

2003-01-01

The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

Practical sliced configuration spaces for curved planar pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sacks, E.

1999-01-01

In this article, the author presents a practical configuration-space computation algorithm for pairs of curved planar parts, based on the general algorithm developed by Bajaj and the author. The general algorithm advances the theoretical understanding of configuration-space computation, but is too slow and fragile for some applications. The new algorithm solves these problems by restricting the analysis to parts bounded by line segments and circular arcs, whereas the general algorithm handles rational parametric curves. The trade-off is worthwhile, because the restricted class handles most robotics and mechanical engineering applications. The algorithm reduces run time by a factor of 60 onmore » nine representative engineering pairs, and by a factor of 9 on two human-knee pairs. It also handles common special pairs by specialized methods. A survey of 2,500 mechanisms shows that these methods cover 90% of pairs and yield an additional factor of 10 reduction in average run time. The theme of this article is that application requirements, as well as intrinsic theoretical interest, should drive configuration-space research.« less

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Time series regression-based pairs trading in the Korean equities market

NASA Astrophysics Data System (ADS)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

PubMed

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

PubMed

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

AUCTSP: an improved biomarker gene pair class predictor.

PubMed

Kagaris, Dimitri; Khamesipour, Alireza; Yiannoutsos, Constantin T

2018-06-26

The Top Scoring Pair (TSP) classifier, based on the concept of relative ranking reversals in the expressions of pairs of genes, has been proposed as a simple, accurate, and easily interpretable decision rule for classification and class prediction of gene expression profiles. The idea that differences in gene expression ranking are associated with presence or absence of disease is compelling and has strong biological plausibility. Nevertheless, the TSP formulation ignores significant available information which can improve classification accuracy and is vulnerable to selecting genes which do not have differential expression in the two conditions ("pivot" genes). We introduce the AUCTSP classifier as an alternative rank-based estimator of the magnitude of the ranking reversals involved in the original TSP. The proposed estimator is based on the Area Under the Receiver Operating Characteristic (ROC) Curve (AUC) and as such, takes into account the separation of the entire distribution of gene expression levels in gene pairs under the conditions considered, as opposed to comparing gene rankings within individual subjects as in the original TSP formulation. Through extensive simulations and case studies involving classification in ovarian, leukemia, colon, breast and prostate cancers and diffuse large b-cell lymphoma, we show the superiority of the proposed approach in terms of improving classification accuracy, avoiding overfitting and being less prone to selecting non-informative (pivot) genes. The proposed AUCTSP is a simple yet reliable and robust rank-based classifier for gene expression classification. While the AUCTSP works by the same principle as TSP, its ability to determine the top scoring gene pair based on the relative rankings of two marker genes across all subjects as opposed to each individual subject results in significant performance gains in classification accuracy. In addition, the proposed method tends to avoid selection of non-informative (pivot

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

PubMed

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

PubMed Central

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

PubMed

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs

NASA Astrophysics Data System (ADS)

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

Two monozygotic twin pairs discordant for female-to-male transsexualism.

PubMed

Segal, Nancy L

2006-06-01

Two monozygotic female twin pairs discordant for transsexualism are described. These reports double the number of such case studies in the current scientific literature. Interviews with the twins and their families indicated that unusual medical and life history factors did not play causal roles. However, inspection of medical records for one transsexual twin suggested that some early life experiences may have exacerbated tendencies toward male gender identification. In both pairs, the twins' gender identity differences emerged early, consistent with, but not proof of, co-twin differences in prenatal hormonal influences. The identification of additional discordant MZ female twin pairs can advance biological and psychological understanding of transsexualism. Suggestions for future research, based upon findings from these two twin pairs and from studies of female-to-male transsexuals, are provided.

Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

NASA Astrophysics Data System (ADS)

Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

2014-02-01

The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

PubMed

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

PubMed

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

Using Pair Programming to Teach CAD Based Engineering Graphics

ERIC Educational Resources Information Center

Leland, Robert P.

2010-01-01

Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

PubMed

Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

2018-04-01

Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library

PubMed Central

Adler, Adam S.; Bedinger, Daniel; Adams, Matthew S.; Asensio, Michael A.; Edgar, Robert C.; Leong, Renee; Leong, Jackson; Mizrahi, Rena A.; Spindler, Matthew J.; Bandi, Srinivasa Rao; Huang, Haichun; Brams, Peter; Johnson, David S.

2018-01-01

ABSTRACT Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of “randomly paired” scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs. PMID:29376776

Experimental extraction of an entangled photon pair from two identically decohered pairs.

PubMed

Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

2003-01-23

Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

Life detection using glucose and tetrasaccharide enantiomer pairs.

PubMed

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

NASA Astrophysics Data System (ADS)

Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

Gut microbiomes of Malawian twin pairs discordant for kwashiorkor

PubMed Central

Smith, Michelle I.; Yatsunenko, Tanya; Manary, Mark J.; Trehan, Indi; Mkakosya, Rajhab; Cheng, Jiye; Kau, Andrew L.; Rich, Stephen S.; Concannon, Patrick; Mychaleckyj, Josyf C.; Liu, Jie; Houpt, Eric; Li, Jia V.; Holmes, Elaine; Nicholson, Jeremy; Knights, Dan; Ursell, Luke K.; Knight, Rob; Gordon, Jeffrey I.

2013-01-01

Kwashiorkor, an enigmatic form of severe acute malnutrition, is the consequence of inadequate nutrient intake plus additional environmental insults. To investigate the role of the gut microbiome, we studied 317 Malawian twin pairs during the first 3 years of life. During this time, half of the twin pairs remained well-nourished, while 43% became discordant and 7% manifested concordance for acute malnutrition. Both children in twin pairs discordant for kwashiorkor were treated with a peanut-based, ready-to-use therapeutic food (RUTF). Time-series metagenomic studies revealed that RUTF produced a transient maturation of metabolic functions in kwashiorkor microbiomes that regressed when RUTF was stopped. Previously frozen fecal communities from several discordant pairs were each transplanted into gnotobiotic mice. The combination of Malawian diet and kwashiorkor microbiome produced marked weight loss in recipient mice, accompanied by perturbations in amino acid, carbohydrate and intermediary metabolism that were only transiently ameliorated with RUTF. These findings implicate the gut microbiome as a causal factor in kwashiorkor. PMID:23363771

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

PubMed

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

The influence of arene-ring size on stacking interaction with canonical base pairs

NASA Astrophysics Data System (ADS)

Formánek, Martin; Burda, Jaroslav V.

2014-04-01

Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

PubMed

Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

2015-11-30

In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2002-01-01

(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

PubMed Central

Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

2015-01-01

The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

Binary Star Orbits. IV. Orbits of 18 Southern Interferometric Pairs

NASA Astrophysics Data System (ADS)

Mason, Brian D.; Hartkopf, William I.; Tokovinin, Andrei

2010-09-01

First orbits are presented for 3 interferometric pairs and revised solutions for 15 others, based in part on first results from a recently initiated program of speckle interferometric observations of neglected southern binaries. Eight of these systems contain additional components, with multiplicity ranging up to 6.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

PubMed

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

PubMed Central

2004-01-01

With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests

Interplay between alkyl chain asymmetry and cholesterol addition in the rigid ion pair amphiphile bilayer systems

NASA Astrophysics Data System (ADS)

Huang, Fong-yin; Chiu, Chi-cheng

2017-01-01

Ion pair amphiphile (IPA), a molecular complex composed of a pair of cationic and anionic surfactants, has been proposed as a novel phospholipid substitute. Controlling the physical stability of IPA vesicles is important for its application developments such as cosmetic and drug deliveries. To investigate the effects of IPA alkyl chain combinations and the cholesterol additive on the structural and mechanical properties of IPA vesicular bilayers, we conducted a series of molecular dynamics studies on the hexadecyltrimethylammonium-dodecylsulfate (HTMA-DS) and dodecyltrimethylammonium-hexadecylsulfate (DTMA-HS) IPA bilayers with cholesterol. We found that both IPA bilayers are in the gel phase at 298 K, consistent with experimental observations. Compared with the HTMA-DS system, the DTMA-HS bilayer has more disordered alkyl chains in the hydrophobic region. When adding cholesterol, it induces alkyl chain ordering around its rigid sterol ring. Yet, cholesterol increases the molecular areas for all species and disturbs the molecular packing near the hydrophilic region and the bilayer core. Cholesterol also promotes the alkyl chain mismatch between the IPA moieties, especially for the DTMA-HS bilayer. The combined effects lead to non-monotonically enhancement of the membrane mechanical moduli for both IPA-cholesterol systems. Furthermore, cholesterol can form H-bonds with the alkylsulfate and thus enhance the contribution of alkylsulfate to the overall mechanical moduli. Combined results provide valuable molecular insights into the roles of each IPA component and the cholesterol on modulating the IPA bilayer properties.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Imidazolium-based ionic liquids used as additives in the nanolubrication of silicon surfaces.

PubMed

Amorim, Patrícia M; Ferraria, Ana M; Colaço, Rogério; Branco, Luís C; Saramago, Benilde

2017-01-01

In recent years, with the development of micro/nanoelectromechanical systems (MEMS/NEMS), the demand for efficient lubricants of silicon surfaces intensified. Although the use of ionic liquids (ILs) as additives to base oils in the lubrication of steel/steel or other types of metal/ metal tribological pairs has been investigated, the number of studies involving Si is very low. In this work, we tested imidazolium-based ILs as additives to the base oil polyethylene glycol (PEG) to lubricate Si surfaces. The friction coefficients were measured in a nanotribometer. The viscosity of the PEG + IL mixtures as well as their contact angles on the Si surface were measured. The topography and chemical composition of the substrates surfaces were determined with atomic force microscopy (AFM) and X-ray photoelectron spectroscopy (XPS), respectively. Due to the hygroscopic properties of PEG, the first step was to assess the effect of the presence of water. Then, a series of ILs based on the cations 1-ethyl-3-methylimidazolium [EMIM], 1-butyl-3-methylimidazolium [BMIM], 1-ethyl-3-vinylimidazolium [EVIM], 1-(2-hydroxyethyl)-3-methylimidazolium [C 2 OHMIM] and 1-allyl-3-methylimidazolium [AMIM] combined with the anions dicyanamide [DCA], trifluoromethanesulfonate [TfO], and ethylsulfate [EtSO 4 ] were added to dry PEG. All additives (2 wt %) led to a decrease in friction coefficient as well as an increase in viscosity (with the exception of [AMIM][TfO]) and improved the Si wettability. The additives based on the anion [EtSO 4 ] exhibited the most promising tribological behavior, which was attributed to the strong interaction with the Si surface ensuring the formation of a stable surface layer, which hinders the contact between the sliding surfaces.

Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

NASA Astrophysics Data System (ADS)

Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

2018-03-01

In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

PubMed

Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

2004-12-01

Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

PubMed

Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

2014-08-15

We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

PubMed

Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

2011-12-01

We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

Heritability of female extra-pair paternity rate in song sparrows (Melospiza melodia)

PubMed Central

Reid, Jane M.; Arcese, Peter; Sardell, Rebecca J.; Keller, Lukas F.

2011-01-01

The forces driving the evolution of extra-pair reproduction in socially monogamous animals remain widely debated and unresolved. One key hypothesis is that female extra-pair reproduction evolves through indirect genetic benefits, reflecting increased additive genetic value of extra-pair offspring. Such evolution requires that a female's propensity to produce offspring that are sired by an extra-pair male is heritable. However, additive genetic variance and heritability in female extra-pair paternity (EPP) rate have not been quantified, precluding accurate estimation of the force of indirect selection. Sixteen years of comprehensive paternity and pedigree data from socially monogamous but genetically polygynandrous song sparrows (Melospiza melodia) showed significant additive genetic variance and heritability in the proportion of a female's offspring that was sired by an extra-pair male, constituting major components of the genetic architecture required for extra-pair reproduction to evolve through indirect additive genetic benefits. However, estimated heritabilities were moderately small (0.12 and 0.18 on the observed and underlying latent scales, respectively). The force of selection on extra-pair reproduction through indirect additive genetic benefits may consequently be relatively weak. However, the additive genetic variance and non-zero heritability observed in female EPP rate allow for multiple further genetic mechanisms to drive and constrain mating system evolution. PMID:20980302

The coevolution of long-term pair bonds and cooperation.

PubMed

Song, Z; Feldman, M W

2013-05-01

The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

PubMed

Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

PubMed

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sauter-Schwinger pair creation dynamically assisted by a plane wave

NASA Astrophysics Data System (ADS)

Torgrimsson, Greger; Schneider, Christian; Schützhold, Ralf

2018-05-01

We study electron-positron pair creation by a strong and constant electric field superimposed with a weaker transversal plane wave which is incident perpendicularly (or under some angle). Comparing the fully nonperturbative approach based on the world-line instanton method with a perturbative expansion into powers of the strength of the weaker plane wave, we find good agreement—provided that the latter is carried out to sufficiently high orders. As usual for the dynamically assisted Sauter-Schwinger effect, the additional plane wave induces an exponential enhancement of the pair-creation probability if the combined Keldysh parameter exceeds a certain threshold.

Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

PubMed Central

van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

1997-01-01

The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

NASA Astrophysics Data System (ADS)

Andreozzi, F.; Covello, A.; Gargano, A.; Ye, Liu Jian; Porrino, A.

1985-07-01

The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v=0, v=1, and v=2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states.

Imidazolium-based ionic liquids used as additives in the nanolubrication of silicon surfaces

PubMed Central

Amorim, Patrícia M; Ferraria, Ana M; Colaço, Rogério; Branco, Luís C

2017-01-01

In recent years, with the development of micro/nanoelectromechanical systems (MEMS/NEMS), the demand for efficient lubricants of silicon surfaces intensified. Although the use of ionic liquids (ILs) as additives to base oils in the lubrication of steel/steel or other types of metal/ metal tribological pairs has been investigated, the number of studies involving Si is very low. In this work, we tested imidazolium-based ILs as additives to the base oil polyethylene glycol (PEG) to lubricate Si surfaces. The friction coefficients were measured in a nanotribometer. The viscosity of the PEG + IL mixtures as well as their contact angles on the Si surface were measured. The topography and chemical composition of the substrates surfaces were determined with atomic force microscopy (AFM) and X-ray photoelectron spectroscopy (XPS), respectively. Due to the hygroscopic properties of PEG, the first step was to assess the effect of the presence of water. Then, a series of ILs based on the cations 1-ethyl-3-methylimidazolium [EMIM], 1-butyl-3-methylimidazolium [BMIM], 1-ethyl-3-vinylimidazolium [EVIM], 1-(2-hydroxyethyl)-3-methylimidazolium [C2OHMIM] and 1-allyl-3-methylimidazolium [AMIM] combined with the anions dicyanamide [DCA], trifluoromethanesulfonate [TfO], and ethylsulfate [EtSO4] were added to dry PEG. All additives (2 wt %) led to a decrease in friction coefficient as well as an increase in viscosity (with the exception of [AMIM][TfO]) and improved the Si wettability. The additives based on the anion [EtSO4] exhibited the most promising tribological behavior, which was attributed to the strong interaction with the Si surface ensuring the formation of a stable surface layer, which hinders the contact between the sliding surfaces. PMID:29046844

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

PubMed

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

Red cell storage in E-Sol 5 and Adsol additive solutions: paired comparison using mixed and non-mixed study designs.

PubMed

Radwanski, K; Thill, M; Min, K

2014-05-01

If transfusion of older stored red cells is found to negatively affect clinical outcome, one possible alternative to shortened outdate is the use of new additive solutions (AS) that ameliorate the storage lesion. Erythro-Sol (E-Sol), a previously developed next-generation AS, has been reformulated into E-Sol 5, which is compatible with current anticoagulants and AS volumes. The effect of E-Sol 5 on red cells during storage compared to current AS has not been reported. Paired, ABO-matched whole-blood units were collected into CPD anticoagulant, pooled, split and processed into plasma and red cell units with either 110 ml of Adsol or 105 ml of E-Sol 5 within 8 h of collection. In Study 1, paired units in E-Sol 5 and Adsol were sampled on Day 0 and every 7 days up to Day 42 (n = 10). In Study 2, paired units in E-Sol 5 and Adsol were sampled only on Day 0 and Day 42 (n = 10). In Study 1, 2,3 DPG levels were maintained until Day 28 in E-Sol 5 units and Day 14 in Adsol units. ATP levels were higher in E-Sol 5 units until Day 21, after which they were comparable between the two groups. In both studies, metabolic activity was greater in E-Sol 5 units with respect to glucose consumption and lactate production. Morphology scores were higher, and haemolysis and microparticles generated were lower in E-Sol 5 vs. Adsol units. Weekly mixing of units lowered haemolysis and microparticle levels and increased potassium content on Day 42 in both additive solutions. Regardless of whether units are mixed weekly or are stored non-mixed, E-Sol 5 slows the progression of the red cell storage lesion and improves the overall in vitro quality of RBC throughout storage. © 2013 International Society of Blood Transfusion.

A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

PubMed

Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

2018-06-04

Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

PubMed

Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

2018-05-02

Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

To pair or not to pair: chromosome pairing and evolution.

PubMed

Moore, G

1998-04-01

Chromosome pairing in wild-type wheat closely resembles the process in both yeast and Drosophila. The recent characterisation of a mutant Ph1 wheat and the observation that chromosome pairing in the absence of Ph1 more closely resembles that of mammals and maize has shed light on the evolution of chromosome pairing in the cereals.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

Photoactive devices including porphyrinoids with coordinating additives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Forrest, Stephen R; Zimmerman, Jeramy; Yu, Eric K

Coordinating additives are included in porphyrinoid-based materials to promote intermolecular organization and improve one or more photoelectric characteristics of the materials. The coordinating additives are selected from fullerene compounds and organic compounds having free electron pairs. Combinations of different coordinating additives can be used to tailor the characteristic properties of such porphyrinoid-based materials, including porphyrin oligomers. Bidentate ligands are one type of coordinating additive that can form coordination bonds with a central metal ion of two different porphyrinoid compounds to promote porphyrinoid alignment and/or pi-stacking. The coordinating additives can shift the absorption spectrum of a photoactive material toward higher wavelengths,more » increase the external quantum efficiency of the material, or both.« less

Improving strand pairing prediction through exploring folding cooperativity

PubMed Central

Jeong, Jieun; Berman, Piotr; Przytycka, Teresa M.

2008-01-01

The topology of β-sheets is defined by the pattern of hydrogen-bonded strand pairing. Therefore, predicting hydrogen bonded strand partners is a fundamental step towards predicting β-sheet topology. At the same time, finding the correct partners is very difficult due to long range interactions involved in strand pairing. Additionally, patterns of aminoacids observed in β-sheet formations are very general and therefore difficult to use for computational recognition of specific contacts between strands. In this work, we report a new strand pairing algorithm. To address above mentioned difficulties, our algorithm attempts to mimic elements of the folding process. Namely, in addition to ensuring that the predicted hydrogen bonded strand pairs satisfy basic global consistency constraints, it takes into account hypothetical folding pathways. Consistently with this view, introducing hydrogen bonds between a pair of strands changes the probabilities of forming hydrogen bonds between other pairs of strand. We demonstrate that this approach provides an improvement over previously proposed algorithms. We also compare the performance of this method to that of a global optimization algorithm that poses the problem as integer linear programming optimization problem and solves it using ILOG CPLEX™ package. PMID:18989036

The effect of relations in paired-associate learning.

PubMed

Wilton, Richard N

2006-02-01

Previous studies have shown that the cued recall of paired associates is greater when one member of a pair has been apprehended as lying on the other member, as compared with the two having been apprehended as independent objects. The effect occurs when the objects have been perceived, imagined, or described in the relevant relationship. The additional thoughts hypothesis postulates that participants have more spontaneous "additional thoughts" when apprehending a pair in the relational condition. These may provide additional retrieval routes, thereby explaining the effect. In four experiments, the hypothesis was tested under conditions in which a clear unambiguous definition could be specified for an additional thought. The results showed that the greater recall in an "on" condition, as compared with an independent condition, occurs at least in part because more additional thoughts occur in the "on" condition. There was no evidence for any other contribution to the effect. It is argued that the findings question whether relations between objects play a fundamental role in the structure of memory.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

The Quasar Pairs Environment At z ∼ 0.5

NASA Astrophysics Data System (ADS)

Sandrinelli, Angela; Falomo, R.; Treves, A.; Scarpa, R.; Uslenghi, M.

2016-10-01

We analyze the environment of a sample of 20 quasar physical pairs at 0.4pairs as derived from SDSS imaging data is compared with a larger sample of isolated QSO matched in terms of redshift and luminosityFrom the comparison of the two samples we find the the galaxy density at 250 kpc from the QSO that are in pairs is about a factor 2 larger than that of isolated QSO. In addition we also complement these imaging study with high quality optical spectroscopy gathered at GTC in La Palma to get info on the dynamic of the systemsImplications of these results based on a small (but "complete") sample are briefly discussed.

Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

PubMed

Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

2007-02-15

Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

PubMed Central

Triman, K L

1995-01-01

Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

β-Amino acid catalyzed asymmetric Michael additions: design of organocatalysts with catalytic acid/base dyad inspired by serine proteases.

PubMed

Yang, Hui; Wong, Ming Wah

2011-09-16

A new type of chiral β-amino acid catalyst has been computationally designed, mimicking the enzyme catalysis of serine proteases. Our catalyst approach is based on the bioinspired catalytic acid/base dyad, namely, a carboxyl and imidazole pair. DFT calculations predict that this designed organocatalyst catalyzes Michael additions of aldehydes to nitroalkenes with excellent enantioselectivities and remarkably high anti diastereoselectivities. The unusual stacked geometry of the enamine intermediate, hydrogen bonding network, and the adoption of an exo transition state are the keys to understand the stereoselectivity. © 2011 American Chemical Society

Array-Based Discovery of Aptamer Pairs

DTIC Science & Technology

2014-12-11

affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND

Dark-bright soliton pairs in nonlocal nonlinear media.

PubMed

Lin, Yuan Yao; Lee, Ray-Kuang

2007-07-09

We study the formation of dark-bright vector soliton pairs in nonlocal Kerr-type nonlinear medium. We show, by analytical analysis and direct numerical calculation, that in addition to stabilize of vector soliton pairs nonlocal nonlinearity also helps to reduce the threshold power for forming a guided bright soliton. With help of the nonlocality, it is expected that the observation of dark-bright vector soliton pairs in experiments becomes more workable.

A terrain-based paired-site sampling design to assess biodiversity losses from eastern hemlock decline

USGS Publications Warehouse

Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.

2002-01-01

Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

NASA Astrophysics Data System (ADS)

Brancolini, Giorgia; Di Felice, Rosa

2011-05-01

Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

PubMed Central

2011-01-01

Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

Paired Reading: Evaluation Report and Executive Summary

ERIC Educational Resources Information Center

Lloyd, Cheryl; Edovald, Triin; Kiss, Zsolt; Morris, Stephen; Skipp, Amy; Ahmed, Hashim

2015-01-01

Paired Reading is a peer tutoring programme in secondary schools which trains teachers to support and encourage the regular tutoring of Year 7 pupils (aged 11-12 years) by Year 9 pupils (aged 13-14 years). The Paired Reading programme aims to improve pupils' general literacy in addition to speaking and listening skills. This is achieved by pupils…

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

PubMed

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

PubMed

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

NASA Astrophysics Data System (ADS)

Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

2018-05-01

We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

Detection of figure and caption pairs based on disorder measurements

NASA Astrophysics Data System (ADS)

Faure, Claudie; Vincent, Nicole

2010-01-01

Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

NASA Astrophysics Data System (ADS)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

NASA Astrophysics Data System (ADS)

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-01

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

Electron pairing without superconductivity

NASA Astrophysics Data System (ADS)

Levy, Jeremy

Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

Prospective very young asteroid pairs

NASA Astrophysics Data System (ADS)

Galád, A.; Vokrouhlický, D.; Zizka, J.

2014-07-01

Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

PubMed

Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

2018-04-27

Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

A novel hazard assessment method for biomass gasification stations based on extended set pair analysis

PubMed Central

Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

2017-01-01

Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011

A likelihood-based approach for assessment of extra-pair paternity and conspecific brood parasitism in natural populations

USGS Publications Warehouse

Lemons, Patrick R.; Marshall, T.C.; McCloskey, Sarah E.; Sethi, S.A.; Schmutz, Joel A.; Sedinger, James S.

2015-01-01

Genotypes are frequently used to assess alternative reproductive strategies such as extra-pair paternity and conspecific brood parasitism in wild populations. However, such analyses are vulnerable to genotyping error or molecular artifacts that can bias results. For example, when using multilocus microsatellite data, a mismatch at a single locus, suggesting the offspring was not directly related to its putative parents, can occur quite commonly even when the offspring is truly related. Some recent studies have advocated an ad-hoc rule that offspring must differ at more than one locus in order to conclude that they are not directly related. While this reduces the frequency with which true offspring are identified as not directly related young, it also introduces bias in the opposite direction, wherein not directly related young are categorized as true offspring. More importantly, it ignores the additional information on allele frequencies which would reduce overall bias. In this study, we present a novel technique for assessing extra-pair paternity and conspecific brood parasitism using a likelihood-based approach in a new version of program cervus. We test the suitability of the technique by applying it to a simulated data set and then present an example to demonstrate its influence on the estimation of alternative reproductive strategies.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

Capturing the radical ion-pair intermediate in DNA guanine oxidation

PubMed Central

Jie, Jialong; Liu, Kunhui; Wu, Lidan; Zhao, Hongmei; Song, Di; Su, Hongmei

2017-01-01

Although the radical ion pair has been frequently invoked as a key intermediate in DNA oxidative damage reactions and photoinduced electron transfer processes, the unambiguous detection and characterization of this species remain formidable and unresolved due to its extremely unstable nature and low concentration. We use the strategy that, at cryogenic temperatures, the transient species could be sufficiently stabilized to be detectable spectroscopically. By coupling the two techniques (the cryogenic stabilization and the time-resolved laser flash photolysis spectroscopy) together, we are able to capture the ion-pair transient G+•⋯Cl− in the chlorine radical–initiated DNA guanine (G) oxidation reaction, and provide direct evidence to ascertain the intricate type of addition/charge separation mechanism underlying guanine oxidation. The unique spectral signature of the radical ion-pair G+•⋯Cl− is identified, revealing a markedly intense absorption feature peaking at 570 nm that is distinctive from G+• alone. Moreover, the ion-pair spectrum is found to be highly sensitive to the protonation equilibria within guanine-cytosine base pair (G:C), which splits into two resolved bands at 480 and 610 nm as the acidic proton transfers along the central hydrogen bond from G+• to C. We thus use this exquisite sensitivity to track the intrabase-pair proton transfer dynamics in the double-stranded DNA oligonucleotides, which is of critical importance for the description of the proton-coupled charge transfer mechanisms in DNA. PMID:28630924

Anti-wear additive derived from soybean oil and boron utilized in a gear oil formulation

USDA-ARS?s Scientific Manuscript database

The synthesis of lubricant additives based on boron and epoxidized soybean oil are presented. These additives are made from a simple patent pending method involving a ring opening reaction and addition of the borate. A pair of different additives were tested in soybean oil, polyalpha olefin basestoc...

Enhancing Specific Energy and Power in Asymmetric Supercapacitors - A Synergetic Strategy based on the Use of Redox Additive Electrolytes

PubMed Central

Singh, Arvinder; Chandra, Amreesh

2016-01-01

The strategy of using redox additive electrolyte in combination with multiwall carbon nanotubes/metal oxide composites leads to a substantial improvements in the specific energy and power of asymmetric supercapacitors (ASCs). When the pure electrolyte is optimally modified with a redox additive viz., KI, ~105% increase in the specific energy is obtained with good cyclic stability over 3,000 charge-discharge cycles and ~14.7% capacitance fade. This increase is a direct consequence of the iodine/iodide redox pairs that strongly modifies the faradaic and non-faradaic type reactions occurring on the surface of the electrodes. Contrary to what is shown in few earlier reports, it is established that indiscriminate increase in the concentration of redox additives will leads to performance loss. Suitable explanations are given based on theoretical laws. The specific energy or power values being reported in the fabricated ASCs are comparable or higher than those reported in ASCs based on toxic acetonitrile or expensive ionic liquids. The paper shows that the use of redox additive is economically favorable strategy for obtaining cost effective and environmentally friendly ASCs. PMID:27184260

The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

PubMed Central

Przybilski, Rita; Hammann, Christian

2007-01-01

Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

Parietal lobe critically supports successful paired immediate and single-item delayed memory for targets.

PubMed

Krumm, Sabine; Kivisaari, Sasa L; Monsch, Andreas U; Reinhardt, Julia; Ulmer, Stephan; Stippich, Christoph; Kressig, Reto W; Taylor, Kirsten I

2017-05-01

The parietal lobe is important for successful recognition memory, but its role is not yet fully understood. We investigated the parietal lobes' contribution to immediate paired-associate memory and delayed item-recognition memory separately for hits (targets) and correct rejections (distractors). We compared the behavioral performance of 56 patients with known parietal and medial temporal lobe dysfunction (i.e. early Alzheimer's Disease) to 56 healthy control participants in an immediate paired and delayed single item object memory task. Additionally, we performed voxel-based morphometry analyses to investigate the functional-neuroanatomic relationships between performance and voxel-based estimates of atrophy in whole-brain analyses. Behaviorally, all participants performed better identifying targets than rejecting distractors. The voxel-based morphometry analyses associated atrophy in the right ventral parietal cortex with fewer correct responses to familiar items (i.e. hits) in the immediate and delayed conditions. Additionally, medial temporal lobe integrity correlated with better performance in rejecting distractors, but not in identifying targets, in the immediate paired-associate task. Our findings suggest that the parietal lobe critically supports successful immediate and delayed target recognition memory, and that the ventral aspect of the parietal cortex and the medial temporal lobe may have complementary preferences for identifying targets and rejecting distractors, respectively, during recognition memory. Copyright © 2017. Published by Elsevier Inc.

High quality image-pair-based deblurring method using edge mask and improved residual deconvolution

NASA Astrophysics Data System (ADS)

Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting

2017-04-01

Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

PubMed

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-05

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

PubMed

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

PubMed

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

PubMed

Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

2017-09-01

Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

A model for 3:2 HFQPO pairs in black hole binaries based on cosmic battery

NASA Astrophysics Data System (ADS)

Huang, Chang-Yin; Ye, Yong-Chun; Wang, Ding-Xiong; Li, Yang

2016-04-01

A model for 3:2 high-frequency quasi-periodic oscillations (HFQPOs) with 3:2 pairs observed in four black hole X-ray binaries (BHXBs) is proposed by invoking the epicyclic resonances with the magnetic connection (MC) between a spinning black hole (BH) with a relativistic accretion disc. It turns out that the MC can be worked out due to Poynting-Robertson cosmic battery, and the 3:2 HFQPO pairs associated with the steep power-law states can be fitted in this model. Furthermore, the severe damping problem in the epicyclic resonance model can be overcome by transferring energy from the BH to the inner disc via the MC process for emitting X-rays with sufficient amplitude and coherence to produce the HFQPOs. In addition, we discuss the important role of the magnetic field in state transition of BHXBs.

Exploiting Bounded Signal Flow for Graph Orientation Based on Cause-Effect Pairs

NASA Astrophysics Data System (ADS)

Dorn, Britta; Hüffner, Falk; Krüger, Dominikus; Niedermeier, Rolf; Uhlmann, Johannes

We consider the following problem: Given an undirected network and a set of sender-receiver pairs, direct all edges such that the maximum number of "signal flows" defined by the pairs can be routed respecting edge directions. This problem has applications in communication networks and in understanding protein interaction based cell regulation mechanisms. Since this problem is NP-hard, research so far concentrated on polynomial-time approximation algorithms and tractable special cases. We take the viewpoint of parameterized algorithmics and examine several parameters related to the maximum signal flow over vertices or edges. We provide several fixed-parameter tractability results, and in one case a sharp complexity dichotomy between a linear-time solvable case and a slightly more general NP-hard case. We examine the value of these parameters for several real-world network instances. For many relevant cases, the NP-hard problem can be solved to optimality. In this way, parameterized analysis yields both deeper insight into the computational complexity and practical solving strategies.

Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

PubMed

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Pick a Pair. Pancake Pairs

ERIC Educational Resources Information Center

Miller, Pat

2005-01-01

Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

PubMed

Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

2018-04-18

Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

PubMed Central

Cotton, R G; Rodrigues, N R; Campbell, R D

1988-01-01

The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

Centromere pairing precedes meiotic chromosome pairing in plants.

PubMed

Zhang, Jing; Han, Fangpu

2017-11-01

Meiosis is a specialized eukaryotic cell division, in which diploid cells undergo a single round of DNA replication and two rounds of nuclear division to produce haploid gametes. In most eukaryotes, the core events of meiotic prophase I are chromosomal pairing, synapsis and recombination. To ensure accurate chromosomal segregation, homologs have to identify and align along each other at the onset of meiosis. Although much progress has been made in elucidating meiotic processes, information on the mechanisms underlying chromosome pairing is limited in contrast to the meiotic recombination and synapsis events. Recent research in many organisms indicated that centromere interactions during early meiotic prophase facilitate homologous chromosome pairing, and functional centromere is a prerequisite for centromere pairing such as in maize. Here, we summarize the recent achievements of chromosome pairing research on plants and other organisms, and outline centromere interactions, nuclear chromosome orientation, and meiotic cohesin, as main determinants of chromosome pairing in early meiotic prophase.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

PubMed

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

PubMed Central

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

NASA Astrophysics Data System (ADS)

Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

2017-07-01

Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

PubMed

Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

2001-11-09

Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They

Pair Housing of Dairy Calves and Age at Pairing: Effects on Weaning Stress, Health, Production and Social Networks

PubMed Central

Mlynski, David T.; James, Richard; Croft, Darren P.

2017-01-01

The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual’s associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no

Pair Housing of Dairy Calves and Age at Pairing: Effects on Weaning Stress, Health, Production and Social Networks.

PubMed

Bolt, Sarah L; Boyland, Natasha K; Mlynski, David T; James, Richard; Croft, Darren P

2017-01-01

The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual's associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no

Experimental entangled photon pair generation using crystals with parallel optical axes

NASA Astrophysics Data System (ADS)

Villar, Aitor; Lohrmann, Alexander; Ling, Alexander

2018-05-01

We present an optical design where polarization-entangled photon pairs are generated within two $\\beta$-Barium Borate crystals whose optical axes are parallel. This design increases the spatial mode overlap of the emitted photon pairs enhancing single mode collection without the need for additional spatial walk-off compensators. The observed photon pair rate is at least 65000 pairs/s/mW with a quantum state fidelity of 99.53$\\pm$0.22% when pumped with an elliptical spatial profile.

A New Scheme for the Design of Hilbert Transform Pairs of Biorthogonal Wavelet Bases

NASA Astrophysics Data System (ADS)

Shi, Hongli; Luo, Shuqian

2010-12-01

In designing the Hilbert transform pairs of biorthogonal wavelet bases, it has been shown that the requirements of the equal-magnitude responses and the half-sample phase offset on the lowpass filters are the necessary and sufficient condition. In this paper, the relationship between the phase offset and the vanishing moment difference of biorthogonal scaling filters is derived, which implies a simple way to choose the vanishing moments so that the phase response requirement can be satisfied structurally. The magnitude response requirement is approximately achieved by a constrained optimization procedure, where the objective function and constraints are all expressed in terms of the auxiliary filters of scaling filters rather than the scaling filters directly. Generally, the calculation burden in the design implementation will be less than that of the current schemes. The integral of magnitude response difference between the primal and dual scaling filters has been chosen as the objective function, which expresses the magnitude response requirements in the whole frequency range. Two design examples illustrate that the biorthogonal wavelet bases designed by the proposed scheme are very close to Hilbert transform pairs.

Ionic micelles and aromatic additives: a closer look at the molecular packing parameter.

PubMed

Lutz-Bueno, Viviane; Isabettini, Stéphane; Walker, Franziska; Kuster, Simon; Liebi, Marianne; Fischer, Peter

2017-08-16

Wormlike micellar aggregates formed from the mixture of ionic surfactants with aromatic additives result in solutions with impressive viscoelastic properties. These properties are of high interest for numerous industrial applications and are often used as model systems for soft matter physics. However, robust and simple models for tailoring the viscoelastic response of the solution based on the molecular structure of the employed additive are required to fully exploit the potential of these systems. We address this shortcoming with a modified packing parameter based model, considering the additive-surfactant pair. The role of charge neutralization on anisotropic micellar growth was investigated with derivatives of sodium salicylate. The impact of the additives on the morphology of the micellar aggregates is explained from the molecular level to the macroscopic viscoelasticity. Changes in the micelle's volume, headgroup area and additive structure are explored to redefine the packing parameter. Uncharged additives penetrated deeper into the hydrophobic region of the micelle, whilst charged additives remained trapped in the polar region, as revealed by a combination of 1 H-NMR, SAXS and rheological measurements. A deeper penetration of the additives densified the hydrophobic core of the micelle and induced anisotropic growth by increasing the effective volume of the additive-surfactant pair. This phenomenon largely influenced the viscosity of the solutions. Partially penetrating additives reduced the electrostatic repulsions between surfactant headgroups and neighboring micelles. The resulting increased network density governed the elasticity of the solutions. Considering a packing parameter composed of the additive-surfactant pair proved to be a facile means of engineering the viscoelastic response of surfactant solutions. The self-assembly of the wormlike micellar aggregates could be tailored to desired morphologies resulting in a specific and predictable

Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

PubMed Central

Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

1987-01-01

We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

PubMed Central

Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

2015-01-01

2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

PubMed

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

An Intelligent Model for Pairs Trading Using Genetic Algorithms

PubMed Central

Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236

An Intelligent Model for Pairs Trading Using Genetic Algorithms.

PubMed

Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

Experimental entangled photon pair generation using crystals with parallel optical axes.

PubMed

Villar, Aitor; Lohrmann, Alexander; Ling, Alexander

2018-05-14

We present an optical design where polarization-entangled photon pairs are generated within two β-Barium Borate crystals whose optical axes are parallel. This design increases the spatial mode overlap of the emitted photon pairs enhancing single mode collection without the need for additional spatial walk-off compensators. The observed photon pair rate is at least 65 000 pairs/s/mW with a quantum state fidelity of 99.53 ± 0.22% when pumped with an elliptical spatial profile.

The Evolution and Expression Pattern of Human Overlapping lncRNA and Protein-coding Gene Pairs.

PubMed

Ning, Qianqian; Li, Yixue; Wang, Zhen; Zhou, Songwen; Sun, Hong; Yu, Guangjun

2017-03-27

Long non-coding RNA overlapping with protein-coding gene (lncRNA-coding pair) is a special type of overlapping genes. Protein-coding overlapping genes have been well studied and increasing attention has been paid to lncRNAs. By studying lncRNA-coding pairs in human genome, we showed that lncRNA-coding pairs were more likely to be generated by overprinting and retaining genes in lncRNA-coding pairs were given higher priority than non-overlapping genes. Besides, the preference of overlapping configurations preserved during evolution was based on the origin of lncRNA-coding pairs. Further investigations showed that lncRNAs promoting the splicing of their embedded protein-coding partners was a unilateral interaction, but the existence of overlapping partners improving the gene expression was bidirectional and the effect was decreased with the increased evolutionary age of genes. Additionally, the expression of lncRNA-coding pairs showed an overall positive correlation and the expression correlation was associated with their overlapping configurations, local genomic environment and evolutionary age of genes. Comparison of the expression correlation of lncRNA-coding pairs between normal and cancer samples found that the lineage-specific pairs including old protein-coding genes may play an important role in tumorigenesis. This work presents a systematically comprehensive understanding of the evolution and the expression pattern of human lncRNA-coding pairs.

Left-handed transmission in a simple cut-wire pair structure

NASA Astrophysics Data System (ADS)

Tung, Nguyen Thanh; Thuy, Vu Tran Thanh; Park, Jin Woo; Rhee, Joo Yull; Lee, YoungPak

2010-01-01

It is well known that, together with the plasma behavior of continuous wires, the use of cut-wire pair as a metamagnetic component is to drive the negative permeability in the left-handed combined structure. In this study, we have investigated a strange left-handed transmission in a metamaterial consisting of only conventional cut-wire pair structure without additional adjustment. It is shown that the observed left-handed behavior, which occurs at a frequency three times higher than that for the combined structure, originates from the fundamental negative permittivity provided by the symmetric resonant mode and a negative permeability by the third-order asymmetric resonance. Our results would simplify extremely the fabricating procedure, especially, for terahertz regime as well as reveal many possibilities to design optical devices based on the electromagnetic responses of cut-wire structure.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

PubMed

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Magnetic field homogeneity of a conical coaxial coil pair.

PubMed

Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Magnetic field homogeneity of a conical coaxial coil pair

NASA Astrophysics Data System (ADS)

Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

NASA Astrophysics Data System (ADS)

Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

2006-12-01

Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

PubMed

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

PubMed

Sawada, Tomohisa; Fujita, Makoto

2010-05-26

Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

Nonlocal Intuition: Replication and Paired-subjects Enhancement Effects

PubMed Central

Mirzaei, Maryam; Zali, Mohammad Reza

2014-01-01

This article reports the results of a study of repeat entrepreneurs in Tehran, Iran, in which nonlocal intuition was investigated in a replication and extension of experiment using measures of heart rate variability (HRV). Nonlocal intuition is the perception of information about a distant or future event by the body's psychophysiological systems, which is not based on reason or memories of prior experience. This study follows up on the McCraty, Radin, and Bradley studies, which found evidence of nonlocal intuition. We used Radin's experimental protocol, with the addition of HRV measures as in the McCraty studies involving computer administration of a random sequence of calm and emotional pictures as the stimulus, and conducted two experiments on mutually exclusive samples—the first on a group of single participants (N=15) and the second on a group of co-participant pairs (N=30)—to investigate the question of the “amplification” of intuition effects by social connection. Each experiment was conducted over 45 trials while heart rate rhythm activity was recorded continuously. Results, using random permutation analysis, a statistically conservative procedure, show significant pre-stimulus results—that is, for the period before the computer had randomly selected the picture stimulus—for both experiments. Moreover, while significant separation between the emotional and calm HRV curves was observed in the single-participant experiment, an even larger separation was apparent for the experiment on co-participant pairs; the difference between the two groups was also significant. Overall, the results of the single-participant experiment confirm previous finding: that electrophysiological measures, especially changes in the heart rhythm, can detect intuitive foreknowledge. This result is notable because it constitutes cross-cultural corroboration in a non-Western context—namely, Iran. In addition, the results for co-participant pairs offer new evidence on the

Magnetic properties and pairing tendencies of the iron-based superconducting ladder BaFe 2 S 3 : Combined ab initio and density matrix renormalization group study

DOE PAGES

Patel, Niravkumar D.; Nocera, Alberto; Alvarez, Gonzalo; ...

2016-08-10

The recent discovery of superconductivity under high pressure in the two-leg ladder compound BaFe 2S 3 [H. Takahashi et al., Nat. Mater. 14, 1008 (2015)] opens a broad avenue of research, because it represents the first report of pairing tendencies in a quasi-one-dimensional iron-based high-critical-temperature superconductor. Similarly, as in the case of the cuprates, ladders and chains can be far more accurately studied using many-body techniques and model Hamiltonians than their layered counterparts, particularly if several orbitals are active. In this publication, we derive a two-orbital Hubbard model from first principles that describes individual ladders of BaFe 2S 3. Themore » model is studied with the density matrix renormalization group. These first reported results are exciting for two reasons: (i) at half-filling, ferromagnetic order emerges as the dominant magnetic pattern along the rungs of the ladder, and antiferromagnetic order along the legs, in excellent agreement with neutron experiments; and (ii) with hole doping, pairs form in the strong coupling regime, as found by studying the binding energy of two holes doped on the half-filled system. In addition, orbital selective Mott phase characteristics develop with doping, with only oneWannier orbital receiving the hole carriers while the other remains half-filled. Lastly, these results suggest that the analysis of models for iron-based two-leg ladders could clarify the origin of pairing tendencies and other exotic properties of iron-based high-critical-temperature superconductors in general.« less

Estimation of Disability Weights in the General Population of South Korea Using a Paired Comparison

PubMed Central

Ock, Minsu; Ahn, Jeonghoon; Yoon, Seok-Jun; Jo, Min-Woo

2016-01-01

We estimated the disability weights in the South Korean population by using a paired comparison-only model wherein ‘full health’ and ‘being dead’ were included as anchor points, without resorting to a cardinal method, such as person trade-off. The study was conducted via 2 types of survey: a household survey involving computer-assisted face-to-face interviews and a web-based survey (similar to that of the GBD 2010 disability weight study). With regard to the valuation methods, paired comparison, visual analogue scale (VAS), and standard gamble (SG) were used in the household survey, whereas paired comparison and population health equivalence (PHE) were used in the web-based survey. Accordingly, we described a total of 258 health states, with ‘full health’ and ‘being dead’ designated as anchor points. In the analysis, 4 models were considered: a paired comparison-only model; hybrid model between paired comparison and PHE; VAS model; and SG model. A total of 2,728 and 3,188 individuals participated in the household and web-based survey, respectively. The Pearson correlation coefficients of the disability weights of health states between the GBD 2010 study and the current models were 0.802 for Model 2, 0.796 for Model 1, 0.681 for Model 3, and 0.574 for Model 4 (all P-values<0.001). The discrimination of values according to health state severity was most suitable in Model 1. Based on these results, the paired comparison-only model was selected as the best model for estimating disability weights in South Korea, and for maintaining simplicity in the analysis. Thus, disability weights can be more easily estimated by using paired comparison alone, with ‘full health’ and ‘being dead’ as one of the health states. As noted in our study, we believe that additional evidence regarding the universality of disability weight can be observed by using a simplified methodology of estimating disability weights. PMID:27606626

New Quantum Key Distribution Scheme Based on Random Hybrid Quantum Channel with EPR Pairs and GHZ States

NASA Astrophysics Data System (ADS)

Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run

2018-05-01

A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.

Water based drilling mud additive

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCrary, J.L.

1983-12-13

A water based fluid additive useful in drilling mud used during drilling of an oil or gas well is disclosed, produced by reacting water at temperatures between 210/sup 0/-280/sup 0/ F. with a mixture comprising in percent by weight: gilsonite 25-30%, tannin 7-15%, lignite 25-35%, sulfonating compound 15-25%, water soluble base compound 5-15%, methylene-yielding compound 1-5%, and then removing substantially all of the remaining water to produce a dried product.

Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

NASA Technical Reports Server (NTRS)

Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

2010-01-01

The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

PubMed Central

Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

2002-01-01

An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Galactic Pairs in the Early Universe

NASA Astrophysics Data System (ADS)

Kohler, Susanna

2018-02-01

,000 objects. They find that roughly 50 have a redshift of z 7, and 22 have a redshift of z 8. None of the galaxies at z 7 are in pairs, but the sample at z 8 includes three groups for which the distance between galaxies is less than 1 arcsecond.But are these three pairs actual merging galaxies?Conclusions from StatisticsTop: Gas density at z 7.7 in the authors simulation output. Bottom: Mock observations of this output withHubbles WFC3 (left) and JWSTs NIRCam (right). [Adapted from Chaikin et al. 2018]To answer this question, the authors next perform numerical simulations of galaxy formation and produce mock observations showing what the simulatedfield would look like in an equivalent deep Hubble exposure.Based on their simulation statistics, Chaikin and collaborators argue that the three pairs at z 8 do represent an unusually high merger fraction but projection coincidences or lensing are far less likely scenarios to account for all three pairs. If the three pairs are indeed all merging galaxies, it could indicate that this Hubble field corresponds to a local overdensity at a redshift of z 8.Looking AheadThe best way to improve on these measurements is to repeat this study with more advanced telescopes. Chaikin and collaborators demonstrate the superiority of the observations that the upcoming James Webb Space Telescope (JWST) will provide. They also point out the potential power of the Wide Field Infrared Survey Telescope (WFIRST) currently under threat under the proposed 2019 federal budget to extend the observational horizon well into the epoch of reionization.Continued studies backed by the power of these future telescopes are sure to discover a wealth of additional distant galactic duos, helping us to characterize the universe in its early stages.CitationEvgenii A. Chaikin et al 2018 ApJ 853 81. doi:10.3847/1538-4357/aaa196

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

PubMed Central

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

PubMed

Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

2017-04-03

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

PubMed Central

De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

2017-01-01

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

Large-scale extraction of accurate drug-disease treatment pairs from biomedical literature for drug repurposing

PubMed Central

2013-01-01

Background A large-scale, highly accurate, machine-understandable drug-disease treatment relationship knowledge base is important for computational approaches to drug repurposing. The large body of published biomedical research articles and clinical case reports available on MEDLINE is a rich source of FDA-approved drug-disease indication as well as drug-repurposing knowledge that is crucial for applying FDA-approved drugs for new diseases. However, much of this information is buried in free text and not captured in any existing databases. The goal of this study is to extract a large number of accurate drug-disease treatment pairs from published literature. Results In this study, we developed a simple but highly accurate pattern-learning approach to extract treatment-specific drug-disease pairs from 20 million biomedical abstracts available on MEDLINE. We extracted a total of 34,305 unique drug-disease treatment pairs, the majority of which are not included in existing structured databases. Our algorithm achieved a precision of 0.904 and a recall of 0.131 in extracting all pairs, and a precision of 0.904 and a recall of 0.842 in extracting frequent pairs. In addition, we have shown that the extracted pairs strongly correlate with both drug target genes and therapeutic classes, therefore may have high potential in drug discovery. Conclusions We demonstrated that our simple pattern-learning relationship extraction algorithm is able to accurately extract many drug-disease pairs from the free text of biomedical literature that are not captured in structured databases. The large-scale, accurate, machine-understandable drug-disease treatment knowledge base that is resultant of our study, in combination with pairs from structured databases, will have high potential in computational drug repurposing tasks. PMID:23742147

CPM Pairs from LSPM so Far Not WDS Listed – Part IV

NASA Astrophysics Data System (ADS)

Knapp, Wilfried; Nanson, John

2018-04-01

The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted – but as we found during research for our report "A New Concept for Counter-Checking of Assumed CPM Pairs" (Knapp and Nanson 2017), there are still many potential CPM pairs indicated in LSPM not listed in the WDS catalog. After our first three reports on about 100 such objects (Knapp and Nanson 2017 - CPM pairs from LSPM so far not WDS listed – Part I/II/III), this report with 30 additional potential common proper motion pairs is presented here.

Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

PubMed

Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

2018-06-22

Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

PubMed

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

Error-correcting pairs for a public-key cryptosystem

NASA Astrophysics Data System (ADS)

Pellikaan, Ruud; Márquez-Corbella, Irene

2017-06-01

Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

Prediction of missing common genes for disease pairs using network based module separation on incomplete human interactome.

PubMed

Akram, Pakeeza; Liao, Li

2017-12-06

Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

PubMed

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

PubMed

Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

2014-01-10

Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

Feasibility of ion-pair/supercritical fluid extraction of an ionic compound--pseudoephedrine hydrochloride.

PubMed

Eckard, P R; Taylor, L T

1997-02-01

The supercritical fluid extraction (SFE) of an ionic compound, pseudoephedrine hydrochloride, from a spiked-sand surface was successfully demonstrated. The effect of carbon dioxide density (CO2), supercritical fluid composition (pure vs. methanol modified), and the addition of a commonly used reversed-phase liquid chromatographic ion-pairing reagent, 1-heptanesulfonic acid, sodium salt, on extraction efficiency was examined. The extraction recoveries of pseudoephedrine hydrochloride with the addition of the ion-pairing reagent from a spiked-sand surface were shown to be statistically greater than the extraction recoveries without the ion-pairing reagent with both pure and methanol-modified carbon dioxide.

Chemoselective Polymerization of Polar Divinyl Monomers with Rare-Earth/Phosphine Lewis Pairs.

PubMed

Xu, Pengfei; Wu, Lei; Dong, Liqiu; Xu, Xin

2018-02-08

This work reports the chemoselective polymerization of polar divinyl monomers, including allyl methacrylate (AMA), vinyl methacrylate (VMA), and 4-vinylbenzyl methacrylate (VBMA), by using simple Lewis pairs comprised of homoleptic rare-earth (RE) aryloxide complexes RE(OAr)₃ (RE = Sc ( 1 ), Y ( 2 ), Sm ( 3 ), La ( 4 ), Ar = 2,6- t Bu₂C₆H₃) and phosphines PR₃ (R = Ph, Cy, Et, Me). Catalytic activities of polymerizations relied heavily upon the cooperation of Lewis acid and Lewis base components. The produced polymers were soluble in common organic solvents and often had a narrow molecular weight distribution. A highly syndiotactic poly(allyl methacrylate) (PAMA) with rr ~88% could be obtained by the scandium complex 1 /PEt₃ pair at -30 °C. In the case of poly(4-vinylbenzyl methacrylate) (PVBMA), it could be post-functionalized with PhCH₂SH. Mechanistic study, including the isolation of the zwitterionic active species and the end-group analysis, revealed that the frustrated Lewis pair (FLP)-type addition was the initiating step in the polymerization.

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

PubMed

McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

2014-04-01

Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base

PubMed Central

McCoy, Allison B.; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J.; Sittig, Dean F.

2014-01-01

Background Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. Objective We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. Approach We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Results Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of

An interatomic pair potential for cadmium selenide

NASA Astrophysics Data System (ADS)

Rabani, Eran

2002-01-01

We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.

Implementation of Complexity Analyzing Based on Additional Effect

NASA Astrophysics Data System (ADS)

Zhang, Peng; Li, Na; Liang, Yanhong; Liu, Fang

According to the Complexity Theory, there is complexity in the system when the functional requirement is not be satisfied. There are several study performances for Complexity Theory based on Axiomatic Design. However, they focus on reducing the complexity in their study and no one focus on method of analyzing the complexity in the system. Therefore, this paper put forth a method of analyzing the complexity which is sought to make up the deficiency of the researches. In order to discussing the method of analyzing the complexity based on additional effect, this paper put forth two concepts which are ideal effect and additional effect. The method of analyzing complexity based on additional effect combines Complexity Theory with Theory of Inventive Problem Solving (TRIZ). It is helpful for designers to analyze the complexity by using additional effect. A case study shows the application of the process.

Real-time spectral characterization of a photon pair source using a chirped supercontinuum seed.

PubMed

Erskine, Jennifer; England, Duncan; Kupchak, Connor; Sussman, Benjamin

2018-02-15

Photon pair sources have wide ranging applications in a variety of quantum photonic experiments and protocols. Many of these protocols require well controlled spectral correlations between the two output photons. However, due to low cross-sections, measuring the joint spectral properties of photon pair sources has historically been a challenging and time-consuming task. Here, we present an approach for the real-time measurement of the joint spectral properties of a fiber-based four wave mixing source. We seed the four wave mixing process using a broadband chirped pulse, studying the stimulated process to extract information regarding the spontaneous process. In addition, we compare stimulated emission measurements with the spontaneous process to confirm the technique's validity. Joint spectral measurements have taken many hours historically and several minutes with recent techniques. Here, measurements have been demonstrated in 5-30 s depending on resolution, offering substantial improvement. Additional benefits of this approach include flexible resolution, large measurement bandwidth, and reduced experimental overhead.

Adsorption of molecular additive onto lead halide perovskite surfaces: A computational study on Lewis base thiophene additive passivation

NASA Astrophysics Data System (ADS)

Zhang, Lei; Yu, Fengxi; Chen, Lihong; Li, Jingfa

2018-06-01

Organic additives, such as the Lewis base thiophene, have been successfully applied to passivate halide perovskite surfaces, improving the stability and properties of perovskite devices based on CH3NH3PbI3. Yet, the detailed nanostructure of the perovskite surface passivated by additives and the mechanisms of such passivation are not well understood. This study presents a nanoscopic view on the interfacial structure of an additive/perovskite interface, consisting of a Lewis base thiophene molecular additive and a lead halide perovskite surface substrate, providing insights on the mechanisms that molecular additives can passivate the halide perovskite surfaces and enhance the perovskite-based device performance. Molecular dynamics study on the interactions between water molecules and the perovskite surfaces passivated by the investigated additive reveal the effectiveness of employing the molecular additives to improve the stability of the halide perovskite materials. The additive/perovskite surface system is further probed via molecular engineering the perovskite surfaces. This study reveals the nanoscopic structure-property relationships of the halide perovskite surface passivated by molecular additives, which helps the fundamental understanding of the surface/interface engineering strategies for the development of halide perovskite based devices.

Concreteness and relational effects on recall of adjective-noun pairs.

PubMed

Paivio, A; Khan, M; Begg, I

2000-09-01

Extending previous research on the problem, we studied the effects of concreteness and relatedness of adjective-noun pairs on free recall, cued recall, and memory integration. Two experiments varied the attributes in paired associates lists or sentences. Consistent with predictions from dual coding theory and prior results with noun-noun pairs, both experiments showed that the effects of concreteness were strong and independent of relatedness in free recall and cued recall. The generally positive effects of relatedness were absent in the case of free recall of sentences. The two attributes also had independent (additive) effects on integrative memory as measured by conditionalized free recall of pairs. Integration as measured by the increment from free to cued recall occurred consistently only when pairs were high in both concreteness and relatedness. Explanations focused on dual coding and relational-distinctiveness processing theories as well as task variables that affect integration measures.

Pair Formation of Hard Core Bosons in Flat Band Systems

NASA Astrophysics Data System (ADS)

Mielke, Andreas

2018-05-01

Hard core bosons in a large class of one or two dimensional flat band systems have an upper critical density, below which the ground states can be described completely. At the critical density, the ground states are Wigner crystals. If one adds a particle to the system at the critical density, the ground state and the low lying multi particle states of the system can be described as a Wigner crystal with an additional pair of particles. The energy band for the pair is separated from the rest of the multi-particle spectrum. The proofs use a Gerschgorin type of argument for block diagonally dominant matrices. In certain one-dimensional or tree-like structures one can show that the pair is localised, for example in the chequerboard chain. For this one-dimensional system with periodic boundary condition the energy band for the pair is flat, the pair is localised.

Quasichemical analysis of the cluster-pair approximation for the thermodynamics of proton hydration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollard, Travis; Beck, Thomas L.; Department of Physics, University of Cincinnati, Cincinnati, Ohio 45221

2014-06-14

A theoretical analysis of the cluster-pair approximation (CPA) is presented based on the quasichemical theory of solutions. The sought single-ion hydration free energy of the proton includes an interfacial potential contribution by definition. It is shown, however, that the CPA involves an extra-thermodynamic assumption that does not guarantee uniform convergence to a bulk free energy value with increasing cluster size. A numerical test of the CPA is performed using the classical polarizable AMOEBA force field and supporting quantum chemical calculations. The enthalpy and free energy differences are computed for the kosmotropic Na{sup +}/F{sup −} ion pair in water clusters ofmore » size n = 5, 25, 105. Additional calculations are performed for the chaotropic Rb{sup +}/I{sup −} ion pair. A small shift in the proton hydration free energy and a larger shift in the hydration enthalpy, relative to the CPA values, are predicted based on the n = 105 simulations. The shifts arise from a combination of sequential hydration and interfacial potential effects. The AMOEBA and quantum chemical results suggest an electrochemical surface potential of water in the range −0.4 to −0.5 V. The physical content of single-ion free energies and implications for ion-water force field development are also discussed.« less

Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

NASA Astrophysics Data System (ADS)

Pinski, Peter; Neese, Frank

2018-01-01

Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

Entangled-Pair Transmission Improvement Using Distributed Phase-Sensitive Amplification

NASA Astrophysics Data System (ADS)

Agarwal, Anjali; Dailey, James M.; Toliver, Paul; Peters, Nicholas A.

2014-10-01

We demonstrate the transmission of time-bin entangled photon pairs through a distributed optical phase-sensitive amplifier (OPSA). We utilize four-wave mixing at telecom wavelengths in a 5-km dispersion-shifted fiber OPSA operating in the low-gain limit. Measurements of two-photon interference curves show no statistically significant degradation in the fringe visibility at the output of the OPSA. In addition, coincidence counting rates are higher than direct passive transmission because of constructive interference between amplitudes of input photon pairs and those generated in the OPSA. Our results suggest that application of distributed phase-sensitive amplification to transmission of entangled photon pairs could be highly beneficial towards advancing the rate and scalability of future quantum communications systems.

Polysulfide and bio-based EP additive performance in vegetable vs. paraffinic base oils

USDA-ARS?s Scientific Manuscript database

Twist compression test (TCT) and 4-ball extreme pressure (EP) methods were used to investigate commercial polysulfide (PS) and bio-based polyester (PE) EP additives in paraffinic (150N) and refined soybean (SOY) base oils of similar viscosity. Binary blends of EP additive and base oil were investiga...

The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

PubMed

Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

2013-10-01

The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

To pair or not to pair: Sources of social variability with white-faced saki monkeys (Pithecia pithecia) as a case study.

PubMed

Thompson, Cynthia L

2016-05-01

Intraspecific variability in social systems is gaining increased recognition in primatology. Many primate species display variability in pair-living social organizations through incorporating extra adults into the group. While numerous models exist to explain primate pair-living, our tools to assess how and why variation in this trait occurs are currently limited. Here I outline an approach which: (i) utilizes conceptual models to identify the selective forces driving pair-living; (ii) outlines novel possible causes for variability in social organization; and (iii) conducts a holistic species-level analysis of social behavior to determine the factors contributing to variation in pair-living. A case study on white-faced sakis (Pithecia pithecia) is used to exemplify this approach. This species lives in either male-female pairs or groups incorporating "extra" adult males and/or females. Various conceptual models of pair-living suggest that high same-sex aggression toward extra-group individuals is a key component of the white-faced saki social system. Variable pair-living in white-faced sakis likely represents alternative strategies to achieve competency in this competition, in which animals experience conflicting selection pressures between achieving successful group defense and maintaining sole reproductive access to mates. Additionally, independent decisions by individuals may generate social variation by preventing other animals from adopting a social organization that maximizes fitness. White-faced saki inter-individual relationships and demographic patterns also lend conciliatory support to this conclusion. By utilizing both model-level and species-level approaches, with a consideration for potential sources of variation, researchers can gain insight into the factors generating variation in pair-living social organizations. © 2014 The Authors. American Journal of Primatology published by Wiley Periodicals, Inc.

Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

PubMed Central

Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

1982-01-01

Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

PubMed

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Ponderomotive effects in multiphoton pair production

NASA Astrophysics Data System (ADS)

Kohlfürst, Christian; Alkofer, Reinhard

2018-02-01

The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

Solid State Photochemical Generation of Triplet Phenoxy-Phenoxy Radical Pairs

DTIC Science & Technology

1990-04-01

of diphenyl oxalate . Tert-butylated bis-aryloxalat s show good radical pair stability, with triplet ESR signals surviving days at room temperature in...between the geminate phenoxyl radicals. The comparable breadth of the spectra for diphenyl carbonate and the oxalates implies a similar interaction strength...ferromagnetic coupling that may be achieved in geminate pairs generated from a diphenyl oxalate vs. a diphenyl carbonate. In addition, we see similar

Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

NASA Astrophysics Data System (ADS)

Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

2018-01-01

We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

NASA Astrophysics Data System (ADS)

Gajewski, Andrzej; Kolenderski, Piotr L.

2016-10-01

There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

Experimental many-pairs nonlocality

NASA Astrophysics Data System (ADS)

Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

2017-08-01

Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

A Macroscopic Analogue of the Nuclear Pairing Potential

ERIC Educational Resources Information Center

Dunlap, Richard A.

2013-01-01

A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

A COMPARISON OF TWO PAIRING PROCEDURES TO ESTABLISH PRAISE AS A REINFORCER

PubMed Central

Dozier, Claudia L.; Iwata, Brian A.; Thomason-Sassi, Jessica; Worsdell, April S.; Wilson, David M.

2012-01-01

Some individuals with intellectual disabilities do not respond to praise as a reinforcer, which may limit their ability to learn. We evaluated 2 procedures (stimulus pairing and response–stimulus pairing), both of which involved pairing previously neutral praise statements with preferred edible items, to determine their usefulness in establishing praise as a reinforcer. Results of Study 1 indicated that stimulus pairing was not effective in conditioning praise as a reinforcer for 3 of 4 subjects; results were inconclusive for the 4th subject. Results of Study 2 indicated that response–stimulus pairing was effective in conditioning praise as a reinforcer for 4 of 8 subjects. After conditioning, praise also increased the occurrence of additional target responses for these 4 subjects. PMID:23322928

Female bluethroats enhance offspring immunocompetence through extra-pair copulations.

PubMed

Johnsen, A; Andersen, V; Sunding, C; Lifjeld, J T

2000-07-20

Female birds frequently copulate with extra-pair males, but the adaptive value of this behaviour is poorly understood. Some studies have suggested that 'good genes' may be involved, where females seek to have their eggs fertilized by high-quality males without receiving any material benefits from them. Nevertheless, it remains to be shown that a genetic benefit is passed on to offspring. Here we report that nestling bluethroats, Luscinia svecica, sired by extra-pair males had a higher T-cell-mediated immune response than their maternal half-siblings raised in the same nest. The difference could not be attributed to nestling body mass, sex or hatching order, but may be an effect of paternal genotype. Extra-pair young were also more immunocompetent than their paternal half-sibs raised in the genetic father's own nest, which indicates an additional effect of maternal genotype. Our results are consistent with the idea that females engage in extra-pair copulations to obtain compatible viability genes, rather than 'good genes' per se.

Introducing Hurst exponent in pair trading

NASA Astrophysics Data System (ADS)

Ramos-Requena, J. P.; Trinidad-Segovia, J. E.; Sánchez-Granero, M. A.

2017-12-01

In this paper we introduce a new methodology for pair trading. This new method is based on the calculation of the Hurst exponent of a pair. Our approach is inspired by the classical concepts of co-integration and mean reversion but joined under a unique strategy. We will show how Hurst approach presents better results than classical Distance Method and Correlation strategies in different scenarios. Results obtained prove that this new methodology is consistent and suitable by reducing the drawdown of trading over the classical ones getting as a result a better performance.

Non-invasive determination of external forces in vortex-pair-cylinder interactions

NASA Astrophysics Data System (ADS)

Hartmann, D.; Schröder, W.; Shashikanth, B. N.

2012-06-01

Expressions for the conserved linear and angular momenta of a dynamically coupled fluid + solid system are derived. Based on the knowledge of the flow velocity field, these expressions allow the determination of the external forces exerted on a body moving in the fluid such as, e.g., swimming fish. The verification of the derived conserved quantities is done numerically. The interaction of a vortex pair with a circular cylinder in various configurations of motions representing a generic test case for a dynamically coupled fluid + solid system is investigated in a weakly compressible Navier-Stokes setting using a Cartesian cut-cell method, i.e., the moving circular cylinder is represented by cut cells on a moving mesh. The objectives of this study are twofold. The first objective is to show the robustness of the derived expressions for the conserved linear and angular momenta with respect to bounded and discrete data sets. The second objective is to study the coupled dynamics of the vortex pair and a neutrally buoyant cylinder free to move in response to the fluid stresses exerted on its surface. A comparison of the vortex-body interaction with the case of a fixed circular cylinder evidences significant differences in the vortex dynamics. When the cylinder is fixed strong secondary vorticity is generated resulting in a repeating process between the primary vortex pair and the cylinder. In the neutrally buoyant cylinder case, a stable structure consisting of the primary vortex pair and secondary vorticity shear layers stays attached to the moving cylinder. In addition to these fundamental cases, the vortex-pair-cylinder interaction is studied for locomotion at constant speed and locomotion at constant thrust. It is shown that a similar vortex structure like in the neutrally buoyant cylinder case is obtained when the cylinder moves away from the approaching vortex pair at a constant speed smaller than the vortex pair translational velocity. Finally, the idealized

Personality, depression, and premorbid lifestyle in twin pairs discordant for Parkinson's disease

PubMed Central

Heberlein, I.; Ludin, H.; Scholz, J.; Vieregge, P.

1998-01-01

Present personality traits (Freiburg personality inventory, FPI-R), depression (von Zerssen's depression scale), and self assessed state of health were evaluated in 15 twin pairs (six monozygotic and nine dizygotic; mean age 62.5 years) discordant for idiopathic Parkinson's disease and in 17 unrelated healthy control subjects. The twins had additional questionnaire based interviews on premorbid lifestyle.
For disability, twins with Parkinson's disease scored lower on FPI-R than controls in "achievement orientation" and "extraversion", higher in "inhibitedness", "somatic complaints", and "emotionality". They scored higher for depression and for state of health than unaffected twins and controls. For zygosity, monozygotic twins scored lower than dizygotic twins in "achievement orientation", "aggressiveness", and "strain". Monozygotic twins had less "achievement orientation" and "extraversion" and more "somatic complaints" than controls. Monozygotic twins had a lower within pair difference than dizygotic twins in "social orientation". During premorbid times the affected twin with later Parkinson's disease was estimated to have been "less often the leader" in the twin pair.
Although small in sample size, this twin study indicates a genetic impact for some personality features beyond the Parkinson's disease motor syndrome.

 PMID:9489545

Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

PubMed

Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

2003-02-01

As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

Binaries and triples among asteroid pairs

NASA Astrophysics Data System (ADS)

Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián

2015-08-01

Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

PubMed

Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

1998-09-23

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

PubMed Central

Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

2005-01-01

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

PubMed

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

ERIC Educational Resources Information Center

Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

PubMed Central

Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

1980-01-01

The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

PubMed Central

Koh, Jansen

2016-01-01

Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

Additivity of Feature-Based and Symmetry-Based Grouping Effects in Multiple Object Tracking

PubMed Central

Wang, Chundi; Zhang, Xuemin; Li, Yongna; Lyu, Chuang

2016-01-01

Multiple object tracking (MOT) is an attentional process wherein people track several moving targets among several distractors. Symmetry, an important indicator of regularity, is a general spatial pattern observed in natural and artificial scenes. According to the “laws of perceptual organization” proposed by Gestalt psychologists, regularity is a principle of perceptual grouping, such as similarity and closure. A great deal of research reported that feature-based similarity grouping (e.g., grouping based on color, size, or shape) among targets in MOT tasks can improve tracking performance. However, no additive feature-based grouping effects have been reported where the tracking objects had two or more features. “Additive effect” refers to a greater grouping effect produced by grouping based on multiple cues instead of one cue. Can spatial symmetry produce a similar grouping effect similar to that of feature similarity in MOT tasks? Are the grouping effects based on symmetry and feature similarity additive? This study includes four experiments to address these questions. The results of Experiments 1 and 2 demonstrated the automatic symmetry-based grouping effects. More importantly, an additive grouping effect of symmetry and feature similarity was observed in Experiments 3 and 4. Our findings indicate that symmetry can produce an enhanced grouping effect in MOT and facilitate the grouping effect based on color or shape similarity. The “where” and “what” pathways might have played an important role in the additive grouping effect. PMID:27199875

Graph-based surface reconstruction from stereo pairs using image segmentation

NASA Astrophysics Data System (ADS)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

Growing Right Onto Wellness (GROW): A Family-Centered, Community-Based Obesity Prevention Randomized Controlled Trial for Preschool Child-Parent Pairs

PubMed Central

Po’e, Eli K.; Heerman, William J.; Mistry, Rishi S.; Barkin, Shari L.

2013-01-01

Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood Body Mass Index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. PMID:24012890

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

PubMed

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

PubMed Central

Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

2015-01-01

An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

Analyses of interactions among pair-rule genes and the gap gene Krüppel in Bombyx segmentation.

PubMed

Nakao, Hajime

2015-09-01

In the short-germ insect Tribolium, a pair-rule gene circuit consisting of the Tribolium homologs of even-skipped, runt, and odd-skipped (Tc-eve, Tc-run and Tc-odd, respectively) has been implicated in segment formation. To examine the application of the model to other taxa, I studied the expression and function of pair-rule genes in Bombyx mori, together with a Bombyx homolog of Krüppel (Bm-Kr), a known gap gene. Knockdown embryos of Bombyx homologs of eve, run and odd (Bm-eve, Bm-run and Bm-odd) exhibited asegmental phenotypes similar to those of Tribolium knockdowns. However, pair-rule gene interactions were similar to those of both Tribolium and Drosophila, which, different from Tribolium, shows a hierarchical segmentation mode. Additionally, the Bm-odd expression pattern shares characteristics with those of Drosophila pair-rule genes that receive upstream regulatory input. On the other hand, Bm-Kr knockdowns exhibited a large posterior segment deletion as observed in short-germ insects. However, a detailed analysis of these embryos indicated that Bm-Kr modulates expression of pair-rule genes like in Drosophila, although the mechanisms appear to be different. This suggested hierarchical interactions between Bm-Kr and pair-rule genes. Based on these results, I concluded that the pair-rule gene circuit model that describes Tribolium development is not applicable to Bombyx. Copyright © 2015 Elsevier Inc. All rights reserved.

Reversible geminate recombination of hydrogen-bonded water molecule pair

NASA Astrophysics Data System (ADS)

Markovitch, Omer; Agmon, Noam

2008-08-01

The (history independent) autocorrelation function for a hydrogen-bonded water molecule pair, calculated from classical molecular dynamics trajectories of liquid water, exhibits a t-3/2 asymptotic tail. Its whole time dependence agrees quantitatively with the solution for reversible diffusion-influenced geminate recombination derived by Agmon and Weiss [J. Chem. Phys. 91, 6937 (1989)]. Agreement with diffusion theory is independent of the precise definition of the bound state. Given the water self-diffusion constant, this theory enables us to determine the dissociation and bimolecular recombination rate parameters for a water dimer. (The theory is indispensable for obtaining the bimolecular rate coefficient.) Interestingly, the activation energies obtained from the temperature dependence of these rate coefficients are similar, rather than differing by the hydrogen-bond (HB) strength. This suggests that recombination requires displacing another water molecule, which meanwhile occupied the binding site. Because these activation energies are about twice the HB strength, cleavage of two HBs may be required to allow pair separation. The autocorrelation function without the HB angular restriction yields a recombination rate coefficient that is larger than that for rebinding to all four tetrahedral water sites (with angular restrictions), suggesting the additional participation of interstitial sites. Following dissociation, the probability of the pair to be unbound but within the reaction sphere rises more slowly than expected, possibly because binding to the interstitial sites delays pair separation. An extended diffusion model, which includes an additional binding site, can account for this behavior.

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

PubMed

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

PubMed

Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

2012-11-01

Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

PubMed Central

2016-01-01

Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

ReLiance: a machine learning and literature-based prioritization of receptor—ligand pairings

PubMed Central

Iacucci, Ernesto; Tranchevent, Léon-Charles; Popovic, Dusan; Pavlopoulos, Georgios A.; De Moor, Bart; Schneider, Reinhard; Moreau, Yves

2012-01-01

Motivation: The prediction of receptor—ligand pairings is an important area of research as intercellular communications are mediated by the successful interaction of these key proteins. As the exhaustive assaying of receptor—ligand pairs is impractical, a computational approach to predict pairings is necessary. We propose a workflow to carry out this interaction prediction task, using a text mining approach in conjunction with a state of the art prediction method, as well as a widely accessible and comprehensive dataset. Among several modern classifiers, random forests have been found to be the best at this prediction task. The training of this classifier was carried out using an experimentally validated dataset of Database of Ligand-Receptor Partners (DLRP) receptor—ligand pairs. New examples, co-cited with the training receptors and ligands, are then classified using the trained classifier. After applying our method, we find that we are able to successfully predict receptor—ligand pairs within the GPCR family with a balanced accuracy of 0.96. Upon further inspection, we find several supported interactions that were not present in the Database of Interacting Proteins (DIPdatabase). We have measured the balanced accuracy of our method resulting in high quality predictions stored in the available database ReLiance. Availability: http://homes.esat.kuleuven.be/~bioiuser/ReLianceDB/index.php Contact: yves.moreau@esat.kuleuven.be; ernesto.iacucci@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22962483

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

PubMed

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

PubMed

Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

2016-04-19

What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

Chemical Mixture Risk Assessment Additivity-Based Approaches

EPA Science Inventory

Powerpoint presentation includes additivity-based chemical mixture risk assessment methods. Basic concepts, theory and example calculations are included. Several slides discuss the use of "common adverse outcomes" in analyzing phthalate mixtures.

Grandmothering life histories and human pair bonding.

PubMed

Coxworth, James E; Kim, Peter S; McQueen, John S; Hawkes, Kristen

2015-09-22

The evolution of distinctively human life history and social organization is generally attributed to paternal provisioning based on pair bonds. Here we develop an alternative argument that connects the evolution of human pair bonds to the male-biased mating sex ratios that accompanied the evolution of human life history. We simulate an agent-based model of the grandmother hypothesis, compare simulated sex ratios to data on great apes and human hunter-gatherers, and note associations between a preponderance of males and mate guarding across taxa. Then we explore a recent model that highlights the importance of mating sex ratios for differences between birds and mammals and conclude that lessons for human evolution cannot ignore mammalian reproductive constraints. In contradiction to our claim that male-biased sex ratios are characteristically human, female-biased ratios are reported in some populations. We consider the likelihood that fertile men are undercounted and conclude that the mate-guarding hypothesis for human pair bonds gains strength from explicit links with our grandmothering life history.

Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

NASA Technical Reports Server (NTRS)

Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

2014-01-01

This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

Paired Comparisons.

DTIC Science & Technology

1982-05-01

including multidimensional scaling. Applications have arisen in many areas, but most notably in food technolog, marketing research, and sports ... competition .- An extensive bibliography on paired comparisons by Davidson and Farquhar (1976) contains some 400 references. - Paired comparisons have been...consideration of chess competition . Ford (1957) pro- posed the model independently. Both Zermelo and Ford concentrated on solution of normal equations for

Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

NASA Astrophysics Data System (ADS)

Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

2013-04-01

We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

Distributed practice can boost evaluative conditioning by increasing memory for the stimulus pairs.

PubMed

Richter, Jasmin; Gast, Anne

2017-09-01

When presenting a neutral stimulus (CS) in close temporal and spatial proximity to a positive or negative stimulus (US) the former is often observed to adopt the valence of the latter, a phenomenon named evaluative conditioning (EC). It is already well established that under most conditions, contingency awareness is important for an EC effect to occur. In addition to that, some findings suggest that awareness of the stimulus pairs is not only relevant during the learning phase, but that it is also relevant whether memory for the pairings is still available during the measurement phase. As previous research has shown that memory is better after temporally distributed than after contiguous (massed) repetitions, it seems plausible that also EC effects are moderated by distributed practice manipulations. This was tested in the current studies. In two experiments with successful distributed practice manipulations on memory, we show that also the magnitude of the EC effect was larger for pairs learned under spaced compared to massed conditions. Both effects, on memory and on EC, are found after a within-participant and after a between-participant manipulation. However, we did not find significant differences in the EC effect for different conditions of spaced practice. These findings are in line with the assumption that EC is based on similar processes as memory for the pairings. Copyright © 2017 Elsevier B.V. All rights reserved.

Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

PubMed Central

Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

2013-01-01

The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements. PMID:23467056

Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

NASA Astrophysics Data System (ADS)

Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

2011-10-01

Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

PubMed Central

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

NASA Astrophysics Data System (ADS)

Riplinger, Christoph; Pinski, Peter; Becker, Ute; Valeev, Edward F.; Neese, Frank

2016-01-01

Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate previous

Detergent-dispersant additives based on high-molecular-weight alkylphenols

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kulieva, K.N.; Namazova, I.I.; Ismailova, N.D.

1988-09-01

This article describes the synthesis and investigation of Mannich bases produced for alkylphenols, obtained in turn from ethylene oligomers. These oligomers are the still bottoms from distillation products of high-temperature oligomerization of ethylene in the presence of triethylaluminum. Two narrow cuts obtained from the distillation of oligomer fraction were used to study the influence of ethylene oligomer molecular weight on the properties of the additives. The additives were blended in DS-11 oil to evaluate their detergency-dispersancy and other properties. Comparison blends were made with succinimide additives based on the same ethylene oligomers. The Mannich bases give improvements in the oxidationmore » resistance, anticorrosion properties, and detergency-dispersancy of the DS-11 diesel oil.« less

Terminal Area Procedures for Paired Runways

NASA Technical Reports Server (NTRS)

Lozito, Sandy

2011-01-01

Parallel Runway operations have been found to increase capacity within the National Airspace (NAS) however, poor visibility conditions reduce this capacity [1]. Much research has been conducted to examine the concepts and procedures related to parallel runways however, there has been no investigation of the procedures associated with the strategic and tactical pairing of aircraft for these operations. This study developed and examined the pilot and controller procedures and information requirements for creating aircraft pairs for parallel runway operations. The goal was to achieve aircraft pairing with a temporal separation of 15s(+/- 10s error) at a coupling point that is about 12 nmi from the runway threshold. Two variables were explored for the pilot participants: Two levels of flight deck automation (current-day flight deck automation, and a prototype future automation) as well as two flight deck displays that assisted in pilot conformance monitoring. The controllers were also provided with automation to help create and maintain aircraft pairs. Data showed that the operations in this study were found to be acceptable and safe. Workload when using the pairing procedures and tools was generally low for both controllers and pilots, and situation awareness (SA) was typically moderate to high. There were some differences based upon the display and automation conditions for the pilots. Future research should consider the refinement of the concepts and tools for pilot and controller displays and automation for parallel runway concepts.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Decomposing variation in male reproductive success: age-specific variances and covariances through extra-pair and within-pair reproduction.

PubMed

Lebigre, Christophe; Arcese, Peter; Reid, Jane M

2013-07-01

Age-specific variances and covariances in reproductive success shape the total variance in lifetime reproductive success (LRS), age-specific opportunities for selection, and population demographic variance and effective size. Age-specific (co)variances in reproductive success achieved through different reproductive routes must therefore be quantified to predict population, phenotypic and evolutionary dynamics in age-structured populations. While numerous studies have quantified age-specific variation in mean reproductive success, age-specific variances and covariances in reproductive success, and the contributions of different reproductive routes to these (co)variances, have not been comprehensively quantified in natural populations. We applied 'additive' and 'independent' methods of variance decomposition to complete data describing apparent (social) and realised (genetic) age-specific reproductive success across 11 cohorts of socially monogamous but genetically polygynandrous song sparrows (Melospiza melodia). We thereby quantified age-specific (co)variances in male within-pair and extra-pair reproductive success (WPRS and EPRS) and the contributions of these (co)variances to the total variances in age-specific reproductive success and LRS. 'Additive' decomposition showed that within-age and among-age (co)variances in WPRS across males aged 2-4 years contributed most to the total variance in LRS. Age-specific (co)variances in EPRS contributed relatively little. However, extra-pair reproduction altered age-specific variances in reproductive success relative to the social mating system, and hence altered the relative contributions of age-specific reproductive success to the total variance in LRS. 'Independent' decomposition showed that the (co)variances in age-specific WPRS, EPRS and total reproductive success, and the resulting opportunities for selection, varied substantially across males that survived to each age. Furthermore, extra-pair reproduction increased

High spectral purity silicon ring resonator photon-pair source

NASA Astrophysics Data System (ADS)

Steidle, Jeffrey A.; Fanto, Michael L.; Tison, Christopher C.; Wang, Zihao; Preble, Stefan F.; Alsing, Paul M.

2015-05-01

Here we present the experimental demonstration of a Silicon ring resonator photon-pair source. The crystalline Silicon ring resonator (radius of 18.5μm) was designed to realize low dispersion across multiple resonances, which allows for operation with a high quality factor of Q~50k. In turn, the source exhibits very high brightness of >3x105 photons/s/mW2/GHz since the produced photon pairs have a very narrow bandwidth. Furthermore, the waveguidefiber coupling loss was minimized to <1.5dB using an inverse tapered waveguide (tip width of ~150nm over a 300μm length) that is butt-coupled to a high-NA fiber (Nufern UHNA-7). This ensured minimal loss of photon pairs to the detectors, which enabled very high purity photon pairs with minimal noise, as exhibited by a very high Coincidental-Accidental Ratio of >1900. The low coupling loss (3dB fiber-fiber) also allowed for operation with very low off-chip pump power of <200μW. In addition, the zero dispersion of the ring resonator resulted in the production of a photon-pair comb across multiple resonances symmetric about the pump resonance (every ~5nm spanning >20nm), which could be used in future wavelength division multiplexed quantum networks.

Two-photon production of dilepton pairs in peripheral heavy ion collisions

NASA Astrophysics Data System (ADS)

Klein, Spencer R.

2018-05-01

The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

PubMed Central

Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

2015-01-01

During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

Simplified Aircraft-Based Paired Approach: Concept Definition and Initial Analysis

NASA Technical Reports Server (NTRS)

Johnson, Sally C.; Lohr, Gary W.; McKissick, Burnell T.; Abbott, Terence S.; Geurreiro, Nelson M.; Volk, Paul

2013-01-01

Simplified Aircraft-based Parallel Approach (SAPA) is an advanced concept proposed by the Federal Aviation Administration (FAA) to support dependent parallel approach operations to runways with lateral spacing closer than 2500 ft. At the request of the FAA, NASA performed an initial assessment of the potential performance and feasibility of the SAPA concept, including developing and assessing an operational implementation of the concept and conducting a Monte Carlo wake simulation study to examine the longitudinal spacing requirements. The SAPA concept was shown to have significant operational advantages in supporting the pairing of aircraft with dissimilar final approach speeds. The wake simulation study showed that support for dissimilar final approach speeds could be significantly enhanced through the use of a two-phased altitudebased longitudinal positioning requirement, with larger longitudinal positioning allowed for higher altitudes out of ground effect and tighter longitudinal positioning defined for altitudes near and in ground effect. While this assessment is preliminary and there are a number of operational issues still to be examined, it has shown the basic SAPA concept to be technically and operationally feasible.

Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

PubMed

Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

2018-05-01

The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

Comparison of clinical knowledge bases for summarization of electronic health records.

PubMed

McCoy, Allison B; Sittig, Dean F; Wright, Adam

2013-01-01

Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

Ionic force field optimization based on single-ion and ion-pair solvation properties: Going beyond standard mixing rules

NASA Astrophysics Data System (ADS)

Fyta, Maria; Netz, Roland R.

2012-03-01

Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

NASA Astrophysics Data System (ADS)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Ultrashort fluorescence lifetimes of hydrogen-bonded base pairs of guanosine and cytidine in solution.

PubMed

Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich

2009-12-24

The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.

Comparison of split double and triple twists in pair figure skating.

PubMed

King, Deborah L; Smith, Sarah L; Brown, Michele R; McCrory, Jean L; Munkasy, Barry A; Scheirman, Gary I

2008-05-01

In this study, we compared the kinematic variables of the split triple twist with those of the split double twist to help coaches and scientists understand these landmark pair skating skills. High-speed video was taken during the pair short and free programmes at the 2002 Salt Lake City Winter Olympics and the 2003 International Skating Union Grand Prix Finals. Three-dimensional analyses of 14 split double twists and 15 split triple twists from eleven pairs were completed. In spite of considerable variability in the performance variables among the pairs, the main difference between the split double twists and split triple twists was an increase in rotational rate. While eight of the eleven pairs relied primarily on an increased rotational rate to complete the split triple twist, three pairs employed a combined strategy of increased rotational rate and increased flight time due predominantly to delayed or lower catches. These results were similar to observations of jumps in singles skating for which the extra rotation is typically due to an increase in rotational velocity; increases in flight time come primarily from delayed landings as opposed to additional height during flight. Combining an increase in flight time and rotational rate may be a good strategy for completing the split triple twist in pair skating.

Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

PubMed

Schmitz, Gunnar; Hättig, Christof

2016-12-21

We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

Pair-instability supernovae of fast rotating stars

NASA Astrophysics Data System (ADS)

Chen, Ke-Jung

2015-01-01

We present 2D simulations of pair-instability supernovae considering rapid rotation during their explosion phases. Recent studies of the Population III (Pop III) star formation suggested that these stars could be born with a mass scale about 100 M⊙ and with a strong rotation. Based on stellar evolution models, these massive Pop III stars might have died as highly energetic pair-instability supernovae. We perform 2D calculations to investigate the impact of rotation on pair-instability supernovae. Our results suggest that rotation leads to an aspherical explosion due to an anisotropic collapse. If the first stars have a 50% of keplerian rotational rate of the oxygen core before their pair-instability explosions, the overall 56Ni production can be significantly reduced by about two orders of magnitude. An extreme case of 100% keplerian rotational rate shows an interesting feature of fluid instabilities along the equatorial plane caused by non-synchronized and non-isotropic ignitions of explosions, so that the shocks run into the in-falling gas and generate the Richtmyer-Meshkov instability.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

PubMed Central

Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095

biobambam: tools for read pair collation based algorithms on BAM files

PubMed Central

2014-01-01

Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.

Cooper Pairs in Insulators?!

ScienceCinema

James Valles

2017-12-09

Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

A chaotic micromixer using obstruction-pairs

NASA Astrophysics Data System (ADS)

Park, Jang Min; Duck Seo, Kyoung; Kwon, Tai Hun

2010-01-01

A micromixer is one of the most important components for a chemical and/or diagnostic analysis in microfluidic devices such as a micro-total-analysis-system and a lab-on-a-chip. In this paper, a novel chaotic micromixer is developed in a simple design by introducing obstruction-pairs on the bottom of a microchannel. An obstruction-pair, which is composed of two hexahedron blocks arranged in an asymmetric manner, can induce a rotational flow along the down-channel direction due to the anisotropy of flow resistance. By utilizing this characteristic of the obstruction-pair, four mixing units are designed in such a way that three obstruction-pairs induce three rotational flows which result in a down-welling and a hyperbolic point in the channel cross-section. There can be a variety of micromixer geometries by arranging the mixing units in various sequences along the microchannel, and their mixing performances will differ from each other due to different flow characteristics. In this regard, numerical investigations are carried out to predict and characterize the mixing performances of various micromixers. Also experimental verifications are carried out by a flow visualization technique using phenolphthalein and sodium hydroxide solutions in a polydimethylsiloxane-based micromixer.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

PubMed

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

PubMed

Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

2014-05-01

The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness

ERIC Educational Resources Information Center

Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert

2014-01-01

Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…

Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

PubMed

Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

1998-04-06

The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

Updates on Pairing Issues with the US Antarctic Meteorite Collection

NASA Technical Reports Server (NTRS)

Righter, K.; Satterwhite, C.; Schutt, J.

2015-01-01

The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.

Understanding Fomalhaut as a Cooper pair

NASA Astrophysics Data System (ADS)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

ERIC Educational Resources Information Center

Ilhan, Mustafa

2016-01-01

The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

Vortex pairs on surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koiller, Jair; Boatto, Stefanella

2009-05-06

A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

CPM Pairs from LSPM so far not WDS Listed – Part II

NASA Astrophysics Data System (ADS)

Knapp, Wilfried; Nanson, John

2017-10-01

The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted – but as we found during research for our report “A new concept for counter-checking of assumed CPM pairs” (Knapp and Nanson 2017) there are still many poten-tial CPM pairs indicated in LSPM which as of the end of 2016 are not listed in the WDS cata-log. After our first part on about 40 such objects (Knapp and Nanson 2017) the next report with about 30 additional common proper motion pairs is presented here.

Multiple re-encounter approach to radical pair reactions and the role of nonlinear master equations.

PubMed

Clausen, Jens; Guerreschi, Gian Giacomo; Tiersch, Markus; Briegel, Hans J

2014-08-07

We formulate a multiple-encounter model of the radical pair mechanism that is based on a random coupling of the radical pair to a minimal model environment. These occasional pulse-like couplings correspond to the radical encounters and give rise to both dephasing and recombination. While this is in agreement with the original model of Haberkorn and its extensions that assume additional dephasing, we show how a nonlinear master equation may be constructed to describe the conditional evolution of the radical pairs prior to the detection of their recombination. We propose a nonlinear master equation for the evolution of an ensemble of independently evolving radical pairs whose nonlinearity depends on the record of the fluorescence signal. We also reformulate Haberkorn's original argument on the physicality of reaction operators using the terminology of quantum optics/open quantum systems. Our model allows one to describe multiple encounters within the exponential model and connects this with the master equation approach. We include hitherto neglected effects of the encounters, such as a separate dephasing in the triplet subspace, and predict potential new effects, such as Grover reflections of radical spins, that may be observed if the strength and time of the encounters can be experimentally controlled.

Sequence-similar, structure-dissimilar protein pairs in the PDB.

PubMed

Kosloff, Mickey; Kolodny, Rachel

2008-05-01

It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We

Strongly exchange-coupled triplet pairs in an organic semiconductor

NASA Astrophysics Data System (ADS)

Weiss, Leah R.; Bayliss, Sam L.; Kraffert, Felix; Thorley, Karl J.; Anthony, John E.; Bittl, Robert; Friend, Richard H.; Rao, Akshay; Greenham, Neil C.; Behrends, Jan

2017-02-01

From biological complexes to devices based on organic semiconductors, spin interactions play a key role in the function of molecular systems. For instance, triplet-pair reactions impact operation of organic light-emitting diodes as well as photovoltaic devices. Conventional models for triplet pairs assume they interact only weakly. Here, using electron spin resonance, we observe long-lived, strongly interacting triplet pairs in an organic semiconductor, generated via singlet fission. Using coherent spin manipulation of these two-triplet states, we identify exchange-coupled (spin-2) quintet complexes coexisting with weakly coupled (spin-1) triplets. We measure strongly coupled pairs with a lifetime approaching 3 μs and a spin coherence time approaching 1 μs, at 10 K. Our results pave the way for the utilization of high-spin systems in organic semiconductors.

Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

PubMed Central

Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

1995-01-01

A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

SlideSort: all pairs similarity search for short reads

PubMed Central

Shimizu, Kana; Tsuda, Koji

2011-01-01

Motivation: Recent progress in DNA sequencing technologies calls for fast and accurate algorithms that can evaluate sequence similarity for a huge amount of short reads. Searching similar pairs from a string pool is a fundamental process of de novo genome assembly, genome-wide alignment and other important analyses. Results: In this study, we designed and implemented an exact algorithm SlideSort that finds all similar pairs from a string pool in terms of edit distance. Using an efficient pattern growth algorithm, SlideSort discovers chains of common k-mers to narrow down the search. Compared to existing methods based on single k-mers, our method is more effective in reducing the number of edit distance calculations. In comparison to backtracking methods such as BWA, our method is much faster in finding remote matches, scaling easily to tens of millions of sequences. Our software has an additional function of single link clustering, which is useful in summarizing short reads for further processing. Availability: Executable binary files and C++ libraries are available at http://www.cbrc.jp/~shimizu/slidesort/ for Linux and Windows. Contact: slidesort@m.aist.go.jp; shimizu-kana@aist.go.jp Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21148542

Universal quantum gates for Single Cooper Pair Box based quantum computing

NASA Technical Reports Server (NTRS)

Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

2000-01-01

We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

QM and QM/MM Studies on Excited-State Relaxation Mechanisms of Unnatural Bases in Vacuo and Base Pairs in DNA.

PubMed

Wang, Qian; Xie, Xiao-Ying; Han, Juan; Cui, Ganglong

2017-11-22

Semisynthetic alphabet can potentially increase the genetic information stored in DNA through the formation of unusual base pairs such as d5SICS:dNaM. However, recent experiments show that near-visible-light irradiation on the d5SICS and dNaM chromophores could lead to genetic mutations and damages. Until now, their photophysical mechanisms remain elusive. Herein, we have employed MS-CASPT2//CASSCF and QM(MS-CASPT2//CASSCF)/MM methods to explore the spectroscopic properties and excited-state relaxation mechanisms of d5SICS, dNaM, and d5SICS:dNaM in DNA. We have found that (1) the S 2 state of d5SICS, the S 1 state of dNaM, and the S 2 state of d5SICS:dNaM are initially populated upon near-visible-light irradiation and (2) for d5SICS and d5SICS:dNaM, there are several parallel relaxation pathways to populate the lowest triplet state, but for dNaM, a main relaxation pathway is uncovered. Moreover, we have found that the excited-state relaxation mechanism of d5SICS:dNaM in DNA is similar to that of the isolated d5SICS chromophore. These mechanistic insights contribute to the understanding of photophysics and photochemistry of unusual base pairs and to the design of better semisynthetic genetic alphabet.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

PubMed Central

Sharma, Kishor; Tollervey, David

1999-01-01

The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

PubMed

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

Statistical deprojection of galaxy pairs

NASA Astrophysics Data System (ADS)

Nottale, Laurent; Chamaraux, Pierre

2018-06-01

Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

Inhibiting Polysulfide Shuttle in Lithium-Sulfur Batteries through Low-Ion-Pairing Salts and a Triflamide Solvent.

PubMed

Shyamsunder, Abhinandan; Beichel, Witali; Klose, Petra; Pang, Quan; Scherer, Harald; Hoffmann, Anke; Murphy, Graham K; Krossing, Ingo; Nazar, Linda F

2017-05-22

The step-change in gravimetric energy density needed for electrochemical energy storage devices to power unmanned autonomous vehicles, electric vehicles, and enable low-cost clean grid storage is unlikely to be provided by conventional lithium ion batteries. Lithium-sulfur batteries comprising lightweight elements provide a promising alternative, but the associated polysulfide shuttle in typical ether-based electrolytes generates loss in capacity and low coulombic efficiency. The first new electrolyte based on a unique combination of a relatively hydrophobic sulfonamide solvent and a low ion-pairing salt, which inhibits the polysulfide shuttle, is presented. This system behaves as a sparingly solvating electrolyte at slightly elevated temperatures, where it sustains reversible capacities as high as 1200-1500 mAh g -1 over a wide range of current density (2C-C/5, respectively) when paired with a lithium metal anode, with a coulombic efficiency of >99.7 % in the absence of LiNO 3 additive. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tautomeric selectivity of the excited-state lifetime of guanine/cytosine base pairs: The role of electron-driven proton-transfer processes

PubMed Central

Sobolewski, Andrzej L.; Domcke, Wolfgang; Hättig, C.

2005-01-01

The UV spectra of three different conformers of the guanine/cytosine base pair were recorded recently with UV-IR double-resonance techniques in a supersonic jet [Abo-Riziq, A., Grace, L., Nir, E., Kabelac, M., Hobza, P. & de Vries, M. S. (2005) Proc. Natl. Acad. Sci. USA 102, 20–23]. The spectra provide evidence for a very efficient excited-state deactivation mechanism that is specific for the Watson–Crick structure and may be essential for the photostability of DNA. Here we report results of ab initio electronic-structure calculations for the excited electronic states of the three lowest-energy conformers of the guanine/cytosine base pair. The calculations reveal that electron-driven interbase proton-transfer processes play an important role in the photochemistry of these systems. The exceptionally short lifetime of the UV-absorbing states of the Watson–Crick conformer is tentatively explained by the existence of a barrierless reaction path that connects the spectroscopic 1π π * excited state with the electronic ground state via two electronic curve crossings. For the non-Watson–Crick structures, the photochemically reactive state is located at higher energies, resulting in a barrier for proton transfer and, thus, a longer lifetime of the UV-absorbing 1π π * state. The computational results support the conjecture that the photochemistry of hydrogen bonds plays a decisive role for the photostability of the molecular encoding of the genetic information in isolated DNA base pairs. PMID:16330778

Interlayer-coupled spin vortex pairs and their response to external magnetic fields

NASA Astrophysics Data System (ADS)

Wintz, Sebastian; Bunce, Christopher; Banholzer, Anja; Körner, Michael; Strache, Thomas; Mattheis, Roland; McCord, Jeffrey; Raabe, Jörg; Quitmann, Christoph; Erbe, Artur; Fassbender, Jürgen

2012-06-01

We report on the response of multilayer spin textures to static magnetic fields. Coupled magnetic vortex pairs in trilayer elements (ferromagnetic/nonmagnetic/ferromagnetic) are imaged directly by means of layer-selective magnetic x-ray microscopy. We observe two different circulation configurations with parallel and opposing senses of magnetization rotation at remanence. Upon application of a field, all of the vortex pairs investigated react with a displacement of their cores. For purely dipolar coupled pairs, the individual core displacements are similar to those of an isolated single-layer vortex, but also a noticeable effect of the mutual stray fields is detected. Vortex pairs that are linked by an additional interlayer exchange coupling (IEC), which is either ferromagnetic or antiferromagnetic, mainly exhibit a layer-congruent response. We find that, apart from a possible decoupling at higher fields, these strict IEC vortex pairs can be described by a single-layer model with effective material parameters. This result implies the possibility to design multilayer spin structures with arbitrary effective magnetization.

Gut microbiomes of Malawian twin pairs discordant for kwashiorkor

USDA-ARS?s Scientific Manuscript database

Kwashiorkor, an enigmatic form of severe acute malnutrition, is the consequence of inadequate nutrient intake plus additional environmental insults. To investigate the role of the gut microbiome, we studied 317 Malawian twin pairs during the first 3 years of life. During this time, half of the twin ...

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

PubMed Central

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

PubMed Central

Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

1998-01-01

The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

Fundamental aspects of recoupled pair bonds. I. Recoupled pair bonds in carbon and sulfur monofluoride

NASA Astrophysics Data System (ADS)

Dunning, Thom H.; Xu, Lu T.; Takeshita, Tyler Y.

2015-01-01

The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their 3P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pair bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a4Σ- states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.

Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

NASA Astrophysics Data System (ADS)

Allan, Milan P.

2013-03-01

The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.

PubMed

Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich

2011-05-12

N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1).

Correlation in photon pairs generated using four-wave mixing in a cold atomic ensemble

NASA Astrophysics Data System (ADS)

Ferdinand, Andrew Richard; Manjavacas, Alejandro; Becerra, Francisco Elohim

2017-04-01

Spontaneous four-wave mixing (FWM) in atomic ensembles can be used to generate narrowband entangled photon pairs at or near atomic resonances. While extensive research has been done to investigate the quantum correlations in the time and polarization of such photon pairs, the study and control of high dimensional quantum correlations contained in their spatial degrees of freedom has not been fully explored. In our work we experimentally investigate the generation of correlated light from FWM in a cold ensemble of cesium atoms as a function of the frequencies of the pump fields in the FWM process. In addition, we theoretically study the spatial correlations of the photon pairs generated in the FWM process, specifically the joint distribution of their orbital angular momentum (OAM). We investigate the width of the distribution of the OAM modes, known as the spiral bandwidth, and the purity of OAM correlations as a function of the properties of the pump fields, collected photons, and the atomic ensemble. These studies will guide experiments involving high dimensional entanglement of photons generated from this FWM process and OAM-based quantum communication with atomic ensembles. This work is supported by AFORS Grant FA9550-14-1-0300.

Asteroid Systems: Binaries, Triples, and Pairs

NASA Astrophysics Data System (ADS)

Margot, J.-L.; Pravec, P.; Taylor, P.; Carry, B.; Jacobson, S.

In the past decade, the number of known binary near-Earth asteroids has more than quadrupled and the number of known large main-belt asteroids with satellites has doubled. Half a dozen triple asteroids have been discovered, and the previously unrecognized populations of asteroid pairs and small main-belt binaries have been identified. The current observational evidence confirms that small (≲20 km) binaries form by rotational fission and establishes that the Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect powers the spin-up process. A unifying paradigm based on rotational fission and post-fission dynamics can explain the formation of small binaries, triples, and pairs. Large (>~20 km) binaries with small satellites are most likely created during large collisions.

In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

PubMed

Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

2017-09-22

Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

PubMed Central

2011-01-01

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

Unravelling the Composition Dependent Anomalies of Pair Hydrophobicity in Water-Ethanol Binary Mixtures.

PubMed

Halder, Ritaban; Jana, Biman

2018-06-05

Aqueous binary mixtures have received immense attention in recent years because of their extensive application in several biological and industrial processes. Water-ethanol binary mixture serves as a unique system because it exhibits composition dependent alteration of dynamic and thermodynamic properties. Our present work demonstrates how different compositions of water-ethanol binary mixtures affect the pair hydrophobicity of different hydrophobes. Pair hydrophobicity is measured by the depth of the first minimum (contact minima) of potential of mean force (PMF) profile between two hydrophobes. The pair hydrophobicity is found to be increased with addition of ethanol to water up to mole fraction of 0.10 and decreased with further addition of ethanol. This observation is shown to be true for three different pairs of hydrophobes. Decomposition of PMF into enthalpic and entropic contribution indicates a switch from entropic to enthalpic stabilization of the contact minimum upon addition of ethanol to water. The gain in mixing enthalpy of the binary solvent system upon association of two hydrophobes is found to be the determining factor for the stabilization of contact minimum. Several static/dynamics quantities (average composition fluctuations, diffusion coefficients, fluctuations in total dipole moment, propensity of ethyl-ethyl association, etc) of the ethanol-water binary mixture also show irregularities around xEtOH =0.10-0.15. We have also discovered that the hydrogen bonding pattern of ethanol rather than water reveals a change in trend near the similar composition range. As the anomalous behaviour of the physical/dynamical properties along with the pair hydrophobicity in aqueous binary mixture of amphiphilic solutes is common phenomena, our results may provide a general viewpoint on these aspects.

CPM Pairs from LSPM so far not WDS Listed – Part III

NASA Astrophysics Data System (ADS)

Knapp, Wilfried; Nanson, John

2017-10-01

The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted – but as we found during research for our report “A new concept for counter-checking of assumed CPM pairs” (Knapp and Nanson 2017) there are still many poten-tial CPM pairs indicated in LSPM which as of the end of 2016 are not listed in the WDS cata-log. After our first two reports on in total about 70 such objects (Knapp and Nanson 2017) the next paper with about 25 additional potential common proper motion pairs is presented here.

Cloud Base Height Measurements at Manila Observatory: Initial Results from Constructed Paired Sky Imaging Cameras

NASA Astrophysics Data System (ADS)

Lagrosas, N.; Tan, F.; Antioquia, C. T.

2014-12-01