Science.gov

Sample records for additional dna damage

  1. DNA damage in human germ cell exposed to the some food additives in vitro.

    PubMed

    Pandir, Dilek

    2016-08-01

    The use of food additives has increased enormously in modern food technology but they have adverse effects in human healthy. The aim of this study was to investigate the DNA damage of some food additives such as citric acid (CA), benzoic acid (BA), brilliant blue (BB) and sunset yellow (SY) which were investigated in human male germ cells using comet assay. The sperm cells were incubated with different concentrations of these food additives (50, 100, 200 and 500 μg/mL) for 1 h at 32 °C. The results showed for CA, BA, BB and SY a dose dependent increase in tail DNA%, tail length and tail moment in human sperm when compared to control group. When control values were compared in the studied parameters in the treatment concentrations, SY was found to exhibit the highest level of DNA damage followed by BB > BA > CA. However, none of the food additives affected the tail DNA%, tail length and tail moment at 50 and 100 μg/mL. At 200 μg/mL of SY, the tail DNA% and tail length of sperm were 95.80 ± 0.28 and 42.56 ± 4.66, for BB the values were 95.06 ± 2.30 and 39.56 ± 3.78, whereas for BA the values were 89.05 ± 2.78 and 31.50 ± 0.71, for CA the values were 88.59 ± 6.45 and 13.59 ± 2.74, respectively. However, only the highest concentration of the used food additives significantly affected the studied parameters of sperm DNA. The present results indicate that SY and BB are more harmful than BA and CA to human sperm in vitro. PMID:25501537

  2. DNA Damage Response

    PubMed Central

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damage can occur at any time on any genomic location, a specialized spatio-temporal orchestration of this defense apparatus is required. PMID:20980439

  3. Single and Combined Effects of Deoxynivalenol Mycotoxin and a Microbial Feed Additive on Lymphocyte DNA Damage and Oxidative Stress in Broiler Chickens

    PubMed Central

    Awad, Wageha A.; Ghareeb, Khaled; Dadak, Agnes; Hess, Michael; Böhm, Josef

    2014-01-01

    The immune and intestinal epithelial cells are particularly sensitive to the toxic effects of deoxynivalenol (DON). The aim of this experiment was to study the effects of DON and/or a microbial feed additive on the DNA damage of blood lymphocytes and on the level of thiobarbituric acid reactive substance (TBARS) as an indicator of lipid peroxidation and oxidative stress in broilers. A total of forty 1-d-old broiler chicks were randomly assigned to 1 of 4 dietary treatments (10 birds per group) for 5 wk. The dietary treatments were 1) basal diet; 2) basal diet contaminated with 10 mg DON/kg feed; 3) basal diet contaminated with 10 mg DON/kg feed and supplemented with 2.5 kg/ton of feed of Mycofix Select; 4) basal diet supplemented with Mycofix Select (2.5 kg/ton of feed). At the end of the feeding trial, blood were collected for measuring the level of lymphocyte DNA damage of blood and the TBARS level was measured in plasma, heart, kidney, duodenum and jejunum. The dietary exposure of DON caused a significant increase (P = 0.001) of DNA damage in blood lymphocytes (31.99±0.89%) as indicated in the tail of comet assay. Interestingly addition of Mycofix Select to DON contaminated diet decreased (P = 0.001) the DNA damage (19.82±1.75%) induced by DON. In order to clarify the involvement of lipid peroxidation in the DNA damage of DON, TBARS levels was measured. A significant increase (P = 0.001) in the level of TBARS (23±2 nmol/mg) was observed in the jejunal tissue suggesting that the lipid peroxidation might be involved in the DNA damage. The results indicate that DON is cytotoxic and genotoxic to the chicken intestinal and immune cells and the feed additive have potential ability to prevent DNA damage induced by DON. PMID:24498242

  4. DNA damage tolerance.

    PubMed

    Branzei, Dana; Psakhye, Ivan

    2016-06-01

    Accurate chromosomal DNA replication is fundamental for optimal cellular function and genome integrity. Replication perturbations activate DNA damage tolerance pathways, which are crucial to complete genome duplication as well as to prevent formation of deleterious double strand breaks. Cells use two general strategies to tolerate lesions: recombination to a homologous template, and trans-lesion synthesis with specialized polymerases. While key players of these processes have been outlined, much less is known on their choreography and regulation. Recent advances have uncovered principles by which DNA damage tolerance is regulated locally and temporally - in relation to replication timing and cell cycle stage -, and are beginning to elucidate the DNA dynamics that mediate lesion tolerance and influence chromosome structure during replication. PMID:27060551

  5. Ribonucleotide triggered DNA damage and RNA-DNA damage responses

    PubMed Central

    Wallace, Bret D; Williams, R Scott

    2014-01-01

    Research indicates that the transient contamination of DNA with ribonucleotides exceeds all other known types of DNA damage combined. The consequences of ribose incorporation into DNA, and the identity of protein factors operating in this RNA-DNA realm to protect genomic integrity from RNA-triggered events are emerging. Left unrepaired, the presence of ribonucleotides in genomic DNA impacts cellular proliferation and is associated with chromosome instability, gross chromosomal rearrangements, mutagenesis, and production of previously unrecognized forms of ribonucleotide-triggered DNA damage. Here, we highlight recent findings on the nature and structure of DNA damage arising from ribonucleotides in DNA, and the identification of cellular factors acting in an RNA-DNA damage response (RDDR) to counter RNA-triggered DNA damage. PMID:25692233

  6. Mitochondrial DNA Damage and Diseases

    PubMed Central

    Singh, Gyanesh; Pachouri, U C; Khaidem, Devika Chanu; Kundu, Aman; Chopra, Chirag; Singh, Pushplata

    2015-01-01

    Various endogenous and environmental factors can cause mitochondrial DNA (mtDNA) damage.  One of the reasons for enhanced mtDNA damage could be its proximity to the source of oxidants, and lack of histone-like protective proteins. Moreover, mitochondria contain inadequate DNA repair pathways, and, diminished DNA repair capacity may be one of the factors responsible for high mutation frequency of the mtDNA. mtDNA damage might cause impaired mitochondrial function, and, unrepaired mtDNA damage has been frequently linked with several diseases. Exploration of mitochondrial perspective of diseases might lead to a better understanding of several diseases, and will certainly open new avenues for detection, cure, and prevention of ailments.

  7. DNA Damage in Major Psychiatric Diseases.

    PubMed

    Raza, Muhammad Ummear; Tufan, Turan; Wang, Yan; Hill, Christopher; Zhu, Meng-Yang

    2016-08-01

    Human cells are exposed to exogenous insults and continuous production of different metabolites. These insults and unwanted metabolic products might interfere with the stability of genomic DNA. Recently, many studies have demonstrated that different psychiatric disorders show substantially high levels of oxidative DNA damage in the brain accompanied with morphological and functional alterations. It reveals that damaged genomic DNA may contribute to the pathophysiology of these mental illnesses. In this article, we review the roles of oxidative damage and reduced antioxidant ability in some vastly studied psychiatric disorders and emphasize the inclusion of treatment options involving DNA repair. In addition, while most currently used antidepressants are based on the manipulation of the neurotransmitter regulation in managing different mental abnormalities, they are able to prevent or reverse neurotoxin-induced DNA damage. Therefore, it may be plausible to target on genomic DNA alterations for psychiatric therapies, which is of pivotal importance for future antipsychiatric drug development. PMID:27126805

  8. DNA damage checkpoints in mammals.

    PubMed

    Niida, Hiroyuki; Nakanishi, Makoto

    2006-01-01

    DNA damage is a common event and probably leads to mutation or deletion within chromosomal DNA, which may cause cancer or premature aging. DNA damage induces several cellular responses including DNA repair, checkpoint activity and the triggering of apoptotic pathways. DNA damage checkpoints are associated with biochemical pathways that end delay or arrest of cell-cycle progression. These checkpoints engage damage sensor proteins, such as the Rad9-Rad1-Hus1 (9-1-1) complex, and the Rad17-RFC complex, in the detection of DNA damage and transduction of signals to ATM, ATR, Chk1 and Chk2 kinases. Chk1 and Chk2 kinases regulate Cdc25, Wee1 and p53 that ultimately inactivate cyclin-dependent kinases (Cdks) which inhibit cell-cycle progression. In this review, we discuss the molecular mechanisms by which DNA damage is recognized by sensor proteins and signals are transmitted to Cdks. We classify the genes involved in checkpoint signaling into four categories, namely sensors, mediators, transducers and effectors, although their proteins have the broad activity, and thus this classification is for convenience and is not definitive. PMID:16314342

  9. Optical detection of DNA damage

    NASA Astrophysics Data System (ADS)

    Rogers, Kim R.; Apostol, A.; Cembrano, J.

    1999-02-01

    A rapid and sensitive fluorescence assay for oxidative damage to calf thymus DNA is reported. A decrease in the transition temperature for strand separation resulted from exposure of the DNA to the reactive decomposition products of 3- morpholinosydnonimine (SIN-1) (i.e., nitric oxide, superoxide, peroxynitrite, hydrogen peroxide, and hydroxyl radicals). A decrease in melting temperature of 12 degrees Celsius was indicative of oxidative damage including single strand chain breaks. Double stranded (ds) and single stranded (ss) forms of DNA were determined using the indicator dyes ethidium bromide and PicoGreen. The change in DNA 'melting' curves was dependant on the concentration of SIN-1 and was most pronounced at 75 degrees Celsius. This chemically induced damage was significantly inhibited by sodium citrate, tris(hydroxymethyl)aminomethane (Tris), and diethylenetriaminepentaacetic acid (DTPA), but was unaffected by superoxide dismutase (SOD), catalase, ethylenediamine tetraacietic acid (EDTA), or deferoxamine. Lowest observable effect level for SIN-1-induced damage was 200 (mu) M.

  10. Deciphering the DNA Damage Response.

    PubMed

    Haber, James E

    2015-09-10

    This year's Albert Lasker Basic Medical Research Award honors Evelyn Witkin and Stephen J. Elledge, two pioneers in elucidating the DNA damage response, whose contributions span more than 40 years. PMID:26359974

  11. Replicating Damaged DNA in Eukaryotes

    PubMed Central

    Chatterjee, Nimrat; Siede, Wolfram

    2013-01-01

    DNA damage is one of many possible perturbations that challenge the mechanisms that preserve genetic stability during the copying of the eukaryotic genome in S phase. This short review provides, in the first part, a general introduction to the topic and an overview of checkpoint responses. In the second part, the mechanisms of error-free tolerance in response to fork-arresting DNA damage will be discussed in some detail. PMID:24296172

  12. DNA damage in neurodegenerative diseases.

    PubMed

    Coppedè, Fabio; Migliore, Lucia

    2015-06-01

    Following the observation of increased oxidative DNA damage in nuclear and mitochondrial DNA extracted from post-mortem brain regions of patients affected by neurodegenerative diseases, the last years of the previous century and the first decade of the present one have been largely dedicated to the search of markers of DNA damage in neuronal samples and peripheral tissues of patients in early, intermediate or late stages of neurodegeneration. Those studies allowed to demonstrate that oxidative DNA damage is one of the earliest detectable events in neurodegeneration, but also revealed cytogenetic damage in neurodegenerative conditions, such as for example a tendency towards chromosome 21 malsegregation in Alzheimer's disease. As it happens for many neurodegenerative risk factors the question of whether DNA damage is cause or consequence of the neurodegenerative process is still open, and probably both is true. The research interest in markers of oxidative stress was shifted, in recent years, towards the search of epigenetic biomarkers of neurodegenerative disorders, following the accumulating evidence of a substantial contribution of epigenetic mechanisms to learning, memory processes, behavioural disorders and neurodegeneration. Increasing evidence is however linking DNA damage and repair with epigenetic phenomena, thereby opening the way to a very attractive and timely research topic in neurodegenerative diseases. We will address those issues in the context of Alzheimer's disease, Parkinson's disease, and Amyotrophic Lateral Sclerosis, which represent three of the most common neurodegenerative pathologies in humans. PMID:26255941

  13. Historical perspective on the DNA damage response.

    PubMed

    Hanawalt, Philip C

    2015-12-01

    The DNA damage response (DDR) has been broadly defined as a complex network of cellular pathways that cooperate to sense and repair lesions in DNA. Multiple types of DNA damage, some natural DNA sequences, nucleotide pool deficiencies and collisions with transcription complexes can cause replication arrest to elicit the DDR. However, in practice, the term DDR as applied to eukaryotic/mammalian cells often refers more specifically to pathways involving the activation of the ATM (ataxia-telangiectasia mutated) and ATR (ATM-Rad3-related) kinases in response to double-strand breaks or arrested replication forks, respectively. Nevertheless, there are distinct responses to particular types of DNA damage that do not involve ATM or ATR. In addition, some of the aberrations that cause replication arrest and elicit the DDR cannot be categorized as direct DNA damage. These include nucleotide pool deficiencies, nucleotide sequences that can adopt non-canonical DNA structures, and collisions between replication forks and transcription complexes. The response to these aberrations can be called the genomic stress response (GSR), a term that is meant to encompass the sensing of all types of DNA aberrations together with the mechanisms involved in coping with them. In addition to fully functional cells, the consequences of processing genomic aberrations may include mutagenesis, genomic rearrangements and lethality. PMID:26507443

  14. Sperm DNA oxidative damage and DNA adducts.

    PubMed

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  15. Types and Consequences of DNA Damage

    EPA Science Inventory

    This review provides a concise overview of the types of DNA damage and the molecular mechanisms by which a cell senses DNA damage, repairs the damage, converts the damage into a mutation, or dies as a consequence of unrepaired DNA damage. Such information is important in consid...

  16. DNA Damage and Pulmonary Hypertension

    PubMed Central

    Ranchoux, Benoît; Meloche, Jolyane; Paulin, Roxane; Boucherat, Olivier; Provencher, Steeve; Bonnet, Sébastien

    2016-01-01

    Pulmonary hypertension (PH) is defined by a mean pulmonary arterial pressure over 25 mmHg at rest and is diagnosed by right heart catheterization. Among the different groups of PH, pulmonary arterial hypertension (PAH) is characterized by a progressive obstruction of distal pulmonary arteries, related to endothelial cell dysfunction and vascular cell proliferation, which leads to an increased pulmonary vascular resistance, right ventricular hypertrophy, and right heart failure. Although the primary trigger of PAH remains unknown, oxidative stress and inflammation have been shown to play a key role in the development and progression of vascular remodeling. These factors are known to increase DNA damage that might favor the emergence of the proliferative and apoptosis-resistant phenotype observed in PAH vascular cells. High levels of DNA damage were reported to occur in PAH lungs and remodeled arteries as well as in animal models of PH. Moreover, recent studies have demonstrated that impaired DNA-response mechanisms may lead to an increased mutagen sensitivity in PAH patients. Finally, PAH was linked with decreased breast cancer 1 protein (BRCA1) and DNA topoisomerase 2-binding protein 1 (TopBP1) expression, both involved in maintaining genome integrity. This review aims to provide an overview of recent evidence of DNA damage and DNA repair deficiency and their implication in PAH pathogenesis. PMID:27338373

  17. DNA Damage and Pulmonary Hypertension.

    PubMed

    Ranchoux, Benoît; Meloche, Jolyane; Paulin, Roxane; Boucherat, Olivier; Provencher, Steeve; Bonnet, Sébastien

    2016-01-01

    Pulmonary hypertension (PH) is defined by a mean pulmonary arterial pressure over 25 mmHg at rest and is diagnosed by right heart catheterization. Among the different groups of PH, pulmonary arterial hypertension (PAH) is characterized by a progressive obstruction of distal pulmonary arteries, related to endothelial cell dysfunction and vascular cell proliferation, which leads to an increased pulmonary vascular resistance, right ventricular hypertrophy, and right heart failure. Although the primary trigger of PAH remains unknown, oxidative stress and inflammation have been shown to play a key role in the development and progression of vascular remodeling. These factors are known to increase DNA damage that might favor the emergence of the proliferative and apoptosis-resistant phenotype observed in PAH vascular cells. High levels of DNA damage were reported to occur in PAH lungs and remodeled arteries as well as in animal models of PH. Moreover, recent studies have demonstrated that impaired DNA-response mechanisms may lead to an increased mutagen sensitivity in PAH patients. Finally, PAH was linked with decreased breast cancer 1 protein (BRCA1) and DNA topoisomerase 2-binding protein 1 (TopBP1) expression, both involved in maintaining genome integrity. This review aims to provide an overview of recent evidence of DNA damage and DNA repair deficiency and their implication in PAH pathogenesis. PMID:27338373

  18. DNA Damage and Repair in Vascular Disease.

    PubMed

    Uryga, Anna; Gray, Kelly; Bennett, Martin

    2016-01-01

    DNA damage affecting both genomic and mitochondrial DNA is present in a variety of both inherited and acquired vascular diseases. Multiple cell types show persistent DNA damage and a range of lesions. In turn, DNA damage activates a variety of DNA repair mechanisms, many of which are activated in vascular disease. Such DNA repair mechanisms either stall the cell cycle to allow repair to occur or trigger apoptosis or cell senescence to prevent propagation of damaged DNA. Recent evidence has indicated that DNA damage occurs early, is progressive, and is sufficient to impair function of cells composing the vascular wall. The consequences of persistent genomic and mitochondrial DNA damage, including inflammation, cell senescence, and apoptosis, are present in vascular disease. DNA damage can thus directly cause vascular disease, opening up new possibilities for both prevention and treatment. We review the evidence for and the causes, types, and consequences of DNA damage in vascular disease. PMID:26442438

  19. DNA damage induction of ribonucleotide reductase.

    PubMed Central

    Elledge, S J; Davis, R W

    1989-01-01

    RNR2 encodes the small subunit of ribonucleotide reductase, the enzyme that catalyzes the first step in the pathway for the production of deoxyribonucleotides needed for DNA synthesis. RNR2 is a member of a group of genes whose activities are cell cycle regulated and that are transcriptionally induced in response to the stress of DNA damage. An RNR2-lacZ fusion was used to further characterize the regulation of RNR2 and the pathway responsible for its response to DNA damage. beta-Galactosidase activity in yeast strains containing the RNR2-lacZ fusion was inducible in response to DNA-damaging agents (UV light, 4-nitroquinoline-1-oxide [4-NQO], and methyl methanesulfonate [MMS]) and agents that block DNA replication (hydroxyurea [HU] and methotrexate) but not heat shock. When MATa cells were arrested in G1 by alpha-factor, RNR2 mRNA was still inducible by DNA damage, indicating that the observed induction can occur outside of S phase. In addition, RNR2 induction was not blocked by the presence of cycloheximide and is therefore likely to be independent of protein synthesis. A mutation, rnr2-314, was found to confer hypersensitivity to HU and increased sensitivity to MMS. In rnr2-314 mutant strains, the DNA damage stress response was found to be partially constitutive as well as hypersensitive to induction by HU but not MMS. The induction properties of RNR2 were examined in a rad4-2 mutant background; in this genetic background, RNR2 was hypersensitive to induction by 4-NQO but not MMS. Induction of the RNR2-lacZ fusion in a RAD(+) strain in response to 4-NQO was not enhanced by the presence of an equal number of rad4-2 cells that lacked the fusion, implying that the DNA damage stress response in cell autonomous. Images PMID:2513480

  20. Method for assaying clustered DNA damages

    DOEpatents

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  1. Targeting DNA damage response in cancer therapy

    PubMed Central

    Hosoya, Noriko; Miyagawa, Kiyoshi

    2014-01-01

    Cancer chemotherapy and radiotherapy are designed to kill cancer cells mostly by inducing DNA damage. DNA damage is normally recognized and repaired by the intrinsic DNA damage response machinery. If the damaged lesions are successfully repaired, the cells will survive. In order to specifically and effectively kill cancer cells by therapies that induce DNA damage, it is important to take advantage of specific abnormalities in the DNA damage response machinery that are present in cancer cells but not in normal cells. Such properties of cancer cells can provide biomarkers or targets for sensitization. For example, defects or upregulation of the specific pathways that recognize or repair specific types of DNA damage can serve as biomarkers of favorable or poor response to therapies that induce such types of DNA damage. Inhibition of a DNA damage response pathway may enhance the therapeutic effects in combination with the DNA-damaging agents. Moreover, it may also be useful as a monotherapy when it achieves synthetic lethality, in which inhibition of a complementary DNA damage response pathway selectively kills cancer cells that have a defect in a particular DNA repair pathway. The most striking application of this strategy is the treatment of cancers deficient in homologous recombination by poly(ADP-ribose) polymerase inhibitors. In this review, we describe the impact of targeting the cancer-specific aberrations in the DNA damage response by explaining how these treatment strategies are currently being evaluated in preclinical or clinical trials. PMID:24484288

  2. DNA damage checkpoint, damage repair, and genome stability.

    PubMed

    Liu, Wei-Feng; Yu, Shan-Shan; Chen, Guan-Jun; Li, Yue-Zhong

    2006-05-01

    Genomic DNA is under constant attack from both endogenous and exogenous sources of DNA damaging agents. Without proper care, the ensuing DNA damages would lead to alteration of genomic structure thus affecting the faithful transmission of genetic information. During the process of evolution, organisms have acquired a series of mechanisms responding to and repairing DNA damage, thus assuring the maintenance of genome stability and faithful transmission of genetic information. DNA damage checkpoint is one such important mechanism by which, in the face of DNA damage, a cell can respond to amplified damage signals, either by actively halting the cell cycle until it ensures that critical processes such as DNA replication or mitosis are complete or by initiating apoptosis as a last resort. Over the last decade, complex hierarchical interactions between the key components like ATM/ATR in the checkpoint pathway and various other mediators, effectors including DNA damage repair proteins have begun to emerge. In the meantime, an intimate relationship between mechanisms of damage checkpoint pathway, DNA damage repair, and genome stability was also uncovered. Reviewed herein are the recent findings on both the mechanisms of activation of checkpoint pathways and their coordination with DNA damage repair machinery as well as their effect on genomic integrity. PMID:16722332

  3. Oxidation of DNA: damage to nucleobases.

    PubMed

    Kanvah, Sriram; Joseph, Joshy; Schuster, Gary B; Barnett, Robert N; Cleveland, Charles L; Landman, Uzi

    2010-02-16

    All organisms store the information necessary to maintain life in their DNA. Any process that damages DNA, causing a loss or corruption of that information, jeopardizes the viability of the organism. One-electron oxidation is such a process. In this Account, we address three of the central features of one-electron oxidation of DNA: (i) the migration of the radical cation away from the site of its formation; (ii) the electronic and structural factors that determine the nucleobases at which irreversible reactions most readily occur; (iii) the mechanism of reaction for nucleobase radical cations. The loss of an electron (ionization) from DNA generates an electron "hole" (a radical cation), located most often on its nucleobases, that migrates reversibly through duplex DNA by hopping until it is trapped in an irreversible chemical reaction. The particular sequence of nucleobases in a DNA oligomer determines both the efficiency of hopping and the specific location and nature of the damaging chemical reaction. In aqueous solution, DNA is a polyanion because of the negative charge carried by its phosphate groups. Counterions to the phosphate groups (typically Na(+)) play an important role in facilitating both hopping and the eventual reaction of the radical cation with H(2)O. Irreversible reaction of a radical cation with H(2)O in duplex DNA occurs preferentially at the most reactive site. In normal DNA, comprising the four common DNA nucleobases G, C, A, and T, reaction occurs most commonly at a guanine, resulting in its conversion primarily to 8-oxo-7,8-dihydroguanine (8-OxoG). Both electronic and steric effects control the outcome of this process. If the DNA oligomer does not contain a suitable guanine, then reaction of the radical cation occurs at the thymine of a TT step, primarily by a tandem process. The oxidative damage of DNA is a complex process, influenced by charge transport and reactions that are controlled by a combination of enthalpic, entropic, steric, and

  4. Oxidative DNA Damage and Nucleotide Excision Repair

    PubMed Central

    Melis, Joost P.M.; Luijten, Mirjam

    2013-01-01

    Abstract Significance: Oxidative DNA damage is repaired by multiple, overlapping DNA repair pathways. Accumulating evidence supports the hypothesis that nucleotide excision repair (NER), besides base excision repair (BER), is also involved in neutralizing oxidative DNA damage. Recent Advances: NER includes two distinct sub-pathways: transcription-coupled NER (TC-NER) and global genome repair (GG-NER). The CSA and CSB proteins initiate the onset of TC-NER. Recent findings show that not only CSB, but also CSA is involved in the repair of oxidative DNA lesions, in the nucleus as well as in mitochondria. The XPG protein is also of importance for the removal of oxidative DNA lesions, as it may enhance the initial step of BER. Substantial evidence exists that support a role for XPC in NER and BER. XPC deficiency not only results in decreased repair of oxidative lesions, but has also been linked to disturbed redox homeostasis. Critical Issues: The role of NER proteins in the regulation of the cellular response to oxidative (mitochondrial and nuclear) DNA damage may be the underlying mechanism of the pathology of accelerated aging in Cockayne syndrome patients, a driving force for internal cancer development in XP-A and XP-C patients, and a contributor to the mixed exhibited phenotypes of XP-G patients. Future Directions: Accumulating evidence indicates that DNA repair factors can be involved in multiple DNA repair pathways. However, the distinct detailed mechanism and consequences of these additional functions remain to be elucidated and can possibly shine a light on clinically related issues. Antioxid. Redox Signal. 18, 2409–2419. PMID:23216312

  5. MicroRNA response to DNA damage

    PubMed Central

    Wan, Guohui; Mathur, Rohit; Hu, Xiaoxiao; Zhang, Xinna; Lu, Xiongbin

    2011-01-01

    Faithful transmission of genetic material in eukaryotic cells requires not only accurate DNA replication and chromosome distribution, but also the ability to sense and repair spontaneous and induced DNA damage. To maintain genomic integrity, cells undergo a DNA damage response using a complex network of signaling pathways, composed of coordinate sensors, transducers and effectors in cell cycle arrest, apoptosis and DNA repair. Emerging evidence has suggested that microRNAs (miRNAs) play a critical role in regulation of DNA damage response. Here, we discuss the recent findings on how miRNAs interact with the canonical DNA damage response and how miRNA expression is regulated after DNA damage. PMID:21741842

  6. Impact of Alternative DNA Structures on DNA Damage, DNA Repair, and Genetic Instability

    PubMed Central

    Wang, Guliang; Vasquez, Karen M.

    2014-01-01

    Repetitive genomic sequences can adopt a number of alternative DNA structures that differ from the canonical B-form duplex (i.e. non-B DNA). These non-B DNA-forming sequences have been shown to have many important biological functions related to DNA metabolic processes; for example, they may have regulatory roles in DNA transcription and replication. In addition to these regulatory functions, non-B DNA can stimulate genetic instability in the presence or absence of DNA damage, via replication-dependent and/or replication-independent pathways. This review focuses on the interactions of non-B DNA conformations with DNA repair proteins and how these interactions impact genetic instability. PMID:24767258

  7. Metabolic activation of carcinogenic ethylbenzene leads to oxidative DNA damage.

    PubMed

    Midorikawa, Kaoru; Uchida, Takafumi; Okamoto, Yoshinori; Toda, Chitose; Sakai, Yoshie; Ueda, Koji; Hiraku, Yusuke; Murata, Mariko; Kawanishi, Shosuke; Kojima, Nakao

    2004-12-01

    Ethylbenzene is carcinogenic to rats and mice, while it has no mutagenic activity. We have investigated whether ethylbenzene undergoes metabolic activation, leading to DNA damage. Ethylbenzene was metabolized to 1-phenylethanol, acetophenone, 2-ethylphenol and 4-ethylphenol by rat liver microsomes. Furthermore, 2-ethylphenol and 4-ethylphenol were metabolically transformed to ring-dihydroxylated metabolites such as ethylhydroquinone and 4-ethylcatechol, respectively. Experiment with 32P-labeled DNA fragment revealed that both ethylhydroquinone and 4-ethylcatechol caused DNA damage in the presence of Cu(II). These dihydroxylated compounds also induced the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine in calf thymus DNA in the presence of Cu(II). Catalase, methional and Cu(I)-specific chelator, bathocuproine, significantly (P<0.05) inhibited oxidative DNA damage, whereas free hydroxyl radical scavenger and superoxide dismutase did not. These results suggest that Cu(I) and H2O2 produced via oxidation of ethylhydroquinone and 4-ethylcatechol are involved in oxidative DNA damage. Addition of an endogenous reductant NADH dramatically enhanced 4-ethylcatechol-induced oxidative DNA damage, whereas ethylhydroquinone-induced DNA damage was slightly enhanced. Enhancing effect of NADH on oxidative DNA damage by 4-ethylcatechol may be explained by assuming that reactive species are generated from the redox cycle. In conclusion, these active dihydroxylated metabolites would be involved in the mechanism of carcinogenesis by ethylbenzene. PMID:15560893

  8. Cellular responses to environmental DNA damage

    SciTech Connect

    Not Available

    1994-08-01

    This volume contains the proceedings of the conference entitled Cellular Responses to Environmental DNA Damage held in Banff,Alberta December 1--6, 1991. The conference addresses various aspects of DNA repair in sessions titled DNA repair; Basic Mechanisms; Lesions; Systems; Inducible Responses; Mutagenesis; Human Population Response Heterogeneity; Intragenomic DNA Repair Heterogeneity; DNA Repair Gene Cloning; Aging; Human Genetic Disease; and Carcinogenesis. Individual papers are represented as abstracts of about one page in length.

  9. DNA Damage Signals and Space Radiation Risk

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.

    2011-01-01

    Space radiation is comprised of high-energy and charge (HZE) nuclei and protons. The initial DNA damage from HZE nuclei is qualitatively different from X-rays or gamma rays due to the clustering of damage sites which increases their complexity. Clustering of DNA damage occurs on several scales. First there is clustering of single strand breaks (SSB), double strand breaks (DSB), and base damage within a few to several hundred base pairs (bp). A second form of damage clustering occurs on the scale of a few kbp where several DSB?s may be induced by single HZE nuclei. These forms of damage clusters do not occur at low to moderate doses of X-rays or gamma rays thus presenting new challenges to DNA repair systems. We review current knowledge of differences that occur in DNA repair pathways for different types of radiation and possible relationships to mutations, chromosomal aberrations and cancer risks.

  10. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.

    2016-01-01

    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  11. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  12. Stress-induced DNA damage biomarkers: applications and limitations.

    PubMed

    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  13. Chimeric Proteins to Detect DNA Damage and Mismatches

    SciTech Connect

    McCutchen-Maloney, S; Malfatti, M; Robbins, K M

    2002-01-14

    The goal of this project was to develop chimeric proteins composed of a DNA mismatch or damage binding protein and a nuclease, as well as methods to detect DNA mismatches and damage. We accomplished this through protein engineering based on using polymerase chain reactions (PCRs) to create chimeras with novel functions for damage and mismatch detection. This project addressed fundamental questions relating to disease susceptibility and radiation-induced damage in cells. It also supported and enhanced LLNL's competency in the emerging field of proteomics. In nature, DNA is constantly being subjected to damaging agents such as exposure to ultraviolet (UV) radiation and various environmental and dietary carcinogens. If DNA damage is not repaired however, mutations in DNA result that can eventually manifest in cancer and other diseases. In addition to damage-induced DNA mutations, single nucleotide polymorphisms (SNPs), which are variations in the genetic sequence between individuals, may predispose some to disease. As a result of the Human Genome Project, the integrity of a person's DNA can now be monitored. Therefore, methods to detect DNA damage, mutations, and SNPs are useful not only in basic research but also in the health and biotechnology industries. Current methods of detection often use radioactive labeling and rely on expensive instrumentation that is not readily available in many research settings. Our methods to detect DNA damage and mismatches employ simple gel electrophoresis and flow cytometry, thereby alleviating the need for radioactive labeling and expensive equipment. In FY2001, we explored SNP detection by developing methods based on the ability of the chimeric proteins to detect mismatches. Using multiplex assays with flow cytometry and fluorescent beads to which the DNA substrates where attached, we showed that several of the chimeras possess greater affinity for damaged and mismatched DNA than for native DNA. This affinity was demonstrated in

  14. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.

    2013-01-01

    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  15. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  16. Ubiquitylation, neddylation and the DNA damage response

    PubMed Central

    Brown, Jessica S.; Jackson, Stephen P.

    2015-01-01

    Failure of accurate DNA damage sensing and repair mechanisms manifests as a variety of human diseases, including neurodegenerative disorders, immunodeficiency, infertility and cancer. The accuracy and efficiency of DNA damage detection and repair, collectively termed the DNA damage response (DDR), requires the recruitment and subsequent post-translational modification (PTM) of a complex network of proteins. Ubiquitin and the ubiquitin-like protein (UBL) SUMO have established roles in regulating the cellular response to DNA double-strand breaks (DSBs). A role for other UBLs, such as NEDD8, is also now emerging. This article provides an overview of the DDR, discusses our current understanding of the process and function of PTM by ubiquitin and NEDD8, and reviews the literature surrounding the role of ubiquitylation and neddylation in DNA repair processes, focusing particularly on DNA DSB repair. PMID:25833379

  17. PCR-Based Analysis of Mitochondrial DNA Copy Number, Mitochondrial DNA Damage, and Nuclear DNA Damage.

    PubMed

    Gonzalez-Hunt, Claudia P; Rooney, John P; Ryde, Ian T; Anbalagan, Charumathi; Joglekar, Rashmi; Meyer, Joel N

    2016-01-01

    Because of the role that DNA damage and depletion play in human disease, it is important to develop and improve tools to assess these endpoints. This unit describes PCR-based methods to measure nuclear and mitochondrial DNA damage and copy number. Long amplicon quantitative polymerase chain reaction (LA-QPCR) is used to detect DNA damage by measuring the number of polymerase-inhibiting lesions present based on the amount of PCR amplification; real-time PCR (RT-PCR) is used to calculate genome content. In this unit, we provide step-by-step instructions to perform these assays in Homo sapiens, Mus musculus, Rattus norvegicus, Caenorhabditis elegans, Drosophila melanogaster, Danio rerio, Oryzias latipes, Fundulus grandis, and Fundulus heteroclitus, and discuss the advantages and disadvantages of these assays. PMID:26828332

  18. PCR-based analysis of mitochondrial DNA copy number, mitochondrial DNA damage, and nuclear DNA damage

    PubMed Central

    Gonzalez-Hunt, Claudia P.; Rooney, John P.; Ryde, Ian T.; Anbalagan, Charumathi; Joglekar, Rashmi

    2016-01-01

    Because of the role DNA damage and depletion play in human disease, it is important to develop and improve tools to assess these endpoints. This unit describes PCR-based methods to measure nuclear and mitochondrial DNA damage and copy number. Long amplicon quantitative polymerase chain reaction (LA-QPCR) is used to detect DNA damage by measuring the number of polymerase-inhibiting lesions present based on the amount of PCR amplification; real-time PCR (RT-PCR) is used to calculate genome content. In this unit we provide step-by-step instructions to perform these assays in Homo sapiens, Mus musculus, Rattus norvegicus, Caenorhabditis elegans, Drosophila melanogaster, Danio rerio, Oryzias latipes, Fundulus grandis, and Fundulus heteroclitus, and discuss the advantages and disadvantages of these assays. PMID:26828332

  19. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik

    2013-01-01

    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  20. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.

    PubMed

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  1. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  2. Age to survive: DNA damage and aging.

    PubMed

    Schumacher, Björn; Garinis, George A; Hoeijmakers, Jan H J

    2008-02-01

    Aging represents the progressive functional decline and increased mortality risk common to nearly all metazoans. Recent findings experimentally link DNA damage and organismal aging: longevity-regulating genetic pathways respond to the accumulation of DNA damage and other stress conditions and conversely influence the rate of damage accumulation and its impact for cancer and aging. This novel insight has emerged from studies on human progeroid diseases and mouse models that have deficient DNA repair pathways. Here we discuss a unified concept of an evolutionarily conserved 'survival' response that shifts the organism's resources from growth to maintenance as an adaptation to stresses, such as starvation and DNA damage. This shift protects the organism from cancer and promotes healthy aging. PMID:18192065

  3. The RNA Splicing Response to DNA Damage.

    PubMed

    Shkreta, Lulzim; Chabot, Benoit

    2015-01-01

    The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging. PMID:26529031

  4. The RNA Splicing Response to DNA Damage

    PubMed Central

    Shkreta, Lulzim; Chabot, Benoit

    2015-01-01

    The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging. PMID:26529031

  5. Homologous recombination maintenance of genome integrity during DNA damage tolerance

    PubMed Central

    Prado, Félix

    2014-01-01

    The DNA strand exchange protein Rad51 provides a safe mechanism for the repair of DNA breaks using the information of a homologous DNA template. Homologous recombination (HR) also plays a key role in the response to DNA damage that impairs the advance of the replication forks by providing mechanisms to circumvent the lesion and fill in the tracks of single-stranded DNA that are generated during the process of lesion bypass. These activities postpone repair of the blocking lesion to ensure that DNA replication is completed in a timely manner. Experimental evidence generated over the last few years indicates that HR participates in this DNA damage tolerance response together with additional error-free (template switch) and error-prone (translesion synthesis) mechanisms through intricate connections, which are presented here. The choice between repair and tolerance, and the mechanism of tolerance, is critical to avoid increased mutagenesis and/or genome rearrangements, which are both hallmarks of cancer. PMID:27308329

  6. DNA damage responses in mammalian oocytes.

    PubMed

    Collins, Josie K; Jones, Keith T

    2016-07-01

    DNA damage acquired during meiosis can lead to infertility and miscarriage. Hence, it should be important for an oocyte to be able to detect and respond to such events in order to make a healthy egg. Here, the strategies taken by oocytes during their stages of growth to respond to DNA damaging events are reviewed. In particular, recent evidence of a novel pathway in fully grown oocytes helps prevent the formation of mature eggs with DNA damage. It has been found that fully grown germinal vesicle stage oocytes that have been DNA damaged do not arrest at this point in meiosis, but instead undergo meiotic resumption and stall during the first meiotic division. The Spindle Assembly Checkpoint, which is a well-known mitotic pathway employed by somatic cells to monitor chromosome attachment to spindle microtubules, appears to be utilised by oocytes also to respond to DNA damage. As such maturing oocytes are arrested at metaphase I due to an active Spindle Assembly Checkpoint. This is surprising given this checkpoint has been previously studied in oocytes and considered to be weak and ineffectual because of its poor ability to be activated in response to microtubule attachment errors. Therefore, the involvement of the Spindle Assembly Checkpoint in DNA damage responses of mature oocytes during meiosis I uncovers a novel second function for this ubiquitous cellular checkpoint. PMID:27069010

  7. DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

    SciTech Connect

    SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

    2004-03-24

    Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNA populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.

  8. DNA damage may drive nucleosomal reorganization to facilitate damage detection

    NASA Astrophysics Data System (ADS)

    LeGresley, Sarah E.; Wilt, Jamie; Antonik, Matthew

    2014-03-01

    One issue in genome maintenance is how DNA repair proteins find lesions at rates that seem to exceed diffusion-limited search rates. We propose a phenomenon where DNA damage induces nucleosomal rearrangements which move lesions to potential rendezvous points in the chromatin structure. These rendezvous points are the dyad and the linker DNA between histones, positions in the chromatin which are more likely to be accessible by repair proteins engaged in a random search. The feasibility of this mechanism is tested by considering the statistical mechanics of DNA containing a single lesion wrapped onto the nucleosome. We consider lesions which make the DNA either more flexible or more rigid by modeling the lesion as either a decrease or an increase in the bending energy. We include this energy in a partition function model of nucleosome breathing. Our results indicate that the steady state for a breathing nucleosome will most likely position the lesion at the dyad or in the linker, depending on the energy of the lesion. A role for DNA binding proteins and chromatin remodelers is suggested based on their ability to alter the mechanical properties of the DNA and DNA-histone binding, respectively. We speculate that these positions around the nucleosome potentially serve as rendezvous points where DNA lesions may be encountered by repair proteins which may be sterically hindered from searching the rest of the nucleosomal DNA. The strength of the repositioning is strongly dependent on the structural details of the DNA lesion and the wrapping and breathing of the nucleosome. A more sophisticated evaluation of this proposed mechanism will require detailed information about breathing dynamics, the structure of partially wrapped nucleosomes, and the structural properties of damaged DNA.

  9. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis

    PubMed Central

    Mukherjee, Anirban; Vasquez, Karen M.

    2012-01-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. PMID:21501652

  10. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. PMID:21501652

  11. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  12. Chromatin Remodeling, DNA Damage Repair and Aging

    PubMed Central

    Liu, Baohua; Yip, Raymond KH; Zhou, Zhongjun

    2012-01-01

    Cells are constantly exposed to a variety of environmental and endogenous conditions causing DNA damage, which is detected and repaired by conserved DNA repair pathways to maintain genomic integrity. Chromatin remodeling is critical in this process, as the organization of eukaryotic DNA into compact chromatin presents a natural barrier to all DNA-related events. Studies on human premature aging syndromes together with normal aging have suggested that accumulated damages might lead to exhaustion of resources that are required for physiological functions and thus accelerate aging. In this manuscript, combining the present understandings and latest findings, we focus mainly on discussing the role of chromatin remodeling in the repair of DNA double-strand breaks (DSBs) and regulation of aging. PMID:23633913

  13. DICER, DROSHA and DNA damage response RNAs are necessary for the secondary recruitment of DNA damage response factors.

    PubMed

    Francia, Sofia; Cabrini, Matteo; Matti, Valentina; Oldani, Amanda; d'Adda di Fagagna, Fabrizio

    2016-04-01

    The DNA damage response (DDR) plays a central role in preserving genome integrity. Recently, we reported that the endoribonucleases DICER and DROSHA contribute to DDR activation by generating small non-coding RNAs, termed DNA damage response RNA (DDRNA), carrying the sequence of the damaged locus. It is presently unclear whether DDRNAs act by promoting the primary recognition of DNA lesions or the secondary recruitment of DDR factors into cytologically detectable foci and consequent signal amplification. Here, we demonstrate that DICER and DROSHA are dispensable for primary recruitment of the DDR sensor NBS1 to DNA damage sites. Instead, the accumulation of the DDR mediators MDC1 and 53BP1 (also known as TP53BP1), markers of secondary recruitment, is reduced in DICER- or DROSHA-inactivated cells. In addition, NBS1 (also known as NBN) primary recruitment is resistant to RNA degradation, consistent with the notion that RNA is dispensable for primary recognition of DNA lesions. We propose that DICER, DROSHA and DDRNAs act in the response to DNA damage after primary recognition of DNA lesions and, together with γH2AX, are essential for enabling the secondary recruitment of DDR factors and fuel the amplification of DDR signaling. PMID:26906421

  14. DICER, DROSHA and DNA damage response RNAs are necessary for the secondary recruitment of DNA damage response factors

    PubMed Central

    Francia, Sofia; Cabrini, Matteo; Matti, Valentina; Oldani, Amanda; d'Adda di Fagagna, Fabrizio

    2016-01-01

    ABSTRACT The DNA damage response (DDR) plays a central role in preserving genome integrity. Recently, we reported that the endoribonucleases DICER and DROSHA contribute to DDR activation by generating small non-coding RNAs, termed DNA damage response RNA (DDRNA), carrying the sequence of the damaged locus. It is presently unclear whether DDRNAs act by promoting the primary recognition of DNA lesions or the secondary recruitment of DDR factors into cytologically detectable foci and consequent signal amplification. Here, we demonstrate that DICER and DROSHA are dispensable for primary recruitment of the DDR sensor NBS1 to DNA damage sites. Instead, the accumulation of the DDR mediators MDC1 and 53BP1 (also known as TP53BP1), markers of secondary recruitment, is reduced in DICER- or DROSHA-inactivated cells. In addition, NBS1 (also known as NBN) primary recruitment is resistant to RNA degradation, consistent with the notion that RNA is dispensable for primary recognition of DNA lesions. We propose that DICER, DROSHA and DDRNAs act in the response to DNA damage after primary recognition of DNA lesions and, together with γH2AX, are essential for enabling the secondary recruitment of DDR factors and fuel the amplification of DDR signaling. PMID:26906421

  15. Epigenome Maintenance in Response to DNA Damage.

    PubMed

    Dabin, Juliette; Fortuny, Anna; Polo, Sophie E

    2016-06-01

    Organism viability relies on the stable maintenance of specific chromatin landscapes, established during development, that shape cell functions and identities by driving distinct gene expression programs. Yet epigenome maintenance is challenged during transcription, replication, and repair of DNA damage, all of which elicit dynamic changes in chromatin organization. Here, we review recent advances that have shed light on the specialized mechanisms contributing to the restoration of epigenome structure and function after DNA damage in the mammalian cell nucleus. By drawing a parallel with epigenome maintenance during replication, we explore emerging concepts and highlight open issues in this rapidly growing field. In particular, we present our current knowledge of molecular players that support the coordinated maintenance of genome and epigenome integrity in response to DNA damage, and we highlight how nuclear organization impacts genome stability. Finally, we discuss possible functional implications of epigenome plasticity in response to genotoxic stress. PMID:27259203

  16. Molecular mechanisms involved in initiation of the DNA damage response

    PubMed Central

    Barnum, Kevin J; O’Connell, Matthew J

    2015-01-01

    DNA is subject to a wide variety of damage. In order to maintain genomic integrity, cells must respond to this damage by activating repair and cell cycle checkpoint pathways. The initiating events in the DNA damage response entail recognition of the lesion and the assembly of DNA damage response complexes at the DNA. Here, we review what is known about these processes for various DNA damage pathways. PMID:27308403

  17. The RNA Response to DNA Damage.

    PubMed

    Giono, Luciana E; Nieto Moreno, Nicolás; Cambindo Botto, Adrián E; Dujardin, Gwendal; Muñoz, Manuel J; Kornblihtt, Alberto R

    2016-06-19

    Multicellular organisms must ensure genome integrity to prevent accumulation of mutations, cell death, and cancer. The DNA damage response (DDR) is a complex network that senses, signals, and executes multiple programs including DNA repair, cell cycle arrest, senescence, and apoptosis. This entails regulation of a variety of cellular processes: DNA replication and transcription, RNA processing, mRNA translation and turnover, and post-translational modification, degradation, and relocalization of proteins. Accumulated evidence over the past decades has shown that RNAs and RNA metabolism are both regulators and regulated actors of the DDR. This review aims to present a comprehensive overview of the current knowledge on the many interactions between the DNA damage and RNA fields. PMID:26979557

  18. Detection of Damaged DNA Bases by DNA Glycosylase Enzymes†

    PubMed Central

    Friedman, Joshua I.; Stivers, James T.

    2010-01-01

    A fundamental and shared process in all forms of life is the use of DNA glycosylase enzymes to excise rare damaged bases from genomic DNA. Without such enzymes, the highly-ordered primary sequences of genes would rapidly deteriorate. Recent structural and biophysical studies are beginning to reveal a fascinating multistep mechanism for damaged base detection that begins with short-range sliding of the glycosylase along the DNA chain in a distinct conformation we refer to as the search complex (SC). Sliding is frequently punctuated by the formation of a transient “interrogation” complex (IC) where the enzyme extrahelically inspects both normal and damaged bases in an exosite pocket that is distant from the active site. When normal bases are presented in the exosite, the IC rapidly collapses back to the SC, while a damaged base will efficiently partition forward into the active site to form the catalytically competent excision complex (EC). Here we review the unique problems associated with enzymatic detection of rare damaged DNA bases in the genome, and emphasize how each complex must have specific dynamic properties that are tuned to optimize the rate and efficiency of damage site location. PMID:20469926

  19. UV damage in DNA promotes nucleosome unwrapping.

    PubMed

    Duan, Ming-Rui; Smerdon, Michael J

    2010-08-20

    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA damage by UV radiation. We find that FRET efficiency is reduced in a dose-dependent manner, showing that the presence of UV photoproducts enhances spontaneous unwrapping of DNA from histones. Furthermore, this UV-induced shift in unwrapping dynamics is associated with increased restriction enzyme accessibility of histone-bound DNA after UV treatment. Surprisingly, the increased unwrapping dynamics is even observed in nucleosome core particles containing a single UV lesion at a specific site. These results highlight the potential for increased "intrinsic exposure" of nucleosome-associated DNA lesions in chromatin to repair proteins. PMID:20562439

  20. FIBER OPTIC BIOSENSOR FOR DNA DAMAGE

    EPA Science Inventory

    This paper describes a fiber optic biosensor for the rapid and sensitive detection of radiation-induced or chemically-induced oxidative DNA damage. The assay is based on the hybridization and temperature-induced dissociation (melting curves) of synthetic oligonucleotides. The...

  1. DNA Damage and Aging Around the Clock.

    PubMed

    Gutierrez-Martinez, Paula; Rossi, Derrick J; Beerman, Isabel

    2016-08-01

    The hematopoietic system undergoes many changes during aging, but the causes and molecular mechanisms behind these changes are not well understood. Wang et al. have recently implicated a circadian rhythm gene, Per2, as playing a role in the DNA damage response and in the expression of lymphoid genes in aged hematopoietic stem cells. PMID:27345866

  2. Activation of the DNA Damage Response by RNA Viruses.

    PubMed

    Ryan, Ellis L; Hollingworth, Robert; Grand, Roger J

    2016-01-01

    RNA viruses are a genetically diverse group of pathogens that are responsible for some of the most prevalent and lethal human diseases. Numerous viruses introduce DNA damage and genetic instability in host cells during their lifecycles and some species also manipulate components of the DNA damage response (DDR), a complex and sophisticated series of cellular pathways that have evolved to detect and repair DNA lesions. Activation and manipulation of the DDR by DNA viruses has been extensively studied. It is apparent, however, that many RNA viruses can also induce significant DNA damage, even in cases where viral replication takes place exclusively in the cytoplasm. DNA damage can contribute to the pathogenesis of RNA viruses through the triggering of apoptosis, stimulation of inflammatory immune responses and the introduction of deleterious mutations that can increase the risk of tumorigenesis. In addition, activation of DDR pathways can contribute positively to replication of viral RNA genomes. Elucidation of the interactions between RNA viruses and the DDR has provided important insights into modulation of host cell functions by these pathogens. This review summarises the current literature regarding activation and manipulation of the DDR by several medically important RNA viruses. PMID:26751489

  3. Activation of the DNA Damage Response by RNA Viruses

    PubMed Central

    Ryan, Ellis L.; Hollingworth, Robert; Grand, Roger J.

    2016-01-01

    RNA viruses are a genetically diverse group of pathogens that are responsible for some of the most prevalent and lethal human diseases. Numerous viruses introduce DNA damage and genetic instability in host cells during their lifecycles and some species also manipulate components of the DNA damage response (DDR), a complex and sophisticated series of cellular pathways that have evolved to detect and repair DNA lesions. Activation and manipulation of the DDR by DNA viruses has been extensively studied. It is apparent, however, that many RNA viruses can also induce significant DNA damage, even in cases where viral replication takes place exclusively in the cytoplasm. DNA damage can contribute to the pathogenesis of RNA viruses through the triggering of apoptosis, stimulation of inflammatory immune responses and the introduction of deleterious mutations that can increase the risk of tumorigenesis. In addition, activation of DDR pathways can contribute positively to replication of viral RNA genomes. Elucidation of the interactions between RNA viruses and the DDR has provided important insights into modulation of host cell functions by these pathogens. This review summarises the current literature regarding activation and manipulation of the DDR by several medically important RNA viruses. PMID:26751489

  4. Complexities of the DNA Base Excision Repair Pathway for Repair of Oxidative DNA Damage

    PubMed Central

    Mitra, Sankar; Boldogh, Istvan; Izumi, Tadahide; Hazra, Tapas K.

    2016-01-01

    Oxidative damage represents the most significant insult to organisms because of continuous production of the reactive oxygen species (ROS) in vivo. Oxidative damage in DNA, a critical target of ROS, is repaired primarily via the base excision repair (BER) pathway which appears to be the simplest among the three excision repair pathways. However, it is now evident that although BER can be carried with four or five enzymes in vitro, a large number of proteins, including some required for nucleotide excision repair (NER), are needed for in vivo repair of oxidative damage. Furthermore, BER in transcribed vs. nontranscribed DNA regions requires distinct sets of proteins, as in the case of NER. We propose an additional complexity in repair of replicating vs. nonreplicating DNA. Unlike DNA bulky adducts, the oxidized base lesions could be incorporated in the nascent DNA strand, repair of which may share components of the mismatch repair process. Distinct enzyme specificities are thus warranted for repair of lesions in the parental vs. nascent DNA strand. Repair synthesis may be carried out by DNA polymerase β or replicative polymerases δ and ε. Thus, multiple subpathways are needed for repairing oxidative DNA damage, and the pathway decision may require coordination of the successive steps in repair. Such coordination includes transfer of the product of a DNA glycosylase to AP-endonuclease, the next enzyme in the pathway. Interactions among proteins in the pathway may also reflect such coordination, characterization of which should help elucidate these subpathways and their in vivo regulation. PMID:11746753

  5. Maternal diabetes triggers DNA damage and DNA damage response in neurulation stage embryos through oxidative stress.

    PubMed

    Dong, Daoyin; Yu, Jingwen; Wu, Yanqing; Fu, Noah; Villela, Natalia Arias; Yang, Peixin

    2015-11-13

    DNA damage and DNA damage response (DDR) in neurulation stage embryos under maternal diabetes conditions are not well understood. The purpose of this study was to investigate whether maternal diabetes and high glucose in vitro induce DNA damage and DDR in the developing embryo through oxidative stress. In vivo experiments were conducted by mating superoxide dismutase 1 (SOD1) transgenic male mice with wild-type (WT) female mice with or without diabetes. Embryonic day 8.75 (E8.75) embryos were tested for the DNA damage markers, phosphorylated histone H2A.X (p-H2A.X) and DDR signaling intermediates, including phosphorylated checkpoint 1 (p-Chk1), phosphorylated checkpoint 2 (p-Chk2), and p53. Levels of the same DNA damage markers and DDR signaling intermediates were also determined in the mouse C17.2 neural stem cell line. Maternal diabetes and high glucose in vitro significantly increased the levels of p-H2A.X. Levels of p-Chk1, p-Chk2, and p53, were elevated under both maternal diabetic and high glucose conditions. SOD1 overexpression blocked maternal diabetes-induced DNA damage and DDR in vivo. Tempol, a SOD1 mimetic, diminished high glucose-induced DNA damage and DDR in vitro. In conclusion, maternal diabetes and high glucose in vitro induce DNA damage and activates DDR through oxidative stress, which may contribute to the pathogenesis of diabetes-associated embryopathy. PMID:26427872

  6. Oxidative DNA damage accumulation in gastric carcinogenesis

    PubMed Central

    Farinati, F; Cardin, R; Degan, P; Rugge, M; Di, M; Bonvicini, P; Naccarato, R

    1998-01-01

    Background—Gastric carcinogenesis is a multifactorial, multistep process, in which chronic inflammation plays a major role. 
Aims—In order to ascertain whether free radical mediated oxidative DNA damage is involved in such a process, concentrations of 8-hydroxydeoxyguanosine (8OHdG), a mutagenic/carcinogenic adduct, and thiobarbituric acid reactive substances (TBARS), as an indirect measure of free radical mediated damage, were determined in biopsy specimens from patients undergoing endoscopy. 
Patients—Eighty eight patients were divided into histological subgroups as follows: 27 with chronic non-atrophic gastritis, 41 with atrophic gastritis, six with gastric cancer, and 14 unaffected controls. 
Methods—Intestinal metaplasia, Helicobacter pylori infection, and disease activity were semiquantitatively scored. 8OHdG concentrations were assessed by HPLC with electrochemical detection, and TBARS concentrations were fluorimetrically assayed. 
Results—8OHdG concentrations (mean number of adducts/105 dG residues) were significantly higher in chronic atrophic gastritis (p=0.0009). Significantly higher concentrations were also detected in the presence of severe disease activity (p=0.02), intestinal metaplasia (p=0.035), and H pylori infection (p=0.001). TBARS concentrations were also higher in atrophic gastritis, though not significantly so. In a multiple logistic regression analysis, 8OHdG concentrations correlated best with the presence and severity of H pylori infection (r=0.53, p=0.002). 
Conclusions—Chronic gastritis is characterised by the accumulation of oxidative DNA damage with mutagenic and carcinogenic potential. H pylori infection is the major determinant for DNA adduct formation. 

 Keywords: free radicals; oxidative DNA damage; gastric carcinogenesis; precancerous changes; peroxidative damage PMID:9577340

  7. DNA damage checkpoint recovery and cancer development

    SciTech Connect

    Wang, Haiyong; Zhang, Xiaoshan; Teng, Lisong; Legerski, Randy J.

    2015-06-10

    Cell cycle checkpoints were initially presumed to function as a regulator of cell cycle machinery in response to different genotoxic stresses, and later found to play an important role in the process of tumorigenesis by acting as a guard against DNA over-replication. As a counterpart of checkpoint activation, the checkpoint recovery machinery is working in opposition, aiming to reverse the checkpoint activation and resume the normal cell cycle. The DNA damage response (DDR) and oncogene induced senescence (OIS) are frequently found in precancerous lesions, and believed to constitute a barrier to tumorigenesis, however, the DDR and OIS have been observed to be diminished in advanced cancers of most tissue origins. These findings suggest that when progressing from pre-neoplastic lesions to cancer, DNA damage checkpoint barriers are overridden. How the DDR checkpoint is bypassed in this process remains largely unknown. Activated cytokine and growth factor-signaling pathways were very recently shown to suppress the DDR and to promote uncontrolled cell proliferation in the context of oncovirus infection. In recent decades, data from cell line and tumor models showed that a group of checkpoint recovery proteins function in promoting tumor progression; data from patient samples also showed overexpression of checkpoint recovery proteins in human cancer tissues and a correlation with patients' poor prognosis. In this review, the known cell cycle checkpoint recovery proteins and their roles in DNA damage checkpoint recovery are reviewed, as well as their implications in cancer development. This review also provides insight into the mechanism by which the DDR suppresses oncogene-driven tumorigenesis and tumor progression. - Highlights: • DNA damage checkpoint works as a barrier to cancer initiation. • DDR machinary response to genotoxic and oncogenic stress in similar way. • Checkpoint recovery pathways provide active signaling in cell cycle control. • Checkpoint

  8. DNA damage tolerance by recombination: Molecular pathways and DNA structures.

    PubMed

    Branzei, Dana; Szakal, Barnabas

    2016-08-01

    Replication perturbations activate DNA damage tolerance (DDT) pathways, which are crucial to promote replication completion and to prevent fork breakage, a leading cause of genome instability. One mode of DDT uses translesion synthesis polymerases, which however can also introduce mutations. The other DDT mode involves recombination-mediated mechanisms, which are generally accurate. DDT occurs prevalently postreplicatively, but in certain situations homologous recombination is needed to restart forks. Fork reversal can function to stabilize stalled forks, but may also promote error-prone outcome when used for fork restart. Recent years have witnessed important advances in our understanding of the mechanisms and DNA structures that mediate recombination-mediated damage-bypass and highlighted principles that regulate DDT pathway choice locally and temporally. In this review we summarize the current knowledge and paradoxes on recombination-mediated DDT pathways and their workings, discuss how the intermediate DNA structures may influence genome integrity, and outline key open questions for future research. PMID:27236213

  9. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.

    2016-01-01

    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  10. DNA Damage to a Single Chromosome End Delays Anaphase Onset*

    PubMed Central

    Silva, Bárbara Alcaraz; Stambaugh, Jessica R.; Yokomori, Kyoko; Shah, Jagesh V.; Berns, Michael W.

    2014-01-01

    Chromosome ends contain nucleoprotein structures known as telomeres. Damage to chromosome ends during interphase elicits a DNA damage response (DDR) resulting in cell cycle arrest. However, little is known regarding the signaling from damaged chromosome ends (designated here as “TIPs”) during mitosis. In the present study, we investigated the consequences of DNA damage induced at a single TIP in mitosis. We used laser microirradiation to damage mitotic TIPs or chromosome arms (non-TIPs) in PtK2 kidney epithelial cells. We found that damage to a single TIP, but not a non-TIP, delays anaphase onset. This TIP-specific checkpoint response is accompanied by differential recruitment of DDR proteins. Although phosphorylation of H2AX and the recruitment of several repair factors, such as Ku70-Ku80, occur in a comparable manner at both TIP and non-TIP damage sites, DDR factors such as ataxia telangiectasia mutated (ATM), MDC1, WRN, and FANCD2 are specifically recruited to TIPs but not to non-TIPs. In addition, Nbs1, BRCA1, and ubiquitin accumulate at damaged TIPs more rapidly than at damaged non-TIPs. ATR and 53BP1 are not detected at either TIPs or non-TIPs in mitosis. The observed delay in anaphase onset is dependent on the activity of DDR kinases ATM and Chk1, and the spindle assembly checkpoint kinase Mps1. Cells damaged at a single TIP or non-TIP eventually exit mitosis with unrepaired lesions. Damaged TIPs are segregated into micronuclei at a significantly higher frequency than damaged non-TIPs. Together, these findings reveal a mitosis-specific DDR uniquely associated with chromosome ends. PMID:24982423

  11. DNA Damage, Homology-Directed Repair, and DNA Methylation

    PubMed Central

    Angrisano, Tiziana; Morano, Annalisa; Lee, Bongyong; Pardo, Alba Di; Messina, Samantha; Iuliano, Rodolfo; Fusco, Alfredo; Santillo, Maria R; Muller, Mark T; Chiariotti, Lorenzo; Gottesman, Max E; Avvedimento, Enrico V

    2007-01-01

    To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES) cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP) genes (DR-GFP). A total of 2%–4% of the cells generated a functional GFP by homology-directed repair (HR) and gene conversion. However, ~50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2′-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments. PMID:17616978

  12. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  13. Quantitative PCR-Based Measurement of Nuclear and Mitochondrial DNA Damage and Repair in Mammalian Cells

    PubMed Central

    Furda, Amy; Santos, Janine H.; Meyer, Joel N.; Van Houten, Bennett

    2015-01-01

    In this chapter, we describe a gene-specific quantitative PCR (QPCR)-based assay for the measurement of DNA damage, using amplification of long DNA targets. This assay has been used extensively to measure the integrity of both nuclear and mitochondrial genomes exposed to different genotoxins and has proven to be particularly valuable in identifying reactive oxygen species-mediated mitochondrial DNA damage. QPCR can be used to quantify both the formation of DNA damage as well as the kinetics of damage removal. One of the main strengths of the assay is that it permits monitoring the integrity of mtDNA directly from total cellular DNA without the need for isolating mitochondria or a separate step of mitochondrial DNA purification. Here we discuss advantages and limitations of using QPCR to assay DNA damage in mammalian cells. In addition, we give a detailed protocol of the QPCR assay that helps facilitate its successful deployment in any molecular biology laboratory. PMID:24623245

  14. How do male germ cells handle DNA damage?

    SciTech Connect

    Olsen, Ann-Karin; Lindeman, Birgitte; Wiger, Richard; Duale, Nur; Brunborg, Gunnar . E-mail: gunnar.brunborg@fhi.no

    2005-09-01

    Male reproductive health has received considerable attention in recent years. In addition to declining sperm quality, fertility problems and increased incidence of testicular cancer, there is accumulating evidence that genetic damage, in the form of unrepaired DNA lesions or de novo mutations, may be transmitted via sperm to the offspring. Such genetic damage may arise from environmental exposure or via endogenously formed reactive species, in stem cells or during spermatogenesis. Damaged testicular cells not removed by apoptosis rely on DNA repair for their genomic integrity to be preserved. To identify factors with potentially harmful effects on testicular cells and to characterise associated risk, a thorough understanding of repair mechanisms in these cells is of particular importance. Based on results from our own and other laboratories, we discuss the current knowledge of different pathways of excision repair in rodent and human testicular cells. It has become evident that, in human spermatogenic cells, some repair functions are indeed non-functional.

  15. Mitochondrial DNA damage and efficiency of ATP biosynthesis: mathematical model.

    PubMed

    Beregovskaya, N; Maiboroda, R

    1995-01-21

    The role of mitochondrial DNA (mtDNA) damage in ageing processes and in malignant transformation of a cell is discussed. A mathematical model of the mtDNA population in a cell and in tissue is constructed. The model describes the effects of mtDNA damages accumulated during ageing and some features of malignant transformation and regeneration. PMID:7891454

  16. DNA-damaging autoantibodies and cancer: the lupus butterfly theory.

    PubMed

    Noble, Philip W; Bernatsky, Sasha; Clarke, Ann E; Isenberg, David A; Ramsey-Goldman, Rosalind; Hansen, James E

    2016-07-01

    Autoantibodies reactive against host DNA are detectable in the circulation of most people with systemic lupus erythematosus (SLE). The long-held view that antibodies cannot penetrate live cells has been disproved. A subset of lupus autoantibodies penetrate cells, translocate to nuclei, and inhibit DNA repair or directly damages DNA. The result of these effects depends on the microenvironment and genetic traits of the cell. Some DNA-damaging antibodies alone have little impact on normal cells, but in the presence of other conditions, such as pre-existing DNA-repair defects, can become highly toxic. These findings raise new questions about autoimmunity and DNA damage, and reveal opportunities for new targeted therapies against malignancies particularly vulnerable to DNA damage. In this Perspectives article, we review the known associations between SLE, DNA damage and cancer, and propose a theory for the effects of DNA-damaging autoantibodies on SLE pathophysiology and cancer risk. PMID:27009542

  17. Proton-induced direct and indirect damage of plasmid DNA.

    PubMed

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie

    2015-08-01

    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  18. Mechanism study of goldenseal-associated DNA damage.

    PubMed

    Chen, Si; Wan, Liqing; Couch, Letha; Lin, Haixia; Li, Yan; Dobrovolsky, Vasily N; Mei, Nan; Guo, Lei

    2013-07-31

    Goldenseal has been used for the treatment of a wide variety of ailments including gastrointestinal disturbances, urinary tract disorders, and inflammation. The five major alkaloid constituents in goldenseal are berberine, palmatine, hydrastine, hydrastinine, and canadine. When goldenseal was evaluated by the National Toxicology Program (NTP) in the standard 2-year bioassay, goldenseal induced an increase in liver tumors in rats and mice; however, the mechanism of goldenseal-associated liver carcinogenicity remains unknown. In this study, the toxicity of the five goldenseal alkaloid constituents was characterized, and their toxic potencies were compared. As measured by the Comet assay and the expression of γ-H2A.X, berberine, followed by palmatine, appeared to be the most potent DNA damage inducer in human hepatoma HepG2 cells. Berberine and palmatine suppressed the activities of both topoisomerase (Topo) I and II. In berberine-treated cells, DNA damage was shown to be directly associated with the inhibitory effect of Topo II, but not Topo I by silencing gene of Topo I or Topo II. In addition, DNA damage was also observed when cells were treated with commercially available goldenseal extracts and the extent of DNA damage was positively correlated to the berberine content. Our findings suggest that the Topo II inhibitory effect may contribute to berberine- and goldenseal-induced genotoxicity and tumorigenicity. PMID:23747414

  19. Modeling the Study of DNA Damage Responses in Mice

    PubMed Central

    Specks, Julia; Nieto-Soler, Maria; Lopez-Contreras, Andres J; Fernandez-Capetillo, Oscar

    2016-01-01

    Summary Damaged DNA has a profound impact on mammalian health and overall survival. In addition to being the source of mutations that initiate cancer, the accumulation of toxic amounts of DNA damage can cause severe developmental diseases and accelerate ageing. Therefore, understanding how cells respond to DNA damage has become one of the most intense areas of biomedical research in the recent years. However, whereas most mechanistic studies derive from in vitro or in cellulo work, the impact of a given mutation on a living organism is largely unpredictable. For instance, why BRCA1 mutations preferentially lead to breast cancer whereas mutations compromising mismatch repair drive colon cancer is still not understood. In this context, evaluating the specific physiological impact of mutations that compromise genome integrity has become crucial for a better dimensioning of our knowledge. We here describe the various technologies that can be used for modeling mutations in mice, and provide a review of the genes and pathways that have been modeled so far in the context of DNA damage responses. PMID:25636482

  20. Tempol inhibits neutrophil and hydrogen peroxide-mediated DNA damage.

    PubMed

    Hahn, S M; Mitchell, J B; Shacter, E

    1997-01-01

    Inflammatory conditions characterized by neutrophil activation are associated with a variety of chronic diseases. Reactive oxygen species are produced by activated neutrophils and produce DNA damage which may lead to tissue damage. Previous studies have shown that activated murine neutrophils induce DNA strand breaks in a target plasmacytoma cell, RIMPC 2394. We studied the effect of a water soluble nitroxide anti-oxidant, Tempol, on murine neutrophil induction of DNA strand breaks in this system. Murine neutrophils were isolated from the peritoneal cavity of BALB/cAn mice after an i.p. injection of pristane oil. Neutrophils were activated by the phorbol ester PMA and co-incubated with RIMPC 2394 cells. Control alkaline elution studies revealed progressive DNA strand breaks in RIMPC cells with time. The addition of Tempol to the incubation mixture prevented DNA damage in a dose dependent fashion. Five mM Tempol provided complete protection. Tempol protection against DNA strand breaks was similar for both stimulated neutrophils and exogenously added hydrogen peroxide. Measurement of hydrogen peroxide produced by stimulated neutrophils demonstrated that Tempol did not decrease hydrogen peroxide concentration. Oxidation of reduced metals, thereby interfering with the production of hydroxyl radical, is the most likely mechanism of nitroxide protection, although superoxide dismutase (SOD) like activity and scavenging of carbon-based free radicals may also account for a portion of the observed protection. The anti-oxidant activity of Tempol inhibited DNA damage by activated neutrophils. The nitroxides as a class of compounds may have a role in the investigation and modification of inflammatory conditions. PMID:9378367

  1. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.

    2016-01-01

    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  2. p53 in the DNA-Damage-Repair Process.

    PubMed

    Williams, Ashley B; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability. PMID:27048304

  3. DNA Damage: A Main Determinant of Vascular Aging.

    PubMed

    Bautista-Niño, Paula K; Portilla-Fernandez, Eliana; Vaughan, Douglas E; Danser, A H Jan; Roks, Anton J M

    2016-01-01

    Vascular aging plays a central role in health problems and mortality in older people. Apart from the impact of several classical cardiovascular risk factors on the vasculature, chronological aging remains the single most important determinant of cardiovascular problems. The causative mechanisms by which chronological aging mediates its impact, independently from classical risk factors, remain to be elucidated. In recent years evidence has accumulated that unrepaired DNA damage may play an important role. Observations in animal models and in humans indicate that under conditions during which DNA damage accumulates in an accelerated rate, functional decline of the vasculature takes place in a similar but more rapid or more exaggerated way than occurs in the absence of such conditions. Also epidemiological studies suggest a relationship between DNA maintenance and age-related cardiovascular disease. Accordingly, mouse models of defective DNA repair are means to study the mechanisms involved in biological aging of the vasculature. We here review the evidence of the role of DNA damage in vascular aging, and present mechanisms by which genomic instability interferes with regulation of the vascular tone. In addition, we present potential remedies against vascular aging induced by genomic instability. Central to this review is the role of diverse types of DNA damage (telomeric, non-telomeric and mitochondrial), of cellular changes (apoptosis, senescence, autophagy), mediators of senescence and cell growth (plasminogen activator inhibitor-1 (PAI-1), cyclin-dependent kinase inhibitors, senescence-associated secretory phenotype (SASP)/senescence-messaging secretome (SMS), insulin and insulin-like growth factor 1 (IGF-1) signaling), the adenosine monophosphate-activated protein kinase (AMPK)-mammalian target of rapamycin (mTOR)-nuclear factor kappa B (NFκB) axis, reactive oxygen species (ROS) vs. endothelial nitric oxide synthase (eNOS)-cyclic guanosine monophosphate (c

  4. DNA Damage: A Main Determinant of Vascular Aging

    PubMed Central

    Bautista-Niño, Paula K.; Portilla-Fernandez, Eliana; Vaughan, Douglas E.; Danser, A. H. Jan; Roks, Anton J. M.

    2016-01-01

    Vascular aging plays a central role in health problems and mortality in older people. Apart from the impact of several classical cardiovascular risk factors on the vasculature, chronological aging remains the single most important determinant of cardiovascular problems. The causative mechanisms by which chronological aging mediates its impact, independently from classical risk factors, remain to be elucidated. In recent years evidence has accumulated that unrepaired DNA damage may play an important role. Observations in animal models and in humans indicate that under conditions during which DNA damage accumulates in an accelerated rate, functional decline of the vasculature takes place in a similar but more rapid or more exaggerated way than occurs in the absence of such conditions. Also epidemiological studies suggest a relationship between DNA maintenance and age-related cardiovascular disease. Accordingly, mouse models of defective DNA repair are means to study the mechanisms involved in biological aging of the vasculature. We here review the evidence of the role of DNA damage in vascular aging, and present mechanisms by which genomic instability interferes with regulation of the vascular tone. In addition, we present potential remedies against vascular aging induced by genomic instability. Central to this review is the role of diverse types of DNA damage (telomeric, non-telomeric and mitochondrial), of cellular changes (apoptosis, senescence, autophagy), mediators of senescence and cell growth (plasminogen activator inhibitor-1 (PAI-1), cyclin-dependent kinase inhibitors, senescence-associated secretory phenotype (SASP)/senescence-messaging secretome (SMS), insulin and insulin-like growth factor 1 (IGF-1) signaling), the adenosine monophosphate-activated protein kinase (AMPK)-mammalian target of rapamycin (mTOR)-nuclear factor kappa B (NFκB) axis, reactive oxygen species (ROS) vs. endothelial nitric oxide synthase (eNOS)-cyclic guanosine monophosphate (c

  5. Direct Detection and Sequencing of Damaged DNA Bases

    PubMed Central

    2011-01-01

    Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597

  6. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.

    PubMed

    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke

    2002-07-01

    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  7. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  8. Acetylation of Werner syndrome protein (WRN): relationships with DNA damage, DNA replication and DNA metabolic activities

    PubMed Central

    Lozada, Enerlyn; Yi, Jingjie; Luo, Jianyuan; Orren, David K.

    2014-01-01

    Loss of WRN function causes Werner Syndrome, characterized by increased genomic instability, elevated cancer susceptibility and premature aging. Although WRN is subject to acetylation, phosphorylation and sumoylation, the impact of these modifications on WRN’s DNA metabolic function remains unclear. Here, we examined in further depth the relationship between WRN acetylation and its role in DNA metabolism, particularly in response to induced DNA damage. Our results demonstrate that endogenous WRN is acetylated somewhat under unperturbed conditions. However, levels of acetylated WRN significantly increase after treatment with certain DNA damaging agents or the replication inhibitor hydroxyurea. Use of DNA repair-deficient cells or repair pathway inhibitors further increase levels of acetylated WRN, indicating that induced DNA lesions and their persistence are at least partly responsible for increased acetylation. Notably, acetylation of WRN correlates with inhibition of DNA synthesis, suggesting that replication blockage might underlie this effect. Moreover, WRN acetylation modulates its affinity for and activity on certain DNA structures, in a manner that may enhance its relative specificity for physiological substrates. Our results also show that acetylation and deacetylation of endogenous WRN is a dynamic process, with sirtuins and other histone deacetylases contributing to WRN deacetylation. These findings advance our understanding of the dynamics of WRN acetylation under unperturbed conditions and following DNA damage induction, linking this modification not only to DNA damage persistence but also potentially to replication stalling caused by specific DNA lesions. Our results are consistent with proposed metabolic roles for WRN and genomic instability phenotypes associated with WRN deficiency. PMID:24965941

  9. DNA Damage Response and Immune Defense: Links and Mechanisms

    PubMed Central

    Nakad, Rania; Schumacher, Björn

    2016-01-01

    DNA damage plays a causal role in numerous human pathologies including cancer, premature aging, and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR) orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signaling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signaling. We highlight evidence gained into (i) which molecular and cellular pathways of DDR activate immune signaling, (ii) how DNA damage drives chronic inflammation, and (iii) how chronic inflammation causes DNA damage and pathology in humans. PMID:27555866

  10. Yap1: a DNA damage responder in Saccharomyces cerevisiae.

    PubMed

    Rowe, Lori A; Degtyareva, Natalya; Doetsch, Paul W

    2012-04-01

    Activation of signaling pathways in response to genotoxic stress is crucial for cells to properly repair DNA damage. In response to DNA damage, intracellular levels of reactive oxygen species increase. One important function of such a response could be to initiate signal transduction processes. We have employed the model eukaryote Saccharomyces cerevisiae to delineate DNA damage sensing mechanisms. We report a novel, unanticipated role for the transcription factor Yap1 as a DNA damage responder, providing direct evidence that reactive oxygen species are an important component of the DNA damage signaling process. Our findings reveal an epistatic link between Yap1 and the DNA base excision repair pathway. Corruption of the Yap1-mediated DNA damage response influences cell survival and genomic stability in response to exposure to genotoxic agents. PMID:22433435

  11. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    PubMed Central

    Fasullo, Michael; Endres, Lauren

    2015-01-01

    Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP) produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases. PMID:25923076

  12. Increase in the frequency of hepadnavirus DNA integrations by oxidative DNA damage and inhibition of DNA repair.

    PubMed Central

    Petersen, J; Dandri, M; Bürkle, A; Zhang, L; Rogler, C E

    1997-01-01

    Persistent hepadnavirus infection leads to oxidative stress and DNA damage through increased production of toxic oxygen radicals. In addition, hepadnaviral DNA integrations into chromosomal DNA can promote the process of hepatocarcinogenesis (M. Feitelson, Clin. Microbiol. Rev. 5:275-301, 1992). While previous studies have identified preferred integration sites in hepadnaviral genomes and suggested integration mechanisms (M. A. Buendia, Adv. Cancer Res. 59:167-226, 1992; C. E. Rogler, Curr. Top. Microbiol. Immunol. 168:103-141, 1991; C. Shih et al., J. Virol. 61:3491-3498, 1987), very little is known about the effects of agents which damage chromosomal DNA on the frequency of hepadnaviral DNA integrations. Using a recently developed subcloning approach to detect stable new integrations of duck hepatitis B virus (DHBV) (S. S. Gong, A. D. Jensen, and C. E. Rogler, J. Virol. 70:2000-2007, 1996), we tested the effects of increased chromosomal DNA damage induced by H2O2, or of the disturbance in DNA repair due to the inhibition of poly(ADP-ribose) polymerase (PARP), on the frequency of DHBV DNA integrations. Subclones of LMH-D21-6 cells, which replicate DHBV, were grown in the presence of various H2O2 concentrations and exhibited up to a threefold increase in viral DNA integration frequency in a dose-dependent manner. Moreover, inhibition of PARP, which plays a role in cellular responses to DNA breakage, by 3-aminobenzamide (3-AB) resulted in a sevenfold increase in the total number of new DHBV DNA integrations into host chromosomal DNA. Removal of either H2O2 or 3-AB from the culture medium in a subsequent cycle of subcloning was accompanied by a reversion back towards the original lower frequency of stable DHBV DNA integrations for LMH-D21-6 cells. These data support the hypothesis that DNA damage sites can serve as sites for hepadnaviral DNA integration, and that increasing the number of DNA damage sites dramatically increases viral integration frequency. PMID

  13. Development of a robust DNA damage model including persistent telomere-associated damage with application to secondary cancer risk assessment

    PubMed Central

    Rastgou Talemi, Soheil; Kollarovic, Gabriel; Lapytsko, Anastasiya; Schaber, Jörg

    2015-01-01

    Mathematical modelling has been instrumental to understand kinetics of radiation-induced DNA damage repair and associated secondary cancer risk. The widely accepted two-lesion kinetic (TLK) model assumes two kinds of double strand breaks, simple and complex ones, with different repair rates. Recently, persistent DNA damage associated with telomeres was reported as a new kind of DNA damage. We therefore extended existing versions of the TLK model by new categories of DNA damage and re-evaluated those models using extensive data. We subjected different versions of the TLK model to a rigorous model discrimination approach. This enabled us to robustly select a best approximating parsimonious model that can both recapitulate and predict transient and persistent DNA damage after ionizing radiation. Models and data argue for i) nonlinear dose-damage relationships, and ii) negligible saturation of repair kinetics even for high doses. Additionally, we show that simulated radiation-induced persistent telomere-associated DNA damage foci (TAF) can be used to predict excess relative risk (ERR) of developing secondary leukemia after fractionated radiotherapy. We suggest that TAF may serve as an additional measure to predict cancer risk after radiotherapy using high dose rates. This may improve predicting risk-dose dependency of ionizing radiation especially for long-term therapies. PMID:26359627

  14. Development of a robust DNA damage model including persistent telomere-associated damage with application to secondary cancer risk assessment.

    PubMed

    Rastgou Talemi, Soheil; Kollarovic, Gabriel; Lapytsko, Anastasiya; Schaber, Jörg

    2015-01-01

    Mathematical modelling has been instrumental to understand kinetics of radiation-induced DNA damage repair and associated secondary cancer risk. The widely accepted two-lesion kinetic (TLK) model assumes two kinds of double strand breaks, simple and complex ones, with different repair rates. Recently, persistent DNA damage associated with telomeres was reported as a new kind of DNA damage. We therefore extended existing versions of the TLK model by new categories of DNA damage and re-evaluated those models using extensive data. We subjected different versions of the TLK model to a rigorous model discrimination approach. This enabled us to robustly select a best approximating parsimonious model that can both recapitulate and predict transient and persistent DNA damage after ionizing radiation. Models and data argue for i) nonlinear dose-damage relationships, and ii) negligible saturation of repair kinetics even for high doses. Additionally, we show that simulated radiation-induced persistent telomere-associated DNA damage foci (TAF) can be used to predict excess relative risk (ERR) of developing secondary leukemia after fractionated radiotherapy. We suggest that TAF may serve as an additional measure to predict cancer risk after radiotherapy using high dose rates. This may improve predicting risk-dose dependency of ionizing radiation especially for long-term therapies. PMID:26359627

  15. Non-coding RNAs in DNA damage response

    PubMed Central

    Liu, Yunhua; Lu, Xiongbin

    2012-01-01

    Genome-wide studies have revealed that human and other mammalian genomes are pervasively transcribed and produce thousands of regulatory non-protein-coding RNAs (ncRNAs), including miRNAs, siRNAs, piRNAs and long non-coding RNAs (lncRNAs). Emerging evidences suggest that these ncRNAs also play a pivotal role in genome integrity and stability via the regulation of DNA damage response (DDR). In this review, we discuss the recent finding on the interplay of ncRNAs with the canonical DDR signaling pathway, with a particular emphasis on miRNAs and lncRNAs. While the expression of ncRNAs is regulated in the DDR, the DDR is also subjected to regulation by those DNA damage-responsive ncRNAs. In addition, the roles of those Dicer- and Drosha-dependent small RNAs produced in the vicinity of double-strand breaks sites are also described. PMID:23226613

  16. Mitochondrial DNA Damage and its Consequences for Mitochondrial Gene Expression

    PubMed Central

    Cline, Susan D.

    2012-01-01

    How mitochondria process DNA damage and whether a change in the steady-state level of mitochondrial DNA damage (mtDNA) contributes to mitochondrial dysfunction are questions that fuel burgeoning areas of research into aging and disease pathogenesis. Over the past decade, researchers have identified and measured various forms of endogenous and environmental mtDNA damage and have elucidated mtDNA repair pathways. Interestingly, mitochondria do not appear to contain the full range of DNA repair mechanisms that operate in the nucleus, although mtDNA contains types of damage that are targets of each nuclear DNA repair pathway. The reduced repair capacity may, in part, explain the high mutation frequency of the mitochondrial chromosome. Since mtDNA replication is dependent on transcription, mtDNA damage may alter mitochondrial gene expression at three levels: by causing DNA polymerase γ nucleotide incorporation errors leading to mutations, by interfering with the priming of mtDNA replication by the mitochondrial RNA polymerase, or by inducing transcriptional mutagenesis or premature transcript termination. This review summarizes our current knowledge of mtDNA damage, its repair, and its effects on mtDNA integrity and gene expression. PMID:22728831

  17. DNA damage profiles induced by sunlight at different latitudes.

    PubMed

    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins

    2012-04-01

    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  18. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying

    2015-01-01

    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  19. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  20. DNA Damage Response in Peripheral Nervous System: Coping with Cancer Therapy-Induced DNA Lesions

    PubMed Central

    Englander, Ella W

    2013-01-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  1. SUMO-mediated regulation of DNA damage repair and responses

    PubMed Central

    Sarangi, Prabha; Zhao, Xiaolan

    2015-01-01

    Sumoylation plays important roles during DNA damage repair and responses. Recent broad-scope and substrate-based studies have shed light on the regulation and significance of sumoylation during these processes. An emerging paradigm is that sumoylation of many DNA metabolism proteins is controlled by DNA engagement. Such “on-site modification” can explain low substrate modification levels and has important implications in sumoylation mechanisms and effects. New studies also suggest that sumoylation can regulate a process through an ensemble effect or via major substrates. Additionally, we describe new trends in the functional effects of sumoylation, such as bi-directional changes in biomolecule binding and multi-level coordination with other modifications. These emerging themes and models will stimulate our thinking and research in sumoylation and genome maintenance. PMID:25778614

  2. Decoupling of DNA damage response signaling from DNA damages underlies temozolomide resistance in glioblastoma cells☆

    PubMed Central

    Cui, Bo; Johnson, Stewart P.; Bullock, Nancy; Ali-Osman, Francis; Bigner, Darell D.; Friedman, Henry S.

    2010-01-01

    Glioblastoma multiforme (GBM) is the most aggressive primary brain tumor in adults. Current therapy includes surgery, radiation and chemotherapy with temozolomide (TMZ). Major determinants of clinical response to TMZ include methylation status of the O6-methylguanine-DNA methyltransferase (MGMT) promoter and mismatch repair (MMR) status. Though the MGMT promoter is methylated in 45% of cases, for the first nine months of follow-up, TMZ does not change survival outcome. Furthermore, MMR deficiency makes little contribution to clinical resistance, suggesting that there exist unrecognized mechanisms of resistance. We generated paired GBM cell lines whose resistance was attributed to neither MGMT nor MMR. We show that, responding to TMZ, these cells exhibit a decoupling of DNA damage response (DDR) from ongoing DNA damages. They display methylation-resistant synthesis in which ongoing DNA synthesis is not inhibited. They are also defective in the activation of the S and G2 phase checkpoint. DDR proteins ATM, Chk2, MDC1, NBS1 and gammaH2AX also fail to form discrete foci. These results demonstrate that failure of DDR may play an active role in chemoresistance to TMZ. DNA damages by TMZ are repaired by MMR proteins in a futile, reiterative process, which activates DDR signaling network that ultimately leads to the onset of cell death. GBM cells may survive genetic insults in the absence of DDR. We anticipate that our findings will lead to more studies that seek to further define the role of DDR in ultimately determining the fate of a tumor cell in response to TMZ and other DNA methylators. PMID:23554659

  3. WDR76 Co-Localizes with Heterochromatin Related Proteins and Rapidly Responds to DNA Damage

    PubMed Central

    Gilmore, Joshua M.; Sardiu, Mihaela E.; Groppe, Brad D.; Thornton, Janet L.; Liu, Xingyu; Dayebgadoh, Gerald; Banks, Charles A.; Slaughter, Brian D.; Unruh, Jay R.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

    2016-01-01

    Proteins that respond to DNA damage play critical roles in normal and diseased states in human biology. Studies have suggested that the S. cerevisiae protein CMR1/YDL156w is associated with histones and is possibly associated with DNA repair and replication processes. Through a quantitative proteomic analysis of affinity purifications here we show that the human homologue of this protein, WDR76, shares multiple protein associations with the histones H2A, H2B, and H4. Furthermore, our quantitative proteomic analysis of WDR76 associated proteins demonstrated links to proteins in the DNA damage response like PARP1 and XRCC5 and heterochromatin related proteins like CBX1, CBX3, and CBX5. Co-immunoprecipitation studies validated these interactions. Next, quantitative imaging studies demonstrated that WDR76 was recruited to laser induced DNA damage immediately after induction, and we compared the recruitment of WDR76 to laser induced DNA damage to known DNA damage proteins like PARP1, XRCC5, and RPA1. In addition, WDR76 co-localizes to puncta with the heterochromatin proteins CBX1 and CBX5, which are also recruited to DNA damage but much less intensely than WDR76. This work demonstrates the chromatin and DNA damage protein associations of WDR76 and demonstrates the rapid response of WDR76 to laser induced DNA damage. PMID:27248496

  4. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  5. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  6. DNA damage in leukocytes of mice treated with copper sulfate.

    PubMed

    Saleha Banu, B; Ishaq, Mohd; Danadevi, K; Padmavathi, P; Ahuja, Y R

    2004-12-01

    Single stranded DNA breaks induced by copper sulfate (CuSO(4)) in mice has been studied in vivo using Alkaline Single Cell Gel Electrophoresis (Comet assay). Mice were administered orally with doses of 0, 1.25, 2.50, 5.00, 7.50, 10.00 and 12.50 mg/kg body weight (b.wt.) of CuSO4 respectively. The samples of whole blood were collected at 24, 48, 72 h, first week and second week post-treatment and the assay was carried out to determine single strand DNA breaks as represented by comet tail-length. In addition, the sample was used to study the repair efficiency by incubating the samples with RPMI medium for 2 h. Results indicated a significant DNA damage at all the doses after treatment with CuSO4 when compared to controls showing a clear dose-dependent response (p < 0.05). A gradual decrease in the tail-lengths from 48 h post-treatment was observed and by second week, the values returned to control levels at all doses. The study on the repair efficiency indicated that mice treated with all the doses of CuSO4 showed decrease in mean comet tail-length indicating repair efficiency capacity but less when compared to those of controls. The study also reveals that comet assay is a sensitive and rapid method for detecting DNA damage caused by trace metals such as copper (Cu). PMID:15500930

  7. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.

    2010-01-01

    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  8. The DNA damage checkpoint allows recombination between divergent DNA sequences in budding yeast

    PubMed Central

    George, Carolyn M.; Lyndaker, Amy M.; Alani, Eric

    2011-01-01

    In the early steps of homologous recombination, single-stranded DNA (ssDNA) from a broken chromosome invades homologous sequence located in a sister or homolog donor. In genomes that contain numerous repetitive DNA elements or gene paralogs, recombination can potentially occur between non-allelic/divergent (homeologous) sequences that share sequence identity. Such recombination events can lead to lethal chromosomal deletions or rearrangements. However, homeologous recombination events can be suppressed through rejection mechanisms that involve recognition of DNA mismatches in heteroduplex DNA by mismatch repair factors, followed by active unwinding of the heteroduplex DNA by helicases. Because factors required for heteroduplex rejection are hypothesized to be targets and/or effectors of the DNA damage response (DDR), a cell cycle control mechanism that ensures timely and efficient repair, we tested whether the DDR, and more specifically, the RAD9 gene, had a role in regulating rejection. We performed these studies using a DNA repair assay that measures repair by single-strand annealing (SSA) of a double-strand break (DSB) using homeologous DNA templates. We found that repair of homeologous DNA sequences, but not identical sequences, induced a RAD9- dependent cell cycle delay in the G2 stage of the cell cycle. Repair through a divergent DNA template occurred more frequently in RAD9 compared to rad9Δ strains. However, repair in rad9Δ mutants could be restored to wild-type levels if a G2 delay was induced by nocodazole. These results suggest that cell cycle arrest induced by the Rad9-dependent DDR allows repair between divergent DNA sequences despite the potential for creating deleterious genome rearrangements, and illustrates the importance of additional cellular mechanisms that act to suppress recombination between divergent DNA sequences. PMID:21978436

  9. Expression Profile of DNA Damage Signaling Genes in Proton Exposed Mouse Brain

    NASA Astrophysics Data System (ADS)

    Ramesh, Govindarajan; Wu, Honglu

    Exposure of living systems to radiation results in a wide assortment of lesions, the most signif-icant of is damage to genomic DNA which induce several cellular functions such as cell cycle arrest, repair, apoptosis etc. The radiation induced DNA damage investigation is one of the im-portant area in biology, but still the information available regarding the effects of proton is very limited. In this report, we investigated the differential gene expression pattern of DNA damage signaling genes particularly, damaged DNA binding, repair, cell cycle arrest, checkpoints and apoptosis using quantitative real-time RT-PCR array in proton exposed mouse brain tissues. The expression profiles showed significant changes in DNA damage related genes in 2Gy proton exposed mouse brain tissues as compared with control brain tissues. Furthermore, we also show that significantly increased levels of apoptotic related genes, caspase-3 and 8 activities in these cells, suggesting that in addition to differential expression of DNA damage genes, the alteration of apoptosis related genes may also contribute to the radiation induced DNA damage followed by programmed cell death. In summary, our findings suggest that proton exposed brain tissue undergo severe DNA damage which in turn destabilize the chromatin stability.

  10. Oxidative DNA damage stalls the human mitochondrial replisome

    PubMed Central

    Stojkovič, Gorazd; Makarova, Alena V.; Wanrooij, Paulina H.; Forslund, Josefin; Burgers, Peter M.; Wanrooij, Sjoerd

    2016-01-01

    Oxidative stress is capable of causing damage to various cellular constituents, including DNA. There is however limited knowledge on how oxidative stress influences mitochondrial DNA and its replication. Here, we have used purified mtDNA replication proteins, i.e. DNA polymerase γ holoenzyme, the mitochondrial single-stranded DNA binding protein mtSSB, the replicative helicase Twinkle and the proposed mitochondrial translesion synthesis polymerase PrimPol to study lesion bypass synthesis on oxidative damage-containing DNA templates. Our studies were carried out at dNTP levels representative of those prevailing either in cycling or in non-dividing cells. At dNTP concentrations that mimic those in cycling cells, the replication machinery showed substantial stalling at sites of damage, and these problems were further exacerbated at the lower dNTP concentrations present in resting cells. PrimPol, the translesion synthesis polymerase identified inside mammalian mitochondria, did not promote mtDNA replication fork bypass of the damage. This argues against a conventional role for PrimPol as a mitochondrial translesion synthesis DNA polymerase for oxidative DNA damage; however, we show that Twinkle, the mtDNA replicative helicase, is able to stimulate PrimPol DNA synthesis in vitro, suggestive of an as yet unidentified role of PrimPol in mtDNA metabolism. PMID:27364318

  11. DNA damage and neurotoxicity of chronic alcohol abuse

    PubMed Central

    Kruman, Inna I; Henderson, George I; Bergeson, Susan E

    2013-01-01

    Chronic alcohol abuse results in a variety of pathological effects including damage to the brain. The causes of alcohol-induced brain pathology are presently unclear. Several mechanisms of pathogenicity of chronic alcoholism have been proposed, including accumulation of DNA damage in the absence of repair, resulting in genomic instability and death of neurons. Genomic instability is a unified genetic mechanism leading to a variety of neurodegenerative disorders. Ethanol also likely interacts with various metabolic pathways, including one-carbon metabolism (OCM). OCM is critical for the synthesis of DNA precursors, essential for DNA repair, and as a methyl donor for various methylation events, including DNA methylation. Both DNA repair and DNA methylation are critical for maintaining genomic stability. In this review, we outline the role of DNA damage and DNA repair dysfunction in chronic alcohol-induced neurodegeneration. PMID:22829701

  12. Colorimetric detection of DNA damage by using hemin-graphene nanocomposites

    NASA Astrophysics Data System (ADS)

    Wei, W.; Zhang, D. M.; Yin, L. H.; Pu, Y. P.; Liu, S. Q.

    2013-04-01

    A colorimetric method for detection of DNA damage was developed by using hemin-graphene nanosheets (H-GNs). H-GNs were skillfully synthesized by adsorping of hemin on graphene through π-π interactions. The as-prepared H-GNs possessed both the ability of graphene to differentiate the damage DNA from intact DNA and the catalytic action of hemin. The damaged DNA made H-GNs coagulated to different degrees from the intact DNA because there were different amount of negative charge exposed on their surface, which made a great impact on the solubility of H-GNs. As a result, the corresponding centrifugal supernatant of H-GNs solution showed different color in the presence of 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2, which could be discriminated by naked eyes or by ultraviolet (UV)-visible spectrometer. Based on this, the damaged effects of styrene oxide (SO), NaAsO2 and UV radiation on DNA were studied. Results showed that SO exerted most serious damage effect on DNA although all of them damaged DNA seriously. The new method for detection of DNA damage showed good prospect in the evaluation of genotoxicity of new compounds, the maximum limit of pesticide residue, food additives, and so on, which is important in the fields of food science, pharmaceutical science and pesticide science.

  13. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  14. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGESBeta

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  15. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  16. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  17. Pseudo-DNA damage response in senescent cells

    PubMed Central

    Pospelova, Tatyana V.; Demidenko, Zoya N.; Bukreeva, Elena I.; Pospelov, Valery A.; Gudkov, Andrei V.; Blagosklonny, Mikhail V.

    2016-01-01

    Cellular senescence is currently viewed as a response to DNA damage. In this report, we showed that non-damaging agents such as sodium butyrate-induced p21 and ectopic expression of either p21 or p16 cause cellular senescence without detectable DNA breaks. Nevertheless, senescent cells displayed components of DNA damage response (DDR) such as γH2AX foci and uniform nuclear staining for p-ATM. Importantly, there was no accumulation of 53BP1 in γH2AX foci of senescent cells. Consistently, comet assay failed to detect DNA damage. Rapamycin, an inhibitor of mTOR, which was shown to suppress cellular senescence, decreased γH2AX foci formation. Thus, cellular senescence leads to activation of atypical DDR without detectable DNA damage. Pseudo-DDR may be a marker of general over-activation of senescent cells. PMID:19946210

  18. DNA Damage among Wood Workers Assessed with the Comet Assay.

    PubMed

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers' exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  19. DNA Damage among Wood Workers Assessed with the Comet Assay

    PubMed Central

    Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.

    2016-01-01

    Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027

  20. Synthetic lethal approaches exploiting DNA damage in aggressive myeloma

    PubMed Central

    Cottini, Francesca; Hideshima, Teru; Suzuki, Rikio; Tai, Yu-Tzu; Bianchini, Giampaolo; Richardson, Paul G.; Anderson, Kenneth C.; Tonon, Giovanni

    2015-01-01

    Ongoing DNA damage is a common feature of epithelial cancers. Here we show that tumor cells derived from multiple myeloma (MM), a disease of clonal plasma cells, demonstrate DNA replicative stress leading to DNA damage. We identified a poor prognosis subset of MM with extensive chromosomal instability and replicative stress which rely on ATR to compensate for DNA replicative stress; conversely, silencing of ATR or treatment with a specific ATR inhibitor triggers MM cell apoptosis. We show that oncogenes such as MYC induce DNA damage in MM cells not only by increased replicative stress, but also via increased oxidative stress, and that ROS-inducer piperlongumine triggers further DNA damage and apoptosis. Importantly, ATR inhibition combined with piperlongumine triggers synergistic MM cytotoxicity. This synthetic lethal approach, enhancing oxidative stress while concomitantly blocking replicative stress response, provides a novel combination targeted therapy to address an unmet medical need in this subset of MM. PMID:26080835

  1. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F

    1993-01-01

    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  2. Reversible and Irreversible Mechanical Damaging of Large Double-Stranded DNA upon Electrospraying.

    PubMed

    Shlyapnikov, Yuri M; Shlyapnikova, Elena A; Morozov, Victor N

    2016-07-19

    Electrohydrodynamic spraying (or electrospaying, ES) of DNA solutions is an attractive technique for applications in mass spectrometry, in microarray fabrication, and in generation of DNA nanoaerosols. Here we report how ES affects DNA structure and evaluate possible ways to reduce DNA damage upon ES. It is shown that under any ES conditions, linear λ-phage DNA is subjected to intensive rupture producing a mixture of fragments. In addition to such fragmentation, notable reversible changes in the DNA structure were revealed by a slight increase in DNA electrophoretic mobility. The degree of fragmentation was shown to decrease with decreased DNA length and with increased flow rate through the ES capillary. Fragments shorter than 5 kbp did not show any notable damage upon ES. Both experimental data and theoretical estimations of the forces acting on DNA during ES indicate that DNA is damaged by mechanical forces, and the damage takes place in the vicinity of the Taylor cone tip, presumably due to the high shear stress or/and viscous drag forces operating there. Condensation of λ-DNA with hexamminecobalt(III) ions completely protected it from any damage upon ES. PMID:27306261

  3. Direct visualization of a DNA glycosylase searching for damage.

    PubMed

    Chen, Liwei; Haushalter, Karl A; Lieber, Charles M; Verdine, Gregory L

    2002-03-01

    DNA glycosylases preserve the integrity of genetic information by recognizing damaged bases in the genome and catalyzing their excision. It is unknown how DNA glycosylases locate covalently modified bases hidden in the DNA helix amongst vast numbers of normal bases. Here we employ atomic-force microscopy (AFM) with carbon nanotube probes to image search intermediates of human 8-oxoguanine DNA glycosylase (hOGG1) scanning DNA. We show that hOGG1 interrogates DNA at undamaged sites by inducing drastic kinks. The sharp DNA bending angle of these non-lesion-specific search intermediates closely matches that observed in the specific complex of 8-oxoguanine-containing DNA bound to hOGG1. These findings indicate that hOGG1 actively distorts DNA while searching for damaged bases. PMID:11927259

  4. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  5. DETECTION OF DNA DAMAGE USING MELTING ANALYSIS TECHNIQUES

    EPA Science Inventory

    A rapid and simple fluorescence screening assay for UV radiation-, chemical-, and enzyme-induced DNA damage is reported. This assay is based on a melting/annealing analysis technique and has been used with both calf thymus DNA and plasmid DNA (puc 19 plasmid from E. coli). DN...

  6. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.

    2011-01-01

    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  7. Chromatin perturbations during the DNA damage response in higher eukaryotes

    PubMed Central

    Bakkenist, Christopher J.; Kastan, Michael B.

    2016-01-01

    The DNA damage response is a widely used term that encompasses all signaling initiated at DNA lesions and damaged replication forks as it extends to orchestrate DNA repair, cell cycle checkpoints, cell death and senescence. ATM, an apical DNA damage signaling kinase, is virtually instantaneously activated following the introduction of DNA double-strand breaks (DSBs). The MRE11-RAD50-NBS1 (MRN) complex, which has a catalytic role in DNA repair, and the KAT5 (Tip60) acetyltransferase are required for maximal ATM kinase activation in cells exposed to low doses of ionizing radiation. The sensing of DNA lesions occurs within a highly complex and heterogeneous chromatin environment. Chromatin decondensation and histone eviction at DSBs may be permissive for KAT5 binding to H3K9me3 and H3K36me3, ATM kinase acetylation and activation. Furthermore, chromatin perturbation may be a prerequisite for most DNA repair. Nucleosome disassembly during DNA repair was first reported in the 1970s by Smerdon and colleagues when nucleosome rearrangement was noted during the process of nucleotide excision repair of UV-induced DNA damage in human cells. Recently, the multi-functional protein nucleolin was identified as the relevant histone chaperone required for partial nucleosome disruption at DBSs, the recruitment of repair enzymes and for DNA repair. Notably, ATM kinase is activated by chromatin perturbations induced by a variety of treatments that do not directly cause DSBs, including treatment with histone deacetylase inhibitors. Central to the mechanisms that activate ATR, the second apical DNA damage signaling kinase, outside of a stalled and collapsed replication fork in S-phase, is chromatin decondensation and histone eviction associated with DNA end resection at DSBs. Thus, a stress that is common to both ATM and ATR kinase activation is chromatin perturbations, and we argue that chromatin perturbations are both sufficient and required for induction of the DNA damage response

  8. Chromatin perturbations during the DNA damage response in higher eukaryotes.

    PubMed

    Bakkenist, Christopher J; Kastan, Michael B

    2015-12-01

    The DNA damage response is a widely used term that encompasses all signaling initiated at DNA lesions and damaged replication forks as it extends to orchestrate DNA repair, cell cycle checkpoints, cell death and senescence. ATM, an apical DNA damage signaling kinase, is virtually instantaneously activated following the introduction of DNA double-strand breaks (DSBs). The MRE11-RAD50-NBS1 (MRN) complex, which has a catalytic role in DNA repair, and the KAT5 (Tip60) acetyltransferase are required for maximal ATM kinase activation in cells exposed to low doses of ionizing radiation. The sensing of DNA lesions occurs within a highly complex and heterogeneous chromatin environment. Chromatin decondensation and histone eviction at DSBs may be permissive for KAT5 binding to H3K9me3 and H3K36me3, ATM kinase acetylation and activation. Furthermore, chromatin perturbation may be a prerequisite for most DNA repair. Nucleosome disassembly during DNA repair was first reported in the 1970s by Smerdon and colleagues when nucleosome rearrangement was noted during the process of nucleotide excision repair of UV-induced DNA damage in human cells. Recently, the multi-functional protein nucleolin was identified as the relevant histone chaperone required for partial nucleosome disruption at DBSs, the recruitment of repair enzymes and for DNA repair. Notably, ATM kinase is activated by chromatin perturbations induced by a variety of treatments that do not directly cause DSBs, including treatment with histone deacetylase inhibitors. Central to the mechanisms that activate ATR, the second apical DNA damage signaling kinase, outside of a stalled and collapsed replication fork in S-phase, is chromatin decondensation and histone eviction associated with DNA end resection at DSBs. Thus, a stress that is common to both ATM and ATR kinase activation is chromatin perturbations, and we argue that chromatin perturbations are both sufficient and required for induction of the DNA damage response

  9. At a crossroads: human DNA tumor viruses and the host DNA damage response.

    PubMed

    Nikitin, Pavel A; Luftig, Micah A

    2011-07-01

    Human DNA tumor viruses induce host cell proliferation in order to establish the necessary cellular milieu to replicate viral DNA. The consequence of such viral-programmed induction of proliferation coupled with the introduction of foreign replicating DNA structures makes these viruses particularly sensitive to the host DNA damage response machinery. In fact, sensors of DNA damage are often activated and modulated by DNA tumor viruses in both latent and lytic infection. This article focuses on the role of the DNA damage response during the life cycle of human DNA tumor viruses, with a particular emphasis on recent advances in our understanding of the role of the DNA damage response in EBV, Kaposi's sarcoma-associated herpesvirus and human papillomavirus infection. PMID:21927617

  10. Metallothionein blocks oxidative DNA damage in vitro

    PubMed Central

    Qu, Wei; Pi, Jingbo; Waalkes, Michael P.

    2012-01-01

    The role of metallothionein (MT) in mitigation of oxidative DNA damage (ODD) induced either by cadmium (Cd) or the direct oxidant hydrogen peroxide (H2O2) was systematically examined by using MT-I/II double knockout (MT-null) or MT-competent wild-type (WT) cells. Both toxicants were much more lethal to MT-null cells (Cd LC50 = 6.6 μM; H2O2 LC50 = 550 μM) than WT cells (Cd LC50 = 16.5 μM; H2O2 LC50 = 930 μM). Cd induced concentration-related MT increases in WT cells, while the basal levels were undetectable and not increased by Cd in MT-null cells. ODD, measured by the immuno-spin trapping method, was minimally induced by sub-toxic Cd levels (1 or 5 μM; 24 h) in WT cells, but markedly increased in MT-null cells (> 430%). Similarly, ODD was induced to higher levels by lower concentrations of H2O2 in MT-null cells than WT cells. Transfection of MT-I into MT-null cells reduced both Cd- and H2O2-induced cytolethality and ODD. Cd increased expression of the oxidant defense genes, HO-1 and GSTa2 to a much greater extent in MT-null cells than WT. Cd or H2O2 exposure increased expression of key transport genes, Mrp1 and Mrp2, in WT cells but not in MT-null cells. MT protects against Cd- and H2O2-induced ODD in MT competent cells possibly by multiple mechanisms, potentially including direct metal ion sequestration and sequestration of oxidant radicals by MT. MT-deficient cells appear to adapt to Cd primarily by turning on oxidant response systems, while MT-competent cells activate MT and transport systems. PMID:22914987

  11. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  12. Inflammation-induced DNA damage and damage-induced inflammation: a vicious cycle.

    PubMed

    Pálmai-Pallag, Timea; Bachrati, Csanád Z

    2014-10-01

    Inflammation is the ultimate response to the constant challenges of the immune system by microbes, irritants or injury. The inflammatory cascade initiates with the recognition of microorganism-derived pathogen associated molecular patterns (PAMPs) and host cell-derived damage associated molecular patterns (DAMPs) by the pattern recognition receptors (PRRs). DNA as a molecular PAMP or DAMP is sensed directly or via specific binding proteins to instigate pro-inflammatory response. Some of these DNA binding proteins also participate in canonical DNA repair pathways and recognise damaged DNA to initiate DNA damage response. In this review we aim to capture the essence of the complex interplay between DNA damage response and the pro-inflammatory signalling through representative examples. PMID:25449753

  13. Characterization of DNA recognition by the human UV-damaged DNA-binding protein.

    PubMed

    Fujiwara, Y; Masutani, C; Mizukoshi, T; Kondo, J; Hanaoka, F; Iwai, S

    1999-07-01

    The UV-damaged DNA-binding (UV-DDB) protein is the major factor that binds DNA containing damage caused by UV radiation in mammalian cells. We have investigated the DNA recognition by this protein in vitro, using synthetic oligonucleotide duplexes and the protein purified from a HeLa cell extract. When a 32P-labeled 30-mer duplex containing the (6-4) photoproduct at a single site was used as a probe, only a single complex was detected in an electrophoretic mobility shift assay. It was demonstrated by Western blotting that both of the subunits (p48 and p127) were present in this complex. Electrophoretic mobility shift assays using various duplexes showed that the UV-DDB protein formed a specific, high affinity complex with the duplex containing an abasic site analog, in addition to the (6-4) photoproduct. By circular permutation analyses, these DNA duplexes were found to be bent at angles of 54 degrees and 57 degrees in the complexes with this protein. From the previously reported NMR studies and the fluorescence resonance energy transfer experiments in the present study, it can be concluded that the UV-DDB protein binds DNA that can be bent easily at the above angle. PMID:10391953

  14. DNA damage and repair after high LET radiation

    NASA Astrophysics Data System (ADS)

    O'Neill, Peter; Cucinotta, Francis; Anderson, Jennifer

    Predictions from biophysical models of interactions of radiation tracks with cellular DNA indicate that clustered DNA damage sites, defined as two or more lesions formed within one or two helical turns of the DNA by passage of a single radiation track, are formed in mammalian cells. These complex DNA damage sites are regarded as a signature of ionizing radiation exposure particularly as the likelihood of clustered damage sites arising endogenously is low. For instance, it was predicted from biophysical modelling that 30-40% of low LET-induced double strand breaks (DSB), a form of clustered damage, are complex with the yield increasing to >90% for high LET radiation, consistent with the reduced reparability of DSB with increasing ionization density of the radiation. The question arises whether the increased biological effects such as mutagenesis, carcinogenesis and lethality is in part related to DNA damage complexity and/or spatial distribution of the damage sites, which may lead to small DNA fragments. With particle radiation it is also important to consider not only delta-rays which may cause clustered damaged sites and may be highly mutagenic but the non-random spatial distribution of DSB which may lead to deletions. In this overview I will concentrate on the molecular aspects of the variation of the complexity of DNA damage on radiation quality and the challenges this complexity presents the DNA damage repair pathways. I will draw on data from micro-irradiations which indicate that the repair of DSBs by non-homologous end joining is highly regulated with pathway choice and kinetics of repair dependent on the chemical complexity of the DSB. In summary the aim is to emphasis the link between the spatial distribution of energy deposition events related to the track, the molecular products formed and the consequence of damage complexity contributing to biological effects and to present some of the outstanding molecular challenges with particle radiation.

  15. ShaPINg Cell Fate Upon DNA Damage: Role of Pin1 Isomerase in DNA Damage-Induced Cell Death and Repair.

    PubMed

    Polonio-Vallon, Tilman; Krüger, Daniel; Hofmann, Thomas G

    2014-01-01

    The peptidyl-prolyl cis/trans isomerase Pin1 acts as a molecular timer in proline-directed Ser/Thr kinase signaling and shapes cellular responses based on recognition of phosphorylation marks and implementing conformational changes in its substrates. Accordingly, Pin1 has been linked to numerous phosphorylation-controlled signaling pathways and cellular processes such as cell cycle progression, proliferation, and differentiation. In addition, Pin1 plays a pivotal role in DNA damage-triggered cell fate decisions. Whereas moderate DNA damage is balanced by DNA repair, cells confronted with massive genotoxic stress are eliminated by the induction of programed cell death or cellular senescence. In this review, we summarize and discuss the current knowledge on how Pin1 specifies cell fate through regulating key players of the apoptotic and the repair branch of the DNA-damage response. PMID:24982848

  16. Analysis of chromatin integrity and DNA damage of buffalo spermatozoa

    PubMed Central

    Mahmoud, K. Gh. M.; El-Sokary, A. A. E.; Abdel-Ghaffar, A. E.; Abou El-Roos, M. E. A.; Ahmed, Y. F.

    2015-01-01

    This study was conducted to determine chromatin integrity and DNA damage by DNA electrophoresis and comet assays of buffalo fresh and frozen semen. Semen samples were collected from four buffalo bulls and evaluated after freezing for semen motility, viability, sperm abnormalities, chromatin integrity and DNA damage. A significant variation was found in semen parameters after thawing. Highly significant differences (P<0.001) in chromatin integrity were observed between fresh and frozen semen. For the fresh semen, there was no significant difference between the bulls for chromatin integrity; however, a significant variation (P<0.05) was detected in their frozen semen. No DNA fragmentation was observed by agarose gel electrophoresis. The percentage of sperm with damaged DNA detected by comet assay differed significantly between fresh and frozen semen. A significant negative correlation was recorded between motility and DNA damage (r=-0.68, P<0.05). Sperm abnormalities and DNA fragmentation were significantly positively correlated (r=0.59, P<0.05). In conclusion, DNA damage evaluation can provide reassurance about genomic normalcy and guide the development of improved methods of selecting spermatozoa with intact DNA to be used in artificial insemination. PMID:27175169

  17. Analysis of chromatin integrity and DNA damage of buffalo spermatozoa.

    PubMed

    Mahmoud, K Gh M; El-Sokary, A A E; Abdel-Ghaffar, A E; Abou El-Roos, M E A; Ahmed, Y F

    2015-01-01

    This study was conducted to determine chromatin integrity and DNA damage by DNA electrophoresis and comet assays of buffalo fresh and frozen semen. Semen samples were collected from four buffalo bulls and evaluated after freezing for semen motility, viability, sperm abnormalities, chromatin integrity and DNA damage. A significant variation was found in semen parameters after thawing. Highly significant differences (P<0.001) in chromatin integrity were observed between fresh and frozen semen. For the fresh semen, there was no significant difference between the bulls for chromatin integrity; however, a significant variation (P<0.05) was detected in their frozen semen. No DNA fragmentation was observed by agarose gel electrophoresis. The percentage of sperm with damaged DNA detected by comet assay differed significantly between fresh and frozen semen. A significant negative correlation was recorded between motility and DNA damage (r=-0.68, P<0.05). Sperm abnormalities and DNA fragmentation were significantly positively correlated (r=0.59, P<0.05). In conclusion, DNA damage evaluation can provide reassurance about genomic normalcy and guide the development of improved methods of selecting spermatozoa with intact DNA to be used in artificial insemination. PMID:27175169

  18. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  19. Superoxide and the production of oxidative DNA damage.

    PubMed Central

    Keyer, K; Gort, A S; Imlay, J A

    1995-01-01

    The conventional model of oxidative DNA damage posits a role for superoxide (O2-) as a reductant for iron, which subsequently generates a hydroxyl radical by transferring the electron to H2O2. The hydroxyl radical then attacks DNA. Indeed, mutants of Escherichia coli that lack superoxide dismutase (SOD) were 10-fold more vulnerable to DNA oxidation by H2O2 than were wild-type cells. Even the pace of DNA damage by endogenous oxidants was great enough that the SOD mutants could not tolerate air if enzymes that repair oxidative DNA lesions were inactive. However, DNA oxidation proceeds in SOD-proficient cells without the involvement of O2-, as evidenced by the failure of SOD overproduction or anaerobiosis to suppress damage by H2O2. Furthermore, the mechanism by which excess O2- causes damage was called into question when the hypersensitivity of SOD mutants to DNA damage persisted for at least 20 min after O2- had been dispelled through the imposition of anaerobiosis. That behavior contradicted the standard model, which requires that O2- be present to rereduce cellular iron during the period of exposure to H2O2. Evidently, DNA oxidation is driven by a reductant other than O2-, which leaves the mechanism of damage promotion by O2- unsettled. One possibility is that, through its well-established ability to leach iron from iron-sulfur clusters, O2- increases the amount of free iron that is available to catalyze hydroxyl radical production. Experiments with iron transport mutants confirmed that increases in free-iron concentration have the effect of accelerating DNA oxidation. Thus, O2- may be genotoxic only in doses that exceed those found in SOD-proficient cells, and in those limited circumstances it may promote DNA damage by increasing the amount of DNA-bound iron. PMID:7592468

  20. DNA damage by soft X-ray exposure at oxygen K-edge

    NASA Astrophysics Data System (ADS)

    Sugaya, Y.; Narita, A.; Fujii, K.; Yokoya, A.

    2014-04-01

    In order to obtain detailed insights into the physicochemical mechanism of DNA damage induction in terms of photoabsorption modes, we have prepared thin DNA films of closed circular plasmid (pUC18) on a cover slip without any additives. Using this film, we have performed preliminary experiments by exposing to soft X-rays with energies around oxygen K-shell ionization threshold. The DNA damage yields of strand breaks and base lesions or AP sites were quantified by biochemical treatments. We confirmed that the DNA film can work as a specimen irradiation. The DNA damage yields induced by π* excitation of a K-shell electron of oxygen atoms in DNA were significantly larger those for oxygen K-ionization.

  1. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.

    PubMed

    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang

    2015-05-01

    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  2. p53 and Cell Cycle Effects After DNA Damage

    PubMed Central

    Senturk, Emir; Manfredi, James J.

    2016-01-01

    Flow cytometry, a valuable technique that employs the principles of light scattering, light excitation, and emission of fluorochrome molecules, can be used to assess the cell cycle position of individual cells based on DNA content. After the permeabilization of cells, the DNA can be stained with a fluorescent dye. Cells which have a 2N amount of DNA can be distinguished from cells with a 4N amount of DNA, making flow cytometry a very useful tool for the analysis of cell cycle checkpoints following DNA damage. A critical feature of the cellular response to DNA damage is the ability to pause and repair the damage so that consequential mutations are not passed along to daughter generations of cells. If cells arrest prior to DNA replication, they will contain a 2N amount of DNA, whereas arrest after replication but before mitosis will result in a 4N amount of DNA. Using this technique, the role that p53 plays in cell cycle checkpoints following DNA damage can be evaluated based on changes in the profile of the G1, S, and G2/M phases of the cell cycle. PMID:23150436

  3. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-01

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  4. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-15

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  5. Global chromatin fibre compaction in response to DNA damage

    SciTech Connect

    Hamilton, Charlotte; Hayward, Richard L.; Gilbert, Nick

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Robust KAP1 phosphorylation in response to DNA damage in HCT116 cells. Black-Right-Pointing-Pointer DNA repair foci are found in soluble chromatin. Black-Right-Pointing-Pointer Biophysical analysis reveals global chromatin fibre compaction after DNA damage. Black-Right-Pointing-Pointer DNA damage is accompanied by rapid linker histone dephosphorylation. -- Abstract: DNA is protected by packaging it into higher order chromatin fibres, but this can impede nuclear processes like DNA repair. Despite considerable research into the factors required for signalling and repairing DNA damage, it is unclear if there are concomitant changes in global chromatin fibre structure. In human cells DNA double strand break (DSB) formation triggers a signalling cascade resulting in H2AX phosphorylation ({gamma}H2AX), the rapid recruitment of chromatin associated proteins and the subsequent repair of damaged sites. KAP1 is a transcriptional corepressor and in HCT116 cells we found that after DSB formation by chemicals or ionising radiation there was a wave of, predominantly ATM dependent, KAP1 phosphorylation. Both KAP1 and phosphorylated KAP1 were readily extracted from cells indicating they do not have a structural role and {gamma}H2AX was extracted in soluble chromatin indicating that sites of damage are not attached to an underlying structural matrix. After DSB formation we did not find a concomitant change in the sensitivity of chromatin fibres to micrococcal nuclease digestion. Therefore to directly investigate higher order chromatin fibre structures we used a biophysical sedimentation technique based on sucrose gradient centrifugation to compare the conformation of chromatin fibres isolated from cells before and after DNA DSB formation. After damage we found global chromatin fibre compaction, accompanied by rapid linker histone dephosphorylation, consistent with fibres being more regularly folded or fibre deformation being stabilized by

  6. DNA damage in cancer therapeutics: a boon or a curse?

    PubMed

    Khanna, Anchit

    2015-06-01

    Millions of DNA-damaging lesions occur every day in each cell of our bodies due to various stresses. The failure to detect and accurately repair these lesions can give rise to cells with high levels of endogenous DNA damage, deleterious mutations, or genomic aberrations. Such genomic instability can lead to the activation of specific signaling pathways, including the DNA damage response (DDR) pathway. Constitutive activation of DDR proteins has been observed in human tumor specimens from different cancer stages, including precancerous and metastatic cancers, although not in normal tissues. The tumor-suppressive role of DDR activity during the premalignant stage has been studied, and strong evidence is emerging for an oncogenic role for DDR proteins such as DNA-PK and CHK1 during the later stages of tumor development. However, the majority of current cancer therapies induce DNA damage, potentially exacerbating protumorigenic genomic instability and enabling the development of resistance. Therefore, elucidating the molecular basis of DNA damage-mediated genomic instability and its role in tumorigenesis is critical. Finally, I discuss the potential existence of distinct DNA damage thresholds at various stages of tumorigenesis and what the ramifications of such thresholds would be, including the ambiguous role of the DDR pathway in human cancers, therapy-induced malignancies, and enhanced therapies. PMID:25931285

  7. The DNA damage response: the omics era and its impact

    PubMed Central

    Derks, Kasper W.J.; Hoeijmakers, Jan H.J.; Pothof, Joris

    2014-01-01

    The emergence of high density technologies monitoring the genome, transcriptome and proteome in relation to genotoxic stress have tremendously enhanced our knowledge on global responses and dynamics in the DNA damage response, including its relation with cancer and aging. Moreover, ‘-omics’ technologies identified many novel factors, their post-translational modifications, pathways and global responses in the cellular response to DNA damage. Based on omics, it is currently estimated that thousands of gene(product)s participate in the DNA damage response, recognizing complex networks that determine cell fate after damage to the most precious cellular molecule, DNA. The development of next generation sequencing technology and associated specialized protocols can quantitatively monitor RNA and DNA at unprecedented single nucleotide resolution. In this review we will discuss the contribution of omics technologies and in particular next generation sequencing to our understanding of the DNA damage response and the future prospective of next generation sequencing, its single cell application and omics dataset integration in unraveling intricate DNA damage signaling networks. PMID:24794401

  8. ISWI chromatin remodeling complexes in the DNA damage response

    PubMed Central

    Aydin, Özge Z; Vermeulen, Wim; Lans, Hannes

    2014-01-01

    Regulation of chromatin structure is an essential component of the DNA damage response (DDR), which effectively preserves the integrity of DNA by a network of multiple DNA repair and associated signaling pathways. Within the DDR, chromatin is modified and remodeled to facilitate efficient DNA access, to control the activity of repair proteins and to mediate signaling. The mammalian ISWI family has recently emerged as one of the major ATP-dependent chromatin remodeling complex families that function in the DDR, as it is implicated in at least 3 major DNA repair pathways: homologous recombination, non-homologous end-joining and nucleotide excision repair. In this review, we discuss the various manners through which different ISWI complexes regulate DNA repair and how they are targeted to chromatin containing damaged DNA. PMID:25486562

  9. Spatially localized generation of nucleotide sequence-specific DNA damage.

    PubMed

    Oh, D H; King, B A; Boxer, S G; Hanawalt, P C

    2001-09-25

    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen-DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320-400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA-psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen-TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  10. Topoisomerase I-mediated DNA damage.

    PubMed

    Pourquier, P; Pommier, Y

    2001-01-01

    Topoisomerase I is a ubiquitous and essential enzyme in multicellular organisms. It is involved in multiple DNA transactions including DNA replication, transcription, chromosome condensation and decondensation, and probably DNA recombination. Besides its activity of DNA relaxation necessary to eliminate torsional stresses associated with these processes, topoisomerase I may have other functions related to its interaction with other cellular proteins. Topoisomerase I is the target of the novel anticancer drugs, the camptothecins. Recently a broad range of physiological and environmentally-induced DNA modifications have also been shown to poison topoisomerases. This review summarizes the various factors that enhance or suppress top1 cleavage complexes and discusses the significance of such effects. We also review the different mechanisms that have been proposed for the repair of topoisomerase I-mediated DNA lesions. PMID:11034544

  11. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking

    PubMed Central

    Kondo, Takeshi; Kobayashi, Junya; Saitoh, Tatsuya; Maruyama, Kenta; Ishii, Ken J.; Barber, Glen N.; Komatsu, Kenshi; Akira, Shizuo; Kawai, Taro

    2013-01-01

    Double-stranded DNA (dsDNA) derived from pathogen- or host-damaged cells triggers innate immune responses when exposed to cytoplasm. However, the machinery underlying the primary recognition of intracellular dsDNA is obscure. Here we show that the DNA damage sensor, meiotic recombination 11 homolog A (MRE11), serves as a cytosolic sensor for dsDNA. Cells with a mutation of MRE11 gene derived from a patient with ataxia-telangiectasia–like disorder, and cells in which Mre11 was knocked down, had defects in dsDNA-induced type I IFN production. MRE11 physically interacted with dsDNA in the cytoplasm and was required for activation of stimulator of IFN genes (STING) and IRF3. RAD50, a binding protein to MRE11, was also required for dsDNA responses, whereas NBS1, another binding protein to MRE11, was dispensable. Collectively, our results suggest that the MRE11–RAD50 complex plays important roles in recognition of dsDNA and initiation of STING-dependent signaling, in addition to its role in DNA-damage responses. PMID:23388631

  12. DNA damage is a late event in resveratrol-mediated inhibition of Escherichia coli.

    PubMed

    Subramanian, Mahesh; Soundar, Swetha; Mangoli, Suhas

    2016-07-01

    Resveratrol is an important phytoalexin notable for a wide variety of beneficial activities. Resveratrol has been reported to be active against various pathogenic bacteria. However, it is not clear at the molecular level how this important activity is manifested. Resveratrol has been reported to bind to cupric ions and reduce it. In the process, it generates copper-peroxide complex and reactive oxygen species (ROS). Due to this ability, resveratrol has been shown to cleave plasmid DNA in several studies. To this end, we envisaged DNA damage to play a role in resveratrol mediated inhibition in Escherichia coli. We employed DNA damage repair deficient mutants from keio collection to demonstrate the hypersensitive phenotype upon resveratrol treatment. Analysis of integrity and PCR efficiency of plasmid DNA from resveratrol-treated cells revealed significant DNA damage after 6 h or more compared to DNA from vehicle-treated cells. RAPD-PCR was performed to demonstrate the damage in genomic DNA from resveratrol-treated cells. In addition, in situ DNA damage was observed under fluorescence microscopy after resveratrol treatment. Further resveratrol treatment resulted in cell cycle arrest of significant fraction of population revealed by flow cytometry. However, a robust induction was not observed in phage induction assay and induction of DNA damage response genes quantified by promoter fused fluorescent tracker protein. These observations along with our previous observation that resveratrol induces membrane damage in E. coli at early time point reveal, DNA damage is a late event, occurring after a few hours of treatment. PMID:27021971

  13. Is DNA Damage Response Ready for Action Anywhere?

    PubMed Central

    Terradas, Mariona; Martín, Marta; Hernández, Laia; Tusell, Laura; Genescà, Anna

    2012-01-01

    Organisms are continuously exposed to DNA damaging agents, consequently, cells have developed an intricate system known as the DNA damage response (DDR) in order to detect and repair DNA lesions. This response has to be rapid and accurate in order to keep genome integrity. It has been observed that the condensation state of chromatin hinders a proper DDR. However, the condensation state of chromatin is not the only barrier to DDR. In this review, we have collected data regarding the presence of DDR factors on micronuclear DNA lesions that indicate that micronuclei are almost incapable of generating an effective DDR because of defects in their nuclear envelope. Finally, considering the recent observations about the reincorporation of micronuclei to the main bulk of chromosomes, we suggest that, under certain circumstances, micronuclei carrying DNA damage might be a source of chromosome instability. PMID:23109871

  14. Roles of RNA-Binding Proteins in DNA Damage Response

    PubMed Central

    Kai, Mihoko

    2016-01-01

    Living cells experience DNA damage as a result of replication errors and oxidative metabolism, exposure to environmental agents (e.g., ultraviolet light, ionizing radiation (IR)), and radiation therapies and chemotherapies for cancer treatments. Accumulation of DNA damage can lead to multiple diseases such as neurodegenerative disorders, cancers, immune deficiencies, infertility, and also aging. Cells have evolved elaborate mechanisms to deal with DNA damage. Networks of DNA damage response (DDR) pathways are coordinated to detect and repair DNA damage, regulate cell cycle and transcription, and determine the cell fate. Upstream factors of DNA damage checkpoints and repair, “sensor” proteins, detect DNA damage and send the signals to downstream factors in order to maintain genomic integrity. Unexpectedly, we have discovered that an RNA-processing factor is involved in DNA repair processes. We have identified a gene that contributes to glioblastoma multiforme (GBM)’s treatment resistance and recurrence. This gene, RBM14, is known to function in transcription and RNA splicing. RBM14 is also required for maintaining the stem-like state of GBM spheres, and it controls the DNA-PK-dependent non-homologous end-joining (NHEJ) pathway by interacting with KU80. RBM14 is a RNA-binding protein (RBP) with low complexity domains, called intrinsically disordered proteins (IDPs), and it also physically interacts with PARP1. Furthermore, RBM14 is recruited to DNA double-strand breaks (DSBs) in a poly(ADP-ribose) (PAR)-dependent manner (unpublished data). DNA-dependent PARP1 (poly-(ADP) ribose polymerase 1) makes key contributions in the DNA damage response (DDR) network. RBM14 therefore plays an important role in a PARP-dependent DSB repair process. Most recently, it was shown that the other RBPs with intrinsically disordered domains are recruited to DNA damage sites in a PAR-dependent manner, and that these RBPs form liquid compartments (also known as

  15. Roles of RNA-Binding Proteins in DNA Damage Response.

    PubMed

    Kai, Mihoko

    2016-01-01

    Living cells experience DNA damage as a result of replication errors and oxidative metabolism, exposure to environmental agents (e.g., ultraviolet light, ionizing radiation (IR)), and radiation therapies and chemotherapies for cancer treatments. Accumulation of DNA damage can lead to multiple diseases such as neurodegenerative disorders, cancers, immune deficiencies, infertility, and also aging. Cells have evolved elaborate mechanisms to deal with DNA damage. Networks of DNA damage response (DDR) pathways are coordinated to detect and repair DNA damage, regulate cell cycle and transcription, and determine the cell fate. Upstream factors of DNA damage checkpoints and repair, "sensor" proteins, detect DNA damage and send the signals to downstream factors in order to maintain genomic integrity. Unexpectedly, we have discovered that an RNA-processing factor is involved in DNA repair processes. We have identified a gene that contributes to glioblastoma multiforme (GBM)'s treatment resistance and recurrence. This gene, RBM14, is known to function in transcription and RNA splicing. RBM14 is also required for maintaining the stem-like state of GBM spheres, and it controls the DNA-PK-dependent non-homologous end-joining (NHEJ) pathway by interacting with KU80. RBM14 is a RNA-binding protein (RBP) with low complexity domains, called intrinsically disordered proteins (IDPs), and it also physically interacts with PARP1. Furthermore, RBM14 is recruited to DNA double-strand breaks (DSBs) in a poly(ADP-ribose) (PAR)-dependent manner (unpublished data). DNA-dependent PARP1 (poly-(ADP) ribose polymerase 1) makes key contributions in the DNA damage response (DDR) network. RBM14 therefore plays an important role in a PARP-dependent DSB repair process. Most recently, it was shown that the other RBPs with intrinsically disordered domains are recruited to DNA damage sites in a PAR-dependent manner, and that these RBPs form liquid compartments (also known as "liquid-demixing"). Among the

  16. Spatially localized generation of nucleotide sequence-specific DNA damage

    PubMed Central

    Oh, Dennis H.; King, Brett A.; Boxer, Steven G.; Hanawalt, Philip C.

    2001-01-01

    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen–DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320–400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA–psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen–TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  17. Regulation of the DNA damage response by ubiquitin conjugation

    PubMed Central

    Brinkmann, Kerstin; Schell, Michael; Hoppe, Thorsten; Kashkar, Hamid

    2015-01-01

    In response to DNA damage, cells activate a highly conserved and complex kinase-based signaling network, commonly referred to as the DNA damage response (DDR), to safeguard genomic integrity. The DDR consists of a set of tightly regulated events, including detection of DNA damage, accumulation of DNA repair factors at the site of damage, and finally physical repair of the lesion. Upon overwhelming damage the DDR provokes detrimental cellular actions by involving the apoptotic machinery and inducing a coordinated demise of the damaged cells (DNA damage-induced apoptosis, DDIA). These diverse actions involve transcriptional activation of several genes that govern the DDR. Moreover, recent observations highlighted the role of ubiquitylation in orchestrating the DDR, providing a dynamic cellular regulatory circuit helping to guarantee genomic stability and cellular homeostasis (Popovic et al., 2014). One of the hallmarks of human cancer is genomic instability (Hanahan and Weinberg, 2011). Not surprisingly, deregulation of the DDR can lead to human diseases, including cancer, and can induce resistance to genotoxic anti-cancer therapy (Lord and Ashworth, 2012). Here, we summarize the role of ubiquitin-signaling in the DDR with special emphasis on its role in cancer and highlight the therapeutic value of the ubiquitin-conjugation machinery as a target in anti-cancer treatment strategy. PMID:25806049

  18. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology.

    PubMed

    Cheung-Ong, Kahlin; Giaever, Guri; Nislow, Corey

    2013-05-23

    DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action. This review covers the current DNA-damaging agents used in the clinic, discusses their limitations, and describes the use of chemical genomics to uncover new information about the DNA damage response network and to evaluate novel DNA-damaging compounds. PMID:23706631

  19. Leishmania major and Trypanosoma cruzi present distinct DNA damage responses.

    PubMed

    Garcia, Juliana B F; Rocha, João P Vieira da; Costa-Silva, Héllida M; Alves, Ceres L; Machado, Carlos R; Cruz, Angela K

    2016-05-01

    Leishmania major and Trypanosoma cruzi are medically relevant parasites and interesting model organisms, as they present unique biological processes. Despite increasing data regarding the mechanisms of gene expression regulation, there is little information on how the DNA damage response (DDR) occurs in trypanosomatids. We found that L. major presented a higher radiosensitivity than T. cruzi. L. major showed G1 arrest and displayed high mortality in response to ionizing radiation as a result of the inefficient repair of double-strand breaks (DSBs). Conversely, T. cruzi exhibited arrest in the S/G2 cell cycle phase, was able to efficiently repair DSBs and did not display high rates of cell death after exposure to gamma irradiation. L. major showed higher resistance to alkylating DNA damage, and only L. major was able to promote DNA repair and growth recovery in the presence of MMS. ASF1c overexpression did not interfere with the efficiency of DNA repair in either of the parasites but did accentuate the DNA damage checkpoint response, thereby delaying cell fate after damage. The observed differences in the DNA damage responses of T. cruzi and L. major may originate from the distinct preferred routes of genetic plasticity of the two parasites, i.e., DNA recombination versus amplification. PMID:27188657

  20. Circadian Modulation of 8-Oxoguanine DNA Damage Repair

    PubMed Central

    Manzella, Nicola; Bracci, Massimo; Strafella, Elisabetta; Staffolani, Sara; Ciarapica, Veronica; Copertaro, Alfredo; Rapisarda, Venerando; Ledda, Caterina; Amati, Monica; Valentino, Matteo; Tomasetti, Marco; Stevens, Richard G.; Santarelli, Lory

    2015-01-01

    The DNA base excision repair pathway is the main system involved in the removal of oxidative damage to DNA such as 8-Oxoguanine (8-oxoG) primarily via the 8-Oxoguanine DNA glycosylase (OGG1). Our goal was to investigate whether the repair of 8-oxoG DNA damage follow a circadian rhythm. In a group of 15 healthy volunteers, we found a daily variation of Ogg1 expression and activity with higher levels in the morning compared to the evening hours. Consistent with this, we also found lower levels of 8-oxoG in morning hours compared to those in the evening hours. Lymphocytes exposed to oxidative damage to DNA at 8:00 AM display lower accumulation of 8-oxoG than lymphocytes exposed at 8:00 PM. Furthermore, altered levels of Ogg1 expression were also observed in a group of shift workers experiencing a deregulation of circadian clock genes compared to a control group. Moreover, BMAL1 knockdown fibroblasts with a deregulated molecular clock showed an abolishment of circadian variation of Ogg1 expression and an increase of OGG1 activity. Our results suggest that the circadian modulation of 8-oxoG DNA damage repair, according to a variation of Ogg1 expression, could render humans less susceptible to accumulate 8-oxoG DNA damage in the morning hours. PMID:26337123

  1. Circadian Modulation of 8-Oxoguanine DNA Damage Repair.

    PubMed

    Manzella, Nicola; Bracci, Massimo; Strafella, Elisabetta; Staffolani, Sara; Ciarapica, Veronica; Copertaro, Alfredo; Rapisarda, Venerando; Ledda, Caterina; Amati, Monica; Valentino, Matteo; Tomasetti, Marco; Stevens, Richard G; Santarelli, Lory

    2015-01-01

    The DNA base excision repair pathway is the main system involved in the removal of oxidative damage to DNA such as 8-Oxoguanine (8-oxoG) primarily via the 8-Oxoguanine DNA glycosylase (OGG1). Our goal was to investigate whether the repair of 8-oxoG DNA damage follow a circadian rhythm. In a group of 15 healthy volunteers, we found a daily variation of Ogg1 expression and activity with higher levels in the morning compared to the evening hours. Consistent with this, we also found lower levels of 8-oxoG in morning hours compared to those in the evening hours. Lymphocytes exposed to oxidative damage to DNA at 8:00 AM display lower accumulation of 8-oxoG than lymphocytes exposed at 8:00 PM. Furthermore, altered levels of Ogg1 expression were also observed in a group of shift workers experiencing a deregulation of circadian clock genes compared to a control group. Moreover, BMAL1 knockdown fibroblasts with a deregulated molecular clock showed an abolishment of circadian variation of Ogg1 expression and an increase of OGG1 activity. Our results suggest that the circadian modulation of 8-oxoG DNA damage repair, according to a variation of Ogg1 expression, could render humans less susceptible to accumulate 8-oxoG DNA damage in the morning hours. PMID:26337123

  2. DNA damage as an intermediate biomarker in intervention studies.

    PubMed

    Santella, R M

    1997-11-01

    The development of sensitive assays for measurement of DNA damage in humans has great potential for enhancing intervention studies. Methods for DNA adduct measurement include immunoassays, [32p] postlabeling, high-performance liquid chromatography with fluorescence or electrochemical detection, and gas chromatography/mass spectroscopy. It is now well established that DNA adducts are a marker of exposure to various environmental, lifestyle, or occupational chemical carcinogens. Our own studies concentrate on immunologic detection of adducts by enzyme-linked immunosorbent assay (ELISA) of isolated DNA or quantitative immunohistochemical analysis of intact cells. Polycyclic aromatic hydrocarbon (PAH)-DNA adducts are elevated in blood cells of foundry and coke oven workers, individuals with high levels of exposure to environmental air pollution, and smokers. The study in smokers also found an inverse relationship between serum antioxidants and PAH-DNA, and is the basis for an ongoing antioxidant intervention. DNA adducts of PAH and 4-aminobiphenyl and oxidative DNA damage (8-oxo-deoxyguanosine) are being measured in blood mononuclear cells and exfoliated oral and bladder cells from subjects on antioxidants or placebo. Data on published intervention studies investigating oxidative damage and general aromatic DNA adducts measured by postlabeling are also summarized. These studies have already demonstrated that DNA adducts can be modulated by interventions and suggest that they can provide important mechanistic information in support of larger scale studies. PMID:9349685

  3. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  4. Curcumin Triggers DNA Damage and Inhibits Expression of DNA Repair Proteins in Human Lung Cancer Cells.

    PubMed

    Ting, Chien-Yi; Wang, Hsin-Ell; Yu, Chien-Chih; Liu, Hsin-Chung; Liu, Yu-Chang; Chiang, I-Tsang

    2015-07-01

    The study goal was to evaluate the effects of curcumin on DNA damage and expression of DNA-repair proteins in human lung cancer. Thus, NCI-H460 cells were used to study the effects of curcumin on DNA damage and repair in vitro. We investigated curcumin induces DNA damage by comet the assay and 4',6-diamidino-2-phenylindole (DAPI) staining. The DNA damage/repair-related protein levels were examined and monitored by western blotting and confocal microscopy. Curcumin significantly increased the length of comet tails and DNA condensation in NCI-H460 cells. Curcumin reduced expression of DNA-repair proteins such as 14-3-3 protein sigma (14-3-3σ), O6-methylguanine-DNA methyltransferase (MGMT), breast cancer susceptibility gene 1 (BRCA1), and mediator of DNA damage checkpoint 1 (MDC1). Curcumin also increased phosphorylation of p53 and Histone H2A.X (S140) in the nuclei of NCI-H460 cells. Taken together, our findings indicated that curcumin triggered DNA damage and inhibited expression of DNA-repair-associated proteins in NCI-H460 cells. PMID:26124332

  5. NF-κB inhibition delays DNA damage-induced senescence and aging in mice.

    PubMed

    Tilstra, Jeremy S; Robinson, Andria R; Wang, Jin; Gregg, Siobhán Q; Clauson, Cheryl L; Reay, Daniel P; Nasto, Luigi A; St Croix, Claudette M; Usas, Arvydas; Vo, Nam; Huard, Johnny; Clemens, Paula R; Stolz, Donna B; Guttridge, Denis C; Watkins, Simon C; Garinis, George A; Wang, Yinsheng; Niedernhofer, Laura J; Robbins, Paul D

    2012-07-01

    The accumulation of cellular damage, including DNA damage, is thought to contribute to aging-related degenerative changes, but how damage drives aging is unknown. XFE progeroid syndrome is a disease of accelerated aging caused by a defect in DNA repair. NF-κB, a transcription factor activated by cellular damage and stress, has increased activity with aging and aging-related chronic diseases. To determine whether NF-κB drives aging in response to the accumulation of spontaneous, endogenous DNA damage, we measured the activation of NF-κB in WT and progeroid model mice. As both WT and progeroid mice aged, NF-κB was activated stochastically in a variety of cell types. Genetic depletion of one allele of the p65 subunit of NF-κB or treatment with a pharmacological inhibitor of the NF-κB-activating kinase, IKK, delayed the age-related symptoms and pathologies of progeroid mice. Additionally, inhibition of NF-κB reduced oxidative DNA damage and stress and delayed cellular senescence. These results indicate that the mechanism by which DNA damage drives aging is due in part to NF-κB activation. IKK/NF-κB inhibitors are sufficient to attenuate this damage and could provide clinical benefit for degenerative changes associated with accelerated aging disorders and normal aging. PMID:22706308

  6. Comparison of DNA damage by methylmelamines and formaldehyde

    SciTech Connect

    Ross, W.E.; McMillan, D.R.; Ross, C.F.

    1981-07-01

    The cytotoxicity and DNA damaging activity of S9-activated hexamethylmelamine (HMM) and pentamethylmelamine (PMM) were compared with suspected active metabolites in mouse leukemia L1210 cells. Following treatment of L1210 cells with high concentrations of activated HMM and PMM, there were no DNA single-strand breaks or interstrand cross-links observed by DNA alkaline elution and only a low frequency of DNA-protein cross-links. Formaldehyde (FA) at nonlethal concentrations caused far greater DNA-protein cross-linking. The cytotoxicities of HMM and PMM were found unlikely to be related to extracellular or intracellular release of FA.

  7. Antioxidant Nutrients and Oxidative DNA Damage in Humans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Oxidative stress has been implicated in the pathogenesis of chronic diseases related to aging, such as cancer and cardiovascular disease. When the excessive amount of reactive oxygen species accumulates in vivo, it can cause oxidative damage to lipids, proteins and DNA. In particular DNA is one of...

  8. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.

    PubMed

    Nackerdien, Z; Atha, D

    1996-08-01

    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  9. The effect of two cryopreservation methods on human sperm DNA damage.

    PubMed

    Liu, Taixiu; Gao, Jianfang; Zhou, Niya; Mo, Min; Wang, Xiaogang; Zhang, Xi; Yang, Huan; Chen, Qing; Ao, Lin; Liu, Jinyi; Cui, Zhihong; Cao, Jia

    2016-06-01

    Several methods are currently available for selection when conducting sperm cryopreservation, however, these methods might cause different degrees of damage on sperm DNA. The aim of the this study is to compare the effects of storage at -80 °C (in ultra-low temperature refrigerator) and at -196 °C (in liquid nitrogen) on sperm DNA damage, thus to provide a reference for choosing the right method according to different aims. We randomly collected 28 semen samples from college students of Chongqing city. The samples stored at -80 °C were neat semen samples and the samples stored at -196 °C were mixed with additional cryoprotectants. Each sample was subjected to two freezing-thawing cycles, and the sperm DNA damage levels of fresh and thawed samples were measured by single cell gel electrophoresis (SCGE) and sperm chromatin structure assay (SCSA). Both SCGE and SCSA assays showed cryopreservation induced significant damage to sperm DNA. However, storage at -196 °C lead to more severe damage to sperm DNA than storage at -80 °C measured by SCSA. Sperm DNA damage increased simultaneously with the higher frequency of freezing-thawing cycles. We concluded that storage of neat semen samples at -80 °C had milder damage to sperm DNA than storage at -196 °C mixed with cryoprotectants. To avoid additional sperm DNA damage, repeated freezing and thawing should be prevented. PMID:27126062

  10. Biomarkers of oxidative damage to DNA and repair.

    PubMed

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  11. Inhibition of transcription by oxidative DNA damage products

    SciTech Connect

    Byrd, S.; Reines, D.; Doetsch, P.W. )

    1991-03-11

    Thymine glycol is a major oxidative DNA base damage product that can be produced spontaneously in normal cells or by certain chemicals and ionizing radiation. This lesion as well as other oxidatively damaged bases are recognized and removed in eukaryotic cells by the DNA repair enzyme redoxyendonuclease which the authors have identified in a variety of cell types. Transcriptional regulation is a key element in the control of gene expression. Deficiencies in the various steps of transcription of an essential gene may have catastrophic effects for a cell. In terminally differentiated cells, the removal of RNA-polymerase blocking lesions could be viewed as a critical function for DNA repair systems in such cells. Very little information exists on the effects of oxidative base damage products on the process of transcription. The authors show here that thymine glycol containing DNA templates can inhibit transcriptional elongation when these lesions are chemically introduced into a DNA template. A DNA segment containing a region of the human H3.3 histone gene was utilized to determine the effects of oxidative DNA base damage on transcription by pure E. coli core RNA polymerase and rat liver RNA polymerase II. Both eukaryotic and prokaryotic RNA polymerases are blocked by the presence of thymine glycols appearing in certain clusters of thymines in the oxidatively damaged transcription template. To obtain quantitative efficiencies of transcriptional arrest, the authors are engineering a DNA template containing a single defined oxidatively damaged residue. The authors' results support the idea that an important function of DNA repair systems in terminally differentiated cells is to ensure the efficient transcription of genes necessary for normal cellular function.

  12. T7 replisome directly overcomes DNA damage

    PubMed Central

    Sun, Bo; Pandey, Manjula; Inman, James T.; Yang, Yi; Kashlev, Mikhail; Patel, Smita S.; Wang, Michelle D.

    2015-01-01

    Cells and viruses possess several known ‘restart' pathways to overcome lesions during DNA replication. However, these ‘bypass' pathways leave a gap in replicated DNA or require recruitment of accessory proteins, resulting in significant delays to fork movement or even cell division arrest. Using single-molecule and ensemble methods, we demonstrate that the bacteriophage T7 replisome is able to directly replicate through a leading-strand cyclobutane pyrimidine dimer (CPD) lesion. We show that when a replisome encounters the lesion, a substantial fraction of DNA polymerase (DNAP) and helicase stay together at the lesion, the replisome does not dissociate and the helicase does not move forward on its own. The DNAP is able to directly replicate through the lesion by working in conjunction with helicase through specific helicase–DNAP interactions. These observations suggest that the T7 replisome is fundamentally permissive of DNA lesions via pathways that do not require fork adjustment or replisome reassembly. PMID:26675048

  13. T7 replisome directly overcomes DNA damage

    NASA Astrophysics Data System (ADS)

    Sun, Bo; Pandey, Manjula; Inman, James T.; Yang, Yi; Kashlev, Mikhail; Patel, Smita S.; Wang, Michelle D.

    2015-12-01

    Cells and viruses possess several known `restart' pathways to overcome lesions during DNA replication. However, these `bypass' pathways leave a gap in replicated DNA or require recruitment of accessory proteins, resulting in significant delays to fork movement or even cell division arrest. Using single-molecule and ensemble methods, we demonstrate that the bacteriophage T7 replisome is able to directly replicate through a leading-strand cyclobutane pyrimidine dimer (CPD) lesion. We show that when a replisome encounters the lesion, a substantial fraction of DNA polymerase (DNAP) and helicase stay together at the lesion, the replisome does not dissociate and the helicase does not move forward on its own. The DNAP is able to directly replicate through the lesion by working in conjunction with helicase through specific helicase-DNAP interactions. These observations suggest that the T7 replisome is fundamentally permissive of DNA lesions via pathways that do not require fork adjustment or replisome reassembly.

  14. GOLPH3 Links the Golgi, DNA Damage, and Cancer

    PubMed Central

    Buschman, Matthew D.; Rahajeng, Juliati; Field, Seth J.

    2014-01-01

    GOLPH3 is the first example of an oncogene that functions in secretory trafficking at the Golgi. The discovery of GOLPH3’s roles in both cancer and Golgi trafficking raises questions about how GOLPH3 and the Golgi contribute to cancer. Our recent investigation of the regulation of GOLPH3 revealed a surprising response by the Golgi upon DNA damage that is mediated by DNA-PK and GOLPH3. These results provide new insight into the DNA damage response with important implications for understanding the cellular response to standard cancer therapeutic agents. PMID:25634214

  15. Characterization of environmental chemicals with potential for DNA damage using isogenic DNA repair-deficient chicken DT40 cell lines

    PubMed Central

    Yamamoto, Kimiyo N.; Hirota, Kouji; Kono, Koichi; Takeda, Shunichi; Sakamuru, Srilatha; Xia, Menghang; Huang, Ruili; Austin, Christopher P.; Witt, Kristine L.; Tice, Raymond R.

    2012-01-01

    Included among the quantitative high throughput screens (qHTS) conducted in support of the U.S. Tox21 program are those being evaluated for the detection of genotoxic compounds. One such screen is based on the induction of increased cytotoxicity in 7 isogenic chicken DT40 cell lines deficient in DNA repair pathways compared to the parental DNA repair-proficient cell line. To characterize the utility of this approach for detecting genotoxic compounds and identifying the type(s) of DNA damage induced, we evaluated nine of 42 compounds identified as positive for differential cytotoxicity in qHTS (actinomycin D, adriamycin, alachlor, benzotrichloride, diglycidyl resorcinol ether, lovastatin, melphalan, trans-1,4-dichloro-2-butene, tris(2,3-epoxypropyl)isocyanurate) and one non-cytotoxic genotoxic compound (2-aminothiamine) for (1) clastogenicity in mutant and wild-type cells; (2) the comparative induction of γH2AX positive foci by melphalan; (3) the extent to which a 72-hr exposure duration increased assay sensitivity or specificity; (4) the use of 10 additional DT40 DNA repair-deficient cell lines to better analyze the type(s) of DNA damage induced; and (5) the involvement of reactive oxygen species in the induction of DNA damage. All compounds but lovastatin and 2-aminothiamine were more clastogenic in at least one DNA repair-deficient cell line than the wild-type cells. The differential responses across the various DNA repair-deficient cell lines provided information on the type(s) of DNA damage induced. The results demonstrate the utility of this DT40 screen for detecting genotoxic compounds, for characterizing the nature of the DNA damage, and potentially for analyzing mechanisms of mutagenesis. PMID:21538559

  16. DNA damage in dihydroartemisinin-resistant Molt-4 cells.

    PubMed

    Park, Jungsoo; Lai, Henry C; Sasaki, Tomikazu; Singh, Narendra P

    2015-03-01

    Artemisinin generates carbon-based free radicals when it reacts with iron, and induces molecular damage and apoptosis. Its toxicity is more selective toward cancer cells because cancer cells contain a higher level of intracellular free iron. Dihydroartemisinin (DHA), an analog of artemisinin, has selective cytotoxicity toward Molt-4 human lymphoblastoid cells. A major concern is whether cancer cells could develop resistance to DHA, thus limiting its therapeutic efficacy. We have developed a DHA-resistant Molt-4 cell line (RTN) and found out that these cells exhibited resistance to DHA but no significant cross- resistance to artemisinin-tagged holotransferrin (ART-TF), a synthetic artemisinin compound. In the present study, we investigated DNA damage induced by DHA and ART-TF in both Molt-4 and RTN cells using the comet assay. RTN cells exhibited a significantly lower level of basal and X-ray-induced DNA damage compared to Molt-4 cells. Both DHA and ART-TF induced DNA damage in Molt-4 cells, whereas DNA damage was induced in RTN cells by ART-TF, and not DHA. The result of this study shows that by the cell selection method, it is possible to generate a Molt-4 cell line which is not sensitive to DHA, but sensitive to ART-TF, as measured by DNA damage. PMID:25750283

  17. MERIT40 facilitates BRCA1 localization and DNA damage repair

    PubMed Central

    Feng, Lin; Huang, Jun; Chen, Junjie

    2009-01-01

    The product of breast cancer susceptibility gene 1, BRCA1, plays pivotal roles in the maintenance of genomic integrity. Mounting evidence indicates that BRCA1 associates with many proteins or protein complexes to regulate diverse processes important for the cellular response to DNA damage. One of these complexes, which mediates the accumulation of BRCA1 at sites of DNA breaks, involves the ubiquitin-binding motif (UIM)-containing protein RAP80, a coiled-coil domain protein CCDC98/Abraxas, and a deubiquitinating enzyme BRCC36. Here we describe the characterization of a novel component of this complex, MERIT40 (Mediator of Rap80 Interactions and Targeting 40 kd), which together with an adaptor protein BRE/BRCC45, enforces the BRCA1-dependent DNA damage response. MERIT40 is assembled into this RAP80/CCDC98-containing complex via its direct interaction with BRE/BRCC45. Importantly, MERIT40 regulates BRCA1 retention at DNA breaks and checkpoint function primarily via a role in maintaining the stability of BRE and this five-subunit protein complex at sites of DNA damage. Together, our study reveals that a stable complex containing MERIT40 acts early in DNA damage response and regulates damage-dependent BRCA1 localization. PMID:19261748

  18. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  19. Quality control mechanisms in cellular and systemic DNA damage responses

    PubMed Central

    Ermolaeva, Maria A.; Dakhovnik, Alexander; Schumacher, Björn

    2016-01-01

    The maintenance of the genome is of pivotal importance for the functional integrity of cells and tissues. The gradual accumulation of DNA damage is thought to contribute to the functional decline of tissues and organs with ageing. Defects in multiple genome maintenance systems cause human disorders characterized by cancer susceptibility, developmental failure, and premature ageing. The complex pathological consequences of genome instability are insufficiently explained by cell-autonomous DNA damage responses (DDR) alone. Quality control pathways play an important role in DNA repair and cellular DDR pathways. Recent years have revealed non-cell autonomous effects of DNA damage that impact the physiological adaptations during ageing. We will discuss the role of quality assurance pathways in cell-autonomous and systemic responses to genome instability. PMID:25560147

  20. Quantitative PCR for detection of DNA damage in mitochondrial DNA of the fission yeast Schizosaccharomyces pombe.

    PubMed

    Senoo, Takanori; Yamanaka, Mayumi; Nakamura, Atori; Terashita, Tomoki; Kawano, Shinji; Ikeda, Shogo

    2016-08-01

    Quantitative polymerase chain reaction (QPCR) has been employed to detect DNA damage and repair in mitochondrial DNA (mtDNA) of human and several model organisms. The assay also permits the quantitation of relative mtDNA copy number in cells. Here, we developed the QPCR assay primers and reaction conditions for the fission yeast Schizosaccharomyces pombe, an important model of eukaryote biology, not previously described. Under these conditions, long targets (approximately 10kb) in mtDNA were quantitatively amplified using 0.1ng of crude DNA templates without isolation of mitochondria and mtDNA. Quantitative detection of oxidative DNA damage in mtDNA was illustrated by using a DNA template irradiated with UVA in the presence of riboflavin. The damage to mtDNA in S. pombe cells treated with hydrogen peroxide and paraquat was also quantitatively measured. Finally, we found that mtDNA copy number in S. pombe cells increased after transition into a stationary phase and that the damage to mtDNA due to endogenous cellular processes accumulated during chronological aging. PMID:27236021

  1. Mouse zygotes respond to severe sperm DNA damage by delaying paternal DNA replication and embryonic development.

    PubMed

    Gawecka, Joanna E; Marh, Joel; Ortega, Michael; Yamauchi, Yasuhiro; Ward, Monika A; Ward, W Steven

    2013-01-01

    Mouse zygotes do not activate apoptosis in response to DNA damage. We previously reported a unique form of inducible sperm DNA damage termed sperm chromatin fragmentation (SCF). SCF mirrors some aspects of somatic cell apoptosis in that the DNA degradation is mediated by reversible double strand breaks caused by topoisomerase 2B (TOP2B) followed by irreversible DNA degradation by a nuclease(s). Here, we created zygotes using spermatozoa induced to undergo SCF (SCF zygotes) and tested how they responded to moderate and severe paternal DNA damage during the first cell cycle. We found that the TUNEL assay was not sensitive enough to identify the breaks caused by SCF in zygotes in either case. However, paternal pronuclei in both groups stained positively for γH2AX, a marker for DNA damage, at 5 hrs after fertilization, just before DNA synthesis, while the maternal pronuclei were negative. We also found that both pronuclei in SCF zygotes with moderate DNA damage replicated normally, but paternal pronuclei in the SCF zygotes with severe DNA damage delayed the initiation of DNA replication by up to 12 hrs even though the maternal pronuclei had no discernable delay. Chromosomal analysis of both groups confirmed that the paternal DNA was degraded after S-phase while the maternal pronuclei formed normal chromosomes. The DNA replication delay caused a marked retardation in progression to the 2-cell stage, and a large portion of the embryos arrested at the G2/M border, suggesting that this is an important checkpoint in zygotic development. Those embryos that progressed through the G2/M border died at later stages and none developed to the blastocyst stage. Our data demonstrate that the zygote responds to sperm DNA damage through a non-apoptotic mechanism that acts by slowing paternal DNA replication and ultimately leads to arrest in embryonic development. PMID:23431372

  2. Survival of phosphate-solubilizing bacteria against DNA damaging agents.

    PubMed

    Shrivastava, Manoj; Rajpurohit, Yogendra S; Misra, Hari S; D'Souza, S F

    2010-10-01

    Phosphate-solubilizing bacteria (PSBs) were isolated from different plant rhizosphere soils of various agroecological regions of India. These isolates showed synthesis of pyrroloquinoline quinone (PQQ), production of gluconic acid, and release of phosphorus from insoluble tricalcium phosphate. The bacterial isolates synthesizing PQQ also showed higher tolerance to ultraviolet C radiation and mitomycin C as compared to Escherichia coli but were less tolerant than Deinococcus radiodurans. Unlike E. coli, PSB isolates showed higher tolerance to DNA damage when grown in the absence of inorganic phosphate. Higher tolerance to ultraviolet C radiation and oxidative stress in these PSBs grown under PQQ synthesis inducible conditions, namely phosphate starvation, might suggest the possible additional role of this redox cofactor in the survival of these isolates under extreme abiotic stress conditions. PMID:20962905

  3. Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity.

    PubMed

    Slyskova, Jana; Lorenzo, Yolanda; Karlsen, Anette; Carlsen, Monica H; Novosadova, Vendula; Blomhoff, Rune; Vodicka, Pavel; Collins, Andrew R

    2014-04-01

    The interplay between dietary habits and individual genetic make-up is assumed to influence risk of cancer, via modulation of DNA integrity. Our aim was to characterize internal and external factors that underlie inter-individual variability in DNA damage and repair and to identify dietary habits beneficial for maintaining DNA integrity. Habitual diet was estimated in 340 healthy individuals using a food frequency questionnaire and biomarkers of antioxidant status were quantified in fasting blood samples. Markers of DNA integrity were represented by DNA strand breaks, oxidized purines, oxidized pyrimidines and a sum of all three as total DNA damage. DNA repair was characterized by genetic variants and functional activities of base and nucleotide excision repair pathways. Sex, fruit-based food consumption and XPG genotype were factors significantly associated with the level of DNA damage. DNA damage was higher in women (p=0.035). Fruit consumption was negatively associated with the number of all measured DNA lesions, and this effect was mediated mostly by β-cryptoxanthin and β-tocopherol (p<0.05). XPG 1104His homozygotes appeared more vulnerable to DNA damage accumulation (p=0.001). Sex and individual antioxidants were also associated with DNA repair capacity; both the base and nucleotide excision repairs were lower in women and the latter increased with higher plasma levels of ascorbic acid and α-carotene (p<0.05). We have determined genetic and dietary factors that modulate DNA integrity. We propose that the positive health effect of fruit intake is partially mediated via DNA damage suppression and a simultaneous increase in DNA repair capacity. PMID:24674629

  4. NBS1 and multiple regulations of DNA damage response

    PubMed Central

    Komatsu, Kenshi

    2016-01-01

    DNA damage response is finely tuned, with several pathways including those for DNA repair, chromatin remodeling and cell cycle checkpoint, although most studies to date have focused on single pathways. Genetic diseases characterized by genome instability have provided novel insights into the underlying mechanisms of DNA damage response. NBS1, a protein responsible for the radiation-sensitive autosomal recessive disorder Nijmegen breakage syndrome, is one of the first factors to accumulate at sites of DNA double-strand breaks (DSBs). NBS1 binds to at least five key proteins, including ATM, RPA, MRE11, RAD18 and RNF20, in the conserved regions within a limited span of the C terminus, functioning in the regulation of chromatin remodeling, cell cycle checkpoint and DNA repair in response to DSBs. In this article, we reviewed the functions of these binding proteins and their comprehensive association with NBS1. PMID:27068998

  5. Connecting the Dots: From DNA Damage and Repair to Aging.

    PubMed

    Pan, Mei-Ren; Li, Kaiyi; Lin, Shiaw-Yih; Hung, Wen-Chun

    2016-01-01

    Mammalian cells evolve a delicate system, the DNA damage response (DDR) pathway, to monitor genomic integrity and to prevent the damage from both endogenous end exogenous insults. Emerging evidence suggests that aberrant DDR and deficient DNA repair are strongly associated with cancer and aging. Our understanding of the core program of DDR has made tremendous progress in the past two decades. However, the long list of the molecules involved in the DDR and DNA repair continues to grow and the roles of the new "dots" are under intensive investigation. Here, we review the connection between DDR and DNA repair and aging and discuss the potential mechanisms by which deficient DNA repair triggers systemic effects to promote physiological or pathological aging. PMID:27164092

  6. Connecting the Dots: From DNA Damage and Repair to Aging

    PubMed Central

    Pan, Mei-Ren; Li, Kaiyi; Lin, Shiaw-Yih; Hung, Wen-Chun

    2016-01-01

    Mammalian cells evolve a delicate system, the DNA damage response (DDR) pathway, to monitor genomic integrity and to prevent the damage from both endogenous end exogenous insults. Emerging evidence suggests that aberrant DDR and deficient DNA repair are strongly associated with cancer and aging. Our understanding of the core program of DDR has made tremendous progress in the past two decades. However, the long list of the molecules involved in the DDR and DNA repair continues to grow and the roles of the new “dots” are under intensive investigation. Here, we review the connection between DDR and DNA repair and aging and discuss the potential mechanisms by which deficient DNA repair triggers systemic effects to promote physiological or pathological aging. PMID:27164092

  7. DNA Damage in Chronic Kidney Disease: Evaluation of Clinical Biomarkers

    PubMed Central

    Schupp, Nicole; Stopper, Helga; Heidland, August

    2016-01-01

    Patients with chronic kidney disease (CKD) exhibit an increased cancer risk compared to a healthy control population. To be able to estimate the cancer risk of the patients and to assess the impact of interventional therapies thereon, it is of particular interest to measure the patients' burden of genomic damage. Chromosomal abnormalities, reduced DNA repair, and DNA lesions were found indeed in cells of patients with CKD. Biomarkers for DNA damage measurable in easily accessible cells like peripheral blood lymphocytes are chromosomal aberrations, structural DNA lesions, and oxidatively modified DNA bases. In this review the most common methods quantifying the three parameters mentioned above, the cytokinesis-block micronucleus assay, the comet assay, and the quantification of 8-oxo-7,8-dihydro-2′-deoxyguanosine, are evaluated concerning the feasibility of the analysis and regarding the marker's potential to predict clinical outcomes. PMID:27313827

  8. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  9. Involvement of DNA Damage Response Pathways in Hepatocellular Carcinoma

    PubMed Central

    Yang, Sheau-Fang; Wei, Ren-Jie; Shiue, Yow-Ling; Wang, Shen-Nien

    2014-01-01

    Hepatocellular carcinoma (HCC) has been known as one of the most lethal human malignancies, due to the difficulty of early detection, chemoresistance, and radioresistance, and is characterized by active angiogenesis and metastasis, which account for rapid recurrence and poor survival. Its development has been closely associated with multiple risk factors, including hepatitis B and C virus infection, alcohol consumption, obesity, and diet contamination. Genetic alterations and genomic instability, probably resulted from unrepaired DNA lesions, are increasingly recognized as a common feature of human HCC. Dysregulation of DNA damage repair and signaling to cell cycle checkpoints, known as the DNA damage response (DDR), is associated with a predisposition to cancer and affects responses to DNA-damaging anticancer therapy. It has been demonstrated that various HCC-associated risk factors are able to promote DNA damages, formation of DNA adducts, and chromosomal aberrations. Hence, alterations in the DDR pathways may accumulate these lesions to trigger hepatocarcinogenesis and also to facilitate advanced HCC progression. This review collects some of the most known information about the link between HCC-associated risk factors and DDR pathways in HCC. Hopefully, the review will remind the researchers and clinicians of further characterizing and validating the roles of these DDR pathways in HCC. PMID:24877058

  10. Copper oxide nanoparticle mediated DNA damage in terrestrial plant models.

    PubMed

    Atha, Donald H; Wang, Huanhua; Petersen, Elijah J; Cleveland, Danielle; Holbrook, R David; Jaruga, Pawel; Dizdaroglu, Miral; Xing, Baoshan; Nelson, Bryant C

    2012-02-01

    Engineered nanoparticles, due to their unique electrical, mechanical, and catalytic properties, are presently found in many commercial products and will be intentionally or inadvertently released at increasing concentrations into the natural environment. Metal- and metal oxide-based nanomaterials have been shown to act as mediators of DNA damage in mammalian cells, organisms, and even in bacteria, but the molecular mechanisms through which this occurs are poorly understood. For the first time, we report that copper oxide nanoparticles induce DNA damage in agricultural and grassland plants. Significant accumulation of oxidatively modified, mutagenic DNA lesions (7,8-dihydro-8-oxoguanine; 2,6-diamino-4-hydroxy-5-formamidopyrimidine; 4,6-diamino-5-formamidopyrimidine) and strong plant growth inhibition were observed for radish (Raphanus sativus), perennial ryegrass (Lolium perenne), and annual ryegrass (Lolium rigidum) under controlled laboratory conditions. Lesion accumulation levels mediated by copper ions and macroscale copper particles were measured in tandem to clarify the mechanisms of DNA damage. To our knowledge, this is the first evidence of multiple DNA lesion formation and accumulation in plants. These findings provide impetus for future investigations on nanoparticle-mediated DNA damage and repair mechanisms in plants. PMID:22201446

  11. Shared Genetic Pathways Contribute to the Tolerance of Endogenous and Low-Dose Exogenous DNA Damage in Yeast

    PubMed Central

    Lehner, Kevin; Jinks-Robertson, Sue

    2014-01-01

    DNA damage that escapes repair and blocks replicative DNA polymerases is tolerated by bypass mechanisms that fall into two general categories: error-free template switching and error-prone translesion synthesis. Prior studies of DNA damage responses in Saccharomyces cerevisiae have demonstrated that repair mechanisms are critical for survival when a single, high dose of DNA damage is delivered, while bypass/tolerance mechanisms are more important for survival when the damage level is low and continuous (acute and chronic damage, respectively). In the current study, epistatic interactions between DNA-damage tolerance genes were examined and compared when haploid yeast cells were exposed to either chronic ultraviolet light or chronic methyl methanesulfonate. Results demonstrate that genes assigned to error-free and error-prone bypass pathways similarly promote survival in the presence of each type of chronic damage. In addition to using defined sources of chronic damage, rates of spontaneous mutations generated by the Pol ζ translesion synthesis DNA polymerase (complex insertions in a frameshift-reversion assay) were used to infer epistatic interactions between the same genes. Similar epistatic interactions were observed in analyses of spontaneous mutation rates, suggesting that chronic DNA-damage responses accurately reflect those used to tolerate spontaneous lesions. These results have important implications when considering what constitutes a safe and acceptable level of exogenous DNA damage. PMID:25060101

  12. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales

    2015-01-01

    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  13. DNA damage and L1 retrotransposition.

    PubMed

    Farkash, Evan A; Luning Prak, Eline T

    2006-01-01

    Barbara McClintock was the first to suggest that transposons are a source of genome instability and that genotoxic stress assisted in their mobilization. The generation of double-stranded DNA breaks (DSBs) is a severe form of genotoxic stress that threatens the integrity of the genome, activates cell cycle checkpoints, and, in some cases, causes cell death. Applying McClintock's stress hypothesis to humans, are L1 retrotransposons, the most active autonomous mobile elements in the modern day human genome, mobilized by DSBs? Here, evidence that transposable elements, particularly retrotransposons, are mobilized by genotoxic stress is reviewed. In the setting of DSB formation, L1 mobility may be affected by changes in the substrate for L1 integration, the DNA repair machinery, or the L1 element itself. The review concludes with a discussion of the potential consequences of L1 mobilization in the setting of genotoxic stress. PMID:16877815

  14. Parvovirus Diversity and DNA Damage Responses

    PubMed Central

    Cotmore, Susan F.; Tattersall, Peter

    2013-01-01

    Parvoviruses have a linear single-stranded DNA genome, around 5 kb in length, with short imperfect terminal palindromes that fold back on themselves to form duplex hairpin telomeres. These contain most of the cis-acting information required for viral “rolling hairpin” DNA replication, an evolutionary adaptation of rolling-circle synthesis in which the hairpins create duplex replication origins, prime complementary strand synthesis, and act as hinges to reverse the direction of the unidirectional cellular fork. Genomes are packaged vectorially into small, rugged protein capsids ∼260 Å in diameter, which mediate their delivery directly into the cell nucleus, where they await their host cell’s entry into S phase under its own cell cycle control. Here we focus on genus-specific variations in genome structure and replication, and review host cell responses that modulate the nuclear environment. PMID:23293137

  15. Parvovirus diversity and DNA damage responses.

    PubMed

    Cotmore, Susan F; Tattersall, Peter

    2013-02-01

    Parvoviruses have a linear single-stranded DNA genome, around 5 kb in length, with short imperfect terminal palindromes that fold back on themselves to form duplex hairpin telomeres. These contain most of the cis-acting information required for viral "rolling hairpin" DNA replication, an evolutionary adaptation of rolling-circle synthesis in which the hairpins create duplex replication origins, prime complementary strand synthesis, and act as hinges to reverse the direction of the unidirectional cellular fork. Genomes are packaged vectorially into small, rugged protein capsids ~260 Å in diameter, which mediate their delivery directly into the cell nucleus, where they await their host cell's entry into S phase under its own cell cycle control. Here we focus on genus-specific variations in genome structure and replication, and review host cell responses that modulate the nuclear environment. PMID:23293137

  16. Activation of a DNA damage checkpoint response in a TAF1-defective cell line.

    PubMed

    Buchmann, Ann M; Skaar, Jeffrey R; DeCaprio, James A

    2004-06-01

    Although the link between transcription and DNA repair is well established, defects in the core transcriptional complex itself have not been shown to elicit a DNA damage response. Here we show that a cell line with a temperature-sensitive defect in TBP-associated factor 1 (TAF1), a component of the TFIID general transcription complex, exhibits hallmarks of an ATR-mediated DNA damage response. Upon inactivation of TAF1, ATR rapidly localized to subnuclear foci and contributed to the phosphorylation of several downstream targets, including p53 and Chk1, resulting in cell cycle arrest. The increase in p53 expression and the G(1) phase arrest could be blocked by caffeine, an inhibitor of ATR. In addition, dominant negative forms of ATR but not ATM were able to override the arrest in G(1). These results suggest that a defect in TAF1 can elicit a DNA damage response. PMID:15169897

  17. Activation of a DNA Damage Checkpoint Response in a TAF1-Defective Cell Line

    PubMed Central

    Buchmann, Ann M.; Skaar, Jeffrey R.; DeCaprio, James A.

    2004-01-01

    Although the link between transcription and DNA repair is well established, defects in the core transcriptional complex itself have not been shown to elicit a DNA damage response. Here we show that a cell line with a temperature-sensitive defect in TBP-associated factor 1 (TAF1), a component of the TFIID general transcription complex, exhibits hallmarks of an ATR-mediated DNA damage response. Upon inactivation of TAF1, ATR rapidly localized to subnuclear foci and contributed to the phosphorylation of several downstream targets, including p53 and Chk1, resulting in cell cycle arrest. The increase in p53 expression and the G1 phase arrest could be blocked by caffeine, an inhibitor of ATR. In addition, dominant negative forms of ATR but not ATM were able to override the arrest in G1. These results suggest that a defect in TAF1 can elicit a DNA damage response. PMID:15169897

  18. Ubiquitin-family modifications in the replication of DNA damage.

    PubMed

    Lehmann, Alan R

    2011-09-16

    The cell uses specialised Y-family DNA polymerases or damage avoidance mechanisms to replicate past damaged sites in DNA. These processes are under complex regulatory systems, which employ different types of post-translational modification. All the Y-family polymerases have ubiquitin binding domains that bind to mono-ubiquitinated PCNA to effect the switching from replicative to Y-family polymerase. Ubiquitination and de-ubiquitination of PCNA are tightly regulated. There is also evidence for another as yet unidentified ubiquitinated protein being involved in recruitment of Y-family polymerases to chromatin. Poly-ubiquitination of PCNA stimulates damage avoidance, and, at least in yeast, PCNA is SUMOylated to prevent unwanted recombination events at the replication fork. The Y-family polymerases themselves can be ubiquitinated and, in the case of DNA polymerase η, this results in the polymerase being excluded from chromatin. PMID:21704031

  19. A Novel Mutation in DNA Topoisomerase I of Yeast Causes DNA Damage and Rad9-Dependent Cell Cycle Arrest

    PubMed Central

    Levin, N. A.; Bjornsti, M. A.; Fink, G. R.

    1993-01-01

    DNA topoisomerases, enzymes that alter the superhelicity of DNA, have been implicated in such critical cellular functions as transcription, DNA replication, and recombination. In the yeast Saccharomyces cerevisiae, a null mutation in the gene encoding topoisomerase I (TOP1) causes elevated levels of mitotic recombination in the ribosomal DNA (rDNA), but has little effect on growth. We have isolated a missense mutation in TOP1 that causes mitotic hyper-recombination not only in the rDNA, but also at other loci, in addition to causing a number of other unexpected phenotypes. This topoisomerase I mutation (top1-103) causes slow growth, constitutive expression of DNA damage-inducible genes, and inviability in the absence of the double-strand break repair system. Overexpression of top1-103 causes RAD9-dependent cell cycle arrest in G(2). We show that the Top1-103 enzyme nicks DNA in vitro, suggesting that it damages DNA directly. We propose that Top1-103 mimics the action of wild-type topoisomerase I in the presence of the anti-tumor drug, camptothecin. PMID:8385050

  20. Significant disparity in base and sugar damage in DNA resulting from neutron and electron irradiation.

    PubMed

    Pang, Dalong; Nico, Jeffrey S; Karam, Lisa; Timofeeva, Olga; Blakely, William F; Dritschilo, Anatoly; Dizdaroglu, Miral; Jaruga, Pawel

    2014-11-01

    In this study, a comparison of the effects of neutron and electron irradiation of aqueous DNA solutions was investigated to characterize potential neutron signatures in DNA damage induction. Ionizing radiation generates numerous lesions in DNA, including base and sugar lesions, lesions involving base-sugar combinations (e.g. 8,5'-cyclopurine-2'-deoxynucleosides) and DNA-protein cross-links, as well as single- and double-strand breaks and clustered damage. The characteristics of damage depend on the linear energy transfer (LET) of the incident radiation. Here we investigated DNA damage using aqueous DNA solutions in 10 mmol/l phosphate buffer from 0-80 Gy by low-LET electrons (10 Gy/min) and the specific high-LET (∼0.16 Gy/h) neutrons formed by spontaneous (252)Cf decay fissions. 8-hydroxy-2'-deoxyguanosine (8-OH-dG), (5'R)-8,5'-cyclo-2'-deoxyadenosine (R-cdA) and (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA) were quantified using liquid chromatography-isotope-dilution tandem mass spectrometry to demonstrate a linear dose dependence for induction of 8-OH-dG by both types of radiation, although neutron irradiation was ∼50% less effective at a given dose compared with electron irradiation. Electron irradiation resulted in an exponential increase in S-cdA and R-cdA with dose, whereas neutron irradiation induced substantially less damage and the amount of damage increased only gradually with dose. Addition of 30 mmol/l 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS), a free radical scavenger, to the DNA solution before irradiation reduced lesion induction to background levels for both types of radiation. These results provide insight into the mechanisms of DNA damage by high-LET (252)Cf decay neutrons and low-LET electrons, leading to enhanced understanding of the potential biological effects of these types of irradiation. PMID:25034731

  1. DNA damage responsive microRNAs misexpressed in human cancer modulate therapy sensitivity

    PubMed Central

    van Jaarsveld, Marijn T.M.; Wouters, Maikel D.; Boersma, Antonius W.M.; Smid, Marcel; van IJcken, Wilfred F.J.; Mathijssen, Ron H.J.; Hoeijmakers, Jan H.J.; Martens, John W. M.; van Laere, Steven; Wiemer, Erik A.C.; Pothof, Joris

    2015-01-01

    The DNA damage response (DDR) is activated upon DNA damage and prevents accumulation of mutations and chromosomal rearrangements, both driving carcinogenesis. Tumor cells often have defects in the DDR, which in combination with continuous cell proliferation are exploited by genotoxic cancer therapies. Most cancers, overcome initial sensitivity and develop drug resistance, e.g. by modulation of the DDR. Not much is known, however, about DNA damage responsive microRNAs in cancer therapy resistance. Therefore, we mapped temporal microRNA expression changes in primary breast epithelial cells upon low and high dose exposure to the DNA damaging agents ionizing radiation and cisplatin. A third of all DDR microRNAs commonly regulated across all treatments was also misexpressed in breast cancer, indicating a DDR defect. We repeated this approach in primary lung epithelial cells and non-small cell lung cancer samples and found that more than 40% of all DDR microRNAs was deregulated in non-small cell lung cancer. Strikingly, the microRNA response upon genotoxic stress in primary breast and lung epithelial cells was markedly different, although the biological outcome of DNA damage signaling (cell death/senescence or survival) was similar. Several DDR microRNAs deregulated in cancer modulated sensitivity to anti-cancer agents. In addition we were able to distinguish between microRNAs that induced resistance by potentially inducing quiescence (miR-296-5p and miR-382) or enhancing DNA repair or increased DNA damage tolerance (miR-21). In conclusion, we provide evidence that DNA damage responsive microRNAs are frequently misexpressed in human cancer and can modulate chemotherapy sensitivity. PMID:24462518

  2. Overtraining is associated with DNA damage in blood and skeletal muscle cells of Swiss mice

    PubMed Central

    2013-01-01

    Background The alkaline version of the single-cell gel (comet) assay is a useful method for quantifying DNA damage. Although some studies on chronic and acute effects of exercise on DNA damage measured by the comet assay have been performed, it is unknown if an aerobic training protocol with intensity, volume, and load clearly defined will improve performance without leading to peripheral blood cell DNA damage. In addition, the effects of overtraining on DNA damage are unknown. Therefore, this study aimed to examine the effects of aerobic training and overtraining on DNA damage in peripheral blood and skeletal muscle cells in Swiss mice. To examine possible changes in these parameters with oxidative stress, we measured reduced glutathione (GSH) levels in total blood, and GSH levels and lipid peroxidation in muscle samples. Results Performance evaluations (i.e., incremental load and exhaustive tests) showed significant intra and inter-group differences. The overtrained (OTR) group showed a significant increase in the percentage of DNA in the tail compared with the control (C) and trained (TR) groups. GSH levels were significantly lower in the OTR group than in the C and TR groups. The OTR group had significantly higher lipid peroxidation levels compared with the C and TR groups. Conclusions Aerobic and anaerobic performance parameters can be improved in training at maximal lactate steady state during 8 weeks without leading to DNA damage in peripheral blood and skeletal muscle cells or to oxidative stress in skeletal muscle cells. However, overtraining induced by downhill running training sessions is associated with DNA damage in peripheral blood and skeletal muscle cells, and with oxidative stress in skeletal muscle cells and total blood. PMID:24099482

  3. Can graphene quantum dots cause DNA damage in cells?

    NASA Astrophysics Data System (ADS)

    Wang, Dan; Zhu, Lin; Chen, Jian-Feng; Dai, Liming

    2015-05-01

    Graphene quantum dots (GQDs) have attracted tremendous attention for biological applications. We report the first study on cytotoxicity and genotoxicity of GQDs to fibroblast cell lines (NIH-3T3 cells). The NIH-3T3 cells treated with GQDs at dosages over 50 μg mL-1 showed no significant cytotoxicity. However, the GQD-treated NIH-3T3 cells exhibited an increased expression of proteins (p53, Rad 51, and OGG1) related to DNA damage compared with untreated cells, indicating the DNA damage caused by GQDs. The GQD-induced release of reactive oxygen species (ROS) was demonstrated to be responsible for the observed DNA damage. These findings should have important implications for future applications of GQDs in biological systems.Graphene quantum dots (GQDs) have attracted tremendous attention for biological applications. We report the first study on cytotoxicity and genotoxicity of GQDs to fibroblast cell lines (NIH-3T3 cells). The NIH-3T3 cells treated with GQDs at dosages over 50 μg mL-1 showed no significant cytotoxicity. However, the GQD-treated NIH-3T3 cells exhibited an increased expression of proteins (p53, Rad 51, and OGG1) related to DNA damage compared with untreated cells, indicating the DNA damage caused by GQDs. The GQD-induced release of reactive oxygen species (ROS) was demonstrated to be responsible for the observed DNA damage. These findings should have important implications for future applications of GQDs in biological systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01734c

  4. Spectrum of complex DNA damages depends on the incident radiation

    NASA Astrophysics Data System (ADS)

    Hada, M.; Sutherland, B.

    Ionizing radiation induces clustered DNA damages in DNA-two or more abasic sites oxidized bases and strand breaks on opposite DNA strands within a few helical turns Clustered damages are considered to be difficult to repair and therefore potentially lethal and mutagenic damages Although induction of single strand breaks and isolated lesions has been studied extensively little is known of factors affecting induction of clusters other than double strand breaks DSB The aim of the present study was to determine whether the type of incident radiation could affect yield or spectra of specific clusters Genomic T7 DNA a simple 40 kbp linear blunt-ended molecule was irradiated in non-scavenging buffer conditions with Fe 970 MeV n Ti 980 MeV n C 293 MeV n Si 586 MeV n ions or protons 1 GeV n at the NASA Space Radiation Laboratory or with 100 kVp X-rays Irradiated DNA was treated with homogeneous Fpg or Nfo proteins or without enzyme treatment for DSB quantitation then electrophoresed in neutral agarose gels DSB Fpg-OxyPurine clusters and Nfo-Abasic clusters were quantified by number average length analysis The results show that the yields of all these complex damages depend on the incident radiation Although LETs are similar protons induced twice as many DSBs than did X-rays Further the spectrum of damage also depends on the radiation The yield damage Mbp Gy of all damages decreased with increasing linear energy transfer LET of the radiation The relative frequencies of DSBs to Abasic- and OxyBase clusters were higher

  5. DNA damage and cell killing. Cause and effect

    SciTech Connect

    Elkind, M.M.

    1985-11-15

    The evidence supporting a cause and effect relationship between DNA damage and cell killing is examined in the light of what is currently known about the organization and replication of genomic DNA in eukaryotic cells and the radio-energetics of DNA breakage. A large disparity is identified between characteristic doses for cell killing and for the production of DNA lesions (i.e., single- or double-strand breaks). In contrast, the sensitive phase of the inhibition of DNA synthesis has a dependence on dose quantitatively similar to that of cell killing. A model is developed in which single- and double-strand breaks are associated with the inhibition of replicon initiation, whereas only double-strand breaks are primarily responsible for strand elongation. Furthermore, the model points to the replisome and the region of replicated DNA just downstream from the fork as the locus of radiation action.

  6. Role of a MutY DNA Glycosylase in Combating Oxidative DNA damage in Helicobacter pylori

    PubMed Central

    Eutsey, Rory; Wang, Ge; Maier, Robert J.

    2007-01-01

    MutY is an adenine glycosylase that has the ability to efficiently remove adenines from adenine/7,8-dihydro-8-oxoguanine (8-oxo-G) or adenine/guanine mismatches, and plays an important role in oxidative DNA damage repair. The human gastric pathogen Helicobacter pylori has a homolog of the MutY enzyme. To investigate the physiological roles of MutY in H. pylori, we constructed and characterized a mutY mutant. H. pylori mutY mutants incubated at 5% O2 have a 325 fold higher spontaneous mutation rate than its parent. The mutation rate is further increased by exposing the mutant to atmospheric levels of oxygen, an effect that is not seen in an E. coli mutY mutant. Most of the mutations that occurred in H. pylori mutY mutants, as examined by rpoB sequence changes that confer rifampicin resistance, are GC to TA transversions. The H. pylori enzyme has the ability to complement an E. coli mutY mutant, restoring its mutation frequency to the wild-type level. Pure H. pylori MutY has the ability to remove adenines from A/8-oxo-G mismatches, but strikingly no ability to cleave A/G mismatches. This is surprising because E. coli MutY can more rapidly turnover A/G than A/8-oxo-G. Thus, H. pylori MutY is an adenine glycosylase involved in the repair of oxidative DNA damage with a specificity for detecting 8-oxo-G. In addition, H. pylori mutY mutants are only 30% as efficient as wild-type in colonizing the stomach of mice, indicating that H. pylori MutY plays a significant role in oxidative DNA damage repair in vivo. PMID:16996809

  7. Specificity of damage recognition and catalysis of DNA repair.

    PubMed

    Osman, R; Fuxreiter, M; Luo, N

    2000-05-01

    A common feature of DNA repair enzymes is their ability to recognize the damage independently of sequence in which they are found. The presence of a flipped out base inserted into the protein in several DNA-enzyme complexes suggests a contribution to enzyme specificity. Molecular simulations of damaged DNA indicate that the damage produces changes in DNA structure and changes the dynamics of DNA bending. The reduced bending force constant can be used by the enzyme to induce DNA bending and facilitate base flipping. We show that a thymine dimer (TD) containing DNA requires less energy to bend, lowering the barrier for base flipping. On the other hand, bending in DNA with U-G mismatch is affected only by a small amount and flipping is not enhanced significantly. T4 endonuclease V (endoV), which recognizes TD, utilizes the reduced barrier for flipping as a specific recognition element. In uracil DNA glycosylase (UDG), which recognizes U-G mismatches, base flipping is not enhanced and recognition is encoded in a highly specific binding pocket for the flipped base. Simulations of UDG and endoV in complex with damaged DNA provide insight into the essential elements of the catalytic mechanism. Calculations of pKas of active site residues in endoV and endoV-DNA complex show that the pKa, of the N-terminus is reduced from 8.01 to 6.52 while that of Glu-23 increases from 1.52 to 7.82. Thus, the key catalytic residues are in their neutral form. The simulations also show that Glu-23 is also H-bonded to O4' of the 5'-TD enhancing the nucleophilic attack on Cl and that Arg-26 enhances the hydrolysis by electrostatic stabilization but does not participate in proton transfer. In the enzyme-substrate complex of UDG, the role of electrostatic stabilization is played by His-268, whose pKa increases to 7.1 from 4.9 in the free enzyme. The pKa of Asp-145, the other important catalytic residue, remains around 4.2 in the free enzyme and in the complex. Thus, it can not act as a proton

  8. Tyrosine 370 phosphorylation of ATM positively regulates DNA damage response

    PubMed Central

    Lee, Hong-Jen; Lan, Li; Peng, Guang; Chang, Wei-Chao; Hsu, Ming-Chuan; Wang, Ying-Nai; Cheng, Chien-Chia; Wei, Leizhen; Nakajima, Satoshi; Chang, Shih-Shin; Liao, Hsin-Wei; Chen, Chung-Hsuan; Lavin, Martin; Ang, K Kian; Lin, Shiaw-Yih; Hung, Mien-Chie

    2015-01-01

    Ataxia telangiectasia mutated (ATM) mediates DNA damage response by controling irradiation-induced foci formation, cell cycle checkpoint, and apoptosis. However, how upstream signaling regulates ATM is not completely understood. Here, we show that upon irradiation stimulation, ATM associates with and is phosphorylated by epidermal growth factor receptor (EGFR) at Tyr370 (Y370) at the site of DNA double-strand breaks. Depletion of endogenous EGFR impairs ATM-mediated foci formation, homologous recombination, and DNA repair. Moreover, pretreatment with an EGFR kinase inhibitor, gefitinib, blocks EGFR and ATM association, hinders CHK2 activation and subsequent foci formation, and increases radiosensitivity. Thus, we reveal a critical mechanism by which EGFR directly regulates ATM activation in DNA damage response, and our results suggest that the status of ATM Y370 phosphorylation has the potential to serve as a biomarker to stratify patients for either radiotherapy alone or in combination with EGFR inhibition. PMID:25601159

  9. Nuclear DNA damage signalling to mitochondria in ageing.

    PubMed

    Fang, Evandro Fei; Scheibye-Knudsen, Morten; Chua, Katrin F; Mattson, Mark P; Croteau, Deborah L; Bohr, Vilhelm A

    2016-05-01

    Mitochondrial dysfunction is a hallmark of ageing, and mitochondrial maintenance may lead to increased healthspan. Emerging evidence suggests a crucial role for signalling from the nucleus to mitochondria (NM signalling) in regulating mitochondrial function and ageing. An important initiator of NM signalling is nuclear DNA damage, which accumulates with age and may contribute to the development of age-associated diseases. DNA damage-dependent NM signalling constitutes a network that includes nuclear sirtuins and controls genomic stability and mitochondrial integrity. Pharmacological modulation of NM signalling is a promising novel approach for the prevention and treatment of age-associated diseases. PMID:26956196

  10. Regenerative capacity of old muscle stem cells declines without significant accumulation of DNA damage.

    PubMed

    Cousin, Wendy; Ho, Michelle Liane; Desai, Rajiv; Tham, Andrea; Chen, Robert Yuzen; Kung, Sunny; Elabd, Christian; Conboy, Irina M

    2013-01-01

    The performance of adult stem cells is crucial for tissue homeostasis but their regenerative capacity declines with age, leading to failure of multiple organs. In skeletal muscle this failure is manifested by the loss of functional tissue, the accumulation of fibrosis, and reduced satellite cell-mediated myogenesis in response to injury. While recent studies have shown that changes in the composition of the satellite cell niche are at least in part responsible for the impaired function observed with aging, little is known about the effects of aging on the intrinsic properties of satellite cells. For instance, their ability to repair DNA damage and the effects of a potential accumulation of DNA double strand breaks (DSBs) on their regenerative performance remain unclear. This work demonstrates that old muscle stem cells display no significant accumulation of DNA DSBs when compared to those of young, as assayed after cell isolation and in tissue sections, either in uninjured muscle or at multiple time points after injury. Additionally, there is no significant difference in the expression of DNA DSB repair proteins or globally assayed DNA damage response genes, suggesting that not only DNA DSBs, but also other types of DNA damage, do not significantly mark aged muscle stem cells. Satellite cells from DNA DSB-repair-deficient SCID mice do have an unsurprisingly higher level of innate DNA DSBs and a weakened recovery from gamma-radiation-induced DNA damage. Interestingly, they are as myogenic in vitro and in vivo as satellite cells from young wild type mice, suggesting that the inefficiency in DNA DSB repair does not directly correlate with the ability to regenerate muscle after injury. Overall, our findings suggest that a DNA DSB-repair deficiency is unlikely to be a key factor in the decline in muscle regeneration observed upon aging. PMID:23704914

  11. DNA damage and repair in human skin in situ

    SciTech Connect

    Sutherland, B.M.; Gange, R.W.; Freeman, S.E.; Sutherland, J.C.

    1987-01-01

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs.

  12. DNA replication: damage tolerance at the assembly line.

    PubMed

    Blastyák, András

    2014-07-01

    Damage tolerance mechanisms ensure resumption of DNA synthesis at damage-replisome encounters. Replication fork reversal (RFR) is one such widely recognized mechanism that acts on replisomes where lagging strand synthesis continues upon leading strand synthesis block. The possibility to form such a structure is highly counter to our current understanding of the replisome dynamics of single replisomes. Here, I suggest a model that takes coupled bidirectional replisome organization into account to solve this apparent contradiction. PMID:24957737

  13. The current state of eukaryotic DNA base damage and repair.

    PubMed

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-01

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. PMID:26519467

  14. The current state of eukaryotic DNA base damage and repair

    PubMed Central

    Bauer, Nicholas C.; Corbett, Anita H.; Doetsch, Paul W.

    2015-01-01

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. PMID:26519467

  15. DNA damage under simulated extraterrestrial conditions in bacteriophage T7

    NASA Astrophysics Data System (ADS)

    Fekete, A.; Módos, K.; Hegedüs, M.; Kovács, G.; Rontó, Gy.; Péter, Á.; Lammer, H.; Panitz, C.

    The experiment "Phage and Uracil response" will be accommodated in the EXPOSE facility of the International Space Station. Its objective is to examine and quantify the effect of specific space conditions on nucleic acid models, especially on bacteriophage T7 and isolated T7 DNA thin films. In order to define the environmental and technical requirements of the EXPOSE, the samples were subjected to the experiment verification test (EVT). During EVT, the samples were exposed to vacuum (10 -4-10 -6 Pa) and polychromatic UV-radiation (200-400 nm) in air, in inert atmosphere, as well as in simulated space vacuum. The effect of extreme temperature in vacuum and the influence of temperature fluctuations around 0 °C were also studied. The total intraphage/isolated DNA damage was determined by quantitative PCR using 555 and 3826 bp fragments of T7 DNA. The type of the damage was resolved using a combination of enzymatic probes and neutral and alkaline agarose gel electrophoresis; the structural/chemical effects were analyzed by spectroscopic and microscopical methods. We obtained substantial evidence that DNA lesions accumulate throughout exposure, but the amount of damage depends on the thickness of the layers. According to our preliminary results, the damages by exposure to conditions of dehydration and UV-irradiation are larger than the sum of vacuum alone, or radiation alone case, suggesting a synergistic action of space vacuum and UV radiation with DNA being the critical target.

  16. Mcl-1 protects prostate cancer cells from cell death mediated by chemotherapy-induced DNA damage.

    PubMed

    Reiner, Teresita; de Las Pozas, Alicia; Parrondo, Ricardo; Palenzuela, Deanna; Cayuso, William; Rai, Priyamvada; Perez-Stable, Carlos

    2015-01-01

    The anti-apoptotic protein Mcl-1 is highly expressed in castration-resistant prostate cancer (CRPC), resulting in resistance to apoptosis and association with poor prognosis. Although predominantly localized in the cytoplasm, there is evidence that Mcl-1 exhibits nuclear localization where it is thought to protect against DNA damage-induced cell death. The role of Mcl-1 in mediating resistance to chemotherapy-induced DNA damage in prostate cancer (PCa) is not known. We show in human PCa cell lines and in TRAMP, a transgenic mouse model of PCa, that the combination of the antimitotic agent ENMD-1198 (analog of 2-methoxyestradiol) with betulinic acid (BA, increases proteotoxic stress) targets Mcl-1 by increasing its proteasomal degradation, resulting in increased γH2AX (DNA damage) and apoptotic/necrotic cell death. Knockdown of Mcl-1 in CRPC cells leads to elevated γH2AX, DNA strand breaks, and cell death after treatment with 1198 + BA- or doxorubicin. Additional knockdowns in PC3 cells suggests that cytoplasmic Mcl-1 protects against DNA damage by blocking the mitochondrial release of apoptosis-inducing factor and thereby preventing its nuclear translocation and subsequent interaction with the cyclophilin A endonuclease. Overall, our results suggest that chemotherapeutic agents that target Mcl-1 will promote cell death in response to DNA damage, particularly in CRPC. PMID:26425662

  17. Glycosylases utilize ``stop and go'' motion to locate DNA damage

    NASA Astrophysics Data System (ADS)

    Nelson, Shane

    2015-03-01

    Oxidative damage to DNA results in alterations that are mutagenic or even cytotoxic. Base excision repair is a mechanism that functions to identify and correct these lesions, and is present in organisms ranging from bacteria to humans. DNA glycosylases are the first enzymes in this pathway and function to locate and remove oxidatively damaged bases, and do so utilizing only thermal energy. However, the question remains of how these enzymes locate and recognize a damaged base among millions of undamaged bases. Utilizing fluorescence video microscopy with high spatial and temporal resolution, we have observed a number of different fluorescently labeled glycosylases (including bacterial FPG, NEI, and NTH as well as mammalian MutyH and OGG). These enzymes diffuse along DNA tightropes at approximately 0.01 +/- 0.005 μm2/s with binding lifetimes ranging from one second to several minutes. Chemically induced damage to the DNA substrate causes a ~ 50% reduction in diffusion coefficients and a ~ 400% increase in binding lifetimes, while mutation of the key ``wedge residue'' - which has been shown to be responsible for damage detection - results in a 200% increase in the diffusion coefficient. Utilizing a sliding window approach to measure diffusion coefficients within individual trajectories, we observe that distributions of diffusion coefficients are bimodal, consistent with periods of diffusive motion interspersed with immobile periods. Utilizing a unique chemo-mechanical simulation approach, we demonstrate that the motion of these glycosylases can be explained as free diffusion along the helical pitch of the DNA, punctuated with two different types of pauses: 1) rapid, short-lived pauses as the enzyme rapidly probes DNA bases to interrogate for damage and, 2) less frequent, longer lived pauses that reflect the enzyme bound to and catalytically removing a damaged base. These simulations also indicate that the wedge residue is critical for interrogation and recognition of

  18. DNA damage response during mouse oocyte maturation.

    PubMed

    Mayer, Alexandra; Baran, Vladimir; Sakakibara, Yogo; Brzakova, Adela; Ferencova, Ivana; Motlik, Jan; Kitajima, Tomoya S; Schultz, Richard M; Solc, Petr

    2016-01-01

    Because low levels of DNA double strand breaks (DSBs) appear not to activate the ATM-mediated prophase I checkpoint in full-grown oocytes, there may exist mechanisms to protect chromosome integrity during meiotic maturation. Using live imaging we demonstrate that low levels of DSBs induced by the radiomimetic drug Neocarzinostatin (NCS) increase the incidence of chromosome fragments and lagging chromosomes but do not lead to APC/C activation and anaphase onset delay. The number of DSBs, represented by γH2AX foci, significantly decreases between prophase I and metaphase II in both control and NCS-treated oocytes. Transient treatment with NCS increases >2-fold the number of DSBs in prophase I oocytes, but less than 30% of these oocytes enter anaphase with segregation errors. MRE11, but not ATM, is essential to detect DSBs in prophase I and is involved in H2AX phosphorylation during metaphase I. Inhibiting MRE11 by mirin during meiotic maturation results in anaphase bridges and also increases the number of γH2AX foci in metaphase II.  Compromised DNA integrity in mirin-treated oocytes indicates a role for MRE11 in chromosome integrity during meiotic maturation. PMID:26745237

  19. Diagnosis of Lung Cancer by Fractal Analysis of Damaged DNA

    PubMed Central

    Namazi, Hamidreza; Kiminezhadmalaie, Mona

    2015-01-01

    Cancer starts when cells in a part of the body start to grow out of control. In fact cells become cancer cells because of DNA damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to study the cancer genes, DNA walk plots of genomes of patients with lung cancer were generated using a program written in MATLAB language. The data so obtained was checked for fractal property by computing the fractal dimension using a program written in MATLAB. Also, the correlation of damaged DNA was studied using the Hurst exponent measure. We have found that the damaged DNA sequences are exhibiting higher degree of fractality and less correlation compared with normal DNA sequences. So we confirmed this method can be used for early detection of lung cancer. The method introduced in this research not only is useful for diagnosis of lung cancer but also can be applied for detection and growth analysis of different types of cancers. PMID:26539245

  20. Diagnosis of Lung Cancer by Fractal Analysis of Damaged DNA.

    PubMed

    Namazi, Hamidreza; Kiminezhadmalaie, Mona

    2015-01-01

    Cancer starts when cells in a part of the body start to grow out of control. In fact cells become cancer cells because of DNA damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to study the cancer genes, DNA walk plots of genomes of patients with lung cancer were generated using a program written in MATLAB language. The data so obtained was checked for fractal property by computing the fractal dimension using a program written in MATLAB. Also, the correlation of damaged DNA was studied using the Hurst exponent measure. We have found that the damaged DNA sequences are exhibiting higher degree of fractality and less correlation compared with normal DNA sequences. So we confirmed this method can be used for early detection of lung cancer. The method introduced in this research not only is useful for diagnosis of lung cancer but also can be applied for detection and growth analysis of different types of cancers. PMID:26539245

  1. Rfc4 Interacts with Rpa1 and Is Required for Both DNA Replication and DNA Damage Checkpoints in Saccharomyces cerevisiae

    PubMed Central

    Kim, Hee-Sook; Brill, Steven J.

    2001-01-01

    The large subunit of replication protein A (Rpa1) consists of three single-stranded DNA binding domains and an N-terminal domain (Rpa1N) of unknown function. To determine the essential role of this domain we searched for mutations that require wild-type Rpa1N for viability in yeast. A mutation in RFC4, encoding a small subunit of replication factor C (RFC), was found to display allele-specific interactions with mutations in the gene encoding Rpa1 (RFA1). Mutations that map to Rpa1N and confer sensitivity to the DNA synthesis inhibitor hydroxyurea, such as rfa1-t11, are lethal in combination with rfc4-2. The rfc4-2 mutant itself is sensitive to hydroxyurea, and like rfc2 and rfc5 strains, it exhibits defects in the DNA replication block and intra-S checkpoints. RFC4 and the DNA damage checkpoint gene RAD24 were found to be epistatic with respect to DNA damage sensitivity. We show that the rfc4-2 mutant is defective in the G1/S DNA damage checkpoint response and that both the rfc4-2 and rfa1-t11 strains are defective in the G2/M DNA damage checkpoint. Thus, in addition to its essential role as part of the clamp loader in DNA replication, Rfc4 plays a role as a sensor in multiple DNA checkpoint pathways. Our results suggest that a physical interaction between Rfc4 and Rpa1N is required for both roles. PMID:11340166

  2. CHROMOTHRIPSIS FROM DNA DAMAGE IN MICRONUCLEI

    PubMed Central

    Zhang, Cheng-Zhong; Spektor, Alexander; Cornils, Hauke; Francis, Joshua M.; Jackson, Emily K.; Liu, Shiwei; Meyerson, Matthew; Pellman, David

    2015-01-01

    Genome sequencing has uncovered a new mutational phenomenon in cancer and congenital disorders called chromothripsis. Chromothripsis is characterized by extensive genomic rearrangements and an oscillating pattern of DNA copy number levels, all curiously restricted to one or a few chromosomes. The mechanism for chromothripsis is unknown, but we previously proposed that it could occur through the physical isolation of chromosomes in aberrant nuclear structures called micronuclei. Here, using a combination of live-cell imaging and single-cell genome sequencing, we demonstrate that micronucleus formation can indeed generate a spectrum of genomic rearrangements, some of which recapitulate all known features of chromothripsis. These events are restricted to the missegregated chromosome and occur within one cell division. We demonstrate that the mechanism for chromothripsis can involve the fragmentation and subsequent reassembly of a single chromatid from a micronucleus. Collectively, these experiments establish a new mutational process of which chromothripsis is one extreme outcome. PMID:26017310

  3. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.

    PubMed

    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong

    2016-07-21

    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  4. No Ancient DNA Damage in Actinobacteria from the Neanderthal Bone

    PubMed Central

    Zaremba-Niedźwiedzka, Katarzyna; Andersson, Siv G. E.

    2013-01-01

    Background The Neanderthal genome was recently sequenced using DNA extracted from a 38,000-year-old fossil. At the start of the project, the fraction of mammalian and bacterial DNA in the sample was estimated to be <6% and 9%, respectively. Treatment with restriction enzymes prior to sequencing increased the relative proportion of mammalian DNA to 15%, but the large majority of sequences remain uncharacterized. Principal Findings Our taxonomic profiling of 3.95 Gb of Neanderthal DNA isolated from the Vindija Neanderthal Vi33.16 fossil showed that 90% of about 50,000 rRNA gene sequence reads were of bacterial origin, of which Actinobacteria accounted for more than 75%. Actinobacteria also represented more than 80% of the PCR-amplified 16S rRNA gene sequences from a cave sediment sample taken from the same G layer as the Neanderthal bone. However, phylogenetic analyses did not identify any sediment clones that were closely related to the bone-derived sequences. We analysed the patterns of nucleotide differences in the individual sequence reads compared to the assembled consensus sequences of the rRNA gene sequences. The typical ancient nucleotide substitution pattern with a majority of C to T changes indicative of DNA damage was observed for the Neanderthal rRNA gene sequences, but not for the Streptomyces-like rRNA gene sequences. Conclusions/Significance Our analyses suggest that the Actinobacteria, and especially members of the Streptomycetales, contribute the majority of sequences in the DNA extracted from the Neanderthal fossil Vi33.16. The bacterial DNA showed no signs of damage, and we hypothesize that it was derived from bacteria that have been enriched inside the bone. The bioinformatic approach used here paves the way for future studies of microbial compositions and patterns of DNA damage in bacteria from archaeological bones. Such studies can help identify targeted measures to increase the relative amount of endogenous DNA in the sample. PMID:23658776

  5. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    PubMed Central

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 μM) formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  6. DNA damage under simulated extraterrestrial conditions in bacteriophage T7

    NASA Astrophysics Data System (ADS)

    Fekete, A.; Kovács, G.; Hegedüs, M.; Módos, K.; Rontó, Gy.; Lammer, H.; Panitz, C.

    The experiment ``Phage and uracil response'' (PUR) will be accommodated in the EXPOSE facility of the ISS aiming to examine and quantify the effect of specific space conditions on bacteriophage T7 and isolated T7 DNA thin films. To achieve this new method was elaborated for the preparation of DNA and nucleoprotein thin films (1). During the EXPOSE Experiment Verification Tests (EVT) the samples were exposed to vacuum (10 -6 Pa), to monochromatic (254 nm) and polychromatic (200-400 nm) UV radiation in air as well in simulated space vacuum. Using neutral density (ND) filters dose-effect curves were performed in order to define the maximum doses tolerated, and we also studied the effect of temperature in vacuum as well as the influence of temperature fluctuations. We obtained substantial evidence that DNA lesions (e.g. strand breaks, DNA-protein cross-links, DNA-DNA cross-links) accumulate throughout exposure. DNA damage was determined by quantitative PCR using 555 bp and 3826 bp fragments of T7 DNA (2) and by neutral and alkaline agarose gel electrophoresis; the structural/chemical effects were analyzed by spectroscopic and microscopical methods. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of the PCR products have been detected indicating the damage of isolated and intraphage DNA. Preliminary results suggest a synergistic action of space vacuum and UV radiation with DNA being the critical target. Fekete et al. J. Luminescence 102-103, 469-475, 2003 Hegedüs et al. Photochem. Photobiol. 78, 213-219, 2003

  7. Mitochondrial Telomerase Protects Cancer Cells from Nuclear DNA Damage and Apoptosis

    PubMed Central

    Singhapol, Chatchawan; Pal, Deepali; Czapiewski, Rafal; Porika, Mahendar; Nelson, Glyn; Saretzki, Gabriele C.

    2013-01-01

    Most cancer cells express high levels of telomerase and proliferate indefinitely. In addition to its telomere maintenance function, telomerase also has a pro-survival function resulting in an increased resistance against DNA damage and decreased apoptosis induction. However, the molecular mechanisms for this protective function remain elusive and it is unclear whether it is connected to telomere maintenance or is rather a non-telomeric function of the telomerase protein, TERT. It was shown recently that the protein subunit of telomerase can shuttle from the nucleus to the mitochondria upon oxidative stress where it protects mitochondrial function and decreases intracellular oxidative stress. Here we show that endogenous telomerase (TERT protein) shuttles from the nucleus into mitochondria upon oxidative stress in cancer cells and analyzed the nuclear exclusion patterns of endogenous telomerase after treatment with hydrogen peroxide in different cell lines. Cell populations excluded TERT from the nucleus upon oxidative stress in a heterogeneous fashion. We found a significant correlation between nuclear localization of telomerase and high DNA damage, while cells which excluded telomerase from the nucleus displayed no or very low DNA damage. We modeled nuclear and mitochondrial telomerase using organelle specific localization vectors and confirmed that mitochondrial localization of telomerase protects the nucleus from inflicted DNA damage and apoptosis while, in contrast, nuclear localization of telomerase correlated with higher amounts of DNA damage and apoptosis. It is known that nuclear DNA damage can be caused by mitochondrially generated reactive oxygen species (ROS). We demonstrate here that mitochondrial localization of telomerase specifically prevents nuclear DNA damage by decreasing levels of mitochondrial ROS. We suggest that this decrease of oxidative stress might be a possible cause for high stress resistance of cancer cells and could be especially

  8. Colocalization of Sensors Is Sufficient to Activate the DNA Damage Checkpoint in the Absence of Damage

    PubMed Central

    Bonilla, Carla Yaneth; Melo, Justine Amy

    2010-01-01

    Summary Previous work on the DNA damage checkpoint in Saccharomyces cerevisiae has shown that two complexes independently sense DNA lesions: the kinase Mec1-Ddc2 and the PCNA-like 9-1-1 complex. To test whether colocalization of these components is sufficient for checkpoint activation, we fused these checkpoint proteins to the LacI repressor and artificially colocalized these fusions by expressing them in cells harboring Lac operator arrays. We observed Rad53 and Rad9 phosphorylation, Sml1 degradation, and metaphase delay, demonstrating that colocalization of these sensors is sufficient to activate the checkpoint in the absence of DNA damage. Our tethering system allowed us to establish that CDK functions in the checkpoint pathway downstream of damage processing and checkpoint protein recruitment. This CDK dependence is likely, at least in part, through Rad9, since mutation of CDK consensus sites compromised its checkpoint function. PMID:18471973

  9. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    PubMed Central

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A.

    2014-01-01

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting. PMID:25099886

  10. Chemistry and Structural Biology of DNA Damage and Biological Consequences

    PubMed Central

    Stone, Michael P.; Huang, Hai; Brown, Kyle L.; Shanmugam, Ganesh

    2013-01-01

    The formation of adducts by the reaction of chemicals with DNA is a critical step for the initiation of carcinogenesis. The structural analysis of various DNA adducts reveals that conformational and chemical rearrangements and interconversions are a common theme. Conformational changes are modulated both by the nature of adduct and the base sequences neighboring the lesion sites. Equilibria between conformational states may modulate both DNA repair and error-prone replication past these adducts. Likewise, chemical rearrangements of initially formed DNA adducts are also modulated both by the nature of adducts and the base sequences neighboring the lesion sites. In this review, we focus on DNA damage caused by a number of environmental and endogenous agents, and biological consequences. PMID:21922653

  11. DNA Damage Repair in the Context of Plant Chromatin1

    PubMed Central

    Donà, Mattia; Mittelsten Scheid, Ortrun

    2015-01-01

    The integrity of DNA molecules is constantly challenged. All organisms have developed mechanisms to detect and repair multiple types of DNA lesions. The basic principles of DNA damage repair (DDR) in prokaryotes and unicellular and multicellular eukaryotes are similar, but the association of DNA with nucleosomes in eukaryotic chromatin requires mechanisms that allow access of repair enzymes to the lesions. This is achieved by chromatin-remodeling factors, and their necessity for efficient DDR has recently been demonstrated for several organisms and repair pathways. Plants share many features of chromatin organization and DNA repair with fungi and animals, but they differ in other, important details, which are both interesting and relevant for our understanding of genome stability and genetic diversity. In this Update, we compare the knowledge of the role of chromatin and chromatin-modifying factors during DDR in plants with equivalent systems in yeast and humans. We emphasize plant-specific elements and discuss possible implications. PMID:26089404

  12. DNA Damage Repair in the Context of Plant Chromatin.

    PubMed

    Donà, Mattia; Mittelsten Scheid, Ortrun

    2015-08-01

    The integrity of DNA molecules is constantly challenged. All organisms have developed mechanisms to detect and repair multiple types of DNA lesions. The basic principles of DNA damage repair (DDR) in prokaryotes and unicellular and multicellular eukaryotes are similar, but the association of DNA with nucleosomes in eukaryotic chromatin requires mechanisms that allow access of repair enzymes to the lesions. This is achieved by chromatin-remodeling factors, and their necessity for efficient DDR has recently been demonstrated for several organisms and repair pathways. Plants share many features of chromatin organization and DNA repair with fungi and animals, but they differ in other, important details, which are both interesting and relevant for our understanding of genome stability and genetic diversity. In this Update, we compare the knowledge of the role of chromatin and chromatin-modifying factors during DDR in plants with equivalent systems in yeast and humans. We emphasize plant-specific elements and discuss possible implications. PMID:26089404

  13. Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

    NASA Astrophysics Data System (ADS)

    Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

    2003-11-01

    Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

  14. UV Radiation Damage and Bacterial DNA Repair Systems

    ERIC Educational Resources Information Center

    Zion, Michal; Guy, Daniel; Yarom, Ruth; Slesak, Michaela

    2006-01-01

    This paper reports on a simple hands-on laboratory procedure for high school students in studying both radiation damage and DNA repair systems in bacteria. The sensitivity to ultra-violet (UV) radiation of both "Escherichia coli" and "Serratia marcescens" is tested by radiating them for varying time periods. Two growth temperatures are used in…

  15. DNA damage tolerance branches out toward sister chromatid cohesion

    PubMed Central

    Branzei, Dana

    2016-01-01

    ABSTRACT Genome duplication is temporarily coordinated with sister chromatid cohesion and DNA damage tolerance. Recently, we found that replication fork-coupled repriming is important for both optimal cohesion and error-free replication by recombination. The mechanism involved has implications for the etiology of replication-based genetic diseases and cancer. PMID:27308553

  16. Pluripotent stem cells and DNA damage response to ionizing radiations

    PubMed Central

    Mujoo, Kalpana; Butler, E. Brian; Pandita, Raj K.; Hunt, Clayton R.; Pandita, Tej K.

    2016-01-01

    Pluripotent stem cells (PSCs) hold great promise in regenerative medicine, disease modeling, functional genomics, toxicological studies and cell-based therapeutics due to their unique characteristics of self-renewal and pluripotency. Novel methods for generation of pluripotent stem cells and their differentiation to the specialized cell types such as neuronal cells, myocardial cells, hepatocytes, and beta cells of the pancreas and many other cells of the body are constantly being refined. Pluripotent stem cell derived differentiated cells, including neuronal cells or cardiac cells are ideal for stem cell transplantation as autologous or allogeneic cells from healthy donors due to their minimum risks of rejection. DNA damage induced by ionizing radiation (IR), ultraviolet (UV) light, genotoxic stress, and other intrinsic and extrinsic factors trigger a series of biochemical reactions termed as DNA damage response (DDR). In order to maintain genomic stability, and avoid transmission of mutations into progenitors cells, stem cells have robust DNA damage response signaling – a contrast to somatic cells. Stem cell transplantation may over come the late effects related to radiation. This review will particularly focus on differential DNA damage response between stem cells and derived differentiated cells and the possible pathways that determine such differences. PMID:27332952

  17. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  18. Pluripotent Stem Cells and DNA Damage Response to Ionizing Radiations.

    PubMed

    Mujoo, Kalpana; Butler, E Brian; Pandita, Raj K; Hunt, Clayton R; Pandita, Tej K

    2016-07-01

    Pluripotent stem cells (PSCs) hold great promise in regenerative medicine, disease modeling, functional genomics, toxicological studies and cell-based therapeutics due to their unique characteristics of self-renewal and pluripotency. Novel methods for generation of pluripotent stem cells and their differentiation to the specialized cell types such as neuronal cells, myocardial cells, hepatocytes and beta cells of the pancreas and many other cells of the body are constantly being refined. Pluripotent stem cell derived differentiated cells, including neuronal cells or cardiac cells, are ideal for stem cell transplantation as autologous or allogeneic cells from healthy donors due to their minimal risk of rejection. Radiation-induced DNA damage, ultraviolet light, genotoxic stress and other intrinsic and extrinsic factors triggers a series of biochemical reactions known as DNA damage response. To maintain genomic stability and avoid transmission of mutations into progenitors cells, stem cells have robust DNA damage response signaling, a contrast to somatic cells. Stem cell transplantation may protect against radiation-induced late effects. In particular, this review focuses on differential DNA damage response between stem cells and derived differentiated cells and the possible pathways that determine such differences. PMID:27332952

  19. DNA bending facilitates the error-free DNA damage tolerance pathway and upholds genome integrity

    PubMed Central

    Gonzalez-Huici, Victor; Szakal, Barnabas; Urulangodi, Madhusoodanan; Psakhye, Ivan; Castellucci, Federica; Menolfi, Demis; Rajakumara, Eerappa; Fumasoni, Marco; Bermejo, Rodrigo; Jentsch, Stefan; Branzei, Dana

    2014-01-01

    DNA replication is sensitive to damage in the template. To bypass lesions and complete replication, cells activate recombination-mediated (error-free) and translesion synthesis-mediated (error-prone) DNA damage tolerance pathways. Crucial for error-free DNA damage tolerance is template switching, which depends on the formation and resolution of damage-bypass intermediates consisting of sister chromatid junctions. Here we show that a chromatin architectural pathway involving the high mobility group box protein Hmo1 channels replication-associated lesions into the error-free DNA damage tolerance pathway mediated by Rad5 and PCNA polyubiquitylation, while preventing mutagenic bypass and toxic recombination. In the process of template switching, Hmo1 also promotes sister chromatid junction formation predominantly during replication. Its C-terminal tail, implicated in chromatin bending, facilitates the formation of catenations/hemicatenations and mediates the roles of Hmo1 in DNA damage tolerance pathway choice and sister chromatid junction formation. Together, the results suggest that replication-associated topological changes involving the molecular DNA bender, Hmo1, set the stage for dedicated repair reactions that limit errors during replication and impact on genome stability. PMID:24473148

  20. DNA damage by reactive species: Mechanisms, mutation and repair.

    PubMed

    Jena, N R

    2012-07-01

    DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and DNA-protein crosslinks can also affect the structure of DNA significantly. These structural modifications are involved in mutation, cancer and many other diseases. As it has the least oxidation potential among all the DNA bases, guanine is frequently attacked by reactive species, producing a plethora of lethal lesions. Fortunately, living cells are evolved with intelligent enzymes that continuously protect DNA from such damages. This review provides an overview of different guanine lesions formed due to reactions of guanine with different reactive species. Involvement of these lesions in inter- and intra-strand crosslinks, DNA-protein crosslinks and mutagenesis are discussed. How certain enzymes recognize and repair different guanine lesions in DNA are also presented. PMID:22750987

  1. Dissection of DNA Damage Responses Using Multiconditional Genetic Interaction Maps

    PubMed Central

    Guénolé, Aude; Srivas, Rohith; Vreeken, Kees; Wang, Ze Zhong; Wang, Shuyi; Krogan, Nevan J.; Ideker, Trey; van Attikum, Haico

    2013-01-01

    SUMMARY To protect the genome, cells have evolved a diverse set of pathways designed to sense, signal, and repair multiple types of DNA damage. To assess the degree of coordination and crosstalk among these pathways, we systematically mapped changes in the cell's genetic network across a panel of different DNA-damaging agents, resulting in ~1,800,000 differential measurements. Each agent was associated with a distinct interaction pattern, which, unlike single-mutant phenotypes or gene expression data, has high statistical power to pinpoint the specific repair mechanisms at work. The agent-specific networks revealed roles for the histone acetyltranferase Rtt109 in the mutagenic bypass of DNA lesions and the neddylation machinery in cell-cycle regulation and genome stability, while the network induced by multiple agents implicates Irc21, an uncharacterized protein, in checkpoint control and DNA repair. Our multiconditional genetic interaction map provides a unique resource that identifies agent-specific and general DNA damage response pathways. PMID:23273983

  2. Initiation of DNA damage responses through XPG-related nucleases.

    PubMed

    Kuntz, Karen; O'Connell, Matthew J

    2013-01-23

    Lesion-specific enzymes repair different forms of DNA damage, yet all lesions elicit the same checkpoint response. The common intermediate required to mount a checkpoint response is thought to be single-stranded DNA (ssDNA), coated by replication protein A (RPA) and containing a primer-template junction. To identify factors important for initiating the checkpoint response, we screened for genes that, when overexpressed, could amplify a checkpoint signal to a weak allele of chk1 in fission yeast. We identified Ast1, a novel member of the XPG-related family of endo/exonucleases. Ast1 promotes checkpoint activation caused by the absence of the other XPG-related nucleases, Exo1 and Rad2, the homologue of Fen1. Each nuclease is recruited to DSBs, and promotes the formation of ssDNA for checkpoint activation and recombinational repair. For Rad2 and Exo1, this is independent of their S-phase role in Okazaki fragment processing. This XPG-related pathway is distinct from MRN-dependent responses, and each enzyme is critical for damage resistance in MRN mutants. Thus, multiple nucleases collaborate to initiate DNA damage responses, highlighting the importance of these responses to cellular fitness. PMID:23211746

  3. Profiling DNA damage and repair capacity in sea urchin larvae and coelomocytes exposed to genotoxicants.

    PubMed

    Reinardy, Helena C; Bodnar, Andrea G

    2015-11-01

    The ability to protect the genome from harmful DNA damage is critical for maintaining genome stability and protecting against disease, including cancer. Many echinoderms, including sea urchins, are noted for the lack of neoplastic disease, but there are few studies investigating susceptibility to DNA damage and capacity for DNA repair in these animals. In this study, DNA damage was induced in adult sea urchin coelomocytes and larvae by exposure to a variety of genotoxicants [UV-C (0-3000 J/m(2)), hydrogen peroxide (0-10mM), bleomycin (0-300 µM) and methylmethanesulfonate (MMS, 0-30 mM)] and the capacity for repair was measured over a 24-h period of recovery. Larvae were more sensitive than coelomocytes, with higher levels of initial DNA damage (fast micromethod) for all genotoxicants except MMS and increased levels of mortality 24h following treatment for all genotoxicants. The larvae that survived were able to efficiently repair damage within 24-h recovery. The ability to repair DNA damage differed depending on treatments, but both larvae and coelomocytes were able to most efficiently repair H2O2-induced damage. Time profiles of expression of a panel of DNA repair genes (ddb1, ercc1, xpc, xrcc1, pcna, ogg1, parp1, parp2, ape, brca1, rad51, xrcc2, xrcc3, xrcc4, xrcc5, xrcc6 and gadd45), throughout the period of recovery, showed greater gene induction in coelomocytes compared with larvae, with particularly high expression of xrcc1, ercc1, parp2 and pcna. The heterogeneous response of larvae to DNA damage may reflect a strategy whereby a subset of the population is equipped to withstand acute genotoxic stress, while the ability of coelomocytes to resist and repair DNA damage confirm their significant role in protection against disease. Consideration of DNA repair capacity is critical for understanding effects of genotoxicants on organisms, in addition to shedding light on life strategies and disease susceptibility. PMID:26175033

  4. Quantitative Profiling of DNA Damage and Apoptotic Pathways in UV Damaged Cells Using PTMScan Direct

    PubMed Central

    Stokes, Matthew P.; Silva, Jeffrey C.; Jia, Xiaoying; Lee, Kimberly A.; Polakiewicz, Roberto D.; Comb, Michael J.

    2013-01-01

    Traditional methods for analysis of peptides using liquid chromatography and tandem mass spectrometry (LC-MS/MS) lack the specificity to comprehensively monitor specific biological processes due to the inherent duty cycle limitations of the MS instrument and the stochastic nature of the analytical platform. PTMScan Direct is a novel, antibody-based method that allows quantitative LC-MS/MS profiling of specific peptides from proteins that reside in the same signaling pathway. New PTMScan Direct reagents have been produced that target peptides from proteins involved in DNA Damage/Cell Cycle and Apoptosis/Autophagy pathways. Together, the reagents provide access to 438 sites on 237 proteins in these signaling cascades. These reagents have been used to profile the response to UV damage of DNA in human cell lines. UV damage was shown to activate canonical DNA damage response pathways through ATM/ATR-dependent signaling, stress response pathways and induce the initiation of apoptosis, as assessed by an increase in the abundance of peptides corresponding to cleaved, activated caspases. These data demonstrate the utility of PTMScan Direct as a multiplexed assay for profiling specific cellular responses to various stimuli, such as UV damage of DNA. PMID:23344034

  5. Phototoxicity mechanisms: chlorpromazine photosensitized damage to DNA and cell membranes

    SciTech Connect

    Kochevar, K.E.

    1981-07-01

    Photosensitized damage to biological molecules is the initial process in phototoxic responses. It is now recognized that many phototoxic compounds can photosensitize damage to more than one type of biological substrate. The in vitro light-initiated reactions of phototoxic compounds with DNA, soluble proteins and membrane components can be classified by their molecular mechanisms: (1) those in which an excited state of the phototoxic compound (or an unstable species derived from it) reacts directly with the biological substrate and (2) those in which a molecule derived from the phototoxic compound (a photoproduct or an activated oxygen species) reacts with the biological substrate. This paper describes the mechanisms by which chlorpromazine photosensitizes damage to membranes, protein and DNA and compares them to the mechanisms of photosensitization by psoralens, porphyrins, dyes, and other molecules.

  6. Exercise as Gene Therapy: BDNF and DNA Damage Repair.

    PubMed

    Schmidt, Robin H; Nickerson, John M; Boatright, Jeffrey H

    2016-01-01

    DNA damage is a common feature of neurodegenerative illnesses, and the ability to repair DNA strand breaks and lesions is crucial for neuronal survival, reported by Jeppesen et al (Prog Neurobiol. 2011;94:166-200) and Shiwaku et al (Curr Mol Med. 2015;15:119-128). Interventions aimed at repairing these lesions, therefore, could be useful for preventing or delaying the progression of disease. One potential strategy for promoting DNA damage repair (DDR) is exercise. Although the role of exercise in DDR is not understood, there is increasing evidence that simple physical activity may impact clinical outcomes for neurodegeneration. Here, we discuss what is currently known about the molecular mechanisms of brain-derived neurotrophic factor and how these mechanisms might influence the DDR process. PMID:27488073

  7. Diseases Associated with Defective Responses to DNA Damage

    PubMed Central

    O’Driscoll, Mark

    2012-01-01

    Within the last decade, multiple novel congenital human disorders have been described with genetic defects in known and/or novel components of several well-known DNA repair and damage response pathways. Examples include disorders of impaired nucleotide excision repair, DNA double-strand and single-strand break repair, as well as compromised DNA damage-induced signal transduction including phosphorylation and ubiquitination. These conditions further reinforce the importance of multiple genome stability pathways for health and development in humans. Furthermore, these conditions inform our knowledge of the biology of the mechanics of genome stability and in some cases provide potential routes to help exploit these pathways therapeutically. Here, I will review a selection of these exciting findings from the perspective of the disorders themselves, describing how they were identified, how genotype informs phenotype, and how these defects contribute to our growing understanding of genome stability pathways. PMID:23209155

  8. Hyperactivation of DNA-PK by Double-Strand Break Mimicking Molecules Disorganizes DNA Damage Response

    PubMed Central

    Quanz, Maria; Chassoux, Danielle; Berthault, Nathalie; Agrario, Céline; Sun, Jian-Sheng; Dutreix, Marie

    2009-01-01

    Cellular response to DNA damage involves the coordinated activation of cell cycle checkpoints and DNA repair. The early steps of DNA damage recognition and signaling in mammalian cells are not yet fully understood. To investigate the regulation of the DNA damage response (DDR), we designed short and stabilized double stranded DNA molecules (Dbait) mimicking double-strand breaks. We compared the response induced by these molecules to the response induced by ionizing radiation. We show that stable 32-bp long Dbait, induce pan-nuclear phosphorylation of DDR components such as H2AX, Rpa32, Chk1, Chk2, Nbs1 and p53 in various cell lines. However, individual cell analyses reveal that differences exist in the cellular responses to Dbait compared to irradiation. Responses to Dbait: (i) are dependent only on DNA-PK kinase activity and not on ATM, (ii) result in a phosphorylation signal lasting several days and (iii) are distributed in the treated population in an “all-or-none” pattern, in a Dbait-concentration threshold dependant manner. Moreover, despite extensive phosphorylation of the DNA-PK downstream targets, Dbait treated cells continue to proliferate without showing cell cycle delay or apoptosis. Dbait treatment prior to irradiation impaired foci formation of Nbs1, 53BP1 and Rad51 at DNA damage sites and inhibited non-homologous end joining as well as homologous recombination. Together, our results suggest that the hyperactivation of DNA-PK is insufficient for complete execution of the DDR but induces a “false” DNA damage signaling that disorganizes the DNA repair system. PMID:19621083

  9. DNA and chromosomal damage in coronary artery disease patients

    PubMed Central

    Bhat, Mohd Akbar; Mahajan, Naresh; Gandhi, Gursatej

    2013-01-01

    DNA and chromosomal damage in peripheral blood leukocytes of patients with coronary artery disease (CAD) were investigated by using the single cell gel electrophoresis assay /comet and cytokinesis- block micronucleus (CBMN) assays, respectively. The case-control study comprised patients with CAD (n = 46; average age 53.0 ± 1.27 y) undergoing treatment at local hospitals, and healthy age-and sex-matched controls (n = 19; average age 54.21 ± 0.91 y) from the general population. The results of the comet assay revealed that the mean values of DNA damage were significantly (p < 0.001) higher in CAD patients than in controls (Tail DNA% 11.55 ± 0.38 vs. 5.31 ± 0.44; Tail moment 6.17 ± 0.31 vs. 2.93 ± 0.21 AU; Olive tail moment 3.52 ± 0.23 vs. 1.25 ± 0.11 AU). The mean values of chromosomal damage were also significantly higher (p < 0.001) in CAD patients than in controls (Binucleated cells with MN- 28.15 ± 1.18 vs. 18.16 ± 2.59; micronuclei 29.52 ± 1.21 vs. 18.68 ± 2.64, respectively) while nuclear division index (1.48 ± 0.01 vs. 1.63 ± 0.01) was significantly higher (p < 0.001) in controls. The results of the present study indicate that coronary artery disease patients had increased levels of both, unrepaired (DNA) and repaired (chromosomal) genetic damage which may be a pathological consequence of the disease and/or the drug-treatment. This accumulation of DNA/chromosomal damage is of concern as it can lead to the development of cancer with increased chances of morbidity and mortality in the CAD patients. PMID:26535030

  10. Smoking-promoted oxidative DNA damage response is highly correlated to lung carcinogenesis

    PubMed Central

    Li, Miao; Zhou, Hongbin; Lv, Dan; Deng, Zaichun; Ying, Songmin; Chen, Zhihua; Li, Wen; Shen, Huahao

    2016-01-01

    Oxidative stress induced by tobacco smoking is one of the main causes of DNA damage and is known to be involved in various cancers. Smoking is the leading cause of lung cancer, while the role of cigarette smoke-induced oxidative DNA damage response during lung carcinogenesis is largely unknown. In this study, we investigated oxidative DNA damage response levels in smoking and nonsmoking patients with lung cancer, and evaluated the potential diagnostic value of 8-OHdG for lung cancer. We observed a higher level of 8-OHdG expression and secretion in airways of lung cancer patients than that of noncancer controls. 8-OHdG expression was associated with the TNM stages. Additionally, cigarette smoke-induced oxidative DNA damage response was observed in bronchial epithelial cells in vitro and in vivo. A statistical significance correlation was found between the levels of 8-OHdG and smoking index. With a cut-off value of 2.86 ng/ml, 8-OHdG showed a sensitivity and specificity of 70.0% and 73.7%, respectively, to identify a patient with lung cancer. These findings not only underscore the importance of smoking in oxidative DNA damage response of lung cancer patients, but also suggest 8-OHdG as a potential diagnostic biomarker for lung cancer. PMID:26942876

  11. The DNA damage and the DNA replication checkpoints converge at the MBF transcription factor.

    PubMed

    Ivanova, Tsvetomira; Alves-Rodrigues, Isabel; Gómez-Escoda, Blanca; Dutta, Chaitali; DeCaprio, James A; Rhind, Nick; Hidalgo, Elena; Ayté, José

    2013-11-01

    In fission yeast cells, Cds1 is the effector kinase of the DNA replication checkpoint. We previously showed that when the DNA replication checkpoint is activated, the repressor Yox1 is phosphorylated and inactivated by Cds1, resulting in activation of MluI-binding factor (MBF)-dependent transcription. This is essential to reinitiate DNA synthesis and for correct G1-to-S transition. Here we show that Cdc10, which is an essential part of the MBF core, is the target of the DNA damage checkpoint. When fission yeast cells are treated with DNA-damaging agents, Chk1 is activated and phosphorylates Cdc10 at its carboxy-terminal domain. This modification is responsible for the repression of MBF-dependent transcription through induced release of MBF from chromatin. This inactivation of MBF is important for survival of cells challenged with DNA-damaging agents. Thus Yox1 and Cdc10 couple normal cell cycle regulation in unperturbed conditions and the DNA replication and DNA damage checkpoints into a single transcriptional complex. PMID:24006488

  12. The DNA damage and the DNA replication checkpoints converge at the MBF transcription factor

    PubMed Central

    Ivanova, Tsvetomira; Alves-Rodrigues, Isabel; Gómez-Escoda, Blanca; Dutta, Chaitali; DeCaprio, James A.; Rhind, Nick; Hidalgo, Elena; Ayté, José

    2013-01-01

    In fission yeast cells, Cds1 is the effector kinase of the DNA replication checkpoint. We previously showed that when the DNA replication checkpoint is activated, the repressor Yox1 is phosphorylated and inactivated by Cds1, resulting in activation of MluI-binding factor (MBF)–dependent transcription. This is essential to reinitiate DNA synthesis and for correct G1-to-S transition. Here we show that Cdc10, which is an essential part of the MBF core, is the target of the DNA damage checkpoint. When fission yeast cells are treated with DNA-damaging agents, Chk1 is activated and phosphorylates Cdc10 at its carboxy-terminal domain. This modification is responsible for the repression of MBF-dependent transcription through induced release of MBF from chromatin. This inactivation of MBF is important for survival of cells challenged with DNA-damaging agents. Thus Yox1 and Cdc10 couple normal cell cycle regulation in unperturbed conditions and the DNA replication and DNA damage checkpoints into a single transcriptional complex. PMID:24006488

  13. DNA damage processing by human 8-oxoguanine-DNA glycosylase mutants with the occluded active site.

    PubMed

    Lukina, Maria V; Popov, Alexander V; Koval, Vladimir V; Vorobjev, Yuri N; Fedorova, Olga S; Zharkov, Dmitry O

    2013-10-01

    8-Oxoguanine-DNA glycosylase (OGG1) removes premutagenic lesion 8-oxoguanine (8-oxo-G) from DNA and then nicks the nascent abasic (apurinic/apyrimidinic) site by β-elimination. Although the structure of OGG1 bound to damaged DNA is known, the dynamic aspects of 8-oxo-G recognition are not well understood. To comprehend the mechanisms of substrate recognition and processing, we have constructed OGG1 mutants with the active site occluded by replacement of Cys-253, which forms a wall of the base-binding pocket, with bulky leucine or isoleucine. The conformational dynamics of OGG1 mutants were characterized by single-turnover kinetics and stopped-flow kinetics with fluorescent detection. Additionally, the conformational mobility of wild type and the mutant OGG1 substrate complex was assessed using molecular dynamics simulations. Although pocket occlusion distorted the active site and greatly decreased the catalytic activity of OGG1, it did not fully prevent processing of 8-oxo-G and apurinic/apyrimidinic sites. Both mutants were notably stimulated in the presence of free 8-bromoguanine, indicating that this base can bind to the distorted OGG1 and facilitate β-elimination. The results agree with the concept of enzyme plasticity, suggesting that the active site of OGG1 is flexible enough to compensate partially for distortions caused by mutation. PMID:23955443

  14. Prooxidant action of knipholone anthrone: copper dependent reactive oxygen species generation and DNA damage.

    PubMed

    Habtemariam, S; Dagne, E

    2009-07-01

    Knipholone (KP) and knipholone anthrone (KA) are natural 4-phenylanthraquinone structural analogues with established differential biological activities including in vitro antioxidant and cytotoxic properties. By using DNA damage as an experimental model, the comparative Cu(II)-dependent prooxidant action of these two compounds were studied. In the presence of Cu(II) ions, the antioxidant KA (3.1-200 microM) but not KP (6-384 microM) caused a concentration-dependent pBR322 plasmid DNA strand scission. The DNA damage induced by KA could be abolished by reactive oxygen species scavengers, glutathione and catalase as well as EDTA and a specific Cu(I) chelator bathocuproine disulfonic acid. In addition to Cu(II) chelating activity, KA readily reduces Cu(II) to Cu(I). Copper-dependent generation of reactive oxygen species and the subsequent macromolecular damage may be involved in the antimicrobial and cytotoxic activity of KA. PMID:19345716

  15. DNA damage responses in cancer stem cells: Implications for cancer therapeutic strategies

    PubMed Central

    Wang, Qi-En

    2015-01-01

    The identification of cancer stem cells (CSCs) that are responsible for tumor initiation, growth, metastasis, and therapeutic resistance might lead to a new thinking on cancer treatments. Similar to stem cells, CSCs also display high resistance to radiotherapy and chemotherapy with genotoxic agents. Thus, conventional therapy may shrink the tumor volume but cannot eliminate cancer. Eradiation of CSCs represents a novel therapeutic strategy. CSCs possess a highly efficient DNA damage response (DDR) system, which is considered as a contributor to the resistance of these cells from exposures to DNA damaging agents. Targeting of enhanced DDR in CSCs is thus proposed to facilitate the eradication of CSCs by conventional therapeutics. To achieve this aim, a better understanding of the cellular responses to DNA damage in CSCs is needed. In addition to the protein kinases and enzymes that are involved in DDR, other processes that affect the DDR including chromatin remodeling should also be explored. PMID:26322164

  16. Phosphorylation of DNA damage-recognizing proteins at heavy-ion track

    NASA Astrophysics Data System (ADS)

    Ohnishi, T.; Takahashi, A.; Nojima, K.; Furusawa, Y.; Ohnishi, K.

    To identify the repair dynamics for high LET-radiation-induced DNA damage we analyzed the focus formation after exposure to iron-ion beams 500 MeV u 200 KeV um using immunocytochemical methods Since the focus formation of phospho-H2AX gamma-H2AX which is well understood to be activated at radiation-induced double strand breaks DSBs we performed the visualization of the tracks spatial distribution of lesions from an aspect of dose dependency The number of this track induced by iron-ion beams was well corresponded with the value of a calculation well In addition we demonstrate that DNA damage-recognizing proteins such as phospho-serine 1981 of ATM phospho-threonine 2609 of DNA-PKcs phospho-serine 343 of NBS1 and phospho-threonine 68 of Chk2 co-localized with gamma-H2AX at high LET-radiation-induced portion These findings suggest that iron-ion beams were quite effective for detection of DNA damages of DSBs recognized with DNA repair enzymes used here after phosphorylation of them because iron-ion beams can be used to generate extremely localized at DNA damages within restricted regions of the nuclei

  17. Mitochondrial DNA damage is associated with damage accrual and disease duration in patients with Systemic Lupus Erythematosus

    PubMed Central

    López-López, Linnette; Nieves-Plaza, Mariely; Castro, María del R.; Font, Yvonne M.; Torres-Ramos, Carlos; Vilá, Luis M.; Ayala-Peña, Sylvette

    2014-01-01

    Objective To determine the extent of mitochondrial DNA (mtDNA) damage in systemic lupus erythematosus (SLE) patients compared to healthy subjects and to determine the factors associated with mtDNA damage among SLE patients. Methods A cross-sectional study was performed in 86 SLE patients (per American College of Rheumatology classification criteria) and 86 healthy individuals matched for age and gender. Peripheral blood mononuclear cells (PBMCs) were collected from subjects to assess the relative amounts of mtDNA damage. Quantitative polymerase chain reaction assay was used to measure the frequency of mtDNA lesions and mtDNA abundance. Socioeconomic-demographic features, clinical manifestations, pharmacologic treatment, disease activity, and damage accrual were determined. Statistical analyses were performed using t test, pairwise correlation, and Pearson’s chi-square test (or Fisher’s exact test) as appropriate. Results Among SLE patients, 93.0% were women. The mean (SD) age was 38.0 (10.4) years and the mean (SD) disease duration was 8.7 (7.5) years. SLE patients exhibited increased levels of mtDNA damage as shown by higher levels of mtDNA lesions and decreased mtDNA abundance as compared to healthy individuals. There was a negative correlation between disease damage and mtDNA abundance and a positive correlation between mtDNA lesions and disease duration. No association was found between disease activity and mtDNA damage. Conclusion PBMCs from SLE patients exhibited more mtDNA damage compared to healthy subjects. Higher levels of mtDNA damage were observed among SLE patients with major organ involvement and damage accrual. These results suggest that mtDNA damage have a potential role in the pathogenesis of SLE. PMID:24899636

  18. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  19. Interactions and Localization of Escherichia coli Error-Prone DNA Polymerase IV after DNA Damage

    PubMed Central

    Mallik, Sarita; Popodi, Ellen M.; Hanson, Andrew J.

    2015-01-01

    ABSTRACT Escherichia coli's DNA polymerase IV (Pol IV/DinB), a member of the Y family of error-prone polymerases, is induced during the SOS response to DNA damage and is responsible for translesion bypass and adaptive (stress-induced) mutation. In this study, the localization of Pol IV after DNA damage was followed using fluorescent fusions. After exposure of E. coli to DNA-damaging agents, fluorescently tagged Pol IV localized to the nucleoid as foci. Stepwise photobleaching indicated ∼60% of the foci consisted of three Pol IV molecules, while ∼40% consisted of six Pol IV molecules. Fluorescently tagged Rep, a replication accessory DNA helicase, was recruited to the Pol IV foci after DNA damage, suggesting that the in vitro interaction between Rep and Pol IV reported previously also occurs in vivo. Fluorescently tagged RecA also formed foci after DNA damage, and Pol IV localized to them. To investigate if Pol IV localizes to double-strand breaks (DSBs), an I-SceI endonuclease-mediated DSB was introduced close to a fluorescently labeled LacO array on the chromosome. After DSB induction, Pol IV localized to the DSB site in ∼70% of SOS-induced cells. RecA also formed foci at the DSB sites, and Pol IV localized to the RecA foci. These results suggest that Pol IV interacts with RecA in vivo and is recruited to sites of DSBs to aid in the restoration of DNA replication. IMPORTANCE DNA polymerase IV (Pol IV/DinB) is an error-prone DNA polymerase capable of bypassing DNA lesions and aiding in the restart of stalled replication forks. In this work, we demonstrate in vivo localization of fluorescently tagged Pol IV to the nucleoid after DNA damage and to DNA double-strand breaks. We show colocalization of Pol IV with two proteins: Rep DNA helicase, which participates in replication, and RecA, which catalyzes recombinational repair of stalled replication forks. Time course experiments suggest that Pol IV recruits Rep and that RecA recruits Pol IV. These findings

  20. iTRAQ-based chromatin proteomic screen reveals CHD4-dependent recruitment of MBD2 to sites of DNA damage.

    PubMed

    Sun, Yazhou; Yang, Yeran; Shen, Hongyan; Huang, Min; Wang, Zhifeng; Liu, Yang; Zhang, Hui; Tang, Tie-Shan; Guo, Caixia

    2016-02-26

    Many DNA repair proteins can be recruited to DNA damage sites upon genotoxic stress. In order to search potential DNA repair proteins involved in cellular response to mitomycin C treatment, we utilized a quantitative proteome to uncover proteins that manifest differentially enrichment in the chromatin fraction after DNA damage. 397 proteins were identified, among which many factors were shown to be involved in chromatin modification and DNA repair by GO analysis. Specifically, methyl-CpG-binding domain protein 2 (MBD2) is revealed to be recruited to DNA damage sites after laser microirradiation, which was mediated through MBD domain and MBD2 C-terminus. Additionally, the recruitment of MBD2 is dependent on poly (ADP-ribose) and chromodomain helicase DNA-binding protein 4 (CHD4). Moreover, knockdown of MBD2 by CRISPR-Cas9 technique results in MMC sensitivity in mammalian cells. PMID:26827827

  1. DNA damage and radiocesium in channel catfish from Chernobyl

    SciTech Connect

    Sugg, D.W.; Brooks, J.A.; Jagoe, C.H.; Smith, M.H.; Chesser, R.K.; Bickham, J.W.; Lomakin, M.D.; Dallas, C.E.; Baker, R.J.

    1996-07-01

    The explosion of the Chernobyl Nuclear Power Plant resulted in some of the most radioactively contaminated habitats on earth. Despite evacuation of all human inhabitants from the most contaminated areas, animals and plants continue to thrive in these areas. This study examines the levels of contamination and genetic damage associated with cesium-137 in catfish (Ictalurus punctatus) from the cooling pond and a control site. In general, catfish from the cooling pond exhibit greater genetic damage, and the amount of damage is related to the concentration of radiocesium in individual fish. Genetic damage is primarily in the form of DNA strand breaks, with few micronuclei being observed in contaminated fish. The possible roles that acclimation and adaption play in the response to high levels of radiation exposure are discussed.

  2. Stem cells: Balancing resistance and sensitivity to DNA damage

    PubMed Central

    Liu, Julia C.; Lerou, Paul H.; Lahav, Galit

    2015-01-01

    Embryonic stem cells are known to be very sensitive to DNA damage and undergo rapid apoptosis even after low damage doses. In contrast, adult stem cells show variable sensitivity to damage. Here we describe the multiple pathways that have been proposed to affect the sensitivity of stem cells to damage, including proximity to the apoptotic threshold (mitochondrial priming) and the p53 signaling pathway, through activation of transcription or direct interaction with pro apoptotic proteins in the cytoplasm. We also discuss which cellular factors might connect mitochondrial priming with pluripotency and the potential therapeutic advances that can be achieved by better understanding the molecular mechanisms leading to sensitivity or resistance of embryonic or adult stem cells from different tissues. PMID:24721782

  3. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage.

    PubMed

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-03-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  4. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  5. An immunochemical approach to the study of DNA damage and repair

    SciTech Connect

    Wallace, S.S.; Erlanger, B.F. . Dept. of Microbiology and Molecular Genetics; Columbia Univ., New York, NY . Dept. of Microbiology)

    1989-01-01

    The most studied radiation-induced modified DNA base is thymine glycol. Thymine glycols are produced in relatively high yields in irradiated DNA and are also formed as a consequence of oxidative stress. Thymine glycol has been shown to be an in vitro replicative block to DNA polymerases as well as a cytotoxic lesion. DNA glycosylases that remove thymine glycol from damaged DNA are found in both prokaryotes an deukaryotes. Thus this lesion provides a good model for studying the potential biological consequences of pyrimidine ring saturation products. In order to elicit antibodies that would react with unique modified base on a damaged DNA molecule, we have chosen to chemically synthesize the hapten of interest and conjugate it to a protein carrier. Thymine glycol monophosphate was synthesized, conjugated by the carbodiimide method to bovine serum albumin (BSA), and used as an immunogen. Initially, polyclonal antibodies were produced in rabbits. These antibodies had high affinity and specificity as measured by both albumin (RSA) and by enzyme immunoassay using either the conjugate or DNA oxidized inhibited by thymine glycol, thymidine glycol and thymine glycol monophosphate determinants for the phosphate group in addition to the thymidine glycol. In both the direct and competitive assays, this antibody reacts with osmium tetroxide-treated DNA containing cis-thymine glycols and DNA X-irradiated in vitro at a femtomole level of sensitivity. 24 refs.

  6. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  7. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    PubMed

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  8. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B

    PubMed Central

    Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  9. Uridine homeostatic disorder leads to DNA damage and tumorigenesis.

    PubMed

    Cao, Zhe; Ma, Jun; Chen, Xinchun; Zhou, Boping; Cai, Chuan; Huang, Dan; Zhang, Xuewen; Cao, Deliang

    2016-03-28

    Uridine is a natural nucleoside precursor of uridine monophosphate in organisms and thus is considered to be safe and is used in a wide range of clinical settings. The far-reaching effects of pharmacological uridine have long been neglected. Here, we report that the homeostatic disorder of uridine is carcinogenic. Targeted disruption (-/-) of murine uridine phosphorylase (UPase) disrupted the homeostasis of uridine and increased spontaneous tumorigenesis by more than 3-fold. Multiple tumors (e.g., lymphoma, hepatoma and lung adenoma) occurred simultaneously in some UPase deficient mice, but not in wild-type mice raised under the same conditions. In the tissue from UPase -/- mice, the 2'-deoxyuridine,5'-triphosphate (dUTP) levels and uracil DNA were increased and p53 was activated with an increased phospho-Ser18 p53 level. Exposing cell lines (e.g., MCF-7, RKO, HCT-8 and NCI-H460) to uridine (10 or 30 µM) led to uracil DNA damage and p53 activation, which in turn triggered the DNA damage response. In these cells, phospho-ATM, phospho-CHK2, and phospho-γH2AX were increased by uridine. These data suggest that uridine homeostatic disorder leads to uracil DNA damage and that pharmacological uridine may be carcinogenic. PMID:26801745

  10. Chromatin Compaction Protects Genomic DNA from Radiation Damage

    PubMed Central

    Takata, Hideaki; Hanafusa, Tomo; Mori, Toshiaki; Shimura, Mari; Iida, Yutaka; Ishikawa, Kenichi; Yoshikawa, Kenichi; Yoshikawa, Yuko; Maeshima, Kazuhiro

    2013-01-01

    Genomic DNA is organized three-dimensionally in the nucleus, and is thought to form compact chromatin domains. Although chromatin compaction is known to be essential for mitosis, whether it confers other advantages, particularly in interphase cells, remains unknown. Here, we report that chromatin compaction protects genomic DNA from radiation damage. Using a newly developed solid-phase system, we found that the frequency of double-strand breaks (DSBs) in compact chromatin after ionizing irradiation was 5–50-fold lower than in decondensed chromatin. Since radical scavengers inhibited DSB induction in decondensed chromatin, condensed chromatin had a lower level of reactive radical generation after ionizing irradiation. We also found that chromatin compaction protects DNA from attack by chemical agents. Our findings suggest that genomic DNA compaction plays an important role in maintaining genomic integrity. PMID:24130727

  11. BRCA1 in the DNA damage response and at telomeres

    PubMed Central

    Rosen, Eliot M.

    2013-01-01

    Mutations of the breast and ovarian cancer susceptibility gene 1 (BRCA1) account for about 40–45% of hereditary breast cancer cases. Moreover, a significant fraction of sporadic (non-hereditary) breast and ovarian cancers exhibit reduced or absent expression of the BRCA1 protein, suggesting an additional role for BRCA1 in sporadic cancers. BRCA1 follows the classic pattern of a highly penetrant Knudsen-type tumor suppressor gene in which one allele is inactivated through a germ-line mutation and the other is mutated or deleted within the tumor. BRCA1 is a multi-functional protein but it is not fully understood which function(s) is (are) most important for tumor suppression, nor is it clear why BRCA1-mutations confer a high risk for breast and ovarian cancers and not a broad spectrum of tumor types. Here, we will review BRCA1 functions in the DNA damage response (DDR), which are likely to contribute to tumor suppression. In the process, we will highlight some of the controversies and unresolved issues in the field. We will also describe a recently identified and under-investigated role for BRCA1 in the regulation of telomeres and the implications of this role in the DDR and cancer suppression. PMID:23802008

  12. Reduction in oxidatively generated DNA damage following smoking cessation

    PubMed Central

    2011-01-01

    Background Cigarette smoking is a known cause of cancer, and cancer may be in part due to effects of oxidative stress. However, whether smoking cessation reverses oxidatively induced DNA damage unclear. The current study sought to examine the extent to which three DNA lesions showed significant reductions after participants quit smoking. Methods Participants (n = 19) in this study were recruited from an ongoing 16-week smoking cessation clinical trial and provided blood samples from which leukocyte DNA was extracted and assessed for 3 DNA lesions (thymine glycol modification [d(TgpA)]; formamide breakdown of pyrimidine bases [d(TgpA)]; 8-oxo-7,8-dihydroguanine [d(Gh)]) via liquid chromatography tandem mass spectrometry (LC-MS/MS). Change in lesions over time was assessed using generalized estimating equations, controlling for gender, age, and treatment condition. Results Overall time effects for the d(TgpA) (χ2(3) = 8.068, p < 0.045), d(PfpA) (χ2(3) = 8.477, p < 0.037), and d(Gh) (χ2(3) = 37.599, p < 0.001) lesions were seen, indicating levels of each decreased significantly after CO-confirmed smoking cessation. The d(TgpA) and d(PfpA) lesions show relatively greater rebound at Week 16 compared to the d(Gh) lesion (88% of baseline for d(TgpA), 64% of baseline for d(PfpA), vs 46% of baseline for d(Gh)). Conclusions Overall, results from this analysis suggest that cigarette smoking contributes to oxidatively induced DNA damage, and that smoking cessation appears to reduce levels of specific damage markers between 30-50 percent in the short term. Future research may shed light on the broader array of oxidative damage influenced by smoking and over longer durations of abstinence, to provide further insights into mechanisms underlying carcinogenesis. PMID:21569419

  13. To senesce or not to senesce: how primary human fibroblasts decide their cell fate after DNA damage

    PubMed Central

    Ivanova, Lyubomira; Lauenstein, Claudia; Heinze, Kristina; Lapytsko, Anastasiya; Talemi, Soheil Rastgou; Figueiredo, Ana Sofia; Schaber, Jörg

    2016-01-01

    Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data with a parameterized mathematical model we elucidate this cell fate decision at the G1-S transition. Our model provides a quantitative and conceptually new understanding of how human fibroblasts decide whether DNA damage is beyond repair and senesce. Model and data imply that the G1-S transition is regulated by a bistable hysteresis switch with respect to Cdk2 activity, which in turn is controlled by the Cdk2/p21 ratio rather than cyclin abundance. We experimentally confirm the resulting predictions that to induce senescence i) in healthy cells both high initial and elevated background DNA damage are necessary and sufficient, and ii) in already damaged cells much lower additional DNA damage is sufficient. Our study provides a mechanistic explanation of a) how noise in protein abundances allows cells to overcome the G1-S arrest even with substantial DNA damage, potentially leading to neoplasia, and b) how accumulating DNA damage with age increasingly sensitizes cells for senescence. PMID:26830321

  14. To senesce or not to senesce: how primary human fibroblasts decide their cell fate after DNA damage.

    PubMed

    Kollarovic, Gabriel; Studencka, Maja; Ivanova, Lyubomira; Lauenstein, Claudia; Heinze, Kristina; Lapytsko, Anastasiya; Talemi, Soheil Rastgou; Figueiredo, Ana Sofia; Schaber, Jörg

    2016-01-01

    Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data with a parameterized mathematical model we elucidate this cell fate decision at the G1-S transition. Our model provides a quantitative and conceptually new understanding of how human fibroblasts decide whether DNA damage is beyond repair and senesce. Model and data imply that the G1-S transition is regulated by a bistable hysteresis switch with respect to Cdk2 activity, which in turn is controlled by the Cdk2/p21 ratio rather than cyclin abundance. We experimentally confirm the resulting predictions that to induce senescence i) in healthy cells both high initial and elevated background DNA damage are necessary and sufficient, and ii) in already damaged cells much lower additional DNA damage is sufficient. Our study provides a mechanistic explanation of a) how noise in protein abundances allows cells to overcome the G1-S arrest even with substantial DNA damage, potentially leading to neoplasia, and b) how accumulating DNA damage with age increasingly sensitizes cells for senescence. PMID:26830321

  15. DNA damage induced by industrial solid waste leachates in Drosophila melanogaster: a mechanistic approach.

    PubMed

    Siddique, Hifzur R; Sharma, Anurag; Gupta, Subash C; Murthy, Ramesh C; Dhawan, Alok; Saxena, Daya K; Chowdhuri, Debapratim K

    2008-04-01

    Genomic stability requires that error-free genetic information be transmitted from generation to generation, a process that is dependent upon efficient DNA repair. Industrial leachates which contain mixtures of diverse chemicals are a major environmental concern. The interaction between these chemicals may have synergistic, antagonistic, or simply additive effects on biological systems. In the present study, the Comet assay was used to measure the DNA damage produced by leachates of solid wastes from flashlight battery, pigment, and tanning factories in the midgut cells and brain ganglia of Drosophila melanogaster mutants deficient in DNA repair proteins. Larvae were allowed to feed for 48 or 72 hr on diets containing 0.1, 0.5, and 2.0% (v/v) of the leachates. Physicochemical analysis run on the solid wastes, leachates, and treated larvae detected elevated levels of heavy metals. Leachates produced significantly greater levels of DNA damage in mutant strains mei41 (deficient in cell cycle check point protein), mus201 (deficient in excision repair protein), mus308 (deficient in postreplication repair protein), and rad54 (deficient in double strand break repair protein) than in the OregonR(+) wild-type strain. Larvae of the ligaseIV mutant (deficient in double strand break repair protein) were hypersensitive only to the pigment plant waste leachate. Conversely, the dnase2 mutant (deficient in protein responsible for degrading fragmented DNA) was more sensitive to DNA damage induction from the flashlight battery and tannery waste leachates. Our data demonstrate that repair of DNA damage in organisms exposed to leachates is dependent upon several DNA repair proteins, indicative of the involvement of multiple overlapping repair pathways. The study further suggests the usefulness of the Comet assay for studying the mechanisms of DNA repair in Drosophila. PMID:18240159

  16. Demonstration of DNA damage/repair in individual cells using in situ end labelling: association of p53 with sites of DNA damage.

    PubMed

    Coates, P J; Save, V; Ansari, B; Hall, P A

    1995-05-01

    We describe the development and application of in situ end labelling (ISEL) to identity sites of damaged DNA in the nuclei of individual cells. In cell culture, exposure to a variety of genotoxic agents induced a dose and time-dependent increase in nuclear labelling. In addition, examination of histological sections of human skin exposed to solar-stimulated UV light showed ISEL in both keratinocytes and superficial dermal cells, with the same spatial and temporal distribution as that of a marker of DNA repair, PCNA (proliferating cell nuclear antigen). Using co-localization techniques and confocal microscopy, we found increased levels of p53 in many ISEL-positive cells in vitro, with a similar distribution of labelling in the nucleus. This observation provides further evidence for a direct role of p53 in the recognition of damaged DNA. Thus, ISEL should prove a convenient method for demonstrating genotoxic insult in individual cells and in histological material, and may have value in toxicological screening. This high-resolution microscopy technique can also be used to compare the spatial distribution of various proteins implicated in the response to DNA damage with the sites of the lesion. PMID:7542331

  17. Melanin photosensitizes ultraviolet light (UVC) DNA damage in pigmented cells

    SciTech Connect

    Huselton, C.A.; Hill, H.Z. )

    1990-01-01

    Melanins, pigments of photoprotection and camouflage, are very photoreactive and can both absorb and emit active oxygen species. Nevertheless, black skinned individuals rarely develop skin cancer and melanin is assumed to act as a solar screen. Since DNA is the target for solar carcinogenesis, the effect of melanin on Ultraviolet (UV)-induced thymine lesions was examined in mouse melanoma and carcinoma cells that varied in melanin content. Cells prelabeled with 14C-dThd were irradiated with UVC; DNA was isolated, purified, degraded to bases by acid hydrolysis and analyzed by HPLC. Thymine dimers were detected in all of the extracts of irradiated cells. Melanotic and hypomelanotic but not mammary carcinoma cell DNA from irradiated cells contained hydrophilic thymine derivatives. The quantity of these damaged bases was a function of both the UVC dose and the cellular melanin content. One such derivative was identified by gas chromatography-mass spectroscopy as thymine glycol. The other appears to be derived from thymine glycol by further oxidation during acid hydrolysis of the DNA. The finding of oxidative DNA damage in melanin-containing cells suggests that melanin may be implicated in the etiology of caucasian skin cancer, particularly melanoma. Furthermore, the projected decrease in stratospheric ozone could impact in an unanticipated deleterious manner on dark-skinned individuals.

  18. Preservation of ancient DNA in thermally damaged archaeological bone

    NASA Astrophysics Data System (ADS)

    Ottoni, Claudio; Koon, Hannah E. C.; Collins, Matthew J.; Penkman, Kirsty E. H.; Rickards, Olga; Craig, Oliver E.

    2009-02-01

    Evolutionary biologists are increasingly relying on ancient DNA from archaeological animal bones to study processes such as domestication and population dispersals. As many animal bones found on archaeological sites are likely to have been cooked, the potential for DNA preservation must be carefully considered to maximise the chance of amplification success. Here, we assess the preservation of mitochondrial DNA in a medieval cattle bone assemblage from Coppergate, York, UK. These bones have variable degrees of thermal alterations to bone collagen fibrils, indicative of cooking. Our results show that DNA preservation is not reliant on the presence of intact collagen fibrils. In fact, a greater number of template molecules could be extracted from bones with damaged collagen. We conclude that moderate heating of bone may enhance the retention of DNA fragments. Our results also indicate that ancient DNA preservation is highly variable, even within a relatively recent assemblage from contexts conducive to organic preservation, and that diagenetic parameters based on protein diagenesis are not always useful for predicting ancient DNA survival.

  19. DNA damage in mammalian cells following heavy-ion irradiation

    SciTech Connect

    Rosander, K.; Frankel, K.A.; Cerda, H.; Phillips, M.H.; Lo, E.H.; Fabrikant, I.; Fabrikant, J.I.; Levy, R.P.

    1989-09-01

    In our laboratory we have been investigating DNA damage and repair in the endothelial and oligodendroglial cells of the mouse brain after irradiation using two different types of heavy ions, helium and neon. The method used, the unwinding technique with subsequent staining of the DNA with acridine orange, has been proven to be useful for nondividing cells and analysis using a microscope photometric technique. Our primary goal has been to obtain a measure of RBE, in the dose range used in clinical treatment of various brain disorders using heavy charged particle radiosurgery. 12 refs., 5 figs.

  20. Impact of different running distances on muscle and lymphocyte DNA damage in amateur marathon runners.

    PubMed

    Ryu, Jae Hoon; Paik, Il Young; Woo, Jin Hee; Shin, Ki Ok; Cho, Su Youn; Roh, Hee Tae

    2016-01-01

    [Purpose] The aim of this study was to investigate the impact of different marathon running distances (10 km, 21 km, and 42.195 km) on muscle and lymphocyte DNA damage in amateur marathon runners. [Subjects and Methods] Thirty male amateur runners were randomly assigned to 10 km, 21 km, and 42 km groups, with 10 subjects in each group. Blood samples were collected before and after the races and on the 3rd day of recovery to examine levels of muscle damage (creatine kinase and lactate dehydrogenase) and lymphocyte DNA damage (DNA in the tail, tail length, and tail moment). [Results] Serum creatine kinase, serum lactate dehydrogenase, and tail moment were significantly higher after the races compared with before the races in all groups. In addition, the 42 km group showed significantly higher levels of creatine kinase, lactate dehydrogenase, and tail moment than the 10 km and 21 km groups after the races. [Conclusion] Strenuous endurance exercise can cause muscle and lymphocyte DNA damage, and the extent of such damage can increase as running distance increases. PMID:27065529

  1. Impact of different running distances on muscle and lymphocyte DNA damage in amateur marathon runners

    PubMed Central

    Ryu, Jae Hoon; Paik, Il Young; Woo, Jin Hee; Shin, Ki Ok; Cho, Su Youn; Roh, Hee Tae

    2016-01-01

    [Purpose] The aim of this study was to investigate the impact of different marathon running distances (10 km, 21 km, and 42.195 km) on muscle and lymphocyte DNA damage in amateur marathon runners. [Subjects and Methods] Thirty male amateur runners were randomly assigned to 10 km, 21 km, and 42 km groups, with 10 subjects in each group. Blood samples were collected before and after the races and on the 3rd day of recovery to examine levels of muscle damage (creatine kinase and lactate dehydrogenase) and lymphocyte DNA damage (DNA in the tail, tail length, and tail moment). [Results] Serum creatine kinase, serum lactate dehydrogenase, and tail moment were significantly higher after the races compared with before the races in all groups. In addition, the 42 km group showed significantly higher levels of creatine kinase, lactate dehydrogenase, and tail moment than the 10 km and 21 km groups after the races. [Conclusion] Strenuous endurance exercise can cause muscle and lymphocyte DNA damage, and the extent of such damage can increase as running distance increases. PMID:27065529

  2. QPCR: a tool for analysis of mitochondrial and nuclear DNA damage in ecotoxicology.

    PubMed

    Meyer, Joel N

    2010-04-01

    The quantitative PCR (QPCR) assay for DNA damage and repair has been used extensively in laboratory species. More recently, it has been adapted to ecological settings. The purpose of this article is to provide a detailed methodological guide that will facilitate its adaptation to additional species, highlight its potential for ecotoxicological and biomonitoring work, and critically review the strengths and limitations of this assay. Major strengths of the assay include very low (nanogram to picogram) amounts of input DNA; direct comparison of damage and repair in the nuclear and mitochondrial genomes, and different parts of the nuclear genome; detection of a wide range of types of DNA damage; very good reproducibility and quantification; applicability to properly preserved frozen samples; simultaneous monitoring of relative mitochondrial genome copy number; and easy adaptation to most species. Potential limitations include the limit of detection (approximately 1 lesion per 10(5) bases); the inability to distinguish different types of DNA damage; and the need to base quantification of damage on a control or reference sample. I suggest that the QPCR assay is particularly powerful for some ecotoxicological studies. PMID:20049526

  3. p53-dependent SIRT6 expression protects Aβ42-induced DNA damage

    PubMed Central

    Jung, Eun Sun; Choi, Hyunjung; Song, Hyundong; Hwang, Yu Jin; Kim, Ahbin; Ryu, Hoon; Mook-Jung, Inhee

    2016-01-01

    Alzheimer’s disease (AD) is the most common type of dementia and age-related neurodegenerative disease. Elucidating the cellular changes that occur during ageing is an important step towards understanding the pathogenesis and progression of neurodegenerative disorders. SIRT6 is a member of the mammalian sirtuin family of anti-aging genes. However, the relationship between SIRT6 and AD has not yet been elucidated. Here, we report that SIRT6 protein expression levels are reduced in the brains of both the 5XFAD AD mouse model and AD patients. Aβ42, a major component of senile plaques, decreases SIRT6 expression, and Aβ42-induced DNA damage is prevented by the overexpression of SIRT6 in HT22 mouse hippocampal neurons. Also, there is a strong negative correlation between Aβ42-induced DNA damage and p53 levels, a protein involved in DNA repair and apoptosis. In addition, upregulation of p53 protein by Nutlin-3 prevents SIRT6 reduction and DNA damage induced by Aβ42. Taken together, this study reveals that p53-dependent SIRT6 expression protects cells from Aβ42-induced DNA damage, making SIRT6 a promising new therapeutic target for the treatment of AD. PMID:27156849

  4. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    SciTech Connect

    Marchetti, Francesco; Marchetti, Francesco; Wryobek, Andrew J

    2008-02-21

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7- 1 dbf). Analysis of chromosomalaberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  5. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    SciTech Connect

    Marchetti, Francesco; Marchetti, Francesco; Wyrobek, Andrew J.

    2007-12-01

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7-1 dbf). Analysis of chromosomal aberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  6. Endogenous DNA Damage and Risk of Testicular Germ Cell Tumors

    SciTech Connect

    Cook, M B; Sigurdson, A J; Jones, I M; Thomas, C B; Graubard, B I; Korde, L; Greene, M H; McGlynn, K A

    2008-01-18

    Testicular germ cell tumors (TGCT) are comprised of two histologic groups, seminomas and nonseminomas. We postulated that the possible divergent pathogeneses of these histologies may be partially explained by variable endogenous DNA damage. To assess our hypothesis, we conducted a case-case analysis of seminomas and nonseminomas using the alkaline comet assay to quantify single-strand DNA breaks and alkali-labile sites. The Familial Testicular Cancer study and the U.S. Radiologic Technologists cohort provided 112 TGCT cases (51 seminomas & 61 nonseminomas). A lymphoblastoid cell line was cultured for each patient and the alkaline comet assay was used to determine four parameters: tail DNA, tail length, comet distributed moment (CDM) and Olive tail moment (OTM). Odds ratios (OR) and 95% confidence intervals (95%CI) were estimated using logistic regression. Values for tail length, tail DNA, CDM and OTM were modeled as categorical variables using the 50th and 75th percentiles of the seminoma group. Tail DNA was significantly associated with nonseminoma compared to seminoma (OR{sub 50th percentile} = 3.31, 95%CI: 1.00, 10.98; OR{sub 75th percentile} = 3.71, 95%CI: 1.04, 13.20; p for trend=0.039). OTM exhibited similar, albeit statistically non-significant, risk estimates (OR{sub 50th percentile} = 2.27, 95%CI: 0.75, 6.87; OR{sub 75th percentile} = 2.40, 95%CI: 0.75, 7.71; p for trend=0.12) whereas tail length and CDM showed no association. In conclusion, the results for tail DNA and OTM indicate that endogenous DNA damage levels are higher in patients who develop nonseminoma compared with seminoma. This may partly explain the more aggressive biology and younger age-of-onset of this histologic subgroup compared with the relatively less aggressive, later-onset seminoma.

  7. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.

    PubMed

    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D

    2016-05-01

    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  8. Alkaline nuclear dispersion assays for the determination of DNA damage at the single cell level.

    PubMed

    Sestili, Piero; Fimognari, Carmela

    2014-01-01

    Over the past three decades the development of methods for visualizing at the cell level the extent of DNA breakage significantly contributed to genotoxicity testing: their availability greatly improved the knowledge in the field of genetic toxicology. These procedures are based on the separation and visualization of DNA fragments resulting from cleavage of nuclear DNA. The separation process can be obtained either electrically (comet assay, linear migration of DNA fragments) or chemically (alkaline dispersion assays, radial diffusion of DNA fragments). Once separated and stained, intact and fragmented DNA can be observed with fluorescence or light microscope. Appropriate computer-assisted image analysis allows quantitative determination of the extent of DNA breakage. These procedures have been proven to be sensitive, flexible, and reliable, and, as compared to former methods, they are simpler, are less time and money consuming, and have the unique capability of detecting DNA damage at the single cell level. This last feature has the additional advantage of allowing the identification of cellular subpopulations characterized by different sensitivity to the damaging agent. The fast halo assay (FHA) is currently the simplest and quickest nuclear dispersion assay; recent modifications of FHA have further improved the assay and pave the way to a full exploitation of its analytical potential. In this chapter the development, procedures, applications, and limits of these dispersion assays, with a particular focus on FHA, will be illustrated. PMID:24162979

  9. A microsuspension adaptation of the Bacillus subtilis ''rec'' assay. [Detection of chemically induced DNA damage

    SciTech Connect

    McCarroll, N.E.; Keech, B.H.; Piper, C.E.

    1981-01-01

    We have demonstrated the utility of an Escherichia coli microsuspension assay to detect and characterize chemical mediation of DNA damage by a wide variety of mutagens and carcinogens. The assay have been improved by the development of a microsuspension modification to the Bacillus subtilis ''rec'' assay. The addition of these gram-positive organisms has allowed detection of DNA damage induced by benzo(a)pyrene (B(a)P), 3-aminopyrene (3-AP), 7, 12-dimethylbenz(a)anthrancene (DMBA), 3-methylcholanthrene (3-MC), and 4-nitrobiphenyl (4-NBP). Data presented in this paper from tests of 61 additional compounds, including a representative number of direct and promutagenic agents, indicate that the B subtilis H17 and M45 strains provide an effective microbial system for identification of DNA damage susceptible to postreplicational repair. The results of this study further suggests that the inclusion of these strains in the microsuspension assay for DNA damage will markedly enhance the detection of agents which cannot readily penetrate the intact cell wall of E coli.

  10. Oxidative DNA damage in peripheral blood lymphocytes of coal workers.

    PubMed

    Schins, R P; Schilderman, P A; Borm, P J

    1995-01-01

    Reactive oxygen species are important mediators of both mineral dust-induced (malignant) lung disease and in vitro DNA damage. Therefore, we studied in vivo oxidative DNA damage in coal workers who had been chronically exposed to silica-containing dust. In peripheral blood lymphocytes of 38 retired coal miners (eight with coal workers pneumoconiosis, 30 references) and 24 age-matched, non-dust-exposed controls 7-hydro-8-oxo-2'-deoxyguanosine (8-oxodG) was determined by reversed phase high-performance liquid chromatography with electrochemical detection. The ratio of 8-oxodG residues to deoxyguanosine (dG) was related to individual cumulative dust exposure estimates and pneumoconiotic stage as established by chest radiography. The ratio of 8-oxodG to dG(x 10(-5)) in lymphocytes did not differ between miners with coal workers' pneumoconiosis (2.61 +/- 0.44) and miners without coal workers' pneumoconiosis (2.96 +/- 1.86). However, oxidative DNA damage in all miners was higher than in the non-dust-exposed controls (1.67 +/- 1.31). 8-oxodG/dG ratio was not related to individual cumulative coal dust exposure, age or smoking (pack years) when evaluated by multiple linear regression. We suggest that oxidative damage to the DNA of peripheral blood lymphocytes may be introduced by increased oxidative stress responses in subjects chronically exposed to mineral dusts. Whether this is an important pathway in the suggested carcinogenicity of silica is still an open question. PMID:7591172

  11. Level of DNA damage in lead-exposed workers.

    PubMed

    Olewińska, Elżbieta; Kasperczyk, Aleksandra; Kapka, Lucyna; Kozłowska, Agnieszka; Pawlas, Natalia; Dobrakowski, Michał; Birkner, Ewa; Kasperczyk, Sławomir

    2010-01-01

    Lead plays a significant role in modern industry. This metal is related to a broad range of physiological, biochemical and behavioural dysfunctions. The genotoxic effects of lead have been studied both in animals and humans in in vitro systems but results were contradictory. The aim of this study was to investigate the association between DNA damage and occupational exposure to lead in workers. The study population consisted of 62 employees of metalworks exposed to lead in the southern region of Poland. The control group consisted of 26 office workers with no history of occupational exposure to lead. The concentration of lead (PbB) and zincprotoporphyrin (ZPP) in blood samples were measured. The DNA damage was analyzed in blood lymphocytes using alkaline comet assay. The level of DNA damage was determined as the percentage of DNA in the tail, tail length and tail moment. The lead exposure indicators were significantly higher in lead exposed group: PbB about 8.5 times and ZPP 3.3 times. Also, the percentage of DNA in the tail (60.3 ± 14 vs. 37.1 ± 17.6), comet tail length (86.9 ± 15.49 vs. 73.8 ± 19.12) and TM (57.8 ± 17.82 vs. 33.2 ± 19.13) were significantly higher in the study group when compared with the controls; however, the difference between the subgroups was only 5-10%. Years of lead exposure positively correlated with all comet assay parameters (R = 0.21-0.41). Both mean and current PbB and ZPP were correlated with tail DNA % and TM (R = 0.32; R = 0.33; R = 0.24; R = 0.26 and R = 0.34; R = 0.33; R = 0.28 and R = 0.28, respectively). This study shows that occupational exposure to lead is associated with DNA damage and confirmed that comet assay is a rapid, sensitive method suitable for biomonitoring studies. PMID:21186764

  12. Prevention of oxidative DNA damage in rats by brussels sprouts.

    PubMed

    Deng, X S; Tuo, J; Poulsen, H E; Loft, S

    1998-03-01

    The alleged cancer preventive effects of cruciferous vegetables could be related to protection from mutagenic oxidative DNA damage. We have studied the effects of Brussels sprouts, some non-cruciferous vegetables and isolated glucosinolates on spontaneous and induced oxidative DNA damage in terms of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in groups of 6-8 male Wistar rats. Excess oxidative DNA damage was induced by 2-nitropropane (2-NP 100 mg/kg). Four days oral administration of 3 g of cooked Brussels sprouts homogenate reduced the spontaneous urinary 8-oxodG excretion by 31% (p<0.05) whereas raw sprouts, beans and endive (1:1), isolated indolyl glucosinolates and breakdown products had no significant effect. An aqueous extract of cooked Brussels sprouts (corresponding to 6.7 g vegetable per day for 4 days) decreased the spontaneous 8-oxodG excretion from 92 +/- 12 to 52 +/- 15 pmol/24 h (p<0.05). After 2-NP administration the 8-oxodG excretion was increased to 132 +/- 26 pmol/24 h (p<0.05) whereas pretreatment with the sprouts extract reduced this to 102 +/- 30 pmol/24 h (p<0.05). The spontaneous level of 8-oxodG in nuclear DNA from liver and bone marrow was not significantly affected by the sprouts extract whereas the level decreased by 27% in the kidney (p<0.05). In the liver 2-NP increased the 8-oxodG levels in nuclear DNA 8.7 and 3.8 times (p<0.05) 6 and 24 h after dose, respectively. The sprouts extract reduced this increase by 57% (p<0.05) at 6 h whereas there was no significant effect at 24 h. In the kidneys 2-NP increased the 8-oxodG levels 2.2 and 1.2 times (p<0.05) 6 and 24 h after dose, respectively. Pretreatment with the sprouts extract abolished these increases (p<0.05). Similarly, in the bone marrow the extract protected completely (p<0.05) against a 4.9-fold 2-NP induced increase (p<0.05) in the 8-oxodG level. These findings demonstrate that cooked Brussels sprouts contain bioactive substance(s) with a potential for reducing the physiological

  13. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.

    PubMed

    Lundqvist, J; Hellman, B; Oskarsson, A

    2016-05-01

    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  14. Cross talk of tyrosine kinases with the DNA damage signaling pathways

    PubMed Central

    Mahajan, Kiran; Mahajan, Nupam P.

    2015-01-01

    Tyrosine kinases respond to extracellular and intracellular cues by activating specific cellular signaling cascades to regulate cell cycle, growth, proliferation, differentiation and survival. Likewise, DNA damage response proteins (DDR) activated by DNA lesions or chromatin alterations recruit the DNA repair and cell cycle checkpoint machinery to restore genome integrity and cellular homeostasis. Several new examples have been uncovered in recent studies which reveal novel epigenetic and non-epigenetic mechanisms by which tyrosine kinases interact with DDR proteins to dictate cell fate, i.e. survival or apoptosis, following DNA damage. These studies reveal the ability of tyrosine kinases to directly regulate the activity of DNA repair and cell cycle check point proteins by tyrosine phosphorylation. In addition, tyrosine kinases epigenetically regulate DNA damage signaling pathways by modifying the core histones as well as chromatin modifiers at critical tyrosine residues. Thus, deregulated tyrosine kinase driven epigenomic alterations have profound implications in cancer, aging and genetic disorders. Consequently, targeting oncogenic tyrosine kinase induced epigenetic alterations has gained significant traction in overcoming cancer cell resistance to various therapies. This review discusses mechanisms by which tyrosine kinases interact with DDR pathways to regulate processes critical for maintaining genome integrity as well as clinical strategies for targeted cancer therapies. PMID:26546517

  15. DNA replication and damage checkpoints and meiotic cell cycle controls in the fission and budding yeasts.

    PubMed Central

    Murakami, H; Nurse, P

    2000-01-01

    The cell cycle checkpoint mechanisms ensure the order of cell cycle events to preserve genomic integrity. Among these, the DNA-replication and DNA-damage checkpoints prevent chromosome segregation when DNA replication is inhibited or DNA is damaged. Recent studies have identified an outline of the regulatory networks for both of these controls, which apparently operate in all eukaryotes. In addition, it appears that these checkpoints have two arrest points, one is just before entry into mitosis and the other is prior to chromosome separation. The former point requires the central cell-cycle regulator Cdc2 kinase, whereas the latter involves several key regulators and substrates of the ubiquitin ligase called the anaphase promoting complex. Linkages between these cell-cycle regulators and several key checkpoint proteins are beginning to emerge. Recent findings on post-translational modifications and protein-protein interactions of the checkpoint proteins provide new insights into the checkpoint responses, although the functional significance of these biochemical properties often remains unclear. We have reviewed the molecular mechanisms acting at the DNA-replication and DNA-damage checkpoints in the fission yeast Schizosaccharomyces pombe, and the modifications of these controls during the meiotic cell cycle. We have made comparisons with the controls in fission yeast and other organisms, mainly the distantly related budding yeast. PMID:10861204

  16. Clofarabine Acts as Radiosensitizer In Vitro and In Vivo by Interfering With DNA Damage Response

    SciTech Connect

    Cariveau, Mickael J.; Stackhouse, Murray; Cui Xiaoli; Tiwari, Kamal; Waud, William; Secrist, John A.; Xu Bo

    2008-01-01

    Purpose: Combination treatment with radiotherapy and chemotherapy has emerged as the dominant form of cancer adjuvant regimens in recent years. Clofarabine, a newly approved drug for pediatric leukemia, is a second-generation purine nucleoside analogue that can block DNA synthesis and inhibit DNA repair. Therefore, we hypothesized that clofarabine could work synergistically with radiotherapy to increase the tumor cell response. Methods and Materials: The effects of clofarabine on radiosensitivity have been established in several tumor cell lines in vitro and in vivo using colony-forming assays and tumor xenografts. The effect of clofarabine on the DNA damage response was also studied in vitro by measuring {gamma}-H2AX focus formation. Results: Clonogenic survival was significantly reduced in irradiated cells treated with clofarabine, demonstrating the strong radiosensitizing effect of clofarabine. Furthermore, clofarabine displayed a radiosensitizing effect that was greater than gemcitabine or 5-fluorouracil. We also found that low doses of clofarabine can prolong the presence of radiation-induced {gamma}-H2AX nuclear focus formation, and high doses of clofarabine can induce DNA double-strand breaks, suggesting that clofarabine can interfere with DNA damage response pathways. In addition, clofarabine-induced radiosensitization was also established in vivo using a colorectal cancer model, DLD-1, in athymic nude mice. When combined with fractionated radiotherapy, a moderate dose of clofarabine led to a significant increase in tumor growth inhibition. Conclusion: Clofarabine acts as a powerful radiosensitizer both in vitro and in vivo by interfering with the DNA damage response.

  17. Cross talk of tyrosine kinases with the DNA damage signaling pathways.

    PubMed

    Mahajan, Kiran; Mahajan, Nupam P

    2015-12-15

    Tyrosine kinases respond to extracellular and intracellular cues by activating specific cellular signaling cascades to regulate cell cycle, growth, proliferation, differentiation and survival. Likewise, DNA damage response proteins (DDR) activated by DNA lesions or chromatin alterations recruit the DNA repair and cell cycle checkpoint machinery to restore genome integrity and cellular homeostasis. Several new examples have been uncovered in recent studies which reveal novel epigenetic and non-epigenetic mechanisms by which tyrosine kinases interact with DDR proteins to dictate cell fate, i.e. survival or apoptosis, following DNA damage. These studies reveal the ability of tyrosine kinases to directly regulate the activity of DNA repair and cell cycle check point proteins by tyrosine phosphorylation. In addition, tyrosine kinases epigenetically regulate DNA damage signaling pathways by modifying the core histones as well as chromatin modifiers at critical tyrosine residues. Thus, deregulated tyrosine kinase driven epigenomic alterations have profound implications in cancer, aging and genetic disorders. Consequently, targeting oncogenic tyrosine kinase induced epigenetic alterations has gained significant traction in overcoming cancer cell resistance to various therapies. This review discusses mechanisms by which tyrosine kinases interact with DDR pathways to regulate processes critical for maintaining genome integrity as well as clinical strategies for targeted cancer therapies. PMID:26546517

  18. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  19. Dietary phytochemicals, HDAC inhibition, and DNA damage/repair defects in cancer cells

    PubMed Central

    2011-01-01

    Genomic instability is a common feature of cancer etiology. This provides an avenue for therapeutic intervention, since cancer cells are more susceptible than normal cells to DNA damaging agents. However, there is growing evidence that the epigenetic mechanisms that impact DNA methylation and histone status also contribute to genomic instability. The DNA damage response, for example, is modulated by the acetylation status of histone and non-histone proteins, and by the opposing activities of histone acetyltransferase and histone deacetylase (HDAC) enzymes. Many HDACs overexpressed in cancer cells have been implicated in protecting such cells from genotoxic insults. Thus, HDAC inhibitors, in addition to unsilencing tumor suppressor genes, also can silence DNA repair pathways, inactivate non-histone proteins that are required for DNA stability, and induce reactive oxygen species and DNA double-strand breaks. This review summarizes how dietary phytochemicals that affect the epigenome also can trigger DNA damage and repair mechanisms. Where such data is available, examples are cited from studies in vitro and in vivo of polyphenols, organosulfur/organoselenium compounds, indoles, sesquiterpene lactones, and miscellaneous agents such as anacardic acid. Finally, by virtue of their genetic and epigenetic mechanisms, cancer chemopreventive agents are being redefined as chemo- or radio-sensitizers. A sustained DNA damage response coupled with insufficient repair may be a pivotal mechanism for apoptosis induction in cancer cells exposed to dietary phytochemicals. Future research, including appropriate clinical investigation, should clarify these emerging concepts in the context of both genetic and epigenetic mechanisms dysregulated in cancer, and the pros and cons of specific dietary intervention strategies. PMID:22247744

  20. Oxidative DNA damage by an N-hydroxy metabolite of the mutagenic compound formed from norharman and aniline.

    PubMed

    Ohnishi, S; Murata, M; Oikawa, S; Totsuka, Y; Takamura, T; Wakabayashi, K; Kawanishi, S

    2001-07-25

    Norharman (9H-pyrido[3,4-b]indole), which is a heterocyclic amine included in cigarette smoke or cooked foodstuffs, is not mutagenic itself. However, norharman reacts with non-mutagenic aniline to form mutagenic aminophenylnorharman (APNH), of which DNA adducts formation and hepatocarcinogenic potential are pointed out. We investigated whether N-OH-APNH, an N-hydroxy metabolite of APNH, can cause oxidative DNA damage or not, using 32P-labeled DNA fragments. N-OH-APNH caused Cu(II)-mediated DNA damage. When an endogenous reductant, beta-nicotinamide adenine dinucleotide (NADH) was added, the DNA damage was greatly enhanced. Catalase and a Cu(I)-specific chelator inhibited DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Typical -*OH scavenger did not inhibit DNA damage. These results suggest that the main reactive species are probably copper-hydroperoxo complexes with DNA. We also measured 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) formation by N-OH-APNH in the presence of Cu(II), using an electrochemical detector coupled to a high-pressure liquid chromatograph. Addition of NADH greatly enhanced 8-oxodG formation. UV-VIS spectra and mass spectra suggested that N-OH-APNH was autoxidized to nitrosophenylnorharman (NO-PNH). We speculated that NO-PNH was reduced by NADH. Cu(II) facilitated the redox cycle. In the presence of NADH and Cu(II), very low concentrations of N-OH-APNH could induce DNA damage via redox reactions. We conclude that oxidative DNA damage, in addition to DNA adduct formation, may play an important role in the expression of genotoxicity of APNH. PMID:11423346

  1. DNA damage in wounded, hypoxic and acidotic human skin fibroblast cell cultures after low laser irradiation

    NASA Astrophysics Data System (ADS)

    Hawkins Evans, D.; Mbene, A.; Zungu, I.; Houreld, N.; Abrahamse, H.

    2009-02-01

    Phototherapy has become more popular and widely used in the treatment of a variety of medical conditions. To ensure sound results as evidence of its effectiveness, well designed experiments must be conducted when determining the effect of phototherapy. Cell culture models such as hypoxic, acidotic and wounded cell cultures simulating different disease conditions including ischemic heart disease, diabetes and wound healing were used to determine the effect of laser irradiation on the genetic integrity of the cell. Even though phototherapy has been found to be beneficial in a wide spectrum of conditions, it has been shown to induce DNA damage. However, this damage appears to be repairable. The risk lies in the fact that phototherapy may help the medical condition initially but damage DNA at the same time leaving undetected damage that may result in late onset, more severe, induced medical conditions including cancer. Human skin fibroblasts were cultured and used to induce a wound (by the central scratch model), hypoxic (by incubation in an anaerobic jar, 95% N2 and 5% O2) and acidotic (reducing the pH of the media to 6.7) conditions. Different models were irradiated using a Helium-Neon (632.8 nm) laser with a power density of 2.07 mW/cm2 and a fluence of 5 J/cm2 or 16 J/cm2. The effect of the irradiation was determined using the Comet assay 1 and 24 h after irradiation. In addition, the Comet assay was performed with the addition of formamidopyrimidine glycosylase (FPG) obviating strand brakes in oxidized bases at a high fluence of 16 J/cm2. A significant increase in DNA damage was seen in all three injured models at both 1 and 24 h post-irradiation when compared to the normal un-injured cells. However, when compared to non-irradiated controls the acidotic model showed a significant decrease in DNA damage 24 h after irradiation indicating the possible induction of cellular DNA repair mechanisms. When wounded cells were irradiated with higher fluences of 16 J/cm2

  2. Oxidative DNA damage induced by benz[a]anthracene dihydrodiols in the presence of dihydrodiol dehydrogenase.

    PubMed

    Seike, Kazuharu; Murata, Mariko; Hirakawa, Kazutaka; Deyashiki, Yoshihiro; Kawanishi, Shosuke

    2004-11-01

    Tobacco smoke and polluted air are risk factors for lung cancer and contain many kinds of polycyclic aromatic hydrocarbons (PAHs) including benzo[a]pyrene (B[a]P) and benz[a]anthracene (BA). BA, as well as B[a]P, is assessed as probably carcinogenic to humans (IARC group 2A). BA is metabolized to several dihydrodiols. Dihydrodiol dehydrogenase (DD), a member of the aldo-keto reductase superfamily, catalyzes NAD(P)+-linked oxidation of dihydrodiols of aromatic hydrocarbons to corresponding catechols. To clarify the role of DD on PAH carcinogenesis, we examined oxidative DNA damage induced by trans-dihydrodiols of BA and B[a]P treated with DD using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene. In addition, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA by using HPLC with an electrochemical detector. DD-catalyzed BA-1,2-dihydrodiol caused Cu(II)-mediated DNA damage including 8-oxodG formation in the presence of NAD+. BA-1,2-dihydrodiol induced a Fpg sensitive and piperidine labile G lesion at the 5'-ACG-3' sequence complementary to codon 273 of the human p53 tumor suppressor gene, which is known as a hotspot. DNA damage was inhibited by catalase and bathocuproine, suggesting the involvement of H2O2 and Cu(I). The observation of NADH production by UV-visible spectroscopy suggested that DD catalyzed BA-1,2-dihydrodiol most efficiently to the corresponding catechol among the PAH-dihydrodiols tested. A time-of-flight mass spectroscopic study showed that the catechol form of BA-1,2-dihydrodiol formed after DD treatment. In conclusion, BA-1,2-dihydrodiol can induce DNA damage more efficiently than B[a]P-7,8-dihydrodiol and other BA-dihydrodiols in the presence of DD. The reaction mechanism on oxidative DNA damage may be explained by theoretical calculations with an enthalpy change of dihydrodiols and oxidation potential of their catechol forms. DD

  3. Inhibition of Topoisomerase (DNA) I (TOP1): DNA Damage Repair and Anticancer Therapy

    PubMed Central

    Xu, Yang; Her, Chengtao

    2015-01-01

    Most chemotherapy regimens contain at least one DNA-damaging agent that preferentially affects the growth of cancer cells. This strategy takes advantage of the differences in cell proliferation between normal and cancer cells. Chemotherapeutic drugs are usually designed to target rapid-dividing cells because sustained proliferation is a common feature of cancer [1,2]. Rapid DNA replication is essential for highly proliferative cells, thus blocking of DNA replication will create numerous mutations and/or chromosome rearrangements—ultimately triggering cell death [3]. Along these lines, DNA topoisomerase inhibitors are of great interest because they help to maintain strand breaks generated by topoisomerases during replication. In this article, we discuss the characteristics of topoisomerase (DNA) I (TOP1) and its inhibitors, as well as the underlying DNA repair pathways and the use of TOP1 inhibitors in cancer therapy. PMID:26287259

  4. 8-Hydroxy-2'-deoxyguanosine as a biomarker of oxidative DNA damage induced by perfluorinated compounds in TK6 cells.

    PubMed

    Yahia, Doha; Haruka, Igarashi; Kagashi, Yae; Tsuda, Shuji

    2016-02-01

    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is the most common biomarker of oxidative DNA damage, it is formed by chemical carcinogens and can be measured in any species. Perfluorooctanoic acid (PFOA) and perfluorononanoic acid (PFNA) are suspected genotoxic carcinogens through induction of reactive oxygen species that are responsible for oxidative DNA damage. This study was conducted to investigate the in vitro genotoxicity of PFOA and PFNA in human lymphoblastoid (TK6) cell line. TK6 cells were exposed to PFOA at 0, 125, 250, and 500 ppm and PFNA at 125 and 250 ppm for 2 h. Single cell gel electrophoresis (comet assay) was used to measure DNA damage; at least 50 cells per sample were analyzed using comet Assay Software Project (CASP). 8-OHdG was measured in DNA of exposed cells using high-performance liquid chromatography (HPLC)-mass spectrometry (MS)/MS. Results showed that both PFOA and PFNA induced DNA damage indicated by increased tail length (DNA migration). The level of 8-OHdG was increased in a dose-dependent manner in both PFOA and PFNA exposure. We concluded that PFOA and PFNA induced DNA damage and the biomarker of oxidative DNA damage (8-OHdG) could be measured by HPLC-MS/MS. In addition, PFNA produced high level of 8-OHdG at concentrations lower than PFOA, this may indicate that PFNA is more potent genotoxicant for TK6 cells than PFOA. PMID:25113910

  5. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    SciTech Connect

    Roper, Katherine; Coverley, Dawn

    2012-03-10

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naieve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naieve nuclei. At the same time, H2AX is phosphorylated in naieve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naieve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: Black-Right-Pointing-Pointer A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. Black-Right-Pointing-Pointer Damage-activated extracts impose the cellular response to DNA damage on naieve nuclei. Black-Right-Pointing-Pointer PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. Black-Right-Pointing-Pointer Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. Black-Right-Pointing-Pointer LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening

  6. Inhibition of DNA damage repair by artificial activation of PARP with siDNA.

    PubMed

    Croset, Amelie; Cordelières, Fabrice P; Berthault, Nathalie; Buhler, Cyril; Sun, Jian-Sheng; Quanz, Maria; Dutreix, Marie

    2013-08-01

    One of the major early steps of repair is the recruitment of repair proteins at the damage site, and this is coordinated by a cascade of modifications controlled by phosphatidylinositol 3-kinase-related kinases and/or poly (ADP-ribose) polymerase (PARP). We used short interfering DNA molecules mimicking double-strand breaks (called Dbait) or single-strand breaks (called Pbait) to promote DNA-dependent protein kinase (DNA-PK) and PARP activation. Dbait bound and induced both PARP and DNA-PK activities, whereas Pbait acts only on PARP. Therefore, comparative study of the two molecules allows analysis of the respective roles of the two signaling pathways: both recruit proteins involved in single-strand break repair (PARP, XRCC1 and PCNA) and prevent their recruitment at chromosomal damage. Dbait, but not Pbait, also inhibits recruitment of proteins involved in double-strand break repair (53BP1, NBS1, RAD51 and DNA-PK). By these ways, Pbait and Dbait disorganize DNA repair, thereby sensitizing cells to various treatments. Single-strand breaks repair inhibition depends on direct trapping of the main proteins on both molecules. Double-strand breaks repair inhibition may be indirect, resulting from the phosphorylation of double-strand breaks repair proteins and chromatin targets by activated DNA-PK. The DNA repair inhibition by both molecules is confirmed by their synthetic lethality with BRCA mutations. PMID:23761435

  7. DNA Damage Response Factors from Diverse Pathways, Including DNA Crosslink Repair, Mediate Alternative End Joining

    PubMed Central

    Howard, Sean M.; Yanez, Diana A.; Stark, Jeremy M.

    2015-01-01

    Alternative end joining (Alt-EJ) chromosomal break repair involves bypassing classical non-homologous end joining (c-NHEJ), and such repair causes mutations often with microhomology at the repair junction. Since the mediators of Alt-EJ are not well understood, we have sought to identify DNA damage response (DDR) factors important for this repair event. Using chromosomal break reporter assays, we surveyed an RNAi library targeting known DDR factors for siRNAs that cause a specific decrease in Alt-EJ, relative to an EJ event that is a composite of Alt-EJ and c-NHEJ (Distal-EJ between two tandem breaks). From this analysis, we identified several DDR factors that are specifically important for Alt-EJ relative to Distal-EJ. While these factors are from diverse pathways, we also found that most of them also promote homologous recombination (HR), including factors important for DNA crosslink repair, such as the Fanconi Anemia factor, FANCA. Since bypass of c-NHEJ is likely important for both Alt-EJ and HR, we disrupted the c-NHEJ factor Ku70 in Fanca-deficient mouse cells and found that Ku70 loss significantly diminishes the influence of Fanca on Alt-EJ. In contrast, an inhibitor of poly ADP-ribose polymerase (PARP) causes a decrease in Alt-EJ that is enhanced by Ku70 loss. Additionally, the helicase/nuclease DNA2 appears to have distinct effects from FANCA and PARP on both Alt-EJ, as well as end resection. Finally, we found that the proteasome inhibitor Bortezomib, a cancer therapeutic that has been shown to disrupt FANC signaling, causes a significant reduction in both Alt-EJ and HR, relative to Distal-EJ, as well as a substantial loss of end resection. We suggest that several distinct DDR functions are important for Alt-EJ, which include promoting bypass of c-NHEJ and end resection. PMID:25629353

  8. The role of reactive oxygen species in the herbicide acetochlor-induced DNA damage on Bufo raddei tadpole liver.

    PubMed

    Liu, Yang; Zhang, Yingmei; Liu, Jianghai; Huang, Dejun

    2006-06-10

    After exposure of Bufo raddei tadpoles to acetochlor (ACETO) for 14 days, malondialdehyde (MDA) and DNA-single strand break (DNA-SSB) in livers were analyzed. An enhanced accumulation of MDA suggests that ACETO causes oxidative stress, and the significant increase in the level of DNA-SSB indicates that ACETO induces DNA damage in a dose-dependent manner as well. On the basis of the fact that oxidative stress is caused by excessive production of reactive oxygen species (ROS), and the present results, we speculate that ACETO-induced DNA damage may be a consequence of the generation of ROS. To evaluate this hypothesis, tadpoles were treated with ROS scavenger, N-acetyl-L-cysteine (NAC) or melatonin (MEL), prior to ACETO exposure. The decrease of DNA-SSB level and the increase of total antioxidant capability (TAC) show that ACETO-caused DNA damage can be attenuated by NAC and MEL. In addition, a negative correlation was observed between the extent of DNA damage and the level of TAC in tadpole liver. In conclusion, the results suggest that ACETO-induced DNA damage is mediated by ROS. PMID:16513190

  9. DNA base damage by reactive oxygen species, oxidizing agents, and UV radiation.

    PubMed

    Cadet, Jean; Wagner, J Richard

    2013-02-01

    Emphasis has been placed in this article dedicated to DNA damage on recent aspects of the formation and measurement of oxidatively generated damage in cellular DNA in order to provide a comprehensive and updated survey. This includes single pyrimidine and purine base lesions, intrastrand cross-links, purine 5',8-cyclonucleosides, DNA-protein adducts and interstrand cross-links formed by the reactions of either the nucleobases or the 2-deoxyribose moiety with the hydroxyl radical, one-electron oxidants, singlet oxygen, and hypochlorous acid. In addition, recent information concerning the mechanisms of formation, individual measurement, and repair-rate assessment of bipyrimidine photoproducts in isolated cells and human skin upon exposure to UVB radiation, UVA photons, or solar simulated light is critically reviewed. PMID:23378590

  10. BRIT1 regulates early DNA damage response, chromosomal integrity,and cancer

    SciTech Connect

    Rai, Rekha; Dai, Hui; Multani, Asha S.; Li, Kaiyi; Chin, Koei; Gray, Joe; Lahad, John P.; Liang, Jiyong; Mills, Gordon B.; Meric-Bernstam, Funda; Lin, Shiaw-Yih

    2006-08-24

    BRIT1, initially identified as an hTERT repressor, hasadditional functions at DNA damage checkpoints. Here, we demonstratedthat BRIT1 formed nuclear foci minutes after irradiation. The foci ofBRIT1 co-localized with 53BP1, MDC1, NBS1, ATM, RPA, and ATR. BRIT1 wasrequired for activation of these elements, indicating that BRIT1 is aproximal factor in the DNA damage response pathway. Depletion of BRIT1increased the accumulation of chromosomal aberrations. In addition,decreased levels of BRIT1 were detected in several types of human cancerwith BRIT1 expression being inversely correlated with genomic instabilityand metastasis. These results identify BRIT1 as a crucial DNA damageregulator in the ATM/ATR pathways and suggest that it functions as atumor suppressor gene.

  11. Evidence for DNA Damage as a Biological Link Between Diabetes and Cancer

    PubMed Central

    Lee, Shao Chin; Chan, Juliana CN

    2015-01-01

    Objective: This review examines the evidence that: Diabetes is a state of DNA damage; pathophysiological factors in diabetes can cause DNA damage; DNA damage can cause mutations; and DNA mutation is linked to carcinogenesis. Data Sources: We retrieved information from the PubMed database up to January, 2014, using various search terms and their combinations including DNA damage, diabetes, cancer, high glucose, hyperglycemia, free fatty acids, palmitic acid, advanced glycation end products, mutation and carcinogenesis. Study Selection: We included data from peer-reviewed journals and a textbook printed in English on relationships between DNA damage and diabetes as well as pathophysiological factors in diabetes. Publications on relationships among DNA damage, mutagenesis, and carcinogenesis, were also reviewed. We organized this information into a conceptual framework to explain the possible causal relationship between DNA damage and carcinogenesis in diabetes. Results: There are a large amount of data supporting the view that DNA mutation is a typical feature in carcinogenesis. Patients with type 2 diabetes have increased production of reactive oxygen species, reduced levels of antioxidant capacity, and increased levels of DNA damage. The pathophysiological factors and metabolic milieu in diabetes can cause DNA damage such as DNA strand break and base modification (i.e., oxidation). Emerging experimental data suggest that signal pathways (i.e., Akt/tuberin) link diabetes to DNA damage. This collective evidence indicates that diabetes is a pathophysiological state of oxidative stress and DNA damage which can lead to various types of mutation to cause aberration in cells and thereby increased cancer risk. Conclusions: This review highlights the interrelationships amongst diabetes, DNA damage, DNA mutation and carcinogenesis, which suggests that DNA damage can be a biological link between diabetes and cancer. PMID:26021514

  12. The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability

    PubMed Central

    Hamperl, Stephan; Cimprich, Karlene A.

    2014-01-01

    Accurate DNA replication and DNA repair are crucial for the maintenance of genome stability, and it is generally accepted that failure of these processes is a major source of DNA damage in cells. Intriguingly, recent evidence suggests that DNA damage is more likely to occur at genomic loci with high transcriptional activity. Furthermore, loss of certain RNA processing factors in eukaryotic cells is associated with increased formation of co-transcriptional RNA:DNA hybrid structures known as R-loops, resulting in double-strand breaks (DSBs) and DNA damage. However, the molecular mechanisms by which R-loop structures ultimately lead to DNA breaks and genome instability is not well understood. In this review, we summarize the current knowledge about the formation, recognition and processing of RNA:DNA hybrids, and discuss possible mechanisms by which these structures contribute to DNA damage and genome instability in the cell. PMID:24746923

  13. Capturing snapshots of APE1 processing DNA damage

    DOE PAGESBeta

    Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; Dyrkheeva, Nadezhda S.; Wilson, Samuel H.

    2015-10-12

    DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylatedmore » CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.« less

  14. Capturing snapshots of APE1 processing DNA damage.

    PubMed

    Freudenthal, Bret D; Beard, William A; Cuneo, Matthew J; Dyrkheeva, Nadezhda S; Wilson, Samuel H

    2015-11-01

    DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. We report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylated CpG dinucleotides. These structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. These snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage. PMID:26458045

  15. Capturing Snapshots of APE1 Processing DNA Damage

    PubMed Central

    Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; Dyrkheeva, Nadezhda S.; Wilson, Samuel H.

    2015-01-01

    DNA apurinic-apyrimidinic (AP) sites are prevalent non-coding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive due in part to limited structural information. We report multiple high-resolution human APE1:DNA structures that divulge novel features of the APE1 reaction, including the metal binding site, nucleophile, and arginine clamps that mediate product release. We also report APE1:DNA structures with a T:G mismatch 5′ to the AP-site, representing a clustered lesion occurring in methylated CpG dinucleotides. These reveal that APE1 molds the T:G mismatch into a unique Watson-Crick like geometry that distorts the active site reducing incision. These snapshots provide mechanistic clarity for APE1, while affording a rational framework to manipulate biological responses to DNA damage. PMID:26458045

  16. Capturing snapshots of APE1 processing DNA damage

    SciTech Connect

    Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; Dyrkheeva, Nadezhda S.; Wilson, Samuel H.

    2015-10-12

    DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylated CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.

  17. Oxidative DNA Damage from Nanoparticle Exposure and Its Application to Workers' Health: A Literature Review

    PubMed Central

    Rim, Kyung-Taek; Song, Se-Wook; Kim, Hyeon-Yeong

    2013-01-01

    The use of nanoparticles (NPs) in industry is increasing, bringing with it a number of adverse health effects on workers. Like other chemical carcinogens, NPs can cause cancer via oxidative DNA damage. Of all the molecules vulnerable to oxidative modification by NPs, DNA has received the greatest attention, and biomarkers of exposure and effect are nearing validation. This review concentrates on studies published between 2000 and 2012 that attempted to detect oxidative DNA damage in humans, laboratory animals, and cell lines. It is important to review these studies to improve the current understanding of the oxidative DNA damage caused by NP exposure in the workplace. In addition to examining studies on oxidative damage, this review briefly describes NPs, giving some examples of their adverse effects, and reviews occupational exposure assessments and approaches to minimizing exposure (e.g., personal protective equipment and engineering controls such as fume hoods). Current recommendations to minimize exposure are largely based on common sense, analogy to ultrafine material toxicity, and general health and safety recommendations. PMID:24422173

  18. Adrenergic DNA damage of embryonic pluripotent cells via β2 receptor signalling

    PubMed Central

    Sun, Fan; Ding, Xu-Ping; An, Shi-Min; Tang, Ya-Bin; Yang, Xin-Jie; Teng, Lin; Zhang, Chun; Shen, Ying; Chen, Hong-Zhuan; Zhu, Liang

    2015-01-01

    Embryonic pluripotent cells are sensitive to genotoxicity though they need more stringent genome integrity to avoid compromising multiple cell lineages and subsequent generations. However it remains unknown whether the cells are susceptible to adrenergic stress which can induce somatic cell genome lesion. We have revealed that adrenergic stress mediators cause DNA damage of the cells through the β2 adrenergic receptor/adenylate cyclase/cAMP/PKA signalling pathway involving an induction of intracellular reactive oxygen species (ROS) accumulation. The adrenergic stress agonists adrenaline, noradrenaline, and isoprenaline caused DNA damage and apoptosis of embryonic stem (ES) cells and embryonal carcinoma stem cells. The effects were mimicked by β2 receptor-coupled signalling molecules and abrogated by selective blockade of β2 receptors and inhibition of the receptor signalling pathway. RNA interference targeting β2 receptors of ES cells conferred the cells the ability to resist the DNA damage and apoptosis. In addition, adrenergic stimulation caused a consistent accumulation of ROS in the cells and the effect was abrogated by β2 receptor blockade; quenching of ROS reversed the induced DNA damage. This finding will improve the understanding of the stem cell regulatory physiology/pathophysiology in an adrenergic receptor subtype signalling mechanism. PMID:26516061

  19. Protective Effects of Extracts from Fructus rhodomyrti against Oxidative DNA Damage In Vitro and In Vivo

    PubMed Central

    Ke, Yuebin; Xu, Xinyun; Wu, Shuang; Huang, Juan; Misra, Hara; Li, Yunbo

    2013-01-01

    Objective. To evaluate the potential protective effects of extracts from Fructus rhodomyrti (FR) against oxidative DNA damage using a cellular system and the antioxidant ability on potassium bromate- (KBrO3-) mediated oxidative stress in rats. Methods. The effects of FR on DNA damage induced by hydrogen peroxide (H2O2) were evaluated by comet assay in primary spleen lymphocytes cultures. The effects of FR on the activities of SOD, CAT, and GPx and the levels of GSH, hydroperoxides, and 8-OHdG were determined in the plasma and tissues of rats treated with KBrO3. Results. FR was shown to effectively protect against DNA damage induced by H2O2  in vitro, and the maximum protective effect was observed when FR was diluted 20 times. Endogenous antioxidant status, namely, the activities of SOD, CAT, and GPx and the levels of GSH were significantly decreased in the plasma, the liver, and the kidney of the KBrO3-treated rats, while the pretreatment of FR prevented the decreases of these parameters. In addition, the pretreatment of FR was also able to prevent KBrO3-induced increases in the levels of hydroperoxides and 8-OHdG in the plasma, the liver, and the kidney in rats. Conclusions. Our findings suggested that FR might act as a chemopreventive agent with antioxidant properties offering effective protection against oxidative DNA damage in a concentration-dependent manner in vitro and in vivo. PMID:24089629

  20. Oxidative DNA damage from nanoparticle exposure and its application to workers' health: a literature review.

    PubMed

    Rim, Kyung-Taek; Song, Se-Wook; Kim, Hyeon-Yeong

    2013-12-01

    The use of nanoparticles (NPs) in industry is increasing, bringing with it a number of adverse health effects on workers. Like other chemical carcinogens, NPs can cause cancer via oxidative DNA damage. Of all the molecules vulnerable to oxidative modification by NPs, DNA has received the greatest attention, and biomarkers of exposure and effect are nearing validation. This review concentrates on studies published between 2000 and 2012 that attempted to detect oxidative DNA damage in humans, laboratory animals, and cell lines. It is important to review these studies to improve the current understanding of the oxidative DNA damage caused by NP exposure in the workplace. In addition to examining studies on oxidative damage, this review briefly describes NPs, giving some examples of their adverse effects, and reviews occupational exposure assessments and approaches to minimizing exposure (e.g., personal protective equipment and engineering controls such as fume hoods). Current recommendations to minimize exposure are largely based on common sense, analogy to ultrafine material toxicity, and general health and safety recommendations. PMID:24422173

  1. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central

    2010-01-01

    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  2. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development.

    PubMed

    Kumar, Rachana A; Oldenburg, Delene J; Bendich, Arnold J

    2014-12-01

    The amount and structural integrity of organellar DNAs change during plant development, although the mechanisms of change are poorly understood. Using PCR-based methods, we quantified DNA damage, molecular integrity, and genome copy number for plastid and mitochondrial DNAs of maize seedlings. A DNA repair assay was also used to assess DNA impediments. During development, DNA damage increased and molecules with impediments that prevented amplification by Taq DNA polymerase increased, with light causing the greatest change. DNA copy number values depended on the assay method, with standard real-time quantitative PCR (qPCR) values exceeding those determined by long-PCR by 100- to 1000-fold. As the organelles develop, their DNAs may be damaged in oxidative environments created by photo-oxidative reactions and photosynthetic/respiratory electron transfer. Some molecules may be repaired, while molecules with unrepaired damage may be degraded to non-functional fragments measured by standard qPCR but not by long-PCR. PMID:25261192

  3. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development

    PubMed Central

    Kumar, Rachana A.; Oldenburg, Delene J.; Bendich, Arnold J.

    2014-01-01

    The amount and structural integrity of organellar DNAs change during plant development, although the mechanisms of change are poorly understood. Using PCR-based methods, we quantified DNA damage, molecular integrity, and genome copy number for plastid and mitochondrial DNAs of maize seedlings. A DNA repair assay was also used to assess DNA impediments. During development, DNA damage increased and molecules with impediments that prevented amplification by Taq DNA polymerase increased, with light causing the greatest change. DNA copy number values depended on the assay method, with standard real-time quantitative PCR (qPCR) values exceeding those determined by long-PCR by 100- to 1000-fold. As the organelles develop, their DNAs may be damaged in oxidative environments created by photo-oxidative reactions and photosynthetic/respiratory electron transfer. Some molecules may be repaired, while molecules with unrepaired damage may be degraded to non-functional fragments measured by standard qPCR but not by long-PCR. PMID:25261192

  4. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  5. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton.

    PubMed

    Malloy, K D; Holman, M A; Mitchell, D; Detrich, H W

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlate with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. PMID:9037040

  6. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    PubMed Central

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  7. Nitric Oxide Suppresses β-Cell Apoptosis by Inhibiting the DNA Damage Response.

    PubMed

    Oleson, Bryndon J; Broniowska, Katarzyna A; Naatz, Aaron; Hogg, Neil; Tarakanova, Vera L; Corbett, John A

    2016-08-01

    Nitric oxide, produced in pancreatic β cells in response to proinflammatory cytokines, plays a dual role in the regulation of β-cell fate. While nitric oxide induces cellular damage and impairs β-cell function, it also promotes β-cell survival through activation of protective pathways that promote β-cell recovery. In this study, we identify a novel mechanism in which nitric oxide prevents β-cell apoptosis by attenuating the DNA damage response (DDR). Nitric oxide suppresses activation of the DDR (as measured by γH2AX formation and the phosphorylation of KAP1 and p53) in response to multiple genotoxic agents, including camptothecin, H2O2, and nitric oxide itself, despite the presence of DNA damage. While camptothecin and H2O2 both induce DDR activation, nitric oxide suppresses only camptothecin-induced apoptosis and not H2O2-induced necrosis. The ability of nitric oxide to suppress the DDR appears to be selective for pancreatic β cells, as nitric oxide fails to inhibit DDR signaling in macrophages, hepatocytes, and fibroblasts, three additional cell types examined. While originally described as the damaging agent responsible for cytokine-induced β-cell death, these studies identify a novel role for nitric oxide as a protective molecule that promotes β-cell survival by suppressing DDR signaling and attenuating DNA damage-induced apoptosis. PMID:27185882

  8. Maintaining Genome Stability in Defiance of Mitotic DNA Damage

    PubMed Central

    Ferrari, Stefano; Gentili, Christian

    2016-01-01

    The implementation of decisions affecting cell viability and proliferation is based on prompt detection of the issue to be addressed, formulation and transmission of a correct set of instructions and fidelity in the execution of orders. While the first and the last are purely mechanical processes relying on the faithful functioning of single proteins or macromolecular complexes (sensors and effectors), information is the real cue, with signal amplitude, duration, and frequency ultimately determining the type of response. The cellular response to DNA damage is no exception to the rule. In this review article we focus on DNA damage responses in G2 and Mitosis. First, we set the stage describing mitosis and the machineries in charge of assembling the apparatus responsible for chromosome alignment and segregation as well as the inputs that control its function (checkpoints). Next, we examine the type of issues that a cell approaching mitosis might face, presenting the impact of post-translational modifications (PTMs) on the correct and timely functioning of pathways correcting errors or damage before chromosome segregation. We conclude this essay with a perspective on the current status of mitotic signaling pathway inhibitors and their potential use in cancer therapy. PMID:27493659

  9. Personal Exposure to Ultrafine Particles and Oxidative DNA Damage

    PubMed Central

    Vinzents, Peter S.; Møller, Peter; Sørensen, Mette; Knudsen, Lisbeth E.; Hertel, Ole; Jensen, Finn Palmgren; Schibye, Bente; Loft, Steffen

    2005-01-01

    Exposure to ultrafine particles (UFPs) from vehicle exhaust has been related to risk of cardiovascular and pulmonary disease and cancer, even though exposure assessment is difficult. We studied personal exposure in terms of number concentrations of UFPs in the breathing zone, using portable instruments in six 18-hr periods in 15 healthy nonsmoking subjects. Exposure contrasts of outdoor pollution were achieved by bicycling in traffic for 5 days and in the laboratory for 1 day. Oxidative DNA damage was assessed as strand breaks and oxidized purines in mononuclear cells isolated from venous blood the morning after exposure measurement. Cumulated outdoor and cumulated indoor exposures to UFPs each were independent significant predictors of the level of purine oxidation in DNA but not of strand breaks. Ambient air concentrations of particulate matter with an aero-dynamic diameter of ≤10 μm (PM10), nitrous oxide, nitrogen dioxide, carbon monoxide, and/or number concentration of UFPs at urban background or busy street monitoring stations was not a significant predictor of DNA damage, although personal UFP exposure was correlated with urban background concentrations of CO and NO2, particularly during bicycling in traffic. The results indicate that biologic effects of UFPs occur at modest exposure, such as that occurring in traffic, which supports the relationship of UFPs and the adverse health effects of air pollution. PMID:16263500

  10. On the consistency of Monte Carlo track structure DNA damage simulations

    SciTech Connect

    Pater, Piotr Seuntjens, Jan; El Naqa, Issam; Bernal, Mario A.

    2014-12-15

    Purpose: Monte Carlo track structures (MCTS) simulations have been recognized as useful tools for radiobiological modeling. However, the authors noticed several issues regarding the consistency of reported data. Therefore, in this work, they analyze the impact of various user defined parameters on simulated direct DNA damage yields. In addition, they draw attention to discrepancies in published literature in DNA strand break (SB) yields and selected methodologies. Methods: The MCTS code Geant4-DNA was used to compare radial dose profiles in a nanometer-scale region of interest (ROI) for photon sources of varying sizes and energies. Then, electron tracks of 0.28 keV–220 keV were superimposed on a geometric DNA model composed of 2.7 × 10{sup 6} nucleosomes, and SBs were simulated according to four definitions based on energy deposits or energy transfers in DNA strand targets compared to a threshold energy E{sub TH}. The SB frequencies and complexities in nucleosomes as a function of incident electron energies were obtained. SBs were classified into higher order clusters such as single and double strand breaks (SSBs and DSBs) based on inter-SB distances and on the number of affected strands. Results: Comparisons of different nonuniform dose distributions lacking charged particle equilibrium may lead to erroneous conclusions regarding the effect of energy on relative biological effectiveness. The energy transfer-based SB definitions give similar SB yields as the one based on energy deposit when E{sub TH} ≈ 10.79 eV, but deviate significantly for higher E{sub TH} values. Between 30 and 40 nucleosomes/Gy show at least one SB in the ROI. The number of nucleosomes that present a complex damage pattern of more than 2 SBs and the degree of complexity of the damage in these nucleosomes diminish as the incident electron energy increases. DNA damage classification into SSB and DSB is highly dependent on the definitions of these higher order structures and their

  11. Targeting the epigenetics of the DNA damage response in breast cancer

    PubMed Central

    Montenegro, M F; González-Guerrero, R; Sánchez-del-Campo, L; Piñero-Madrona, A; Cabezas-Herrera, J; Rodríguez-López, J N

    2016-01-01

    Cancer is as much an epigenetic disease as it is a genetic disease, and epigenetic alterations in cancer often serve as potent surrogates for genetic mutations. Because the epigenetic factors involved in the DNA damage response are regulated by multiple elements, therapies to target specific components of the epigenetic machinery can be inefficient. In contrast, therapies aimed at inhibiting the methionine cycle can indirectly inhibit both DNA and protein methylation, and the wide variety of genes and pathways that are affected by these methylations make this global strategy very attractive. In the present study, we propose an adjuvant therapy that targets the epigenetics of the DNA damage response in breast cancer cells and that results in efficient apoptosis and a reduction in distant metastases in vivo. We observed that a combined therapy designed to uncouple adenosine metabolism using dipyridamole in the presence of a new synthetic antifolate, 3-O-(3,4,5-trimethoxybenzoyl)-(−)-catechin, simultaneously and efficiently blocked both the folic cycle and the methionine cycle in breast cancer cells and sensitized these cells to radiotherapy. The treatment impeded the recruitment of 53BP1 and BRCA1 to the chromatin regions flanking DNA double-strand breaks and thereby avoided the DNA damage responses in breast cancer cells that were exposed to ionizing radiation. In addition, this hypomethylating therapy was also efficient in reducing the self-renewal capability of breast cancer-initiating cells and induced reversion of mesenchymal phenotypes in breast cancer cells. PMID:27054335

  12. 99mTc-Labeled HYNIC-DAPI Causes Plasmid DNA Damage with High Efficiency

    PubMed Central

    Kotzerke, Joerg; Punzet, Robert; Runge, Roswitha; Ferl, Sandra; Oehme, Liane; Wunderlich, Gerd; Freudenberg, Robert

    2014-01-01

    99mTc is the standard radionuclide used for nuclear medicine imaging. In addition to gamma irradiation, 99mTc emits low-energy Auger and conversion electrons that deposit their energy within nanometers of the decay site. To study the potential for DNA damage, direct DNA binding is required. Plasmid DNA enables the investigation of the unprotected interactions between molecules and DNA that result in single-strand breaks (SSBs) or double-strand breaks (DSBs); the resulting DNA fragments can be separated by gel electrophoresis and quantified by fluorescent staining. This study aimed to compare the plasmid DNA damage potential of a 99mTc-labeled HYNIC-DAPI compound with that of 99mTc pertechnetate (99mTcO4−). pUC19 plasmid DNA was irradiated for 2 or 24 hours. Direct and radical-induced DNA damage were evaluated in the presence or absence of the radical scavenger DMSO. For both compounds, an increase in applied activity enhanced plasmid DNA damage, which was evidenced by an increase in the open circular and linear DNA fractions and a reduction in the supercoiled DNA fraction. The number of SSBs elicited by 99mTc-HYNIC-DAPI (1.03) was twice that caused by 99mTcO4− (0.51), and the number of DSBs increased fivefold in the 99mTc-HYNIC-DAPI-treated sample compared with the 99mTcO4− treated sample (0.02 to 0.10). In the presence of DMSO, the numbers of SSBs and DSBs decreased to 0.03 and 0.00, respectively, in the 99mTcO4– treated samples, whereas the numbers of SSBs and DSBs were slightly reduced to 0.95 and 0.06, respectively, in the 99mTc-HYNIC-DAPI-treated samples. These results indicated that 99mTc-HYNIC-DAPI induced SSBs and DSBs via a direct interaction of the 99mTc-labeled compound with DNA. In contrast to these results, 99mTcO4− induced SSBs via radical formation, and DSBs were formed by two nearby SSBs. The biological effectiveness of 99mTc-HYNIC-DAPI increased by approximately 4-fold in terms of inducing SSBs and by approximately 10-fold in terms of

  13. Nitrative and oxidative DNA damage caused by K-ras mutation in mice

    SciTech Connect

    Ohnishi, Shiho; Saito, Hiromitsu; Suzuki, Noboru; Ma, Ning; Hiraku, Yusuke; Murata, Mariko; Kawanishi, Shosuke

    2011-09-23

    Highlights: {yields} Mutated K-ras in transgenic mice caused nitrative DNA damage, 8-nitroguanine. {yields} The mutagenic 8-nitroguanine seemed to be generated by iNOS via Ras-MAPK signal. {yields} Mutated K-ras produces additional mutagenic lesions, as a new oncogenic role. -- Abstract: Ras mutation is important for carcinogenesis. Carcinogenesis consists of multi-step process with mutations in several genes. We investigated the role of DNA damage in carcinogenesis initiated by K-ras mutation, using conditional transgenic mice. Immunohistochemical analysis revealed that mutagenic 8-nitroguanine and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) were apparently formed in adenocarcinoma caused by mutated K-ras. 8-Nitroguanine was co-localized with iNOS, eNOS, NF-{kappa}B, IKK, MAPK, MEK, and mutated K-ras, suggesting that oncogenic K-ras causes additional DNA damage via signaling pathway involving these molecules. It is noteworthy that K-ras mutation mediates not only cell over-proliferation but also the accumulation of mutagenic DNA lesions, leading to carcinogenesis.

  14. ERK3 regulates TDP2-mediated DNA damage response and chemoresistance in lung cancer cells

    PubMed Central

    Bian, Ka; Muppani, Naveen Reddy; Elkhadragy, Lobna; Wang, Wei; Zhang, Cheng; Chen, Tenghui; Jung, Sungyun; Seternes, Ole Morten; Long, Weiwen

    2016-01-01

    Posttranslational modifications (PTMs), such as phosphorylation and ubiquitination, play critical regulatory roles in the assembly of DNA damage response proteins on the DNA damage site and their activities in DNA damage repair. Tyrosyl DNA phosphodiesterase 2 (TDP2) repairs Topoisomerase 2 (Top2)-linked DNA damage, thereby protecting cancer cells against Top2 inhibitors-induced growth inhibition and cell death. The regulation of TDP2 activity by post-translational modifications in DNA repair, however, remains unclear. In the current study, we have found that ERK3, an atypical MAPK, phosphorylates TDP2 at S60 and regulates TDP2's phosphodiesterase activity, thereby cooperatively protecting lung cancer cells against Top2 inhibitors-induced DNA damage and growth inhibition. As such, our study revealed a post-translational regulation of TDP2 activity and discovered a new role of ERK3 in increasing cancer cells’ DNA damage response and chemoresistance to Top2 inhibitors. PMID:26701725

  15. DNA with Damage in Both Strands as Affinity Probes and Nucleotide Excision Repair Substrates.

    PubMed

    Lukyanchikova, N V; Petruseva, I O; Evdokimov, A N; Silnikov, V N; Lavrik, O I

    2016-03-01

    Nucleotide excision repair (NER) is a multistep process of recognition and elimination of a wide spectrum of damages that cause significant distortions in DNA structure, such as UV-induced damage and bulky chemical adducts. A series of model DNAs containing new bulky fluoro-azidobenzoyl photoactive lesion dC(FAB) and well-recognized nonnucleoside lesions nFlu and nAnt have been designed and their interaction with repair proteins investigated. We demonstrate that modified DNA duplexes dC(FAB)/dG (probe I), dC(FAB)/nFlu+4 (probe II), and dC(FAB)/nFlu-3 (probe III) have increased (as compared to unmodified DNA, umDNA) structure-dependent affinity for XPC-HR23B (Kdum > KdI > KdII ≈ KdIII) and differentially crosslink to XPC and proteins of NER-competent extracts. The presence of dC(FAB) results in (i) decreased melting temperature (ΔTm = -3°C) and (ii) 12° DNA bending. The extended dC(FAB)/dG-DNA (137 bp) was demonstrated to be an effective NER substrate. Lack of correlation between the affinity to XPC-HR23B and substrate properties of the model DNA suggests a high impact of the verification stage on the overall NER process. In addition, DNAs containing closely positioned, well-recognized lesions in the complementary strands represent hardly repairable (dC(FAB)/nFlu+4, dC(FAB)/nFlu-3) or irreparable (nFlu/nFlu+4, nFlu/nFlu-3, nAnt/nFlu+4, nAnt/nFlu-3) structures. Our data provide evidence that the NER system of higher eukaryotes recognizes and eliminates damaged DNA fragments on a multi-criterion basis. PMID:27262196

  16. Binding of the UvrB dimer to non-damaged and damaged DNA: residues Y92 and Y93 influence the stability of both subunits.

    PubMed

    Moolenaar, Geri F; Schut, Menno; Goosen, Nora

    2005-06-01

    UvrB is the ultimate damage-binding protein in bacterial nucleotide excision repair. Previous AFM experiments have indicated that UvrB binds to a damage as a dimer. In this paper we visualize for the first time a UvrB dimer in a gel retardation assay, with the second subunit (B2) more loosely bound than the subunit (B1) that interacts with the damage. A beta-hairpin motif in UvrB plays an important role in damage specific binding. Alanine substitutions of Y92 or Y93 in the beta-hairpin result in proteins that kill E. coli cells as a consequence of incision in non-damaged DNA. Apparently, both residues are needed to prevent binding of UvrB to non-damaged DNA. The lethality of Y93A results from UvrC-mediated incisions, whereas that of Y92A is due to incisions by Cho. This difference could be ascribed to a difference in stability of the B2 subunit in the mutant UvrB-DNA complexes. We show that for 3' incision UvrC needs to displace this second UvrB subunit from the complex, whereas Cho seems capable to incise the dimer-complex. Footprint analysis of the contacts of UvrB with damaged DNA revealed that the B2 subunit interacts with the flanking DNA at the 3' side of the lesion. The B2 subunit of mutant Y92A appeared to be more firmly associated with the DNA, indicating that even when B1 is bound to a lesion, the B2 subunit probes the adjacent DNA for presence of damage. We propose this to be a reflection of the process that the UvrB dimer uses to find lesions in the DNA. In addition to preventing binding to non-damaged DNA, the Y92 and Y93 residues appear also important for making specific contacts (of B1) with the damaged site. We show that the concerted action of the two tyrosines lead to a conformational change in the DNA surrounding the lesion, which is required for the 3' incision reaction. PMID:15886069

  17. Fisetin Protects DNA Against Oxidative Damage and Its Possible Mechanism

    PubMed Central

    Wang, Tingting; Lin, Huajuan; Tu, Qian; Liu, Jingjing; Li, Xican

    2016-01-01

    Purpose: The paper tries to assess the protective effect of fisetin against •OH-induced DNA damage, then to investigate the possible mechanism. Methods: The protective effect was evaluated based on the content of malondialdehyde (MDA). The possible mechanism was analyzed using various antioxidant methods in vitro, including •OH scavenging (deoxyribose degradation), •O2- scavenging (pyrogallol autoxidation), DPPH• scavenging, ABTS•+ scavenging, and Cu2+-reducing power assays. Results: Fisetin increased dose-dependently its protective percentages against •OH-induced DNA damage (IC50 value =1535.00±29.60 µM). It also increased its radical-scavenging percentages in a dose-dependent manner in various antioxidants assays. Its IC50 values in •OH scavenging, •O2- scavenging, DPPH• scavenging, ABTS•+ scavenging, and Cu2+-reducing power assays, were 47.41±4.50 µM, 34.05±0.87 µM, 9.69±0.53 µM, 2.43±0.14 µM, and 1.49±0.16 µM, respectively. Conclusion: Fisetin can effectively protect DNA against •OH-induced oxidative damage possibly via reactive oxygen species (ROS) scavenging approach, which is assumed to be hydrogen atom (H•) and/or single electron (e) donation (HAT/SET) pathways. In the HAT pathway, the 3’,4’-dihydroxyl moiety in B ring of fisetin is thought to play an important role, because it can be ultimately oxidized to a stable ortho-benzoquinone form. PMID:27478791

  18. Characterization of the interactions of PARP-1 with UV-damaged DNA in vivo and in vitro.

    PubMed

    Purohit, Nupur K; Robu, Mihaela; Shah, Rashmi G; Geacintov, Nicholas E; Shah, Girish M

    2016-01-01

    The existing methodologies for studying robust responses of poly (ADP-ribose) polymerase-1 (PARP-1) to DNA damage with strand breaks are often not suitable for examining its subtle responses to altered DNA without strand breaks, such as UV-damaged DNA. Here we describe two novel assays with which we characterized the interaction of PARP-1 with UV-damaged DNA in vivo and in vitro. Using an in situ fractionation technique to selectively remove free PARP-1 while retaining the DNA-bound PARP-1, we demonstrate a direct recruitment of the endogenous or exogenous PARP-1 to the UV-lesion site in vivo after local irradiation. In addition, using the model oligonucleotides with single UV lesion surrounded by multiple restriction enzyme sites, we demonstrate in vitro that DDB2 and PARP-1 can simultaneously bind to UV-damaged DNA and that PARP-1 casts a bilateral asymmetric footprint from -12 to +9 nucleotides on either side of the UV-lesion. These techniques will permit characterization of different roles of PARP-1 in the repair of UV-damaged DNA and also allow the study of normal housekeeping roles of PARP-1 with undamaged DNA. PMID:26753915

  19. Characterization of the interactions of PARP-1 with UV-damaged DNA in vivo and in vitro

    PubMed Central

    Purohit, Nupur K.; Robu, Mihaela; Shah, Rashmi G.; Geacintov, Nicholas E.; Shah, Girish M.

    2016-01-01

    The existing methodologies for studying robust responses of poly (ADP-ribose) polymerase-1 (PARP-1) to DNA damage with strand breaks are often not suitable for examining its subtle responses to altered DNA without strand breaks, such as UV-damaged DNA. Here we describe two novel assays with which we characterized the interaction of PARP-1 with UV-damaged DNA in vivo and in vitro. Using an in situ fractionation technique to selectively remove free PARP-1 while retaining the DNA-bound PARP-1, we demonstrate a direct recruitment of the endogenous or exogenous PARP-1 to the UV-lesion site in vivo after local irradiation. In addition, using the model oligonucleotides with single UV lesion surrounded by multiple restriction enzyme sites, we demonstrate in vitro that DDB2 and PARP-1 can simultaneously bind to UV-damaged DNA and that PARP-1 casts a bilateral asymmetric footprint from −12 to +9 nucleotides on either side of the UV-lesion. These techniques will permit characterization of different roles of PARP-1 in the repair of UV-damaged DNA and also allow the study of normal housekeeping roles of PARP-1 with undamaged DNA. PMID:26753915

  20. Chemical and Biological Consequences of Oxidatively Damaged Guanine in DNA

    PubMed Central

    Delaney, Sarah; Jarem, Daniel A.; Volle, Catherine B.; Yennie, Craig J.

    2013-01-01

    Of the four native nucleosides, 2′-deoxyguanosine (dGuo) is most easily oxidized. Two lesions derived from dGuo are 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodGuo) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy)·dGuo. Furthermore, while steady-state levels of 8-oxodGuo can be detected in genomic DNA, it is also known that 8-oxodGuo is more easily oxidized than dGuo. Thus, 8-oxodGuo is susceptible to further oxidation to form several hyperoxidized dGuo products. This review addresses the structural impact, the mutagenic and genotoxic potential, and biological implications of oxidatively damaged DNA, in particular 8-oxodGuo, Fapy·dGuo, and the hyperoxidized dGuo products. PMID:22239655

  1. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  2. L-Carnitine supplementation decreases DNA damage in treated MSUD patients.

    PubMed

    Mescka, Caroline Paula; Guerreiro, Gilian; Hammerschmidt, Tatiane; Faverzani, Jéssica; de Moura Coelho, Daniella; Mandredini, Vanusa; Wayhs, Carlos Alberto Yasin; Wajner, Moacir; Dutra-Filho, Carlos Severo; Vargas, Carmen Regla

    2015-05-01

    Maple syrup urine disease (MSUD) is an inherited disorder caused by severe deficient activity of the branched-chain α-keto acid dehydrogenase complex involved in the degradation pathway of branched-chain amino acids (BCAAs) and their α-ketoacid derivatives. MSUD patients generally present ketoacidosis, poor feeding, ataxia, coma, psychomotor delay, mental retardation and brain abnormalites. Treatment consists of dietary restriction of the BCAA (low protein intake) supplemented by a BCAA-free amino acid mixture. Although the mechanisms of brain damage in MSUD are poorly known, previous studies have shown that oxidative stress may be involved in the neuropathology of this disorder. In this regard, it was recently reported that MSUD patients have deficiency of l-carnitine (l-car), a compound with antioxidant properties that is used as adjuvant therapy in various inborn errors of metabolism. In this work, we investigated DNA damage determined by the alkaline comet assay in peripheral whole blood leukocytes of MSUD patients submitted to a BCAA-restricted diet supplemented or not with l-car. We observed a significant increase of DNA damage index (DI) in leukocytes from MSUD patients under BCAA-restricted diet as compared to controls and that l-car supplementation significantly decreased DNA DI levels. It was also found a positive correlation between DI and MDA content, a marker of lipid peroxidation, and an inverse correlation between DI and l-car levels. Taken together, our present results suggest a role for reactive species and the involvement of oxidative stress in DNA damage in this disorder. Since l-car reduced DNA damage, it is presumed that dietary supplementation of this compound may serve as an adjuvant therapeutic strategy for MSUD patients in addition to other therapies. PMID:25867118

  3. Effects of temperature on baseline and genotoxicant-induced DNA damage in haemocytes of Dreissena polymorpha.

    PubMed

    Buschini, Annamaria; Carboni, Pamela; Martino, Anna; Poli, Paola; Rossi, Carlo

    2003-05-01

    The potential application of the Comet assay for monitoring genotoxicity in the freshwater mussel Dreissena polymorpha was explored and a preliminary investigation was undertaken of the baseline levels of DNA damage in mussel haemocytes of animals kept at different temperatures. In addition, in vitro cell sensitivity against genotoxicants was assessed in relation to increasing temperatures. The mussels were kept at four different constant temperatures (4, 18, 28 and 37 degrees C) for 15 h. The haemocytes withdrawn were treated in vitro with melphalan, as a model genotoxic compound, or sodium hypochlorite, a common water disinfectant capable of producing mutagenic/carcinogenic by-products, at the established temperatures for 1h. The data obtained in vivo, in cells directly withdrawn from the mussels showed a significant (P<0.001, Student's t test) inter-individual variability, probably due to genetic and epigenetic factors and an increasing amount of DNA damage at increasing temperature. Mussel haemocytes showed a clear dose-response effect after in vitro melphalan treatment. Hypochlorite treatment also significantly increased DNA migration: the damage was temperature dependent, with a similar increase at 4 and 28 degrees C and a minimum level at 18 degrees C. This study demonstrates the potential application of the Comet assay to haemocytes of D. polymorpha. However, these findings suggest that temperature could alter both DNA damage baseline levels in untreated animals and cell sensitivity towards environmental pollutants in in vitro conditions. Therefore, more information is needed about seasonal variations and the natural background levels of DNA damage in mussels living in the wild, before they are used for the monitoring of genotoxic effects in aquatic environments. PMID:12742509

  4. Genotoxicity of refinery waste assessed by some DNA damage tests.

    PubMed

    Gupta, Amit Kumar; Ahmad, Irshad; Ahmad, Masood

    2015-04-01

    Refinery waste effluent is well known to contain polycyclic aromatic hydrocarbons, phenols and heavy metals as potentially genotoxic substances. The aim of the present study was to assess the genotoxic potential of Mathura refinery wastewater (MRWW) by various in vitro tests including the single cell gel electrophoresis, plasmid nicking assay and S1 nuclease assay. Treatment of human lymphocytes to different MRWW concentrations (0.15×, 0.3×, 0.5× and 0.78×) caused the formation of comets of which the mean tail lengths increased proportionately and differed significantly from those of unexposed controls. The toxic effect of MRWW on DNA was also studied by plasmid nicking assay and S1 nuclease assay. Strand breaks formation in the MRWW treated pBR322 plasmid confirmed its genotoxic effect. Moreover, a dose dependent increase in cleavage of calf thymus DNA in S1 nuclease assay was also suggestive of the DNA damaging potential of MRWW. A higher level of ROS generation in the test water sample was recorded which might be contributing to its genotoxicity. Interaction between the constituents of MRWW and calf thymus DNA was also ascertained by UV-visible spectroscopy. PMID:24836934

  5. Sumoylation regulates EXO1 stability and processing of DNA damage

    PubMed Central

    Bologna, Serena; Altmannova, Veronika; Valtorta, Emanuele; Koenig, Christiane; Liberali, Prisca; Gentili, Christian; Anrather, Dorothea; Ammerer, Gustav; Pelkmans, Lucas; Krejci, Lumir; Ferrari, Stefano

    2015-01-01

    DNA double-strand break repair by the error-free pathway of homologous recombination (HR) requires the concerted action of several factors. Among these, EXO1 and DNA2/BLM are responsible for the extensive resection of DNA ends to produce 3′-overhangs, which are essential intermediates for downstream steps of HR. Here we show that EXO1 is a SUMO target and that sumoylation affects EXO1 ubiquitylation and protein stability. We identify an UBC9-PIAS1/PIAS4-dependent mechanism controlling human EXO1 sumoylation in vivo and demonstrate conservation of this mechanism in yeast by the Ubc9-Siz1/Siz2 using an in vitro reconstituted system. Furthermore, we show physical interaction between EXO1 and the de-sumoylating enzyme SENP6 both in vitro and in vivo, promoting EXO1 stability. Finally, we identify the major sites of sumoylation in EXO1 and show that ectopic expression of a sumoylation-deficient form of EXO1 rescues the DNA damage-induced chromosomal aberrations observed upon wt-EXO1 expression. Thus, our study identifies a novel layer of regulation of EXO1, making the pathways that regulate its function an ideal target for therapeutic intervention. PMID:26083678

  6. Association between copper deficiency and DNA damage in cattle.

    PubMed

    Picco, S J; Abba, M C; Mattioli, G A; Fazzio, L E; Rosa, D; De Luca, J C; Dulout, F N

    2004-11-01

    Cattle hypocuprosis is the second most widespread mineral deficiency affecting grazing cattle. The consequences of hypocuprosis include a failure of copper metalloenzymes, many of which form part of the antioxidant defence system. This work focuses on the association between copper (Cu) plasma concentration and DNA damage in Aberdeen Angus cattle. Two-hundred and ninety-nine heparinized blood samples from 2-year-old Aberdeen Angus cows were obtained from different farms located in the Salado River basin, Argentina. Plasma copper level analysis was carried out in whole samples, while cytogenetic analysis and single cell gel electrophoresis assay (comet assay) were carried out in 82 and 217 samples, respectively. Cytogenetic analysis showed a significant increase in the frequency of abnormal metaphases in moderate/severe hypocupremic groups (groups B and C) in relation to the normocupremic group (group A) (4.5 and 1.5 abnormal metaphases/100 cells, respectively, P < 0.01). The Spearman correlation test showed a negative association between cupremic values and the yield of chromosomal aberrations (r = -0.708, P < 0.0001). In the comet assay greater migration was observed in cells from the hypocupremic group, from a median of 54 in the severe hypocupremic group to 31 in the normocupremic group (P < 0.01). Accordingly, the Spearman correlation test showed a significant positive relationship between copper levels and cells without DNA migration and a significant negative relationship between copper levels and cells with a tiny tail (P < 0.0001 in both cases). The results obtained show that hypocupremia in cattle is associated with an increase in the frequency of chromosomal aberrations as well as in DNA migration as assessed by the comet assay. Whereas the comet assay could differentiate copper plasma level groups, chromosomal aberrations only detected differences between normal and hypocupremic animals. The increase of DNA damage found in hypocupremic animals could be

  7. DNA damage and repair in human peripheral blood lymphocytes following treatment with microcystin-LR.

    PubMed

    Lankoff, Anna; Krzowski, Łukasz; Głab, Joanna; Banasik, Anna; Lisowska, Halina; Kuszewski, Tomasz; Góźdź, Stanisław; Wójcik, Andrzej

    2004-04-11

    The purpose of this study was to find a possible explanation of the inconsistency of data regarding the genotoxicity of microcystin-LR (MC-LR). We compared the results of the comet assay with the results of the analysis of chromosome aberrations and apoptosis. In order to investigate the influence of MC-LR on DNA damage in human lymphocytes, cells were treated with MC-LR at different concentrations (1, 10 and 25 microg/ml) for 6, 12, 18 and 24 h. Analyses of Olive Tail Moment (OTM) as an indicator of DNA damage showed that MC-LR treatment induced DNA damage in a time-dependent manner, reaching its maximum after 18 h. The lowest values of OTM were observed after 24 h. MC-LR had no effect on the frequency of chromosome aberrations in lymphocytes. Since some data available in the literature indicate that apoptosis may lead to overestimated or false positive results regarding the genotoxicity of mutagens in the comet assay, we measured the frequency of late apoptotic cells by use of the comet assay and the frequency of early apoptotic cells with the TUNEL method. The comet assay results revealed that the highest level of apoptosis was observed after 24 h and the lowest after 18 h. The comparison of the frequency of apoptotic cells determined by the comet assay with DNA damage (OTM) examined by the comet assay revealed a statistically significant, negative correlation. The TUNEL results showed that the frequency of apoptotic cells progressively increased in a dose- and time-dependent manner. The comparison of the frequency of apoptotic cells determined by TUNEL method with DNA damage (OTM) examined by the comet assay showed a significant positive correlation for lymphocytes treated with MC-LR for 6, 12 and 18 h. Therefore, our findings indicate that microcystin-LR-induced DNA damage observed in the comet assay may be related to the early stages of apoptosis due to cytotoxicity but not genotoxicity. In addition, we examined the DNA repair kinetics in lymphocytes

  8. Significant disparity in base and sugar damage in DNA resulting from neutron and electron irradiation

    PubMed Central

    Pang, Dalong; Nico, Jeffrey S.; Karam, Lisa; Timofeeva, Olga; Blakely, William F.; Dritschilo, Anatoly; Dizdaroglu, Miral; Jaruga, Pawel

    2014-01-01

    In this study, a comparison of the effects of neutron and electron irradiation of aqueous DNA solutions was investigated to characterize potential neutron signatures in DNA damage induction. Ionizing radiation generates numerous lesions in DNA, including base and sugar lesions, lesions involving base–sugar combinations (e.g. 8,5′-cyclopurine-2′-deoxynucleosides) and DNA–protein cross-links, as well as single- and double-strand breaks and clustered damage. The characteristics of damage depend on the linear energy transfer (LET) of the incident radiation. Here we investigated DNA damage using aqueous DNA solutions in 10 mmol/l phosphate buffer from 0–80 Gy by low-LET electrons (10 Gy/min) and the specific high-LET (∼0.16 Gy/h) neutrons formed by spontaneous 252Cf decay fissions. 8-hydroxy-2′-deoxyguanosine (8-OH-dG), (5′R)-8,5′-cyclo-2′-deoxyadenosine (R-cdA) and (5′S)-8,5′-cyclo-2′-deoxyadenosine (S-cdA) were quantified using liquid chromatography–isotope-dilution tandem mass spectrometry to demonstrate a linear dose dependence for induction of 8-OH-dG by both types of radiation, although neutron irradiation was ∼50% less effective at a given dose compared with electron irradiation. Electron irradiation resulted in an exponential increase in S-cdA and R-cdA with dose, whereas neutron irradiation induced substantially less damage and the amount of damage increased only gradually with dose. Addition of 30 mmol/l 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS), a free radical scavenger, to the DNA solution before irradiation reduced lesion induction to background levels for both types of radiation. These results provide insight into the mechanisms of DNA damage by high-LET 252Cf decay neutrons and low-LET electrons, leading to enhanced understanding of the potential biological effects of these types of irradiation. PMID:25034731

  9. Nucleolar exit of RNF8 and BRCA1 in response to DNA damage

    SciTech Connect

    Guerra-Rebollo, Marta; Mateo, Francesca; Franke, Kristin; Huen, Michael S.Y.; Lopitz-Otsoa, Fernando; Rodriguez, Manuel S.; Plans, Vanessa; Thomson, Timothy M.

    2012-11-01

    The induction of DNA double-strand breaks (DSBs) elicits a plethora of responses that redirect many cellular functions to the vital task of repairing the injury, collectively known as the DNA damage response (DDR). We have found that, in the absence of DNA damage, the DSB repair factors RNF8 and BRCA1 are associated with the nucleolus. Shortly after exposure of cells to {gamma}-radiation, RNF8 and BRCA1 translocated from the nucleolus to damage foci, a traffic that was reverted several hours after the damage. RNF8 interacted through its FHA domain with the ribosomal protein RPSA, and knockdown of RPSA caused a depletion of nucleolar RNF8 and BRCA1, suggesting that the interaction of RNF8 with RPSA is critical for the nucleolar localization of these DDR factors. Knockdown of RPSA or RNF8 impaired bulk protein translation, as did {gamma}-irradiation, the latter being partially countered by overexpression of exogenous RNF8. Our results suggest that RNF8 and BRCA1 are anchored to the nucleolus through reversible interactions with RPSA and that, in addition to its known functions in DDR, RNF8 may play a role in protein synthesis, possibly linking the nucleolar exit of this factor to the attenuation of protein synthesis in response to DNA damage. -- Highlights: Black-Right-Pointing-Pointer RNF8 and BRCA1 are associated with the nucleolus of undamaged cells. Black-Right-Pointing-Pointer Upon {gamma}-radiation, RNF8 and BRCA1 are translocated from the nucleolus to damage foci. Black-Right-Pointing-Pointer The ribosomal protein RPSA anchors RNF8 to the nucleolus. Black-Right-Pointing-Pointer RNF8 may play previously unsuspected roles in protein synthesis.

  10. Oxidative DNA damage induced by hair dye components ortho-phenylenediamines and the enhancement by superoxide dismutase.

    PubMed

    Murata, Mariko; Nishimura, Tomoko; Chen, Fang; Kawanishi, Shosuke

    2006-09-01

    There is an association between occupational exposure to hair dyes and incidence of cancers. Permanent oxidant hair dyes are consisted of many chemical components including ortho-phenylenediamines. To clarify the mechanism of carcinogenesis by hair dyes, we examined DNA damage induced by mutagenic ortho-phenylenediamine (o-PD) and its derivatives, 4-chloro-ortho-phenylenediamine (Cl-PD) and 4-nitro-ortho-phenylenediamine (NO(2)-PD), using (32)P-labeled DNA fragments obtained from the human p16 and the p53 tumor suppressor gene. We also measured the content of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), a marker of oxidative DNA damage, in calf thymus DNA with an electrochemical detector coupled to a high performance liquid chromatograph. Carcinogenic o-PD and Cl-PD caused Cu(II)-mediated DNA damage, including 8-oxodG formation, and antioxidant enzyme superoxide dismutase (SOD) enhanced DNA damage. o-PD and Cl-PD caused piperidine-labile and formamidopyrimidine-DNA glycosylase-sensitive lesions at cytosine and guanine residues respectively in the 5'-ACG-3' sequence, complementary to codon 273, a well-known hotspot of the human p53 tumor suppressor gene. UV-vis spectroscopic studies showed that the spectral change of o-PD and Cl-PD required Cu(II), and addition of SOD enhanced it. This suggested that SOD enhanced the rate of Cu(II)-mediated autoxidation of o-PD and Cl-PD, leading to enhancement of DNA damage. On the other hand, mutagenic but non-carcinogenic NO(2)-PD induced no DNA damage. These results suggest that carcinogenicity of ortho-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:16798066

  11. USING THE DNA ALKALINE UNWINDING ASSAY TO DETECT DNA DAMAGE IN LABORATORY AND ENVIRONMENTALLY EXPOSED CELLS AND TISSUES

    EPA Science Inventory

    The DNA alkaline unwinding assay is being evaluated for use in the detection of DNA damage in marine animals exposed to environmental pollutants. n preliminary work, DNA unwinding methods were used with in vitro cell systems to demonstrate DNA strand breaks. ultured mammalian fib...

  12. The dynamic behavior of Ect2 in response to DNA damage

    PubMed Central

    He, Dan; Xiang, Jinnan; Li, Baojie; Liu, Huijuan

    2016-01-01

    Ect2 is a BRCT-containing guanidine exchange factor for Rho GTPases. It is essential for cytokinesis and is also involved in tumorigenesis. Since most BRCT-containing proteins are involved in DNA damage response and/or DNA repair, we tested whether Ect2 plays similar roles. We report that in primary mouse embryonic fibroblasts (MEFs), DNA damage quickly led to Ect2 relocalization to the chromatin and DNA damage foci-like structures. Ect2 knockdown did not affect foci localization of γH2AX, TopBP1, or Brca1, or activation of Atm, yet it impeded p53 Ser15 phosphorylation and activation, and resulted in defects in apoptosis and activation of S and G2/M checkpoints in response to DNA damage. These results suggest that Ect2 plays a role in DNA damage response. Interestingly, Ect2 is down-regulated at late stages of DNA damage response. Although p53 and E2F1 have been shown to regulate Ect2 transcription, DNA damage-induced Ect2 down-regulation occurred in p53−/− or Atm−/− MEFs and E2F1 knockdown cells. Instead, DNA damage-induced Ect2 down-regulation is mainly attributable to decreased protein stability. Like Ect2 knockdown, Ect2 destabilization may help the cell to recover from DNA damage response. These results suggest that Ect2 plays roles in multiple aspects of DNA damage response. PMID:27074761

  13. Glutathione-deficient Plasmodium berghei parasites exhibit growth delay and nuclear DNA damage.

    PubMed

    Padín-Irizarry, Vivian; Colón-Lorenzo, Emilee E; Vega-Rodríguez, Joel; Castro, María Del R; González-Méndez, Ricardo; Ayala-Peña, Sylvette; Serrano, Adelfa E

    2016-06-01

    Plasmodium parasites are exposed to endogenous and exogenous oxidative stress during their complex life cycle. To minimize oxidative damage, the parasites use glutathione (GSH) and thioredoxin (Trx) as primary antioxidants. We previously showed that disruption of the Plasmodium berghei gamma-glutamylcysteine synthetase (pbggcs-ko) or the glutathione reductase (pbgr-ko) genes resulted in a significant reduction of GSH in intraerythrocytic stages, and a defect in growth in the pbggcs-ko parasites. In this report, time course experiments of parasite intraerythrocytic development and morphological studies showed a growth delay during the ring to schizont progression. Morphological analysis shows a significant reduction in size (diameter) of trophozoites and schizonts with increased number of cytoplasmic vacuoles in the pbggcs-ko parasites in comparison to the wild type (WT). Furthermore, the pbggcs-ko mutants exhibited an impaired response to oxidative stress and increased levels of nuclear DNA (nDNA) damage. Reduced GSH levels did not result in mitochondrial DNA (mtDNA) damage or protein carbonylations in neither pbggcs-ko nor pbgr-ko parasites. In addition, the pbggcs-ko mutant parasites showed an increase in mRNA expression of genes involved in oxidative stress detoxification and DNA synthesis, suggesting a potential compensatory mechanism to allow for parasite proliferation. These results reveal that low GSH levels affect parasite development through the impairment of oxidative stress reduction systems and damage to the nDNA. Our studies provide new insights into the role of the GSH antioxidant system in the intraerythrocytic development of Plasmodium parasites, with potential translation into novel pharmacological interventions. PMID:26952808

  14. FUS is phosphorylated by DNA-PK and accumulates in the cytoplasm after DNA damage.

    PubMed

    Deng, Qiudong; Holler, Christopher J; Taylor, Georgia; Hudson, Kathryn F; Watkins, William; Gearing, Marla; Ito, Daisuke; Murray, Melissa E; Dickson, Dennis W; Seyfried, Nicholas T; Kukar, Thomas

    2014-06-01

    Abnormal cytoplasmic accumulation of Fused in Sarcoma (FUS) in neurons defines subtypes of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). FUS is a member of the FET protein family that includes Ewing's sarcoma (EWS) and TATA-binding protein-associated factor 2N (TAF15). FET proteins are predominantly localized to the nucleus, where they bind RNA and DNA to modulate transcription, mRNA splicing, and DNA repair. In ALS cases with FUS inclusions (ALS-FUS), mutations in the FUS gene cause disease, whereas FTLD cases with FUS inclusions (FTLD-FUS) do not harbor FUS mutations. Notably, in FTLD-FUS, all FET proteins accumulate with their nuclear import receptor Transportin 1 (TRN1), in contrast ALS-FUS inclusions are exclusively positive for FUS. In the present study, we show that induction of DNA damage replicates several pathologic hallmarks of FTLD-FUS in immortalized human cells and primary human neurons and astrocytes. Treatment with the antibiotic calicheamicin γ1, which causes DNA double-strand breaks, leads to the cytoplasmic accumulation of FUS, TAF15, EWS, and TRN1. Moreover, cytoplasmic translocation of FUS is mediated by phosphorylation of its N terminus by the DNA-dependent protein kinase. Finally, we observed elevated levels of phospho-H2AX in FTLD-FUS brains, indicating that DNA damage occurs in patients. Together, our data reveal a novel regulatory mechanism for FUS localization in cells and suggest that DNA damage may contribute to the accumulation of FET proteins observed in human FTLD-FUS cases, but not in ALS-FUS. PMID:24899704

  15. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction

    PubMed Central

    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu

    2015-01-01

    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function. PMID:26064230

  16. Neil3 and NEIL1 DNA Glycosylases Remove Oxidative Damages from Quadruplex DNA and Exhibit Preferences for Lesions in the Telomeric Sequence Context*

    PubMed Central

    Zhou, Jia; Liu, Minmin; Fleming, Aaron M.; Burrows, Cynthia J.; Wallace, Susan S.

    2013-01-01

    The telomeric DNA of vertebrates consists of d(TTAGGG)n tandem repeats, which can form quadruplex DNA structures in vitro and likely in vivo. Despite the fact that the G-rich telomeric DNA is susceptible to oxidation, few biochemical studies of base excision repair in telomeric DNA and quadruplex structures have been done. Here, we show that telomeric DNA containing thymine glycol (Tg), 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh), or spiroiminodihydantoin (Sp) can form quadruplex DNA structures in vitro. We have tested the base excision activities of five mammalian DNA glycosylases (NEIL1, NEIL2, mNeil3, NTH1, and OGG1) on these lesion-containing quadruplex substrates and found that only mNeil3 had excision activity on Tg in quadruplex DNA and that the glycosylase exhibited a strong preference for Tg in the telomeric sequence context. Although Sp and Gh in quadruplex DNA were good substrates for mNeil3 and NEIL1, none of the glycosylases had activity on quadruplex DNA containing 8-oxoG. In addition, NEIL1 but not mNeil3 showed enhanced glycosylase activity on Gh in the telomeric sequence context. These data suggest that one role for Neil3 and NEIL1 is to repair DNA base damages in telomeres in vivo and that Neil3 and Neil1 may function in quadruplex-mediated cellular events, such as gene regulation via removal of damaged bases from quadruplex DNA. PMID:23926102

  17. Histone ubiquitylation and its roles in transcription and DNA damage response.

    PubMed

    Meas, Rithy; Mao, Peng

    2015-12-01

    DNA in human cells is constantly assaulted by endogenous and exogenous DNA damaging agents. It is vital for the cell to respond rapidly and precisely to DNA damage to maintain genome integrity and reduce the risk of mutagenesis. Sophisticated reactions occur in chromatin surrounding the damaged site leading to the activation of DNA damage response (DDR), including transcription reprogramming, cell cycle checkpoint, and DNA repair. Histone proteins around the DNA damage play essential roles in DDR, through extensive post-translational modifications (PTMs) by a variety of modifying enzymes. One PTM on histones, mono-ubiquitylation, has emerged as a key player in cellular response to DNA damage. In this review, we will (1) briefly summarize the history of histone H2A and H2B ubiquitylation (H2Aub and H2Bub, respectively), (2) discuss their roles in transcription, and (3) their functions in DDR. PMID:26422137

  18. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.

    PubMed

    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S

    2015-10-01

    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. PMID:26447197

  19. 3D view of chromosomes, DNA damage, and translocations.

    PubMed

    Schwartz, Michal; Hakim, Ofir

    2014-04-01

    The cell nucleus is a busy and organized organelle. In this megalopolis made of billions of nucleotides, protein factors find their target loci to exert nuclear functions such as transcription and replication. Remarkably, despite the lack of internal membrane barrier, the interlinked and tightly regulated nuclear processes occur in spatially organized fashion. These processes can lead to double-strand breaks (DSBs) that compromise the integrity of the genome. Moreover, in some cells like lymphocytes, DNA damage is also targeted within the context of immunoglobulin gene recombination. If not repaired correctly, DSBs can cause chromosomal rearrangements, including translocations which are etiological in numerous tumors. Therefore, the chromosomal locations of DSBs, as well as their spatial positioning, are important contributors to formation of chromosomal translocations at specific genomic loci. To obtain a mechanistic understanding of chromosomal translocations these parameters should be accounted for in a global and integrative fashion. In this review we will discuss recent findings addressing how genome architecture, DNA damage, and repair contribute to the genesis of chromosomal translocations. PMID:24632298

  20. The Yeast Copper Response Is Regulated by DNA Damage

    PubMed Central

    Dong, Kangzhen; Addinall, Stephen G.; Lydall, David

    2013-01-01

    Copper is an essential but potentially toxic redox-active metal, so the levels and distribution of this metal are carefully regulated to ensure that it binds to the correct proteins. Previous studies of copper-dependent transcription in the yeast Saccharomyces cerevisiae have focused on the response of genes to changes in the exogenous levels of copper. We now report that yeast copper genes are regulated in response to the DNA-damaging agents methyl methanesulfonate (MMS) and hydroxyurea by a mechanism(s) that requires the copper-responsive transcription factors Mac1 and AceI, copper superoxide dismutase (Sod1) activity, and the Rad53 checkpoint kinase. Furthermore, in copper-starved yeast, the response of the Rad53 pathway to MMS is compromised due to a loss of Sod1 activity, consistent with the model that yeast imports copper to ensure Sod1 activity and Rad53 signaling. Crucially, the Mac1 transcription factor undergoes changes in its redox state in response to changing levels of copper or MMS. This study has therefore identified a novel regulatory relationship between cellular redox, copper homeostasis, and the DNA damage response in yeast. PMID:23959798

  1. DNA damage response and sphingolipid signaling in liver diseases.

    PubMed

    Nagahashi, Masayuki; Matsuda, Yasunobu; Moro, Kazuki; Tsuchida, Junko; Soma, Daiki; Hirose, Yuki; Kobayashi, Takashi; Kosugi, Shin-Ichi; Takabe, Kazuaki; Komatsu, Masaaki; Wakai, Toshifumi

    2016-09-01

    Patients with unresectable hepatocellular carcinoma (HCC) cannot generally be cured by systemic chemotherapy or radiotherapy due to their poor response to conventional therapeutic agents. The development of novel and efficient targeted therapies to increase their treatment options depends on the elucidation of the molecular mechanisms that underlie the pathogenesis of HCC. The DNA damage response (DDR) is a network of cell-signaling events that are triggered by DNA damage. Its dysregulation is thought to be one of the key mechanisms underlying the generation of HCC. Sphingosine-1-phosphate (S1P), a lipid mediator, has emerged as an important signaling molecule that has been found to be involved in many cellular functions. In the liver, the alteration of S1P signaling potentially affects the DDR pathways. In this review, we explore the role of the DDR in hepatocarcinogenesis of various etiologies, including hepatitis B and C infection and non-alcoholic steatohepatitis. Furthermore, we discuss the metabolism and functions of S1P that may affect the hepatic DDR. The elucidation of the pathogenic role of S1P may create new avenues of research into therapeutic strategies for patients with HCC. PMID:26514817

  2. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  3. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.

    PubMed

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  4. Sumoylation of MDC1 is important for proper DNA damage response.

    PubMed

    Luo, Kuntian; Zhang, Haoxing; Wang, Liewei; Yuan, Jian; Lou, Zhenkun

    2012-06-29

    In response to DNA damage, many DNA damage factors, such as MDC1 and 53BP1, redistribute to sites of DNA damage. The mechanism governing the turnover of these factors at DNA damage sites, however, remains enigmatic. Here, we show that MDC1 is sumoylated following DNA damage, and the sumoylation of MDC1 at Lys1840 is required for MDC1 degradation and removal of MDC1 and 53BP1 from sites of DNA damage. Sumoylated MDC1 is recognized and ubiquitinated by the SUMO-targeted E3 ubiquitin ligase RNF4. Mutation of the MDC1 Lys 1840 (K1840R) results in impaired CtIP, replication protein A, and Rad51 accumulation at sites of DNA damage and defective homologous recombination (HR). The HR defect caused by MDC1K1840R mutation could be rescued by 53BP1 downregulation. These results reveal the intricate dynamics governing the assembly and disassembly of DNA damage factors at sites of DNA damage for prompt response to DNA damage. PMID:22635276

  5. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  6. Protective Effect of Folic Acid on Oxidative DNA Damage

    PubMed Central

    Guo, Xiaojuan; Cui, Huan; Zhang, Haiyang; Guan, Xiaoju; Zhang, Zheng; Jia, Chaonan; Wu, Jia; Yang, Hui; Qiu, Wenting; Zhang, Chuanwu; Yang, Zuopeng; Chen, Zhu; Mao, Guangyun

    2015-01-01

    Abstract Although previous reports have linked DNA damage with both transmissions across generations as well as our own survival, it is unknown how to reverse the lesion. Based on the data from a Randomized, Double-blind, Placebo Controlled Clinical Trial, this study aimed to assess the efficacy of folic acid supplementation (FAS) on DNA oxidative damage reversal. In this randomized clinical trial (RCT), a total of 450 participants were enrolled and randomly assigned to 3 groups to receive folic acid (FA) 0.4 mg/day (low-FA), 0.8 mg/day (high-FA), or placebo (control) for 8 weeks. The urinary 8-hydroxy-2’-deoxyguanosine (8-OHdG) and creatinine (Cr) concentration at pre- and post-FAS were measured with modified enzyme-linked immunosorbent assay (ELISA) and high-performance liquid chromatography (HPLC), respectively. A multivariate general linear model was applied to assess the individual effects of FAS and the joint effects between FAS and hypercholesterolemia on oxidative DNA damage improvement. This clinical trial was registered with ClinicalTrials.gov, number NCT02235948. Of the 438 subjects that received FA fortification or placebo, the median (first quartile, third quartile) of urinary 8-OHdG/Cr for placebo, low-FA, and high-FA groups were 58.19 (43.90, 82.26), 53.51 (38.97, 72.74), 54.73 (39.58, 76.63) ng/mg at baseline and 57.77 (44.35, 81.33), 51.73 (38.20, 71.30), and 50.65 (37.64, 76.17) ng/mg at the 56th day, respectively. A significant decrease of urinary 8-OHdG was observed after 56 days FA fortification (P < 0.001). Compared with the placebo, after adjusting for some potential confounding factors, including the baseline urinary 8-OHdG/Cr, the urinary 8-OHdG/Cr concentration significantly decreased after 56 days FAS [β (95% confidence interval) = −0.88 (−1.62, −0.14) and P = 0.020 for low-FA; and β (95% confidence interval) = −2.68 (−3.42, −1.94) and P < 0.001 for high-FA] in a dose-response fashion (Ptrend

  7. Determination of DNA Damage in Floriculturists Exposed to Mixtures of Pesticides

    PubMed Central

    Castillo-Cadena, J.; Tenorio-Vieyra, L. E.; Quintana-Carabia, A. I.; García-Fabila, M. M.; Ramírez-San Juan, E.; Madrigal-Bujaidar, E.

    2006-01-01

    The aim of the study was to determine possible DNA damage in floriculturists chronically exposed to pesticides. Leukocytes from 52 workers, 46 environmentally exposed, and 38 control individuals were evaluated with the comet assay. Serum from all individuals was also analyzed for pesticides using gas chromatography coupled to mass spectrometry. A statistically significant difference in DNA fragmentation in the pesticide exposed group compared to the other two groups (P < .001) was found. No differences between environmentally exposed and control individuals were detected. The statistical analysis showed no significant correlation between DNA damage and sex, age, drinking or smoking habits, as well as years of exposure. One or more pesticides were detected in 50% of the floriculturists, while in the rest of the individuals, a chemical related with the preparation of pesticides, such as additives, plasticizers, or solvents, was found. Our study shows that chronic exposure to pesticides produces DNA damage in floriculturists. It also suggests that this type of monitoring could be valuable in recommending preventive measures. PMID:16883059

  8. Platelet-activating factor induces cell cycle arrest and disrupts the DNA damage response in mast cells

    PubMed Central

    Puebla-Osorio, N; Damiani, E; Bover, L; Ullrich, S E

    2015-01-01

    Platelet-activating factor (PAF) is a potent phospholipid modulator of inflammation that has diverse physiological and pathological functions. Previously, we demonstrated that PAF has an essential role in ultraviolet (UV)-induced immunosuppression and reduces the repair of damaged DNA, suggesting that UV-induced PAF is contributing to skin cancer initiation by inducing immune suppression and also affecting a proper DNA damage response. The exact role of PAF in modulating cell proliferation, differentiation or transformation is unclear. Here, we investigated the mechanism(s) by which PAF affects the cell cycle and impairs early DNA damage response. PAF arrests proliferation in transformed and nontransformed human mast cells by reducing the expression of cyclin-B1 and promoting the expression of p21. PAF-treated cells show a dose-dependent cell cycle arrest mainly at G2–M, and a decrease in the DNA damage response elements MCPH1/BRIT-1 and ataxia telangiectasia and rad related (ATR). In addition, PAF disrupts the localization of p-ataxia telangiectasia mutated (p-ATM), and phosphorylated-ataxia telangiectasia and rad related (p-ATR) at the site of DNA damage. Whereas the potent effect on cell cycle arrest may imply a tumor suppressor activity for PAF, the impairment of proper DNA damage response might implicate PAF as a tumor promoter. The outcome of these diverse effects may be dependent on specific cues in the microenvironment. PMID:25950475

  9. Oxidative DNA Damage in Kidneys and Heart of Hypertensive Mice Is Prevented by Blocking Angiotensin II and Aldosterone Receptors

    PubMed Central

    Brand, Susanne; Amann, Kerstin; Mandel, Philipp; Zimnol, Anna; Schupp, Nicole

    2014-01-01

    Introduction Recently, we could show that angiotensin II, the reactive peptide of the blood pressure-regulating renin-angiotensin-aldosterone-system, causes the formation of reactive oxygen species and DNA damage in kidneys and hearts of hypertensive mice. To further investigate on the one hand the mechanism of DNA damage caused by angiotensin II, and on the other hand possible intervention strategies against end-organ damage, the effects of substances interfering with the renin-angiotensin-aldosterone-system on angiotensin II-induced genomic damage were studied. Methods In C57BL/6-mice, hypertension was induced by infusion of 600 ng/kg • min angiotensin II. The animals were additionally treated with the angiotensin II type 1 receptor blocker candesartan, the mineralocorticoid receptor blocker eplerenone and the antioxidant tempol. DNA damage and the activation of transcription factors were studied by immunohistochemistry and protein expression analysis. Results Administration of angiotensin II led to a significant increase of blood pressure, decreased only by candesartan. In kidneys and hearts of angiotensin II-treated animals, significant oxidative stress could be detected (1.5-fold over control). The redox-sensitive transcription factors Nrf2 and NF-κB were activated in the kidney by angiotensin II-treatment (4- and 3-fold over control, respectively) and reduced by all interventions. In kidneys and hearts an increase of DNA damage (3- and 2-fold over control, respectively) and of DNA repair (3-fold over control) was found. These effects were ameliorated by all interventions in both organs. Consistently, candesartan and tempol were more effective than eplerenone. Conclusion Angiotensin II-induced DNA damage is caused by angiotensin II type 1 receptor-mediated formation of oxidative stress in vivo. The angiotensin II-mediated physiological increase of aldosterone adds to the DNA-damaging effects. Blocking angiotensin II and mineralocorticoid receptors therefore

  10. Garlic supplementation prevents oxidative DNA damage in essential hypertension.

    PubMed

    Dhawan, Veena; Jain, Sanjay

    2005-07-01

    Oxygen-free radicals and other oxygen/nitrogen species are constantly generated in the human body. Most are intercepted by antioxidant defences and perform useful metabolic roles, whereas others escape to damage biomolecules like DNA, lipids and proteins. Garlic has been shown to contain antioxidant phytochemicals that prevent oxidative damage. These include unique water-soluble organosulphur compounds, lipid-soluble organosulphur compounds and flavonoids. Therefore, in the present study, we have tried to explore the antioxidant effect of garlic supplementation on oxidative stress-induced DNA damage, nitric oxide (NO) and superoxide generation and on the total antioxidant status (TAS) in patients of essential hypertension (EH). Twenty patients of EH as diagnosed by JNC VI criteria (Group I) and 20 age and sex-matched normotensive controls (Group II) were enrolled in the study. Both groups were given garlic pearls (GP) in a dose of 250 mg per day for 2 months. Baseline samples were taken at the start of the study, i.e. 0 day, and thereafter 2 months follow-up. 8-Hydroxy-2'-deoxyguanosine (8-OHdG), lipids, lipid peroxidation (MDA), NO and antioxidant vitamins A, E and C were determined. A moderate decline in blood pressure (BP) and a significant reduction in 8-OHdG, NO levels and lipid peroxidation were observed in Group I subjects with GP supplementation. Further, a significant increase in vitamin levels and TAS was also observed in this group as compared to the control subjects. These findings point out the beneficial effects of garlic supplementation in reducing blood pressure and counteracting oxidative stress, and thereby, offering cardioprotection in essential hypertensives. PMID:16335787

  11. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY STYRENE OXIDE

    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  13. Neutron energy-dependent initial DNA damage and chromosomal exchange.

    PubMed

    Tanaka, K; Gajendiran, N; Endo, S; Komatsu, K; Hoshi, M; Kamada, N

    1999-12-01

    This study was undertaken to investigate the biological effect of monoenergetic neutrons on human lymphocyte DNA and chromosomes. Monoenergetic neutrons of 2.3, 1.0, 0.79, 0.57, 0.37 and 0.186 MeV were generated, and 252Cf neutrons and 60Co gamma-rays were also used for comparison. Biological effect was evaluated two ways. The RBE values with the comet assay were estimated as 6.3 and 5.4 at 0.37 MeV and 0.57 MeV relative to that of 60Co gamma-rays, and chromosome aberration rates were also observed in these different levels of monoenergetic neutrons. The yield of chromosome aberrations per unit dose was high at lower neutron energies with a gradual decline with 0.186 MeV neutron energy. The RBE was increased to 10.7 at 0.57 MeV from 3.9 at 252Cf neutrons and reached 16.4 as the highest RBE at 0.37 MeV, but the value decreased to 11.2 at 0.186 MeV. The response patterns of initial DNA damage and chromosome exchange were quite similar to that of LET. These results show that the intensity of DNA damage and chromosomal exchange is LET dependent. RBE of low energy neutrons is higher than that of fission neutrons. Low energy neutrons containing Hiroshima atomic bomb radiation may have created a significantly higher incidence of biological effect in atomic bomb survivors. PMID:10804992

  14. Thioredoxin-dependent regulation of AIF-mediated DNA damage.

    PubMed

    Shelar, Sandeep B; Kaminska, Kamila K; Reddy, Shridhivya A; Kumar, Dilip; Tan, Chong-Teik; Yu, Victor C; Lu, Jun; Holmgren, Arne; Hagen, Thilo; Chew, Eng-Hui

    2015-10-01

    The thioredoxin (Trx) system is one major redox system in mammalian cells. One of its component, Trx, is involved in redox homeostasis and many cellular biological processes through participating in disulfide reduction, S-nitrosylation/S-denitrosylation reactions and protein-protein interactions. In this study, we report the identification of a novel interaction between cytosolic/nuclear Trx1 and apoptosis inducing factor (AIF), and the redox sensitivity and biological significance of the Trx-AIF interaction was characterized. Cytosolic Trx1 but not mitochondrial Trx2 was observed to interact with AIF under physiological conditions and Trx1's active site cysteines were crucial for the interaction. Under oxidative stress conditions, Trx-AIF interaction was disrupted. When the treated cells were allowed to recover from oxidative stress by means of removal of the oxidants, interaction between Trx1 and AIF was re-established time-dependently, which underpins the biological relevance of a Trx-dependent redox regulation of AIF-mediated cell death. Indeed, in times of oxidative stress, nuclear translocation of AIF was found to occur concurrently with perturbations to the Trx-AIF interaction. Once localized in the nucleus, reduced Trx1 hindered the interaction between AIF and DNA, thereby bringing about an attenuation of AIF-mediated DNA damage. In conclusion, characterization of the Trx-AIF interaction has led to an understanding of the effect of reduced Trx1 on possibly regulating AIF-dependent cell death through impeding AIF-mediated DNA damage. Importantly, identification of the novel interaction between Trx1 and AIF has provided opportunities to design and develop therapeutically relevant strategies that either promote or prevent this protein-protein interaction for the treatment of different disease states. PMID:26119781

  15. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    SciTech Connect

    Ganesan, Shanthi Nteeba, Jackson Keating, Aileen F.

    2014-12-01

    7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.

  16. Antioxidant and DNA damage protection potentials of selected phenolic acids.

    PubMed

    Sevgi, Kemal; Tepe, Bektas; Sarikurkcu, Cengiz

    2015-03-01

    In this study, ten different phenolic acids (caffeic, chlorogenic, cinnamic, ferulic, gallic, p-hydroxybenzoic, protocatechuic, rosmarinic, syringic, and vanillic acids) were evaluated for their antioxidant and DNA damage protection potentials. Antioxidant activity was evaluated by using four different test systems named as β-carotene bleaching, DPPH free radical scavenging, reducing power and chelating effect. In all test systems, rosmarinic acid showed the maximum activity potential, while protocatechuic acid was determined as the weakest antioxidant in β-carotene bleaching, DPPH free radical scavenging, and chelating effect assays. Phenolic acids were also screened for their protective effects on pBR322 plasmid DNA against the mutagenic and toxic effects of UV and H2O2. Ferulic acid was found as the most active phytochemical among the others. Even at the lowest concentration value (0.002 mg/ml), ferulic acid protected all of the bands in the presence of H2O2 and UV. It is followed by caffeic, rosmarinic, and vanillic acids. On the other hand, cinnamic acid (at 0.002 mg/ml), gallic acid (at 0.002 mg/ml), p-hydroxybenzoic acid (at 0.002 and 0.004 mg/ml), and protocatechuic acid (at 0.002 and 0.004 mg/ml) could not protect plasmid DNA. PMID:25542528

  17. Aberrant DNA Damage Response Pathways May Predict the Outcome of Platinum Chemotherapy in Ovarian Cancer

    PubMed Central

    Stefanou, Dimitra T.; Bamias, Aristotelis; Episkopou, Hara; Kyrtopoulos, Soterios A.; Likka, Maria; Kalampokas, Theodore; Photiou, Stylianos; Gavalas, Nikos; Sfikakis, Petros P.; Dimopoulos, Meletios A.; Souliotis, Vassilis L.

    2015-01-01

    Ovarian carcinoma (OC) is the most lethal gynecological malignancy. Despite the advances in the treatment of OC with combinatorial regimens, including surgery and platinum-based chemotherapy, patients generally exhibit poor prognosis due to high chemotherapy resistance. Herein, we tested the hypothesis that DNA damage response (DDR) pathways are involved in resistance of OC patients to platinum chemotherapy. Selected DDR signals were evaluated in two human ovarian carcinoma cell lines, one sensitive (A2780) and one resistant (A2780/C30) to platinum treatment as well as in peripheral blood mononuclear cells (PBMCs) from OC patients, sensitive (n = 7) or resistant (n = 4) to subsequent chemotherapy. PBMCs from healthy volunteers (n = 9) were studied in parallel. DNA damage was evaluated by immunofluorescence γH2AX staining and comet assay. Higher levels of intrinsic DNA damage were found in A2780 than in A2780/C30 cells. Moreover, the intrinsic DNA damage levels were significantly higher in OC patients relative to healthy volunteers, as well as in platinum-sensitive patients relative to platinum-resistant ones (all P<0.05). Following carboplatin treatment, A2780 cells showed lower DNA repair efficiency than A2780/C30 cells. Also, following carboplatin treatment of PBMCs ex vivo, the DNA repair efficiency was significantly higher in healthy volunteers than in platinum-resistant patients and lowest in platinum-sensitive ones (t1/2 for loss of γH2AX foci: 2.7±0.5h, 8.8±1.9h and 15.4±3.2h, respectively; using comet assay, t1/2 of platinum-induced damage repair: 4.8±1.4h, 12.9±1.9h and 21.4±2.6h, respectively; all P<0.03). Additionally, the carboplatin-induced apoptosis rate was higher in A2780 than in A2780/C30 cells. In PBMCs, apoptosis rates were inversely correlated with DNA repair efficiencies of these cells, being significantly higher in platinum-sensitive than in platinum-resistant patients and lowest in healthy volunteers (all P<0.05). We conclude that

  18. Anthracyclines Induce DNA Damage Response-Mediated Protection against Severe Sepsis

    PubMed Central

    Figueiredo, Nuno; Chora, Angelo; Raquel, Helena; Pejanovic, Nadja; Pereira, Pedro; Hartleben, Björn; Neves-Costa, Ana; Moita, Catarina; Pedroso, Dora; Pinto, Andreia; Marques, Sofia; Faridi, Hafeez; Costa, Paulo; Gozzelino, Raffaella; Zhao, Jimmy L.; Soares, Miguel P.; Gama-Carvalho, Margarida; Martinez, Jennifer; Zhang, Qingshuo; Döring, Gerd; Grompe, Markus; Simas, J. Pedro; Huber, Tobias B.; Baltimore, David; Gupta, Vineet; Green, Douglas R.; Ferreira, João A.; Moita, Luis F.

    2014-01-01

    Summary Severe sepsis remains a poorly understood systemic inflammatory condition with high mortality rates and limited therapeutic options in addition to organ support measures. Here we show that the clinically approved group of anthracyclines acts therapeutically at a low dose regimen to confer robust protection against severe sepsis in mice. This salutary effect is strictly dependent on the activation of DNA damage response and autophagy pathways in the lung, as demonstrated by deletion of the ataxia telangiectasia mutated (Atm) or the autophagy-related protein 7 (Atg7) specifically in this organ. The protective effect of anthracyclines occurs irrespectively of pathogen burden, conferring disease tolerance to severe sepsis. These findings demonstrate that DNA damage responses, including the ATM and Fancony Anemia pathways, are important modulators of immune responses and might be exploited to confer protection to inflammation-driven conditions, including severe sepsis. PMID:24184056

  19. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    PubMed

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound. PMID:22828439

  20. DNA Base Damage by Reactive Oxygen Species, Oxidizing Agents, and UV Radiation

    PubMed Central

    Cadet, Jean; Wagner, J. Richard

    2013-01-01

    Emphasis has been placed in this article dedicated to DNA damage on recent aspects of the formation and measurement of oxidatively generated damage in cellular DNA in order to provide a comprehensive and updated survey. This includes single pyrimidine and purine base lesions, intrastrand cross-links, purine 5′,8-cyclonucleosides, DNA–protein adducts and interstrand cross-links formed by the reactions of either the nucleobases or the 2-deoxyribose moiety with the hydroxyl radical, one-electron oxidants, singlet oxygen, and hypochlorous acid. In addition, recent information concerning the mechanisms of formation, individual measurement, and repair-rate assessment of bipyrimidine photoproducts in isolated cells and human skin upon exposure to UVB radiation, UVA photons, or solar simulated light is critically reviewed. PMID:23378590

  1. Anthracyclines induce DNA damage response-mediated protection against severe sepsis.

    PubMed

    Figueiredo, Nuno; Chora, Angelo; Raquel, Helena; Pejanovic, Nadja; Pereira, Pedro; Hartleben, Björn; Neves-Costa, Ana; Moita, Catarina; Pedroso, Dora; Pinto, Andreia; Marques, Sofia; Faridi, Hafeez; Costa, Paulo; Gozzelino, Raffaella; Zhao, Jimmy L; Soares, Miguel P; Gama-Carvalho, Margarida; Martinez, Jennifer; Zhang, Qingshuo; Döring, Gerd; Grompe, Markus; Simas, J Pedro; Huber, Tobias B; Baltimore, David; Gupta, Vineet; Green, Douglas R; Ferreira, João A; Moita, Luis F

    2013-11-14

    Severe sepsis remains a poorly understood systemic inflammatory condition with high mortality rates and limited therapeutic options in addition to organ support measures. Here we show that the clinically approved group of anthracyclines acts therapeutically at a low dose regimen to confer robust protection against severe sepsis in mice. This salutary effect is strictly dependent on the activation of DNA damage response and autophagy pathways in the lung, as demonstrated by deletion of the ataxia telangiectasia mutated (Atm) or the autophagy-related protein 7 (Atg7) specifically in this organ. The protective effect of anthracyclines occurs irrespectively of pathogen burden, conferring disease tolerance to severe sepsis. These findings demonstrate that DNA damage responses, including the ATM and Fanconi Anemia pathways, are important modulators of immune responses and might be exploited to confer protection to inflammation-driven conditions, including severe sepsis. PMID:24184056

  2. DNA Damage Response in Neonatal and Adult Stromal Cells Compared With Induced Pluripotent Stem Cells

    PubMed Central

    Liedtke, Stefanie; Biebernick, Sophie; Radke, Teja Falk; Stapelkamp, Daniela; Coenen, Carolin; Zaehres, Holm; Fritz, Gerhard; Kogler, Gesine

    2015-01-01

    Comprehensive analyses comparing individual DNA damage response (DDR) of induced pluripotent stem cells (iPSCs) with neonatal stromal cells with respect to their developmental age are limited. The imperative necessity of providing developmental age-matched cell sources for meaningful toxicological drug safety assessments in replacement of animal-based testing strategies is evident. Here, DDR after radiation or treatment with N-methyl-N-nitrosurea (MNU) was determined in iPSCs compared with neonatal and bone marrow stromal cells. Neonatal and adult stromal cells showed no significant morphologically detectable cytotoxicity following treatment with 1 Gy or 1 mM MNU, whereas iPSCs revealed a much higher sensitivity. Foci analyses revealed an effective DNA repair in stromal cell types and iPSCs, as reflected by a rapid formation and disappearance of phosphorylated ATM and γH2AX foci. Furthermore, quantitative polymerase chain reaction analyses revealed the highest basic expression level of DDR and repair-associated genes in iPSCs, followed by neonatal stromal cells and adult stromal cells with the lowest expression levels. In addition, the influence of genotoxic stress prior to and during osteogenic differentiation of neonatal and adult stromal cells was analyzed applying common differentiation procedures. Experiments presented here suggest a developmental age-dependent basic expression level of genes involved in the processing of DNA damage. In addition a differentiation-dependent downregulation of repair genes was observed during osteogenesis. These results strongly support the requirement to provide adequate cell sources for toxicological in vitro drug testing strategies that match to the developmental age and differentiation status of the presumptive target cell of interest. Significance The results obtained in this study advance the understanding of DNA damage processing in human neonatal stromal cells as compared with adult stromal cells and induced pluripotent

  3. DNA damage response in male gametes of Cyrtanthus mackenii during pollen tube growth

    PubMed Central

    Hirano, Tomonari; Takagi, Keiichi; Hoshino, Yoichiro; Abe, Tomoko

    2013-01-01

    Male gametophytes of plants are exposed to environmental stress and mutagenic agents during the double fertilization process and therefore need to repair the DNA damage in order to transmit the genomic information to the next generation. However, the DNA damage response in male gametes is still unclear. In the present study, we analysed the response to DNA damage in the generative cells of Cyrtanthus mackenii during pollen tube growth. A carbon ion beam, which can induce DNA double-strand breaks (DSBs), was used to irradiate the bicellular pollen, and then the irradiated pollen grains were cultured in a liquid culture medium. The male gametes were isolated from the cultured pollen tubes and used for immunofluorescence analysis. Although inhibitory effects on pollen tube growth were not observed after irradiation, sperm cell formation decreased significantly after high-dose irradiation. After high-dose irradiation, the cell cycle progression of generative cells was arrested at metaphase in pollen mitosis II, and phosphorylated H2AX (γH2AX) foci, an indicator of DSBs, were detected in the majority of the arrested cells. However, these foci were not detected in cells that were past metaphase. Cell cycle progression in irradiated generative cells is regulated by the spindle assembly checkpoint, and modification of the histones surrounding the DSBs was confirmed. These results indicate that during pollen tube growth generative cells can recognize and manage genomic lesions using DNA damage response pathways. In addition, the number of generative cells with γH2AX foci decreased with culture prolongation, suggesting that the DSBs in the generative cells are repaired. PMID:23550213

  4. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  5. The activation of DNA damage detection and repair responses in cleavage-stage rat embryos by a damaged paternal genome.

    PubMed

    Grenier, Lisanne; Robaire, Bernard; Hales, Barbara F

    2012-06-01

    Male germ cell DNA damage, after exposure to radiation, exogenous chemicals, or chemotherapeutic agents, is a major cause of male infertility. DNA-damaged spermatozoa can fertilize oocytes; this is of concern because there is limited information on the capacity of early embryos to repair a damaged male genome or on the fate of these embryos if repair is inadequate. We hypothesized that the early activation of DNA damage response in the early embryo is a critical determinant of its fate. The objective of this study was to assess the DNA damage response and mitochondrial function as a measure of the energy supply for DNA repair and general health in cleavage-stage embryos sired by males chronically exposed to an anticancer alkylating agent, cyclophosphamide. Male rats were treated with saline or cyclophosphamide (6 mg/kg/day) for 4 weeks and mated to naturally cycling females. Pronuclear two- and eight-cell embryos were collected for immunofluorescence analysis of mitochondrial function and biomarkers of the DNA damage response: γH2AX foci, 53BP1 reactivity, and poly(ADP-ribose) polymer formation. Mitochondrial activities did not differ between embryos sired by control- and cyclophosphamide-exposed males. At the two-cell stage, there was no treatment-related increase in DNA double-strand breaks; by the eight-cell stage, a significant increase was noted, as indicated by increased medium and large γH2AX foci. This was accompanied by a dampened DNA repair response, detected as a decrease in the nuclear intensity of poly(ADP-ribose) polymers. The micronuclei formed in cyclophosphamide-sired embryos contained large γH2AX foci and enhanced poly(ADP-ribose) polymer and 53BP1 reactivity compared with their nuclear counterparts. Thus, paternal cyclophosphamide exposure activated a DNA damage response in cleavage-stage embryos. Furthermore, this damage response may be useful in assessing embryo quality and developmental competence. PMID:22454429

  6. Assessment of oxidative DNA damage formation by organic complex mixtures from airborne particles PM(10).

    PubMed

    Gábelová, Alena; Valovicová, Zuzana; Lábaj, Juraj; Bacová, Gabriela; Binková, Blanka; Farmer, Peter B

    2007-07-01

    The free radical generating activity of airborne particulate matter (PM(10)) has been proposed as a primary mechanism in biological activity of ambient air pollution. In an effort to determine the impact of the complex mixtures of extractable organic matter (EOM) from airborne particles on oxidative damage to DNA, the level of 8-oxo-2'-deoxyguanosine (8-oxodG), the most prevalent and stable oxidative lesion, was measured in the human metabolically competent cell line Hep G2. Cultured cells were exposed to equivalent EOM concentrations (5-150microg/ml) and oxidative DNA damage was analyzed using a modified single cell gel electrophoresis (SCGE), which involves the incubation of whole cell DNA with repair specific DNA endonuclease, which cleaves oxidized DNA at the sites of 8-oxodG. EOMs were extracted from PM(10) collected daily (24h intervals) in three European cities: Prague (Czech Republic, two monitoring sites, Libus and Smíchov), Kosice (Slovak Republic) and Sofia (Bulgaria) during 3-month sampling periods in the winter and summer seasons. No substantial time- and dose-dependent increase of oxidative DNA lesions was detected in EOM-treated cells with the exception of the EOM collected at the monitoring site Kosice, summer sampling. In this case, 2h cell exposure to EOM resulted in a slight but significant increase of oxidative DNA damage at three from total of six concentrations. The mean 8-oxodG values at these concentrations ranged from 15.3 to 26.1 per 10(6) nucleotides with a value 3.5 per 10(6) nucleotides in untreated cells. B[a]P, the positive control, induced a variable but insignificant increase of oxidative DNA damage in Hep G2 cell (approximately 1.6-fold increase over control value). Based on these data we believe that EOM samples extracted from airborne particle PM(10) play probably only a marginal role in oxidative stress generation and oxidative lesion formation to DNA. However, adsorbed organic compounds can undergo various interactions

  7. Repair of UV damaged DNA, genes and proteins of yeast and human

    SciTech Connect

    Prakash, L.

    1991-04-01

    Our objectives are to determine the molecular mechanism of the incision step of excision repair of ultraviolet (UV) light damaged DNA in eukaryotic organisms, using the yeast Saccharomyces cerevisiae as a model system, as well as studying the human homologs of yeast excision repair and postreplication repair proteins. In addition to its single-stranded DNA-dependent A TPase and DNA helicase activities, we have found that RAD3 protein also possesses DNA-RNA helicase activity, and that like RAD3, the Schizosaccharomyces pombe RAD3 homolog, rhp3{sup +}, is an essential gene. We have overexpressed the human RAD3 homolog, ERCC2, in yeast to facilitate its purification. The RAD10 protein was purified to homogeneity and shown to bind DNA. ERCC3y, the yeast homolog of the human ERCC-3/XP-B gene, has been sequenced and shown to be essential for viability. The Drosophila and human homologs of RAD6, required for postreplication repair and UV induced mutagenesis, were shown to complement the rad6 {Delta} mutation of yeast. Since defective DNA repair and enhanced neoplasia characterize several human genetic diseases, and repair proteins are highly conserved between yeast and man, a thorough understanding of the molecular mechanisms of DNA repir in yeast should provide a better understanding of the causes of carcinogenesis.

  8. Plasmid DNA damage caused by stibine and trimethylstibine.

    PubMed

    Andrewes, Paul; Kitchin, Kirk T; Wallace, Kathleen

    2004-01-01

    Antimony is classified as "possibly carcinogenic to humans" and there is also sufficient evidence for antimony carcinogenicity in experimental animals. Stibine is a volatile inorganic antimony compound to which humans can be exposed in occupational settings (e.g., lead-acid battery charging). Because it is highly toxic, stibine is considered a significant health risk; however, its genotoxicity has received little attention. For the work reported here, stibine was generated by sodium borohydride reduction of potassium antimony tartrate. Trimethylstibine is a volatile organometallic antimony compound found commonly in landfill and sewage fermentation gases at concentrations ranging between 0.1 and 100 microg/m3. Trimethylstibine is generally considered to pose little environmental or health risk. In the work reported here, trimethylstibine was generated by reduction of trimethylantimony dichloride using either sodium borohydride or the thiol compounds, dithioerythritol (DTE), L-cysteine, and glutathione. Here we report the evaluation of the in vitro genotoxicities of five antimony compounds-potassium antimony tartrate, stibine, potassium hexahydroxyantimonate, trimethylantimony dichloride, and trimethylstibine-using a plasmid DNA-nicking assay. Of these five antimony compounds, only stibine and trimethylstibine were genotoxic (significant nicking to pBR 322 plasmid DNA). We found stibine and trimethylstibine to be about equipotent with trimethylarsine using this plasmid DNA-nicking assay. Reaction of trimethylantimony dichloride with either glutathione or L-cysteine to produce DNA-damaging trimethylstibine was observed with a trimethylantimony dichloride concentration as low as 50 microM and L-cysteine or glutathione concentrations as low as 500 and 200 microM, respectively, for a 24 h incubation. PMID:14728978

  9. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  10. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.

    PubMed

    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  11. Changing the ubiquitin landscape during viral manipulation of the DNA damage response

    PubMed Central

    Weitzman, Matthew D.; Lilley, Caroline E.; Chaurushiya, Mira S.

    2011-01-01

    Viruses often induce signaling through the same cellular cascades that are activated by damage to the cellular genome. Signaling triggered by viral proteins or exogenous DNA delivered by viruses can be beneficial or detrimental to viral infection. Viruses have therefore evolved to dissect the cellular DNA damage response pathway during infection, often marking key cellular regulators with ubiquitin to induce their degradation or change their function. Signaling controlled by ubiquitin or ubiquitin-like proteins has recently emerged as key regulator of the cellular DNA damage response. Situated at the interface between DNA damage signaling and the ubiquitin system, viruses can reveal key convergence points in this important cellular pathway. In this review, we examine how viruses harness the diversity of the cellular ubiquitin system to modulate the DNA damage signaling pathway. We discuss the implications of viral infiltration of this pathway for both the transcriptional program of the virus and for the cellular response to DNA damage. PMID:21549706

  12. Hyperglycemia Differentially Affects Maternal and Fetal DNA Integrity and DNA Damage Response

    PubMed Central

    Moreli, Jusciele B.; Santos, Janine H.; Lorenzon-Ojea, Aline Rodrigues; Corrêa-Silva, Simone; Fortunato, Rodrigo S.; Rocha, Clarissa Ribeiro; Rudge, Marilza V.; Damasceno, Débora C.; Bevilacqua, Estela; Calderon, Iracema M.

    2016-01-01

    Objective: Investigate the DNA damage and its cellular response in blood samples from both mother and the umbilical cord of pregnancies complicated by hyperglycemia. Methods: A total of 144 subjects were divided into 4 groups: normoglycemia (ND; 46 cases), mild gestational hyperglycemia (MGH; 30 cases), gestational diabetes mellitus (GDM; 45 cases) and type-2 diabetes mellitus (DM2; 23 cases). Peripheral blood mononuclear cell (PBMC) isolation and/or leukocytes from whole maternal and umbilical cord blood were obtained from all groups at delivery. Nuclear and mitochondrial DNA damage were measured by gene-specific quantitative PCR, and the expression of mRNA and proteins involved in the base excision repair (BER) pathway were assessed by real-time qPCR and Western blot, respectively. Apoptosis was measured in vitro experiments by caspase 3/7 activity and ATP levels. Results: GDM and DM2 groups were characterized by an increase in oxidative stress biomarkers, an increase in nuclear and mitochondrial DNA damage, and decreased expression of mRNA (APE1, POLβ and FEN1) and proteins (hOGG1, APE1) involved in BER. The levels of hyperglycemia were associated with the in vitro apoptosis pathway. Blood levels of DNA damage in umbilical cord were similar among the groups. Newborns of diabetic mothers had increased expression of BER mRNA (APE1, POLβ and FEN1) and proteins (hOGG1, APE1, POLβ and FEN1). A diabetes-like environment was unable to induce apoptosis in the umbilical cord blood cells. Conclusions: Our data show relevant asymmetry between maternal and fetal blood cell susceptibility to DNA damage and apoptosis induction. Maternal cells seem to be more predisposed to changes in an adverse glucose environment. This may be due to differential ability in upregulating multiple genes involved in the activation of DNA repair response, especially the BER mechanism. However if this study shows a more effective adaptive response by the fetal organism, it also calls for

  13. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression

    PubMed Central

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F.; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-01-01

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker–induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  14. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  15. Ginsenoside-Rg5 induces apoptosis and DNA damage in human cervical cancer cells

    PubMed Central

    LIANG, LI-DAN; HE, TAO; DU, TING-WEI; FAN, YONG-GANG; CHEN, DIAN-SEN; WANG, YAN

    2015-01-01

    Panax ginseng is traditionally used as a remedy for cancer, inflammation, stress and aging, and ginsenoside-Rg5 is a major bioactive constituent of steamed ginseng. The present study aimed to evaluate whether ginsenoside-Rg5 had any marked cytotoxic, apoptotic or DNA-damaging effects in human cervical cancer cells. Five human cervical cancer cell lines (HeLa, MS751, C33A, Me180 and HT-3) were used to investigate the cytotoxicity of ginsenoside-Rg5 using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Additionally, the effects of ginsenoside-Rg5 on the apoptosis of HeLa and MS751 cells were detected using DNA ladder assays and flow cytometry. DNA damage was assessed in the HeLa and MS751 cells using alkaline comet assays and by detection of γH2AX focus formation. The HeLa and MS751 cells were significantly more sensitive to ginsenoside-Rg5 treatment compared with the C-33A, HT-3 and Me180 cells. As expected, ginsenoside-Rg5 induced significant concentration- and time-dependent increases in apoptosis. In addition, ginsenoside-Rg5 induced significant concentration-dependent increases in the level of DNA damage compared with the negative control. Consistent with the comet assay data, the percentage of γH2AX-positive HeLa and MS751 cells also revealed that ginsenoside-Rg5 caused DNA double-strands to break in a concentration-dependent manner. In conclusion, ginsenoside-Rg5 had marked genotoxic effects in the HeLa and MS751 cells and, thus, demonstrates potential as a genotoxic or cytotoxic drug for the treatment of cervical cancer. PMID:25355274

  16. Associations of subjective vitality with DNA damage, cardiovascular risk factors and physical performance

    PubMed Central

    Maynard, S.; Keijzers, G.; Hansen, Å.-M.; Osler, M.; Molbo, D.; Bendix, L.; Møller, P.; Loft, S.; Moreno-Villanueva, M.; Bürkle, A.; Hvitby, C. P.; Schurman, S. H.; Stevnsner, T.; Rasmussen, L. J.; Avlund, K.; Bohr, V. A.

    2015-01-01

    Aim To examine associations of DNA damage, cardiovascular risk factors and physical performance with vitality, in middle-aged men. We also sought to elucidate underlying factors of physical performance by comparing physical performance parameters to DNA damage parameters and cardiovascular risk factors. Methods We studied 2487 participants from the Metropolit cohort of 11 532 men born in 1953 in the Copenhagen Metropolitan area. The vitality level was estimated using the SF-36 vitality scale. Cardiovascular risk factors were determined by body mass index (BMI), and haematological biochemistry tests obtained from non-fasting participants. DNA damage parameters were measured in peripheral blood mononuclear cells (PBMCs) from as many participants as possible from a representative subset of 207 participants. Results Vitality was inversely associated with spontaneous DNA breaks (measured by comet assay) (P = 0.046) and BMI (P = 0.002), and positively associated with all of the physical performance parameters (all P < 0.001). Also, we found several associations between physical performance parameters and cardiovascular risk factors. In addition, the load of short telomeres was inversely associated with maximum jump force (P = 0.018), with lowered significance after exclusion of either arthritis sufferers (P = 0.035) or smokers (P = 0.031). Conclusion Here, we show that self-reported vitality is associated with DNA breaks, BMI and objective (measured) physical performance in a cohort of middle-aged men. Several other associations in this study verify clinical observations in medical practice. In addition, the load of short telomeres may be linked to peak performance in certain musculoskeletal activities. PMID:24703498

  17. 46 CFR 174.205 - Additional damaged stability for OSVs carrying more than 16 offshore workers.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Additional damaged stability for OSVs carrying more than... (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO SPECIFIC VESSEL TYPES Special Rules Pertaining to Offshore Supply Vessels § 174.205 Additional damaged stability for OSVs carrying more than...

  18. 46 CFR 174.205 - Additional damaged stability for OSVs carrying more than 16 offshore workers.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Additional damaged stability for OSVs carrying more than... (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO SPECIFIC VESSEL TYPES Special Rules Pertaining to Offshore Supply Vessels § 174.205 Additional damaged stability for OSVs carrying more than...

  19. DNA Damage Response and DNA Repair in Skeletal Myocytes From a Mouse Model of Spinal Muscular Atrophy.

    PubMed

    Fayzullina, Saniya; Martin, Lee J

    2016-09-01

    We studied DNA damage response (DDR) and DNA repair capacities of skeletal muscle cells from a mouse model of infantile spinal muscular atrophy (SMA) caused by loss-of-function mutation of survival of motor neuron (Smn). Primary myocyte cultures derived from skeletal muscle satellite cells of neonatal control and mutant SMN mice had similar myotube length, myonuclei, satellite cell marker Pax7 and differentiated myotube marker myosin, and acetylcholine receptor clustering. DNA damage was induced in differentiated skeletal myotubes by γ-irradiation, etoposide, and methyl methanesulfonate (MMS). Unexposed control and SMA myotubes had stable genome integrity. After γ-irradiation and etoposide, myotubes repaired most DNA damage equally. Control and mutant myotubes exposed to MMS exhibited equivalent DNA damage without repair. Control and SMA myotube nuclei contained DDR proteins phospho-p53 and phospho-H2AX foci that, with DNA damage, dispersed and then re-formed similarly after recovery. We conclude that mouse primary satellite cell-derived myotubes effectively respond to and repair DNA strand-breaks, while DNA alkylation repair is underrepresented. Morphological differentiation, genome stability, genome sensor, and DNA strand-break repair potential are preserved in mouse SMA myocytes; thus, reduced SMN does not interfere with myocyte differentiation, genome integrity, and DNA repair, and faulty DNA repair is unlikely pathogenic in SMA. PMID:27452406

  20. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  1. DNA damage action spectroscopy and DNA repair in intact organisms: Alfalfa seedlings

    SciTech Connect

    Sutherland, B.M.; Quaite, F.E.; Sutherland, J.C.

    1993-12-31

    Understanding the effects of UV, and increased levels of UV, on DNA in living organisms requires knowledge of both the frequency of damages induced by the quantities and quality (wavelength composition) of the damaging radiation, and of the capacity of the organisms to carry out efficient and accurate repair. The major levels of uncertainty in understanding the responses of intact organisms, both plant and animal, to UV indicates that we cannot assess accurately the impact of stratospheric ozone depletion without major increases in knowledge of DNA damage and repair. What repair paths does alfalfa use for dealing with UV damages? The rate of pyrimidine dimers induced at a low exposure of 280 nm radiation to alfalfa seedlings, was observed to be about 8 dimers/million bases. After UV exposure, the seedlings were kept in the dark or exposed to blue light filtered by a yellow. filter which excluded wavelengths shorter than about 405 nm. Seedlings so exposed carry out photorepair, but do not seem to remove dimers by excision.

  2. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  3. DDRprot: a database of DNA damage response-related proteins

    PubMed Central

    Andrés-León, Eduardo; Cases, Ildefonso; Arcas, Aida; Rojas, Ana M.

    2016-01-01

    The DNA Damage Response (DDR) signalling network is an essential system that protects the genome’s integrity. The DDRprot database presented here is a resource that integrates manually curated information on the human DDR network and its sub-pathways. For each particular DDR protein, we present detailed information about its function. If involved in post-translational modifications (PTMs) with each other, we depict the position of the modified residue/s in the three-dimensional structures, when resolved structures are available for the proteins. All this information is linked to the original publication from where it was obtained. Phylogenetic information is also shown, including time of emergence and conservation across 47 selected species, family trees and sequence alignments of homologues. The DDRprot database can be queried by different criteria: pathways, species, evolutionary age or involvement in (PTM). Sequence searches using hidden Markov models can be also used. Database URL: http://ddr.cbbio.es. PMID:27577567

  4. DDRprot: a database of DNA damage response-related proteins.

    PubMed

    Andrés-León, Eduardo; Cases, Ildefonso; Arcas, Aida; Rojas, Ana M

    2016-01-01

    The DNA Damage Response (DDR) signalling network is an essential system that protects the genome's integrity. The DDRprot database presented here is a resource that integrates manually curated information on the human DDR network and its sub-pathways. For each particular DDR protein, we present detailed information about its function. If involved in post-translational modifications (PTMs) with each other, we depict the position of the modified residue/s in the three-dimensional structures, when resolved structures are available for the proteins. All this information is linked to the original publication from where it was obtained. Phylogenetic information is also shown, including time of emergence and conservation across 47 selected species, family trees and sequence alignments of homologues. The DDRprot database can be queried by different criteria: pathways, species, evolutionary age or involvement in (PTM). Sequence searches using hidden Markov models can be also used.Database URL: http://ddr.cbbio.es. PMID:27577567

  5. Paternal DNA damage resulting from various sperm treatments persists after fertilization and is similar before and after DNA replication.

    PubMed

    Yamauchi, Yasuhiro; Riel, Jonathan M; Ward, Monika A

    2012-01-01

    In spite of its highly condensed state, sperm DNA is vulnerable to damage that can originate from oxidative stress, the activity of sperm-specific nucleases, or both. After fertilization, in the oocyte, paternal chromatin undergoes dramatic changes, and during this extensive remodeling, it can be both repaired and degraded, and these processes can be linked to DNA synthesis. Here, we analyzed sperm response to damage-inducing treatments both before and after fertilization and before or after zygotic DNA replication. Epididymal mouse spermatozoa were either frozen without cryoprotection (FT) or treated with detergent Triton X-100 coupled with dithiothreitol (TX+DTT) to induce DNA damage. Fresh, untreated sperm served as control. Immediately after preparation, spermatozoa from 3 groups were taken for comet assay, or for intracytoplasmic sperm injection into prometaphase I oocytes to visualize prematurely condensed single-chromatid chromosomes, or into mature metaphase II oocytes to visualize chromosomes after DNA replication. Comet assay revealed increased DNA fragmentation in treated sperm when compared with control, with FT sperm more severely affected. Chromosome analysis demonstrated paternal DNA damage in oocytes injected with treated, but not with fresh, sperm, with FT and TX+DTT groups now yielding similar damage. There were no differences in the incidence of abnormal paternal karyoplates before and after DNA synthesis in all examined groups. This study provides evidence that subjecting sperm to DNA damage-inducing treatments results in degradation of highly condensed sperm chromatin when it is still packed within the sperm head, and that this DNA damage persists after fertilization. The difference in DNA damage in sperm subjected to 2 treatments was ameliorated in the fertilized oocytes, suggesting that some chromatin repair might have occurred. This process, however, was independent of DNA synthesis and took place during oocyte maturation. PMID:21546611

  6. Assessment of the role of DNA repair in damaged forensic samples.

    PubMed

    Ambers, Angie; Turnbough, Meredith; Benjamin, Robert; King, Jonathan; Budowle, Bruce

    2014-11-01

    Previous studies on DNA damage and repair have involved in vitro laboratory procedures that induce a single type of lesion in naked templates. Although repair of singular, sequestered types of DNA damage has shown some success, forensic and ancient specimens likely contain a number of different types of lesions. This study sought to (1) develop protocols to damage DNA in its native state, (2) generate a pool of candidate samples for repair that more likely emulate authentic forensic samples, and (3) assess the ability of the PreCR(TM) Repair Mix to repair the resultant lesions. Complexed, native DNA is more difficult to damage than naked DNA. Modified procedures included the use of higher concentrations and longer exposure times. Three types of samples, those that demonstrated damage based on short tandem repeat (STR) profile signals, were selected for repair experiments: environmentally damaged bloodstains, bleach-damaged whole blood, and human skeletal remains. Results showed trends of improved performance of STR profiling of bleach-damaged DNA. However, the repair assay did not improve DNA profiles from environmentally damaged bloodstains or bone, and in some cases resulted in lower RFU values for STR alleles. The extensive spectrum of DNA damage and myriad combinations of lesions that can be present in forensic samples appears to pose a challenge for the in vitro PreCR(TM) assay. The data suggest that the use of PreCR in casework should be considered with caution due to the assay's varied results. PMID:24792635

  7. Low concentrations of isothiocyanates protect mesenchymal stem cells from oxidative injuries, while high concentrations exacerbate DNA damage.

    PubMed

    Zanichelli, Fulvia; Capasso, Stefania; Di Bernardo, Giovanni; Cipollaro, Marilena; Pagnotta, Eleonora; Cartenì, Maria; Casale, Fiorina; Iori, Renato; Giordano, Antonio; Galderisi, Umberto

    2012-09-01

    Isothiocyanates (ITCs) are molecules naturally present in many cruciferous vegetables (broccoli, black radish, daikon radish, and cauliflowers). Several studies suggest that cruciferous vegetable consumption may reduce cancer risk and slow the aging process. To investigate the effect of ITCs on cellular DNA damage, we evaluated the effects of two different ITCs [sulforaphane (SFN) and raphasatin (RPS)] on the biology of human mesenchymal stem cells (MSCs), which, in addition to their ability to differentiate into mesenchymal tissues, contribute to the homeostatic maintenance of many organs. The choice of SFN and RPS relies on two considerations: they are among the most popular cruciferous vegetables in the diet of western and eastern countries, respectively, and their bioactive properties may differ since they possess specific molecular moiety. Our investigation evidenced that MSCs incubated with low doses of SFN and RPS show reduced in vitro oxidative stress. Moreover, these cells are protected from oxidative damages induced by hydrogen peroxide, while no protection was evident following treatment with the UV ray of a double strand DNA damaging drug, such as doxorubicin. High concentrations of both ITCs induced cytotoxic effects in MSC cultures and further increased DNA damage induced by peroxides. In summary, our study suggests that ITCs, at low doses, may contribute to slowing the aging process related to oxidative DNA damage. Moreover, in cancer treatment, low doses of ITCs may be used as an adjuvant to reduce chemotherapy-induced oxidative stress, while high doses may synergize with anticancer drugs to promote cell DNA damage. PMID:22684843

  8. RNF4 interacts with both SUMO and nucleosomes to promote the DNA damage response.

    PubMed

    Groocock, Lynda M; Nie, Minghua; Prudden, John; Moiani, Davide; Wang, Tao; Cheltsov, Anton; Rambo, Robert P; Arvai, Andrew S; Hitomi, Chiharu; Tainer, John A; Luger, Karolin; Perry, J Jefferson P; Lazzerini-Denchi, Eros; Boddy, Michael N

    2014-05-01

    The post-translational modification of DNA repair and checkpoint proteins by ubiquitin and small ubiquitin-like modifier (SUMO) critically orchestrates the DNA damage response (DDR). The ubiquitin ligase RNF4 integrates signaling by SUMO and ubiquitin, through its selective recognition and ubiquitination of SUMO-modified proteins. Here, we define a key new determinant for target discrimination by RNF4, in addition to interaction with SUMO. We identify a nucleosome-targeting motif within the RNF4 RING domain that can bind DNA and thereby enables RNF4 to selectively ubiquitinate nucleosomal histones. Furthermore, RNF4 nucleosome-targeting is crucially required for the repair of TRF2-depleted dysfunctional telomeres by 53BP1-mediated non-homologous end joining. PMID:24714598

  9. Gene polymorphisms and increased DNA damage in morbidly obese women.

    PubMed

    Luperini, B C O; Almeida, D C; Porto, M P; Marcondes, J P C; Prado, R P; Rasera, I; Oliveira, M R M; Salvadori, D M F

    2015-06-01

    Obesity is characterized by increased adipose tissue mass resulting from a chronic imbalance between energy intake and expenditure. Furthermore, there is a clearly defined relationship among fat mass expansion, chronic low-grade systemic inflammation and reactive oxygen species (ROS) generation; leading to ROS-related pathological events. In the past years, genome-wide association studies have generated convincing evidence associating genetic variation at multiple regions of the genome with traits that reflect obesity. Therefore, the present study aimed to evaluate the relationships among the gene polymorphisms ghrelin (GHRL-rs26802), ghrelin receptor (GHSR-rs572169), leptin (LEP-rs7799039), leptin receptor (LEPR-rs1137101) and fat mass and obesity-associated (FTO-rs9939609) and obesity. The relationships among these gene variants and the amount of DNA damage were also investigated. Three hundred Caucasian morbidly obese and 300 eutrophic (controls) women were recruited. In summary, the results demonstrated that the frequencies of the GHRL, GHSR, LEP and LEPR polymorphisms were not different between Brazilian white morbidly obese and eutrophic women. Exceptions were the AA-FTO genotype and allele A, which were significantly more frequent in obese women than in the controls (0.23% vs. 0.10%; 0.46 vs. 0.36, respectively), and the TT-FTO genotype and the T allele, which were less frequent in morbidly obese women (p<0.01). Furthermore, significant differences in the amount of genetic lesions associated with FTO variants were observed only in obese women. In conclusion, this study demonstrated that the analyzed SNPs were not closely associated with morbid obesity, suggesting they are not the major contributors to obesity. Therefore, our data indicated that these gene variants are not good biomarkers for predicting risk susceptibility for obesity, whereas ROS generated by the inflammatory status might be one of the causes of DNA damage in obese women, favoring

  10. Targeted DNA damage at individual telomeres disrupts their integrity and triggers cell death

    PubMed Central

    Sun, Luxi; Tan, Rong; Xu, Jianquan; LaFace, Justin; Gao, Ying; Xiao, Yanchun; Attar, Myriam; Neumann, Carola; Li, Guo-Min; Su, Bing; Liu, Yang; Nakajima, Satoshi; Levine, Arthur S.; Lan, Li

    2015-01-01

    Cellular DNA is organized into chromosomes and capped by a unique nucleoprotein structure, the telomere. Both oxidative stress and telomere shortening/dysfunction cause aging-related degenerative pathologies and increase cancer risk. However, a direct connection between oxidative damage to telomeric DNA, comprising <1% of the genome, and telomere dysfunction has not been established. By fusing the KillerRed chromophore with the telomere repeat binding factor 1, TRF1, we developed a novel approach to generate localized damage to telomere DNA and to monitor the real time damage response at the single telomere level. We found that DNA damage at long telomeres in U2OS cells is not repaired efficiently compared to DNA damage in non-telomeric regions of the same length in heterochromatin. Telomeric DNA damage shortens the average length of telomeres and leads to cell senescence in HeLa cells and cell death in HeLa, U2OS and IMR90 cells, when DNA damage at non-telomeric regions is undetectable. Telomere-specific damage induces chromosomal aberrations, including chromatid telomere loss and telomere associations, distinct from the damage induced by ionizing irradiation. Taken together, our results demonstrate that oxidative damage induces telomere dysfunction and underline the importance of maintaining telomere integrity upon oxidative damage. PMID:26082495

  11. Mitotic entry in the presence of DNA damage is a widespread property of aneuploidy in yeast

    PubMed Central

    Blank, Heidi M.; Sheltzer, Jason M.; Meehl, Colleen M.; Amon, Angelika

    2015-01-01

    Genetic instability is a hallmark of aneuploidy in budding and fission yeast. All aneuploid yeast strains analyzed to date harbor elevated levels of Rad52-GFP foci, a sign of DNA damage. Here we investigate how continuously elevated levels of DNA damage affect aneuploid cells. We show that Rad52-GFP foci form during S phase, consistent with the observation that DNA replication initiation and elongation are impaired in some aneuploid yeast strains. We furthermore find that although DNA damage is low in aneuploid cells, it nevertheless has dramatic consequences. Many aneuploid yeast strains adapt to DNA damage and undergo mitosis despite the presence of unrepaired DNA leading to cell death. Wild-type cells exposed to low levels of DNA damage exhibit a similar phenotype, indicating that adaptation to low levels of unrepaired DNA is a general property of the cell's response to DNA damage. Our results indicate that by causing low levels of DNA damage, whole-chromosome aneuploidies lead to DNA breaks that persist into mitosis. Such breaks provide the substrate for translocations and deletions that are a hallmark of cancer. PMID:25694455

  12. DNA damage by smoke: Protection by turmeric and other inhibitors of ROS

    SciTech Connect

    Srinivas, L.; Shalini, V.K. )

    1991-01-01

    Twigs-dry leaves smoke condensate (TDS), as a source of clastogenic ROS and carcinogenic PAH, was investigated for its in vitro DNA-damaging effect in calf thymus DNA and human peripheral lymphocytes. An aqueous turmeric component--Aq.T--with an established antioxidant activity, was tested as a DNA protectant. TDS induced 13-fold damage to calf thymus DNA as judged by the emergence of a DNA damage specific, fluorescent product (em: 405 nm). Aq.T at 800 ng/microL extended 69% protection to calf thymus DNA and was comparable to the other protectants such as curcumin, BHA, vitamin E, SOD, and CAT. In human peripheral lymphocytes, TDS induced extensive DNA damage in comparison with the tumor promoter TPA, as judged by FADU. Aq.T at 300 ng/microL extended 90% protection to human lymphocyte DNA against TDS-induced damage, and was more effective than the other protectants--DABCO, D-mannitol, sodium benzoate, vitamin E (ROS quenchers), SOD, CAT (antioxidant enzymes), tannic acid, flufenamic acid, BHA, BHT, n-PG, curcumin and quercetin (antioxidants). Aq.T offered 65% protection to human lymphocyte DNA against TPA-induced damage and was comparable to SOD. The above results indicate that TDS induces substantial DNA damage in calf thymus DNA and human lymphocytes and Aq.T is an efficient protectant.

  13. Flow cytometric detection of oxidative DNA damage in fish spermatozoa exposed to cadmium - Short communication.

    PubMed

    Nagy, Szabolcs; Kakasi, Balázs; Bercsényi, Miklós

    2016-03-01

    The aim of the present pilot study was to apply a flow cytometric assay, the so-called OxyDNA test, to determine the level of oxidative DNA damage in fish spermatozoa exposed to different concentrations (0.01-10,000 mg/L) of cadmium. Milt was collected from three randomly selected Prussian carp (Carassius auratus gibelio) males. Oxidative DNA damage was assessed with the OxyDNA kit and using flow cytometry. The ratio of OxyDNA-positive events increased significantly at higher cadmium concentrations. The results indicate that direct contact of fish spermatozoa with cadmium-polluted water initiates genotoxic damage. PMID:26919149

  14. DNA Damage Response in Hematopoietic Stem Cell Ageing.

    PubMed

    Li, Tangliang; Zhou, Zhong-Wei; Ju, Zhenyu; Wang, Zhao-Qi

    2016-06-01

    Maintenance of tissue-specific stem cells is vital for organ homeostasis and organismal longevity. Hematopoietic stem cells (HSCs) are the most primitive cell type in the hematopoietic system. They divide asymmetrically and give rise to daughter cells with HSC identity (self-renewal) and progenitor progenies (differentiation), which further proliferate and differentiate into full hematopoietic lineages. Mammalian ageing process is accompanied with abnormalities in the HSC self-renewal and differentiation. Transcriptional changes and epigenetic modulations have been implicated as the key regulators in HSC ageing process. The DNA damage response (DDR) in the cells involves an orchestrated signaling pathway, consisting of cell cycle regulation, cell death and senescence, transcriptional regulation, as well as chromatin remodeling. Recent studies employing DNA repair-deficient mouse models indicate that DDR could intrinsically and extrinsically regulate HSC maintenance and play important roles in tissue homeostasis of the hematopoietic system. In this review, we summarize the current understanding of how the DDR determines the HSC fates and finally contributes to organismal ageing. PMID:27221660

  15. The ribosomal protein S26 regulates p53 activity in response to DNA damage.

    PubMed

    Cui, D; Li, L; Lou, H; Sun, H; Ngai, S-M; Shao, G; Tang, J

    2014-04-24

    Ribosomal proteins have emerged as novel regulators of the Mdm2-p53 feedback loop, especially in the context of ribosomal stress. RPS26 is a recently identified Diamond-Blackfan Anemia-related ribosomal protein and its role in p53 activation has not been previously explored. In this study we found knockdown of RPS26 induced p53 stabilization and activation via a RPL11-dependent mechanism, resulting in p53-dependent cell growth inhibition. Moreover, RPS26 has the ability to interact with Mdm2 and inhibits Mdm2-mediated p53 ubiquitination that leads to p53 stabilization upon overexpression. Importantly, we discovered that RPS26 knockdown impaired p53's ability to transcriptionally activate its target genes in response to DNA damage, without affecting its stability. Accordingly, the cells lost the ability to induce G2/M cell cycle arrest. We further found that upon RPS26 knockdown, the DNA damage induced recruitment of p53 to the promoters of its target genes and p53 acetylation were both greatly reduced. In addition, RPS26 can interact with p53 independent of Mdm2 and coexist in a complex with p53 and p300. These data establish a role of RPS26 in DNA damage response by directly influencing p53 transcriptional activity, and suggest that RPS26 acts distinctively in different scenarios of p53 activation. Our finding also implicates p53 transcriptional activity control as an important mechanism of p53 regulation by ribosomal proteins. PMID:23728348

  16. Quantitative Proteomic Atlas of Ubiquitination and Acetylation in the DNA Damage Response

    PubMed Central

    Elia, Andrew E.H.; Boardman, Alexander P.; Wang, David C.; Huttlin, Edward L.; Everley, Robert A.; Dephoure, Noah; Zhou, Chunshui; Koren, Itay; Gygi, Steven P.; Elledge, Stephen J.

    2015-01-01

    Summary Execution of the DNA damage response (DDR) relies upon a dynamic array of protein modifications. Using quantitative proteomics, we have globally profiled ubiquitination, acetylation, and phosphorylation in response to ultraviolet and ionizing radiation. To improve acetylation site profiling, we developed the strategy FACET-IP. Our datasets of 33,500 ubiquitination and 16,740 acetylation sites provide valuable insight into DDR remodeling of the proteome. We find that K6- and K33-linked polyubiquitination undergo bulk increases in response to DNA damage, raising the possibility that these linkages are largely dedicated to DDR function. We also show that Cullin Ring Ligases mediate 10% of DNA damage induced ubiquitination events and that EXO1 is an SCF-Cyclin F substrate in the response to UV radiation. Our extensive datasets uncover additional regulated sites on known DDR players such as PCNA and identify previously unknown DDR targets such as CENPs, underscoring the broad impact of the DDR on cellular physiology. PMID:26051181

  17. DNA damage protective effect of honey-sweetened cashew apple nectar in Drosophila melanogaster.

    PubMed

    Silva, Robson Alves da; Dihl, Rafael Rodrigues; Dias, Lucas Pinheiro; Costa, Maiane Papke; Abreu, Bianca Regina Ribas de; Cunha, Kênya Silva; Lehmann, Mauricio

    2016-01-01

    Fruits and derivatives, such as juices, are complex mixtures of chemicals, some of which may have mutagenic and/or carcinogenic potential, while others may have antimutagenic and/or anticancer activities. The modulating effects of honey-sweetened cashew apple nectar (HSCAN), on somatic mutation and recombination induced by ethyl methanesulfonate (EMS) and mitomycin C (MMC) were evaluated with the wing spot test in Drosophila melanogaster using co- and post-treatment protocols. Additionally, the antimutagenic activity of two HSCAN components, cashew apple pulp and honey, in MMC-induced DNA damage was also investigated. HSCAN reduced the mutagenic activity of both EMS and MMC in the co-treatment protocol, but had a co-mutagenic effect when post-administered. Similar results were also observed with honey on MMC mutagenic activity. Cashew apple pulp was effective in exerting protective or enhancing effects on the MMC mutagenicity, depending on the administration protocol and concentration used. Overall, these results indicate that HSCAN, cashew apple and honey seem capable of modulating not only the events that precede the induced DNA damages, but also the Drosophila DNA repair processes involved in the correction of EMS and MMC-induced damages. PMID:27560988

  18. DNA damage protective effect of honey-sweetened cashew apple nectar in Drosophila melanogaster.

    PubMed

    Silva, Robson Alves da; Dihl, Rafael Rodrigues; Dias, Lucas Pinheiro; Costa, Maiane Papke; Abreu, Bianca Regina Ribas de; Cunha, Kênya Silva; Lehmann, Mauricio

    2016-07-25

    Fruits and derivatives, such as juices, are complex mixtures of chemicals, some of which may have mutagenic and/or carcinogenic potential, while others may have antimutagenic and/or anticancer activities. The modulating effects of honey-sweetened cashew apple nectar (HSCAN), on somatic mutation and recombination induced by ethyl methanesulfonate (EMS) and mitomycin C (MMC) were evaluated with the wing spot test in Drosophila melanogaster using co- and post-treatment protocols. Additionally, the antimutagenic activity of two HSCAN components, cashew apple pulp and honey, in MMC-induced DNA damage was also investigated. HSCAN reduced the mutagenic activity of both EMS and MMC in the co-treatment protocol, but had a co-mutagenic effect when post-administered. Similar results were also observed with honey on MMC mutagenic activity. Cashew apple pulp was effective in exerting protective or enhancing effects on the MMC mutagenicity, depending on the administration protocol and concentration used. Overall, these results indicate that HSCAN, cashew apple and honey seem capable of modulating not only the events that precede the induced DNA damages, but also the Drosophila DNA repair processes involved in the correction of EMS and MMC-induced damages. PMID:27459259

  19. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage.

    PubMed

    Ciamporcero, E; Shen, H; Ramakrishnan, S; Yu Ku, S; Chintala, S; Shen, L; Adelaiye, R; Miles, K M; Ullio, C; Pizzimenti, S; Daga, M; Azabdaftari, G; Attwood, K; Johnson, C; Zhang, J; Barrera, G; Pili, R

    2016-03-24

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knockdown sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  20. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage

    PubMed Central

    Ciamporcero, Eric; Shen, He; Ramakrishnan, Swathi; Ku, Sheng Yu; Chintala, Sreenivasulu; Shen, Li; Adelaiye, Remi; Miles, Kiersten Marie; Ullio, Chiara; Pizzimenti, Stefania; Daga, Martina; Azabdaftari, Gissou; Attwood, Kris; Johnson, Candace; Zhang, Jianmin; Barrera, Giuseppina; Pili, Roberto

    2015-01-01

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knock-down sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  1. DNA damage protective effect of honey-sweetened cashew apple nectar in Drosophila melanogaster

    PubMed Central

    da Silva, Robson Alves; Dihl, Rafael Rodrigues; Dias, Lucas Pinheiro; Costa, Maiane Papke; de Abreu, Bianca Regina Ribas; Cunha, Kênya Silva; Lehmann, Mauricio

    2016-01-01

    Abstract Fruits and derivatives, such as juices, are complex mixtures of chemicals, some of which may have mutagenic and/or carcinogenic potential, while others may have antimutagenic and/or anticancer activities. The modulating effects of honey-sweetened cashew apple nectar (HSCAN), on somatic mutation and recombination induced by ethyl methanesulfonate (EMS) and mitomycin C (MMC) were evaluated with the wing spot test in Drosophila melanogaster using co- and post-treatment protocols. Additionally, the antimutagenic activity of two HSCAN components, cashew apple pulp and honey, in MMC-induced DNA damage was also investigated. HSCAN reduced the mutagenic activity of both EMS and MMC in the co-treatment protocol, but had a co-mutagenic effect when post-administered. Similar results were also observed with honey on MMC mutagenic activity. Cashew apple pulp was effective in exerting protective or enhancing effects on the MMC mutagenicity, depending on the administration protocol and concentration used. Overall, these results indicate that HSCAN, cashew apple and honey seem capable of modulating not only the events that precede the induced DNA damages, but also the Drosophila DNA repair processes involved in the correction of EMS and MMC-induced damages. PMID:27560988

  2. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes

    PubMed Central

    2011-01-01

    Background Clarifying the physicochemical properties of nanomaterials is crucial for hazard assessment and the safe application of these substances. With this in mind, we analyzed the relationship between particle size and the in vitro effect of amorphous nanosilica (nSP). Specifically, we evaluated the relationship between particle size of nSP and the in vitro biological effects using human keratinocyte cells (HaCaT). Results Our results indicate that exposure to nSP of 70 nm diameter (nSP70) induced an elevated level of reactive oxygen species (ROS), leading to DNA damage. A markedly reduced response was observed using submicron-sized silica particles of 300 and 1000 nm diameter. In addition, cytochalasin D-treatment reduced nSP70-mediated ROS generation and DNA damage, suggesting that endocytosis is involved in nSP70-mediated cellular effects. Conclusions Thus, particle size affects amorphous silica-induced ROS generation and DNA damage of HaCaT cells. We believe clarification of the endocytosis pathway of nSP will provide useful information for hazard assessment as well as the design of safer forms of nSPs. PMID:21235812

  3. GENETIC AND MOLECULAR ANALYSIS OF DNA DAMAGE REPAIR AND TOLERANCE PATHWAYS.

    SciTech Connect

    SUTHERLAND, B.M.

    2001-07-26

    Radiation can damage cellular components, including DNA. Organisms have developed a panoply of means of dealing with DNA damage. Some repair paths have rather narrow substrate specificity (e.g. photolyases), which act on specific pyrimidine photoproducts in a specific type (e.g., DNA) and conformation (double-stranded B conformation) of nucleic acid. Others, for example, nucleotide excision repair, deal with larger classes of damages, in this case bulky adducts in DNA. A detailed discussion of DNA repair mechanisms is beyond the scope of this article, but one can be found in the excellent book of Friedberg et al. [1] for further detail. However, some DNA damages and paths for repair of those damages important for photobiology will be outlined below as a basis for the specific examples of genetic and molecular analysis that will be presented below.

  4. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.

    2015-01-01

    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  5. Oxidative DNA damage and cellular sensitivity to oxidative stress in human autoimmune diseases.

    PubMed Central

    Bashir, S; Harris, G; Denman, M A; Blake, D R; Winyard, P G

    1993-01-01

    OBJECTIVES--To estimate the extent of genomic DNA damage and killing of lymphocytes by reactive oxygen intermediates in autoimmune diseases. METHODS--8-Oxo-7-hydrodeoxyguanosine (8-oxodG), a promutagenic DNA lesion induced by reactive oxygen intermediates, was measured by high performance liquid chromatography, coupled with electrochemical detection, in hydrolysates of DNA which had been extracted from lymphocyte and polymorphonuclear leucocyte fractions of human blood. In addition, human primary blood lymphocytes stimulated by concanavalin A were assayed for cytotoxicity induced by hydrogen peroxide on day 0, by assessing cell proliferation during seven days of culture. RESULTS--Constitutive 8-oxodG was detectable (mean (2 SEM) moles 8-oxodG/10(6) moles deoxyguanosine) in DNA isolated from normal human blood lymphocytes (68 (8), n = 26) and polymorphonuclear leucocytes (118 (24), n = 24). Lymphocyte DNA from donors with the following inflammatory autoimmune diseases contained significantly higher levels of 8-oxodG than that from healthy donors: rheumatoid arthritis (98 (16)), systemic lupus erythematosus (137 (28)), vasculitis (100 (32)), and Behçet's disease (92 (19)). Lymphocyte 8-oxodG levels in non-autoimmune controls and patients with scleroderma were not significantly different from those of healthy controls. The levels of 8-oxodG were significantly higher in the DNA from normal polymorphonuclear leucocytes than in paired DNA samples from normal lymphocytes, but there were no differences between levels of 8-oxodG in polymorphonuclear leucocytes from normal subjects and the patients studied. Levels of 8-oxodG did not correlate with disease duration, disease severity, or age. Lymphocytes from patients with systemic lupus erythematosus and rheumatoid arthritis, but not those with scleroderma, also showed cellular hypersensitivity to the toxic effects of hydrogen peroxide. CONCLUSION--There was increased genomic DNA damage, and increased susceptibility to

  6. HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism.

    PubMed

    Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

    2016-01-01

    Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

  7. HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism

    PubMed Central

    Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

    2016-01-01

    Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

  8. Developmental stage- and DNA damage-specific functions of C. elegans FANCD2

    SciTech Connect

    Lee, Kyong Yun; Yang, Insil; Park, Jung-Eun; Baek, Ok-Ryun; Chung, Kee Yang; Koo, Hyeon-Sook . E-mail: kooh@yonsei.ac.kr

    2007-01-12

    In this study, we set out to investigate the role of Fanconi anemia complementation group D2 protein (FANCD2) in developmental stage-specific DNA damage responses in Caenorhabditis elegans. A mutant C. elegans strain containing a deletion in the gene encoding the FANCD2 homolog, FCD-2, exhibited egg-laying defects, precocious oogenesis, and partial defects in fertilization. The mutant strain also had a lower hatching rate than the wild-type after {gamma}-irradiation of embryos, but not after the irradiation of pachytene stage germ cells. This mutation sensitized pachytene stage germ cells to the genotoxic effects of photoactivated psoralen, as seen by a greatly reduced hatching rate and increased chromosomal aberrations. This mutation also enhanced physiological M-phase arrest and apoptosis. Taken together, our data reveal that the C. elegans FANCD2 homolog participates in the repair of spontaneous DNA damage and DNA crosslinks, not only in proliferating cells but also in pachytene stage cells, and it may have an additional role in double-stranded DNA break repair during embryogenesis.

  9. Modulation of ATR-mediated DNA damage checkpoint response by cryptochrome 1

    PubMed Central

    Kang, Tae-Hong; Leem, Sun-Hee

    2014-01-01

    Mammalian cryptochromes (Crys) are essential circadian clock factors implicated in diverse clock-independent physiological functions, including DNA damage responses. Here we show that Cry1 modulates the ATR-mediated DNA damage checkpoint (DDC) response by interacting with Timeless (Tim) in a time-of-day-dependent manner. The DDC capacity in response to UV irradiation showed a circadian rhythm. Interestingly, clock-deficient Cry1 and Cry2 double knockout (CryDKO) cells retained substantial DDC capacity compared with clock-proficient wild-type cells, although the Cry1-modulated oscillation of the DDC capacity was abolished in CryDKO cells. We found temporal interaction of Cry1 and Tim in the nucleus. When Cry1 was expressed in the nucleus, it was critical for circadian ATR activity. We regenerated rhythmic DDC responses by ectopically expressing Cry1 in CryDKO cells. In addition, we also investigated the DDC capacity in the liver of mice that were intraperitoneally injected with cisplatin at different circadian times (CT). When mice were injected at CT20, about 2-fold higher expression of phosphorylated minichromosome maintenance protein 2 (p-MCM2) was detected compared with mice injected at CT08, which consequently affected the removal rate of cisplatin-DNA adducts from genomic DNA. Taken together, our data demonstrate the intimate interaction between the circadian clock and the DDC system during genotoxic stress in clock-ticking cells. PMID:24489120

  10. DNA damage in an animal model of maple syrup urine disease.

    PubMed

    Scaini, Giselli; Jeremias, Isabela C; Morais, Meline O S; Borges, Gabriela D; Munhoz, Bruna P; Leffa, Daniela D; Andrade, Vanessa M; Schuck, Patrícia F; Ferreira, Gustavo C; Streck, Emilio L

    2012-06-01

    Maple syrup urine disease is an inborn error of metabolism caused by a severe deficiency of the branched chain alpha-ketoacid dehydrogenase complex. Neurological dysfunction is a common finding in patients with maple syrup urine disease. However, the mechanisms underlying the neuropathology of brain damage in this disorder are poorly understood. In this study, we investigated whether acute or chronic administration of a branched chain amino acid pool (leucine, isoleucine and valine) causes transient DNA damage, as determined by the alkaline comet assay, in the brain and blood of rats during development and whether antioxidant treatment prevented the alterations induced by branched chain amino acids. Our results showed that the acute administration of branched chain amino acids increased the DNA damage frequency and damage index in the hippocampus. However, the chronic administration of branched chain amino acids increased the DNA damage frequency and damage index in both the hippocampus and the striatum, and the antioxidant treatment was able to prevent DNA damage in the hippocampus and striatum. The present study demonstrated that metabolite accumulation in MSUD induces DNA damage in the hippocampus and striatum and that it may be implicated in the neuropathology observed in the affected patients. We demonstrated that the effect of antioxidant treatment (N-acetylcysteine plus deferoxamine) prevented DNA damage, suggesting the involvement of oxidative stress in DNA damage. PMID:22560665

  11. p19Arf is required for the cellular response to chronic DNA damage

    PubMed Central

    Bieging-Rolett, Kathryn T.; Johnson, Thomas M.; Brady, Colleen A.; Beaudry, Veronica G.; Pathak, Navneeta; Han, Shuo; Attardi, Laura D.

    2015-01-01

    The p53 tumor suppressor is a stress sensor, driving cell-cycle arrest or apoptosis in response to DNA damage or oncogenic signals. p53 activation by oncogenic signals relies on the p19Arf tumor suppressor, while p53 activation downstream of acute DNA damage is reported to be p19Arf-independent. Accordingly, p19Arf-deficient mouse embryo fibroblasts (MEFs) arrest in response to acute DNA damage. However, p19Arf is required for replicative senescence, a condition associated with an activated DNA damage response, as p19Arf−/− MEFs do not senesce after serial passage. A possible explanation for these seemingly disparate roles for p19Arf is that acute and chronic DNA damage responses are mechanistically distinct. Replicative senescence may result from chronic, low-dose DNA damage responses in which p19Arf has a specific role. We therefore examined the role of p19Arf in cellular responses to chronic, low-dose DNA damaging agent treatment by maintaining MEFs in low oxygen and administering 0.5 Gy γ-irradiation daily or 150μM hydroxyurea, a replication stress-inducer. In contrast to their response to acute DNA damage, p19Arf−/− MEFs exposed to chronic DNA damage do not senesce, revealing a selective role for p19Arf in senescence upon low-level, chronic DNA damage. We show further that p53 pathway activation in p19Arf−/− MEFs exposed to chronic DNA damage is attenuated relative to wild-type MEFs, suggesting a role for p19Arf in fine-tuning p53 activity. However, combined Nutlin3a and chronic DNA damaging agent treatment is insufficient to promote senescence in p19Arf−/− MEFs, suggesting that the role of p19Arf in the chronic DNA damage response may be partially p53-independent. These data suggest the importance of p19Arf for the cellular response to the low-level DNA damage incurred in culture or upon oncogene expression, providing new insight into how p19Arf serves as a tumor suppressor. Moreover, our study helps reconcile reports suggesting crucial

  12. p19(Arf) is required for the cellular response to chronic DNA damage.

    PubMed

    Bieging-Rolett, K T; Johnson, T M; Brady, C A; Beaudry, V G; Pathak, N; Han, S; Attardi, L D

    2016-08-18

    The p53 tumor suppressor is a stress sensor, driving cell cycle arrest or apoptosis in response to DNA damage or oncogenic signals. p53 activation by oncogenic signals relies on the p19(Arf) tumor suppressor, while p53 activation downstream of acute DNA damage is reported to be p19(Arf)-independent. Accordingly, p19(Arf)-deficient mouse embryo fibroblasts (MEFs) arrest in response to acute DNA damage. However, p19(Arf) is required for replicative senescence, a condition associated with an activated DNA damage response, as p19(Arf)-/- MEFs do not senesce after serial passage. A possible explanation for these seemingly disparate roles for p19(Arf) is that acute and chronic DNA damage responses are mechanistically distinct. Replicative senescence may result from chronic, low-dose DNA damage responses in which p19(Arf) has a specific role. We therefore examined the role of p19(Arf) in cellular responses to chronic, low-dose DNA-damaging agent treatment by maintaining MEFs in low oxygen and administering 0.5 G y γ-irradiation daily or 150 μM hydroxyurea, a replication stress inducer. In contrast to their response to acute DNA damage, p19(Arf)-/- MEFs exposed to chronic DNA damage do not senesce, revealing a selective role for p19(Arf) in senescence upon low-level, chronic DNA damage. We show further that p53 pathway activation in p19(Arf)-/- MEFs exposed to chronic DNA damage is attenuated relative to wild-type MEFs, suggesting a role for p19(Arf) in fine-tuning p53 activity. However, combined Nutlin3a and chronic DNA-damaging agent treatment is insufficient to promote senescence in p19(Arf)-/- MEFs, suggesting that the role of p19(Arf) in the chronic DNA damage response may be partially p53-independent. These data suggest the importance of p19(Arf) for the cellular response to the low-level DNA damage incurred in culture or upon oncogene expression, providing new insight into how p19(Arf) serves as a tumor suppressor. Moreover, our study helps reconcile reports

  13. SPATA12 and Its Possible Role in DNA Damage Induced by Ultraviolet-C

    PubMed Central

    Lin, Yiting; Rong, Zhuoxian; Liu, Xiaowen; Li, Dan

    2013-01-01

    Our previous studies indicated that SPATA12, a novel spermatogenesis-associated gene, might be an inhibitor involved in spermatogenesis and tumorigenesis. To obtain a better understanding of the functions of SPATA12, a yeast two-hybrid screening system was used to search for interacting proteins, and chromodomain helicase DNA binding protein 2 (CHD2) was successfully identified. Bimolecular fluorescence complementation (BiFC) and subcellular co-localization assays further suggested a possible interaction between SPATA12 and CHD2 in the nuclei. CHD2 is known to be involved in the later stage of the DNA damage response pathway by influencing the transcriptional activity of p53. Thus, our hypothesis is that SPATA12 might play a role in DNA damage signaling. Western blotting results showed that SPATA12 expression could be induced in ultraviolet-C (UV-C) irradiated cells. Through reporter gene assays and the activator protein-1 (AP-1) decoy oligodeoxynucleotide method, we demonstrated that SPATA12 promoter activity could be up-regulated in response to UV-C radiation exposure and an AP-1 binding site in the SPATA12 promoter may have a role in transcriptional regulation of SPATA12. Using colony formation and host cell reactivation assays, it was demonstrated that SPATA12 might lead to inhibition of cellular proliferation in UV-C-irradiated DNA damage. Furthermore, SPATA12 was transfected into H1299, MCF-7 and HeLa cells, and flow cytometry (FCM) results suggested that there are some biological association between SPATA12 and p53 in UV-C-irradiated DNA damage. In addition, we investigated whether SPATA12 could up-regulate the expression of p53. Taken together, these findings indicate that SPATA12 could be induced under UV-C stress. During DNA damage process, AP-1 involves in the transcriptional up-regulation of SPATA12 in response to UV-C radiation and p53 involves in growth inhibitory effects of SPATA12 on UV-C irradiated cells. PMID:24205157

  14. The DNA Damage Response: Making it safe to play with knives

    PubMed Central

    Ciccia, Alberto; Elledge, Stephen J.

    2010-01-01

    Damage to our genetic material is an ongoing threat to both our ability to faithfully transmit genetic information to our offspring as well as our own survival. To respond to these threats, eukaryotes have evolved the DNA Damage Response (DDR). The DDR is a complex signal transduction pathway that has the ability to sense DNA damage and transduce this information to the cell to influence cellular responses to DNA damage. Cells possess an arsenal of enzymatic tools capable of remodeling and repairing DNA, however, their activities must be tightly regulated in a temporal, spatial and DNA lesion-appropriate fashion to optimize repair and prevent unnecessary and potentially deleterious alterations in the structure of DNA during normal cellular processes. This review will focus on how the DDR controls DNA repair and the phenotypic consequences of defects in these critical regulatory functions in mammals. PMID:20965415

  15. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  16. Combined metformin and resveratrol confers protection against UVC-induced DNA damage in A549 lung cancer cells via modulation of cell cycle checkpoints and DNA repair.

    PubMed

    Lee, Yong-Syu; Doonan, Barbara B; Wu, Joseph M; Hsieh, Tze-Chen

    2016-06-01

    Aging in humans is a multi-factorial cellular process that is associated with an increase in the risk of numerous diseases including diabetes, coronary heart disease and cancer. Aging is linked to DNA damage, and a persistent source of DNA damage is exposure to ultraviolet (UV) radiation. As such, identifying agents that confer protection against DNA damage is an approach that could reduce the public health burden of age-related disorders. Metformin and resveratrol have both shown effectiveness in preventing several age-related diseases; using human A549 cells, we investigated whether metformin or resveratrol, alone or combined, prevent UVC-induced DNA damage. We found that metformin inhibited UVC-induced upregulation of p53, as well as downregulated the expression of two DNA damage markers: γH2AX and p-chk2. Metformin also upregulated DNA repair as evidenced by the increase in expression of p53R2. Treatment with metformin also induced cell cycle arrest in UVC-induced cells, in correlation with a reduction in the levels of cyclin E/cdk2/Rb and cyclin B1/cdk1. Compared to metformin, resveratrol as a single agent showed less effectiveness in counteracting UVC-elicited cellular responses. However, resveratrol displayed synergism when combined with metformin as shown by the downregulation of p53/γH2AX/p-chk2. In conclusion, the results of the present study validate the effectiveness of metformin, alone or with the addition of resveratrol, in reducing the risk of aging by conferring protection against UV-induced DNA damage. PMID:27109601

  17. Quantification of damage in DNA recovered from highly degraded samples – a case study on DNA in faeces

    PubMed Central

    Deagle, Bruce E; Eveson, J Paige; Jarman, Simon N

    2006-01-01

    Background Poorly preserved biological tissues have become an important source of DNA for a wide range of zoological studies. Measuring the quality of DNA obtained from these samples is often desired; however, there are no widely used techniques available for quantifying damage in highly degraded DNA samples. We present a general method that can be used to determine the frequency of polymerase blocking DNA damage in specific gene-regions in such samples. The approach uses quantitative PCR to measure the amount of DNA present at several fragment sizes within a sample. According to a model of random degradation the amount of available template will decline exponentially with increasing fragment size in damaged samples, and the frequency of DNA damage (λ) can be estimated by determining the rate of decline. Results The method is illustrated through the analysis of DNA extracted from sea lion faecal samples. Faeces contain a complex mixture of DNA from several sources and different components are expected to be differentially degraded. We estimated the frequency of DNA damage in both predator and prey DNA within individual faecal samples. The distribution of fragment lengths for each target fit well with the assumption of a random degradation process and, in keeping with our expectations, the estimated frequency of damage was always less in predator DNA than in prey DNA within the same sample (mean λpredator = 0.0106 per nucleotide; mean λprey = 0.0176 per nucleotide). This study is the first to explicitly define the amount of template damage in any DNA extracted from faeces and the first to quantify the amount of predator and prey DNA present within individual faecal samples. Conclusion We present an approach for characterizing mixed, highly degraded PCR templates such as those often encountered in ecological studies using non-invasive samples as a source of DNA, wildlife forensics investigations and ancient DNA research. This method will allow researchers to

  18. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.

    PubMed

    Ganesan, Shanthi; Keating, Aileen F

    2016-02-01

    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  19. Analogs of the novel phytohormone, strigolactone, trigger apoptosis and synergize with PARP inhibitors by inducing DNA damage and inhibiting DNA repair

    PubMed Central

    Ryan, Colin P.; Wang, Victor S.; Lapier, Jennifer; Schlarbaum, Jamie P.; Dayani, Yaron; Artuso, Emma; Prandi, Cristina; Koltai, Hinanit; Agama, Keli; Pommier, Yves; Chen, Yu; Tricoli, Lucas; LaRocque, Jeannine R.; Albanese, Christopher; Yarden, Ronit I.

    2016-01-01

    Strigolactones are a novel class of plant hormones produced in roots that regulate shoot and root development. We previously reported that strigolactone analogs (SLs) induce G2/M cell cycle arrest and apoptosis in a variety of human cancer cells and inhibit tumor growth of human breast cancer xenografts in mice. SLs had no significant influences on non-transformed cells. Here we report for the first time that SLs induce DNA damage in the form of DNA double-strand breaks (DSBs) and activate the DNA damage response signaling by inducing phosphorylation of ATM, ATR and DNA-PKcs and co-localization of the DNA damage signaling protein, 53BP1, with γH2AX nuclear foci. We further report that in addition to DSBs induction, SLs simultaneously impair DSBs repair, mostly homology-directed repair (HDR) and to a lesser extent non-homologous end joining (NHEJ). In response to SLs, RAD51, the homologous DSB repair protein, is ubiquitinated and targeted for proteasomal degradation and it fails to co-localize with γH2AX foci. Interestingly, SLs synergize with DNA damaging agents-based therapeutics. The combination of PARP inhibitors and SLs showed an especially potent synergy, but only in BRCA1-proficient cells. No synergy was observed between SLs and PARP inhibitors in BRCA1-deficient cells, supporting a role for SLs in HDR impairment. Together, our data suggest that SLs increase genome instability and cell death by a unique mechanism of inducing DNA damage and inhibiting DNA repair. PMID:26910887

  20. Analogs of the novel phytohormone, strigolactone, trigger apoptosis and synergize with PARP inhibitors by inducing DNA damage and inhibiting DNA repair.

    PubMed

    Croglio, Michael P; Haake, Jefferson M; Ryan, Colin P; Wang, Victor S; Lapier, Jennifer; Schlarbaum, Jamie P; Dayani, Yaron; Artuso, Emma; Prandi, Cristina; Koltai, Hinanit; Agama, Keli; Pommier, Yves; Chen, Yu; Tricoli, Lucas; LaRocque, Jeannine R; Albanese, Christopher; Yarden, Ronit I

    2016-03-22

    Strigolactones are a novel class of plant hormones produced in roots that regulate shoot and root development. We previously reported that strigolactone analogs (SLs) induce G2/M cell cycle arrest and apoptosis in a variety of human cancer cells and inhibit tumor growth of human breast cancer xenografts in mice. SLs had no significant influences on non-transformed cells. Here we report for the first time that SLs induce DNA damage in the form of DNA double-strand breaks (DSBs) and activate the DNA damage response signaling by inducing phosphorylation of ATM, ATR and DNA-PKcs and co-localization of the DNA damage signaling protein, 53BP1, with γH2AX nuclear foci. We further report that in addition to DSBs induction, SLs simultaneously impair DSBs repair, mostly homology-directed repair (HDR) and to a lesser extent non-homologous end joining (NHEJ). In response to SLs, RAD51, the homologous DSB repair protein, is ubiquitinated and targeted for proteasomal degradation and it fails to co-localize with γH2AX foci. Interestingly, SLs synergize with DNA damaging agents-based therapeutics. The combination of PARP inhibitors and SLs showed an especially potent synergy, but only in BRCA1-proficient cells. No synergy was observed between SLs and PARP inhibitors in BRCA1-deficient cells, supporting a role for SLs in HDR impairment. Together, our data suggest that SLs increase genome instability and cell death by a unique mechanism of inducing DNA damage and inhibiting DNA repair. PMID:26910887

  1. Identification of S-phase DNA damage-response targets in fission yeast reveals conservation of damage-response networks.

    PubMed

    Willis, Nicholas A; Zhou, Chunshui; Elia, Andrew E H; Murray, Johanne M; Carr, Antony M; Elledge, Stephen J; Rhind, Nicholas

    2016-06-28

    The cellular response to DNA damage during S-phase regulates a complicated network of processes, including cell-cycle progression, gene expression, DNA replication kinetics, and DNA repair. In fission yeast, this S-phase DNA damage response (DDR) is coordinated by two protein kinases: Rad3, the ortholog of mammalian ATR, and Cds1, the ortholog of mammalian Chk2. Although several critical downstream targets of Rad3 and Cds1 have been identified, most of their presumed targets are unknown, including the targets responsible for regulating replication kinetics and coordinating replication and repair. To characterize targets of the S-phase DDR, we identified proteins phosphorylated in response to methyl methanesulfonate (MMS)-induced S-phase DNA damage in wild-type, rad3∆, and cds1∆ cells by proteome-wide mass spectrometry. We found a broad range of S-phase-specific DDR targets involved in gene expression, stress response, regulation of mitosis and cytokinesis, and DNA replication and repair. These targets are highly enriched for proteins required for viability in response to MMS, indicating their biological significance. Furthermore, the regulation of these proteins is similar in fission and budding yeast, across 300 My of evolution, demonstrating a deep conservation of S-phase DDR targets and suggesting that these targets may be critical for maintaining genome stability in response to S-phase DNA damage across eukaryotes. PMID:27298342

  2. The FHA domain determines Drosophila Chk2/Mnk localization to key mitotic structures and is essential for early embryonic DNA damage responses.

    PubMed

    Takada, Saeko; Collins, Eric R; Kurahashi, Kayo

    2015-05-15

    DNA damage responses, including mitotic centrosome inactivation, cell-cycle delay in mitosis, and nuclear dropping from embryo cortex, maintain genome integrity in syncytial Drosophila embryos. A conserved signaling kinase, Chk2, known as Mnk/Loki, is essential for the responses. Here we demonstrate that functional EGFP-Mnk expressed from a transgene localizes to the nucleus, centrosomes, interkinetochore/centromere region, midbody, and pseudocleavage furrows without DNA damage and in addition forms numerous foci/aggregates on mitotic chromosomes upon DNA damage. We expressed EGFP-tagged Mnk deletion or point mutation variants and investigated domain functions of Mnk in vivo. A triple mutation in the phosphopeptide-binding site of the forkhead-associated (FHA) domain disrupted normal Mnk localization except to the nucleus. The mutation also disrupted Mnk foci formation on chromosomes upon DNA damage. FHA mutations and deletion of the SQ/TQ-cluster domain (SCD) abolished Mnk transphosphorylations and autophosphorylations, indicative of kinase activation after DNA damage. A potent NLS was found at the C-terminus, which is required for normal Mnk function. We propose that the FHA domain in Mnk plays essential dual functions in mediating embryonic DNA damage responses by means of its phosphopeptide-binding ability: activating Mnk in the nucleus upon DNA damage and recruiting Mnk to multiple subcellular structures independently of DNA damage. PMID:25808488

  3. The FHA domain determines Drosophila Chk2/Mnk localization to key mitotic structures and is essential for early embryonic DNA damage responses

    PubMed Central

    Takada, Saeko; Collins, Eric R.; Kurahashi, Kayo

    2015-01-01

    DNA damage responses, including mitotic centrosome inactivation, cell-cycle delay in mitosis, and nuclear dropping from embryo cortex, maintain genome integrity in syncytial Drosophila embryos. A conserved signaling kinase, Chk2, known as Mnk/Loki, is essential for the responses. Here we demonstrate that functional EGFP-Mnk expressed from a transgene localizes to the nucleus, centrosomes, interkinetochore/centromere region, midbody, and pseudocleavage furrows without DNA damage and in addition forms numerous foci/aggregates on mitotic chromosomes upon DNA damage. We expressed EGFP-tagged Mnk deletion or point mutation variants and investigated domain functions of Mnk in vivo. A triple mutation in the phosphopeptide-binding site of the forkhead-associated (FHA) domain disrupted normal Mnk localization except to the nucleus. The mutation also disrupted Mnk foci formation on chromosomes upon DNA damage. FHA mutations and deletion of the SQ/TQ-cluster domain (SCD) abolished Mnk transphosphorylations and autophosphorylations, indicative of kinase activation after DNA damage. A potent NLS was found at the C-terminus, which is required for normal Mnk function. We propose that the FHA domain in Mnk plays essential dual functions in mediating embryonic DNA damage responses by means of its phosphopeptide-binding ability: activating Mnk in the nucleus upon DNA damage and recruiting Mnk to multiple subcellular structures independently of DNA damage. PMID:25808488

  4. Integrated Stochastic Model of DNA Damage Repair by Non-homologous End Joining and p53/p21- Mediated Early Senescence Signalling

    PubMed Central

    Nelson, Glyn; Hall, Philip; Miwa, Satomi; Kirkwood, Thomas B. L.; Shanley, Daryl P.

    2015-01-01

    Unrepaired or inaccurately repaired DNA damage can lead to a range of cell fates, such as apoptosis, cellular senescence or cancer, depending on the efficiency and accuracy of DNA damage repair and on the downstream DNA damage signalling. DNA damage repair and signalling have been studied and modelled in detail separately, but it is not yet clear how they integrate with one another to control cell fate. In this study, we have created an integrated stochastic model of DNA damage repair by non-homologous end joining and of gamma irradiation-induced cellular senescence in human cells that are not apoptosis-prone. The integrated model successfully explains the changes that occur in the dynamics of DNA damage repair after irradiation. Simulations of p53/p21 dynamics after irradiation agree well with previously published experimental studies, further validating the model. Additionally, the model predicts, and we offer some experimental support, that low-dose fractionated irradiation of cells leads to temporal patterns in p53/p21 that lead to significant cellular senescence. The integrated model is valuable for studying the processes of DNA damage induced cell fate and predicting the effectiveness of DNA damage related medical interventions at the cellular level. PMID:26020242

  5. Method for assessing damage to mitochondrial DNA caused by radiation and epichlorohydrin

    SciTech Connect

    Singh, G.; Hauswirth, W.W.; Ross, W.E.; Neims, A.H.

    1985-01-01

    This paper describes a rapid and reliable method for quantification of damage to mitochondrial DNA (mtDNA), especially strand breaks. The degree of damage to mtDNA is assessed by the proportion of physical forms (i.e., supercoiled versus open-circular and linear forms) upon agarose gel electrophoresis, blotting, and visualization by hybridization with (/sup 32/P)mtDNA probes. The use of a radiolabeled probe is a crucial step in the procedure because it provides both a means to quantify by radioautography and to obtain the mtDNA specificity required to eliminate misinterpretation due to nuclear DNA contamination. To demonstrate the utility of this technique, X-irradiation and epichlorohydrin are shown to damage both isolated mtDNA and mtDNA in whole cells in a dose-dependent fashion.

  6. An Investigation into the Association between DNA Damage and Dietary Fatty Acid in Men with Prostate Cancer

    PubMed Central

    Bishop, Karen S.; Erdrich, Sharon; Karunasinghe, Nishi; Han, Dug Yeo; Zhu, Shuotun; Jesuthasan, Amalini; Ferguson, Lynnette R.

    2015-01-01

    Prostate cancer is a growing problem in New Zealand and worldwide, as populations adopt a Western style dietary pattern. In particular, dietary fat is believed to be associated with oxidative stress, which in turn may be associated with cancer risk and development. In addition, DNA damage is associated with the risk of various cancers, and is regarded as an ideal biomarker for the assessment of the influence of foods on cancer. In the study presented here, 20 men with prostate cancer adhered to a modified Mediterranean style diet for three months. Dietary records, blood fatty acid levels, prostate specific antigen, C-reactive protein and DNA damage were assessed pre- and post-intervention. DNA damage was inversely correlated with dietary adherence (p = 0.013) and whole blood monounsaturated fatty acids (p = 0.009) and oleic acid (p = 0.020). DNA damage was positively correlated with the intake of dairy products (p = 0.043), red meat (p = 0.007) and whole blood omega-6 polyunsaturated fatty acids (p = 0.015). Both the source and type of dietary fat changed significantly over the course of the dietary intervention. Levels of DNA damage were correlated with various dietary fat sources and types of dietary fat. PMID:25580814

  7. Higher levels of oxidative DNA damage in cervical cells are correlated with the grade of dysplasia and HPV infection.

    PubMed

    Visalli, Giuseppa; Riso, Romana; Facciolà, Alessio; Mondello, Placido; Caruso, Carmela; Picerno, Isa; Di Pietro, Angela; Spataro, Pasquale; Bertuccio, Maria Paola

    2016-02-01

    The Human papillomavirus is responsible for the most common sexually transmitted infection and is also known to be an oncogenic virus that is associated with cervical, anogenital, and head-neck cancers. The present study aims to assess whether oxidative DNA damage is correlated with the grade of HPV-related lesions. Moreover, we evaluated clinical data and unhealthy lifestyles to verify their possible influence on the genesis of oxidative DNA damage in cervical cells. We quantified the amount of 8-Oxo-2'-deoxyguanosine in DNA as a biomarker of oxidative damage in women with and without HPV infection. We also correlated oxidative damage with different stages of cervical lesions and available clinical data (e.g., HPV genotypes). To identify HPV infections, in which proteins with a transforming potential are produced, we performed a qualitative detection of HPV E6/E7 mRNA. Our results showed greater oxidative damage in HPV-related dysplastic cervical lesions compared to samples with normal cytology, especially in women with high-grade squamous intraepithelial lesions. The latter showed a closed link with high-risk HPV genotypes. Reactive oxygen species can induce DNA double-strand breaks in both the host DNA and in the circular viral episome; this could facilitate the integration of the virus, promoting HPV carcinogenesis. Therefore, in HPV-infected women, it could be useful to reduce additional resources of reactive oxygen/nitrogen species (RONS) with a healthy lifestyle. PMID:26174792

  8. Aging and DNA damage in humans: a meta-analysis study

    PubMed Central

    Soares, Jorge Pinto; Cortinhas, António; Bento, Teresa; Leitão, José Carlos; Collins, Andrew R.; Gaivã, Isabel; Mota, Maria Paula

    2014-01-01

    Age-related DNA damage is regarded as one of the possible explanations of aging. Although a generalized idea about the accumulation of DNA damage with age exists, results found in the literature are inconsistent. To better understand the question of age-related DNA damage in humans and to identify possible moderator variables, a meta-analysis was conducted. Electronic databases and bibliographies for studies published since 2004 were searched. Summary odds ratios (ORs) and 95% confidence intervals (CIs) for age-related DNA damage were calculated in a random-effects model. A total of 76 correlations from 36 studies with 4676 participants were included. Based on our analysis, a correlation between age and DNA damage was found (r = 0.230, p = 0.000; 95% confidence interval = 0.111 - 0.342). The test for heterogeneity of variance indicates that the study´s results are significantly high (Q (75) = 1754.831, p = 0.000). Moderator variables such as smoking habits, technique used, and the tissue/sample analyzed, are shown to influence age-related DNA damage (p=0.026; p=0.000; p=0.000, respectively). Nevertheless, sex did not show any influence on this relation (p=0.114). In conclusion, this meta-analysis showed an association between age and DNA damage in humans. It was also found that smoking habits, the technique used, and tissue/sample analyzed, are important moderator variables in age-related DNA damage. PMID:25140379

  9. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  10. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY RADIATION, CHEMICAL MUTAGENS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence up