Science.gov

Sample records for additional regulatory elements

  1. Selection of color additives: a regulatory view.

    PubMed

    Kumar, Anuj; Dureja, Harish; Madan, Anil K

    2012-01-01

    Color additives have a unique place in the categories of the excipients. However, most of the color additives are complex heterogeneous organic compounds. In pharmaceuticals, colors are used in various oral (solid, liquid) and topical dosage form. Different regulatory authorities have their own specific set of regulation for registration, approval, and control of color additives. However, at this time of globalization, selection of appropriate color is not an easy task when a company wants to sale its product in many countries. In this article, the authors have explored various important factors which should be considered in the selection of color additives.

  2. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.

    2013-01-01

    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  3. Modular arrangement of regulatory RNA elements

    PubMed Central

    Roßmanith, Johanna; Narberhaus, Franz

    2017-01-01

    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  4. Modular arrangement of regulatory RNA elements.

    PubMed

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  5. Identifying Synonymous Regulatory Elements in Vertebrate Genomes

    SciTech Connect

    Ovcharenko, I; Nobrega, M A

    2005-02-07

    Synonymous gene regulation, defined as driving shared temporal and/or spatial expression of groups of genes, is likely predicated on genomic elements that contain similar modules of certain transcription factor binding sites (TFBS). We have developed a method to scan vertebrate genomes for evolutionary conserved modules of TFBS in a predefined configuration, and created a tool, named SynoR that identify synonymous regulatory elements (SREs) in vertebrate genomes. SynoR performs de novo identification of SREs utilizing known patterns of TFBS in active regulatory elements (REs) as seeds for genome scans. Layers of multiple-species conservation allow the use of differential phylogenetic sequence conservation filters in the search of SREs and the results are displayed as to provide an extensive annotation of genes containing detected REs. Gene Ontology categories are utilized to further functionally classify the identified genes, and integrated GNF Expression Atlas 2 data allow the cataloging of tissue-specificities of the predicted SREs. We illustrate how this new tool can be used to establish a linkage between human diseases and noncoding genomic content. SynoR is publicly available at http://synor.dcode.org.

  6. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  7. Information capacity of genetic regulatory elements

    NASA Astrophysics Data System (ADS)

    Tkačik, Gašper; Callan, Curtis G., Jr.; Bialek, William

    2008-07-01

    Changes in a cell’s external or internal conditions are usually reflected in the concentrations of the relevant transcription factors. These proteins in turn modulate the expression levels of the genes under their control and sometimes need to perform nontrivial computations that integrate several inputs and affect multiple genes. At the same time, the activities of the regulated genes would fluctuate even if the inputs were held fixed, as a consequence of the intrinsic noise in the system, and such noise must fundamentally limit the reliability of any genetic computation. Here we use information theory to formalize the notion of information transmission in simple genetic regulatory elements in the presence of physically realistic noise sources. The dependence of this “channel capacity” on noise parameters, cooperativity and cost of making signaling molecules is explored systematically. We find that, in the range of parameters probed by recent in vivo measurements, capacities higher than one bit should be achievable. It is of course generally accepted that gene regulatory elements must, in order to function properly, have a capacity of at least one bit. The central point of our analysis is the demonstration that simple physical models of noisy gene transcription, with realistic parameters, can indeed achieve this capacity: it was not self-evident that this should be so. We also demonstrate that capacities significantly greater than one bit are possible, so that transcriptional regulation need not be limited to simple “on-off” components. The question whether real systems actually exploit this richer possibility is beyond the scope of this investigation.

  8. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  9. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

    2007-01-01

    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  10. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj

    2006-01-01

    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  11. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  12. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)

    1989-04-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  13. Distant cis Regulatory Elements in Human Skeletal Muscle Differentiation

    PubMed Central

    McCord, Rachel Patton; Zhou, Vicky W.; Yuh, Tiffany; Bulyk, Martha L.

    2011-01-01

    Identifying gene regulatory elements and their target genes in human cells remains a significant challenge. Despite increasing evidence of physical interactions between distant regulatory elements and gene promoters in mammalian cells, many studies consider only promoter-proximal regulatory regions. We identify putative cis-regulatory modules (CRMs) in human skeletal muscle differentiation by combining myogenic TF binding data before and after differentiation with histone modification data in myoblasts. CRMs that are distant (>20 kb) from muscle gene promoters are common and are more likely than proximal promoter regions to show differentiation-specific changes in myogenic TF binding. We find that two of these distant CRMs, known to activate transcription in differentiating myoblasts, interact physically with gene promoters (PDLIM3 and ACTA1) during differentiation. Our results highlight the importance of considering distal CRMs in investigations of mammalian gene regulation and support the hypothesis that distant CRM-promoter looping contacts are a general mechanism of gene regulation. PMID:21907276

  14. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.

    PubMed

    Santini, Simona; Boore, Jeffrey L; Meyer, Axel

    2003-06-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  15. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  16. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  17. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.

    2008-01-01

    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  18. Latent Regulatory Potential of Human-Specific Repetitive Elements

    PubMed Central

    Ward, Michelle C.; Wilson, Michael D.; Barbosa-Morais, Nuno L.; Schmidt, Dominic; Stark, Rory; Pan, Qun; Schwalie, Petra C.; Menon, Suraj; Lukk, Margus; Watt, Stephen; Thybert, David; Kutter, Claudia; Kirschner, Kristina; Flicek, Paul; Blencowe, Benjamin J.; Odom, Duncan T.

    2013-01-01

    Summary At least half of the human genome is derived from repetitive elements, which are often lineage specific and silenced by a variety of genetic and epigenetic mechanisms. Using a transchromosomic mouse strain that transmits an almost complete single copy of human chromosome 21 via the female germline, we show that a heterologous regulatory environment can transcriptionally activate transposon-derived human regulatory regions. In the mouse nucleus, hundreds of locations on human chromosome 21 newly associate with activating histone modifications in both somatic and germline tissues, and influence the gene expression of nearby transcripts. These regions are enriched with primate and human lineage-specific transposable elements, and their activation corresponds to changes in DNA methylation at CpG dinucleotides. This study reveals the latent regulatory potential of the repetitive human genome and illustrates the species specificity of mechanisms that control it. PMID:23246434

  19. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  20. Additive functions in boolean models of gene regulatory network modules.

    PubMed

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  1. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.

    2013-01-01

    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  2. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  3. Identifying splicing regulatory elements with de Bruijn graphs.

    PubMed

    Badr, Eman; Heath, Lenwood S

    2014-12-01

    Splicing regulatory elements (SREs) are short, degenerate sequences on pre-mRNA molecules that enhance or inhibit the splicing process via the binding of splicing factors, proteins that regulate the functioning of the spliceosome. Existing methods for identifying SREs in a genome are either experimental or computational. Here, we propose a formalism based on de Bruijn graphs that combines genomic structure, word count enrichment analysis, and experimental evidence to identify SREs found in exons. In our approach, SREs are not restricted to a fixed length (i.e., k-mers, for a fixed k). As a result, we identify 2001 putative exonic enhancers and 3080 putative exonic silencers for human genes, with lengths varying from 6 to 15 nucleotides. Many of the predicted SREs overlap with experimentally verified binding sites. Our model provides a novel method to predict variable length putative regulatory elements computationally for further experimental investigation.

  4. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  5. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  6. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  7. Cis-regulatory RNA elements that regulate specialized ribosome activity

    PubMed Central

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5′UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution. PMID:26327194

  8. Epistatic Interactions in the Arabinose Cis-Regulatory Element.

    PubMed

    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B; Guet, Călin C; Bollback, Jonathan P

    2016-03-01

    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner.

  9. Identification of active transcriptional regulatory elements with GRO-seq

    PubMed Central

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam

    2015-01-01

    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Our prediction method, called discriminative Regulatory Element detection from GRO-seq (dREG), summarizes GRO-seq read counts at multiple scales and uses support vector regression to identify active TREs. The predicted TREs are more strongly enriched for several marks of transcriptional activation, including eQTL, GWAS-associated SNPs, H3K27ac, and transcription factor binding than those identified by alternative functional assays. Using dREG, we survey TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  10. Discovery of regulatory elements is improved by a discriminatory approach.

    PubMed

    Valen, Eivind; Sandelin, Albin; Winther, Ole; Krogh, Anders

    2009-11-01

    A major goal in post-genome biology is the complete mapping of the gene regulatory networks for every organism. Identification of regulatory elements is a prerequisite for realizing this ambitious goal. A common problem is finding regulatory patterns in promoters of a group of co-expressed genes, but contemporary methods are challenged by the size and diversity of regulatory regions in higher metazoans. Two key issues are the small amount of information contained in a pattern compared to the large promoter regions and the repetitive characteristics of genomic DNA, which both lead to "pattern drowning". We present a new computational method for identifying transcription factor binding sites in promoters using a discriminatory approach with a large negative set encompassing a significant sample of the promoters from the relevant genome. The sequences are described by a probabilistic model and the most discriminatory motifs are identified by maximizing the probability of the sets given the motif model and prior probabilities of motif occurrences in both sets. Due to the large number of promoters in the negative set, an enhanced suffix array is used to improve speed and performance. Using our method, we demonstrate higher accuracy than the best of contemporary methods, high robustness when extending the length of the input sequences and a strong correlation between our objective function and the correct solution. Using a large background set of real promoters instead of a simplified model leads to higher discriminatory power and markedly reduces the need for repeat masking; a common pre-processing step for other pattern finders.

  11. Regulatory elements of the Staphylococcus aureus protein A (Spa) promoter.

    PubMed

    Gao, Jinxin; Stewart, George C

    2004-06-01

    Staphylococcal protein A (Spa) is an important virulence factor of Staphylococcus aureus. Transcription of the spa determinant occurs during the exponential growth phase and is repressed when the cells enter the postexponential growth phase. Regulation of spa expression has been found to be complicated, with regulation involving multiple factors, including Agr, SarA, SarS, SarT, Rot, and MgrA. Our understanding of how these factors work on the spa promoter to regulate spa expression is incomplete. To identify regulatory sites within the spa promoter, analysis of deletion derivatives of the promoter in host strains deficient in one or more of the regulatory factors was undertaken, and several critical features of spa regulation were revealed. The transcriptional start sites of spa were determined by primer extension. The spa promoter sequences were subcloned in front of a promoterless chloramphenicol acetyltransferase reporter gene. Various lengths of spa truncations with the same 3' end were constructed, and the resultant plasmids were transduced into strains with different regulatory genetic backgrounds. Our results identified upstream promoter sequences necessary for Agr system regulation of spa expression. The cis elements for SarS activity, an activator of spa expression, and for SarA activity, a repressor of spa expression, were identified. The well-characterized SarA consensus sequence on the spa promoter was found to be insufficient for SarA repression of the spa promoter. Full repression required the presence of a second consensus site adjacent to the SarS binding site. Sequences directly upstream of the core promoter sequence were found to stimulate transcription.

  12. Efficiently finding regulatory elements using correlation with gene expression.

    PubMed

    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru

    2004-06-01

    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  13. Idefix insulator activity can be modulated by nearby regulatory elements.

    PubMed

    Brasset, E; Bantignies, F; Court, F; Cheresiz, S; Conte, C; Vaury, C

    2007-01-01

    Insulators play important roles in controlling gene activity and maintaining regulatory independence between neighbouring genes. In this article, we show that the enhancer-blocking activity of the insulator present within the LTR retrotransposon Idefix can be abolished if two copies of the region containing the insulator--specifically, the long terminal repeat (LTR)--are fused to the retrotransposon's 5' untranslated region (5' UTR). The presence of this combination of two [LTR-5' UTR] modules is a prerequisite for the loss of enhancer-blocking activity. We further show that the 5' UTR causes flanking genomic sequences to be displaced to the nuclear periphery, which is not observed when two insulators are present by themselves. This study thus provides a functional link between insulators and independent genomic modules, which may cooperate to allow the specific regulation of defined genomic loci via nuclear repositioning. It further illustrates the complexity of genomic regulation within a chromatic environment with multiple functional elements.

  14. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    PubMed

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  15. Negative transcriptional regulatory element that functions in embryonal carcinoma cells.

    PubMed Central

    Ariizumi, K; Takahashi, H; Nakamura, M; Ariga, H

    1989-01-01

    We have cloned the polyomavirus mutant fPyF9, which persists in an episomal state in F9 embryonal carcinoma cells (K. Ariizumi and H. Ariga, Mol. Cell. Biol. 6:3920-3927, 1986). fPyF9 carries three copies of exogenous sequences, the prototype of which is a 21-base-pair repeat (box DNA), in the region of the enhancer B domain of wild-type polyomavirus DNA. The consensus sequence, GCATTCCATTGTT, is 13 base pairs long. The box DNA inserted into fPyF9 appeared to come from a cellular sequence and was present in many kinds of DNAs, including F9 chromosomal DNA. The biological function of box DNA was analyzed by chloramphenicol acetyltransferase expression assays, using chimeric plasmids containing box DNA conjugated with simian virus 40 promoter elements. The results showed that box DNA repressed the activities both of the simian virus 40 promoter and enhancer only in transfected undifferentiated F9 cells and not in differentiated LTK- cells. Box DNA functioned independently of orientation and position with respect to the promoter in an enhancerlike manner, although the effect of box DNA was opposite that of the enhancer. The XhoI linker insertion into the consensus sequences of box DNA abolished the repression activity, and the protein(s) recognizing the consensus sequences was identified only in F9 cells, not in L cells. These analyses suggest that box DNA may be a negative regulatory element that functions in undifferentiated cells. Images PMID:2550812

  16. Covariation among glucocorticoid regulatory elements varies seasonally in house sparrows.

    PubMed

    Liebl, Andrea L; Shimizu, Toru; Martin, Lynn B

    2013-03-01

    Glucocorticoids (GCs) help individuals cope with changes throughout life; one such change is the seasonal transition through life-history stages. Previous research shows that many animals exhibit seasonal variation in baseline GCs and GC responses to stressors, but the effects of season on other aspects of GC regulation have been less studied. Moreover, whether elements of GC regulation covary within individuals and whether covariation changes seasonally has been not been investigated. Evolutionarily, strong linkages among GC regulatory elements is predicted to enhance system efficiency and regulation, however may reduce the plasticity necessary to ensure appropriate responses under varying conditions. Here, we measured corticosterone (CORT), the major avian GC, at baseline, after exposure to a restraint stressor, and in response to dexamethasone (to assess negative feedback capacity) in wild house sparrows (Passer domesticus) during the breeding and molting seasons. We also measured hippocampal mRNA expression of the two receptors primarily responsible for CORT regulation: the mineralocorticoid and glucocorticoid receptors (MR and GR, respectively). Consistent with previous studies, restraint-induced CORT was lower during molt than breeding, but negative-feedback was not influenced by season. Receptor gene expression was affected by season, however, as during breeding, the ratio of MR to GR expression was significantly lower than during molt. Furthermore, MR expression was negatively correlated with CORT released in response to a stressor, but only during molt. We found that individuals that most strongly up-regulated CORT in response to restraint were also most effective at reducing CORT via negative feedback; although these relationships were independent of season, they were stronger during molt.

  17. Methanogenesis from wastewater stimulated by addition of elemental manganese

    PubMed Central

    Qiao, Sen; Tian, Tian; Qi, Benyu; Zhou, Jiti

    2015-01-01

    This study presents a novel procedure for accelerating methanogenesis from wastewater by adding elemental manganese into the anaerobic digestion system. The results indicated that elemental manganese effectively enhanced both the methane yield and the production rate. Compared to the control test without elemental manganese, the total methane yield and production rate with 4 g/L manganese addition increased 3.4-fold (from 0.89 ± 0.03 to 2.99 ± 0.37 M/gVSS within 120 h) and 4.4-fold (from 6.2 ± 0.1 to 27.2 ± 2.2 mM/gVSS/h), respectively. Besides, more acetate consumption and less propionate generation were observed during the methanogenesis with manganese. Further studies demonstrated that the elemental manganese served as electron donors for the methanogenesis from carbon dioxide, and the final proportion of methane in the total generated gas with 4 g/L manganese addition reached 96.9%, which was 2.1-fold than that of the control (46.6%). PMID:26244609

  18. Regulatory Elements in Vectors for Efficient Generation of Cell Lines Producing Target Proteins

    PubMed Central

    Maksimenko, O.; Gasanov, N. B.; Georgiev, P.

    2015-01-01

    To date, there has been an increasing number of drugs produced in mammalian cell cultures. In order to enhance the expression level and stability of target recombinant proteins in cell cultures, various regulatory elements with poorly studied mechanisms of action are used. In this review, we summarize and discuss the potential mechanisms of action of such regulatory elements. PMID:26483956

  19. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  20. The Regulatory Properties of Autonomous Subtelomeric P Elements Are Sensitive to a Suppressor of Variegation in Drosophila Melanogaster

    PubMed Central

    Ronsseray, S.; Lehmann, M.; Nouaud, D.; Anxolabehere, D.

    1996-01-01

    Genetic recombination was used in Drosophila melanogaster to isolate P elements, inserted at the telomeres of X chromosomes (cytological site 1A) from natural populations, in a genetic background devoid of other P elements. We show that complete maternally inherited P repression in the germline (P cytotype) can be elicited by only two autonomous P elements at 1A and that a single element at this site has partial regulatory properties. The analysis of the surrounding chromosomal regions of the P elements at 1A shows that in all cases these elements are flanked by Telomeric Associated Sequences, tandemly repetitive noncoding sequences that have properties of heterochromatin. In addition, we show that the regulatory properties of P elements at 1A can be inhibited by some of the mutant alleles of the Su(var)205 gene and by a deficiency of this gene. However, the regulatory properties of reference P strains (Harwich and Texas 007) are not impaired by Su(var)205 mutations. Su(var)205 encodes Heterochromatin Protein 1 (HP1). These results suggest that the HP1 dosage effect on the P element properties is site-dependent and could involve the structure of the chromatin. PMID:8844154

  1. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  2. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements

    PubMed Central

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Gac, Gérald Le; Dostie, Josée; Férec, Claude

    2016-01-01

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory ‘chromatin looping’ systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF. PMID:26615198

  3. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements.

    PubMed

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Le Gac, Gérald; Dostie, Josée; Férec, Claude

    2016-04-07

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory 'chromatin looping' systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF.

  4. Exaptation of Transposable Elements into Novel Cis-Regulatory Elements: Is the Evidence Always Strong?

    PubMed Central

    de Souza, Flávio S.J.; Franchini, Lucía F.; Rubinstein, Marcelo

    2013-01-01

    Transposable elements (TEs) are mobile genetic sequences that can jump around the genome from one location to another, behaving as genomic parasites. TEs have been particularly effective in colonizing mammalian genomes, and such heavy TE load is expected to have conditioned genome evolution. Indeed, studies conducted both at the gene and genome levels have uncovered TE insertions that seem to have been co-opted—or exapted—by providing transcription factor binding sites (TFBSs) that serve as promoters and enhancers, leading to the hypothesis that TE exaptation is a major factor in the evolution of gene regulation. Here, we critically review the evidence for exaptation of TE-derived sequences as TFBSs, promoters, enhancers, and silencers/insulators both at the gene and genome levels. We classify the functional impact attributed to TE insertions into four categories of increasing complexity and argue that so far very few studies have conclusively demonstrated exaptation of TEs as transcriptional regulatory regions. We also contend that many genome-wide studies dealing with TE exaptation in recent lineages of mammals are still inconclusive and that the hypothesis of rapid transcriptional regulatory rewiring mediated by TE mobilization must be taken with caution. Finally, we suggest experimental approaches that may help attributing higher-order functions to candidate exapted TEs. PMID:23486611

  5. A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements

    PubMed Central

    Wang, Guandong; Zhang, Weixiong

    2006-01-01

    The comprehensive identification of cis-regulatory elements on a genome scale is a challenging problem. We develop a novel, steganalysis-based approach for genome-wide motif finding, called WordSpy, by viewing regulatory regions as a stegoscript with cis-elements embedded in 'background' sequences. We apply WordSpy to the promoters of cell-cycle-related genes of Saccharomyces cerevisiae and Arabidopsis thaliana, identifying all known cell-cycle motifs with high ranking. WordSpy can discover a complete set of cis-elements and facilitate the systematic study of regulatory networks. PMID:16787547

  6. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  7. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    NASA Astrophysics Data System (ADS)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  8. DBTGR: a database of tunicate promoters and their regulatory elements.

    PubMed

    Sierro, Nicolas; Kusakabe, Takehiro; Park, Keun-Joon; Yamashita, Riu; Kinoshita, Kengo; Nakai, Kenta

    2006-01-01

    The high similarity of tunicates and vertebrates during their development coupled with the transparency of tunicate larvae, their well-studied cell lineages and the availability of simple and efficient transgenesis methods makes of this subphylum an ideal system for the investigation of vertebrate physiological and developmental processes. Recently, the sequencing of two different Ciona genomes has lead to the identification of numerous genes. In order to better understand the regulation of these genes, a database was created containing information on regulation of tunicate genes collected from literature. It includes for instance information regarding the minimal promoter length, the transcription factors involved and their binding sites, as well as the localization of the gene expression. Additionally, binding sites for characterized transcription factors were predicted based on published in vitro recognition sites. Comparison of the promoters of homologous genes in different species is also provided to allow identification of conserved cis elements. At the time of writing, information about 184 promoters, containing 73 identified binding sites and >2000 newly predicted binding sites is available. This database is accessible at http://dbtgr.hgc.jp.

  9. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  10. MicroRNAs as regulatory elements in psoriasis

    PubMed Central

    Liu, Yuan

    2016-01-01

    Abstract Psoriasis is a chronic, autoimmune, and complex genetic disorder that affects 23% of the European population. The symptoms of Psoriatic skin are inflammation, raised and scaly lesions. microRNA, which is short, nonprotein-coding, regulatory RNAs, plays critical roles in psoriasis. microRNA participates in nearly all biological processes, such as cell differentiation, development and metabolism. Recent researches reveal that multitudinous novel microRNAs have been identified in skin. Some of these substantial novel microRNAs play as a class of posttranscriptional gene regulator in skin disease, such as psoriasis. In order to insight into microRNAs biological functions and verify microRNAs biomarker, we review diverse references about characterization, profiling and subtype of microRNAs. Here we will share our opinions about how and which microRNAs are as regulatory in psoriasis.

  11. Isolation of a non-genomic origin fluoroquinolone responsive regulatory element using a combinatorial bioengineering approach.

    PubMed

    Srivastava, Santosh Kumar; Iyer, V Rajesh; Ghosh, Tamoghna; Lambadi, Paramesh Ramulu; Pathania, Ranjana; Navani, Naveen Kumar

    2016-03-18

    Advances in chemical biology have led to selection of synthetic functional nucleic acids for in vivo applications. Discovery of synthetic nucleic acid regulatory elements has been a long-standing goal of chemical biologists. Availability of vast genome level genetic resources has motivated efforts for discovery and understanding of inducible synthetic genetic regulatory elements. Such elements can lead to custom-design of switches and sensors, oscillators, digital logic evaluators and cell-cell communicators. Here, we describe a simple, robust and universally applicable module for discovery of inducible gene regulatory elements. The distinguishing feature is the use of a toxic peptide as a reporter to suppress the background of unwanted bacterial recombinants. Using this strategy, we show that it is possible to isolate genetic elements of non-genomic origin which specifically get activated in the presence of DNA gyrase A inhibitors belonging to fluoroquinolone (FQ) group of chemicals. Further, using a system level genetic resource, we prove that the genetic regulation is exerted through histone-like nucleoid structuring (H-NS) repressor protein. Till date, there are no reports of in vivo selection of non-genomic origin inducible regulatory promoter like elements. Our strategy opens an uncharted route to discover inducible synthetic regulatory elements from biologically-inspired nucleic acid sequences.

  12. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  13. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.

    1990-01-01

    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  14. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  15. The regulatory compliance plan for the Minimum Additive Waste Stabilization (MAWS) Program

    SciTech Connect

    Akgunduz, N.K.; Gimpel, R.F.; Finger, S.M.

    1993-01-27

    The Fernald Environmental Management Project (FEMP) has initiated the Minimum Additive Waste Stabilization (MAWS) Program to demonstrate and evaluate integrated treatment of the FEMP site`s Operable Unit 1 contaminated soils and sludges. The demonstration will require on-site operation of an integrated treatment system consisting of soil washing, water treatment by ion exchange, and vitrification of all contaminated solid wastes at a rate of 300 kg per day. Compliance with all relevant environmental regulations is a major priority of this program. Relevant regulatory requirements come under the jurisdiction of the US Environmental Protection Agency (US EPA), the Ohio Environmental Protection Agency (Ohio EPA), and the Department of Energy (DOE). The plethora of potentially applicable regulations were reviewed and an efficient regulatory compliance strategy developed. This strategy was documented in the MAWS Regulatory Compliance Plan which was presented to the regulatory agencies as a reasonable working plan. The FEMP has found the development of a comprehensive, organized regulatory plan to be critical to the successful implementation of integrated demonstration projects such as the MAWS Program. This paper discusses the approaches used in the MAWS Regulatory Compliance Plan and highlights which could prove useful for others that want to approach the DOE and/or EPA with technology demonstrations.

  16. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  17. Functional characterisation of cis-regulatory elements governing dynamic Eomes expression in the early mouse embryo.

    PubMed

    Simon, Claire S; Downes, Damien J; Gosden, Matthew E; Telenius, Jelena; Higgs, Douglas R; Hughes, Jim R; Costello, Ita; Bikoff, Elizabeth K; Robertson, Elizabeth J

    2017-02-07

    The T-box transcription factor (TF) Eomes is a key regulator of cell fate decisions during early mouse development. The cis-acting regulatory elements that direct expression in the anterior visceral endoderm (AVE), primitive streak (PS) and definitive endoderm (DE) have yet to be defined. Here, we identified three gene-proximal enhancer-like sequences (PSE_a, PSE_b and VPE) that faithfully activate tissue specific expression in transgenic embryos. However, targeted deletion experiments demonstrate that PSE_a and PSE_b are dispensable and only the VPE is required for optimal Eomes expression in vivo Embryos lacking this enhancer display variably penetrant defects in anterior-posterior axis orientation and DE formation. Chromosome conformation capture experiments reveal VPE-promoter interactions embryonic stem cells (ESC), prior to gene activation. The locus resides in a large (500kb) pre-formed compartment in ESC and activation during DE differentiation occurs in the absence of 3D structural changes. ATAC-seq analysis reveals that VPE, PSE_a, and four additional putative enhancers display increased chromatin accessibility in DE associated with Smad2/3 binding coincident with transcriptional activation. In contrast, activation of the Eomes target genes Foxa2 and Lhx1 is associated with higher order chromatin reorganisation. Thus diverse regulatory mechanisms govern activation of lineage specifying TFs during early development.

  18. The Interplay of cis-Regulatory Elements Rules Circadian Rhythms in Mouse Liver

    PubMed Central

    Korenčič, Anja; Bordyugov, Grigory; Košir, Rok; Rozman, Damjana; Goličnik, Marko; Herzel, Hanspeter

    2012-01-01

    The mammalian circadian clock is driven by cell-autonomous transcriptional feedback loops that involve E-boxes, D-boxes, and ROR-elements. In peripheral organs, circadian rhythms are additionally affected by systemic factors. We show that intrinsic combinatorial gene regulation governs the liver clock. With a temporal resolution of 2 h, we measured the expression of 21 clock genes in mouse liver under constant darkness and equinoctial light-dark cycles. Based on these data and known transcription factor binding sites, we develop a six-variable gene regulatory network. The transcriptional feedback loops are represented by equations with time-delayed variables, which substantially simplifies modelling of intermediate protein dynamics. Our model accurately reproduces measured phases, amplitudes, and waveforms of clock genes. Analysis of the network reveals properties of the clock: overcritical delays generate oscillations; synergy of inhibition and activation enhances amplitudes; and combinatorial modulation of transcription controls the phases. The agreement of measurements and simulations suggests that the intrinsic gene regulatory network primarily determines the circadian clock in liver, whereas systemic cues such as light-dark cycles serve to fine-tune the rhythms. PMID:23144788

  19. The contribution of transposable elements to the evolution of regulatory networks

    PubMed Central

    Feschotte, Cédric

    2008-01-01

    Preface The control and coordination of eukaryotic gene expression rely on transcriptional and post-transcriptional regulatory networks. Although progress has been made in mapping the components and deciphering the function of these networks, the mechanisms by which such intricate circuits originate and evolve remain poorly understood. Here I revisit and expand earlier models proposing that genomic repeats, and in particular transposable elements, have been a rich source of material for the assembly and tinkering of eukaryotic gene regulatory systems. PMID:18368054

  20. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.

    2015-01-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  1. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2008-04-01

    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  2. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.

    2005-01-01

    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  3. Addition of higher order plate and shell elements into NASTRAN computer program

    NASA Technical Reports Server (NTRS)

    Narayanaswami, R.; Goglia, G. L.

    1976-01-01

    Two higher order plate elements, the linear strain triangular membrane element and the quintic bending element, along with a shallow shell element, suitable for inclusion into the NASTRAN (NASA Structural Analysis) program are described. Additions to the NASTRAN Theoretical Manual, Users' Manual, Programmers' Manual and the NASTRAN Demonstration Problem Manual, for inclusion of these elements into the NASTRAN program are also presented.

  4. Bifunctional air electrodes containing elemental iron powder charging additive

    DOEpatents

    Liu, Chia-tsun; Demczyk, Brian G.; Gongaware, Paul R.

    1982-01-01

    A bifunctional air electrode for use in electrochemical energy cells is made, comprising a hydrophilic layer and a hydrophobic layer, where the hydrophilic layer essentially comprises a hydrophilic composite which includes: (i) carbon; (ii) elemental iron particles having a particle size of between about 25 microns and about 700 microns diameter; (iii) an oxygen evolution material; (iv) a nonwetting agent; and (v) a catalyst, where at least one current collector is formed into said composite.

  5. EMERGE: a flexible modelling framework to predict genomic regulatory elements from genomic signatures

    PubMed Central

    van Duijvenboden, Karel; de Boer, Bouke A.; Capon, Nicolas; Ruijter, Jan M.; Christoffels, Vincent M.

    2016-01-01

    Regulatory DNA elements, short genomic segments that regulate gene expression, have been implicated in developmental disorders and human disease. Despite this clinical urgency, only a small fraction of the regulatory DNA repertoire has been confirmed through reporter gene assays. The overall success rate of functional validation of candidate regulatory elements is low. Moreover, the number and diversity of datasets from which putative regulatory elements can be identified is large and rapidly increasing. We generated a flexible and user-friendly tool to integrate the information from different types of genomic datasets, e.g. ATAC-seq, ChIP-seq, conservation, aiming to increase the ease and success rate of functional prediction. To this end, we developed the EMERGE program that merges all datasets that the user considers informative and uses a logistic regression framework, based on validated functional elements, to set optimal weights to these datasets. ROC curve analysis shows that a combination of datasets leads to improved prediction of tissue-specific enhancers in human, mouse and Drosophila genomes. Functional assays based on this prediction can be expected to have substantially higher success rates. The resulting integrated signal for prediction of functional elements can be plotted in a build-in genome browser or exported for further analysis. PMID:26531828

  6. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon

    2016-01-01

    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  7. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study.

  8. The identification of cis-regulatory elements: A review from a machine learning perspective.

    PubMed

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  9. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  10. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    PubMed

    Rogers, William A; Salomone, Joseph R; Tacy, David J; Camino, Eric M; Davis, Kristen A; Rebeiz, Mark; Williams, Thomas M

    2013-08-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  11. Do pharmacological approaches that prevent opioid tolerance target different elements in the same regulatory machinery?

    PubMed

    Garzón, Javier; Rodríguez-Muñoz, María; Sánchez-Blázquez, Pilar

    2008-06-01

    In the nervous system, the interaction of opioids like heroin and morphine with the G protein-coupled Mu-opioid receptor (MOR) provokes the development of tolerance to these opioids, as well as physical dependence. Tolerance implies that higher doses of these drugs must be consumed in order to obtain an equivalent sensation, a situation that contributes notably to the social problems surrounding recreational opioid abuse. The mechanisms that promote opioid tolerance involve a series of adaptive changes in the MOR and in the post-receptor signalling elements. Pharmacological studies have consistently identified a number of signalling proteins relevant to morphine-induced tolerance, including the delta-opioid receptor (DOR), protein kinase C (PKC), protein kinase A (PKA), calcium/calmodulin-dependent kinase II (CaMKII), nitric oxide synthase (NOS), N-methyl-D-aspartate acid glutamate receptors (NMDAR), and regulators of G-signalling (RGS) proteins. Thus, it is feasible that these treatments which diminish morphine tolerance target distinct elements within the same regulatory machinery. In this scheme, the signals originated at the agonist-activated MORs would be recognised by elements such as the NMDARs, which in turn exert a negative feedback on MOR-evoked signalling. This process involves DOR regulation of MORs, MOR-induced activation of NMDARs (probably via the regulation of Src, recruiting PKC and Galpha subunits) and the NMDAR-mediated activation of CaMKII. The active CaMKII promotes the sequestering of morphine-activated Gbetagamma dimers by phosducin-like proteins (PhLP) and of Galpha subunits by RGS proteins and tolerance to opioids like morphine develops. Future efforts to study these phenomena should focus on fitting additional pieces into this puzzle in order to fully define the mechanism underlying the desensitization of MORs in neural cells.

  12. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    PubMed Central

    Janky, Rekin's; van Helden, Jacques

    2008-01-01

    Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation. PMID:18215291

  13. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... Action Programs § 60-2.17 Additional required elements of affirmative action programs. In addition to the elements required by § 60-2.10 through § 60-2.16, an acceptable affirmative action program must include...

  14. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    PubMed

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  15. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  16. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.

    PubMed

    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H

    2017-03-01

    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity.

  17. Additive Manufacturing of Functional Elements on Sheet Metal

    NASA Astrophysics Data System (ADS)

    Schaub, Adam; Ahuja, Bhrigu; Butzhammer, Lorenz; Osterziel, Johannes; Schmidt, Michael; Merklein, Marion

    Laser Beam Melting (LBM) process with its advantages of high design flexibility and free form manufacturing methodology is often applied limitedly due to its low productivity and unsuitability for mass production compared to conventional manufacturing processes. In order to overcome these limitations, a hybrid manufacturing methodology is developed combining the additive manufacturing process of laser beam melting with sheet forming processes. With an interest towards aerospace and medical industry, the material in focus is Ti-6Al-4V. Although Ti-6Al-4V is a commercially established material and its application for LBM process has been extensively investigated, the combination of LBM of Ti-6Al-4V with sheet metal still needs to be researched. Process dynamics such as high temperature gradients and thermally induced stresses lead to complex stress states at the interaction zone between the sheet and LBM structure. Within the presented paper mechanical characterization of hybrid parts will be performed by shear testing. The association of shear strength with process parameters is further investigated by analyzing the internal structure of the hybrid geometry at varying energy inputs during the LBM process. In order to compare the hybrid manufacturing methodology with conventional fabrication, the conventional methodologies subtractive machining and state of the art Laser Beam Melting is evaluated within this work. These processes will be analyzed for their mechanical characteristics and productivity by determining the build time and raw material consumption for each case. The paper is concluded by presenting the characteristics of the hybrid manufacturing methodology compared to alternative manufacturing technologies.

  18. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    PubMed

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  19. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.

    PubMed

    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D

    1999-08-01

    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  20. Microsatellite Tandem Repeats Are Abundant in Human Promoters and Are Associated with Regulatory Elements

    PubMed Central

    Sawaya, Sterling; Bagshaw, Andrew; Buschiazzo, Emmanuel; Kumar, Pankaj; Chowdhury, Shantanu; Black, Michael A.; Gemmell, Neil

    2013-01-01

    Tandem repeats are genomic elements that are prone to changes in repeat number and are thus often polymorphic. These sequences are found at a high density at the start of human genes, in the gene’s promoter. Increasing empirical evidence suggests that length variation in these tandem repeats can affect gene regulation. One class of tandem repeats, known as microsatellites, rapidly alter in repeat number. Some of the genetic variation induced by microsatellites is known to result in phenotypic variation. Recently, our group developed a novel method for measuring the evolutionary conservation of microsatellites, and with it we discovered that human microsatellites near transcription start sites are often highly conserved. In this study, we examined the properties of microsatellites found in promoters. We found a high density of microsatellites at the start of genes. We showed that microsatellites are statistically associated with promoters using a wavelet analysis, which allowed us to test for associations on multiple scales and to control for other promoter related elements. Because promoter microsatellites tend to be G/C rich, we hypothesized that G/C rich regulatory elements may drive the association between microsatellites and promoters. Our results indicate that CpG islands, G-quadruplexes (G4) and untranslated regulatory regions have highly significant associations with microsatellites, but controlling for these elements in the analysis does not remove the association between microsatellites and promoters. Due to their intrinsic lability and their overlap with predicted functional elements, these results suggest that many promoter microsatellites have the potential to affect human phenotypes by generating mutations in regulatory elements, which may ultimately result in disease. We discuss the potential functions of human promoter microsatellites in this context. PMID:23405090

  1. Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach

    PubMed Central

    Elemento, Olivier; Tavazoie, Saeed

    2005-01-01

    We describe a powerful new approach for discovering globally conserved regulatory elements between two genomes. The method is fast, simple and comprehensive, without requiring alignments. Its application to pairs of yeasts, worms, flies and mammals yields a large number of known and novel putative regulatory elements. Many of these are validated by independent biological observations, have spatial and/or orientation biases, are co-conserved with other elements and show surprising conservation across large phylogenetic distances. PMID:15693947

  2. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  3. Downstream Regulatory Element Antagonist Modulator (DREAM), a target for anti-thrombotic agents.

    PubMed

    Cho, Jaehyung

    2017-03-01

    Circulating platelets participate in the process of numerous diseases including thrombosis, inflammation, and cancer. Thus, it is of great importance to understand the underlying mechanisms mediating platelet activation under disease conditions. Emerging evidence indicates that despite the lack of a nucleus, platelets possess molecules that are involved in gene transcription in nucleated cells. This review will summarize downstream regulatory element antagonist modulator (DREAM), a transcriptional repressor, and highlight recent findings suggesting its novel non-transcriptional role in hemostasis and thrombosis.

  4. Cell-type-specific enrichment of risk-associated regulatory elements at ovarian cancer susceptibility loci

    PubMed Central

    Coetzee, Simon G.; Shen, Howard C.; Hazelett, Dennis J.; Lawrenson, Kate; Kuchenbaecker, Karoline; Tyrer, Jonathan; Rhie, Suhn K.; Levanon, Keren; Karst, Alison; Drapkin, Ronny; Ramus, Susan J.; Couch, Fergus J.; Offit, Kenneth; Chenevix-Trench, Georgia; Monteiro, Alvaro N.A.; Antoniou, Antonis; Freedman, Matthew; Coetzee, Gerhard A.; Pharoah, Paul D.P.; Noushmehr, Houtan; Gayther, Simon A.

    2015-01-01

    Understanding the regulatory landscape of the human genome is a central question in complex trait genetics. Most single-nucleotide polymorphisms (SNPs) associated with cancer risk lie in non-protein-coding regions, implicating regulatory DNA elements as functional targets of susceptibility variants. Here, we describe genome-wide annotation of regions of open chromatin and histone modification in fallopian tube and ovarian surface epithelial cells (FTSECs, OSECs), the debated cellular origins of high-grade serous ovarian cancers (HGSOCs) and in endometriosis epithelial cells (EECs), the likely precursor of clear cell ovarian carcinomas (CCOCs). The regulatory architecture of these cell types was compared with normal human mammary epithelial cells and LNCaP prostate cancer cells. We observed similar positional patterns of global enhancer signatures across the three different ovarian cancer precursor cell types, and evidence of tissue-specific regulatory signatures compared to non-gynecological cell types. We found significant enrichment for risk-associated SNPs intersecting regulatory biofeatures at 17 known HGSOC susceptibility loci in FTSECs (P = 3.8 × 10−30), OSECs (P = 2.4 × 10−23) and HMECs (P = 6.7 × 10−15) but not for EECs (P = 0.45) or LNCaP cells (P = 0.88). Hierarchical clustering of risk SNPs conditioned on the six different cell types indicates FTSECs and OSECs are highly related (96% of samples using multi-scale bootstrapping) suggesting both cell types may be precursors of HGSOC. These data represent the first description of regulatory catalogues of normal precursor cells for different ovarian cancer subtypes, and provide unique insights into the tissue specific regulatory variation with respect to the likely functional targets of germline genetic susceptibility variants for ovarian cancer. PMID:25804953

  5. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin

    2011-01-01

    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  6. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.

    PubMed

    Wang, Hongyan; Zhou, Xiaobo

    2013-04-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice.

  7. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    PubMed

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1.

  8. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells

    PubMed Central

    Golov, Arkadiy K.; Gavrilov, Alexey A.; Razin, Sergey V.

    2015-01-01

    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  9. Reporting of NSC Additional (A2) Data Elements. Updated July 29, 2014

    ERIC Educational Resources Information Center

    National Student Clearinghouse, 2014

    2014-01-01

    Since the 2008-09 academic year, the National Student Clearinghouse has provided its participating institutions with the option to include 13 additional data elements in their enrollment submissions. These additional data elements help make Clearinghouse data more comprehensive and enable StudentTracker? participants to utilize a more robust data…

  10. Regulatory network reconstruction using an integral additive model with flexible kernel functions

    PubMed Central

    Novikov, Eugene; Barillot, Emmanuel

    2008-01-01

    Background Reconstruction of regulatory networks is one of the most challenging tasks of systems biology. A limited amount of experimental data and little prior knowledge make the problem difficult to solve. Although models that are currently used for inferring regulatory networks are sometimes able to make useful predictions about the structures and mechanisms of molecular interactions, there is still a strong demand to develop increasingly universal and accurate approaches for network reconstruction. Results The additive regulation model is represented by a set of differential equations and is frequently used for network inference from time series data. Here we generalize this model by converting differential equations into integral equations with adjustable kernel functions. These kernel functions can be selected based on prior knowledge or defined through iterative improvement in data analysis. This makes the integral model very flexible and thus capable of covering a broad range of biological systems more adequately and specifically than previous models. Conclusion We reconstructed network structures from artificial and real experimental data using differential and integral inference models. The artificial data were simulated using mathematical models implemented in JDesigner. The real data were publicly available yeast cell cycle microarray time series. The integral model outperformed the differential one for all cases. In the integral model, we tested the zero-degree polynomial and single exponential kernels. Further improvements could be expected if the kernel were selected more specifically depending on the system. PMID:18218091

  11. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central

    2014-01-01

    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  12. Sterol Regulatory Element Binding Protein Is a Principal Regulator of Anaerobic Gene Expression in Fission Yeast†

    PubMed Central

    Todd, Bridget L.; Stewart, Emerson V.; Burg, John S.; Hughes, Adam L.; Espenshade, Peter J.

    2006-01-01

    Fission yeast sterol regulatory element binding protein (SREBP), called Sre1p, functions in an oxygen-sensing pathway to allow adaptation to fluctuating oxygen concentrations. The Sre1p-Scp1p complex responds to oxygen-dependent sterol synthesis as an indirect measure of oxygen availability. To examine the role of Sre1p in anaerobic gene expression in Schizosaccharomyces pombe, we performed transcriptional profiling experiments after a shift to anaerobic conditions for 1.5 h. Of the 4,940 genes analyzed, expression levels of 521 (10.5%) and 686 (13.9%) genes were significantly increased and decreased, respectively, under anaerobic conditions. Sre1p controlled 68% of genes induced ≥2-fold. Oxygen-requiring biosynthetic pathways for ergosterol, heme, sphingolipid, and ubiquinone were primary targets of Sre1p. Induction of glycolytic genes and repression of mitochondrial oxidative phosphorylation genes largely did not require Sre1p. Using chromatin immunoprecipitation, we demonstrated that Sre1p acts directly at target gene promoters and stimulates its own transcription under anaerobic conditions. sre1+ promoter analysis identified two DNA elements that are both necessary and sufficient for oxygen-dependent, Sre1p-dependent transcription. Interestingly, these elements are homologous to sterol regulatory elements bound by mammalian SREBP, highlighting the evolutionary conservation between Sre1p and SREBP. We conclude that Sre1p is a principal activator of anaerobic gene expression, upregulating genes required for nonrespiratory oxygen consumption. PMID:16537923

  13. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression

    PubMed Central

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M. Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K.

    2016-01-01

    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches. PMID:28005952

  14. Identification of regulatory elements that control expression of the tbpBA operon in Neisseria gonorrhoeae.

    PubMed

    Vélez Acevedo, Rosuany N; Ronpirin, Chalinee; Kandler, Justin L; Shafer, William M; Cornelissen, Cynthia Nau

    2014-08-01

    Iron is an essential nutrient for survival and establishment of infection by Neisseria gonorrhoeae. The neisserial transferrin binding proteins (Tbps) comprise a bipartite system for iron acquisition from human transferrin. TbpA is the TonB-dependent transporter that accomplishes iron internalization. TbpB is a surface-exposed lipoprotein that makes the iron uptake process more efficient. Previous studies have shown that the genes encoding these proteins are arranged in a bicistronic operon, with the tbpB gene located upstream of tbpA and separated from it by an inverted repeat. The operon is under the control of the ferric uptake regulator (Fur); however, promoter elements necessary for regulated expression of the genes have not been experimentally defined. In this study, putative regulatory motifs were identified and confirmed by mutagenesis. Further examination of the sequence upstream of these promoter/operator motifs led to the identification of several novel repeats. We hypothesized that these repeats are involved in additional regulation of the operon. Insertional mutagenesis of regions upstream of the characterized promoter region resulted in decreased tbpB and tbpA transcript levels but increased protein levels for both TbpA and TbpB. Using RNA sequencing (RNA-Seq) technology, we determined that a long RNA was produced from the region upstream of tbpB. We localized the 5' endpoint of this transcript to between the two upstream insertions by qualitative RT-PCR. We propose that expression of this upstream RNA leads to optimized expression of the gene products from within the tbpBA operon.

  15. The alr-groEL1 operon in Mycobacterium tuberculosis: an interplay of multiple regulatory elements

    PubMed Central

    Bhat, Aadil H.; Pathak, Deepika; Rao, Alka

    2017-01-01

    Threonylcarbamoyladenosine is a universally conserved essential modification of tRNA that ensures translational fidelity in cellular milieu. TsaD, TsaB and TsaE are identified as tRNA-A37-threonylcarbamoyl (t6A)-transferase enzymes that have been reconstituted in vitro, in few bacteria recently. However, transcriptional organization and regulation of these genes are not known in any of these organisms. This study describes the intricate architecture of a complex multicistronic alr-groEL1 operon, harboring essential genes, namely tsaD, tsaB, tsaE, groES, groEL1, and alr (required for cell wall synthesis), and rimI encoding an N-α- acetyltransferase in Mycobacterium tuberculosis. Using northern blotting, RT-PCR and in vivo fluorescence assays, genes alr to groEL1 were found to constitute an ~6.3 kb heptacistronic operon with multiple internal promoters and an I-shaped intrinsic hairpin-like cis-regulatory element. A strong promoter PtsaD within the coding sequence of rimI gene is identified in M. tuberculosis, in addition. The study further proposes an amendment in the known bicistronic groESL1 operon annotation by providing evidence that groESL1 is co-transcribed as sub-operon of alr-groEL1 operon. The architecture of alr-groEL1 operon, conservation of the genetic context and a mosaic transcriptional profile displayed under various stress conditions convincingly suggest the involvement of this operon in stress adaptation in M. tuberculosis. PMID:28256563

  16. Identification of positive and negative transcriptional regulatory elements of the rabbit angiotensin-converting enzyme gene.

    PubMed Central

    Goraya, T Y; Kessler, S P; Kumar, R S; Douglas, J; Sen, G C

    1994-01-01

    The two tissue-specific mRNAs encoding the isozymes of rabbit angiotensin-converting enzyme (ACE) are generated from the same gene by alternative choice of two transcription initiation sites 5.7 kb apart. In the current study, we have characterized the regulatory sites controlling the transcription of the larger pulmonary isozyme mRNA. For this purpose, reporter genes driven by varying lengths of upstream region of the ACE gene were transfected into ACE-producing cells. Our results demonstrated that the transcription of this gene is primarily driven by positive elements within the first 274 bp DNA upstream of the transcription initiation site. The reporter gene driven by this region was expressed in two ACE-producing cells but not in two ACE-non-producing cells thereby establishing its tissue specificity. Our experiments also revealed the existence of a strong negative element located between -692 and -610 positions. This element suppressed the expression of the reporter gene in a dose-dependent and position and orientation-independent fashion thus suggesting that it is a true silencer element. It could also repress the expression of a reporter gene driven by the heterologous strong promoter of the beta-actin gene. The repressing effects of the negative element could be partially overcome by cotransfecting the isolated negative element along with the reporter gene containing the negative element. This result was possibly due to the functional removal of a limiting trans-acting factor which binds to this element. Electrophoretic mobility shift assays revealed that the negative element can form several complexes with proteins present in the nuclear extract of an ACE-producing cell line. At least part of the negative element is strongly conserved in the upstream regions of the human and mouse ACE genes. Images PMID:8165133

  17. Dissection of a Ciona regulatory element reveals complexity of cross-species enhancer activity

    PubMed Central

    Chen, Wei-Chung; Pauls, Stefan; Bacha, Jamil; Elgar, Greg; Loose, Matthew; Shimeld, Sebastian M.

    2014-01-01

    Vertebrate genomes share numerous conserved non-coding elements, many of which function as enhancer elements and are hypothesised to be under evolutionary constraint due to a need to be bound by combinations of sequence-specific transcription factors. In contrast, few such conserved elements can be detected between vertebrates and their closest invertebrate relatives. Despite this lack of sequence identity, cross-species transgenesis has identified some cases where non-coding DNA from invertebrates drives reporter gene expression in transgenic vertebrates in patterns reminiscent of the expression of vertebrate orthologues. Such instances are presumed to reflect the presence of conserved suites of binding sites in the regulatory regions of invertebrate and vertebrate orthologues, such that both regulatory elements can correctly interpret the trans-activating environment. Shuffling of binding sites has been suggested to lie behind loss of sequence conservation; however this has not been experimentally tested. Here we examine the underlying basis of enhancer activity for the Ciona intestinalis βγ-crystallin gene, which drives expression in the lens of transgenic vertebrates despite the Ciona lineage predating the evolution of the lens. We construct an interactive gene regulatory network (GRN) for vertebrate lens development, allowing network interactions to be robustly catalogued and conserved network components and features to be identified. We show that a small number of binding motifs are necessary for Ciona βγ-crystallin expression, and narrow down the likely factors that bind to these motifs. Several of these overlap with the conserved core of the vertebrate lens GRN, implicating these sites in cross species function. However when we test these motifs in a transgenic vertebrate they prove to be dispensable for reporter expression in the lens. These results show that current models depicting cross species enhancer function as dependent on conserved binding

  18. [Regulatory elements in the skin epithelium of Saccoglossus mereschkowskii (Enteropneusta, Hemichordata): electron microscopic and immunocytochemical study].

    PubMed

    Stoliarova, M V; Val'kovich, E I

    2013-01-01

    The aim of this investigation was to demonstrate the regulatory elements in the skin epithelium of Enteropneusta which are supposed to be related to the chordate ancestors. Using electron microscopy, it was found that in the skin epithelium of a representative of enteropneusts Saccoglossus mereschkowskii, the basal parts of some epitheliocytes took part in formation of a nerve layer. These cells were considered as receptor ciliated cells. The granular epithelial cells were shown to release secretion according to both exocrine and endocrine mechanism; these cells were characterized as endocrine-like regulatory cells. Fine granular cells possibly represent special receptor-endocrine-like cell type. The immunocytochemical detection of FMRFamid neuropeptide localization in histological sections confirmed the electron microscopic data on the presence of receptor and endocrine-like cells in the epithelium. It is suggested that the skin epithelium of Enteropneusta contains a peculiar neuro-endocrine regulatory system that is represented by receptor cells, receptor-endocrine-like cells of an open type and nerve elements of the nerve layer.

  19. Plants with genetically modified events combined by conventional breeding: an assessment of the need for additional regulatory data.

    PubMed

    Pilacinski, W; Crawford, A; Downey, R; Harvey, B; Huber, S; Hunst, P; Lahman, L K; MacIntosh, S; Pohl, M; Rickard, C; Tagliani, L; Weber, N

    2011-01-01

    Crop varieties with multiple GM events combined by conventional breeding have become important in global agriculture. The regulatory requirements in different countries for such products vary considerably, placing an additional burden on regulatory agencies in countries where the submission of additional data is required and delaying the introduction of innovative products to meet agricultural needs. The process of conventional plant breeding has predictably provided safe food and feed products both historically and in the modern era of plant breeding. Thus, previously approved GM events that have been combined by conventional plant breeding and contain GM traits that are not likely to interact in a manner affecting safety should be considered to be as safe as their conventional counterparts. Such combined GM event crop varieties should require little, if any, additional regulatory data to meet regulatory requirements.

  20. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola

    2007-01-01

    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  1. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.

    PubMed

    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu

    2016-11-01

    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  2. A General Approach for Identifying Distant Regulatory Elements Applied to the Gdf6 Gene

    PubMed Central

    Mortlock, Douglas P.; Guenther, Catherine; Kingsley, David M.

    2003-01-01

    Regulatory sequences in higher genomes can map large distances from gene coding regions, and cannot yet be identified by simple inspection of primary DNA sequence information. Here we describe an efficient method of surveying large genomic regions for gene regulatory information, and subdividing complex sets of distant regulatory elements into smaller intervals for detailed study. The mouse Gdf6 gene is expressed in a number of distinct embryonic locations that are involved in the patterning of skeletal and soft tissues. To identify sequences responsible for Gdf6 regulation, we first isolated a series of overlapping bacterial artificial chromosomes (BACs) that extend varying distances upstream and downstream of the gene. A LacZ reporter cassette was integrated into the Gdf6 transcription unit of each BAC using homologous recombination in bacteria. Each modified BAC was injected into fertilized mouse eggs, and founder transgenic embryos were analyzed for LacZ expression mid-gestation. The overlapping segments defined by the BAC clones revealed five separate regulatory regions that drive LacZ expression in 11 distinct anatomical locations. To further localize sequences that control expression in developing skeletal joints, we created a series of BAC constructs with precise deletions across a putative joint-control region. This approach further narrowed the critical control region to an area containing several stretches of sequence that are highly conserved between mice and humans. A distant 2.9-kilobase fragment containing the highly conserved regions is able to direct very specific expression of a minimal promoter/LacZ reporter in proximal limb joints. These results demonstrate that even distant, complex regulatory sequences can be identified using a combination of BAC scanning, BAC deletion, and comparative sequencing approaches. PMID:12915490

  3. Who owns Australia's water--elements of an effective regulatory model.

    PubMed

    McKay, J

    2003-01-01

    This paper identifies and describes a number of global trends in regulatory theory and legal scholarship. It points out the huge level of complexity demanded by globalisation and the unfortunate complication of this is that there is legal indeterminacy. The legal indeterminacy springs from the desire to amend and alter existing models. That has been the thrust of the Council of Australian Governments changes to adapt and add huge amounts of complexity to a flawed system. This paper argues that an effective water regulatory model requires a fundamental re-examination of the concept of water ownership and a capturing by the State of the right to allocate rainfall. This foundation is effective and the way forward to deal with the key issues in this transition phase. The second key element to an effective regulatory model is the concept of performance-based assessment. This requires information and schemes to be set up to work out ways to monitor and evaluate the performance of the utility on selected criteria. For Australia at present there is a dire lack of agreed criteria on these key issues and these have the potential to pull apart the whole process. The key issues are indigenous rights, governance issues, public participation, alteration of pre-existing rights and incorporation of environmental requirements.

  4. Addition of three-dimensional isoparametric elements to NASA structural analysis program (NASTRAN)

    NASA Technical Reports Server (NTRS)

    Field, E. I.; Johnson, S. E.

    1973-01-01

    Implementation is made of the three-dimensional family of linear, quadratic and cubic isoparametric solid elements into the NASA Structural Analysis program, NASTRAN. This work included program development, installation, testing, and documentation. The addition of these elements to NASTRAN provides a significant increase in modeling capability particularly for structures requiring specification of temperatures, material properties, displacements, and stresses which vary throughout each individual element. Complete program documentation is presented in the form of new sections and updates for direct insertion to the three NASTRAN manuals. The results of demonstration test problems are summarized. Excellent results are obtained with the isoparametric elements for static, normal mode, and buckling analyses.

  5. [Requirements for drug approval and additional benefits assessment: Regulatory aspects and experiences].

    PubMed

    Broich, K; Löbker, W; Schulte, A; Beinlich, P; Müller, T

    2016-04-01

    The early assessment of benefits of newly approved drugs with novel active substances or new applications, which came into force on 1 January 2011 still represents a challenge to all parties involved. This article highlights the definitions, regulatory requirements and interaction between drug marketing approval and early assessment of benefits in Germany. The constellation of an extensively harmonized European and even international drug authorization process with a predominantly national regulation of drug reimbursement situation inevitably causes friction, which could be markedly reduced through early joint advisory discussions during the planning phase for pivotal clinical trials. During the year 2015 the Federal Institute for Drugs and Medical Devices (BfArM) carried out 300 scientific advice procedures of which 34 were concerned with applications in the field of indications for the central nervous system (CNS). In comparison 98 advisory meetings were held by the Federal Joint Committee (G-BA) of which the BfArM provided advice in 12 instances and in 2 cases on CNS indications. Study design, endpoints and appropriate comparative therapies are the key issues in exchanges and discussions between the BfArM, the G‑BA and applicants. Under these aspects the BfArM and G‑BA promote an early and consistent involvement in early advice procedures regarding the prerequisites for drug approval and assessment of additional benefits.

  6. Transcription factor MITF and remodeller BRG1 define chromatin organisation at regulatory elements in melanoma cells.

    PubMed

    Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin

    2015-03-24

    Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma.

  7. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.

    2004-01-01

    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  8. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition

    PubMed Central

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  9. A positive regulatory element is involved in the induction of the beta-galactosidase gene from Kluyveromyces lactis.

    PubMed Central

    Das, S; Breunig, K D; Hollenberg, C P

    1985-01-01

    The regulation of the LAC4 gene encoding beta-galactosidase in the yeast Kluyveromyces lactis has been studied. The expression of cloned LAC4 gene present on autonomously replicating plasmids was normally regulated by lactose or galactose as inducers. The LAC4 transcription initiation sites were mapped on two plasmids, PTY75-LAC4 and pKL2. The sites were found to be dependent on the level of gene expression and on the plasmid used. Under induced conditions, the normal cluster of initiation sites was used on both plasmids, whereas under non-induced conditions LAC4 on pKL2 showed additional sites. Deletion mapping of the 5' regulatory region of the LAC4 gene revealed a DNA element required for induction, presumably for the binding of a positive regulator. Images Fig. 2. Fig. 3. Fig. 6. PMID:3924596

  10. Identification of two regulatory elements controlling Fucosyltransferase 7 transcription in murine CD4+ T cells.

    PubMed

    Pink, Matthias; Ratsch, Boris A; Mardahl, Maibritt; Schröter, Micha F; Engelbert, Dirk; Triebus, Julia; Hamann, Alf; Syrbe, Uta

    2014-11-01

    Fucosyltransferase VII encoded by the gene Fut7 is essential in CD4(+) T cells for the generation of E- and P-selectin ligands (E- and P-lig) which facilitate recruitment of lymphocytes into inflamed tissues and into the skin. This study aimed to identify regulatory elements controlling the inducible Fut7 expression in CD4(+) T cells that occurs upon activation and differentiation of naive T cells into effector cells. Comparative analysis of the histone modification pattern in non-hematopoetic cells and CD4(+) T cell subsets revealed a differential histone modification pattern within the Fut7 locus including a conserved non-coding sequence (CNS) identified by cross-species conservation comparison suggesting that regulatory elements are confined to this region. Cloning of the CNS located about 500 bp upstream of the Fut7 locus, into a luciferase reporter vector elicited reporter activity after transfection of the αβ-WT T cell line, but not after transfection of primary murine CD4(+) Th1 cells. As quantification of different Fut7 transcripts revealed a predominance of transcripts lacking the first exons in primary Th1 cells we searched for an alternative promoter. Cloning of an intragenic region spanning a 1kb region upstream of exon 4 into an enhancer-containing vector indeed elicited promoter activity. Interestingly, also the CNS enhanced activity of this intragenic minimal promoter in reporter assays in primary Th1 cells suggesting that both elements interact in primary CD4(+) T cells to induce Fut7 transcription.

  11. Co-digestion of manure and industrial waste--The effects of trace element addition.

    PubMed

    Nordell, Erik; Nilsson, Britt; Nilsson Påledal, Sören; Karisalmi, Kaisa; Moestedt, Jan

    2016-01-01

    Manure is one of the most common substrates for biogas production. Manure from dairy- and swine animals are often considered to stabilize the biogas process by contributing nutrients and trace elements needed for the biogas process. In this study two lab-scale reactors were used to evaluate the effects of trace element addition during co-digestion of manure from swine- and dairy animals with industrial waste. The substrate used contained high background concentrations of both cobalt and nickel, which are considered to be the most important trace elements. In the reactor receiving additional trace elements, the volatile fatty acids (VFA) concentration was 89% lower than in the control reactor. The lower VFA concentration contributed to a more digested digestate, and thus lower methane emissions in the subsequent storage. Also, the biogas production rate increased with 24% and the biogas production yield with 10%, both as a result of the additional trace elements at high organic loading rates. All in all, even though 50% of the feedstock consisted of manure, trace element addition resulted in multiple positive effects and a more reliable process with stable and high yield.

  12. Analysis of synthetic motor oils for additive elements by ICP-AES

    SciTech Connect

    Williams, M.C.; Salmon, S.G.

    1995-12-31

    Standard motor oils are made by blending paraffinic or naphthenic mineral oil base stocks with additive packages containing anti-wear agents, dispersants, corrosion inhibitors, and viscosity index improvers. The blender can monitor the correct addition of the additives by determining the additive elements in samples dissolved in a solvent by ICP-AES. Internal standardization is required to control sample transport interferences due to differences in viscosity between samples and standards. Synthetic motor oils, made with poly-alpha-olefins and trimethylol propane esters, instead of mineral oils, pose an additional challenge since these compounds affect the plasma as well as having sample transport interference considerations. The synthetic lubricant base stocks add significant oxygen to the sample matrix, which makes the samples behave differently than standards prepared in mineral oil. Determination of additive elements in synthetic motor oils will be discussed.

  13. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    PubMed Central

    DuBois, Juwen C.; Smulian, A. George

    2016-01-01

    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  14. Effect of lubricant extreme pressure additives on rolling element fatigue life

    NASA Technical Reports Server (NTRS)

    Parker, R. J.; Zaretsky, E. V.

    1973-01-01

    The effects of surface active additives on rolling-element fatigue life were investigated with the five-ball fatigue tester at conditions where classical subsurface initiated rolling-element fatigue is the sole mode of failure. Test balls of AISI 52100, AISI M-50, and AISI 1018 were run with an acid-treated white oil containing either 2.5 percent sulfurized terpene, 1 percent didodecyl phosphite, or 5 percent chlorinated wax. In general, it was found that the influence of surface active additives was detrimental to rolling-element fatigue life. The chlorinated-wax additive significantly reduced fatigue life by a factor of 7. The base oil with the 2.5 percent sulfurized-terpene additive can reduce fatigue life by as much as 50 percent. No statistical change in fatigue life occurred with the base oil having the 1 percent didodecyl-phosphite additive. The additives used with the base oil did not change the ranking of the bearing steels where rolling-element fatigue life was of subsurface origin.

  15. Dissection of Regulatory Elements During Direct Conversion of Somatic Cells into Neurons.

    PubMed

    Soleimani, Tahereh; Falsafi, Nafiseh; Fallahi, Hossein

    2017-02-23

    A revolutionary approach that involves direct conversion of somatic cells into almost any other types of cells showed promising results for regenerative medicine. Currently, producing valuable cell types including neurons, cardiomyocytes and hepatocytes through direct conversion of somatic cells appear to be a feasible option for regenerative medicine. The process involves inducing the cells by chemical cocktails or by expression of different types of transcription factors. In this concept, in vitro neurogenesis considered to be able to produce neuron cells to replace damaged neurons especially in Alzheimer and Parkinson disease. However, early successful experiments followed by major drawbacks such as low differentiation efficiency in producing neurons and detection of various undesirable types of cells in the culture. Therefore, there is not a single optimized common protocol for producing high quality neurons in vitro so far. This is partly due to the lack of our understanding about the precise cellular, genetic, and molecular mechanisms underlying neurogenesis via direct conversion. In the current work, we have employed meta-analysis tools and extensive gene regulatory network analysis on the high through put gene expression data obtained from previous reprogramming protocols to identify central gene regulatory components involved in direct conversion of fibroblasts into neurons. Our results identified miR-9, miR-30 as the most important miRNA and TP53, MYC, JUN, SP1 and SMAD2 considered to be the most important transcription factors. These findings would be useful for direct targeting these hub regulatory elements in order to increase the efficacy and specificity of the conversion protocols. This article is protected by copyright. All rights reserved.

  16. Pitx1 Broadly Associates with Limb Enhancers and is Enriched on Hindlimb cis-Regulatory Elements

    PubMed Central

    Infante, Carlos R.; Park, Sungdae; Mihala, Alexandra; Kingsley, David M.; Menke, Douglas B.

    2013-01-01

    Extensive functional analyses have demonstrated that the pituitary homeodomain transcription factor Pitx1 plays a critical role in specifying hindlimb morphology in vertebrates. However, much less is known regarding the target genes and cis-regulatory elements through which Pitx1 acts. Earlier studies suggested that the hindlimb transcription factors Tbx4, HoxC10, and HoxC11 might be transcriptional targets of Pitx1, but definitive evidence for direct regulatory interactions has been lacking. Using ChIP-Seq on embryonic mouse hindlimbs, we have pinpointed the genome-wide location of Pitx1 binding sites during mouse hindlimb development and identified potential gene targets for Pitx1. We determined that Pitx1 binding is significantly enriched near genes involved in limb morphogenesis, including Tbx4, HoxC10, and HoxC11. Notably, Pitx1 is bound to the previously identified HLEA and HLEB hindlimb enhancers of the Tbx4 gene and to a newly identified Tbx2 hindlimb enhancer. Moreover, Pitx1 binding is significantly enriched on hindlimb relative to forelimb-specific cis-regulatory features that are differentially marked by H3K27ac. However, our analysis revealed that Pitx1 also strongly associates with many functionally verified limb enhancers that exhibit similar levels of activity in the embryonic mesenchyme of forelimbs and hindlimbs. We speculate that Pitx1 influences hindlimb morphology both through the activation of hindlimb specific enhancers as well as through the hindlimb-specific modulation of enhancers that are active in both sets of limbs. PMID:23201014

  17. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway.

    PubMed

    Bhattacharya, Bonhi S; Sweby, Peter K; Minihane, Anne-Marie; Jackson, Kim G; Tindall, Marcus J

    2014-05-21

    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature.

  18. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  19. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway

    PubMed Central

    Bhattacharya, Bonhi S.; Sweby, Peter K.; Minihane, Anne-Marie; Jackson, Kim G.; Tindall, Marcus J.

    2014-01-01

    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature. PMID:24444765

  20. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  1. Tissue-specific SMARCA4 binding at active and repressed regulatory elements during embryogenesis.

    PubMed

    Attanasio, Catia; Nord, Alex S; Zhu, Yiwen; Blow, Matthew J; Biddie, Simon C; Mendenhall, Eric M; Dixon, Jesse; Wright, Crystal; Hosseini, Roya; Akiyama, Jennifer A; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Afzal, Veena; Ren, Bing; Bernstein, Bradley E; Rubin, Edward M; Visel, Axel; Pennacchio, Len A

    2014-06-01

    The SMARCA4 (also known as BRG1 in humans) chromatin remodeling factor is critical for establishing lineage-specific chromatin states during early mammalian development. However, the role of SMARCA4 in tissue-specific gene regulation during embryogenesis remains poorly defined. To investigate the genome-wide binding landscape of SMARCA4 in differentiating tissues, we engineered a Smarca4(FLAG) knock-in mouse line. Using ChIP-seq, we identified ∼51,000 SMARCA4-associated regions across six embryonic mouse tissues (forebrain, hindbrain, neural tube, heart, limb, and face) at mid-gestation (E11.5). The majority of these regions was distal from promoters and showed dynamic occupancy, with most distal SMARCA4 sites (73%) confined to a single or limited subset of tissues. To further characterize these regions, we profiled active and repressive histone marks in the same tissues and examined the intersection of informative chromatin states and SMARCA4 binding. This revealed distinct classes of distal SMARCA4-associated elements characterized by activating and repressive chromatin signatures that were associated with tissue-specific up- or down-regulation of gene expression and relevant active/repressed biological pathways. We further demonstrate the predicted active regulatory properties of SMARCA4-associated elements by retrospective analysis of tissue-specific enhancers and direct testing of SMARCA4-bound regions in transgenic mouse assays. Our results indicate a dual active/repressive function of SMARCA4 at distal regulatory sequences in vivo and support its role in tissue-specific gene regulation during embryonic development.

  2. OTX2 Activity at Distal Regulatory Elements Shapes the Chromatin Landscape of Group 3 Medulloblastoma.

    PubMed

    Boulay, Gaylor; Awad, Mary E; Riggi, Nicolo; Archer, Tenley C; Iyer, Sowmya; Boonseng, Wannaporn E; Rossetti, Nikki E; Naigles, Beverly; Rengarajan, Shruthi; Volorio, Angela; Kim, James C; Mesirov, Jill P; Tamayo, Pablo; Pomeroy, Scott L; Aryee, Martin J; Rivera, Miguel N

    2017-02-17

    Medulloblastoma is the most frequent malignant pediatric brain tumor and is divided into at least four subgroups known as WNT, SHH, Group 3, and Group 4. Here, we characterized gene regulation mechanisms in the most aggressive subtype, Group 3 tumors, through genome-wide chromatin and expression profiling. Our results show that most active distal sites in these tumors are occupied by the transcription factor OTX2. Highly active OTX2-bound enhancers are often arranged as clusters of adjacent peaks and are also bound by the transcription factor NEUROD1. These sites are responsive to OTX2 and NEUROD1 knockdown and could also be generated de novo upon ectopic OTX2 expression in primary cells, showing that OTX2 cooperates with NEUROD1 and plays a major role in maintaining and possibly establishing regulatory elements as a pioneer factor. Among OTX2 target genes, we identified the kinase NEK2, whose knockdown and pharmacologic inhibition decreased cell viability. Our studies thus show that OTX2 controls the regulatory landscape of Group 3 medulloblastoma through cooperative activity at enhancer elements and contributes to the expression of critical target genes.SIGNIFICANCE: The gene regulation mechanisms that drive medulloblastoma are not well understood. Using chromatin profiling, we find that the transcription factor OTX2 acts as a pioneer factor and, in cooperation with NEUROD1, controls the Group 3 medulloblastoma active enhancer landscape. OTX2 itself or its target genes, including the mitotic kinase NEK2, represent attractive targets for future therapies. Cancer Discov; 7(3); 1-14. ©2017 AACR.

  3. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter

    2014-01-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  4. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    PubMed Central

    2011-01-01

    Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs), which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell-specific gene expression. PMID

  5. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail: msafak@temple.edu

    2006-05-25

    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  6. Regulatory elements in the first intron contribute to transcriptional regulation of the beta 3 tubulin gene by 20-hydroxyecdysone in Drosophila Kc cells.

    PubMed Central

    Bruhat, A; Tourmente, S; Chapel, S; Sobrier, M L; Couderc, J L; Dastugue, B

    1990-01-01

    We have studied the transcriptional regulation of the beta 3 tubulin gene by the steroid hormone 20-hydroxyecdysone (20-OH-E) in Drosophila Kc cells. A series of hybrid genes with varying tubulin gene lengths driving the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. The promoter activity was assayed after transient expression in Kc cells, in the presence or absence of 20-OH-E. We find that 0.91Kb upstream from the transcription start site contain one or several hormone independent positive cis-acting elements, responsible for the constitutive expression of the beta 3 tubulin gene. In the large (4.5 Kb) first intron of this gene, we identified additional hormone dependent negative and positive regulatory elements, which can act in both directions and in a position-independence manner. Then, the negative intron element(s), which repress the transcription in the absence of 20-OH-E has characteristics of silencer. Images PMID:2349088

  7. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 1 2014-07-01 2014-07-01 false Additional required elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... EMPLOYMENT OPPORTUNITY, DEPARTMENT OF LABOR 2-AFFIRMATIVE ACTION PROGRAMS Purpose and Contents of...

  8. 41 CFR 60-2.17 - Additional required elements of affirmative action programs.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 41 Public Contracts and Property Management 1 2012-07-01 2009-07-01 true Additional required elements of affirmative action programs. 60-2.17 Section 60-2.17 Public Contracts and Property Management... EMPLOYMENT OPPORTUNITY, DEPARTMENT OF LABOR 2-AFFIRMATIVE ACTION PROGRAMS Purpose and Contents of...

  9. Identification of distal cis-regulatory elements at mouse mitoferrin loci using zebrafish transgenesis.

    PubMed

    Amigo, Julio D; Yu, Ming; Troadec, Marie-Berengere; Gwynn, Babette; Cooney, Jeffrey D; Lambert, Amy J; Chi, Neil C; Weiss, Mitchell J; Peters, Luanne L; Kaplan, Jerry; Cantor, Alan B; Paw, Barry H

    2011-04-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully drive the expression of Mfrn1 during blood and heart development and Mfrn2 ubiquitously. Through in vivo analyses of the Mfrn-CRMs in zebrafish and mouse, we demonstrate their functional and evolutionary conservation. Using knockdowns with morpholinos and cell sorting analysis in transgenic zebrafish embryos, we show that GATA-1 directly regulates the expression of Mfrn1. Mutagenesis of individual GATA-1 binding cis elements (GBE) demonstrated that at least two of the three GBE within this CRM are functionally required for GATA-mediated transcription of Mfrn1. Furthermore, ChIP assays demonstrate switching from GATA-2 to GATA-1 at these elements during erythroid maturation. Our results provide new insights into the genetic regulation of mitochondrial function and iron homeostasis and, more generally, illustrate the utility of genome-wide ChIP analysis combined with zebrafish transgenesis for identifying long-range transcriptional enhancers that regulate tissue development.

  10. c/EBPbeta is a major regulatory element driving transcriptional activation of the CXCL12 promoter.

    PubMed

    Calonge, E; Alonso-Lobo, J M; Escandón, C; González, N; Bermejo, M; Santiago, B; Mestre, L; Pablos, J L; Caruz, A; Alcamí, J

    2010-02-26

    CXCL12 is considered a constitutively expressed chemokine with homeostatic functions. However, induction of CXCL12 expression and its potential role in several pathologic conditions have been reported, suggesting that CXCL12 gene expression can be induced by different stimuli. To elucidate the molecular mechanisms involved in the regulation of CXCL12 gene expression, we aim to define the molecular factors that operate at the transcriptional level. Basal, constitutive expression of CXCL12 was dependent on basic helix-loop-helix factors. Transcriptional up-regulation of the CXCL12 gene was induced by cellular confluence or inflammatory stimuli such as interleukin-1 and interleukin-6, in a CCAAT/enhancer binding protein beta (c/EBPbeta)-dependent manner. Chromatin immunoprecipitation assays confirmed c/EBPbeta binding to a specific response element located at -1171 of the promoter region of CXCL12. Our data show that c/EBPbeta is a major regulatory element driving transcription of the CXCL12 gene in response to cytokines and cell confluence.

  11. An Altered State of a Specific EN Regulatory Element Induced in a Maize Tiller

    PubMed Central

    Fowler, Robert G.; Peterson, Peter A.

    1978-01-01

    There are numerous states of the regulatory element, Enhancer (En). With specific receptor alleles, such as a2m(r-pa-pu) or a2m(r), specific mutability patterns are expressed. One specific derivative En allele, En-v (En-variable), was originally identified with a coarse pattern of mutability with the a2m(r-pa-pu) allele and giving progeny with varied En expression (standard to reduced within an ear progeny). Derivatives of En-v were subsequently found on numerous occasions to give only a very reduced expression (fewer mutant spots) with the a2m(r-pa-pu) allele in the ears derived from the main stalk of the corn plant. When a comparison is made of the effect of this changed En-v state between tiller ears and main stalk ears of the same plant, the tiller ears show an increased level of En-v expression (coarse pattern), while the main-stalk ears continue to show the very reduced level of En-v expression (low frequency of very late variegation). This increased level of mutability of the tiller ears is maintained when transmitted through the main-stalk ear in the subsequent generation. These results indicate that heritable alterations of controlling elements can be produced by endogenous environmental factors present during normal plant development. PMID:17248873

  12. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

    PubMed

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE.

  13. Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis.

    PubMed Central

    Watanabe, N; Sakakibara, J; Hovanessian, A G; Taniguchi, T; Fujita, T

    1991-01-01

    Expression of the Type I IFN (i.e., IFN-alpha s and IFN-beta) genes is efficiently induced by viruses at the transcriptional level. This induction is mediated by at least two types of positive regulatory elements located in the human IFN-beta gene promoter: (1) the repeated elements which bind both the transcriptional activator IRF-1 and the repressor IRF-2 (IRF-elements; IRF-Es), and (2) the kappa B element (kappa B-E), which binds NF kappa B and is located between the IRF-Es and the TATA box. In this study we demonstrate that a promoter containing synthetic IRF-E, which displays high affinity for the IRFs can be efficiently activated by Newcastle disease virus (NDV). In contrast, such activation was either very weak or nil when cells were treated by IFN-beta or tumor necrosis factor-alpha (TNF-alpha), despite the fact they both efficiently induce de novo synthesis of the short-lived IRF-1 in L929 cells. In fact, efficient activation of the IRF-E apparently requires an event in addition to de novo IRF-1 induction, which can be elicited by NDV even in the presence of protein synthesis inhibitor, cycloheximide. Moreover, efficient activation of the IRF-E by NDV is specifically inhibited by the protein kinase inhibitor, Staurosporin. Hence our results suggest the importance of IRF-1 synthesis and post-translational modification event(s), possibly phosphorylation for the efficient activation of IRF-Es, which are otherwise under negative regulation by IRF-2. Images PMID:1886766

  14. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

    2012-01-01

    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  15. Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes

    PubMed Central

    Jegga, Anil G.; Sherwood, Shawn P.; Carman, James W.; Pinski, Andrew T.; Phillips, Jerry L.; Pestian, John P.; Aronow, Bruce J.

    2002-01-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions. PMID:12213778

  16. Detection and visualization of compositionally similar cis-regulatory element clusters in orthologous and coordinately controlled genes.

    PubMed

    Jegga, Anil G; Sherwood, Shawn P; Carman, James W; Pinski, Andrew T; Phillips, Jerry L; Pestian, John P; Aronow, Bruce J

    2002-09-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions.

  17. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  18. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  19. Forkhead transcription factor 1 inhibits endometrial cancer cell proliferation via sterol regulatory element-binding protein 1

    PubMed Central

    Zhang, Yifang; Zhang, Lili; Sun, Hengzi; Lv, Qingtao; Qiu, Chunping; Che, Xiaoxia; Liu, Zhiming; Jiang, Jie

    2017-01-01

    The morbidity and mortality associated with endometrial cancer (EC) has increased in recent years. Regarded as a tumor suppressor, forkhead transcription factor 1 (FOXO1) has various biological activities and participates in cell cycle progression, apoptosis and differentiation. Notably, FOXO1 also functions in the regulation of lipogenesis and energy metabolism. Lipogenesis is a feature of cancer and is upregulated in EC. Sterol regulatory element-binding protein 1 (SREBP1) is a transcription factor that is also able to regulate lipogenesis. Increased expression of SREBP1 is directly correlated with malignant transformation of tumors. A previous study demonstrated that SREBP1 was highly expressed in EC and directly resulted in tumorigenesis. However, the association between FOXO1 and SREBP1 in EC is not clear. In the present study, lentiviruses overexpressing FOXO1 were used in cell transfection and transduction. Cell viability assays demonstrated that the overexpression of FOXO1 was able to suppress cell proliferation significantly in Ishikawa and AN3 CA cell lines. In addition, FOXO1 overexpression significantly inhibited cell migration and invasion ability in vitro. In xenograft models, overexpression of FOXO1 suppressed cell tumorigenesis, and western blot analysis demonstrated that SREBP1 expression was markedly reduced in the FOXO1-overexpressing cells. It may therefore be concluded that FOXO1 is able to inhibit the proliferative capacity of cells in vitro and in vivo, in addition to the migratory and invasive capacities in vitro by directly targeting SREBP1. PMID:28356952

  20. Characterization of an upstream regulatory element of adenovirus L1 poly (A) site.

    PubMed

    Liu, Li

    2005-06-20

    The transition from early to late stage infection by adenovirus involves a change in mRNA expression from the adenovirus major late transcription unit (AdMLTU). This early to late switch centers around alternative selection of one of five poly (A) sites (L1-L5) that code for the major structural proteins of Adenovirus. During the early stage of infection, steady state mRNA is primarily derived from the L1 poly (A) site. During the late stage of infection, each of the MLTU poly (A) sites is represented in the steady state mRNA pool (Falck-Pedersen, E., Logan, J., 1989. Regulation of poly(A) site selection in adenovirus. J. Virol. 63 (2), 532-541.). Using transient transfection of a plasmid expressing Chloramphenicol Acetyl Transferase with a tandem poly (A) minigene system (L13) (DeZazzo, J.D., Falck-Pedersen, E., Imperiale, M.J., 1991. Sequences regulating temporal poly(A) site switching in the adenovirus major late transcription unit. Mol. Cell. Biol. 11 (12), 5977-5984; Prescott, J., Falck-Pedersen, E., 1994. Sequence elements upstream of the 3' cleavage site confer substrate strength to the adenovirus L1 and L3 polyadenylation sites. Mol. Cell. Biol. 14 (7), 4682-4693.), it has been demonstrated that the promoter-proximal L1 poly (A) site which is poorly recognized by the 3' end processing machinery, contains an upstream repressor element (URE) that influences steady state levels of mRNA (Prescott, J.C., Liu, L., Falck-Pedersen, E., 1997. Sequence-mediated regulation of adenovirus gene expression by repression of mRNA accumulation. Mol. Cell. Biol. 17 (4), 2207-2216.). In this study, we have further characterized the elements that mediate L1URE function. These studies indicate that the L1 upstream regulatory element (L1 URE) contains a complex RNA architecture that serves to repress gene expression through multiple sub-effectors. The L1URE functions when located upstream of a heterologous poly (A) site, and is able to strongly suppress steady state m

  1. Enhancing Surface Finish of Additively Manufactured Titanium and Cobalt Chrome Elements Using Laser Based Finishing

    NASA Astrophysics Data System (ADS)

    Gora, Wojciech S.; Tian, Yingtao; Cabo, Aldara Pan; Ardron, Marcus; Maier, Robert R. J.; Prangnell, Philip; Weston, Nicholas J.; Hand, Duncan P.

    Additive manufacturing (AM) offers the possibility of creating a complex free form object as a single element, which is not possible using traditional mechanical machining. Unfortunately the typically rough surface finish of additively manufactured parts is unsuitable for many applications. As a result AM parts must be post-processed; typically mechanically machined and/or and polished using either chemical or mechanical techniques (both of which have their limitations). Laser based polishing is based on remelting of a very thin surface layer and it offers potential as a highly repeatable, higher speed process capable of selective area polishing, and without any waste problems (no abrasives or liquids). In this paper an in-depth investigation of CW laser polishing of titanium and cobalt chrome AM elements is presented. The impact of different scanning strategies, laser parameters and initial surface condition on the achieved surface finish is evaluated.

  2. Heat shock regulatory elements are present in telomeric repeats of Chironomus thummi.

    PubMed

    Martinez, J L; Sanchez-Elsner, T; Morcillo, G; Diez, J L

    2001-11-15

    As in other Diptera, the telomeres of Chironomus thummi lack canonical short telomerase-specified repeats and instead contain complex sequences. They react to heat shock and other stress treatments by forming giant puffs at some chromosome termini, which are visible in polytene cells. All telomeres, except the telocentric end of chromosome four (4L), consist of large blocks of repeats, 176 bp in length. Three subfamilies of telomeric sequences have been found to show different distribution patterns between chromosome ends. TsA and TsC are characteristic of telomeres 3R and 4R, respectively, whereas TsB is present in the other non-telocentric telomeres. Heat shock transcription regulatory elements have been identified in the telomeric sequences, appearing differentially represented in the three subfamilies, but otherwise rather similar in size and sequence. Interestingly, TsA and TsB repeats share the well-conserved heat shock element (HSE) and GAGA motif, while the TATA box is only present in the former. Neither a HSE nor a TATA box appear in TsC repeats. Moreover, experimental data indicate that the HSE is functionally active in binding heat shock transcription factor (HSF). These results provide, for the first time, a molecular basis for the effect of heat shock on C.thummi telomeres and might also explain the different behaviour they show. A positive correlation between the presence of HSE and telomeric puffing and transcription under heat shock was demonstrated. This was also confirmed in the sibling species Chironomus piger. The significance of heat shock activation of telomeric repeats in relation to telomeric function is unknown at present, but it might be compared to the behaviour of other non-heat shock protein coding sequences, such as SINE-like and LINE-like retroelements, which have been reported to be activated by stress.

  3. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.

    2016-01-01

    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  4. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps.

    PubMed

    Setty, Manu; Leslie, Christina S

    2015-05-01

    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at http://cbio.mskcc.org/public/Leslie/SeqGL/.

  5. Drosophila gypsy insulator and yellow enhancers regulate activity of yellow promoter through the same regulatory element.

    PubMed

    Melnikova, Larisa; Kostuchenko, Margarita; Silicheva, Margarita; Georgiev, Pavel

    2008-04-01

    There is ample evidence that the enhancers of a promoterless yellow locus in one homologous chromosome can activate the yellow promoter in the other chromosome where the enhancers are inactive or deleted, which is indicative of a high specificity of the enhancer-promoter interaction in yellow. In this paper, we have found that the yellow sequence from -100 to -69 is essential for stimulation of the heterologous eve (TATA-containing) and white (TATA-less) promoters by the yellow enhancers from a distance. However, the presence of this sequence is not required when the yellow enhancers are directly fused to the heterologous promoters or are activated by the yeast GAL4 activator. Unexpectedly, the same promoter proximal region defines previously described promoter-specific, long-distance repression of the yellow promoter by the gypsy insulator on the mod(mdg4) ( u1 ) background. These finding suggest that proteins bound to the -100 to -69 sequence are essential for communication between the yellow promoter and upstream regulatory elements.

  6. MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice

    PubMed Central

    Horie, Takahiro; Nishino, Tomohiro; Baba, Osamu; Kuwabara, Yasuhide; Nakao, Tetsushi; Nishiga, Masataka; Usami, Shunsuke; Izuhara, Masayasu; Sowa, Naoya; Yahagi, Naoya; Shimano, Hitoshi; Matsumura, Shigenobu; Inoue, Kazuo; Marusawa, Hiroyuki; Nakamura, Tomoyuki; Hasegawa, Koji; Kume, Noriaki; Yokode, Masayuki; Kita, Toru; Kimura, Takeshi; Ono, Koh

    2013-01-01

    MicroRNAs (miRs) are small non-protein-coding RNAs that bind to specific mRNAs and inhibit translation or promote mRNA degradation. Recent reports have indicated that miR-33, which is located within the intron of sterol regulatory element-binding protein (SREBP) 2, controls cholesterol homoeostasis and may be a potential therapeutic target for the treatment of atherosclerosis. Here we show that deletion of miR-33 results in marked worsening of high-fat diet-induced obesity and liver steatosis. Using miR-33−/−Srebf1+/− mice, we demonstrate that SREBP-1 is a target of miR-33 and that the mechanisms leading to obesity and liver steatosis in miR-33−/− mice involve enhanced expression of SREBP-1. These results elucidate a novel interaction between SREBP-1 and SREBP-2 mediated by miR-33 in vivo. PMID:24300912

  7. Improved regulatory element prediction based on tissue-specific local epigenomic signatures

    PubMed Central

    He, Yupeng; Gorkin, David U.; Dickel, Diane E.; Nery, Joseph R.; Castanon, Rosa G.; Lee, Ah Young; Shen, Yin; Visel, Axel; Pennacchio, Len A.; Ren, Bing; Ecker, Joseph R.

    2017-01-01

    Accurate enhancer identification is critical for understanding the spatiotemporal transcriptional regulation during development as well as the functional impact of disease-related noncoding genetic variants. Computational methods have been developed to predict the genomic locations of active enhancers based on histone modifications, but the accuracy and resolution of these methods remain limited. Here, we present an algorithm, regulatory element prediction based on tissue-specific local epigenetic marks (REPTILE), which integrates histone modification and whole-genome cytosine DNA methylation profiles to identify the precise location of enhancers. We tested the ability of REPTILE to identify enhancers previously validated in reporter assays. Compared with existing methods, REPTILE shows consistently superior performance across diverse cell and tissue types, and the enhancer locations are significantly more refined. We show that, by incorporating base-resolution methylation data, REPTILE greatly improves upon current methods for annotation of enhancers across a variety of cell and tissue types. REPTILE is available at https://github.com/yupenghe/REPTILE/. PMID:28193886

  8. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  9. Modular Utilization of Distal cis-Regulatory Elements Controls Ifng Gene Expression in T Cells Activated by Distinct Stimuli

    PubMed Central

    Balasubramani, Anand; Shibata, Yoichiro; Crawford, Gregory E.; Baldwin, Albert S.; Hatton, Robin D.; Weaver, Casey T.

    2010-01-01

    SUMMARY Distal cis-regulatory elements play essential roles in the T lineage-specific expression of cytokine genes. We have mapped interactions of three transacting factors – NF-κB, STAT4 and T-bet – with cis elements in the Ifng locus. We find that RelA is critical for optimal Ifng expression and is differentially recruited to multiple elements contingent upon T cell receptor (TCR) or interleukin-12 (IL-12) plus IL-18 signaling. RelA recruitment to at least four elements is dependent on T-bet-dependent remodeling of the Ifng locus and co-recruitment of STAT4. STAT4 and NF-κB therefore cooperate at multiple cis elements to enable NF-κB–dependent enhancement of Ifng expression. RelA recruitment to distal elements was similar in Th1 and Tc1 effector cells, although T-bet was dispensable in CD8 effectors. These results support a model of Ifng regulation in which distal cis-regulatory elements differentially recruit key transcription factors in a modular fashion to initiate gene transcription induced by distinct activation signals. PMID:20643337

  10. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    PubMed Central

    2010-01-01

    Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc) family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE), is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta). The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection. PMID:20868489

  11. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J

    2006-01-01

    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  12. microRNAs and Alu elements in the p53-Mdm2-Mdm4 regulatory network.

    PubMed

    Hoffman, Yonit; Pilpel, Yitzhak; Oren, Moshe

    2014-06-01

    p53 is a transcription factor that governs numerous stress response pathways within the cell. Maintaining the right levels of p53 is crucial for cell survival and proper cellular homeostasis. The tight regulation of p53 involves many cellular components, most notably its major negative regulators Mdm2 and Mdm4, which maintain p53 protein amount and activity in tight check. microRNAs (miRNAs) are small non-coding RNAs that target specific mRNAs to translational arrest and degradation. miRNAs are also key components of the normal p53 pathway, joining forces with Mdm2 and Mdm4 to maintain proper p53 activity. Here we review the current knowledge of miRNAs targeting Mdm2 and Mdm4, and their importance in different tissues and in pathological states such as cancer. In addition, we address the role of Alu sequences-highly abundant retroelements spread throughout the human genome, and their impact on gene regulation via the miRNA machinery. Alus occupy a significant portion of genes' 3'UTR, and as such they have the potential to impact mRNA regulation. Since Alus are primate-specific, they introduce a new regulatory layer into primate genomes. Alus can influence and alter gene regulation, creating primate-specific cancer-preventive regulatory mechanisms to sustain the transition to longer life span in primates. We review the possible influence of Alu sequences on miRNA functionality in general and specifically within the p53 network.

  13. Integrated methylome and transcriptome analysis reveals novel regulatory elements in pediatric acute lymphoblastic leukemia

    PubMed Central

    Almamun, Md; Levinson, Benjamin T; van Swaay, Annette C; Johnson, Nathan T; McKay, Stephanie D; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2015-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer diagnosed in children under the age of 15. In addition to genetic aberrations, epigenetic modifications such as DNA methylation are altered in cancer and impact gene expression. To identify epigenetic alterations in ALL, genome-wide methylation profiles were generated using the methylated CpG island recovery assay followed by next-generation sequencing. More than 25,000 differentially methylated regions (DMR) were observed in ALL patients with ∼90% present within intronic or intergenic regions. To determine the regulatory potential of the DMR, whole-transcriptome analysis was performed and integrated with methylation data. Aberrant promoter methylation was associated with the altered expression of genes involved in transcriptional regulation, apoptosis, and proliferation. Novel enhancer-like sequences were identified within intronic and intergenic DMR. Aberrant methylation in these regions was associated with the altered expression of neighboring genes involved in cell cycle processes, lymphocyte activation and apoptosis. These genes include potential epi-driver genes, such as SYNE1, PTPRS, PAWR, HDAC9, RGCC, MCOLN2, LYN, TRAF3, FLT1, and MELK, which may provide a selective advantage to leukemic cells. In addition, the differential expression of epigenetic modifier genes, pseudogenes, and non-coding RNAs was also observed accentuating the role of erroneous epigenetic gene regulation in ALL. PMID:26308964

  14. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.

    PubMed

    Ahn, Sejin; Spatt, Dan; Winston, Fred

    2012-08-01

    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  15. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.

    PubMed

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-12-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  16. Gentiana manshurica Kitagawa reverses acute alcohol-induced liver steatosis through blocking sterol regulatory element-binding protein-1 maturation.

    PubMed

    Lian, Li-Hua; Wu, Yan-Ling; Song, Shun-Zong; Wan, Ying; Xie, Wen-Xue; Li, Xin; Bai, Ting; Ouyang, Bing-Qing; Nan, Ji-Xing

    2010-12-22

    This study was undertaken to investigate the protective effects of Gentiana manshurica Kitagawa (GM) on acute alcohol-induced fatty liver. Mice were treated with ethanol (5 g/kg of body weight) by gavage every 12 h for a total of three doses to induce acute fatty liver. Methanol extract of GM (50, 100, or 200 mg/kg) or silymarin (100 mg/kg) was gavaged simultaneously with ethanol for three doses. GM administration significantly reduced the increases in serum ALT and AST levels, the serum and hepatic triglyceride levels, at 4 h after the last ethanol administration. GM was also found to prevent ethanol-induced hepatic steatosis and necrosis, as indicated by liver histopathological studies. Additionally, GM suppressed the elevation of malondialdehyde (MDA) levels, restored the glutathione (GSH) levels, and enhanced the superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) activities. The concurrent administration of GM efficaciously abrogated cytochrome P450 2E1 (CYP2E1) induction. Moreover, GM significantly reduced the nuclear translocation of sterol regulatory element-binding protein-1 (nSREBP-1) in ethanol-treated mice. These data indicated that GM possessed the ability to prevent ethanol-induced acute liver steatosis, possibly through blocking CYP2E1-mediated free radical scavenging effects and SREBP-1-regulated fatty acid synthesis. Especially, GM may be developed as a potential therapeutic candidate for ethanol-induced oxidative damage in liver.

  17. Effects of extreme pressure additive chemistry on rolling element bearing surface durability

    SciTech Connect

    Evans, Ryan D.; Nixon, H. P.; Darragh, Craig V.; Howe, Jane Y; Coffey, Dorothy W

    2007-01-01

    Lubricant additives have been known to affect rolling element bearing surface durability for many years. Tapered roller bearings were used in fatigue testing of lubricants formulated with gear oil type additive systems. These systems have sulfur- and phosphoruscontaining compounds used for gear protection as well as bearing lubrication. Several variations of a commercially available base additive formulation were tested having modified sulfur components. The variations represent a range of ''active'' extreme pressure (EP) chemistries. The bearing fatigue test results were compared with respect to EP formulation and test conditions. Inner ring near-surface material in selected test bearings was evaluated on two scales: the micrometer scale using optical metallography and the nanometer scale using transmission electron microscopy (TEM). Focused-ion beam (FIB) techniques were used for TEM specimen preparation. Imaging and chemical analysis of the bearing samples revealed near-surface material and tribofilm characteristics. These results are discussed with respect to the relative fatigue lives.

  18. Control of mRNA decapping by positive and negative regulatory elements in the Dcp2 C-terminal domain

    PubMed Central

    He, Feng; Jacobson, Allan

    2015-01-01

    Decapping commits an mRNA to complete degradation and promotes general 5′ to 3′ decay, nonsense-mediated decay (NMD), and transcript-specific degradation. In Saccharomyces cerevisiae, a single decapping enzyme composed of a regulatory subunit (Dcp1) and a catalytic subunit (Dcp2) targets thousands of distinct substrate mRNAs. However, the mechanisms controlling this enzyme's in vivo activity and substrate specificity remain elusive. Here, using a genetic approach, we show that the large C-terminal domain of Dcp2 includes a set of conserved negative and positive regulatory elements. A single negative element inhibits enzymatic activity and controls the downstream functions of several positive elements. The positive elements recruit the specific decapping activators Edc3, Pat1, and Upf1 to form distinct decapping complexes and control the enzyme's substrate specificity and final activation. Our results reveal unforeseen regulatory mechanisms that control decapping enzyme activity and function in vivo, and define roles for several decapping activators in the regulation of mRNA decapping. PMID:26184073

  19. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.

    1973-01-01

    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  20. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    PubMed

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  1. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  2. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K

    1998-01-01

    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  3. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2016-01-01

    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  4. Nucleotide-specific recognition of iron-responsive elements by iron regulatory protein 1.

    PubMed

    Selezneva, Anna I; Walden, William E; Volz, Karl W

    2013-09-23

    IRP1 [iron regulatory protein (IRP) 1] is a bifunctional protein with mutually exclusive end-states. In one mode of operation, IRP1 binds iron-responsive element (IRE) stem-loops in messenger RNAs encoding proteins of iron metabolism to control their rate of translation. In its other mode, IRP1 serves as cytoplasmic aconitase to correlate iron availability with the energy and oxidative stress status of the cell. IRP1/IRE binding occurs through two separate interfaces, which together contribute about two-dozen hydrogen bonds. Five amino acids make base-specific contacts and are expected to contribute significantly to binding affinity and specificity of this protein:RNA interaction. In this mutagenesis study, each of the five base-specific amino acids was changed to alter binding at each site. Analysis of IRE binding affinity and translational repression activity of the resulting IRP1 mutants showed that four of the five contact points contribute uniquely to the overall binding affinity of the IRP1:IRE interaction, while one site was found to be unimportant. The stronger-than-expected effect on binding affinity of mutations at Lys379 and Ser681, residues that make contact with the conserved nucleotides G16 and C8, respectively, identified them as particularly critical for providing specificity and stability to IRP1:IRE complex formation. We also show that even though the base-specific RNA-binding residues are not part of the aconitase active site, their substitutions can affect the aconitase activity of holo-IRP1, positively or negatively.

  5. Overview of regulatory strategies and molecular elements in metabolic engineering of bacteria.

    PubMed

    Wang, Tianwen; Ma, Xingyuan; Du, Guocheng; Chen, Jian

    2012-11-01

    From a viewpoint of biotechnology, metabolic engineering mainly aims to change the natural status of a pathway in a microorganism towards the overproduction of certain bioproducts. The biochemical nature of a pathway implies us that changed pathway is often the collective results of altered behavior of the metabolic enzymes encoded by corresponding genes. By finely modulating the expression of these genes or the properties of the enzyme, we can gain efficient control on the pathway. In this article, we reviewed the typical methods that have been applied to regulate the expression of genes in metabolic engineering. These methods are grouped according to the operation targets in a typical gene. The transcription of a gene is controlled by an indispensable promoter. By utilizing promoters with different strengths, expected levels of expression can be easily achieved, and screening a promoter library may find suitable mutant promoters that can provide tunable expression of a gene. Auto-responsive promoter (quorum sensing (QS)-based or oxygen-inducible) simplifies the induction process by driving the expression of a gene in an automated manner. Light responsive promoter enables reversible and noninvasive control on gene activity, providing a promising method in controlling gene expression with time and space resolution in metabolic engineering involving complicated genetic circuits. Through directed evolution and/or rational design, the encoding sequences of a gene can be altered, leading to the possibly most profound changes in properties of a metabolic enzyme. Introducing an engineered riboswitch in mRNA can make it a regulatory molecule at the same time; ribosomal binding site is commonly engineered to be more attractive for a ribosome through design. Terminator of a gene will affect the stability of an mRNA, and intergenic region will influence the expression of many related genes. Improving the performance of these elements are generally the main activities in

  6. Impact of Zn, Mg, Ni and Co elements on glass alteration: Additive effects

    NASA Astrophysics Data System (ADS)

    Aréna, H.; Godon, N.; Rébiscoul, D.; Podor, R.; Garcès, E.; Cabie, M.; Mestre, J.-P.

    2016-03-01

    The minor elements present in the nuclear glass composition or coming from the groundwater of the future repository may impact glass alteration. In this study, the effects of Zn, Mg, Ni and Co on the International Simple Glass (ISG) alteration were studied throughout 511 days of aqueous leaching experiments. The aim was to determine their additive or competitive effect on glass alteration and the nature of the alteration products. The four elements were introduced separately or altogether in solution as XCl2 chloride salts (X = Zn, Mg, Ni or Co) with monthly additions to compensate for their consumption. The alteration kinetics were determined by leachate analyses (ICP-AES) and alteration products were characterized in terms of composition, morphology and microstructure (SEM, TEM-EDX, ToF-SIMS and XRD). Results indicate that when they are introduced separately, Zn, Mg, Ni and Co have the same qualitative and quantitative effect on glass alteration kinetics and on pH: they form secondary phases leading to a pH decrease and a significant increase in glass alteration. The secondary phases were identified as silicates of the added X element: trioctahedral smectites with a stoichiometry of[(Si(4-a) Ala) (X(3-b) Alb) O10 (OH)2](a+b)- [Xc Nad Cae] (2c+d+2e) + with a = 0.11 to 0.45, b = 0.00 to 0.29, c = 0, d = 0.19 to 0.74 and e = 0.10 to 0.14. . It was shown that as pH stabilizes at a minimum value, X-silicates no longer precipitate, thus leading to a significant drop in the glass alteration rate. This pH value depends on X and it has been identified as being 8 for Mg-silicates, probably around 7.3 for Ni and Co-silicates and less than 6.2 for Zn-silicates. When tested together, the effects of these four elements on glass alteration are additive and lead to the formation of a mix of X-silicates that precipitate as long as their constitutive elements are available and the pH is above their respective minimum value. This study brings new quantitative information about the

  7. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  8. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.

    PubMed

    Sharif, K A; Li, C; Gudas, L J

    2001-05-01

    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  9. Laser Additive Melting and Solidification of Inconel 718: Finite Element Simulation and Experiment

    NASA Astrophysics Data System (ADS)

    Romano, John; Ladani, Leila; Sadowski, Magda

    2016-03-01

    The field of powdered metal additive manufacturing is experiencing a surge in public interest finding uses in aerospace, defense, and biomedical industries. The relative youth of the technology coupled with public interest makes the field a vibrant research topic. The authors have expanded upon previously published finite element models used to analyze the processing of novel engineering materials through the use of laser- and electron beam-based additive manufacturing. In this work, the authors present a model for simulating fabrication of Inconel 718 using laser melting processes. Thermal transport phenomena and melt pool geometries are discussed and validation against experimental findings is presented. After comparing experimental and simulation results, the authors present two correction correlations to transform the modeling results into meaningful predictions of actual laser melting melt pool geometries in Inconel 718.

  10. The Wavelet Element Method. Part 2; Realization and Additional Features in 2D and 3D

    NASA Technical Reports Server (NTRS)

    Canuto, Claudio; Tabacco, Anita; Urban, Karsten

    1998-01-01

    The Wavelet Element Method (WEM) provides a construction of multiresolution systems and biorthogonal wavelets on fairly general domains. These are split into subdomains that are mapped to a single reference hypercube. Tensor products of scaling functions and wavelets defined on the unit interval are used on the reference domain. By introducing appropriate matching conditions across the interelement boundaries, a globally continuous biorthogonal wavelet basis on the general domain is obtained. This construction does not uniquely define the basis functions but rather leaves some freedom for fulfilling additional features. In this paper we detail the general construction principle of the WEM to the 1D, 2D and 3D cases. We address additional features such as symmetry, vanishing moments and minimal support of the wavelet functions in each particular dimension. The construction is illustrated by using biorthogonal spline wavelets on the interval.

  11. Seawater-derived rare earth element addition to abyssal peridotites during serpentinization

    NASA Astrophysics Data System (ADS)

    Frisby, Carl; Bizimis, Michael; Mallick, Soumen

    2016-04-01

    Serpentinized abyssal peridotites are evidence for active communication between the Earth's hydrosphere and the upper mantle, where exchange and retention of both major and trace elements occur. Bulk rock Nd isotopes in serpentinized abyssal peridotites imply interaction of seawater with the peridotite. In contrast, the Nd isotopes of clinopyroxenes from serpentinized abyssal peridotites retain their primary magmatic signature. It is currently unclear if, how and where seawater-derived Nd and other REE are being added or exchanged with the mantle peridotite minerals during serpentinization. To remedy this knowledge gap, we present in situ trace and major element concentrations, bulk rock and sequential leaching experiment trace element concentrations as well as Nd, Sr isotope data on refertilized and depleted serpentinized abyssal peridotites from the Southwest Indian Ridge. The secondary serpentine matrix and magnetite veins in these peridotites have elevated LREE concentrations, with variable negative Ce anomalies and large Rb, Sr, Pb and U enrichments that resemble seawater trace element patterns. The LREE concentrations in the serpentine phase are higher than those expected for the primary mantle mineralogy (olivine, orthopyroxene) based on data from relic clinopyroxenes and equilibrium partition coefficients. These data are consistent with seawater-derived REE addition to the peridotite during serpentinization. The bulk rocks have more radiogenic Sr and more unradiogenic Nd isotopes than their clinopyroxene (up to 8 εNd units lower than clinopyroxene). Sequential leaching experiments designed to mobilize secondary carbonates and Fe-oxides show even more unradiogenic Nd isotope ratios in the leachates than the bulk rock and clinopyroxene, approaching seawater compositions (up to 15 εNd units lower than clinopyroxene). Mass balance calculations using trace elements or Nd isotopes suggest that up to 30% of the bulk peridotite Nd budget is of seawater origin and

  12. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  13. Non-additive interactions involving two distinct elements mediate sloppy-paired regulation by pair-rule transcription factors

    PubMed Central

    Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter

    2010-01-01

    The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028

  14. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.

    PubMed

    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi

    2004-04-01

    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6.

  15. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.

    PubMed

    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia

    2013-08-15

    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  16. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling.

    PubMed

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua

    2014-04-02

    The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method.

  17. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling

    PubMed Central

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua

    2014-01-01

    Summary The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method. PMID:25061254

  18. Differential contribution of cis-regulatory elements to higher order chromatin structure and expression of the CFTR locus

    PubMed Central

    Yang, Rui; Kerschner, Jenny L.; Gosalia, Nehal; Neems, Daniel; Gorsic, Lidija K.; Safi, Alexias; Crawford, Gregory E.; Kosak, Steven T.; Leir, Shih-Hsing; Harris, Ann

    2016-01-01

    Higher order chromatin structure establishes domains that organize the genome and coordinate gene expression. However, the molecular mechanisms controlling transcription of individual loci within a topological domain (TAD) are not fully understood. The cystic fibrosis transmembrane conductance regulator (CFTR) gene provides a paradigm for investigating these mechanisms. CFTR occupies a TAD bordered by CTCF/cohesin binding sites within which are cell-type-selective cis-regulatory elements for the locus. We showed previously that intronic and extragenic enhancers, when occupied by specific transcription factors, are recruited to the CFTR promoter by a looping mechanism to drive gene expression. Here we use a combination of CRISPR/Cas9 editing of cis-regulatory elements and siRNA-mediated depletion of architectural proteins to determine the relative contribution of structural elements and enhancers to the higher order structure and expression of the CFTR locus. We found the boundaries of the CFTR TAD are conserved among diverse cell types and are dependent on CTCF and cohesin complex. Removal of an upstream CTCF-binding insulator alters the interaction profile, but has little effect on CFTR expression. Within the TAD, intronic enhancers recruit cell-type selective transcription factors and deletion of a pivotal enhancer element dramatically decreases CFTR expression, but has minor effect on its 3D structure. PMID:26673704

  19. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).

    PubMed

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav

    2016-10-01

    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  20. Simulation of Powder Layer Deposition in Additive Manufacturing Processes Using the Discrete Element Method

    SciTech Connect

    Herbold, E. B.; Walton, O.; Homel, M. A.

    2015-10-26

    This document serves as a final report to a small effort where several improvements were added to a LLNL code GEODYN-­L to develop Discrete Element Method (DEM) algorithms coupled to Lagrangian Finite Element (FE) solvers to investigate powder-­bed formation problems for additive manufacturing. The results from these simulations will be assessed for inclusion as the initial conditions for Direct Metal Laser Sintering (DMLS) simulations performed with ALE3D. The algorithms were written and performed on parallel computing platforms at LLNL. The total funding level was 3-­4 weeks of an FTE split amongst two staff scientists and one post-­doc. The DEM simulations emulated, as much as was feasible, the physical process of depositing a new layer of powder over a bed of existing powder. The DEM simulations utilized truncated size distributions spanning realistic size ranges with a size distribution profile consistent with realistic sample set. A minimum simulation sample size on the order of 40-­particles square by 10-­particles deep was utilized in these scoping studies in order to evaluate the potential effects of size segregation variation with distance displaced in front of a screed blade. A reasonable method for evaluating the problem was developed and validated. Several simulations were performed to show the viability of the approach. Future investigations will focus on running various simulations investigating powder particle sizing and screen geometries.

  1. Failure location prediction by finite element analysis for an additive manufactured mandible implant.

    PubMed

    Huo, Jinxing; Dérand, Per; Rännar, Lars-Erik; Hirsch, Jan-Michaél; Gamstedt, E Kristofer

    2015-09-01

    In order to reconstruct a patient with a bone defect in the mandible, a porous scaffold attached to a plate, both in a titanium alloy, was designed and manufactured using additive manufacturing. Regrettably, the implant fractured in vivo several months after surgery. The aim of this study was to investigate the failure of the implant and show a way of predicting the mechanical properties of the implant before surgery. All computed tomography data of the patient were preprocessed to remove metallic artefacts with metal deletion technique before mandible geometry reconstruction. The three-dimensional geometry of the patient's mandible was also reconstructed, and the implant was fixed to the bone model with screws in Mimics medical imaging software. A finite element model was established from the assembly of the mandible and the implant to study stresses developed during mastication. The stress distribution in the load-bearing plate was computed, and the location of main stress concentration in the plate was determined. Comparison between the fracture region and the location of the stress concentration shows that finite element analysis could serve as a tool for optimizing the design of mandible implants.

  2. CASCADES AFTER K-VACANCY PRODUCTION AND ADDITIONAL IONIZATION OR EXCITATION IN ATOMS OF LIGHT ELEMENTS

    SciTech Connect

    Kucas, S.; Momkauskaitė, A.; Karazija, R.

    2015-09-01

    The results of Auger and radiative cascades after the production of a vacancy in the K-shell and the additional ionization or excitation of the other shell are presented for the various ions of astrophysically important elements, namely, Ne, Mg, Si, S, and Ar. The detailed level-by-level calculations are performed using a single-configuration quasi-relativistic approximation. The populations of the levels of the excited configurations produced during a cascade as well as for the final ions are presented. These data enable us to take into account two-electron processes at the K-shell ionization, and thus to supplement the results of our earlier investigation of K-vacancy cascades.

  3. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  4. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    PubMed

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  5. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed Central

    Rindt, H; Knotts, S; Robbins, J

    1995-01-01

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7878016

  6. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed

    Rindt, H; Knotts, S; Robbins, J

    1995-02-28

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter.

  7. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin

    2001-02-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  8. Nitrogen addition alters elemental stoichiometry within soil aggregates in a temperate steppe

    NASA Astrophysics Data System (ADS)

    Yin, Jinfei; Wang, Ruzhen; Liu, Heyong; Feng, Xue; Xu, Zhuwen; Jiang, Yong

    2016-11-01

    Ongoing increases in anthropogenic nitrogen (N) inputs have largely affected soil carbon (C) and nutrient cycling in most terrestrial ecosystems. Numerous studies have concerned the effects of elevated N inputs on soil dissolved organic carbon (DOC), dissolved inorganic N (DIN), available phosphorus (AP), exchangeable calcium (Ca) and magnesium (Mg), and available iron (Fe) and manganese (Mn). However, few have emphasized the stoichiometric traits of these soil parameters, especially within different soil aggregate fractions. In a semiarid grassland of Inner Mongolia, we studied the effect of N addition on the ratios of DOC : DIN, DOC : AP, DIN : AP, exchangeable Ca : Mg, available Fe : Mn within three soil aggregate classes of large macroaggregates (> 2000 µm), small macroaggregates (250-2000 µm), and microaggregates (< 250 µm). Elevated N inputs significantly decreased the DOC : DIN ratio within three soil aggregates. The soil DOC : AP ratio significantly decreased along with increasing N gradients within large macroaggregates and microaggregates. Nitrogen significantly decreased the ratio of exchangeable Ca : Mg within soil macroaggregates. The ratio of available Fe : Mn decreased with N addition within three soil aggregate classes. Alteration of elemental stoichiometry within soil fractions that are characterized by different nutrient retention capacity will influence the chemical composition of soil microorganisms and plant quality.

  9. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.

    2012-01-01

    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  10. Mutations in the hormone regulatory element of mouse mammary tumor virus differentially affect the response to progestins, androgens, and glucocorticoids.

    PubMed Central

    Gowland, P L; Buetti, E

    1989-01-01

    Transcription of the mouse mammary tumor virus DNA is known to be induced by several steroid hormones. Using chimeric MMTV plasmids containing mutations within the hormone regulatory element, we have previously studied the regions required for the glucocorticoid response in mouse fibroblasts. Here we report the characterization of elements essential for the stimulation by progestins and androgens as compared with glucocorticoids. The same set of mutant plasmids was transfected into the human mammary tumor cell line T47D, and the specific transcripts were analyzed by an S1 nuclease protection assay. Androgen-mediated stimulation, although weak, showed an extended sensitivity to mutations, with a slight preference for the proximal region. The results with progestin suggest that sequences within all the described sites protected by the receptor in vitro are required and that the promoter-proximal region (-128 to -78 from the RNA start site) is more important than the distal one (-190 to -160). Moreover, a binding site for nuclear factor I was not required for the progestin response, whereas it was required for glucocorticoids. Thus, the various steroid receptors play a role in the differential regulation of mouse mammary tumor virus transcription by recognizing distinct sequence differences in the hormone regulatory element and interacting with different factors bound to the promoter. Images PMID:2550809

  11. Scavenger receptor A gene regulatory elements target gene expression to macrophages and to foam cells of atherosclerotic lesions.

    PubMed Central

    Horvai, A; Palinski, W; Wu, H; Moulton, K S; Kalla, K; Glass, C K

    1995-01-01

    Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7777517

  12. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.

    PubMed

    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud

    2016-08-01

    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor.

  13. Effects of heavy metal and other elemental additives to activated sludge on growth of Eisenia foetida

    SciTech Connect

    Hartenstein, R.; Neuhauser, E.F.; Narahara, A.

    1981-09-01

    The approximate level at which added concentrations of certain elements would cause an activated sludge to induce a toxic effect upon the growth of Eisenia foetida was determined. During 43 trials on sludge samples obtained throughout 1 year of study, earthworms grew from 3 to 10 mg live wt at hatching to 792 mg +- 18% (mean +- C.V.) in 8 weeks, when sludge was 24/sup 0/C and contained no additives. None of several elements commonly used in microbial growth media enhanced the growth rate of the earthworm. At salt concentrations up to about 6.6% on a dry wt basis, none of six anions tested was in and of itself toxic, while five of 15 cations - Co, Hg, Cu, Ni, and Cd - appeared specifically to inhibit growth rate or cause death. Manganese, Cr, and Pb were innocuous even at the highest levels of application - 22,000, 46,000, and 52,000 mg/kg, respectively. Neither the anionic nor cationic component of certain salts, such as NaCl or NH/sub 4/Cl, could be said to inhibit growth, which occurred only at high concentrations of these salts (about 3.3 and/or 6.6%). Below 7 mmho/cm, toxicity could not be correlated with electrolytic conductance, though higher values may help to explain the nonspecific growth inhibitory effects of salts like NaCl and KCl. Nor could toxicity ever be ascribed to hydrogen ion activity, since sludge pH was not altered even at the highest salt dose. It is concluded that except under very extreme conditions, the levels of heavy metals and salts generally found in activated sludges will not have an adverse affect on the growth of E. foetida.

  14. BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation.

    PubMed Central

    Kihara-Negishi, F; Tsujita, R; Negishi, Y; Ariga, H

    1993-01-01

    BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct

  15. Deformed protein binding sites and cofactor binding sites are required for the function of a small segment-specific regulatory element in Drosophila embryos.

    PubMed Central

    Zeng, C; Pinsonneault, J; Gellon, G; McGinnis, N; McGinnis, W

    1994-01-01

    How each of the homeotic selector proteins can regulate distinct sets of DNA target elements in embryos is not understood. Here we describe a detailed functional dissection of a small element that is specifically regulated by the Deformed homeotic protein. This 120 bp element (module E) is part of a larger 2.7 kb autoregulatory enhancer that maintains Deformed (Dfd) transcription in the epidermis of the maxillary and mandibular segments of Drosophila embryos. In vitro binding assays show that module E contains only one Dfd protein binding site. Mutations in the Dfd binding site that increase or decrease its in vitro affinity for Dfd protein generate parallel changes in the regulatory activity of module E in transgenic embryos, strong evidence that the in vitro-defined binding site is a direct target of Dfd protein in embryos. However, a monomer or multimer of the Dfd binding region alone is not sufficient to supply Dfd-dependent, segment-specific reporter gene expression. An analysis of a systematic series of clustered point mutations in module E revealed that an additional region containing an imperfect inverted repeat sequence is also required for the function of this homeotic protein response element. The Dfd binding site and the putative cofactor binding site(s) in the region of the inverted repeat are both necessary and in combination sufficient for the function of module E. Images PMID:7910795

  16. Extension to linear dynamics for hybrid stress finite element formulation based on additional displacements

    NASA Astrophysics Data System (ADS)

    Sumihara, K.

    Based upon legitimate variational principles, one microscopic-macroscopic finite element formulation for linear dynamics is presented by Hybrid Stress Finite Element Method. The microscopic application of Geometric Perturbation introduced by Pian and the introduction of infinitesimal limit core element (Baby Element) have been consistently combined according to the flexible and inherent interpretation of the legitimate variational principles initially originated by Pian and Tong. The conceptual development based upon Hybrid Finite Element Method is extended to linear dynamics with the introduction of physically meaningful higher modes.

  17. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  18. Prediction of cis-regulatory elements for drug-activated transcription factors in the regulation of drug-metabolising enzymes and drug transporters.

    PubMed

    Podvinec, Michael; Meyer, Urs A

    2006-06-01

    The expression of drug-metabolising enzymes is affected by many endogenous and exogenous factors, including sex, age, diet and exposure to xenobiotics and drugs. To understand fully how the organism metabolises a drug, these alterations in gene expression must be taken into account. The central process, the definition of likely regulatory elements in the genes coding for enzymes and transporters involved in drug disposition, can be vastly accelerated using existing and emerging bioinformatics methods to unravel the regulatory networks causing drug-mediated induction of genes. Here, various approaches to predict transcription factor interactions with regulatory DNA elements are reviewed.

  19. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  20. Distal cis-regulatory elements are required for tissue-specific expression of enamelin (Enam)

    PubMed Central

    Hu, Yuanyuan; Papagerakis, Petros; Ye, Ling; Feng, Jerry Q.; Simmer, James P.; Hu, Jan C-C.

    2009-01-01

    Enamel formation is orchestrated by the sequential expression of genes encoding enamel matrix proteins; however, the mechanisms sustaining the spatio–temporal order of gene transcription during amelogenesis are poorly understood. The aim of this study was to characterize the cis-regulatory sequences necessary for normal expression of enamelin (Enam). Several enamelin transcription regulatory regions, showing high sequence homology among species, were identified. DNA constructs containing 5.2 or 3.9 kb regions upstream of the enamelin translation initiation site were linked to a LacZ reporter and used to generate transgenic mice. Only the 5.2-Enam–LacZ construct was sufficient to recapitulate the endogenous pattern of enamelin tooth-specific expression. The 3.9-Enam–LacZ transgenic lines showed no expression in dental cells, but ectopic β-galactosidase activity was detected in osteoblasts. Potential transcription factor-binding sites were identified that may be important in controlling enamelin basal promoter activity and in conferring enamelin tissue-specific expression. Our study provides new insights into regulatory mechanisms governing enamelin expression. PMID:18353004

  1. Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci.

    PubMed

    Canver, Matthew C; Lessard, Samuel; Pinello, Luca; Wu, Yuxuan; Ilboudo, Yann; Stern, Emily N; Needleman, Austen J; Galactéros, Frédéric; Brugnara, Carlo; Kutlar, Abdullah; McKenzie, Colin; Reid, Marvin; Chen, Diane D; Das, Partha Pratim; A Cole, Mitchel; Zeng, Jing; Kurita, Ryo; Nakamura, Yukio; Yuan, Guo-Cheng; Lettre, Guillaume; Bauer, Daniel E; Orkin, Stuart H

    2017-02-20

    Cas9-mediated, high-throughput, saturating in situ mutagenesis permits fine-mapping of function across genomic segments. Disease- and trait-associated variants identified in genome-wide association studies largely cluster at regulatory loci. Here we demonstrate the use of multiple designer nucleases and variant-aware library design to interrogate trait-associated regulatory DNA at high resolution. We developed a computational tool for the creation of saturating-mutagenesis libraries with single or multiple nucleases with incorporation of variants. We applied this methodology to the HBS1L-MYB intergenic region, which is associated with red-blood-cell traits, including fetal hemoglobin levels. This approach identified putative regulatory elements that control MYB expression. Analysis of genomic copy number highlighted potential false-positive regions, thus emphasizing the importance of off-target analysis in the design of saturating-mutagenesis experiments. Together, these data establish a widely applicable high-throughput and high-resolution methodology to identify minimal functional sequences within large disease- and trait-associated regions.

  2. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    PubMed

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  3. Phosphorylation of sterol regulatory element binding protein-1a by protein kinase A (PKA) regulates transcriptional activity.

    PubMed

    Dong, Qingming; Giorgianni, Francesco; Deng, Xiong; Beranova-Giorgianni, Sarka; Bridges, Dave; Park, Edwards A; Raghow, Rajendra; Elam, Marshall B

    2014-07-11

    The counter-regulatory hormone glucagon inhibits lipogenesis via downregulation of sterol regulatory element binding protein 1 (SREBP-1). The effect of glucagon is mediated via protein kinase A (PKA). To determine if SREBP-1 is a direct phosphorylation target of PKA, we conducted mass spectrometry analysis of recombinant n-terminal SREBP-1a following PKA treatment in vitro. This analysis identified serines 331/332 as bona-fide phosphorylation targets of PKA. To determine the functional consequences of phosphorylation at these sites, we constructed mammalian expression vector for both nSREBP-1a and 1c isoforms in which the candidate PKA phosphorylation sites were mutated to active phosphomimetic or non-phosphorylatable amino acids. The transcriptional activity of SREBP was reduced by the phosphomimetic mutation of S332 of nSREBP-1a and the corresponding serine (S308) of nSREBP-1c. This site is a strong candidate for mediating the negative regulatory effect of glucagon on SREBP-1 and lipogenesis.

  4. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    PubMed

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo.

  5. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter

    PubMed Central

    Wang, Yaolai; Liu, Feng; Wang, Wei

    2016-01-01

    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ54-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. PMID:27899598

  6. Addition of organic amendments contributes to C sequestration in trace element contaminated soils.

    NASA Astrophysics Data System (ADS)

    del Mar Montiel Rozas, María; Panettier, Marco; Madejón Rodríguez, Paula; Madejón Rodríguez, Engracia

    2015-04-01

    Nowadays, the study of global C cycle and the different natural sinks of C have become especially important in a climate change context. Fluxes of C have been modified by anthropogenic activities and, presently, the global objective is the decrease of net CO2 emission. For this purpose, many studies are being conducted at local level for evaluate different C sequestration strategies. These techniques must be, in addition to safe in the long term, environmentally friendly. Restoration of contaminated and degraded areas is considered as a strategy for SOC sequestration. Our study has been carried out in the Guadiamar Green Corridor (Seville, Spain) affected by the Aznalcóllar mining accident. This accident occurred 16 years ago, due to the failure of the tailing dam which contained 4-5 million m3 of toxic tailings (slurry and acid water).The affected soils had a layer of toxic sludge containing heavy metals as As, Cd, Cu, Pb and Zn. Restoration techniques began to be applied just after the accident, including the removal of the toxic sludge and a variable layer of topsoil (10-30 cm) from the surface. In a second phase, in a specific area (experimental area) of the Green Corridor the addition of organic amendments (Biosolid compost (BC) and Leonardite (LE), a low grade coal rich in humic acids) was carried out to increase pH, organic matter and fertility in a soil which lost its richest layer during the clean-up operation. In our experimental area, half of the plots (A) received amendments for four years (2002, 2003, 2006 and 2007) whereas the other half (B) received amendments only for two years (2002-2003). To compare, plots without amendments were also established. Net balance of C was carried out using values of Water Soluble Carbon (WSC) and Total Organic Carbon (TOC) for three years (2012, 2013 and 2015). To eliminate artificial changes carried out in the plots, amendment addition and withdrawal of biomass were taken into account to calculate balance of kg TOC

  7. The Responses of Arabidopsis Early Light-Induced Protein2 to Ultraviolet B, High Light, and Cold Stress Are Regulated by a Transcriptional Regulatory Unit Composed of Two Elements1[OPEN

    PubMed Central

    Hayami, Natsuki; Sakai, Yusaku; Kimura, Mitsuhiro; Saito, Tatsunori; Tokizawa, Mutsutomo; Iuchi, Satoshi; Kurihara, Yukio; Matsui, Minami; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.

    2015-01-01

    The Arabidopsis (Arabidopsis thaliana) Early Light-Induced Protein (ELIP) is thought to act as a photoprotectant, reducing the damaging effects of high light (HL). Expression of ELIP2 is activated by multiple environmental stresses related to photoinhibition. We have identified putative regulatory elements in an ELIP2 promoter using an octamer-based frequency comparison method, analyzed the role of these elements using synthetic promoters, and revealed a key transcriptional regulatory unit for ultraviolet B (UV-B) radiation, HL, and cold stress responses. The unit is composed of two elements, designated as Elements A (TACACACC) and B (GGCCACGCCA), and shows functionality only when paired. Our genome-wide correlation analysis between possession of these elements in the promoter region and expression profiles in response to UV-B, HL, and cold suggests that Element B receives and integrates these multiple stress signals. In vitro protein-DNA binding assays revealed that LONG HYPOCOTYL5 (HY5), a basic domain-Leucine zipper transcription factor, directly binds to Element B. In addition, mutant analysis of HY5 showed partial involvement in the UV-B and HL responses but not in the cold stress response. These results suggest that signals for UV-B, HL, and cold stress join at Element B, which recognizes the signals of multiple transcription factors, including HY5. PMID:26175515

  8. Sterol Regulatory Element-binding Protein (SREBP) Cleavage Regulates Golgi-to-Endoplasmic Reticulum Recycling of SREBP Cleavage-activating Protein (SCAP)*

    PubMed Central

    Shao, Wei; Espenshade, Peter J.

    2014-01-01

    Sterol regulatory element-binding protein (SREBP) transcription factors are central regulators of cellular lipogenesis. Release of membrane-bound SREBP requires SREBP cleavage-activating protein (SCAP) to escort SREBP from the endoplasmic reticulum (ER) to the Golgi for cleavage by site-1 and site-2 proteases. SCAP then recycles to the ER for additional rounds of SREBP binding and transport. Mechanisms regulating ER-to-Golgi transport of SCAP-SREBP are understood in molecular detail, but little is known about SCAP recycling. Here, we have demonstrated that SCAP Golgi-to-ER transport requires cleavage of SREBP at site-1. Reductions in SREBP cleavage lead to SCAP degradation in lysosomes, providing additional negative feedback control to the SREBP pathway. Current models suggest that SREBP plays a passive role prior to cleavage. However, we show that SREBP actively prevents premature recycling of SCAP-SREBP until initiation of SREBP cleavage. SREBP regulates SCAP in human cells and yeast, indicating that this is an ancient regulatory mechanism. PMID:24478315

  9. Yeast sterol regulatory element-binding protein (SREBP) cleavage requires Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing subunit of the Golgi Dsc E3 ligase.

    PubMed

    Stewart, Emerson V; Lloyd, S Julie-Ann; Burg, John S; Nwosu, Christine C; Lintner, Robert E; Daza, Riza; Russ, Carsten; Ponchner, Karen; Nusbaum, Chad; Espenshade, Peter J

    2012-01-02

    Schizosaccharomyces pombe Sre1 is a membrane-bound transcription factor that controls adaptation to hypoxia. Like its mammalian homolog, sterol regulatory element-binding protein (SREBP), Sre1 activation requires release from the membrane. However, in fission yeast, this release occurs through a strikingly different mechanism that requires the Golgi Dsc E3 ubiquitin ligase complex and the proteasome. The mechanistic details of Sre1 cleavage, including the link between the Dsc E3 ligase complex and proteasome, are not well understood. Here, we present results of a genetic selection designed to identify additional components required for Sre1 cleavage. From the selection, we identified two new components of the fission yeast SREBP pathway: Dsc5 and Cdc48. The AAA (ATPase associated with diverse cellular activities) ATPase Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing protein, interact with known Dsc complex components and are required for SREBP cleavage. These findings provide a mechanistic link between the Dsc E3 ligase complex and the proteasome in SREBP cleavage and add to a growing list of similarities between the Dsc E3 ligase and membrane E3 ligases involved in endoplasmic reticulum-associated degradation.

  10. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    PubMed Central

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

    2016-01-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  11. Exploiting a precise design of universal synthetic modular regulatory elements to unlock the microbial natural products in Streptomyces.

    PubMed

    Bai, Chaoxian; Zhang, Yang; Zhao, Xuejin; Hu, Yiling; Xiang, Sihai; Miao, Jin; Lou, Chunbo; Zhang, Lixin

    2015-09-29

    There is a great demand for precisely quantitating the expression of genes of interest in synthetic and systems biotechnology as new and fascinating insights into the genetics of streptomycetes have come to light. Here, we developed, for the first time to our knowledge, a quantitative method based on flow cytometry and a superfolder green fluorescent protein (sfGFP) at single-cell resolution in Streptomyces. Single cells of filamentous bacteria were obtained by releasing the protoplasts from the mycelium, and the dead cells could be distinguished from the viable ones by propidium iodide (PI) staining. With this sophisticated quantitative method, some 200 native or synthetic promoters and 200 ribosomal binding sites (RBSs) were characterized in a high-throughput format. Furthermore, an insulator (RiboJ) was recruited to eliminate the interference between promoters and RBSs and improve the modularity of regulatory elements. Seven synthetic promoters with gradient strength were successfully applied in a proof-of-principle approach to activate and overproduce the cryptic lycopene in a predictable manner in Streptomyces avermitilis. Our work therefore presents a quantitative strategy and universal synthetic modular regulatory elements, which will facilitate the functional optimization of gene clusters and the drug discovery process in Streptomyces.

  12. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  13. Distal regulatory element of the STAT1 gene potentially mediates positive feedback control of STAT1 expression.

    PubMed

    Yuasa, Katsutoshi; Hijikata, Takao

    2016-01-01

    We previously identified a distal regulatory element located approximately 5.5-kb upstream of the signal transducer and activator of transcription 1 (STAT1) gene, thereafter designating it as 5.5-kb upstream regulatory region (5.5URR). In this study, we investigated the functional roles of 5.5URR in the transcriptional regulation of STAT1 gene. A chromosome conformation capture assay indicated physical interaction of 5.5URR with the STAT1 core promoter. In luciferase reporter assays, 5.5URR-combined STAT1 core promoter exhibited significant increase in reporter activity enhanced by forced STAT1 expression or interferon (IFN) treatment, but STAT1 core promoter alone did not. The 5.5URR contained IFN-stimulated response element and GAS sites, which bound STAT1 complexes in electrophoretic mobility shift assays. Consistently, chromatin immunoprecipitation (ChIP) assays of HEK293 cells with Halo-tagged STAT1 expression indicated the association of Halo-tagged STAT1 with 5.5URR. ChIP assays with IFN treatment demonstrated that IFNs promoted the recruitment of Halo-tagged STAT1 to 5.5URR. Forced STAT1 expression or IFN treatment increased the expression of endogenous STAT1 and other IFN signaling pathway components, such as STAT2, IRF9 and IRF1, besides IFN-responsive genes. Collectively, the results suggest that 5.5URR may provide a regulatory platform for positive feedback control of STAT1 expression possibly to amplify or sustain the intracellular IFN signals.

  14. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    PubMed Central

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.

    2013-01-01

    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  15. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.

    PubMed

    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup

    2012-04-30

    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  16. Rounding up active cis-elements in the triple C corral: combining conservation, cleavage and conformation capture for the analysis of regulatory gene domains.

    PubMed

    McBride, David J; Kleinjan, Dirk A

    2004-11-01

    Identification and functional analysis of potential cis-regulatory elements is a laborious process that often depends on removing putative elements from their natural context to study their activity. While such methods provide valuable information about the isolated element, they disregard the potential role of an element's interaction(s) with other regulatory sequences and the three-dimensional structure of an active gene locus. Here, two novel methods are discussed--chromosome conformation capture (3C) and RNA-TRAP--that can be used to detect interactions between distal regulatory sites and which thus indicate the chromosomal conformation that is adopted by a gene locus in various states of transcriptional activity. Combined with comparative genomics and traditional DNase I hypersensitive site mapping, these methods form a powerful approach for the study of the mechanisms of long-range transcriptional regulation.

  17. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  18. Assessment of diurnal systemic dose of agrochemicals in regulatory toxicity testing--an integrated approach without additional animal use.

    PubMed

    Saghir, Shakil A; Bartels, Michael J; Rick, David L; McCoy, Alene T; Rasoulpour, Reza J; Ellis-Hutchings, Robert G; Sue Marty, M; Terry, Claire; Bailey, Jason P; Billington, Richard; Bus, James S

    2012-07-01

    Integrated toxicokinetics (TK) data provide information on the rate, extent and duration of systemic exposure across doses, species, strains, gender, and life stages within a toxicology program. While routine for pharmaceuticals, TK assessments of non-pharmaceuticals are still relatively rare, and have never before been included in a full range of guideline studies for a new agrochemical. In order to better understand the relationship between diurnal systemic dose (AUC(24h)) and toxicity of agrochemicals, TK analyses in the study animals is now included in all short- (excluding acute), medium- and long-term guideline mammalian toxicity studies including reproduction/developmental tests. This paper describes a detailed procedure for the implementation of TK in short-, medium- and long-term regulatory toxicity studies, without the use of satellite animals, conducted on three agrochemicals (X11422208, 2,4-D and X574175). In these studies, kinetically-derived maximum doses (KMD) from short-term studies instead of, or along with, maximum tolerated doses (MTD) were used for the selection of the high dose in subsequent longer-term studies. In addition to leveraging TK data to guide dose level selection, the integrated program was also used to select the most appropriate method of oral administration (i.e., gavage versus dietary) of test materials for rat and rabbit developmental toxicity studies. The integrated TK data obtained across toxicity studies (without the use of additional/satellite animals) provided data critical to understanding differences in response across doses, species, strains, sexes, and life stages. Such data should also be useful in mode of action studies and to improve human risk assessments.

  19. Targeting a Regulatory Element in Human Thymidylate Synthase mRNA

    PubMed Central

    Brunn, Nicholas D.; Sega, Emily Garcia; Kao, Melody B.

    2013-01-01

    Thymidylate synthase (TS) is a key enzyme in the biosynthesis of thymidine. TS inhibitors, which are used in cancer chemotherapy, suffer from resistance development in tumors through upregulation of TS expression. Autoregulatory translation control has been implicated with TS overexpression. TS binding at its own mRNA, which leads to sequestration of the start codon, is abolished when the enzyme forms an inhibitor complex, thereby relieving translation suppression. We have used the protein binding site from the TS mRNA in the context of a bicistronic expression system to validate targeting the regulatory motif with stabilizing ligands that prevent ribosomal initiation. Stabilization of the RNA by mutations, which were studied as surrogates of ligand binding, suppresses translation of the TS protein. Compounds that stabilize the TS binding RNA motif and thereby inhibit ribosomal initiation might be used in combination with existing TS enzyme-targeting drugs to overcome resistance development during chemotherapy. PMID:23143777

  20. Renal Anemia Model Mouse Established by Transgenic Rescue with an Erythropoietin Gene Lacking Kidney-Specific Regulatory Elements.

    PubMed

    Hirano, Ikuo; Suzuki, Norio; Yamazaki, Shun; Sekine, Hiroki; Minegishi, Naoko; Shimizu, Ritsuko; Yamamoto, Masayuki

    2017-02-15

    The erythropoietin (Epo) gene is under tissue-specific inducible regulation. Because the kidney is the primary EPO-producing tissue in adults, impaired EPO production in chronic kidney disorders results in serious renal anemia. The Epo gene contains a liver-specific enhancer in the 3' region, but the kidney-specific enhancer for gene expression in renal EPO-producing (REP) cells remains elusive. Here, we examined a conserved upstream element for renal Epo regulation (CURE) region that spans 17.4 kb to 3.6 kb upstream of the Epo gene and harbors several phylogenetically conserved elements. We prepared various Epo gene-reporter constructs utilizing a bacterial artificial chromosome and generated a number of transgenic-mouse lines. We observed that deletion of the CURE region (δCURE) abrogated Epo gene expression in REP cells. Although transgenic expression of the δCURE construct rescued Epo-deficient mice from embryonic lethality, the rescued mice had severe EPO-dependent anemia. These mouse lines serve as an elaborate model for the search for erythroid stimulatory activity and are referred to as AnRED (anemic model with renal EPO deficiency) mice. We also dissected the CURE region by exploiting a minigene harboring four phylogenetically conserved elements in reporter transgenic-mouse analyses. Our analyses revealed that Epo gene regulation in REP cells is a complex process that utilizes multiple regulatory influences.

  1. The effect of trace element addition to mono-digestion of grass silage at high organic loading rates.

    PubMed

    Wall, David M; Allen, Eoin; Straccialini, Barbara; O'Kiely, Padraig; Murphy, Jerry D

    2014-11-01

    This study investigated the effect of trace element addition to mono-digestion of grass silage at high organic loading rates. Two continuous reactors were compared. The first mono-digested grass silage whilst the second operated in co-digestion, 80% grass silage with 20% dairy slurry (VS basis). The reactors were run for 65weeks with a further 5weeks taken for trace element supplementation for the mono-digestion of grass silage. The co-digestion reactor reported a higher biomethane efficiency (1.01) than mono-digestion (0.90) at an OLR of 4.0kgVSm(-3)d(-1) prior to addition of trace elements. Addition of cobalt, iron and nickel, led to an increase in the SMY in mono-digestion of grass silage by 12% to 404LCH4kg(-1)VS and attained a biomethane efficiency of 1.01.

  2. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L

    1995-01-01

    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  3. Early and late periodic patterns of even skipped expression are controlled by distinct regulatory elements that respond to different spatial cues.

    PubMed

    Goto, T; Macdonald, P; Maniatis, T

    1989-05-05

    We have identified the regulatory sequences required for the periodic expression of the Drosophila pair rule gene even skipped (eve). We find that the gradually changing pattern of periodic eve expression during early embryogenesis is directed by two distinct regulatory programs. Initially, eve expression in individual stripes is established by different regulatory elements, each of which responds to nonperiodic spatial cues provided, at least in part, by the gap genes. Later, coordinate expression of eve in all seven stripes is directed by a single regulatory region that responds to periodic cues provided by primary pair rule genes, including eve itself. As a consequence of this two-step regulatory program, eve functions both in the establishment of the periodic pattern of gene expression and in the subsequent specification of parasegmental boundaries.

  4. Global identification of the genetic networks and cis-regulatory elements of the cold response in zebrafish

    PubMed Central

    Hu, Peng; Liu, Mingli; Zhang, Dong; Wang, Jinfeng; Niu, Hongbo; Liu, Yimeng; Wu, Zhichao; Han, Bingshe; Zhai, Wanying; Shen, Yu; Chen, Liangbiao

    2015-01-01

    The transcriptional programs of ectothermic teleosts are directly influenced by water temperature. However, the cis- and trans-factors governing cold responses are not well characterized. We profiled transcriptional changes in eight zebrafish tissues exposed to mildly and severely cold temperatures using RNA-Seq. A total of 1943 differentially expressed genes (DEGs) were identified, from which 34 clusters representing distinct tissue and temperature response expression patterns were derived using the k-means fuzzy clustering algorithm. The promoter regions of the clustered DEGs that demonstrated strong co-regulation were analysed for enriched cis-regulatory elements with a motif discovery program, DREME. Seventeen motifs, ten known and seven novel, were identified, which covered 23% of the DEGs. Two motifs predicted to be the binding sites for the transcription factors Bcl6 and Jun, respectively, were chosen for experimental verification, and they demonstrated the expected cold-induced and cold-repressed patterns of gene regulation. Protein interaction modeling of the network components followed by experimental validation suggested that Jun physically interacts with Bcl6 and might be a hub factor that orchestrates the cold response in zebrafish. Thus, the methodology used and the regulatory networks uncovered in this study provide a foundation for exploring the mechanisms of cold adaptation in teleosts. PMID:26227973

  5. Functional roles of Aves class-specific cis-regulatory elements on macroevolution of bird-specific features.

    PubMed

    Seki, Ryohei; Li, Cai; Fang, Qi; Hayashi, Shinichi; Egawa, Shiro; Hu, Jiang; Xu, Luohao; Pan, Hailin; Kondo, Mao; Sato, Tomohiko; Matsubara, Haruka; Kamiyama, Namiko; Kitajima, Keiichi; Saito, Daisuke; Liu, Yang; Gilbert, M Thomas P; Zhou, Qi; Xu, Xing; Shiroishi, Toshihiko; Irie, Naoki; Tamura, Koji; Zhang, Guojie

    2017-02-06

    Unlike microevolutionary processes, little is known about the genetic basis of macroevolutionary processes. One of these magnificent examples is the transition from non-avian dinosaurs to birds that has created numerous evolutionary innovations such as self-powered flight and its associated wings with flight feathers. By analysing 48 bird genomes, we identified millions of avian-specific highly conserved elements (ASHCEs) that predominantly (>99%) reside in non-coding regions. Many ASHCEs show differential histone modifications that may participate in regulation of limb development. Comparative embryonic gene expression analyses across tetrapod species suggest ASHCE-associated genes have unique roles in developing avian limbs. In particular, we demonstrate how the ASHCE driven avian-specific expression of gene Sim1 driven by ASHCE may be associated with the evolution and development of flight feathers. Together, these findings demonstrate regulatory roles of ASHCEs in the creation of avian-specific traits, and further highlight the importance of cis-regulatory rewiring during macroevolutionary changes.

  6. Negative regulatory elements upstream of a novel exon of the neuronal nicotinic acetylcholine receptor alpha 2 subunit gene.

    PubMed Central

    Bessis, A; Savatier, N; Devillers-Thiéry, A; Bejanin, S; Changeux, J P

    1993-01-01

    The expression of the nicotinic acetylcholine receptor alpha 2 subunit gene is highly restricted to the Spiriform lateralis nucleus of the Chick diencephalon. As a first step toward understanding the molecular mechanism underlying this regulation, we have investigated the structural and regulatory properties of the 5' sequence of this gene. A strategy based on the ligation of an oligonucleotide to the first strand of the cDNA (SLIC) followed by PCR amplification was used. A new exon was found approximately 3kb upstream from the first coding exon, and multiple transcription start sites of the gene were mapped. Analysis of the flanking region shows many consensus sequences for the binding of nuclear proteins, suggesting that the 1 kb flanking region contains at least a portion of the promoter of the gene. We have analysed the negative regulatory elements present within this region and found that a silencer region located between nucleotide -144 and +76 is active in fibroblasts as well as in neurons. This silencer is composed of six tandem repeat Oct-like motifs (CCCCATGCAAT), but does not bind any member of the Oct family. Moreover these motifs were found to act as a silencer only when they were tandemly repeated. When two, four or five motifs were deleted, the silencer activity of the motifs unexpectedly became an enhancer activity in all cells we have tested. Images PMID:8502560

  7. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    PubMed Central

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  8. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  9. The mouse albumin enhancer contains a negative regulatory element that interacts with a novel DNA-binding protein.

    PubMed Central

    Herbst, R S; Boczko, E M; Darnell, J E; Babiss, L E

    1990-01-01

    The far-upstream mouse albumin enhancer (-10.5 to -8.43 kilobases) has both positive and negative regulatory domains which contribute to the rate and tissue specificity of albumin gene transcription. (R. S. Herbst, N. Friedman, J. E. Darnell, Jr., and L. E. Babiss, Proc. Natl. Acad. Sci. USA 86:1553-1557). In this work, the negative regulatory region has been functionally localized to sequences -8.7 to -8.43 kilobases upstream of the albumin gene cap site. In the absence of the albumin-modulating region (in which there are binding sites for the transcription factor C/EBP), the negative region can suppress a neighboring positive-acting element, thereby interfering with albumin enhancer function. The negative region is also capable of negating the positive action of the heterologous transthyretin enhancer in an orientation-independent fashion. Within this negative-acting region we can detect two DNA-binding sites, both of which are recognized by a protein present in all cell types tested. This DNA-binding activity is not competed for by any of a series of known DNA-binding sites, and hence this new protein is a candidate for a role in suppressing the albumin gene in nonhepatic cells. Images PMID:2370857

  10. [The expression of tPA directed by the bovine BLG regulatory elements in the mammary gland of transgenic mice].

    PubMed

    Chen, H X; Chen, X; Yang, X; Deng, J X; Su, G F; Huang, P T

    2001-03-01

    In order to get the regulatory elements which are essential for generating mammary gland bioreactors, the whole 8.4 kb bovine BLG gene was obtained by PCR amplification. The 1.6 kb chicken lysozyme matrix attachment region (MAR) was used to overcome position effects. The bovine BLG-tPA expression vector was constructed and the BLG-tPA fusion gene was introduced into fertilized eggs of mice by microinjection to generate transgenic mouse. 170 offsprings were obtained, of which 9 were proved to be transgenic mice based on PCR and Southern-blot analysis. The tPA expression level amounted to 12 micrograms/mL in the milk of mice. The bovine BLG-tPA fusion gene integrated in the founders was inheritable.

  11. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  12. The identification of hematopoietic-specific regulatory elements for WASp gene expression

    PubMed Central

    Zhan, Jun; Johnson, Irudayam Maria; Wielgosz, Matthew; Nienhuis, Arthur W

    2016-01-01

    Chromosome Conformation Capture (3C) technology was used to identify physical interactions between the proximal Wiskott-Aldrich Syndrome protein (WASp) promoter and its distant DNA segments in Jurkat-T cells. We found that two hematopoietic specific DNase I hypersensitive (DHS) sites (proximal DHS-A, and distal DHS-B) which had high interaction frequencies with the proximal WASp promoter indicating potential regulatory activity for these DHS sites. Subsequently, we cloned several DNA fragments around the proximal DHS-A site into a luciferase reporter vector. Interestingly, no fragments showed enhancer activity, but two fragments exhibited strong silencing activity in Jurkat-T cells. After aligning the chromatin state profiling for hematopoietic and nonhematopoietic cells using the human genome browser (UCSC), we found a 5 kb putative hematopoietic specific enhancer region located 250 kb downstream of the WAS gene. This putative enhancer region contains two hematopoietic cell specific DHS sites. Subsequently, the hematopoietic specific DHS sites enhanced luciferase expression from the proximal WASp promoter in all hematopoietic cells we tested. Finally, using a lentiviral vector stable expression system, the hematopoietic specific-enhancer(s) increased GFP reporter gene expression in hematopoietic cells, and increased WASp gene expression in WASp deficient cells. This enhancer may have the potential to be used in gene therapy for hematological diseases. PMID:28035317

  13. Regulatory elements involved in the bidirectional activity of an immunoglobulin promoter.

    PubMed Central

    Doyen, N; Dreyfus, M; Rougeon, F

    1989-01-01

    We show that the promoter from the mouse VH441 heavy-chain immunoglobulin gene, when present on plasmids transiently introduced into myeloma cells, promotes transcription bidirectionally, due to the presence on both strands of TATA-like sequences bracketing the highly conserved decanucleotide element. The two divergent promoters compete for the transcriptional machinery, their relative strength ultimately reflecting the likeness of the two TATA boxes to the consensus sequence. Moreover, their relative activity is also strongly influenced by certain point mutations within the distally located heavy-chain enhancer. The bearing of these results on current concepts of promoter function is discussed. Images PMID:2494644

  14. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  15. Marsupial anti-Mullerian hormone gene structure, regulatory elements, and expression.

    PubMed

    Pask, Andrew J; Whitworth, Deanne J; Mao, Chai-An; Wei, Ke-Jun; Sankovic, Natasha; Graves, Jennifer A M; Shaw, Geoffrey; Renfree, Marilyn B; Behringer, Richard R

    2004-01-01

    During male sexual development in reptiles, birds, and mammals, anti-Müllerian hormone (AMH) induces the regression of the Müllerian ducts that normally form the primordia of the female reproductive tract. Whereas Müllerian duct regression occurs during fetal development in eutherian mammals, in marsupial mammals this process occurs after birth. To investigate AMH in a marsupial, we isolated an orthologue from the tammar wallaby (Macropus eugenii) and characterized its expression in the testes and ovaries during development. The wallaby AMH gene is highly conserved with the eutherian orthologues that have been studied, particularly within the encoded C-terminal mature domain. The N-terminus of marsupial AMH is divergent and larger than that of eutherian species. It is located on chromosome 3/4, consistent with its autosomal localization in other species. The wallaby 5' regulatory region, like eutherian AMH genes, contains binding sites for SF1, SOX9, and GATA factors but also contains a putative SRY-binding site. AMH expression in the developing testis begins at the time of seminiferous cord formation at 2 days post partum, and Müllerian duct regression begins shortly afterward. In the developing testis, AMH is localized in the cytoplasm of the Sertoli cells but is lost by adulthood. In the developing ovary, there is no detectable AMH expression, but in adults it is produced by the granulosa cells of primary and secondary follicles. It is not detectable in atretic follicles. Collectively, these studies suggest that AMH expression has been conserved during mammalian evolution and is intimately linked to upstream sex determination mechanisms.

  16. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  17. Control of Gas Tungsten Arc welding pool shape by trace element addition to the weld pool

    DOEpatents

    Heiple, C.R.; Burgardt, P.

    1984-03-13

    An improved process for Gas Tungsten Arc welding maximizes the depth/width ratio of the weld pool by adding a sufficient amount of a surface active element to insure inward fluid flow, resulting in deep, narrow welds. The process is especially useful to eliminate variable weld penetration and shape in GTA welding of steels and stainless steels, particularly by using a sulfur-doped weld wire in a cold wire feed technique.

  18. Photon mass energy transfer coefficients for elements z=1 to 92 and 48 additional substances of dosimetric interest.

    PubMed

    Kato, Hideki

    2014-07-01

    Photon mass energy transfer coefficient is an essential factor when converting photon energy fluence into kinetic energy released per unit mass (kerma). Although mass attenuation coefficient and mass energy absorption coefficients can be looked up in databases, the mass energy transfer coefficient values are still controversial. In this paper, the photon mass energy transfer coefficients for elements Z=1-92 were calculated based on cross-sectional data for each photon interaction type. Mass energy transfer coefficients for 48 compounds and/or mixtures of dosimetric interest were calculated from coefficient data for elements using Bragg's additivity rule. We additionally developed software that can search these coefficient data for any element or substance of dosimetric interest. The database and software created in this paper should prove useful for radiation measurements and/or dose calculations.

  19. Gene-specific factors determine mitotic expression and bookmarking via alternate regulatory elements

    PubMed Central

    Arampatzi, Panagiota; Gialitakis, Manolis; Makatounakis, Takis; Papamatheakis, Joseph

    2013-01-01

    Transcriptional silencing during mitosis is caused by inactivation of critical transcriptional regulators and/or chromatin condensation. Inheritance of gene expression patterns through cell division involves various bookmarking mechanisms. In this report, we have examined the mitotic and post-mitotic expression of the DRA major histocompatibility class II (MHCII) gene in different cell types. During mitosis the constitutively MHCII-expressing B lymphoblastoid cells showed sustained occupancy of the proximal promoter by the cognate enhanceosome and general transcription factors. In contrast, although mitotic epithelial cells were depleted of these proteins irrespectively of their MHCII transcriptional activity, a distal enhancer selectively recruited the PP2A phosphatase via NFY and maintained chromatin accessibility. Based on our data, we propose a novel chromatin anti-condensation role for this element in mitotic bookmarking and timing of post-mitotic transcriptional reactivation. PMID:23303784

  20. Active learning: effects of core training design elements on self-regulatory processes, learning, and adaptability.

    PubMed

    Bell, Bradford S; Kozlowski, Steve W J

    2008-03-01

    This article describes a comprehensive examination of the cognitive, motivational, and emotional processes underlying active learning approaches; their effects on learning and transfer; and the core training design elements (exploration, training frame, emotion control) and individual differences (cognitive ability, trait goal orientation, trait anxiety) that shape these processes. Participants (N = 350) were trained to operate a complex, computer-based simulation. Exploratory learning and error-encouragement framing had a positive effect on adaptive transfer performance and interacted with cognitive ability and dispositional goal orientation to influence trainees' metacognition and state goal orientation. Trainees who received the emotion-control strategy had lower levels of state anxiety. Implications for development of an integrated theory of active learning, learner-centered design, and research extensions are discussed.

  1. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  2. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    DOE PAGES

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  3. Determination of rare earth elements and other trace elements (Y, Mn, Co, Cr) in seawater using Tm addition and Mg(OH)₂ co-precipitation.

    PubMed

    Freslon, Nicolas; Bayon, Germain; Birot, Dominique; Bollinger, Claire; Barrat, Jean Alix

    2011-07-15

    This paper reports on a novel procedure for determining trace element abundances (REE and Y, Cr, Mn, Co) in seawater by inductively coupled plasma sector field mass spectrometry (ICP-SFMS). The procedure uses a combination of pre-concentration using co-precipitation onto magnesium hydroxides and addition of thulium spike. The validity of the method was assessed onto 25 ml volumes of certified reference materials (NASS- and CASS-4) and in house seawater standard. Procedural blanks were determined by applying the same procedure to aliquots of seawater previously depleted in trace elements by successive Mg(OH)(2) co-precipitations, yielding estimated contributions to the studied samples better than 1.1% for all elements, with the exception of Cr (<3.3%) and Co (up to 8%). The reproducibility of the method over the six month duration of the study was smaller than 11% RSD for all the studied elements. Results obtained for NASS-5 and CASS-4 agree well with published working values for trace elements.

  4. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons

    PubMed Central

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram

    2016-01-01

    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs—dubbed R1, R2, and R3—that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs’ ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs. PMID:28007784

  5. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons.

    PubMed

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram

    2016-12-01

    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs-dubbed R1, R2, and R3-that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs' ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs.

  6. In situ detection of a heat-shock regulatory element binding protein using a soluble synthetic enhancer sequence.

    PubMed Central

    Harel-Bellan, A; Brini, A T; Ferris, D K; Robin, P; Farrar, W L

    1989-01-01

    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also it was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer. Images PMID:2740211

  7. Competition between planar and central chiral control elements in nucleophilic addition to ferrocenyl imine derivatives.

    PubMed

    Joly, Kévin M; Wilson, Claire; Blake, Alexander J; Tucker, James H R; Moody, Christopher J

    2008-11-07

    Planar chirality associated with the ferrocene in ferrocenyl oximes and hydrazones bearing chiral auxiliaries effectively competes with or overrides the normally excellent stereocontrol afforded by the auxiliary in determining the diastereoselectivity of addition to the C=N bond.

  8. The effect of selected alloying element additions on properties of Mg-based alloy as bioimplants: A literature review

    NASA Astrophysics Data System (ADS)

    Zhang, Li-Nan; Hou, Zeng-Tao; Ye, Xin; Xu, Zhao-Bin; Bai, Xue-Ling; Shang, Peng

    2013-09-01

    This review investigates the current application limitations of Mg and Mg alloys. The key issues hindering the application of biodegradable Mg alloys as implants are their fast degradation rate and biological consideration. We have discussed the effect of some selected alloying element additions on the properties of the Mg-based alloy, especially the nutrient elements in human (Zn, Mn, Ca, Sr). Different grain sizes, phase constituents and distributions consequently influence the mechanical properties of the Mg alloys. Solution strengthening and precipitation strengthening are enhanced by the addition of alloying elements, generally improving the mechanical properties. Besides, the hot working process can also improve the mechanical properties. Combination of different processing steps is suggested to be adopted in the fabrication of Mg-based alloys. Corrosion properties of these Mg-based alloys have been measured in vitro and in vivo. The degradation mechanism is also discussed in terms of corrosion types, rates, byproducts and response of the surrounding tissues. Moreover, the clinical response and requirements of degradable implants are presented, especially for the nutrient elements (Ca, Mn, Zn, Sr). This review provides information related to different Mg alloying elements and presents the promising candidates for an ideal implant.

  9. Myosin regulatory elements as vectors for gene transfer by intramuscular injection.

    PubMed

    Skarli, M; Kiri, A; Vrbova, G; Lee, C A; Goldspink, G

    1998-04-01

    Intramuscular injection of plasmid constructs promises to be an effective way of carrying out gene therapy for muscle disorders as well as using muscle as an in vivo expression system for disorders that involve the gene product being secreted into the bloodstream. The effectiveness of this method depends on the design of the cassette used for the expression of the cDNA of the introduced gene. We tested the levels of expression achieved by a number of muscle-specific promoters and a myosin light chain enhancer when spliced to the reporter gene chloramphenicol acetyltransferase (CAT), in vitro and in vivo by injection into fast and slow muscles of the mouse. The results show that the highest levels of expression are achieved by a combination of a truncated myosin heavy chain promoter and the enhancer, and that a whole range of expression levels is obtained with the other combinations tested. The data show that a cassette based on these elements should provide efficient vectors for the introduction and expression of genes following intramuscular injection of naked DNA.

  10. Origins of Cdx1 regulatory elements suggest roles in vertebrate evolution.

    PubMed

    Gaunt, Stephen J; Paul, Yu-Lee

    2011-01-01

    Cdx1, an upstream regulator of Hox genes, is best characterized for its homeotic effects upon the developing axial skeleton, particularly in the neck. It responds to retinoic acid (RA) in both mouse embryos and embryonal carcinoma (EC) cells. By use of beta-galactosidase chemiluminescence, we show that a mouse Cdx1/lacZ reporter expressed in P19 EC cells responds to RA by the combined activities of an intron retinoic acid response element (RARE) and an upstream RARE. In contrast, a chicken Cdx1/lacZ reporter responds only by activity of the intron RARE. Database analyses upon Cdx1 from twenty three vertebrate species reveal that the intron RARE is structurally conserved in amniotes (eutherian mammals, marsupials, birds and Anole lizard), but not in Xenopus or fish. The upstream RARE is structurally conserved only in eutherian mammals. We conclude that the intron RARE originated at around the amphibian/amniote division, and the upstream RARE appeared around the marsupial/eutherian mammal division. In view of the site of action of Cdx1, we propose that acquisition of the intron RARE may have facilitated the substantial changes that occurred in the neck and anterior thorax at the advent of the amniotes. We present evidence that Cdx1 is also a developmental regulator of the female urogenital system, and we suggest that acquisition of the upstream RARE may have contributed to morphological divergence of marsupial and eutherian mammals.

  11. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    PubMed

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  12. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  13. Prolactin Regulatory Element Binding Protein Is Involved in Hepatitis C Virus Replication by Interaction with NS4B

    PubMed Central

    Kong, Lingbao; Fujimoto, Akira; Nakamura, Mariko; Aoyagi, Haruyo; Matsuda, Mami; Watashi, Koichi; Suzuki, Ryosuke; Arita, Minetaro; Yamagoe, Satoshi; Dohmae, Naoshi; Suzuki, Takehiro; Sakamaki, Yuriko; Ichinose, Shizuko; Suzuki, Tetsuro; Wakita, Takaji

    2016-01-01

    ABSTRACT It has been proposed that the hepatitis C virus (HCV) NS4B protein triggers the membranous HCV replication compartment, but the underlying molecular mechanism is not fully understood. Here, we screened for NS4B-associated membrane proteins by tandem affinity purification and proteome analysis and identified 202 host proteins. Subsequent screening of replicon cells with small interfering RNA identified prolactin regulatory element binding (PREB) to be a novel HCV host cofactor. The interaction between PREB and NS4B was confirmed by immunoprecipitation, immunofluorescence, and proximity ligation assays. PREB colocalized with double-stranded RNA and the newly synthesized HCV RNA labeled with bromouridine triphosphate in HCV replicon cells. Furthermore, PREB shifted to detergent-resistant membranes (DRMs), where HCV replication complexes reside, in the presence of NS4B expression in Huh7 cells. However, a PREB mutant lacking the NS4B-binding region (PREBd3) could not colocalize with double-stranded RNA and did not shift to the DRM in the presence of NS4B. These results indicate that PREB locates at the HCV replication complex by interacting with NS4B. PREB silencing inhibited the formation of the membranous HCV replication compartment and increased the protease and nuclease sensitivity of HCV replicase proteins and RNA in DRMs, respectively. Collectively, these data indicate that PREB promotes HCV RNA replication by participating in the formation of the membranous replication compartment and by maintaining its proper structure by interacting with NS4B. Furthermore, PREB was induced by HCV infection in vitro and in vivo. Our findings provide new insights into HCV host cofactors. IMPORTANCE The hepatitis C virus (HCV) protein NS4B can induce alteration of the endoplasmic reticulum and the formation of a membranous web structure, which provides a platform for the HCV replication complex. The molecular mechanism by which NS4B induces the membranous HCV replication

  14. Proteome-wide Structural Analysis of PTM Hotspots Reveals Regulatory Elements Predicted to Impact Biological Function and Disease*

    PubMed Central

    Dewhurst, Henry; Sundararaman, Niveda

    2016-01-01

    Post-translational modifications (PTMs) regulate protein behavior through modulation of protein-protein interactions, enzymatic activity, and protein stability essential in the translation of genotype to phenotype in eukaryotes. Currently, less than 4% of all eukaryotic PTMs are reported to have biological function - a statistic that continues to decrease with an increasing rate of PTM detection. Previously, we developed SAPH-ire (Structural Analysis of PTM Hotspots) - a method for the prioritization of PTM function potential that has been used effectively to reveal novel PTM regulatory elements in discrete protein families (Dewhurst et al., 2015). Here, we apply SAPH-ire to the set of eukaryotic protein families containing experimental PTM and 3D structure data - capturing 1,325 protein families with 50,839 unique PTM sites organized into 31,747 modified alignment positions (MAPs), of which 2010 (∼6%) possess known biological function. Here, we show that using an artificial neural network model (SAPH-ire NN) trained to identify MAP hotspots with biological function results in prediction outcomes that far surpass the use of single hotspot features, including nearest neighbor PTM clustering methods. We find the greatest enhancement in prediction for positions with PTM counts of five or less, which represent 98% of all MAPs in the eukaryotic proteome and 90% of all MAPs found to have biological function. Analysis of the top 1092 MAP hotspots revealed 267 of truly unknown function (containing 5443 distinct PTMs). Of these, 165 hotspots could be mapped to human KEGG pathways for normal and/or disease physiology. Many high-ranking hotspots were also found to be disease-associated pathogenic sites of amino acid substitution despite the lack of observable PTM in the human protein family member. Taken together, these experiments demonstrate that the functional relevance of a PTM can be predicted very effectively by neural network models, revealing a large but testable

  15. Detecting the limits of regulatory element conservation and divergence estimation using pairwise and multiple alignments

    PubMed Central

    Pollard, Daniel A; Moses, Alan M; Iyer, Venky N; Eisen, Michael B

    2006-01-01

    Background Molecular evolutionary studies of noncoding sequences rely on multiple alignments. Yet how multiple alignment accuracy varies across sequence types, tree topologies, divergences and tools, and further how this variation impacts specific inferences, remains unclear. Results Here we develop a molecular evolution simulation platform, CisEvolver, with models of background noncoding and transcription factor binding site evolution, and use simulated alignments to systematically examine multiple alignment accuracy and its impact on two key molecular evolutionary inferences: transcription factor binding site conservation and divergence estimation. We find that the accuracy of multiple alignments is determined almost exclusively by the pairwise divergence distance of the two most diverged species and that additional species have a negligible influence on alignment accuracy. Conserved transcription factor binding sites align better than surrounding noncoding DNA yet are often found to be misaligned at relatively short divergence distances, such that studies of binding site gain and loss could easily be confounded by alignment error. Divergence estimates from multiple alignments tend to be overestimated at short divergence distances but reach a tool specific divergence at which they cease to increase, leading to underestimation at long divergences. Our most striking finding was that overall alignment accuracy, binding site alignment accuracy and divergence estimation accuracy vary greatly across branches in a tree and are most accurate for terminal branches connecting sister taxa and least accurate for internal branches connecting sub-alignments. Conclusion Our results suggest that variation in alignment accuracy can lead to errors in molecular evolutionary inferences that could be construed as biological variation. These findings have implications for which species to choose for analyses, what kind of errors would be expected for a given set of species and how

  16. A Novel Pregnane X Receptor-mediated and Sterol Regulatory Element-binding Protein-independent Lipogenic Pathway*

    PubMed Central

    Zhou, Jie; Zhai, Yonggong; Mu, Ying; Gong, Haibiao; Uppal, Hirdesh; Toma, David; Ren, Songrong; Evans, Ronald M.; Xie, Wen

    2014-01-01

    The pregnane X receptor (PXR) was isolated as a xenosensor regulating xenobiotic responses. In this study, we show that PXR plays an endobiotic role by impacting lipid homeostasis. Expression of an activated PXR in the livers of transgenic mice resulted in an increased hepatic deposit of triglycerides. This PXR-mediated lipid accumulation was independent of the activation of the lipogenic transcriptional factor SREBP-1c (sterol regulatory element-binding protein 1c) and its primary lipogenic target enzymes, including fatty-acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC-1). Instead, the lipid accumulation in transgenic mice was associated with an increased expression of the free fatty acid transporter CD36 and several accessory lipogenic enzymes, such as stearoyl-CoA desaturase-1 (SCD-1) and long chain free fatty acid elongase. Studies using transgenic and knock-out mice showed that PXR is both necessary and sufficient for Cd36 activation. Promoter analyses revealed a DR-3-type of PXR-response element in the mouse Cd36 promoter, establishing Cd36 as a direct transcriptional target of PXR. The hepatic lipid accumulation and Cd36 induction were also seen in the hPXR “humanized” mice treated with the hPXR agonist rifampicin. The activation of PXR was also associated with an inhibition of pro-β-oxidative genes, such as peroxisome proliferator-activated receptor α (PPARα) and thiolase, and an up-regulation of PPARγ, a positive regulator of CD36. The cross-regulation of CD36 by PXR and PPARγ suggests that this fatty acid transporter may function as a common target of orphan nuclear receptors in their regulation of lipid homeostasis. PMID:16556603

  17. Control of Human PLP1 Expression Through Transcriptional Regulatory Elements and Alternatively Spliced Exons in Intron 1

    PubMed Central

    Hamdan, Hamdan; Kockara, Neriman T.; Jolly, Lee Ann; Haun, Shirley

    2015-01-01

    *These authors contributed equally to this work.Although the myelin proteolipid protein gene (PLP1) encodes the most abundant protein in central nervous system (CNS) myelin, not much is known about the mechanisms that govern expression of the human gene (hPLP1). Much more is known about the processes that regulate Plp1 gene expression in rodents. From studies with Plp1-lacZ transgenic mice, it was determined that the first intron of mouse Plp1 (mPlp1) is required to attain high levels of expression in brain, concurrent with the active myelination period. Other studies have suggested that within mPlp1 intron 1 (>8 kb) lie several regions with enhancer-like activity. To test whether these sequences (and possibly others) in hPLP1 intron 1 are functional, deletion-transfection analysis was performed with hPLP1-lacZ constructs that contain various portions of the intron, or lack it altogether. Results presented here demonstrate the importance of hPLP1 intron 1 in achieving maximal levels of expression in the immortalized oligodendroglial cell line, Oli-neu. Deletion analysis indicates that the intron contains multiple positive regulatory elements which are active in Oli-neu cells. Some of these elements appear to be functionally conserved between human and mouse, while others are not. Furthermore, our studies demonstrate that multiple splice variants can be formed due to inclusion of extra (supplementary) exons from what is classically thought of as hPLP1 intron 1. Thus, splicing of these novel exons (which are not recognized as such in mPlp1 due to lack of conserved splice sites) must utilize factors common to both human and mouse since Oli-neu cells are of mouse origin. PMID:25694552

  18. Control of tissue size and development by a regulatory element in the yorkie 3’UTR

    PubMed Central

    Umegawachi, Takanari; Yoshida, Hideki; Koshida, Hiromu; Yamada, Momoko; Ohkawa, Yasuyuki; Sato, Tetsuya; Suyama, Mikita; Krause, Henry M; Yamaguchi, Masamitsu

    2017-01-01

    Regulation of the Hippo pathway via phosphorylation of Yorkie (Yki), the Drosophila homolog of human Yes-associated protein 1, is conserved from Drosophila to humans. Overexpression of a non-phosphorylatable form of Yki induces severe overgrowth in adult fly eyes. Here, we show that yki mRNA associates with microsomal fractions and forms foci that partially colocalize to processing bodies in the vicinity of endoplasmic reticulum. This localization is dependent on a stem-loop (SL) structure in the 3’ untranslated region of yki. Surprisingly, expression of SL deleted yki in eye imaginal discs also results in severe overgrowth phenotypes. When the structure of the SL is disrupted, Yki protein levels increase without a significant effect on RNA levels. When the SL is completely removed, protein levels drastically increase, but in this case, due to increased RNA stability. In the latter case, we show that the increased RNA accumulation is due to removal of a putative miR-8 seed sequence in the SL. These data demonstrate the function of two novel regulatory mechanisms, both controlled by the yki SL element, that are essential for proper Hippo pathway mediated growth regulation.

  19. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  20. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach.

    PubMed

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-09

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located -70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the -70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE.

  1. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  2. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-08-14

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome.

  3. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  4. Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

    SciTech Connect

    Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti; Prasad, Tulika; Mukhopadhyay, Gauranga; Hoefer, Milan; Morschhaeuser, Joachim; Prasad, Rajendra . E-mail: rp47@hotmail.com

    2005-06-24

    Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild type CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.

  5. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui

    2016-01-01

    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  6. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach

    PubMed Central

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-01

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located −70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the −70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE. PMID:27651453

  7. The effect of oxidant addition on ferrous iron removal from multi-element acidic sulphate solutions

    NASA Astrophysics Data System (ADS)

    Mbedzi, Ndishavhelafhi; Ibana, Don; Dyer, Laurence; Browner, Richard

    2017-01-01

    This study was an investigation on the hydrolytic precipitation of iron from simulated pregnant leach solution (PLS) of nickel laterite atmospheric leaching. The effect of equilibrium pH, temperature and the addition of oxidant on total iron (ferrous (Fe (II)) and ferric (Fe (III)), aluminium and chromium removal was investigated together with the associated nickel and cobalt losses to the precipitate. Systematic variations of the experimental variables revealed ≥99% of the ferric iron can be removed from solution at conditions similar to those used in standard partial neutralisation in zinc and nickel production, pH of 2.5 and temperature less than 100 °C with minimal losses (<0.5%) of both nickel and cobalt. Temperature variation from 55 to 90 °C had no significant effect on the magnitude of Fe (III) precipitation but led to a significant increase in aluminium removal from 67% to 95% and improved the filterability of the precipitates. There was no ferrous iron precipitation even at a pH of 3.75 in the absence of an oxidant with its removal (98%) achieved by oxidative precipitation with oxygen gas at pH 3.5. Unlike Fe (III) precipitation, the operating temperature significantly affects oxidative precipitation of Fe (II). Hence, in practical application, the hydrolytic precipitation and oxidation to remove iron must be operated at 85 °C to ensure both ferrous and ferric iron are precipitated.

  8. Multiple positive and negative 5' regulatory elements control the cell-type-specific expression of the embryonic skeletal myosin heavy-chain gene.

    PubMed Central

    Bouvagnet, P F; Strehler, E E; White, G E; Strehler-Page, M A; Nadal-Ginard, B; Mahdavi, V

    1987-01-01

    To identify the DNA sequences that regulate the expression of the sarcomeric myosin heavy-chain (MHC) genes in muscle cells, a series of deletion constructs of the rat embryonic MHC gene was assayed for transient expression after introduction into myogenic and nonmyogenic cells. The sequences in 1.4 kilobases of 5'-flanking DNA were found to be sufficient to direct expression of the MHC gene constructs in a tissue-specific manner (i.e., in differentiated muscle cells but not in undifferentiated muscle and nonmuscle cells). Three main distinct regulatory domains have been identified: (i) the upstream sequences from positions -1413 to -174, which determine the level of expression of the MHC gene and are constituted of three positive regulatory elements and two negative ones; (ii) a muscle-specific regulatory element from positions -173 to -142, which restricts the expression of the MHC gene to muscle cells; and (iii) the promoter region, downstream from position -102, which directs transcription initiation. Introduction of the simian virus 40 enhancer into constructs where subportions of or all of the upstream sequences are deleted (up to position -173) strongly increases the level of expression of such truncated constructs but without changing their muscle specificity. These upstream sequences, which can be substituted for by the simian virus 40 enhancer, function in an orientation-, position-, and promoter-dependent fashion. The muscle-specific element is also promoter specific but does not support efficient expression of the MHC gene. The MHC promoter in itself is not muscle specific. These results underline the importance of the concerted action of multiple regulatory elements that are likely to represent targets for DNA-binding-regulatory proteins. Images PMID:2830491

  9. Identification of gene co-regulatory modules and associated cis-elements involved in degenerative heart disease

    PubMed Central

    2009-01-01

    Background Cardiomyopathies, degenerative diseases of cardiac muscle, are among the leading causes of death in the developed world. Microarray studies of cardiomyopathies have identified up to several hundred genes that significantly alter their expression patterns as the disease progresses. However, the regulatory mechanisms driving these changes, in particular the networks of transcription factors involved, remain poorly understood. Our goals are (A) to identify modules of co-regulated genes that undergo similar changes in expression in various types of cardiomyopathies, and (B) to reveal the specific pattern of transcription factor binding sites, cis-elements, in the proximal promoter region of genes comprising such modules. Methods We analyzed 149 microarray samples from human hypertrophic and dilated cardiomyopathies of various etiologies. Hierarchical clustering and Gene Ontology annotations were applied to identify modules enriched in genes with highly correlated expression and a similar physiological function. To discover motifs that may underly changes in expression, we used the promoter regions for genes in three of the most interesting modules as input to motif discovery algorithms. The resulting motifs were used to construct a probabilistic model predictive of changes in expression across different cardiomyopathies. Results We found that three modules with the highest degree of functional enrichment contain genes involved in myocardial contraction (n = 9), energy generation (n = 20), or protein translation (n = 20). Using motif discovery tools revealed that genes in the contractile module were found to contain a TATA-box followed by a CACC-box, and are depleted in other GC-rich motifs; whereas genes in the translation module contain a pyrimidine-rich initiator, Elk-1, SP-1, and a novel motif with a GCGC core. Using a naïve Bayes classifier revealed that patterns of motifs are statistically predictive of expression patterns, with odds ratios of 2

  10. Maturation and Activity of Sterol Regulatory Element Binding Protein 1 Is Inhibited by Acyl-CoA Binding Domain Containing 3

    PubMed Central

    Chen, Yong; Patel, Vishala; Bang, Sookhee; Cohen, Natalie; Millar, John; Kim, Sangwon F.

    2012-01-01

    Imbalance of lipid metabolism has been linked with pathogenesis of a variety of human pathological conditions such as diabetes, obesity, cancer and neurodegeneration. Sterol regulatory element binding proteins (SREBPs) are the master transcription factors controlling the homeostasis of fatty acids and cholesterol in the body. Transcription, expression, and activity of SREBPs are regulated by various nutritional, hormonal or stressful stimuli, yet the molecular and cellular mechanisms involved in these adaptative responses remains elusive. In the present study, we found that overexpressed acyl-CoA binding domain containing 3 (ACBD3), a Golgi-associated protein, dramatically inhibited SREBP1-sensitive promoter activity of fatty acid synthase (FASN). Moreover, lipid deprivation-stimulated SREBP1 maturation was significantly attenuated by ACBD3. With cell fractionation, gene knockdown and immunoprecipitation assays, it was showed that ACBD3 blocked intracellular maturation of SREBP1 probably through directly binding with the lipid regulator rather than disrupted SREBP1-SCAP-Insig1 interaction. Further investigation revealed that acyl-CoA domain-containing N-terminal sequence of ACBD3 contributed to its inhibitory effects on the production of nuclear SREBP1. In addition, mRNA and protein levels of FASN and de novo palmitate biosynthesis were remarkably reduced in cells overexpressed with ACBD3. These findings suggest that ACBD3 plays an essential role in maintaining lipid homeostasis via regulating SREBP1's processing pathway and thus impacting cellular lipogenesis. PMID:23166793

  11. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    PubMed

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  12. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids

    PubMed Central

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica. PMID:26347724

  13. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.

    PubMed

    Jose-Estanyol, M; Puigdomènech, P

    2012-10-01

    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2.

  14. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression.

    PubMed

    Eiberg, Hans; Troelsen, Jesper; Nielsen, Mette; Mikkelsen, Annemette; Mengel-From, Jonas; Kjaer, Klaus W; Hansen, Lars

    2008-03-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86 of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind different subsets of nuclear extracts. One single haplotype, represented by six polymorphic SNPs covering half of the 3' end of the HERC2 gene, was found in 155 blue-eyed individuals from Denmark, and in 5 and 2 blue-eyed individuals from Turkey and Jordan, respectively. Hence, our data suggest a common founder mutation in an OCA2 inhibiting regulatory element as the cause of blue eye color in humans. In addition, an LOD score of Z = 4.21 between hair color and D14S72 was obtained in the large family, indicating that RABGGTA is a candidate gene for hair color.

  15. Chromatin Heterogeneity and Distribution of Regulatory Elements in the Late-Replicating Intercalary Heterochromatin Domains of Drosophila melanogaster Chromosomes

    PubMed Central

    Khoroshko, Varvara A.; Levitsky, Viktor G.; Zykova, Tatyana Yu.; Antonenko, Oksana V.; Belyaeva, Elena S.; Zhimulev, Igor F.

    2016-01-01

    Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of

  16. The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

    PubMed

    Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

    2004-03-01

    egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

  17. Application of prestressed structural elements in the erection of heavy viscoelastic arched structures with the use of an additive technology

    NASA Astrophysics Data System (ADS)

    Manzhirov, A. V.; Parshin, D. A.

    2016-11-01

    The process of erection an object under the action of gravity forces in the absence of additional loads is studied together with the technology of application of prestressed structure elements. The mathematically two-dimensional engineering problem of mechanics of gradual building of a heavy semicircular vault from a prestressed viscoelastic homogeneously aging material is solved analytically. The vault fixation on a rigid horizontal base by sliding fixation, which ensures continuous smooth contact between the vault foot and the base, is considered. The performed computations permit demonstrating high efficiency of preliminary stress creation in the material elements added to the vault in the process of its building in order to control its technological stress state. It is shown that this measure permits significantly decreasing the final values of the separating contact stresses on the foot of the built vault and obtaining the final state of the whole structure which is safer with respect to the level of tensile stresses than that obtain by using unstressed elements.

  18. Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.

    PubMed Central

    Avni, D; Shama, S; Loreni, F; Meyuhas, O

    1994-01-01

    The translation of mammalian ribosomal protein (rp) mRNAs is selectively repressed in nongrowing cells. This response is mediated through a regulatory element residing in the 5' untranslated region of these mRNAs and includes a 5' terminal oligopyrimidine tract (5' TOP). To further characterize the translational cis-regulatory element, we monitored the translational behavior of various endogenous and heterologous mRNAs or hybrid transcripts derived from transfected chimeric genes. The translational efficiency of these mRNAs was assessed in cells that either were growing normally or were growth arrested under various physiological conditions. Our experiments have yielded the following results: (i) the translation of mammalian rp mRNAs is properly regulated in amphibian cells, and likewise, amphibian rp mRNA is regulated in mammalian cells, indicating that all of the elements required for translation control of rp mRNAs are conserved among vertebrate classes; (ii) selective translational control is not confined to rp mRNAs, as mRNAs encoding the naturally occurring ubiquitin-rp fusion protein and elongation factor 1 alpha, which contain a 5' TOP, also conform this mode of regulation; (iii) rat rpP2 mRNA contains only five pyrimidines in its 5' TOP, yet this mRNA is translationally controlled in the same fashion as other rp mRNAs with a 5' TOP of eight or more pyrimidines; (iv) full manifestation of this mode of regulation seems to require both the 5' TOP and sequences immediately downstream; and (v) an intact translational regulatory element from rpL32 mRNA fails to exert its regulatory properties even when preceded by a single A residue. Images PMID:8196625

  19. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  20. High constitutive activity of a broad panel of housekeeping and tissue-specific cis-regulatory elements depends on a subset of ETS proteins.

    PubMed

    Curina, Alessia; Termanini, Alberto; Barozzi, Iros; Prosperini, Elena; Simonatto, Marta; Polletti, Sara; Silvola, Alessio; Soldi, Monica; Austenaa, Liv; Bonaldi, Tiziana; Ghisletti, Serena; Natoli, Gioacchino

    2017-02-15

    Enhancers and promoters that control the transcriptional output of terminally differentiated cells include cell type-specific and broadly active housekeeping elements. Whether the high constitutive activity of these two groups of cis-regulatory elements relies on entirely distinct or instead also on shared regulators is unknown. By dissecting the cis-regulatory repertoire of macrophages, we found that the ELF subfamily of ETS proteins selectively bound within 60 base pairs (bp) from the transcription start sites of highly active housekeeping genes. ELFs also bound constitutively active, but not poised, macrophage-specific enhancers and promoters. The role of ELFs in promoting high-level constitutive transcription was suggested by multiple evidence: ELF sites enabled robust transcriptional activation by endogenous and minimal synthetic promoters, ELF recruitment was stabilized by the transcriptional machinery, and ELF proteins mediated recruitment of transcriptional and chromatin regulators to core promoters. These data suggest that the co-optation of a limited number of highly active transcription factors represents a broadly adopted strategy to equip both cell type-specific and housekeeping cis-regulatory elements with the ability to efficiently promote transcription.

  1. A cis-acting regulatory element that affects the alternative splicing of a muscle-specific exon in the mouse NCAM gene.

    PubMed

    Kawahigashi, H; Harada, Y; Asano, A; Nakamura, M

    1998-05-11

    The pre-mRNA encoding the neural cell adhesion molecule (NCAM) is spliced to generate NCAM isoforms containing the muscle-specific domain (MSD) during myogenesis. Utilizing chimeric NCAM minigenes, we searched for cis-acting elements that contribute to the alternative selection of exon MSDb, one of the four exons encoding MSD, and identified an intronic cis-element located downstream of exon MSDb. The cis-element acted as a negative regulator for the selection of exon MSDb in nonmuscle fibroblasts but not in myoblasts, that are already destined to differentiate into muscle cells. The suppressive effect of this cis-element on the selection of exon MSDb was released in the process of myogenesis. When MyoD was co-expressed with a minigene containing this element in fibroblasts, the suppressive effect of the cis-element was released as the cells underwent differentiation. We propose that this cis-element contributes at least as one of the regulatory elements in the differentiation state-dependent selection of MSD exons in vivo.

  2. PreCisIon: PREdiction of CIS-regulatory elements improved by gene’s positION

    PubMed Central

    Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

    2013-01-01

    Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases. PMID:23241390

  3. Analysis of the laser powder bed fusion additive manufacturing process through experimental measurement and finite element modeling

    NASA Astrophysics Data System (ADS)

    Dunbar, Alexander Jay

    The objective in this work is to provide rigourous experimental measurements to aid in the development of laser powder bed fusion (LPBF) additive manufacturing (AM). A specialized enclosed instrumented measurement system is designed to provide in situ experimental measurements of temperature and distortion. Experiments include comparisons of process parameters, materials and LPBF machines. In situ measurements of distortion and temperature made throughout the build process highlight inter-layer distortion effects previously undocumented for laser powder bed fusion. Results from these experiments are also be implemented in the development and validation of finite element models of the powder bed build process. Experimental analysis is extended from small-scale to larger part-scale builds where experimental post-build measurements are used in analysis of distortion profiles. Experimental results provided from this study are utilized in the validation of a finite element model capable of simulating production scale parts. The validated finite element model is then implemented in the analysis of the part to provide information regarding the distortion evolution process. A combination of experimental measurements and simulation results are used to identify the mechanism that results in the measured distortion profile for this geometry. Optimization of support structure primarily focuses on the minimization of material use and scan time, but no information regarding failure criteria for support structure is available. Tensile test samples of LPBF built support structure are designed, built, and tested to provide measurements of mechanical properties of the support structure. Experimental tests show that LPBF built support structure has only 30-40% of the ultimate tensile strength of solid material built in the same machine. Experimental measurement of LPBF built support structure provides clear failure criteria to be utilized in the future design and implementation of

  4. U18666A, an Activator of Sterol Regulatory Element Binding Protein (SREBP) Pathway Modulates Presynaptic Dopaminergic Phenotype of SH-SY5Y Neuroblastoma Cells.

    PubMed

    Schmitt, Mathieu; Dehay, Benjamin; Bezard, Erwan; Garcia-Ladona, F Javier

    2017-04-13

    The therapeutic use of statins has been associated to a reduced risk of Parkinson's disease (PD) and may hold neuroprotective potential by counteracting the degeneration of dopaminergic neurons. Transcriptional activation of the sterol regulatory element-binding protein (SREBP) is one of the major downstream signalling pathways triggered by the cholesterol-lowering effect of statins. In a previous study in neuroblastoma cells, we have shown that statins consistently induce the up-regulation of presynaptic dopaminergic proteins as well as changes of their function and these effects were accompanied by downstream activation of SREBP. In current study, we aimed to determine the direct role of SREBP pathway in the modulation of dopaminergic phenotype. We demonstrate that treatment of SH-SY5Y cells with U18666A, a SREBP activator, increases the translocation of SREBPs into the nucleus, increases expression of SREBP-1, SREBP-2 and of the presynaptic dopaminergic markers such as vesicular monoamine transporter 2, synaptic vesicle glycoprotein 2A and 2C, synaptogyrin-3 and tyrosine hydroxylase. The addition of SREBP inhibitor, PF-429242, blocks the increase of U18666A-induced expression of SREBPs and of presynaptic markers. Our results, in line with previously reported effects of statins, demonstrate that direct stimulation of SREBP translocation is associated to differentiation towards a dopaminergic-like phenotype and suggest that SREBP-mediated transcriptional activity may lead to the restoration of the presynaptic dopamine markers and may contribute to neuroprotection of dopaminergic neurons. These findings further support the potential protective role of statin in PD and shed light upon SREBP as a potential new target for developing disease-modifying treatment in PD. This article is protected by copyright. All rights reserved.

  5. Sterol Regulatory Element-Binding Protein-1c Regulates Inflammasome Activation in Gingival Fibroblasts Infected with High-Glucose-Treated Porphyromonas gingivalis

    PubMed Central

    Kuo, Hsing-Chun; Chang, Li-Ching; Chen, Te-Chuan; Lee, Ko-Chao; Lee, Kam-Fai; Chen, Cheng-Nan; Yu, Hong-Ren

    2016-01-01

    Background: Porphyromonas gingivalis is a major bacterial species implicated in the progression of periodontal disease, which is recognized as a common complication of diabetes. The interleukin (IL)-1β, processed by the NLR family pyrin domain containing 3 (NLRP3) inflammasome, has been identified as a target for pathogenic infection of the inflammatory response. However, the effect of P. gingivalis in a high-glucose situation in the modulation of inflammasome activation in human gingival fibroblasts (HGFs) is not well-understood. Methods: P. gingivalis strain CCUG25226 was used to study the mechanisms underlying the regulation of HGF NLRP3 expression by the infection of high-glucose-treated P. gingivalis (HGPg). Results: HGF infection with HGPg increases the expression of IL-1β and NLRP3. We further demonstrated that the upregulation of sterol regulatory element-binding protein (SREBP)-1c by activation of the Akt and p70S6K pathways is critical for HGPg-induced NLRP3 expression. We showed that the inhibition of Janus kinase 2 (JAK2) blocks the Akt- and p70S6K-mediated SREBP-1c, NLRP3, and IL-1β expression. The effect of HGPg on HGF signaling and NLRP3 expression is mediated by β1 integrin. In addition, gingival tissues from diabetic patients with periodontal disease exhibited higher NLRP3 and SREBP-1c expression. Conclusions: Our findings identify the molecular pathways underlying HGPg-dependent NLRP3 inflammasome expression in HGFs, providing insight into the effect of P. gingivalis invasion in HGFs. PMID:28083517

  6. Sterol regulatory element binding transcription factor 1 expression and genetic polymorphism significantly affect intramuscular fat deposition in the longissimus muscle of Erhualian and Sutai pigs.

    PubMed

    Chen, J; Yang, X J; Xia, D; Chen, J; Wegner, J; Jiang, Z; Zhao, R Q

    2008-01-01

    Two experiments were performed to elucidate the role of sterol regulatory element binding transcription factor 1 (SREBF1) in i.m. fat (IMF) deposition in pigs. In Exp. 1, LM samples were removed from 4 male and 4 female Erhualian piglets at 3, 20, and 45 d of age, and SREBF1 mRNA expression level and IMF content were measured. Intramuscular fat content and expression of SREBF1 mRNA was greater (P < 0.05) in females than males at all 3 stages of age, providing initial evidence that the level of SREBF1 mRNA expression is related to IMF deposition in muscle of suckling pigs. Additionally, in Exp. 2 there was a positive correlation between the SREBF1 mRNA level and IMF content (r = 0.67, P < 0.01) in 100 Sutai finishing pigs, a synthetic line produced by crossing Erhualian and Duroc pigs. Single-strand conformation polymorphism (SSCP) analysis of the reverse transcription PCR products of the SREBF1 gene revealed 3 genotypes in Sutai pigs with frequencies of 50% for AA, 36% for AB, and 14% for BB, respectively. Both SREBF1 mRNA level and IMF content in muscle were greater (P < 0.05) in AB and BB animals than in AA animals, whereas no difference in backfat thickness was observed among the 3 genotypes. Sequencing analysis identified 2 SNP at T1006C and C1033T within the open reading frame of the SREBF1 gene (NM_214157). Although both are silent mutations, they affected the secondary structure of SREBF1 mRNA. These results suggest that SREBF1 might play an important role in regulation of muscle fat deposition during postnatal growth of pigs. The SNP identified in the SREBF1 gene suggest that it could be used as a genetic marker to improve IMF content in pigs.

  7. Tlr4-mutant mice are resistant to acute alcohol-induced sterol-regulatory element binding protein activation and hepatic lipid accumulation.

    PubMed

    Zhang, Zhi-Hui; Liu, Xiao-Qian; Zhang, Cheng; He, Wei; Wang, Hua; Chen, Yuan-Hua; Liu, Xiao-Jing; Chen, Xi; Xu, De-Xiang

    2016-09-15

    Previous studies demonstrated that acute alcohol intoxication caused hepatic lipid accumulation. The present study showed that acute alcohol intoxication caused hepatic lipid accumulation in Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic sterol-regulatory element binding protein (SREBP)-1, a transcription factor regulating fatty acid and triglyceride (TG) synthesis, was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic Fas, Acc, Scd-1 and Dgat-2, the key genes for fatty acid and TG synthesis, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Additional experiment showed that hepatic MyD88 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic NF-κB was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Moreover, hepatic GSH content was reduced and hepatic MDA level was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic CYP2E1 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic p67phox and gp91phox, two NADPH oxidase subunits, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Alpha-phenyl-N-t-butylnitrone (PBN), a free radical spin-trapping agent, protected against alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. In conclusion, Tlr4-mutant mice are resistant to acute alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation.

  8. Tlr4-mutant mice are resistant to acute alcohol-induced sterol-regulatory element binding protein activation and hepatic lipid accumulation

    PubMed Central

    Zhang, Zhi-Hui; Liu, Xiao-Qian; Zhang, Cheng; He, Wei; Wang, Hua; Chen, Yuan-Hua; Liu, Xiao-Jing; Chen, Xi; Xu, De-Xiang

    2016-01-01

    Previous studies demonstrated that acute alcohol intoxication caused hepatic lipid accumulation. The present study showed that acute alcohol intoxication caused hepatic lipid accumulation in Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic sterol-regulatory element binding protein (SREBP)-1, a transcription factor regulating fatty acid and triglyceride (TG) synthesis, was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic Fas, Acc, Scd-1 and Dgat-2, the key genes for fatty acid and TG synthesis, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Additional experiment showed that hepatic MyD88 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic NF-κB was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Moreover, hepatic GSH content was reduced and hepatic MDA level was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic CYP2E1 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic p67phox and gp91phox, two NADPH oxidase subunits, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Alpha-phenyl-N-t-butylnitrone (PBN), a free radical spin-trapping agent, protected against alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. In conclusion, Tlr4-mutant mice are resistant to acute alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. PMID:27627966

  9. Characterization of a disease-associated mutation affecting a putative splicing regulatory element in intron 6b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.

    PubMed

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M Cristina

    2009-10-30

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as "splicing mutations," but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002-1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5'- and 3'-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002-1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75.

  10. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.

    1989-06-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  11. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    PubMed

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  12. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation*

    PubMed Central

    Guo, Jianfei; Öz, Orhan K.

    2015-01-01

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the −36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  13. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance.

  14. Integration of distinct intracellular signaling pathways at distal regulatory elements directs T-bet expression in human CD4+ T cells.

    PubMed

    Placek, Katarzyna; Gasparian, Sona; Coffre, Maryaline; Maiella, Sylvie; Sechet, Emmanuel; Bianchi, Elisabetta; Rogge, Lars

    2009-12-15

    T-bet is a key regulator controlling Th1 cell development. This factor is not expressed in naive CD4(+) T cells, and the mechanisms controlling expression of T-bet are incompletely understood. In this study, we defined regulatory elements at the human T-bet locus and determined how signals originating at the TCR and at cytokine receptors are integrated to induce chromatin modifications and expression of this gene during human Th1 cell differentiation. We found that T cell activation induced two strong DNase I-hypersensitive sites (HS) and rapid histone acetylation at these elements in CD4(+) T cells. Histone acetylation and T-bet expression were strongly inhibited by cyclosporine A, and we detected binding of NF-AT to a HS in vivo. IL-12 and IFN-gamma signaling alone were not sufficient to induce T-bet expression in naive CD4(+) T cells, but enhanced T-bet expression in TCR/CD28-stimulated cells. We detected a third HS 12 kb upstream of the mRNA start site only in developing Th1 cells, which was bound by IL-12-induced STAT4. Our data suggest that T-bet locus remodeling and gene expression are initiated by TCR-induced NF-AT recruitment and amplified by IL-12-mediated STAT4 binding to distinct distal regulatory elements during human Th1 cell differentiation.

  15. Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2.

    PubMed

    Oem, Jae-Ku; Jackel-Cram, Candice; Li, Yi-Ping; Zhou, Yan; Zhong, Jin; Shimano, Hitoshi; Babiuk, Lorne A; Liu, Qiang

    2008-05-01

    Transcriptional factor sterol regulatory element-binding protein 1c (SREBP-1c) activates the transcription of lipogenic genes, including fatty acid synthase (FAS). Hepatitis C virus (HCV) infection is often associated with lipid accumulation within the liver, known as steatosis in the clinic. The molecular mechanisms of HCV-associated steatosis are not well characterized. Here, we showed that HCV non-structural protein 2 (NS2) activated SREBP-1c transcription in human hepatic Huh-7 cells as measured by using a human SREBP-1c promoter-luciferase reporter plasmid. We further showed that sterol regulatory element (SRE) and liver X receptor element (LXRE) in the SREBP-1c promoter were involved in SREBP-1c activation by HCV NS2. Furthermore, expression of HCV NS2 resulted in the upregulation of FAS transcription. We also showed that FAS upregulation by HCV NS2 was SREBP-1-dependent since deleting the SRE sequence in a FAS promoter and expressing a dominant-negative SREBP-1 abrogated FAS promoter upregulation by HCV NS2. Taken together, our results suggest that HCV NS2 can upregulate the transcription of SREBP-1c and FAS, and thus is probably a contributing factor for HCV-associated steatosis.

  16. Can the Isolated-Elements Strategy Be Improved by Targeting Points of High Cognitive Load for Additional Practice?

    ERIC Educational Resources Information Center

    Ayres, Paul

    2013-01-01

    Reducing problem complexity by isolating elements has been shown to be an effective instructional strategy. Novices, in particular, benefit from learning from worked examples that contain partially interacting elements rather than worked examples that provide full interacting elements. This study investigated whether the isolating-elements…

  17. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor

    PubMed Central

    Ares, Miguel A.; Fernández-Vázquez, José L.; Pacheco, Sabino; Martínez-Santos, Verónica I.; Jarillo-Quijada, Ma. Dolores; Torres, Javier; Alcántar-Curiel, María D.; González-y-Merchand, Jorge A.; De la Cruz, Miguel A.

    2017-01-01

    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae. PMID:28278272

  18. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor.

    PubMed

    Ares, Miguel A; Fernández-Vázquez, José L; Pacheco, Sabino; Martínez-Santos, Verónica I; Jarillo-Quijada, Ma Dolores; Torres, Javier; Alcántar-Curiel, María D; González-Y-Merchand, Jorge A; De la Cruz, Miguel A

    2017-01-01

    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae.

  19. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1.

    PubMed Central

    Van Lint, C; Ghysdael, J; Paras, P; Burny, A; Verdin, E

    1994-01-01

    Analysis of the chromatin organization of the integrated human immunodeficiency virus type 1 (HIV-1) genome has previously revealed a major constitutive DNase I-hypersensitive site associated with the pol gene (E. Verdin, J. Virol. 65:6790-6799, 1991). In the present report, high-resolution mapping of this site with DNase I and micrococcal nuclease identified a nucleosome-free region centered around nucleotides (nt) 4490 to 4766. A 500-bp fragment encompassing this hypersensitive site (nt 4481 to 4982) exhibited transcription-enhancing activity (two- to threefold) when it was cloned in its natural position with respect to the HIV-1 promoter after transient transfection in U937 and CEM cells. Using in vitro footprinting and gel shift assays, we have identified four distinct binding sites for nuclear proteins within this positive regulatory element. Site B (nt 4519 to 4545) specifically bound four distinct nuclear protein complexes: a ubiquitous factor, a T-cell-specific factor, a B-cell-specific factor, and the monocyte/macrophage- and B-cell-specific transcription factor PU.1/Spi-1. In most HIV-1 isolates in which this PU box was not conserved, it was replaced by a binding site for the related factor Ets1. Factors binding to site C (nt 4681 to 4701) had a DNA-binding specificity similar to that of factors binding to site B, except for PU.1/Spi-1. A GC box containing a binding site for Sp1 was identified (nt 4623 to 4631). Site D (nt 4816 to 4851) specifically bound a ubiquitously expressed factor. These results identify a transcriptional regulatory element associated with a nuclease-hypersensitive site in the pol gene of HIV-1 and suggest that its activity may be controlled by a complex interplay of cis-regulatory elements. Images PMID:8139041

  20. Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis.

    PubMed

    Duan, Yong-Bo; Li, Juan; Qin, Rui-Ying; Xu, Rong-Fang; Li, Hao; Yang, Ya-Chun; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2016-01-01

    Salt is a major environmental stress factor that can affect rice growth and yields. Recent studies suggested that members of the AP2/ERF domain-containing RAV (related to ABI3/VP1) TF family are involved in abiotic stress adaptation. However, the transcriptional response of rice RAV genes (OsRAVs) to salt has not yet been fully characterized. In this study, the expression patterns of all five OsRAVs were examined under salt stress. Only one gene, OsRAV2, was stably induced by high-salinity treatment. Further expression profile analyses indicated that OsRAV2 is transcriptionally regulated by salt, but not KCl, osmotic stress, cold or ABA (abscisic acid) treatment. To elucidate the regulatory mechanism of the stress response at the transcriptional level, we isolated and characterized the promoter region of OsRAV2 (P OsRAV2 ). Transgenic analysis indicated that P OsRAV2 is induced by salt stress but not osmotic stress or ABA treatment. Serial 5' deletions and site-specific mutations in P OsRAV2 revealed that a GT-1 element located at position -664 relative to the putative translation start site is essential for the salt induction of P OsRAV2 . The regulatory function of the GT-1 element in the salt induction of OsRAV2 was verified in situ in plants with targeted mutations generated using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system. Taken together, our results indicate that the GT-1 element directly controls the salt response of OsRAV2. This study provides a better understanding of the putative functions of OsRAVs and the molecular regulatory mechanisms of plant genes under salt stress.

  1. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    PubMed

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles.

  2. Thermal aging of traditional and additively manufactured foams: analysis by time-temperature-superposition, constitutive, and finite-element models

    SciTech Connect

    Maiti, A.; Weisgraber, T. H.; Small, W.; Lewicki, J. P.; Duoss, E. B.; Spadaccini, C. M.; Pearson, M. A.; Chinn, S. C.; Wilson, T. S.; Maxwell, R. S.

    2016-12-08

    Cellular solids or foams are a very important class of materials with diverse applications ranging from thermal insulation and shock absorbing support cushions, to light-weight structural and floatation components, and constitute crucial components in a large number of industries including automotive, aerospace, electronics, marine, biomedical, packaging, and defense. In many of these applications the foam material is subjected to long periods of continuous stress, which can, over time, lead to a permanent change in structure and a degradation in performance. In this report we summarize our modeling efforts to date on polysiloxane foam materials that form an important component in our systems. Aging of the materials was characterized by two measured quantities, i.e., compression set and load retention. Results of accelerated aging experiments were analyzed by an automated time-temperaturesuperposition (TTS) approach, which creates a master curve that can be used for long-term predictions (over decades) under ambient conditions. When comparing such master curves for traditional (stochastic) foams with those for recently 3D-printed (i.e., additively manufactured, or AM) foams, it became clear that AM foams have superior aging behavior. To gain deeper understanding, we imaged the microstructure of both foams using X-ray computed tomography, and performed finite-element analysis of the mechanical response within these microstructures. This indicates a wider stress variation in the stochastic foam with points of more extreme local stress as compared to the 3D printed material.

  3. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  4. Genome Wide Analysis Reveals Zic3 Interaction with Distal Regulatory Elements of Stage Specific Developmental Genes in Zebrafish

    PubMed Central

    Kumar, Vibhor; Srinivasan, Kandhadayar G.; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W.; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-01-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches – ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape. PMID:24204288

  5. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  6. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji

    2003-01-01

    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  7. Long-range DNase I hypersensitivity mapping reveals the imprinted Igf2r and Air promoters share cis-regulatory elements

    PubMed Central

    Pauler, Florian M.; Stricker, Stefan H.; Warczok, Katarzyna E.; Barlow, Denise P.

    2005-01-01

    Epigenetic mechanisms restrict the expression of imprinted genes to one parental allele in diploid cells. At the Igf2r/Air imprinted cluster on mouse chromosome 17, paternal-specific expression of the Air noncoding RNA has been shown to silence three genes in cis: Igf2r, Slc22a2, and Slc22a3. By an unbiased mapping of DNase I hypersensitive sites (DHS) in a 192-kb region flanking Igf2r and Air, we identified 21 DHS, of which nine mapped to evolutionarily conserved sequences. Based on the hypothesis that silencing effects of Air would be directed towards cis regulatory elements used to activate genes, DHS are potential key players in the control of imprinted expression. However, in this 192-kb region only the two DHS mapping to the Igf2r and Air promoters show parental specificity. The remaining 19 DHS were present on both parental alleles and, thus, have the potential to activate Igf2r on the maternal allele and Air on the paternal allele. The possibility that the Igf2r and Air promoters share the same cis-acting regulatory elements, albeit on opposite parental chromosomes, was supported by the similar expression profiles of Igf2r and Air in vivo. These results refine our understanding of the onset of imprinted silencing at this cluster and indicate the Air noncoding RNA may specifically target silencing to the Igf2r promoter. PMID:16204191

  8. The maize regulatory gene B-Peru contains a DNA rearrangement that specifies tissue-specific expression through both positive and negative promoter elements.

    PubMed Central

    Selinger, D A; Lisch, D; Chandler, V L

    1998-01-01

    The B-Peru allele of the maize b regulatory gene is unusual relative to most b alleles in that it is expressed in the aleurone layer of the seed. It is also expressed in a subset of plant vegetative tissues. Transgenic maize plants containing the B-Peru gene with the first 710 bases of upstream sequence conferred the same levels of aleurone expression as nontransgenic B-Peru plants, but no pigment was made in vegetative tissues. Transient transformation assays in aleurone tissue localized the aleurone-specific promoter to the first 176 bases of the B-Peru upstream region and identified two critically important regions within this fragment. Mutation of either region alone reduced expression greater than fivefold. Surprisingly, the double mutation actually increased expression to twice the native promoter level. Our results suggest that these two critical sequences, which lie close together in the promoter, may form a negative regulatory element. Several lines of evidence suggest that the B-Peru promoter arose through the translocation of an existing aleurone-specific promoter to the b locus. Immediately upstream of the aleurone-specific promoter elements and in the opposite orientation to the b coding sequence is a pseudogene sequence with strong similarity to a known class of proteins. Our findings that novel aleurone-specific promoter sequences of the B-Peru transcription factor are found adjacent to part of another gene in a small insertion are quite unexpected and have interesting evolutionary implications. PMID:9611220

  9. Identification of positive and negative regulatory elements involved in the retinoic acid/cAMP induction of Fgf-3 transcription in F9 cells.

    PubMed Central

    Murakami, A; Grinberg, D; Thurlow, J; Dickson, C

    1993-01-01

    The proto-oncogene Fgf-3 has been implicated as an important signalling molecule in vertebrate development. In the mouse, it is expressed for a limited time at a multitude of sites from embryonic day 7 to birth. Transcription of Fgf-3 initiates at three promoter regions resulting in the generation of various mRNAs which nevertheless all encode the same protein products. A 1.7kb DNA fragment which encompasses these regions was joined to the CAT reporter gene and shown to function as a promoter in embryonal carcinoma cells. In stable transfectants the promoter retains its retinoic acid inducibility, initiating transcription at the same cap-sites as the endogenous gene. In differentiated F9 cells, transient transfection of progressive and targeted deletion mutants of the promoter region has revealed at least two positive and three negative regulatory elements. With one exception, loss of these elements was shown to dramatically affect promoter activity in stable transfectants of F9 cells. However the promoter remained inducible by retinoic acid to differing degrees, apart from deletions encompassing PS-4A which essentially abolished promoter activity in both undifferentiated and differentiated cells. The sequences of these potential regulatory regions were further defined using DNase-I footprinting, revealing some similarities to consensus binding sites for known transcription factors. Images PMID:8265348

  10. The role of mecA and blaZ regulatory elements in mecA expression by regional clones of methicillin-resistant Staphylococcus pseudintermedius.

    PubMed

    Black, C C; Eberlein, L C; Solyman, S M; Wilkes, R P; Hartmann, F A; Rohrbach, B W; Bemis, D A; Kania, S A

    2011-08-05

    Two major regional clones of methicillin-resistant Staphylococcus pseudintermedius (MRSP) have been identified in Europe and North America. They are designated multilocus sequence types (ST) 71 and 68 and contain staphylococcal chromosome cassette (SCCmec) types II-III and V(T), respectively. One notable difference between the two clones is a deletion in the mecI/mecR1 regulatory apparatus of ST 68 SCCmec V(T). This deletion in analogous methicillin-resistant Staphylococcus aureus (MRSA) results in more responsive and greater expression of the mecA encoded penicillin-binding protein 2a, and is associated with SCCmec types occurring in community-acquired MRSA lineages. The aim of this study was to characterize mec and bla regulatory apparatuses in MRSP and determine their effects on expression of mecA. Seventeen S. pseudintermedius isolates representing nine methicillin-resistant ST lineages were screened for the presence of the repressors blaI and mecI and sensors blaR1 and mecR1. The bla and mec operons for each isolate were sequenced and compared for homology between the repressor open-reading frames (ORF), sensor ORFs, and mecA promoter regions. A real-time reverse transcriptase PCR expression assay was developed, validated and applied to nine isolates determining the effect of oxacillin induction on mecA transcription. Significant differences were found in mecA expression between isolates with a full regulatory complement (mecI/mecR1 and blaI/blaR1) and those with truncated and/or absent regulatory elements. Isolates representative of European and North American MRSP ST regional clones have dissimilar mecA responses to oxacillin.

  11. Epithelial Expression of Human ABO Blood Group Genes Is Dependent upon a Downstream Regulatory Element Functioning through an Epithelial Cell-specific Transcription Factor, Elf5.

    PubMed

    Sano, Rie; Nakajima, Tamiko; Takahashi, Yoichiro; Kubo, Rieko; Kobayashi, Momoko; Takahashi, Keiko; Takeshita, Haruo; Ogasawara, Kenichi; Kominato, Yoshihiko

    2016-10-21

    The human ABO blood group system is of great importance in blood transfusion and organ transplantation. The ABO system is composed of complex carbohydrate structures that are biosynthesized by A- and B-transferases encoded by the ABO gene. However, the mechanisms regulating ABO gene expression in epithelial cells remain obscure. On the basis of DNase I-hypersensitive sites in and around ABO in epithelial cells, we prepared reporter plasmid constructs including these sites. Subsequent luciferase assays and histone modifications indicated a novel positive regulatory element, designated the +22.6-kb site, downstream from ABO, and this was shown to enhance ABO promoter activity in an epithelial cell-specific manner. Expression of ABO and B-antigen was reduced in gastric cancer KATOIII cells by biallelic deletion of the +22.6-kb site using the CRISPR/Cas9 system. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that the site bound to an epithelial cell-specific transcription factor, Elf5. Mutation of the Ets binding motifs to abrogate binding of this factor reduced the regulatory activity of the +22.6-kb site. Furthermore, ELF5 knockdown with shRNA reduced both endogenous transcription from ABO and B-antigen expression in KATOIII cells. Thus, Elf5 appeared to be involved in the enhancer potential of the +22.6-kb site. These results support the contention that ABO expression is dependent upon a downstream positive regulatory element functioning through a tissue-restricted transcription factor, Elf5, in epithelial cells.

  12. A new regulatory element mediates ethanol repression of KlADH3, a Kluyveromyces lactis gene coding for a mitochondrial alcohol dehydrogenase.

    PubMed

    Saliola, Michele; Getuli, Claudia; Mazzoni, Cristina; Fantozzi, Ivana; Falcone, Claudio

    2007-08-01

    KlADH3 is a Kluyveromyces lactis alcohol dehydrogenase gene induced in the presence of all respiratory carbon sources except ethanol, which specifically represses this gene. Deletion analysis of the KlADH3 promoter revealed the presence of both positive and negative elements. However, by site-directed mutagenesis and gel retardation experiments, we identified a 15-bp element responsible for the transcriptional repression of this gene by ethanol. In particular, this element showed putative sites required for the sequential binding of ethanol-induced factors responsible for the repressed conditions, and the binding of additional factors relieved repression. In addition, we showed that the ethanol element was required for in vivo repression of KlAdh3 activity.

  13. The salt-regulated element in the promoter of lycopene β-cyclase gene confers a salt regulatory pattern in carotenogenesis of Dunaliella bardawil.

    PubMed

    Liang, Ming-Hua; Lu, Yan; Chen, Hao-Hong; Jiang, Jian-Guo

    2017-03-01

    In the carotenoid biosynthesis, lycopene β-cyclase (LCYb) is a key regulatory enzyme involved in the conversion of lycopene into β-carotene. Under stress conditions, such as high salinity, high light and nutrient deprivation, large amounts of β-carotene can be accumulated in Dunaliella bardawil. To study on the molecular responses of salt stress in D. bardawil is of great significance to reveal the mechanisms of salt tolerance and engineer crop plants to be salt-tolerant. In this study, the full-length coding sequence of lcyb from D. bardawil (Dblcyb, GenBank: KX218392) was isolated by transcriptome sequencing. Then, the genomic sequence, promoter and terminator regions of Dblcyb were isolated by genome walking. The Dblcyb promoter (GenBank: KX218393) contained several typical transcription boxes, multiple light response elements and a salt-regulated element (SRE, GT1GMSCAM4). Dbpsy and Dblcyb responsible for β-carotene biosynthesis in D. bardawil was shown to be up-regulated under salt stress and their promoters contained the common SRE. By element deletion analysis and using Ble-EGFP as the reporter, the salt-inducible SRE was confirmed to confer salt-induced expression of Dblcyb promoter. It was indicated that the salt-regulated expression of Dblcyb may be attributed to the salt-responsive element (GT1GMSCAM4) and the GT-rich region in its genomic sequence.

  14. FoxO1 inhibits sterol regulatory element-binding protein-1c (SREBP-1c) gene expression via transcription factors Sp1 and SREBP-1c.

    PubMed

    Deng, Xiong; Zhang, Wenwei; O-Sullivan, InSug; Williams, J Bradley; Dong, Qingming; Park, Edwards A; Raghow, Rajendra; Unterman, Terry G; Elam, Marshall B

    2012-06-08

    Induction of lipogenesis in response to insulin is critically dependent on the transcription factor, sterol regulatory element-binding protein-1c (SREBP-1c). FoxO1, a forkhead box class-O transcription factor, is an important mediator of insulin action, but its role in the regulation of lipid metabolism has not been clearly defined. We examined the effects of FoxO1 on srebp1 gene expression in vivo and in vitro. In vivo studies showed that constitutively active (CA) FoxO1 (CA-FoxO1) reduced basal expression of SREBP-1c mRNA in liver by ∼60% and blunted induction of SREBP-1c in response to feeding. In liver-specific FoxO knock-out mice, SREBP-1c expression was increased ∼2-fold. Similarly, in primary hepatocytes, CA-FoxO1 suppressed SREBP1-c expression and inhibited basal and insulin-induced SREBP-1c promoter activity. SREBP-1c gene expression is induced by the liver X receptor (LXR), but CA-FoxO1 did not block the activation of SREBP-1c by the LXR agonist TO9. Insulin stimulates SREBP-1c transcription through Sp1 and via "feed forward" regulation by newly synthesized SREBP-1c. CA-FoxO1 inhibited SREBP-1c by reducing the transactivational capacity of both Sp1 and SREBP-1c. In addition, chromatin immunoprecipitation assays indicate that FoxO1 can associate with the proximal promoter region of the srebp1 gene and disrupt the assembly of key components of the transcriptional complex of the SREBP-1c promoter. We conclude that FoxO1 inhibits SREBP-1c transcription via combined actions on multiple transcription factors and that this effect is exerted at least in part through reduced transcriptional activity of Sp1 and SREBP-1c and disrupted assembly of the transcriptional initiation complex on the SREBP-1c promoter.

  15. Asymmetrically reduced expression of hand1 homeologs involving a single nucleotide substitution in a cis-regulatory element.

    PubMed

    Ochi, Haruki; Suzuki, Nanoka; Kawaguchi, Akane; Ogino, Hajime

    2017-03-28

    During vertebrate evolution, whole genome duplications resulted in a number of duplicated genes, some of which eventually changed their expression patterns and/or levels via alteration of cis-regulatory sequences. However, the initial process involved in such cis-regulatory changes remains unclear. Therefore, we investigated this process by analyzing the duplicated hand1 genes of Xenopus laevis (hand1.L and hand1.S), which were generated by allotetraploidization 17-18 million years ago, and compared these with their single ortholog in the ancestral-type diploid species X. tropicalis. A dN/dS analysis indicated that hand1.L and hand1.S are still under purifying selection, and thus, their products appear to retain ancestral functional properties. RNA-seq and in situ hybridization analyses revealed that hand1.L and hand1.S have similar expression patterns to each other and to X. tropicalis hand1, but the hand1.S expression level was much lower than the hand1.L expression level in the primordial heart. A comparative sequence analysis, luciferase reporter analysis, ChIP-PCR analysis, and transgenic reporter analysis showed that a single nucleotide substitution in the hand1.S promoter was responsible for the reduced expression in the heart. These findings demonstrated that a small change in the promoter sequence can trigger diversification of duplicated gene expression prior to diversification of their encoded protein functions in a young duplicated genome.

  16. Effect of the addition of low rare earth elements (lanthanum, neodymium, cerium) on the biodegradation and biocompatibility of magnesium.

    PubMed

    Willbold, Elmar; Gu, Xuenan; Albert, Devon; Kalla, Katharina; Bobe, Katharina; Brauneis, Maria; Janning, Carla; Nellesen, Jens; Czayka, Wolfgang; Tillmann, Wolfgang; Zheng, Yufeng; Witte, Frank

    2015-01-01

    Rare earth elements are promising alloying element candidates for magnesium alloys used as biodegradable devices in biomedical applications. Rare earth elements have significant effects on the high temperature strength as well as the creep resistance of alloys and they improve magnesium corrosion resistance. We focused on lanthanum, neodymium and cerium to produce magnesium alloys with commonly used rare earth element concentrations. We showed that low concentrations of rare earth elements do not promote bone growth inside a 750 μm broad area around the implant. However, increased bone growth was observed at a greater distance from the degrading alloys. Clinically and histologically, the alloys and their corrosion products caused no systematic or local cytotoxicological effects. Using microtomography and in vitro experiments, we could show that the magnesium-rare earth element alloys showed low corrosion rates, both in in vitro and in vivo. The lanthanum- and cerium-containing alloys degraded at comparable rates, whereas the neodymium-containing alloy showed the lowest corrosion rates.

  17. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )

    1991-05-01

    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  18. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael

    2016-01-01

    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s

  19. The cyclic oxidation resistance at 1200 C of beta-NiAl, FeAl, and CoAl alloys with selected third element additions

    NASA Technical Reports Server (NTRS)

    Barrett, C. A.; Titran, R. H.

    1992-01-01

    The intermetallic compounds Beta-NiAl, FeAl, and CoAl were tested in cyclic oxidation with selected third element alloy additions. Tests in static air for 200 1-hr cycles at 1200 C indicated by specific weight change/time data and x-ray diffraction analysis that the 5 at percent alloy additions did not significantly improve the oxidation resistance over the alumina forming baseline alloys without the additions. Many of the alloy additions were actually deleterious. Ta and Nb were the only alloy additions that actually altered the nature of the oxide(s) formed and still maintained the oxidation resistance of the protective alumina scale.

  20. Photographic Atlas and Three-Dimensional Reconstruction of the Holotype Skull of Euhelopus zdanskyi with Description of Additional Cranial Elements

    PubMed Central

    Poropat, Stephen F.; Kear, Benjamin P.

    2013-01-01

    Background Euhelopus zdanskyi is one of relatively few sauropod taxa known from an almost complete skull and mandible. Recent phylogenetic analyses suggest that Euhelopus is a somphospondylan titanosauriform, and that it is a member of the clade (Euhelopodidae) which is the sister taxon to the hugely successful, dominantly Cretaceous sauropod group Titanosauria. Methodology/Principal Findings The skull elements of Euhelopus were CT scanned at Uppsala Akademiska Sjukhuset. Three-dimensional models of the elements were constructed from the DICOM data using Mimics 14.0, InVesalius 3.0, and GeoMagic Studio 2012, the skull was rearticulated in Rhinoceros 4.0, and the final version was rendered in GeoMagic Studio 2012. Conclusions/Significance The fact that relatively complete sauropod skulls are so rare in the fossil record, particularly among titanosauriforms, means that the skulls that are known should be as thoroughly described and well-illustrated as possible. This contribution supplements previous descriptions of the cranial elements of Euhelopus, one of the few euhelopodid taxa for which cranial material is known, by presenting a comprehensive photographic atlas of the skull elements to facilitate a better understanding of their morphology. We describe several elements which have been overlooked in past studies of Euhelopus, and also provide as accurate a reconstruction of the skull as possible (in the absence of the braincase), the most significant components of which are the articulations of the palate and the mandible. PMID:24278222

  1. Analysis of a DNase I-hypersensitive site in transgenic Drosophila reveals a key regulatory element of Sgs3.

    PubMed Central

    Ramain, P; Giangrande, A; Richards, G; Bellard, M

    1988-01-01

    We have undertaken chromatin studies on transformed Drosophila strains carrying DNA sequences modified in the region of the DNase I (EC 3.1.4.5)-hypersensitive sites -750 and -600 base pairs upstream from the Sgs3 start site. Although both sites are developmentally specific, modifications in the -750 site have little or no effect on Sgs3-encoded transcript levels, whereas either deletion or replacement of sequences at the -600 site causes an important reduction in transcript levels. The element associated with the -600 site enhances Sgs3 transcription when displaced with respect to the start site. This combined approach has defined sequence elements necessary both for normal transcript levels as well as the chromatin structure characteristic of Sgs3 activity in vivo. Images PMID:3128796

  2. The sequential addition and migration method to generate representative volume elements for the homogenization of short fiber reinforced plastics

    NASA Astrophysics Data System (ADS)

    Schneider, Matti

    2017-02-01

    We present an algorithm for generating volume elements of short fiber reinforced plastic microstructures for prescribed fourth order fiber orientation tensor, fiber aspect ratio and solid volume fraction. The algorithm inserts fibers randomly into an existing microstructure, and removes the resulting overlap systematically based on a gradient descent method. In contrast to existing methods, large fiber aspect ratios (up to 150) and large volume fractions (60 vol% for isotropic orientation and aspect ratio of 33) can be reached. We study the effective linear elastic properties of the resulting microstructures, depending on fiber orientation, volume fraction as well as aspect ratio, and examine the size of a corresponding representative volume element.

  3. Epstein–Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression

    PubMed Central

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B.; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G.; Sinclair, Alison J.

    2015-01-01

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  4. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    PubMed

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network.

  5. HRP-2, the Caenorhabditis elegans homolog of mammalian heterogeneous nuclear ribonucleoproteins Q and R, is an alternative splicing factor that binds to UCUAUC splicing regulatory elements.

    PubMed

    Kabat, Jennifer L; Barberan-Soler, Sergio; Zahler, Alan M

    2009-10-16

    Alternative splicing is regulated by cis sequences in the pre-mRNA that serve as binding sites for trans-acting alternative splicing factors. In a previous study, we used bioinformatics and molecular biology to identify and confirm that the intronic hexamer sequence UCUAUC is a nematode alternative splicing regulatory element. In this study, we used RNA affinity chromatography to identify trans factors that bind to this sequence. HRP-2, the Caenorhabditis elegans homolog of human heterogeneous nuclear ribonucleoproteins Q and R, binds to UCUAUC in the context of unc-52 intronic regulatory sequences as well as to RNAs containing tandem repeats of this sequence. The three Us in the hexamer are the most important determinants of this binding specificity. We demonstrate, using RNA interference, that HRP-2 regulates the alternative splicing of two genes, unc-52 and lin-10, both of which have cassette exons flanked by an intronic UCUAUC motif. We propose that HRP-2 is a protein responsible for regulating alternative splicing through binding interactions with the UCUAUC sequence.

  6. Unraveling the regulatory network of IncA/C plasmid mobilization: When genomic islands hijack conjugative elements.

    PubMed

    Carraro, Nicolas; Matteau, Dominick; Burrus, Vincent; Rodrigue, Sébastien

    2015-01-01

    Conjugative plasmids of the A/C incompatibility group (IncA/C) have become substantial players in the dissemination of multidrug resistance. These large conjugative plasmids are characterized by their broad host-range, extended spectrum of antimicrobials resistance, and prevalence in enteric bacteria recovered from both environmental and clinical settings. Until recently, relatively little was known about the basic biology of IncA/C plasmids, mostly because of the hindrance of multidrug resistance for molecular biology experiments. To circumvent this issue, we previously developed pVCR94ΔX, a convenient prototype that codes for a reduced set of antibiotic resistances. Using pVCR94ΔX, we then characterized the regulatory pathway governing IncA/C plasmid dissemination. We found that the expression of roughly 2 thirds of the genes encoded by this plasmid, including large operons involved in the conjugation process, depends on an FlhCD-like master activator called AcaCD. Beyond the mobility of IncA/C plasmids, AcaCD was also shown to play a key role in the mobilization of different classes of genomic islands (GIs) identified in various pathogenic bacteria. By doing so, IncA/C plasmids can have a considerable impact on bacterial genomes plasticity and evolution.

  7. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.

    PubMed

    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L

    2016-09-01

    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease.

  8. Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands

    PubMed Central

    Zubović, Lorena; Baralle, Marco; Baralle, Francisco E.

    2012-01-01

    Mutually exclusive splicing is a form of alternative pre-mRNA processing that consists in the use of only one of a set of two or more exons. We have investigated the mechanisms involved in this process for exon 18 of the Nav 1.6 sodium channel transcript and its significance regarding gene-expression regulation. The 18N exon (neonatal form) has a stop codon in phase and although the mRNA can be detected by amplification methods, the truncated protein has not been observed. The switch from 18N to 18A (adult form) occurs only in a restricted set of neural tissues producing the functional channel while other tissues display the mRNA with the 18N exon also in adulthood. We demonstrate that the mRNA species carrying the stop codon is subjected to Nonsense-Mediated Decay, providing a control mechanism of channel expression. We also map a string of cis-elements within the mutually exclusive exons and in the flanking introns responsible for their strict tissue and temporal specificity. These elements bind a series of positive (RbFox-1, SRSF1, SRSF2) and negative (hnRNPA1, PTB, hnRNPA2/B1, hnRNPD-like JKTBP) splicing regulatory proteins. These splicing factors, with the exception of RbFox-1, are ubiquitous but their levels vary during development and differentiation, ensuing unique sets of tissue and temporal levels of splicing factors. The combinatorial nature of these elements is highlighted by the dominance of the elements that bind the ubiquitous factors over the tissue specific RbFox-1. PMID:22434879

  9. Uranium hydrogeochemical and stream sediment reconnasissance of the Trinidad NTMS Quadrangle, Colorado, including concentrations of forty-two additional elements

    SciTech Connect

    Shannon, S.S. Jr.

    1980-05-01

    Uranium and other elemental data resulting from the Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Trinidad National Topographic Map Series (NTMS) quadrangle, Colorado, by the Los Alamos Scientific Laboratory (LASL) are reported herein. This study was conducted as part of the United States Department of Energy's National Uranium Resource Evaluation (NURE), which is designed to provide improved estimates of the availability and economics of nuclear fuel resources and to make available to industry information for use in exploration and development of uranium resources. The HSSR data will ultimately be integrated with other NURE data (e.g., airborne radiometric surveys and geological investigations) to complete the entire NURE program. This report is a supplement to the HSSR uranium evaluation report for the Trinidad quadrange (Morris et al, 1978), which presented the field and uranium data for the 1060 water and 1240 sediment samples collected from 1768 locations in the quadrangle. The earlier report contains an evaluation of the uranium concentrations of the samples as well as descriptions of the geology, hydrology, climate, and uranium occurrences of the quadrange. This supplement presents the sediment field and uranium data again and the analyses of 42 other elements in the sediments. All uranium samples were redetermined by delayed-neutron counting (DNC) when the sediment samples were analyzed for 31 elements by neutron activation. For 99.6% of the sediment samples analyzed, the differences between the uranium contents first determined (Morris et al, 1978) and the analyses reported herein are less than 10%.

  10. Identification and characterization of hepatocyte-specific regulatory regions of the rat pyruvate kinase L gene. The synergistic effect of multiple elements.

    PubMed

    Yamada, K; Noguchi, T; Matsuda, T; Takenaka, M; Monaci, P; Nicosia, A; Tanaka, T

    1990-11-15

    The rat pyruvate kinase L (PKL) gene produces the L- and R-type isozymes by alternative transcription that is regulated in a tissue-specific manner. To investigate which DNA elements are involved in hepatocyte-specific expression of the L-type isozyme, we performed transient DNA transfer experiments with PKL/chloramphenicol acetyltransferase fusion genes. We found three positive regulatory regions required for expression of the L-type isozyme in adult rat hepatocytes by functional analyses of a series of 5' and internal deletion constructs of the fusion genes. These regions, designated as PKL-I, PKL-II, and PKL-III, were located between nucleotides -76 and -94, -126 and -149, and -150 and -170, respectively. PKL-I showed enhancer-like activity alone, whereas PKL-II and PKL-III did not have any independent effect. Combinations of L-I + L-II and L-II + L-III, but not of L-I + L-III, showed synergistic enhancer activities when oriented in the same direction. The inclusion of all three elements oriented in the same direction had the maximum synergistic effect, indicating that these elements function as a unit. This unit enhanced expression from heterologous as well as homologous promoters in a manner that was independent of its orientation and position relative to the cap site. The activity of the unit was not detected in HeLa cells or K562 erythroleukemia cells, suggesting that this unit possessed cell-type specificity. PKL-I consists of a palindrome sequence 5'-CTGGTTATACTTTAACCAG-3', which contain a sequence homologous to the LF-B1-binding site. PKL-II contains the sequence 5'-TTCCTGGACTCTGGCCCCCAGTGT-3', which is similar to that of the LF-A1-binding site. PKL-III contains a palindrome sequence 5'-CCACGGGGCACTCCCGTGG-3', which include a sequence homologous to the binding site of the adenovirus major late transcription factor. Gel retardation assay indicated that the different trans-acting factors interacted with three elements and that the transacting protein bound

  11. A novel tumor necrosis factor-responsive transcription factor which recognizes a regulatory element in hemopoietic growth factor genes

    SciTech Connect

    Shannon, M.F.; Pell, L.M.; Kuczek, E.S.; Occhiodoro, F.S.; Dunn, S.M.; Vadas, M.A. ); Lenardo, M.J. )

    1990-06-01

    A conserved DNA sequence element, termed cytokine 1 (CK-1), is found in the promoter regions of many hemopoietic growth factor (HGF) genes. Mutational analyses and modification interference experiments show that this sequence specifically binds a nuclear transcription factor, NF-GMa, which is a protein with a molecular mass of 43 kilodaltons. It interacts with different affinities with the CK-1-like sequence from a number of HGF genes, including granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte (G)-CSF, interleukin 3 (IL-3), and IL-5. The authors show that the level of NF-GMa binding is induced in embryonic fibroblasts by tumor necrosis factor {alpha} (TNF-{alpha}) treatment and that the CK-1 sequence from the G-CSF gene is a TNF-{alpha}-responsive enhancer in these cells.

  12. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus.

    PubMed

    Braem, Caroline; Recolin, Bénédicte; Rancourt, Rebecca C; Angiolini, Christopher; Barthès, Pauline; Branchu, Priscillia; Court, Franck; Cathala, Guy; Ferguson-Smith, Anne C; Forné, Thierry

    2008-07-04

    We previously showed that genomic imprinting regulates matrix attachment region activities at the mouse Igf2 (insulin-like growth factor 2) locus and that these activities are functionally linked to neighboring differentially methylated regions (DMRs). Here, we investigate the similarly structured Dlk1/Gtl2 imprinted domain and show that in the mouse liver, the G/C-rich intergenic germ line-derived DMR, a sequence involved in domain-wide imprinting, is highly retained within the nuclear matrix fraction exclusively on the methylated paternal copy, reflecting its differential function on that chromosome. Therefore, not only "classical" A/T-rich matrix attachment region (MAR) sequences but also other important regulatory DNA elements (such as DMRs) can be recovered from genomic MAR assays following a high salt treatment. Interestingly, the recovery of one A/T-rich sequence (MAR4) from the "nuclear matrix" fraction is strongly correlated with gene expression. We show that this element possesses an intrinsic activity that favors transcription, and using chromosome conformation capture quantitative real time PCR assays, we demonstrate that the MAR4 interacts with the intergenic germ line-derived DMR specifically on the paternal allele but not with the Dlk1/Gtl2 promoters. Altogether, our findings shed a new light on gene regulation at this locus.

  13. Identification of a melanocyte-specific, microphthalmia-associated transcription factor-dependent regulatory element in the intronic duplication causing hair greying and melanoma in horses.

    PubMed

    Sundström, Elisabeth; Komisarczuk, Anna Z; Jiang, Lin; Golovko, Anna; Navratilova, Pavla; Rinkwitz, Silke; Becker, Thomas S; Andersson, Leif

    2012-01-01

    Greying with age in horses is an autosomal dominant trait, characterized by hair greying, high incidence of melanoma and vitiligo-like depigmentation. Previous studies have revealed that the causative mutation for this phenotype is a 4.6-kb intronic duplication in STX17 (Syntaxin 17). By using reporter constructs in transgenic zebrafish, we show that a construct containing two copies of the duplicated sequence acts as a strong enhancer in neural crest cells and has subsequent melanophore-specific activity during zebrafish embryonic development whereas a single copy of the duplicated sequence acts as a weak enhancer, consistent with the phenotypic manifestation of the mutation in horses. We further used luciferase assays to investigate regulatory regions in the duplication, to reveal tissue-specific activities of these elements. One region upregulated the reporter gene expression in a melanocyte-specific manner and contained two microphthalmia-associated transcription factor (MITF) binding sites, essential for the activity. Microphthalmia-associated transcription factor regulates melanocyte development, and these binding sites are outstanding candidates for mediating the melanocyte-specific activity of the element. These results provide strong support for the causative nature of the duplication and constitute an explanation for the melanocyte-specific effects of the Grey allele.

  14. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space

    PubMed Central

    Karnik, Rahul; Beer, Michael A.

    2015-01-01

    The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs. PMID:26465884

  15. Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Spolaore, Barbara; Xodo, Luigi E.

    2008-01-01

    The human KRAS proto-oncogene contains a critical nuclease hypersensitive element (NHE) upstream of the major transcription initiation site. In this article, we demonstrate by primer-extension experiments, PAGE, chemical footprinting, CD, UV and FRET experiments that the G-rich strand of NHE (32R) folds into intra-molecular G-quadruplex structures. Fluorescence data show that 32R in 100 mM KCl melts with a biphasic profile, showing the formation of two distinct G-quadruplexes with Tm of ∼55°C (Q1) and ∼72°C (Q2). DMS-footprinting and CD suggest that Q1 can be a parallel and Q2 a mixed parallel/antiparallel G-quadruplex. When dsNHE (32R hybridized to its complementary) is incubated with a nuclear extract from Panc-1 cells, three DNA–protein complexes are observed by EMSA. The complex of slower mobility is competed by quadruplex 32R, but not by mutant oligonucleotides, which cannot form a quadruplex structure. Using paramagnetic beads coupled with 32R, we pulled down from the Panc-1 extract proteins with affinity for quadruplex 32R. One of these is the heterogeneous nuclear ribonucleoprotein A1, which was previously reported to unfold quadruplex DNA. Our study suggests a role of quadruplex DNA in KRAS transcription and provides the basis for the rationale design of molecular strategies to inhibit the expression of KRAS. PMID:18490377

  16. In Silico Identification and Experimental Characterization of Regulatory Elements Controlling the Expression of the Salmonella csrB and csrC Genes

    PubMed Central

    Martínez, Luary C.; Martínez-Flores, Irma; Salgado, Heladia; Fernández-Mora, Marcos; Medina-Rivera, Alejandra; Puente, José L.; Collado-Vides, Julio

    2014-01-01

    The small RNAs CsrB and CsrC of Salmonella indirectly control the expression of numerous genes encoding widespread cellular functions, including virulence. The expression of csrB and csrC genes, which are located in different chromosomal regions, is coordinated by positive transcriptional control mediated by the two-component regulatory system BarA/SirA. Here, we identified by computational analysis an 18-bp inverted repeat (IR) sequence located far upstream from the promoter of Salmonella enterica serovar Typhimurium csrB and csrC genes. Deletion analysis and site-directed mutagenesis of the csrB and csrC regulatory regions revealed that this IR sequence is required for transcriptional activation of both genes. Protein-DNA and protein-protein interaction assays showed that the response regulator SirA specifically binds to the IR sequence and provide evidence that SirA acts as a dimer. Interestingly, whereas the IR sequence was essential for the SirA-mediated expression of csrB, our results revealed that SirA controls the expression of csrC not only by binding to the IR sequence but also by an indirect mode involving the Csr system. Additional computational, biochemical, and genetic analyses demonstrated that the integration host factor (IHF) global regulator positively controls the expression of csrB, but not of csrC, by interacting with a sequence located between the promoter and the SirA-binding site. These findings contribute to the better understanding of the regulatory mechanism controlling the expression of CsrB and CsrC. PMID:24187088

  17. Functional Classification, Genomic Organization, Putatively cis-Acting Regulatory Elements, and Relationship to Quantitative Trait Loci, of Sorghum Genes with Rhizome-Enriched Expression1[W

    PubMed Central

    Jang, Cheol Seong; Kamps, Terry L.; Skinner, D. Neil; Schulze, Stefan R.; Vencill, William K.; Paterson, Andrew H.

    2006-01-01

    Rhizomes are organs of fundamental importance to plant competitiveness and invasiveness. We have identified genes expressed at substantially higher levels in rhizomes than other plant parts, and explored their functional categorization, genomic organization, regulatory motifs, and association with quantitative trait loci (QTLs) conferring rhizomatousness. The finding that genes with rhizome-enriched expression are distributed across a wide range of functional categories suggests some degree of specialization of individual members of many gene families in rhizomatous plants. A disproportionate share of genes with rhizome-enriched expression was implicated in secondary and hormone metabolism, and abiotic stimuli and development. A high frequency of unknown-function genes reflects our still limited knowledge of this plant organ. A putative oligosaccharyl transferase showed the highest degree of rhizome-specific expression, with several transcriptional or regulatory protein complex factors also showing high (but lesser) degrees of specificity. Inferred by the upstream sequences of their putative rice (Oryza sativa) homologs, sorghum (Sorghum bicolor) genes that were relatively highly expressed in rhizome tip tissues were enriched for cis-element motifs, including the pyrimidine box, TATCCA box, and CAREs box, implicating the gibberellins in regulation of many rhizome-specific genes. From cDNA clones showing rhizome-enriched expression, expressed sequence tags forming 455 contigs were plotted on the rice genome and aligned to QTL likelihood intervals for ratooning and rhizomatous traits in rice and sorghum. Highly expressed rhizome genes were somewhat enriched in QTL likelihood intervals for rhizomatousness or ratooning, with specific candidates including some of the most rhizome-specific genes. Some rhizomatousness and ratooning QTLs were shown to be potentially related to one another as a result of ancient duplication, suggesting long-term functional conservation of

  18. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    PubMed

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  19. The LA loop as an important regulatory element of the HtrA (DegP) protease from Escherichia coli: structural and functional studies.

    PubMed

    Figaj, Donata; Gieldon, Artur; Polit, Agnieszka; Sobiecka-Szkatula, Anna; Koper, Tomasz; Denkiewicz, Milena; Banecki, Bogdan; Lesner, Adam; Ciarkowski, Jerzy; Lipinska, Barbara; Skorko-Glonek, Joanna

    2014-05-30

    Bacterial HtrAs are serine proteases engaged in extracytoplasmic protein quality control and are required for the virulence of several pathogenic species. The proteolytic activity of HtrA (DegP) from Escherichia coli, a model prokaryotic HtrA, is stimulated by stressful conditions; the regulation of this process is mediated by the LA, LD, L1, L2, and L3 loops. The precise mechanism of action of the LA loop is not known due to a lack of data concerning its three-dimensional structure as well as its mode of interaction with other regulatory elements. To address these issues we generated a theoretical model of the three-dimensional structure of the LA loop as per the resting state of HtrA and subsequently verified its correctness experimentally. We identified intra- and intersubunit contacts that formed with the LA loops; these played an important role in maintaining HtrA in its inactive conformation. The most significant proved to be the hydrophobic interactions connecting the LA loops of the hexamer and polar contacts between the LA' (the LA loop on an opposite subunit) and L1 loops on opposite subunits. Disturbance of these interactions caused the stimulation of HtrA proteolytic activity. We also demonstrated that LA loops contribute to the preservation of the integrity of the HtrA oligomer and to the stability of the monomer. The model presented in this work explains the regulatory role of the LA loop well; it should also be applicable to numerous Enterobacteriaceae pathogenic species as the amino acid sequences of the members of this bacterial family are highly conserved.

  20. Measuring Productive Elements of Multi-Word Phrase Vocabulary Knowledge among Children with English as an Additional or Only Language

    ERIC Educational Resources Information Center

    Smith, Sara A.; Murphy, Victoria A.

    2015-01-01

    Vocabulary plays a critical role in language and reading development for children, particularly those learning English as an additional language (EAL) (Stahl & Nagy, 2006). Previous research on vocabulary has mainly focused on measuring individual words without considering multi-word phrase knowledge, despite evidence that these items occur…

  1. THE LATTICE PARAMETERS AND SOLUBILITY LIMITS OF ALPHA IRON AS AFFECTED BY SOME BINARY TRANSITION-ELEMENT ADDITIONS.

    DTIC Science & Technology

    The lattice parameters of alpha iron with binary additions of all the transition metals, except technetium, have been accurately determined on solid...samples. No direct correlation with solute size is observed, but an effect of electron configuration is noted. The solubility limits of alpha iron with

  2. Biochemical methane potential from sewage sludge: Effect of an aerobic pretreatment and fly ash addition as source of trace elements.

    PubMed

    Huiliñir, César; Pinto-Villegas, Paula; Castillo, Alejandra; Montalvo, Silvio; Guerrero, Lorna

    2017-03-18

    The effect of aerobic pretreatment and fly ash addition on the production of methane from mixed sludge is studied. Three assays with pretreated and not pretreated mixed sludge in the presence of fly ash (concentrations of 0, 10, 25, 50, 250 and 500mg/L) were run at mesophilic condition. It was found that the combined use of aerobic pretreatment and fly ash addition increases methane production up to 70% when the fly ash concentrations were lower than 50mg/L, while concentrations higher than 250mg/L cause up to 11% decrease of methane production. For the anaerobic treatment of mixed sludge without pretreatment, the fly ash improved methane generation at all the concentrations studied, with a maximum of 56%. The removal of volatile solids does not show an improvement compared to the separate use of an aerobic pre-treatment and fly ash addition. Therefore, the combined use of the aerobic pre-treatment and fly ash addition improves only the production of methane.

  3. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  4. Uranium hydrogeochemical and stream sediment reconnaissance of the Newcastle NTMS quadrangle, Wyoming, including concentrations of forty-two additional elements

    SciTech Connect

    Goff, S.J.; Sandoval, W.F.; Gallimore, D.L.; Talcott, C.L.; Martinez, R.G.; Minor, M.E.; Mills, C.F.

    1980-06-01

    During the summer and fall of 1977, 533 water and 1226 sediment samples were collected from 1740 locations within the 18,000 km/sup 2/ area of the Newcastle quadrangle, Wyoming. Water samples were collected from wells and springs; sediment samples were collected from stream channels and from springs. Each water sample was analyzed for uranium, and each sediment sample was analyzed for 43 elements, including uranium and thorium. Uranium concentrations in water samples range from below the detection limit of 0.02 ppB to 702.26 ppB and have a median of 1.73 ppB and a mean of 11.76 ppB. Water samples containing high uranium concentrations (>20 ppB) generally are associated with known uranium mining activity or units known to be uranium bearing. About one-third of the water samples containing high uranium concentrations were collected from locations within the Pumpkin Buttes and Turnercrest-Ross Districts. Nearly half of the water samples containing high uranium concentrations were collected from locations just west of the Monument Hill and Highland Flats-Box Creek Districts. Similar anomalous uranium concentrations in this region have been reported updip from Exxon's Highland uranium deposits. High uranium concentrations were also found associated with the Lance Creek-Old Woman Anticline District.

  5. A new high-performance heterologous fungal expression system based on regulatory elements from the Aspergillus terreus terrein gene cluster.

    PubMed

    Gressler, Markus; Hortschansky, Peter; Geib, Elena; Brock, Matthias

    2015-01-01

    Recently, the Aspergillus terreus terrein gene cluster was identified and selected for development of a new heterologous expression system. The cluster encodes the specific transcription factor TerR that is indispensable for terrein cluster induction. To identify TerR binding sites, different recombinant versions of the TerR DNA-binding domain were analyzed for specific motif recognition. The high affinity consensus motif TCGGHHWYHCGGH was identified from genes required for terrein production and binding site mutations confirmed their essential contribution to gene expression in A. terreus. A combination of TerR with its terA target promoter was tested as recombinant expression system in the heterologous host Aspergillus niger. TerR mediated target promoter activation was directly dependent on its transcription level. Therefore, terR was expressed under control of the regulatable amylase promoter PamyB and the resulting activation of the terA target promoter was compared with activation levels obtained from direct expression of reporters from the strong gpdA control promoter. Here, the coupled system outcompeted the direct expression system. When the coupled system was used for heterologous polyketide synthase expression high metabolite levels were produced. Additionally, expression of the Aspergillus nidulans polyketide synthase gene orsA revealed lecanoric acid rather than orsellinic acid as major polyketide synthase product. Domain swapping experiments assigned this depside formation from orsellinic acid to the OrsA thioesterase domain. These experiments confirm the suitability of the expression system especially for high-level metabolite production in heterologous hosts.

  6. A new high-performance heterologous fungal expression system based on regulatory elements from the Aspergillus terreus terrein gene cluster

    PubMed Central

    Gressler, Markus; Hortschansky, Peter; Geib, Elena; Brock, Matthias

    2015-01-01

    Recently, the Aspergillus terreus terrein gene cluster was identified and selected for development of a new heterologous expression system. The cluster encodes the specific transcription factor TerR that is indispensable for terrein cluster induction. To identify TerR binding sites, different recombinant versions of the TerR DNA-binding domain were analyzed for specific motif recognition. The high affinity consensus motif TCGGHHWYHCGGH was identified from genes required for terrein production and binding site mutations confirmed their essential contribution to gene expression in A. terreus. A combination of TerR with its terA target promoter was tested as recombinant expression system in the heterologous host Aspergillus niger. TerR mediated target promoter activation was directly dependent on its transcription level. Therefore, terR was expressed under control of the regulatable amylase promoter PamyB and the resulting activation of the terA target promoter was compared with activation levels obtained from direct expression of reporters from the strong gpdA control promoter. Here, the coupled system outcompeted the direct expression system. When the coupled system was used for heterologous polyketide synthase expression high metabolite levels were produced. Additionally, expression of the Aspergillus nidulans polyketide synthase gene orsA revealed lecanoric acid rather than orsellinic acid as major polyketide synthase product. Domain swapping experiments assigned this depside formation from orsellinic acid to the OrsA thioesterase domain. These experiments confirm the suitability of the expression system especially for high-level metabolite production in heterologous hosts. PMID:25852654

  7. Uranium hydrogeochemical and stream sediment reconnaissance of the Newcastle NTMS Quadrangle, Wyoming, including concentrations of forty-two additional elements

    SciTech Connect

    Goff, S.J.; Sandoval, W.F.; Gallimore, D.L.; Talcott, C.L.; Martinez, R.G.; Minor, M.E.; Mills, C.F.

    1980-06-01

    Water and sediment samples were collected and each water sample was analyzed for U, and each sediment sample was analyzed for 43 elements, including U and Th. Uranium concentrations in water samples range from below the detection limit of 0.02 ppB to 702.26 ppB and have a median of 1.73 ppB and a mean of 11.76 ppB. Water samples containing high uranium concentrations generally are associated with known uranium mining activity or units known to be uranium bearing. About one-third of the water samples containing high uranium concentrations were collected from locations within the Pumpkin Buttes and Turnercrest-Ross Districts. Nearly half of the water samples containing high uranium concentrations were collected from locations just west of the Monument Hill and Highland Flats-Box Creek Districts. Similar anomalous uranium concentrations in this region have been reported updip from Exxon's Highland uranium deposits. High uranium concentrations were also found associated with the Lance Creek-Old Woman Anticline District. Uranium concentrations in sediment samples range from 1.14 to 220.70 ppM and have a median of 3.37 ppM and a mean of 4.03 ppM. Throughout the major uranium mining districts of the Powder River Basin, sediment samples with high uranium concentrations were collected from dry streams located near wells producing water samples with high uranium concentrations. High uranium concentrations were also found associated with the Lance Creek oil field where uranium mineralization is known in the White River formation. High uranium concentrations were also found in sediment samples in areas where uranium mineralization is not known. These samples are from dry streams in areas underlain by the White River formation, the Niobrara formation, and the Pierre, Carlisle, Belle Fourche, and Mowry shales.

  8. The atomic-scale mechanism for the enhanced glass-forming-ability of a Cu-Zr based bulk metallic glass with minor element additions

    NASA Astrophysics Data System (ADS)

    Wang, Q.; Liu, C. T.; Yang, Y.; Liu, J. B.; Dong, Y. D.; Lu, J.

    2014-04-01

    It is known that the glass forming-ability (GFA) of bulk metallic glasses (BMGs) can be greatly enhanced via minor element additions. However, direct evidence has been lacking to reveal its structural origin despite different theories hitherto proposed. Through the high-resolution transmission-electron-microscopy (HRTEM) analysis, here we show that the content of local crystal-like orders increases significantly in a Cu-Zr-Al BMG after a 2-at% Y addition. Contrasting the previous studies, our current results indicate that the formation of crystal-like order at the atomic scale plays an important role in enhancing the GFA of the Cu-Zr-Al base BMG.

  9. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  10. Effects of retinoic acid and hydrogen peroxide on sterol regulatory element-binding protein-1a activation during adipogenic differentiation of 3T3-L1 cells.

    PubMed

    Abd Eldaim, Mabrouk A; Okamatsu-Ogura, Yuko; Terao, Akira; Kimura, Kazuhiro

    2010-11-01

    Both retinoic acid (RA) and oxidative stress (H2O2) increased transcription and cleavage of membrane-bound sterol regulatory element-binding protein (SREBP)-1, leading to enhanced transcription of fatty acid synthase (FAS) in hepatoma cells. On the other hand, RA and H2O2 decreased and increased lipogenesis in adipocytes, respectively, although roles of SREBP-1 activation in these effects remain to be elucidated. To elucidate its involvement, we examined the activation of SREBP-la, expression of FAS genes and lipid accumulation in 3T3-L1 cells in the presence of RA and/or H2O2. RA (1 microM) treatment suppressed expression of SREBP-1a and FAS genes and lipid accumulation. H2O2 (2 microM) treatment induced increased cleavage of SREBP-1a, without affecting amounts of SREBP-1a mRNA and precursor protein, and enhanced expression of FAS gene and lipid accumulation. Increased cleavage of SREBP-1a by H2O2 was also observed even in the presence of RA. These results suggest that H2O2, enhances a cleavage of SREBP-1a precursor protein, which independently occurs with the RA suppression of SREBP-1a gene expression, and that RA itself has no role in the SREBP-1a activation in adipocytes.

  11. Neuronal Activity-Induced Sterol Regulatory Element Binding Protein-1 (SREBP1) is Disrupted in Dysbindin-Null Mice-Potential Link to Cognitive Impairment in Schizophrenia.

    PubMed

    Chen, Yong; Bang, Sookhee; McMullen, Mary F; Kazi, Hala; Talbot, Konrad; Ho, Mei-Xuan; Carlson, Greg; Arnold, Steven E; Ong, Wei-Yi; Kim, Sangwon F

    2017-04-01

    Schizophrenia is a chronic debilitating neuropsychiatric disorder that affects about 1 % of the population. Dystrobrevin-binding protein 1 (DTNBP1 or dysbindin) is one of the Research Domain Constructs (RDoC) associated with cognition and is significantly reduced in the brain of schizophrenia patients. To further understand the molecular underpinnings of pathogenesis of schizophrenia, we have performed microarray analyses of the hippocampi from dysbindin knockout mice, and found that genes involved in the lipogenic pathway are suppressed. Moreover, we discovered that maturation of a master transcriptional regulator for lipid synthesis, sterol regulatory element binding protein-1 (SREBP1) is induced by neuronal activity, and is required for induction of the immediate early gene ARC (activity-regulated cytoskeleton-associated protein), necessary for synaptic plasticity and memory. We found that nuclear SREBP1 is dramatically reduced in dysbindin-1 knockout mice and postmortem brain tissues from human patients with schizophrenia. Furthermore, activity-dependent maturation of SREBP1 as well as ARC expression were attenuated in dysbindin-1 knockout mice, and these deficits were restored by an atypical antipsychotic drug, clozapine. Together, results indicate an important role of dysbindin-1 in neuronal activity induced SREBP1 and ARC, which could be related to cognitive deficits in schizophrenia.

  12. Heat Shock Protein 90 Modulates Lipid Homeostasis by Regulating the Stability and Function of Sterol Regulatory Element-binding Protein (SREBP) and SREBP Cleavage-activating Protein.

    PubMed

    Kuan, Yen-Chou; Hashidume, Tsutomu; Shibata, Takahiro; Uchida, Koji; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2017-02-17

    Sterol regulatory element-binding proteins (SREBPs) are the key transcription factors that modulate lipid biosynthesis. SREBPs are synthesized as endoplasmic reticulum-bound precursors that require proteolytic activation in the Golgi apparatus. The stability and maturation of precursor SREBPs depend on their binding to SREBP cleavage-activating protein (SCAP), which escorts the SCAP-SREBP complex to the Golgi apparatus. In this study, we identified heat shock protein (HSP) 90 as a novel SREBP regulator that binds to and stabilizes SCAP-SREBP. In HepG2 cells, HSP90 inhibition led to proteasome-dependent degradation of SCAP-SREBP, which resulted in the down-regulation of SREBP target genes and the reduction in intracellular triglyceride and cholesterol levels. We also demonstrated in vivo that HSP90 inhibition decreased SCAP-SREBP protein, down-regulated SREBP target genes, and reduced lipids levels in mouse livers. We propose that HSP90 plays an indispensable role in SREBP regulation by stabilizing the SCAP-SREBP complex, facilitating the activation of SREBP to maintain lipids homeostasis.

  13. The regulatory elements of araBAD operon, contrary to lac-based expression systems, afford hypersynthesis of murine, and human interferons in Escherichia coli.

    PubMed

    Stefan, Alessandra; Alfarano, Pietro; Merulla, Davide; Mattana, Paolo; Rolli, Eleonora; Mangino, Pierluigi; Masotti, Lanfranco; Hochkoeppler, Alejandro

    2009-01-01

    The overexpression of four different interferons, i.e., murine interferon alpha1 and human interferons alpha1, alpha 8, and alpha 21 was challenged in Escherichia coli. Synthetic genes coding for these interferons were designed, assembled, and cloned into the vector pET9a (using the NdeI and BamHI sites), placing interferon expression under the control of phage T7 promoter. Despite an intensive screening for optimal culture conditions, no interferon synthesis was observed using overexpression systems based on the regulatory elements of lac operon (e.g., in E. coli BL21DE3). On the contrary, high levels of interferon expression were detected in E. coli BL21AI, which chromosome contains the gene coding for phage T7 RNA polymerase under the control of the araBAD promoter. To analyze the reasons of this striking difference, the molecular events associated with the lack of interferon expression in E. coli BL21DE3 were studied, and murine interferon alpha1 was chosen as a model system. Surprisingly, it was observed that this interferon represses the synthesis of T7 RNA polymerase in E. coli BL21DE3 and, in particular, the expression of lac operon. In fact, by determining beta-galactosidase activity in E. coli BL21AI, a significantly lower LacZ activity was observed in cells induced to interferon synthesis.

  14. Expression of the rat sterol regulatory element-binding protein-1c gene in response to insulin is mediated by increased transactivating capacity of specificity protein 1 (Sp1).

    PubMed

    Deng, Xiong; Yellaturu, Chandrahasa; Cagen, Lauren; Wilcox, Henry G; Park, Edwards A; Raghow, Rajendra; Elam, Marshall B

    2007-06-15

    The induction of genes involved in lipid biosynthesis by insulin is mediated in part by the sterol regulatory element-binding protein-1c (SREBP-1c). SREBP-1c is directly regulated by insulin by transcriptional and post-transcriptional mechanisms. Previously, we have demonstrated that the insulin-responsive cis-acting unit of the rat SREBP-1c promoter is composed of several elements that include a sterol regulatory element, two liver X receptor elements, and a number of conserved GC boxes. Here we systematically dissected the role of these GC boxes and report that five bona fide Sp1-binding elements of the SREBP-1c promoter determine its basal and insulin-induced activation. Luciferase expression driven by the rat SREBP-1c promoter was accelerated by ectopic expression of Sp1, and insulin further enhanced the transactivation potential of Sp1. Introduction of a small interfering RNA against Sp1 reduced both basal and insulin-induced activation of the SREBP-1c promoter. We also found that Sp1 interacted with both SREBP-1c and LXRalpha proteins and that insulin promoted these interactions. Chromatin immunoprecipitation studies revealed that insulin facilitated the recruitment of the steroid receptor coactivator-1 to the SREBP-1c promoter. These studies identify a novel mechanism by which maximal activation of the rat SREBP-1c gene expression by insulin is mediated by Sp1 and its enhanced ability to interact with other transcriptional regulatory proteins.

  15. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  16. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed Central

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor. Images PMID:2554307

  17. Mechanical properties and phase composition of potential biodegradable Mg-Zn-Mn-base alloys with addition of rare earth elements

    SciTech Connect

    Stulikova, Ivana; Smola, Bohumil

    2010-10-15

    Mechanical properties and creep resistance of the MgY4Zn1Mn1 alloy in the as cast as well as in the T5 condition were compared to those of the MgCe4Zn1Mn1 alloy in the same conditions. Yield tensile stress and ultimate tensile strength of the MgY4Zn1Mn1 alloy are slightly better in the temperature range 20 deg. C-400 deg. C than these of the MgCe4Zn1Mn1 alloy. Better thermal stability of ultimate tensile strength was observed in the T5 treated MgCe4Zn1Mn1 alloy than in this material in the as cast condition. An outstanding creep resistance at 225 deg. C-350 deg. C found in the MgY4Zn1Mn1 alloy is due to the existence of the 18R long period stacking structure persisting in this alloy even a long heat treatment of 500 deg. C/32 h. No similar stacking effects happen when Ce substitutes Y in approximately the same concentration. The creep resistance deteriorates considerably in the MgCe4Zn1Mn1 alloy. Rectangular particles of the equilibrium Mg{sub 12}Ce phase dominate in the microstructure of as cast as well as of high temperature heat-treated MgCe4Zn1Mn1 alloy. A population of small oval particles containing Mg and Zn develops additionally during annealing of this alloy. These particles pin effectively dislocations and can be responsible for the better thermal stability of the T5 treated material.

  18. The N-terminal peptide of mammalian GTP cyclohydrolase I is an autoinhibitory control element and contributes to binding the allosteric regulatory protein GFRP.

    PubMed

    Higgins, Christina E; Gross, Steven S

    2011-04-08

    GTP cyclohydrolase I (GTPCH) is the rate-limiting enzyme for biosynthesis of tetrahydrobiopterin (BH4), an obligate cofactor for NO synthases and aromatic amino acid hydroxylases. BH4 can limit its own synthesis by triggering decameric GTPCH to assemble in an inhibitory complex with two GTPCH feedback regulatory protein (GFRP) pentamers. Subsequent phenylalanine binding to the GTPCH·GFRP inhibitory complex converts it to a stimulatory complex. An N-terminal inhibitory peptide in GTPCH may also contribute to autoregulation of GTPCH activity, but mechanisms are undefined. To characterize potential regulatory actions of the N-terminal peptide in rat GTPCH, we expressed, purified, and characterized a truncation mutant, devoid of 45 N-terminal amino acids (Δ45-GTPCH) and contrasted its catalytic and GFRP binding properties to wild type GTPCH (wt-GTPCH). Contrary to prior reports, we show that GFRP binds wt-GTPCH in the absence of any small molecule effector, resulting in allosteric stimulation of GTPCH activity: a 20% increase in Vmax, 50% decrease in KmGTP, and increase in Hill coefficient to 1.6, from 1.0. These features of GFRP-stimulated wt-GTPCH activity were phenocopied by Δ45-GTPCH in the absence of bound GFRP. Addition of GFRP to Δ45-GTPCH failed to elicit complex formation or a substantial further increase in GTPCH catalytic activity. Expression of Δ45-GTPCH in HEK-293 cells elicited 3-fold greater BH4 accumulation than an equivalent of wt-GTPCH. Together, results indicate that the N-terminal peptide exerts autoinhibitory control over rat GTPCH and is required for GFRP binding on its own. Displacement of the autoinhibitory peptide provides a molecular mechanism for physiological up-regulation of GTPCH activity.

  19. Effect of surfactant addition on ultrasonic leaching of trace elements from plant samples in inductively coupled plasma-atomic emission spectrometry

    NASA Astrophysics Data System (ADS)

    Borkowska-Burnecka, Jolanta; Jankowiak, Urszula; Zyrnicki, Wieslaw; Anna Wilk, Kazimiera

    2004-04-01

    The applicability of surfactants in sample preparation of plant materials followed by analysis by inductively coupled plasma atomic emission spectrometry has been examined. Reference materials (INCT-MPH-2-Mixed Polish Herbs, INCT-TL-1 black tea leaves and CTA-VTL-2 -Virginia tobacco leaves) and commercially available tea leaves were analyzed. Effects of addition surfactants (Triton X-100, didodecyldimethylammonium bromide and cetyltrimethylammonium bromide) on efficiency of ultrasonic leaching of elements from the plant samples and on plasma parameters were investigated. Low concentrations of the surfactants in solutions did not affect, in practice, analytical line intensities and the nebulization process. Quantitative recovery of some elements could be obtained by ultrasonic diluted acid leaching with the aid of surfactants. However, the element recovery depended on type of surfactant, as well as element and sample material. Plasma parameters, i.e. the excitation temperatures of Ar I, Fe II and Ca II as well as the electron number density and the Mg II/Mg I intensity ratio did not vary significantly due to the surfactants in solutions.

  20. Anti-Müllerian hormone (AMH/AMH) in the European sea bass: its gene structure, regulatory elements, and the expression of alternatively-spliced isoforms.

    PubMed

    Halm, S; Rocha, A; Miura, T; Prat, F; Zanuy, S

    2007-02-15

    In mammals, a multitude of studies have shown that anti-Müllerian hormone (AMH/AMH), apart from inducing Müllerian duct regression during male sexual differentiation, exerts inhibitory effects on male and female gonadal steroidogenesis and differentiation. However, in lower vertebrates like teleost fish, the function of AMH/AMH has been far less explored. As a first step to unravel its potential role in reproduction in teleost fish, we isolated and characterised the AMH gene in the European sea bass (sb), Dicentrachus labrax, determined putative regulatory elements of its 5'-flanking region, and analysed its gene expression and those of alternatively-spliced transcripts. The characterisation of sb-AMH revealed distinct features that distinguishes it from mammalian and bird AMH, suggesting a high rate of diversification of AMH during vertebrate evolution. It contained 7 exons that were divided by 6 introns, of which the last intron (intron vi) was localised only a few nucleotides upstream of the putative peptide cleavage site. The guanine and cytosine content of the open reading frame (ORF) was 52.7% and thus notably lower than that of bird and mammalian AMH. Sb-AMH cDNA was 2045 base pairs (bp) long, containing an ORF of 1599 bp encoding 533 amino acids. Deduced amino acid similarities of the conserved, carboxyterminal domain were highest with AMH in Japanese flounder (84.2%) and lowest with chicken AMH (45.5%). In the proximal promoter sequence of sb-AMH, a steroidogenic factor-1 (SF-1) binding site was present; however other regulatory sequences essential for transcriptional activation of AMH in mammals were absent. Likewise, there was no sequence homology to an SF3A2 sequence within the first 3200 bp upstream of the sb-AMH translation start site. Gene expression of sb-AMH and of alternatively-spliced sb-AMH transcripts were analysed in male and female juvenile and adult gonads as well as in somatic tissues of juvenile males. sb-AMH expression was highest in

  1. Dietary fiber prevents obesity-related liver lipotoxicity by modulating sterol-regulatory element binding protein pathway in C57BL/6J mice fed a high-fat/cholesterol diet.

    PubMed

    Han, Shufen; Jiao, Jun; Zhang, Wei; Xu, Jiaying; Wan, Zhongxiao; Zhang, Weiguo; Gao, Xiaoran; Qin, Liqiang

    2015-10-29

    Adequate intake of dietary fibers has proven metabolic and cardiovascular benefits, molecular mechanisms remain still limited. This study was aimed to investigate the effects of cereal dietary fiber on obesity-related liver lipotoxicity in C57BL/6J mice fed a high-fat/cholesterol (HFC) diet and underlying mechanism. Forty-eight adult male C57BL/6J mice were randomly given a reference chow diet, or a high fat/cholesterol (HFC) diet supplemented with or without oat fiber or wheat bran fiber for 24 weeks. Our results showed mice fed oat or wheat bran fiber exhibited lower weight gain, lipid profiles and insulin resistance, compared with HFC diet. The two cereal dietary fibers potently decreased protein expressions of sterol regulatory element binding protein-1 and key factors involved in lipogenesis, including fatty acid synthase and acetyl-CoA carboxylase in target tissues. At molecular level, the two cereal dietary fibers augmented protein expressions of peroxisome proliferator-activated receptor alpha and gamma, liver X receptor alpha, and ATP-binding cassette transporter A1 in target tissues. Our findings indicated that cereal dietary fiber supplementation abrogated obesity-related liver lipotoxicity and dyslipidemia in C57BL/6J mice fed a HFC diet. In addition, the efficacy of oat fiber is greater than wheat bran fiber in normalizing these metabolic disorders and pathological profiles.

  2. An Intronic cis-Regulatory Element Is Crucial for the Alpha Tubulin Pl-Tuba1a Gene Activation in the Ciliary Band and Animal Pole Neurogenic Domains during Sea Urchin Development

    PubMed Central

    Cuttitta, Angela; Gianguzza, Fabrizio; Ragusa, Maria Antonietta

    2017-01-01

    In sea urchin development, structures derived from neurogenic territory control the swimming and feeding responses of the pluteus as well as the process of metamorphosis. We have previously isolated an alpha tubulin family member of Paracentrotus lividus (Pl-Tuba1a, formerly known as Pl-Talpha2) that is specifically expressed in the ciliary band and animal pole neurogenic domains of the sea urchin embryo. In order to identify cis-regulatory elements controlling its spatio-temporal expression, we conducted gene transfer experiments, transgene deletions and site specific mutagenesis. Thus, a genomic region of about 2.6 Kb of Pl-Tuba1a, containing four Interspecifically Conserved Regions (ICRs), was identified as responsible for proper gene expression. An enhancer role was ascribed to ICR1 and ICR2, while ICR3 exerted a pivotal role in basal expression, restricting Tuba1a expression to the proper territories of the embryo. Additionally, the mutation of the forkhead box consensus sequence binding site in ICR3 prevented Pl-Tuba1a expression. PMID:28141828

  3. Impact of trace element addition on degradation efficiency of volatile fatty acids, oleic acid and phenyl acetate and on microbial populations in a biogas digester.

    PubMed

    Karlsson, Anna; Einarsson, Peter; Schnürer, Anna; Sundberg, Carina; Ejlertsson, Jörgen; Svensson, Bo H

    2012-10-01

    The effect of trace element addition on anaerobic digestion of food industry- and household waste was studied using two semi-continuous lab-scale reactors, one (R30+) was supplied with Fe, Co and Ni, while the other (R30) acted as a control. Tracer analysis illustrated that methane production from acetate proceeded through syntrophic acetate oxidation (SAO) in both digesters. The effect of the trace elements was also evaluated in batch assays to determine the capacity of the microorganisms of the two digesters to degrade acetate, phenyl acetate, oleic acid or propionate, butyrate and valerate provided as a cocktail. The trace elements addition improved the performance of the process giving higher methane yields during start-up and early operation and lower levels of mainly acetate and propionate in the R30+ reactor. The batch assay showed that material from R30+ gave effects on methane production from all substrates tested. Phenyl acetate was observed to inhibit methane formation in the R30 but not in the R30+ assay. A real-time PCR analysis targeting methanogens on the order level as well as three SAO bacteria showed an increase in Methanosarcinales in the R30+ reactor over time, even though SAO continuously was the dominating pathway for methane production. Possibly, this increase explains the low VFA-levels and higher degradation rates observed in the R30+ batch incubations. These results show that the added trace elements affected the ability of the microflora to degrade VFAs as well as oleic acid and phenyl acetate in a community, where acetate utilization is dominated by SAO.

  4. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  5. Differential use of the regulatory elements of the alpha B-crystallin enhancer in cultured murine lung (MLg), lens (alpha TN4-1) and muscle (C2C12) cells.

    PubMed

    Haynes, J I; Gopal-Srivastava, R; Frederikse, P H; Piatigorsky, J

    1995-04-03

    The mouse alpha B-crystallin-encoding gene (alpha B-cry) is highly expressed in the lens and expressed to lesser extents in other tissues. Here, we investigated alpha B-cry expression in mouse-lung-derived MLg cells. Two sizes of MLg alpha B-cry transcripts comigrated with alpha B-cry transcripts contained in total and poly(A)+RNA from mouse lung, with preference for the larger species in the MLg cells. Expression of both alpha B-cry promoter/cat reporter gene constructs and alpha B-cry enhancer (nt -427/-259)/herpes simplex virus (HSV) thymidine kinase promoter (ptk)/human growth hormone reporter gene (hGH) constructs was studied in transfected MLg cells and the results compared with those obtained from alpha TN4-1 lens and C2C12 muscle cells. The alpha B-cry enhancer increased activity of the endogenous and tk promoters approx. 2-fold in the MLg cells, in contrast to its 3-7-fold effect in alpha TN4-1 cells and 17-20-fold effect in C2C12 myotubes. Site-specific mutagenesis of the previously identified enhancer control elements, alpha B-E-1 (nt -407 to -397), alpha BE-2 (-360 to -327) and MRF (-300 to -288), decreased enhancer strength in transfected MLg cells. DNase I footprinting showed that MLg nuclear proteins occupy only alpha BE-1 and alpha BE-2. Previous data have shown that lens cells use alpha BE-1, alpha BE-2 and alpha BE-3, while muscle cells use, in addition, the muscle regulatory factor-binding site (MRF). Thus, the present experiments correlate tissue-specific enhancer strength and the number of control elements utilized.

  6. Identification of positive and negative splicing regulatory elements within the terminal tat-rev exon of human immunodeficiency virus type 1.

    PubMed Central

    Staffa, A; Cochrane, A

    1995-01-01

    The requirement of human immunodeficiency virus type 1 to generate numerous proteins from a single primary transcript is met largely by the use of suboptimal splicing to generate over 30 mRNAs. To ensure that appropriate quantities of each protein are produced, there must be a signal(s) that controls the efficiency with which any particular splice site in the RNA is used. To identify this control element(s) and to understand how it operates to generate the splicing pattern observed, we have initially focused on the control of splicing of the tat-rev intron, which spans the majority of the env open reading frame. Previous analysis indicated that a suboptimal branchpoint and polypyridimine tract in this intron contribute to its suboptimal splicing (A. Staffa and A. Cochrane, J. Virol. 68:3071-3079, 1994). In this report, we identify two additional elements within the 3'-terminal exon, an exon-splicing enhancer (ESE) and an exon splicing silencer (ESS), that modulate the overall efficiency with which the 3' tat-rev splice site is utilized. Both elements are capable of functioning independently of one another. Furthermore, while both the ESE and ESS can function in a heterologous context, the function of the ESS is extremely sensitive to the sequence context into which it is placed. In conclusion, it would appear that the presence of a suboptimal branchpoint and a polypyrimidine tract as well as the ESE and ESS operate together to yield the balanced splicing of the tat-rev intron observed in vivo. PMID:7623851

  7. MicroRNAs Are Part of the Regulatory Network that Controls EGF Induced Apoptosis, Including Elements of the JAK/STAT Pathway, in A431 Cells

    PubMed Central

    Alanazi, Ibrahim; Hoffmann, Peter; Adelson, David L.

    2015-01-01

    MiRNAs are known to regulate gene expression and in the context of cancer have been shown to regulate metastasis, cell proliferation and cell death. In this report we describe potential miRNA regulatory roles with respect to induction of cell death by pharmacologic dose of Epidermal Growth Factor (EGF). Our previous work suggested that multiple pathways are involved in the induction of apoptosis, including interferon induced genes, cytokines, cytoskeleton and cell adhesion and TP53 regulated genes. Using miRNA time course expression profiling of EGF treated A431 cells and coupling this to our previous gene expression and proteomic data, we have been able to implicate a number of additional miRNAs in the regulation of apoptosis. Specifically we have linked miR-134, miR-145, miR-146b-5p, miR-432 and miR-494 to the regulation of both apoptotic and anti-apoptotic genes expressed as a function of EGF treatment. Whilst additional miRNAs were differentially expressed, these had the largest number of apoptotic and anti-apoptotic targets. We found 5 miRNAs previously implicated in the regulation of apoptosis and our results indicate that an additional 20 miRNAs are likely to be involved based on their correlated expression with targets. Certain targets were linked to multiple miRNAs, including PEG10, BTG1, ID1, IL32 and NCF2. Some miRNAs that target the interferon pathway were found to be down regulated, consistent with a novel layer of regulation of interferon pathway components downstream of JAK/STAT. We have significantly expanded the repertoire of miRNAs that may regulate apoptosis in cancer cells as a result of this work. PMID:25781916

  8. The Hepatitis C Virus-induced NLRP3 Inflammasome Activates the Sterol Regulatory Element-binding Protein (SREBP) and Regulates Lipid Metabolism*

    PubMed Central

    McRae, Steven; Iqbal, Jawed; Sarkar-Dutta, Mehuli; Lane, Samantha; Nagaraj, Abhiram; Ali, Naushad; Waris, Gulam

    2016-01-01

    Hepatitis C virus (HCV) relies on host lipids and lipid droplets for replication and morphogenesis. The accumulation of lipid droplets in infected hepatocytes manifests as hepatosteatosis, a common pathology observed in chronic hepatitis C patients. One way by which HCV promotes the accumulation of intracellular lipids is through enhancing de novo lipogenesis by activating the sterol regulatory element-binding proteins (SREBPs). In general, activation of SREBPs occurs during cholesterol depletion. Interestingly, during HCV infection, the activation of SREBPs occurs under normal cholesterol levels, but the underlying mechanisms are still elusive. Our previous study has demonstrated the activation of the inflammasome complex in HCV-infected human hepatoma cells. In this study, we elucidate the potential link between chronic hepatitis C-associated inflammation and alteration of lipid homeostasis in infected cells. Our results reveal that the HCV-activated NLRP3 inflammasome is required for the up-regulation of lipogenic genes such as 3-hydroxy-3-methylglutaryl-coenzyme A synthase, fatty acid synthase, and stearoyl-CoA desaturase. Using pharmacological inhibitors and siRNA against the inflammasome components (NLRP3, apoptosis-associated speck-like protein containing a CARD, and caspase-1), we further show that the activation of the NLRP3 inflammasome plays a critical role in lipid droplet formation. NLRP3 inflammasome activation in HCV-infected cells enables caspase-1-mediated degradation of insulin-induced gene proteins. This subsequently leads to the transport of the SREBP cleavage-activating protein·SREBP complex from the endoplasmic reticulum to the Golgi, followed by proteolytic activation of SREBPs by S1P and S2P in the Golgi. Typically, inflammasome activation leads to viral clearance. Paradoxically, here we demonstrate how HCV exploits the NLRP3 inflammasome to activate SREBPs and host lipid metabolism, leading to liver disease pathogenesis associated with

  9. Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase.

    PubMed

    Deng, Xiong; Dong, Qingming; Bridges, Dave; Raghow, Rajendra; Park, Edwards A; Elam, Marshall B

    2015-12-01

    In hyperinsulinemic states including obesity and T2DM, overproduction of fatty acid and triglyceride contributes to steatosis of the liver, hyperlipidemia and hepatic insulin resistance. This effect is mediated in part by the transcriptional regulator sterol responsive element binding protein-1c (SREBP-1c), which stimulates the expression of genes involved in hepatic fatty acid and triglyceride synthesis. SREBP-1c is up regulated by insulin both via increased transcription of nascent full-length SREBP-1c and by enhanced proteolytic processing of the endoplasmic reticulum (ER)-bound precursor to yield the transcriptionally active n-terminal form, nSREBP-1c. Polyunsaturated fatty acids of marine origin (n-3 PUFA) prevent induction of SREBP-1c by insulin thereby reducing plasma and hepatic triglycerides. Despite widespread use of n-3 PUFA supplements to reduce triglycerides in clinical practice, the exact mechanisms underlying their hypotriglyceridemic effect remain elusive. Here we demonstrate that the n-3 PUFA docosahexaenoic acid (DHA; 22:5 n-3) reduces nSREBP-1c by inhibiting regulated intramembrane proteolysis (RIP) of the nascent SREBP-1c. We further show that this effect of DHA is mediated both via activation of AMP-activated protein kinase (AMPK) and by inhibition of mechanistic target of rapamycin complex 1 (mTORC1). The inhibitory effect of AMPK on SREBP-1c processing is linked to phosphorylation of serine 365 of SREBP-1c in the rat. We have defined a novel regulatory mechanism by which n-3 PUFA inhibit induction of SREBP-1c by insulin. These findings identify AMPK as an important negative regulator of hepatic lipid synthesis and as a potential therapeutic target for hyperlipidemia in obesity and T2DM.

  10. Association Study Between Metabolic Syndrome and rs8066560 Polymorphism in the Promoter Region of Sterol Regulatory Element-binding Transcription Factor 1 Gene in Iranian Children and Adolescents

    PubMed Central

    Miranzadeh-Mahabadi, Hajar; Emadi-Baygi, Modjtaba; Nikpour, Parvaneh; Kelishadi, Roya

    2016-01-01

    Background: Metabolic syndrome (MetS) is a prevalent disorder in pediatric age groups, described by a combination of genetic and environmental factors. Sterol regulatory element-binding transcription factor 1 (SREBF-1) induces the expression of a family of genes involved in fatty acid synthesis. Moreover, dysregulation of miR-33b, which is located within the intron 17 of the SREBF-1 gene, disrupts fatty acid oxidation and insulin signaling, thus leading to MetS. The aim of the present study was to investigate the association between SREBF-1 rs8066560 polymorphism and MetS in Iranian children and adolescents. Methods: This study includes 100 MetS and 100 normal individuals aged 9–19 years. Anthropological and biochemical indexes were measured. The -1099G > A polymorphism was genotyped by TaqMan real-time polymerase chain reaction. Results: Significant differences were observed in anthropometric measurements and lipid profiles between MetS and normal children. There were no differences in the genotype frequencies or allele distribution for -1099G > A polymorphism between MetS and control groups. High-density lipoprotein cholesterol levels were significantly higher in the MetS GG group than in the A allele carrier group. The genotype AA controls had significantly increased cholesterol and low-density lipoprotein cholesterol levels than AG genotypes. By logistic regression using different genetic models, no significant association was observed between SREBF-1 rs8066560 polymorphism and the risk of MetS. Conclusions: We conclude that the -1099G > A variant on SREBF-1 gene associated with serum lipid profiles, however, it may not be a major risk factor for the MetS in Iranian children and adolescents. PMID:27076879

  11. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats.

    PubMed

    Xu, J; Nakamura, M T; Cho, H P; Clarke, S D

    1999-08-13

    Polyunsaturated fatty acids (PUFA) coordinately suppress the transcription of a wide array of hepatic lipogenic genes including fatty acid synthase (FAS) and acetyl-CoA carboxylase. Interestingly, the over-expression of sterol regulatory element binding protein-1 (SREBP-1) induces the expression of all of the enzymes suppressed by PUFA. This observation led us to hypothesize that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1. Our initial studies revealed that the SREBP-1 and FAS mRNA contents of HepG2 cells were reduced by 20:4(n-6) in a dose-dependent manner (i.e. EC(50) approximately 10 microM), whereas 18:1(n-9) had no effect. Similarly, supplementing a fat-free, high glucose diet with oils rich in (n-6) or (n-3) PUFA reduced the hepatic content of precursor and nuclear SREBP-1 60 and 85%, respectively; however, PUFA had no effect on the nuclear content of upstream stimulatory factor (USF)-1. The PUFA-dependent decrease in nuclear content of mature SREBP-1 was paralleled by a 70-90% suppression in FAS gene transcription. In contrast, dietary 18:1(n-9), i.e. triolein, had no inhibitory influence on the expression of SREBP-1 or FAS. The decrease in hepatic expression of SREBP-1 and FAS associated with PUFA ingestion was mimicked by supplementing the fat-free diet with the PPARalpha-activator, WY 14, 643. Interestingly, nuclear run-on assays revealed that changes in SREBP-1 mRNA abundance were not accompanied by changes in SREBP-1 gene transcription. These results support the concept that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1 and that the PUFA regulation of SREBP-1 appears to occur at the post-transcriptional level.

  12. Subunit architecture of the Golgi Dsc E3 ligase required for sterol regulatory element-binding protein (SREBP) cleavage in fission yeast.

    PubMed

    Lloyd, S Julie-Ann; Raychaudhuri, Sumana; Espenshade, Peter J

    2013-07-19

    The membrane-bound sterol regulatory element-binding protein (SREBP) transcription factors regulate lipogenesis in mammalian cells and are activated through sequential cleavage by the Golgi-localized Site-1 and Site-2 proteases. The mechanism of fission yeast SREBP cleavage is less well defined and, in contrast, requires the Golgi-localized Dsc E3 ligase complex. The Dsc E3 ligase consists of five integral membrane subunits, Dsc1 through Dsc5, and resembles membrane E3 ligases that function in endoplasmic reticulum-associated degradation. Using immunoprecipitation assays and blue native electrophoresis, we determined the subunit architecture for the complex of Dsc1 through Dsc5, showing that the Dsc proteins form subcomplexes and display defined connectivity. Dsc2 is a rhomboid pseudoprotease family member homologous to mammalian UBAC2 and a central component of the Dsc E3 ligase. We identified conservation in the architecture of the Dsc E3 ligase and the multisubunit E3 ligase gp78 in mammals. Specifically, Dsc1-Dsc2-Dsc5 forms a complex resembling gp78-UBAC2-UBXD8. Further characterization of Dsc2 revealed that its C-terminal UBA domain can bind to ubiquitin chains but that the Dsc2 UBA domain is not essential for yeast SREBP cleavage. Based on the ability of rhomboid superfamily members to bind transmembrane proteins, we speculate that Dsc2 functions in SREBP recognition and binding. Homologs of Dsc1 through Dsc4 are required for SREBP cleavage and virulence in the human opportunistic pathogen Aspergillus fumigatus. Thus, these studies advance our organizational understanding of multisubunit E3 ligases involved in endoplasmic reticulum-associated degradation and fungal pathogenesis.

  13. Expression of Sterol Regulatory Element-Binding Proteins in epicardial adipose tissue in patients with coronary artery disease and diabetes mellitus: preliminary study

    PubMed Central

    Pérez-Belmonte, Luis M.; Moreno-Santos, Inmaculada; Cabrera-Bueno, Fernando; Sánchez-Espín, Gemma; Castellano, Daniel; Such, Miguel; Crespo-Leiro, María G; Carrasco-Chinchilla, Fernando; Alonso-Pulpón, Luis; López-Garrido, Miguel; Ruiz-Salas, Amalio; Becerra-Muñoz, Víctor M.; Gómez-Doblas, Juan J.; de Teresa-Galván, Eduardo; Jiménez-Navarro, Manuel

    2017-01-01

    Objectives: Sterol regulatory element-binding proteins (SREBP) genes are crucial in lipid biosynthesis and cardiovascular homeostasis. Their expression in epicardial adipose tissue (EAT) and their influence in the development of coronary artery disease (CAD) and type-2 diabetes mellitus remain to be determined. The aim of our study was to evaluate the expression of SREBP genes in EAT in patients with CAD according to diabetes status and its association with clinical and biochemical data. Methods: SREBP-1 and SREBP-2 mRNA expression levels were measured in EAT from 49 patients with CAD (26 with diabetes) and 23 controls without CAD or diabetes. Results: Both SREBPs mRNA expression were significantly higher in patients with CAD and diabetes (p<0.001) and were identified as independent cardiovascular risk factor for coronary artery disease in patients with type-2 diabetes (SREBP-1: OR 1.7, 95%CI 1.1-2.5, p=0.02; SREBP-2: OR 1.6, 95%CI 1.2-3, p=0.02) and were independently associated with the presence of multivessel CAD, left main and anterior descending artery stenosis, and higher total and LDL cholesterol levels, and lower HDL cholesterol levels, in patients with CAD and diabetes. Conclusions: SREBP genes are expressed in EAT and were higher in CAD patients with diabetes than those patients without CAD or diabetes. SREBP expression was associated as cardiovascular risk factor for the severity of CAD and the poor lipid control. In this preliminary study we suggest the importance of EAT in the lipid metabolism and cardiovascular homeostasis for coronary atherosclerosis of patients with diabetes and highlight a future novel therapeutic target. PMID:28367087

  14. The crucial role of GATA-1 in CCR3 gene transcription: modulated balance by multiple GATA elements in the CCR3 regulatory region.

    PubMed

    Kim, Byung Soo; Uhm, Tae Gi; Lee, Seol Kyoung; Lee, Sin-Hwa; Kang, Jin Hyun; Park, Choon-Sik; Chung, Il Yup

    2010-12-01

    GATA-1, a zinc finger-containing transcription factor, regulates not only the differentiation of eosinophils but also the expression of many eosinophil-specific genes. In the current study, we dissected CCR3 gene expression at the molecular level using several cell types that express varying levels of GATA-1 and CCR3. Chromatin immunoprecipitation analysis revealed that GATA-1 preferentially bound to sequences in both exon 1 and its proximal intron 1. A reporter plasmid assay showed that constructs harboring exon 1 and/or intron 1 sequences retained transactivation activity, which was essentially proportional to cellular levels of endogenous GATA-1. Introduction of a dominant-negative GATA-1 or small interfering RNA of GATA-1 resulted in a decrease in transcription activity of the CCR3 reporter. Both point mutation and EMSA analyses demonstrated that although GATA-1 bound to virtually all seven putative GATA elements present in exon 1-intron 1, the first GATA site in exon 1 exhibited the highest binding affinity for GATA-1 and was solely responsible for GATA-1-mediated transactivation. The fourth and fifth GATA sites in exon 1, which were postulated previously to be a canonical double-GATA site for GATA-1-mediated transcription of eosinophil-specific genes, appeared to play an inhibitory role in transactivation, albeit with a high affinity for GATA-1. Furthermore, mutation of the seventh GATA site (present in intron 1) increased transcription, suggesting an inhibitory role. These data suggest that GATA-1 controls CCR3 transcription by interacting dynamically with the multiple GATA sites in the regulatory region of the CCR3 gene.

  15. Global Analysis of DNA Methylation Variation in Adipose Tissue from Twins Reveals Links to Disease-Associated Variants in Distal Regulatory Elements

    PubMed Central

    Grundberg, Elin; Meduri, Eshwar; Sandling, Johanna K.; Hedman, Åsa K.; Keildson, Sarah; Buil, Alfonso; Busche, Stephan; Yuan, Wei; Nisbet, James; Sekowska, Magdalena; Wilk, Alicja; Barrett, Amy; Small, Kerrin S.; Ge, Bing; Caron, Maxime; Shin, So-Youn; Ahmadi, Kourosh R.; Ainali, Chrysanthi; Barrett, Amy; Bataille, Veronique; Bell, Jordana T.; Buil, Alfonso; Deloukas, Panos; Dermitzakis, Emmanouil T.; Dimas, Antigone S.; Durbin, Richard; Glass, Daniel; Grundberg, Elin; Hassanali, Neelam; Hedman, Åsa K.; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lindgren, Cecilia M.; Lowe, Christopher E.; McCarthy, Mark I.; Meduri, Eshwar; di Meglio, Paola; Min, Josine L.; Montgomery, Stephen B.; Nestle, Frank O.; Nica, Alexandra C.; Nisbet, James; O’Rahilly, Stephen; Parts, Leopold; Potter, Simon; Sandling, Johanna; Sekowska, Magdalena; Shin, So-Youn; Small, Kerrin S.; Soranzo, Nicole; Spector, Tim D.; Surdulescu, Gabriela; Travers, Mary E.; Tsaprouni, Loukia; Tsoka, Sophia; Wilk, Alicja; Yang, Tsun-Po; Zondervan, Krina T.; Lathrop, Mark; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Bell, Jordana T.; Deloukas, Panos

    2013-01-01

    Epigenetic modifications such as DNA methylation play a key role in gene regulation and disease susceptibility. However, little is known about the genome-wide frequency, localization, and function of methylation variation and how it is regulated by genetic and environmental factors. We utilized the Multiple Tissue Human Expression Resource (MuTHER) and generated Illumina 450K adipose methylome data from 648 twins. We found that individual CpGs had low variance and that variability was suppressed in promoters. We noted that DNA methylation variation was highly heritable (h2median = 0.34) and that shared environmental effects correlated with metabolic phenotype-associated CpGs. Analysis of methylation quantitative-trait loci (metQTL) revealed that 28% of CpGs were associated with nearby SNPs, and when overlapping them with adipose expression quantitative-trait loci (eQTL) from the same individuals, we found that 6% of the loci played a role in regulating both gene expression and DNA methylation. These associations were bidirectional, but there were pronounced negative associations for promoter CpGs. Integration of metQTL with adipose reference epigenomes and disease associations revealed significant enrichment of metQTL overlapping metabolic-trait or disease loci in enhancers (the strongest effects were for high-density lipoprotein cholesterol and body mass index [BMI]). We followed up with the BMI SNP rs713586, a cg01884057 metQTL that overlaps an enhancer upstream of ADCY3, and used bisulphite sequencing to refine this region. Our results showed widespread population invariability yet sequence dependence on adipose DNA methylation but that incorporating maps of regulatory elements aid in linking CpG variation to gene regulation and disease risk in a tissue-dependent manner. PMID:24183450

  16. Honokiol reverses alcoholic fatty liver by inhibiting the maturation of sterol regulatory element binding protein-1c and the expression of its downstream lipogenesis genes

    SciTech Connect

    Yin Huquan; Kim, Youn-Chul; Chung, Young-Suk; Kim, Young-Chul; Shin, Young-Kee; Lee, Byung-Hoon

    2009-04-01

    Ethanol induces hepatic steatosis via a complex mechanism that is not well understood. Among the variety of molecules that have been proposed to participate in this mechanism, the sterol regulatory element (SRE)-binding proteins (SREBPs) have been identified as attractive targets for therapeutic intervention. In the present study, we evaluated the effects of honokiol on alcoholic steatosis and investigated its possible effect on the inhibition of SREBP-1c maturation. In in vitro studies, H4IIEC3 rat hepatoma cells developed increased lipid droplets when exposed to ethanol, but co-treatment with honokiol reversed this effect. Honokiol inhibited the maturation of SREBP-1c and its translocation to the nucleus, the binding of nSREBP-1c to SRE or SRE-related sequences of its lipogenic target genes, and the expression of genes for fatty acid synthesis. In contrast, magnolol, a structural isomer of honokiol, had no effect on nSREBP-1c levels. Male Wistar rats fed with a standard Lieber-DeCarli ethanol diet for 4 weeks exhibited increased hepatic triglyceride and decreased hepatic glutathione levels, with concomitantly increased serum alanine aminotransferase and TNF-{alpha} levels. Daily administration of honokiol (10 mg/kg body weight) by gavage during the final 2 weeks of ethanol treatment completely reversed these effects on hepatotoxicity markers, including hepatic triglyceride, hepatic glutathione, and serum TNF-{alpha}, with efficacious abrogation of fat accumulation in the liver. Inhibition of SREBP-1c protein maturation and of the expression of Srebf1c and its target genes for hepatic lipogenesis were also observed in vivo. A chromatin immunoprecipitation assay demonstrated inhibition of specific binding of SREBP-1c to the Fas promoter by honokiol in vivo. These results demonstrate that honokiol has the potential to ameliorate alcoholic steatosis by blocking fatty acid synthesis regulated by SREBP-1c.

  17. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3' untranslated region AU-rich regulatory element.

    PubMed

    Yoo, Soonmoon; Kim, Hak H; Kim, Paul; Donnelly, Christopher J; Kalinski, Ashley L; Vuppalanchi, Deepika; Park, Michael; Lee, Seung J; Merianda, Tanuja T; Perrone-Bizzozero, Nora I; Twiss, Jeffery L

    2013-09-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3'UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich regulatory element (ARE) in GAP-43's 3'UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 co-immunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3'UTR competing with endogenous GAP-43 mRNA. Conversely, over-expressing GAP-43 coding sequence with its 3'UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43's 3'UTR. We have recently found that over-expression of GAP-43 using an axonally targeted construct with the 3'UTRs of GAP-43 promoted elongating growth of axons, while restricting the mRNA to the cell body with the 3'UTR of γ-actin had minimal effect on axon length. In this study, we show that the ARE in GAP-43's 3'UTR is responsible for localization of GAP-43 mRNA into axons and is sufficient for GAP-43 protein's role in elongating axonal growth.

  18. Effects of TiO2 and Co2O3 combination additions on the elemental distribution and electromagnetic properties of Mn-Zn power ferrites

    NASA Astrophysics Data System (ADS)

    Yang, W. D.; Wang, Y. G.

    2015-06-01

    The effects of TiO2 and Co2O3 combination additions on the elemental distribution and electromagnetic properties of Mn-Zn power ferrites are investigated. TiO2 addition can promote Co2O3 transfer from grain boundaries to the bulk of the grains. The temperature at which the highest initial permeability μi and the lowest power losses PL appear shifts to low temperature range with the increase of Co2O3 content. Compared with the reference sample without TiO2 and Co2O3 addition, the microstructure and electromagnetic properties of Mn-Zn power ferrites can be considerably improved with suitable amounts of TiO2 and Co2O3 combination additions. At the peak temperature, the sample with the 0.1 wt% TiO2 and 0.08 wt% Co2O3 additions has an increase of 15.8% in μi to 3951, and a decrease of 22.9% in PL to 286 kW/m3. The saturation magnetic induction Bs and electrical resistivity ρ at 25 °C reach the highest values of 532 mT and 8.12 Ω m, respectively.

  19. Identification of an additional ferric-siderophore uptake gene clustered with receptor, biosynthesis, and fur-like regulatory genes in fluorescent Pseudomonas sp. strain M114.

    PubMed Central

    O'Sullivan, D J; Morris, J; O'Gara, F

    1990-01-01

    Five cosmid clones with insert sizes averaging 22.6 kilobases (kb) were isolated after complementation of 22 Tn5-induced Sid- mutants of Pseudomonas sp. strain M114. One of these plasmids (pMS639) was also shown to encode ferric-siderophore receptor and dissociation functions. The receptor gene was located on this plasmid since introduction of the plasmid into three wild-type fluorescent pseudomonads enabled them to utilize the ferric-siderophore from strain M114. The presence of an extra iron-regulated protein in the outer membrane profile of one of these strains was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A ferric-siderophore dissociation gene was attributed to pMS639 since it complemented the ferric-siderophore uptake mutation in strain M114FR2. This mutant was not defective in the outer membrane receptor for ferric-siderophore but apparently accumulated ferric-siderophore internally. Since ferric-citrate alleviated the iron stress of the mutant, there was no defect in iron metabolism subsequent to release of iron from the ferric-siderophore complex. Consequently, this mutant was defective in ferric-siderophore dissociation. A fur-like regulatory gene also present on pMS639 was subcloned to a 7.0-kb BglII insert of pCUP5 and was located approximately 7.3 kb from the receptor region. These results established that the 27.2-kb insert of pMS639 encoded at least two siderophore biosynthesis genes, ferric-siderophore receptor and dissociation genes, and a fur-like regulatory gene from the biocontrol fluorescent Pseudomonas sp. strain M114. Images PMID:2143887

  20. Homologous Elements hs3a and hs3b in the 3′ Regulatory Region of the Murine Immunoglobulin Heavy Chain (Igh) Locus Are Both Dispensable for Class-switch Recombination*

    PubMed Central

    Yan, Yi; Pieretti, Joyce; Ju, Zhongliang; Wei, Shiniu; Christin, John R.; Bah, Fatmata; Birshtein, Barbara K.; Eckhardt, Laurel A.

    2011-01-01

    Immunoglobulin heavy chain (IgH) genes are formed, tested, and modified to yield diverse, specific, and high affinity antibody responses to antigen. The processes involved must be regulated, however, to avoid unintended damage to chromosomes. The 3′ regulatory region of the Igh locus plays a major role in regulating class-switch recombination (CSR), the process by which antibody effector functions are modified during an immune response. Loss of all known enhancer-like elements in this region dramatically impairs CSR, but individual element deletions have no effect on this process. In the present study, we explored the hypothesis that an underlying functional redundancy in the homologous elements hs3a and hs3b was masking the importance of either element to CSR. Several transgenic mouse lines were generated, each carrying a bacterial artificial chromosome transgene that mimicked Igh locus structure but in which hs3a was missing and hs3b was flanked by loxP sites. Matings to Cyclization Recombination Enzyme-expressing mice established “pairs” of lines that differed only in the presence or absence of hs3b. Remarkably, CSR remained robust in the absence of both hs3a and hs3b, suggesting that the remaining two elements of the 3′ regulatory region, hs1.2 and hs4, although individually dispensable for CSR, are, together, sufficient to support CSR. PMID:21673112

  1. Functional footprinting of regulatory DNA

    PubMed Central

    Vierstra, Jeff; Reik, Andreas; Chang, Kai-Hsin; Stehling-Sun, Sandra; Zhou, Yuan-Yue; Hinkley, Sarah J.; Paschon, David E.; Zhang, L.; Psatha, Nikoletta; Bendana, Yuri R.; O'Neill, Colleen M.; Song, Alex H.; Mich, Andrea; Liu, Pei-Qi; Lee, Gary; Bauer, Daniel E.; Holmes, Michael C.; Orkin, Stuart H.; Papayannopoulou, Thalia; Stamatoyannopoulos, George; Rebar, Edward J.; Gregory, Philip D.; Urnov, Fyodor D.; Stamatoyannopoulos, John A.

    2017-01-01

    Regulatory regions harbor multiple transcription factor recognition sites; however, the contribution of individual sites to regulatory function remains challenging to define. We describe a facile approach that exploits the error-prone nature of genome editing-induced double-strand break repair to map functional elements within regulatory DNA at nucleotide resolution. We demonstrate the approach on a human erythroid enhancer, revealing single TF recognition sites that gate the majority of downstream regulatory function. PMID:26322838

  2. Interferon regulatory factor 3 as key element of the interferon signature in plasmacytoid dendritic cells from systemic lupus erythematosus patients: novel genetic associations in the Mexican mestizo population

    PubMed Central

    Santana-de Anda, K; Gómez-Martín, D; Monsivais-Urenda, A E; Salgado-Bustamante, M; González-Amaro, R; Alcocer-Varela, J

    2014-01-01

    Many genetic studies have found an association between interferon regulatory factors (IRF) single nucleotide polymorphisms (SNPs) and systemic lupus erythematosus (SLE); however, specific dendritic cell (DC) alterations have not been assessed. The aim of the present study was to address the expression of IRF3 and IRF5 on different DC subsets from SLE patients, as well as their association with interferon (IFN)-α production and novel SNPs. For the genetic association analyses, 156 SLE patients and 272 healthy controls from the Mexican mestizo population were included. From these, 36 patients and 36 controls were included for functional analysis. Two IRF3 SNPs − rs2304206 and rs2304204 – were determined. We found an increased percentage of circulating pDC in SLE patients in comparison to controls (8·04 ± 1·48 versus 3·35 ± 0·8, P = 0·032). We also observed enhanced expression of IRF3 (64 ± 6·36 versus 36·1 ± 5·57, P = 0·004) and IRF5 (40 ± 5·25 versus 22·5 ± 2·6%, P = 0·010) restricted to this circulating pDC subset from SLE patients versus healthy controls. This finding was associated with higher IFN-α serum levels in SLE (160·2 ± 21 versus 106·1 ± 14 pg/ml, P = 0·036). Moreover, the IRF3 rs2304206 polymorphism was associated with increased susceptibility to SLE [odds ratio (OR), 95% confidence interval (CI) = 2·401 (1·187–4·858), P = 0·021] as well as enhanced levels of serum type I IFN in SLE patients who were positive for dsDNA autoantibodies. The IRF3 rs2304204 GG and AG genotypes conferred decreased risk for SLE. Our findings suggest that the predominant IRF3 expression on circulating pDC is a key element for the increased IFN-α activation based on the interplay between the rs2304206 gene variant and the presence of dsDNA autoantibodies in Mexican mestizo SLE patients. PMID:25130328

  3. Sterol regulatory element binding protein (SREBP)-1 expression in brain is affected by age but not by hormones or metabolic changes.

    PubMed

    Okamoto, Kenjirou; Kakuma, Tetsuya; Fukuchi, Satoshi; Masaki, Takayuki; Sakata, Toshiie; Yoshimatsu, Hironobu

    2006-04-07

    Sterol regulatory element binding protein (SREBP)-1 is a membrane-bound transcription factor that regulates the expression of several genes involved in cellular fatty acid synthesis in the peripheral tissues, including liver. Although SREBP-1 is expressed in brain, little is known about its function. The aim of the present study was to clarify the characteristics of SREBP-1 mRNA expression in rat brain under various nutritional and hormonal conditions. In genetically obese (fa/fa) Zucker rats, expression of SREBP-1 mRNA was greater in liver than in hypothalamus or cerebrum compared to the lean littermates of these rats. Fasting for 45 h and refeeding for 3 h did not affect expression in brains of Wistar rats of SREBP-1 mRNA or the mRNAs of lipogenic enzymes that are targets of SREBP-1, i.e., fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC). Infusion of 2.0 mIU insulin or 3.0 microg leptin into the third cerebroventricle did not affect SREBP-1 mRNA expression in either hypothalamus or cerebrum. SREBP-1 mRNA expression in brains of transgenic mice that overexpressed leptin did not differ from that of wild-type mice. However, we observed a unique age-related alteration in SREBP-1 mRNA expression in brains of Sprague-Dawley rats. Specifically, SREBP-1 mRNA expression increased between 1 and 20 months of age, while there was no such change in the expression of FAS or ACC. This raises the possibility that increased SREBP-1 expression secondary to aging-related decline of polyunsaturated fatty acid (PUFA) might compensate for the reduction of FAS expression in brain. These findings suggest that the expression of SREBP-1 and downstream lipogenic enzymes in brain is probably not regulated by peripheral nutritional conditions or humoral factors. Aging-related changes in SREBP-1 mRNA expression may be involved in developmental changes in brain lipid metabolism.

  4. Cluster analysis of Plasmodium RNA-seq time-course data identifies stage-specific co-regulated biological processes and regulatory elements

    PubMed Central

    Oyelade, Jelili; Adebiyi, Ezekiel

    2016-01-01

    In this study, we interpreted RNA-seq time-course data of three developmental stages of Plasmodium species by clustering genes based on similarities in their expression profile without prior knowledge of the gene function. Functional enrichment of clusters of upregulated genes at specific time-points reveals potential targetable biological processes with information on their timings. We identified common consensus sequences that these clusters shared as potential points of coordinated transcriptional control. Five cluster groups showed upregulated profile patterns of biological interest. This included two clusters from the Intraerythrocytic Developmental Cycle (cluster 4 = 16 genes, and cluster 9 = 32 genes), one from the sexual development stage (cluster 2 = 851 genes), and two from the gamete-fertilization stage in the mosquito host (cluster 4 = 153 genes, and cluster 9 = 258 genes). The IDC expressed the least numbers of genes with only 1448 genes showing any significant activity of the 5020 genes (~29%) in the experiment. Gene ontology (GO) enrichment analysis of these clusters revealed a total of 671 uncharacterized genes implicated in 14 biological processes and components associated with these stages, some of which are currently being investigated as drug targets in on-going research. Five putative transcription regulatory binding motifs shared by members of each cluster were also identified, one of which was also identified in a previous study by separate researchers. Our study shows stage-specific genes and biological processes that may be important in antimalarial drug research efforts. In addition, timed-coordinated control of separate processes may explain the paucity of factors in parasites. PMID:27990252

  5. Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements.

    PubMed

    Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H

    2014-02-01

    A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria.

  6. Computation-based discovery of related transcriptional regulatory modules and motifs using an experimentally validated combinatorial model.

    PubMed

    Halfon, Marc S; Grad, Yonatan; Church, George M; Michelson, Alan M

    2002-07-01

    Gene expression is regulated by transcription factors that interact with cis-regulatory elements. Predicting these elements from sequence data has proven difficult. We describe here a successful computational search for elements that direct expression in a particular temporal-spatial pattern in the Drosophila embryo, based on a single well characterized enhancer model. The fly genome was searched to identify sequence elements containing the same combination of transcription factors as those found in the model. Experimental evaluation of the search results demonstrates that our method can correctly predict regulatory elements and highlights the importance of functional testing as a means of identifying false-positive results. We also show that the search results enable the identification of additional relevant sequence motifs whose functions can be empirically validated. This approach, combined with gene expression and phylogenetic sequence data, allows for genome-wide identification of related regulatory elements, an important step toward understanding the genetic regulatory networks involved in development.

  7. Sodium Benzoate, a Food Additive and a Metabolite of Cinnamon, Enriches Regulatory T Cells via STAT6-Mediated Upregulation of TGF-β.

    PubMed

    Kundu, Madhuchhanda; Mondal, Susanta; Roy, Avik; Martinson, Jeffrey L; Pahan, Kalipada

    2016-10-15

    Upregulation and/or maintenance of regulatory T cells (Tregs) during autoimmune insults may have therapeutic efficacy in autoimmune diseases. Earlier we have reported that sodium benzoate (NaB), a metabolite of cinnamon and a Food and Drug Administration-approved drug against urea cycle disorders, upregulates Tregs and protects mice from experimental allergic encephalomyelitis, an animal model of multiple sclerosis. However, mechanisms by which NaB increases Tregs are poorly understood. Because TGF-β is an important inducer of Tregs, we examined the effect of NaB on the status of TGF-β. In this study, we demonstrated that NaB induced the expression of TGF-β mRNA and protein in normal as well as proteolipid protein-primed splenocytes. The presence of a consensus STAT6 binding site in the promoter of the TGF-β gene, activation of STAT6 in splenocytes by NaB, recruitment of STAT6 to the TGF-β promoter by NaB, and abrogation of NaB-induced expression of TGF-β in splenocytes by small interfering RNA knockdown of STAT6 suggest that NaB induces the expression of TGF-β via activation of STAT6. Furthermore, we demonstrated that blocking of TGF-β by neutralizing Abs abrogated NaB-mediated protection of Tregs and experimental allergic encephalomyelitis. These studies identify a new function of NaB in upregulating TGF-β via activation of STAT6, which may be beneficial in MS patients.

  8. Constitutive androstane receptor transcriptionally activates human CYP1A1 and CYP1A2 genes through a common regulatory element in the 5'-flanking region.

    PubMed

    Yoshinari, Kouichi; Yoda, Noriaki; Toriyabe, Takayoshi; Yamazoe, Yasushi

    2010-01-15

    Phenobarbital has long been known to increase cellular levels of CYP1A1 and CYP1A2 possibly through a pathway(s) independent of aryl hydrocarbon receptor. We have investigated the role of constitutive androstane receptor (CAR), a xenobiotic-responsive nuclear receptor, in the transactivation of human CYP1A1 and CYP1A2. These genes are located in a head-to-head orientation, sharing a 5'-flanking region. Reporter assays were thus performed with dual-reporter constructs, containing the whole or partially deleted human CYP1A promoter between two different reporter genes. In this system, human CAR (hCAR) enhanced the transcription of both genes through common promoter regions from -461 to -554 and from -18089 to -21975 of CYP1A1. With reporter assays using additional deleted and mutated constructs, electrophoresis mobility shift assays and chromatin immunoprecipitation assays, an ER8 motif (everted repeat separated by eight nucleotides), located at around -520 of CYP1A1, was identified as an hCAR-responsive element and a binding motif of hCAR/human retinoid X receptor alpha heterodimer. hCAR enhanced the transcription of both genes also in the presence of an aryl hydrocarbon receptor ligand. Finally, hCAR activation increased CYP1A1 and CYP1A2 mRNA levels in cultured human hepatocytes. Our results indicate that CAR transactivates human CYP1A1 and CYP1A2 in human hepatocytes through the common cis-element ER8. Interestingly, the ER8 motif is highly conserved in the CYP1A1 proximal promoter sequences of various species, suggesting a fundamental role of CAR in the xenobiotic-induced expression of CYP1A1 and CYP1A2 independent of aryl hydrocarbon receptor.

  9. A Novel Sterol Regulatory Element-Binding Protein Gene (sreA) Identified in Penicillium digitatum Is Required for Prochloraz Resistance, Full Virulence and erg11 (cyp51) Regulation

    PubMed Central

    Liu, Jing; Yuan, Yongze; Wu, Zhi; Li, Na; Chen, Yuanlei; Qin, Tingting; Geng, Hui; Xiong, Li; Liu, Deli

    2015-01-01

    Penicillium digitatum is the most destructive postharvest pathogen of citrus fruits, causing fruit decay and economic loss. Additionally, control of the disease is further complicated by the emergence of drug-resistant strains due to the extensive use of triazole antifungal drugs. In this work, an orthologus gene encoding a putative sterol regulatory element-binding protein (SREBP) was identified in the genome of P. digitatum and named sreA. The putative SreA protein contains a conserved domain of unknown function (DUF2014) at its carboxyl terminus and a helix-loop-helix (HLH) leucine zipper DNA binding domain at its amino terminus, domains that are functionally associated with SREBP transcription factors. The deletion of sreA (ΔsreA) in a prochloraz-resistant strain (PdHS-F6) by Agrobacterium tumefaciens-mediated transformation led to increased susceptibility to prochloraz and a significantly lower EC50 value compared with the HS-F6 wild-type or complementation strain (COsreA). A virulence assay showed that the ΔsreA strain was defective in virulence towards citrus fruits, while the complementation of sreA could restore the virulence to a large extent. Further analysis by quantitative real-time PCR demonstrated that prochloraz-induced expression of cyp51A and cyp51B in PdHS-F6 was completely abolished in the ΔsreA strain. These results demonstrate that sreA is a critical transcription factor gene required for prochloraz resistance and full virulence in P. digitatum and is involved in the regulation of cyp51 expression. PMID:25699519

  10. Elements of the maize A1 promoter required for transactivation by the anthocyanin B/C1 or phlobaphene P regulatory genes.

    PubMed Central

    Tuerck, J A; Fromm, M E

    1994-01-01

    The extensive genetic and molecular characterization of the flavonoid pathway's structural and regulatory genes has provided some of the most detailed knowledge of gene interactions in plants. In maize flavonoid biosynthesis, the A1 gene is independently regulated in the anthocyanin and phlobaphene pathways. Anthocyanin production requires the expression of the C1 or PI and R or B regulatory genes, whereas phlobaphene production requires only the P regulatory gene. By deletion analysis of the A1 promoter, we show that the sequences between -123 and -88 are critical for activation by anthocyanin and phlobaphene regulatory genes. Linker-scanner mutations indicated that the -123 to -100 region is more important for transactivation by the P protein. The -98 to -88 region is more important for B/C1 transactivation and shows a strong homology with the region of the Bz1 anthocyanin structural gene promoter shown to be activated by B/C1 and not by P. We identified a 14-bp consensus sequence that is also present in the promoters of three other genes in the anthocyanin pathway, and we propose a model for how the flavonoid regulatory proteins interact with the promoters of the structural genes. PMID:7827497

  11. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  12. Influence of ternary addition of transition elements (Cr, Si and Mn) on the microstructure and magnetic properties of nano-structured CuCo alloy

    NASA Astrophysics Data System (ADS)

    Mondal, B. N.; Chabri, S.; Basumallick, A.; Chattopadhyay, P. P.

    2012-09-01

    The current state of studies presents the effect of ternary addition of transition elements such as Mn, Cr and Si (10 wt%) on the mechanically driven non-equilibrium solubility of 40 wt% Co containing Cu-Co alloy. X-ray powder diffraction analysis indicates that addition of Mn has been found to be the most effective in enhancing the solubility and formation of a complete solid solution between Co and Cu in a short duration (30 h) of ball milling. The microstructure of the ball milled CuCoMn alloy was found to be stable after the isothermal annealing up to a temperature of 450 °C for 1 h. The magnetic properties such as magnetic saturation, coercivity and remanence of ball milled CuCo alloy in the presence of Mn significantly altered after annealing in the temperature range 350-650 °C for 1 h. The best combination of magnetic properties of CuCoMn alloy has been found after annealing at 550 °C for 1 h.

  13. The influence of Citrosept addition to drinking water and Scutellaria baicalensis root extract on the content of selected mineral elements in the blood plasma of turkey hens.

    PubMed

    Rusinek-Prystupa, Elżbieta; Lechowski, Jerzy; Zukiewicz-Sobczak, Wioletta; Sobczak, Paweł; Zawiślak, Kazimierz

    2014-01-01

    The aim of this research work was to indicate the influence of Citrosept preparation and Scutellaria baicalensis root extract, administered per os to growing turkey hens in 3 different dosages, on the content of selected mineral elements in blood plasma of slaughter turkey hens. An attempt was also made to specify the most effective dosage of the applied preparations with the highest efficiency as regards increased levels of examined macro- and microelements in the birds' blood. The research experiment was conducted on 315 turkey hens randomly divided into seven groups, each consisting of 45 turkey hens. Group K constituted the control group without experimental additions of the above-mentioned preparations. When it comes to turkey hens which belonged to groups II-IV, Citrosept preparation was instilled to water in the following dosages: Group II - 0.011 ml/kg of bm; Group III - 0.021 ml/kg of bm; Group IV - 0.042 ml/kg bm. For birds which belonged to groups V-VII preparation, which was Scutellaria baicalensis root extract, was instilled to water in the following dosages: Group V - 0.009 ml/kg of bm; Group VI - 0.018 ml/kg of bm, Group VII - 0.036 ml/kg bm. In the examined plant extracts and blood plasma of the birds the levels of Na, K, Ca, Mg, Cu, Zn, and Fe were identified. The use of examined extracts influenced the changes in the levels of all tested elements in slaughter turkey hens' blood plasma. An upward tendency was recorded which regarded the level of calcium and magnesium, and a downward tendency of sodium, potassium, copper, zinc, and iron in relation to the results achieved in the control group.

  14. Influencing the arc and the mechanical properties of the weld metal in GMA-welding processes by additive elements on the wire electrode surface

    NASA Astrophysics Data System (ADS)

    Wesling, V.; Schram, A.; Müller, T.; Treutler, K.

    2016-03-01

    Under the premise of an increasing scarcity of raw materials and increasing demands on construction materials, the mechanical properties of steels and its joints are gaining highly important. In particular high- and highest-strength steels are getting in the focus of the research and the manufacturing industry. To the same extent, the requirements for filler metals are increasing as well. At present, these low-alloy materials are protected by a copper coating (<1μm) against corrosion. In addition, the coating realizes a good ohmic contact and good sliding properties between the welding machine and the wire during the welding process. By exchanging the copper with other elements it should be possible to change the mechanical properties of the weld metal and the arc stability during gas metal arc welding processes and keep the basic functions of the coating nearly untouched. On a laboratory scale solid wire electrodes with coatings of various elements and compounds such as titanium oxide were made and processed with a Gas Metal Arc Welding process. During the processing a different process behavior between the wire electrodes, coated and original, could be observed. The influences ranges from greater/shorter arc-length over increasing/decreasing droplets to larger/smaller arc foot point. Furthermore, the weld metal of the coated electrodes has significantly different mechanical and technological characteristics as the weld metal from the copper coated ground wire. The yield strength and tensile strength can be increased by up to 50%. In addition, the chemical composition of the weld metal was influenced by the application of coatings with layer thicknesses to 15 microns in the lower percentage range (up to about 3%). Another effect of the coating is a modified penetration. The normally occurring “argon finger” can be suppressed or enhanced by the choice of the coating. With the help of the presented studies it will be shown that Gas Metal Arc Welding processes

  15. Regulatory use of computational toxicology tools and databases at the United States Food and Drug Administration's Office of Food Additive Safety.

    PubMed

    Arvidson, Kirk B; Chanderbhan, Ronald; Muldoon-Jacobs, Kristi; Mayer, Julie; Ogungbesan, Adejoke

    2010-07-01

    Over 10 years ago, the Office of Food Additive Safety (OFAS) in the FDA's Center for Food Safety and Applied Nutrition implemented the formal use of structure-activity relationship analysis and quantitative structure-activity relationship (QSAR) analysis in the premarket review of food-contact substances. More recently, OFAS has implemented the use of multiple QSAR software packages and has begun investigating the use of metabolism data and metabolism predictive models in our QSAR evaluations of food-contact substances. In this article, we provide an overview of the programs used in OFAS as well as a perspective on how to apply multiple QSAR tools in the review process of a new food-contact substance.

  16. Grain refinement in heavy rare earth element-free sintered Nd–Fe–B magnets by addition of a small amount of molybdenum

    SciTech Connect

    Kim, Jin Woo; Lee, Won Suk; Byun, Jong Min; Kim, Young Do; Kim, Se Hoon

    2015-05-07

    We employed a modified refractory-metal-addition method to achieve higher coercivity and remanence in heavy rare earth element (HREE)-free Nd–Fe–B sintered magnets. This process involved inducing the formation of a homogeneous secondary phase at the grain boundaries during sintering, making it possible to control the intergrain diffusion by adding small amounts of Mo, a refractory metal. To control the microstructure of the secondary phase effectively, a metal organic compound of the refractory metal was coated on the surfaces of the particles of an HREE-free Nd–Fe–B powder. The average grain size after this process was 5.60 μm, which was approximately 1.8 μm smaller than that of the HREE-free sintered Nd–Fe–B magnets (7.4 μm). The coercivity of the magnets prepared through this process could be increased from 11.88 kOe to 13.91 kOe without decreasing their remanence.

  17. Additive Promotion of Viral Internal Ribosome Entry Site-Mediated Translation by Far Upstream Element-Binding Protein 1 and an Enterovirus 71-Induced Cleavage Product

    PubMed Central

    Hung, Chuan-Tien; Kung, Yu-An; Li, Mei-Ling; Lee, Kuo-Ming; Liu, Shih-Tung; Shih, Shin-Ru

    2016-01-01

    The 5' untranslated region (5' UTR) of the enterovirus 71 (EV71) RNA genome contains an internal ribosome entry site (IRES) that is indispensable for viral protein translation. Due to the limited coding capacity of their RNA genomes, EV71 and other picornaviruses typically recruit host factors, known as IRES trans-acting factors (ITAFs), to mediate IRES-dependent translation. Here, we show that EV71 viral proteinase 2A is capable of cleaving far upstream element-binding protein 1 (FBP1), a positive ITAF that directly binds to the EV71 5' UTR linker region to promote viral IRES-driven translation. The cleavage occurs at the Gly-371 residue of FBP1 during the EV71 infection process, and this generates a functional cleavage product, FBP11-371. Interestingly, the cleavage product acts to promote viral IRES activity. Footprinting analysis and gel mobility shift assay results showed that FBP11-371 similarly binds to the EV71 5' UTR linker region, but at a different site from full-length FBP1; moreover, FBP1 and FBP11-371 were found to act additively to promote IRES-mediated translation and virus yield. Our findings expand the current understanding of virus-host interactions with regard to viral recruitment and modulation of ITAFs, and provide new insights into translational control during viral infection. PMID:27780225

  18. Effects of Al Content and Addition of Third Element on Fabrication of Ti-Al Intermetallic Coatings by Heat Treatment of Warm-Sprayed Precursors

    NASA Astrophysics Data System (ADS)

    Sienkiewicz, J.; Kuroda, S.; Minagawa, K.; Murakami, H.; Araki, H.; Kurzydłowski, K. J.

    2015-06-01

    Four powder mixtures of titanium and aluminum with 50:50, 40:60, 30:70, and 20:80 atomic ratios were used as feedstock for Warm Spray process to produce composite coatings. A two-stage heat treatment at 600 and 1000 °C was applied to the deposits in order to obtain titanium aluminide intermetallic phases. The microstructure, chemical, and phase composition of the as-deposited and heat-treated coatings were investigated using SEM, EDS, and XRD. It was found that the Al content affects on the thickness expansion of the heat-treated Ti-Al coatings significantly and also has a major influence on the porosity development, which is caused by the Kirkendall effect. The effects of adding a third element Si and heat treatment with pressure to produce denser Ti-Al intermetallic coating were also examined. The investigated hot-pressed coatings with addition of Si exhibited much denser microstructure and contained Ti-Al intermetallic phases with titanium silicide precipitates.

  19. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements.

    PubMed

    Lutz, R; Bujard, H

    1997-03-15

    Based on parameters governing promoter activity and using regulatory elements of the lac, ara and tet operon transcription control sequences were composed which permit the regulation in Escherichia coli of several gene activities independently and quantitatively. The novel promoter PLtetO-1 allows the regulation of gene expression over an up to 5000-fold range with anhydrotetracycline (aTc) whereas with IPTG and arabinose the activity of Plac/ara-1 may be controlled 1800-fold. Escherichia coli host strains which produce defined amounts of the regulatory proteins, Lac and Tet repressor as well as AraC from chromosomally located expression units provide highly reproducible in vivo conditions. Controlling the expression of the genes encoding luciferase, the low abundance E.coli protein DnaJ and restriction endonuclease Cfr9I not only demonstrates that high levels of expression can be achieved but also suggests that under conditions of optimal repression only around one mRNA every 3rd generation is produced. This potential of quantitative control will open up new approaches in the study of gene function in vivo, in particular with low abundance regulatory gene products. The system will also provide new opportunities for the controlled expression of heterologous genes.

  20. [Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

    PubMed

    Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

    2016-01-01

    In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

  1. Uranium hydrogeochemical and stream sediment reconnaissance of the Dalhart NTMS quadrangle, New Mexico/Texas/Oklahoma, including concentrations of forty-two additional elements

    SciTech Connect

    Morgan, T.L.

    1980-08-01

    Totals of 1583 water samples and 503 sediment samples were collected from 2028 locations within the 20 000-km/sup 2/ area of the quadrangle at an average density of one location per 9.86 km/sup 2/. Water samples were collected from wells, springs, and streams and were analyzed for uranium. Sediment samples were collected from streams and springs and were analyzed for uranium, thorium, and 41 additional elements. All field and analytical data are listed in the appendixes of this report. Discussion is limited to anomalous samples, which are considered to be those containing over 20 ppB uranium for waters and over 5 ppM uranium for sediments. Uranium concentrations in water samples range from below the detection limit of 0.2 ppB to 1457.65 ppB and average 7.41 ppB. Most of the seventy anomalous water samples (4.4% of all water samples) are grouped spatially into five clusters or areas of interest. Samples in three of the clusters were collected along the north edge of the quadrangle where Mesozoic strata are exposed. The other two clusters are from the central and southern portions where the Quaternary Ogallala formation is exposed. Sediment samples from the quadrangle have uranium concentrations that range from 0.90 ppM to 27.20 ppM and average 3.27 ppM. Fourteen samples (2.8% of all sediment samples) contain over 5 ppM uranium and are considered anomalous. The five samples with the highest concentrations occur where downcutting streams expose Cretaceous units beneath the Quaternary surficial deposits. The remaining anomalous sediment samples were collected from scattered locations and do not indicate any single formation or unit as a potential source for the anomalous concentrations.

  2. Regulatory guidance document

    SciTech Connect

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  3. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Elk City NTMS Quadrangle, Idaho/Montana, including concentrations of forty-five additional elements

    SciTech Connect

    Broxton, D.E.; Beyth, M.

    1980-07-01

    Totals of 1580 water and 1720 sediment samples were collected from 1754 locations in the quadrangle. Elemental concentration, field measurement, weather, geologic, and geographic data for each sample location are listed for waters in Appendix I-A and for sediments in Appendix I-B. Uranium/thorium ratios for sediment samples are also included in Appendix I-B. All elemental analyses were performed at the LASL. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than 40 parts per billion (ppB) uranium were reanalyzed by delayed-neutron counting (DNC). A supplemental report containing the multielement analyses of water samples will be open filed in the near future. Sediments were analyzed for uranium and thorium as well as aluminum, antimony, arsenic, barium, beryllium, bismuth, cadmium, calcium, cerium, cesium, chlorine, chromium, cobalt, copper, dysprosium, europium, gold, hafnium, iron, lanthanum, lead, lithium, lutetium, magnesium, manganese, nickel, niobium, potassium, rubidium, samarium, selenium, scandium, silver, sodium, strontium, tantalum, terbium, tin, titanium, tungsten, vanadium, ytterbium, zinc, and zirconium. Basic statistics for 40 of these elements are presented. All sediments were analyzed for uranium by delayed-neutron counting. Other elemental concentrations in sediments were determined by neutron-activation analysis for 30 elements, by x-ray fluorescence for 12 elements, and by arc-source emission spectrography for 2 elements. Analytical results for sediments are reported as parts per million.

  4. Internal loop/bulge and hairpin loop of the iron-responsive element of ferritin mRNA contribute to maximal iron regulatory protein 2 binding and translational regulation in the iso-iron-responsive element/iso-iron regulatory protein family.

    PubMed

    Ke, Y; Sierzputowska-Gracz, H; Gdaniec, Z; Theil, E C

    2000-05-23

    Iron-responsive elements (IREs), a natural group of mRNA-specific sequences, bind iron regulatory proteins (IRPs) differentially and fold into hairpins [with a hexaloop (HL) CAGUGX] with helical distortions: an internal loop/bulge (IL/B) (UGC/C) or C-bulge. C-bulge iso-IREs bind IRP2 more poorly, as oligomers (n = 28-30), and have a weaker signal response in vivo. Two trans-loop GC base pairs occur in the ferritin IRE (IL/B and HL) but only one in C-bulge iso-IREs (HL); metal ions and protons perturb the IL/B [Gdaniec et al. (1998) Biochemistry 37, 1505-1512]. IRE function (translation) and physical properties (T(m) and accessibility to nucleases) are now compared for IL/B and C-bulge IREs and for HL mutants. Conversion of the IL/B into a C-bulge by a single deletion in the IL/B or by substituting the HL CG base pair with UA both derepressed ferritin synthesis 4-fold in rabbit reticulocyte lysates (IRP1 + IRP2), confirming differences in IRP2 binding observed for the oligomers. Since the engineered C-bulge IRE was more helical near the IL/B [Cu(phen)(2) resistant] and more stable (T(m) increased) and the HL mutant was less helical near the IL/B (ribonuclease T1 sensitive) and less stable (T(m) decreased), both CG trans-loop base pairs contribute to maximum IRP2 binding and translational regulation. The (1)H NMR spectrum of the Mg-IRE complex revealed, in contrast to the localized IL/B effects of Co(III) hexaammine observed previously, perturbation of the IL/B plus HL and interloop helix. The lower stability and greater helix distortion in the ferritin IL/B-IRE compared to the C-bulge iso-IREs create a combinatorial set of RNA/protein interactions that control protein synthesis rates with a range of signal sensitivities.

  5. Omeprazole transactivates human CYP1A1 and CYP1A2 expression through the common regulatory region containing multiple xenobiotic-responsive elements.

    PubMed

    Yoshinari, Kouichi; Ueda, Rika; Kusano, Kazutomi; Yoshimura, Tsutomu; Nagata, Kiyoshi; Yamazoe, Yasushi

    2008-07-01

    Omeprazole induces human CYP1A1 and CYP1A2 in human hepatoma cells and human liver. Aryl hydrocarbon receptor (AHR) is shown to be involved in this induction. However, its precise molecular mechanism remains unknown because the chemical activates AHR without its direct binding in contrast to typical AHR ligands such as 3-methylcholanthrene (3MC) and beta-naphthoflavone (BNF). Human CYP1A1 and CYP1A2 genes are located in a head-to-head orientation sharing about 23 kb 5'-flanking region. Recently, we succeeded to measure CYP1A1 and CYP1A2 transcriptional activities simultaneously using dual reporter gene constructs containing the 23 kb sequence. In this study, transient transfection assays have been performed using numbers of single and dual reporter constructs to identify omeprazole-responsive region for CYP1A1 and CYP1A2 induction. Reporter assays with deletion constructs have demonstrated that the omeprazole-induced expression of both CYP1A1 and CYP1A2 is mediated via the common regulatory region containing multiple AHR-binding motifs (the nucleotides from -464 to -1829 of human CYP1A1), which is identical with the region for BNF and 3MC induction. Interestingly, omeprazole activated the transcription of CYP1A1 and CYP1A2 to similar extents while BNF and 3MC preferred CYP1A1 expression. We have also found that primaquine is an omeprazole-like CYP1A inducer, while lansoprazole and albendazole are 3MC/BNF-like in terms of the CYP1A1/CYP1A2 preference. The present results suggest that omeprazole as well as BNF and 3MC activates both human CYP1A1 and CYP1A2 expression through the common regulatory region despite that omeprazole may involve a different cellular signal(s) from BNF and 3MC.

  6. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Dubois NTMS Quadrangle, Idaho/Montana, including concentrations of forty-five additional elements

    SciTech Connect

    LaDelfe, C.M.

    1980-08-01

    Totals of 1024 water samples and 1600 sediment samples were collected from 1669 locations in the Dubois quadrangle. Water samples were taken at streams, springs, and wells; sediment samples were collected from streams and springs. All field and analytical data are presented for waters in Appendix I-A and for sediments in I-B. All elemental analyses were performed at the LASL. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than the upper detection limit of uranium were reanalyzed by delayed neutron counting. Sediments were analyzed for uranium and thorium as well as aluminum, antimony, arsenic, barium, beryllium, bismuth, cadmium, calcium, cerium, cesium, chlorine, chromium, cobalt, copper, dysprosium, europium, gold, hafnium, iron, lanthanum, lead, lithium, lutetium, magnesium, manganese, nickel, niobium, potassium rubidium, samarium, scandium, selenium, silver, sodium, strontium, tantalum, terbium, tin, titanium, tungsten, vanadium, ytterbium, zinc and zirconium. All sediments were analyzed for uranium by delayed-neutron counting. Other elemental concentrations in sediments were determined by neutron-activation analysis for 30 elements, by x-ray fluorescence for 12 elements, and by arc-source emission spectrography for 2 elements. Analytical results for sediments are reported as parts per million.

  7. Transcriptionally active MuDR, the regulatory element of the mutator transposable element family of Zea mays, is present in some accessions of the Mexican land race Zapalote chico.

    PubMed Central

    de la Luz Gutiérrez-Nava, M; Warren, C A; León, P; Walbot, V

    1998-01-01

    To date, mobile Mu transposons and their autonomous regulator MuDR have been found only in the two known Mutator lines of maize and their immediate descendants. To gain insight into the origin, organization, and regulation of Mutator elements, we surveyed exotic maize and related species for cross-hybridization to MuDR. Some accessions of the mexican land race Zapalote chico contain one to several copies of full-length, unmethylated, and transcriptionally active MuDR-like elements plus non-autonomous Mu elements. The sequenced 5.0-kb MuDR-Zc element is 94.6% identical to MuDR, with only 20 amino acid changes in the 93-kD predicted protein encoded by mudrA and ten amino acid changes in the 23-kD predicted protein of mudrB. The terminal inverted repeat (TIR) A of MuDR-Zc is identical to standard MuDR; TIRB is 11.2% divergent from TIRA. In Zapalote chico, mudrA transcripts are very rare, while mudrB transcripts are as abundant as in Mutator lines with a few copies of MuDR. Zapalote chico lines with MuDR-like elements can trans-activate reporter alleles in inactive Mutator backgrounds; they match the characteristic increased forward mutation frequency of standard Mutator lines, but only after outcrossing to another line. Zapalote chico accessions that lack MuDR-like elements and the single copy MuDR a1-mum2 line produce few mutations. New mutants recovered from Zapalote chico are somatically stable. PMID:9584107

  8. Conservation and evolution of cis-regulatory systems in ascomycete fungi

    SciTech Connect

    Gasch, Audrey P.; Moses, Alan M.; Chiang, Derek Y.; Fraser, Hunter B.; Berardini, Mark; Eisen, Michael B.

    2004-03-15

    Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups from S. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

  9. CONTROL OF LASER RADIATION PARAMETERS: Compensation for thermally induced aberrations in optical elements by means of additional heating by CO2 laser radiation

    NASA Astrophysics Data System (ADS)

    Soloviev, A. A.; Kozhevatov, I. E.; Palashov, O. V.; Khazanov, E. A.

    2006-10-01

    A method is proposed for compensating thermally induced phase distortions of laser radiation in absorbing optical elements. The method is based on supplementary heating of the peripheral region of the distorting element by the radiation from an auxiliary laser. A programme code has been developed for calculating the optimal parameters of supplementary radiation for minimising phase distortions. This code is based on the numerical solution of the thermal conductivity and static elasticity equations for a nonuniformly heated solid of cylindrical symmetry. Experiments reveal a high efficiency of the method for compensating distortions resulting from absorption of radiation with a Gaussian intensity profile.

  10. Uranium hydrogeochemical and stream sediment reconnaissance data release for the Lewistown NTMS Quadrangle, Montana, including concentrations of forty-two additional elements

    SciTech Connect

    Shannon, S.S. Jr.

    1980-08-01

    Totals of 758 water and 1170 sediment samples were collected from 1649 locations in the Levistown quadrangle. Water samples were collected at streams, springs, wells, ponds, and marshes; sediment samples were obtained from streams, springs, and ponds. Histograms and statistical data for uranium concentrations in water and sediment samples and thorium concentrations in sediment samples are given. All samples were collected at the nominal reconnaissance density of one sample location per 10 km/sup 2/. Elemental concentration, field measurement, weather, geologic, and geographic data for each sample location are listed for waters and for sediments. Uranium to thorium (U/Th) ratios for sediment samples are included. Water samples were initially analyzed for uranium by fluorometry. All water samples containing more than 40 ppB U were reanalyzed by delayed-neutron counting. Sediments were analyzed for U and Th as well as Al, Sb, Ba, Be, Bi, Cd, Ca, Ce, Cs, Cl, Cr, Co, Cu, Dy, Eu, Au, Hf, Fe, La, Pb, Li, Lu, Mg, Mn, Ni, Nb, K, Rb, Sa, Sc, Ag, Na, Sr, Ta, Tb, Sn, Ti, W, V, Yb, and Zn. All sediments were analyzed for U by delayed neutron counting. Other elemental concentrations in sediments were determined by neutron activation analysis for 31 elements, by x-ray fluorescence for 9 elements, and by arc-source emission spectrography for 2 elements. Analytical results are reported as parts per million. Descriptions of procedures used for analysis of water and sediments samples as well as analytical precisions and detection limits are given.

  11. Ginsenoside F2 reduces hair loss by controlling apoptosis through the sterol regulatory element-binding protein cleavage activating protein and transforming growth factor-β pathways in a dihydrotestosterone-induced mouse model.

    PubMed

    Shin, Heon-Sub; Park, Sang-Yong; Hwang, Eun-Son; Lee, Don-Gil; Mavlonov, Gafurjon Turdalievich; Yi, Tae-Hoo

    2014-01-01

    This study was conducted to test whether ginsenoside F2 can reduce hair loss by influencing sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and the transforming growth factor beta (TGF-β) pathway of apoptosis in dihydrotestosterone (DHT)-treated hair cells and in a DHT-induced hair loss model in mice. Results for ginsenoside F2 were compared with finasteride. DHT inhibits proliferation of hair cells and induces androgenetic alopecia and was shown to activate an apoptosis signal pathway both in vitro and in vivo. The cell-based 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that the proliferation rates of DHT-treated human hair dermal papilla cells (HHDPCs) and HaCaTs increased by 48% in the ginsenoside F2-treated group and by 12% in the finasteride-treated group. Western blot analysis showed that ginsenoside F2 decreased expression of TGF-β2 related factors involved in hair loss. The present study suggested a hair loss related pathway by changing SCAP related apoptosis pathway, which has been known to control cholesterol metabolism. SCAP, sterol regulatory element-binding protein (SREBP) and caspase-12 expression in the ginsenoside F2-treated group were decreased compared to the DHT and finasteride-treated group. C57BL/6 mice were also prepared by injection with DHT and then treated with ginsenoside F2 or finasteride. Hair growth rate, density, thickness measurements and tissue histotological analysis in these groups suggested that ginsenoside F2 suppressed hair cell apoptosis and premature entry to catagen more effectively than finasteride. Our results indicated that ginsenoside F2 decreased the expression of TGF-β2 and SCAP proteins, which have been suggested to be involved in apoptosis and entry into catagen. This study provides evidence those factors in the SCAP pathway could be targets for hair loss prevention drugs.

  12. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis

    PubMed Central

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671

  13. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis.

    PubMed

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype.

  14. Several Cis-regulatory Elements Control mRNA Stability, Translation Efficiency, and Expression Pattern of Prrxl1 (Paired Related Homeobox Protein-like 1)*

    PubMed Central

    Regadas, Isabel; Matos, Mariana Raimundo; Monteiro, Filipe Almeida; Gómez-Skarmeta, José Luis; Lima, Deolinda; Bessa, José; Casares, Fernando; Reguenga, Carlos

    2013-01-01

    The homeodomain transcription factor Prrxl1/DRG11 has emerged as a crucial molecule in the establishment of the pain circuitry, in particular spinal cord targeting of dorsal root ganglia (DRG) axons and differentiation of nociceptive glutamatergic spinal cord neurons. Despite Prrxl1 importance in the establishment of the DRG-spinal nociceptive circuit, the molecular mechanisms that regulate its expression along development remain largely unknown. Here, we show that Prrxl1 transcription is regulated by three alternative promoters (named P1, P2, and P3), which control the expression of three distinct Prrxl1 5′-UTR variants, named 5′-UTR-A, 5′-UTR-B, and 5′-UTR-C. These 5′-UTR sequences confer distinct mRNA stability and translation efficiency to the Prrxl1 transcript. The most conserved promoter (P3) contains a TATA-box and displays in vivo enhancer activity in a pattern that overlaps with the zebrafish Prrxl1 homologue, drgx. Regulatory modules present in this sequence were identified and characterized, including a binding site for Phox2b. Concomitantly, we demonstrate that zebrafish Phox2b is required for the expression of drgx in the facial, glossopharyngeal, and vagal cranial ganglia. PMID:24214975

  15. CNS-specific regulatory elements in brain-derived HIV-1 strains affect responses to latency-reversing agents with implications for cure strategies

    PubMed Central

    Gray, L R; Cowley, D; Welsh, C; Lu, H K; Brew, B J; Lewin, S R; Wesselingh, S L; Gorry, P R; Churchill, M J

    2016-01-01

    Latency-reversing agents (LRAs), including histone deacetylase inhibitors (HDACi), are being investigated as a strategy to eliminate latency in HIV-infected patients on suppressive antiretroviral therapy. The effectiveness of LRAs in activating latent infection in HIV strains derived from the central nervous system (CNS) is unknown. Here we show that CNS-derived HIV-1 strains possess polymorphisms within and surrounding the Sp transcription factor motifs in the long terminal repeat (LTR). These polymorphisms result in decreased ability of the transcription factor specificity protein 1 to bind CNS-derived LTRs, reducing the transcriptional activity of CNS-derived viruses. These mutations result in CNS-derived viruses being less responsive to activation by the HDACi panobinostat and romidepsin compared with lymphoid-derived viruses from the same subjects. Our findings suggest that HIV-1 strains residing in the CNS have unique transcriptional regulatory mechanisms, which impact the regulation of latency, the consideration of which is essential for the development of HIV-1 eradication strategies. PMID:26303660

  16. A simplified soil extraction sequence to monitor the main and trace element speciation in soil after compost and mineral fertilizer additions upon the composition of wheat grains

    NASA Astrophysics Data System (ADS)

    Sager, Manfred; Erhart, Eva

    2016-04-01

    High quality biological waste treatment aims at producing compost in order to maintain a clean environment and to sustain soil organic carbon levels. Fertilization with compost as a source of organic carbon, nutrients, and accessory elements, as well as fertilization with mineral N- and PK fertilizer have been tested in a field experiment on a calcaric Fluvisol in the Danube wetlands, at 4 levels each. Yields of wheat were recorded, and grains and soils were sampled from each treatment, and analyzed for main and trace element composition. The corresponding soils were characterized by mobile phases, obtained by leaching with 0,16M acetic acid to cover exchangeables plus carbonates, and subsequently by 0,1M oxalate buffer pH 3 to dissolve the pedogenic oxides. Total amounts were obtained from digests with perchloric- nitric-hydrofluoric acid. For quasi-total amounts, aqua regia was replaced by pressure decomposition with KClO3 in dilute nitric acid. The proposed extraction sequence permits to analyze and interpret soil for main elements, trace elements, nutrients and anions simultaneously. Factor analyses of soil extracts obtained from dilute acetic acid revealed Ba-Be-Cd-Cu-Li-S (traces), Ca-Mg-Mn (main carbonates), Al-Fe-B, Y, and P-K (nutrients) as chemically feasible principal components. Subsequent soil extracts from oxalate contained Al-B-Co-K-Na-Pb-Si-V-S (maybe acid silicate weathering), Cr-Li-Ni-Sr-Ti (maybe basic silicate weathering), Be-Cu-Fe-P, Co-Mg-Mn-Zn (Mn-oxides) and Ba-Sc as principal components. Factor analyses of total element data distinguished the principal components Ce-La-Li-Sc-Y-P (rare earths), Al-Ca-Fe-K-Mg-Na-P (main elements), Cd-Co-Cr-Cu-Ni-Zn (trace elements), As-Pb (contaminants), Ba-Mn-Sr, and Ti, which looks chemically feasible also. Factor analyses of those soil fractions which presumably form the main fractions of exchangeables, carbonates, pedogenic oxides and silicates, showed no cross connections, except for P. Oxalate

  17. Regulatory T cell memory

    PubMed Central

    Rosenblum, Michael D.; Way, Sing Sing; Abbas, Abul K.

    2016-01-01

    Memory for antigen is a defining feature of adaptive immunity. Antigen-specific lymphocyte populations show an increase in number and function after antigen encounter and more rapidly re-expand upon subsequent antigen exposure. Studies of immune memory have primarily focused on effector B cells and T cells with microbial specificity, using prime challenge models of infection. However, recent work has also identified persistently expanded populations of antigen-specific regulatory T cells that protect against aberrant immune responses. In this Review, we consider the parallels between memory effector T cells and memory regulatory T cells, along with the functional implications of regulatory memory in autoimmunity, antimicrobial host defence and maternal fetal tolerance. In addition, we discuss emerging evidence for regulatory T cell memory in humans and key unanswered questions in this rapidly evolving field. PMID:26688349

  18. Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA.

    PubMed

    Gueydan, C; Droogmans, L; Chalon, P; Huez, G; Caput, D; Kruys, V

    1999-01-22

    In monocyte/macrophages, the translation of tumor necrosis factor alpha (TNF-alpha) mRNA is tightly regulated. In unstimulated cells, translation of TNF-alpha mRNA is blocked. Upon stimulation with lipopolysaccharides, this repression is overcome, and the mRNA becomes efficiently translated. The key element in this regulation is the AU-rich element (ARE). We have previously reported the binding of two cytosolic protein complexes to the TNF-alpha mRNA ARE. One of these complexes (complex 1) forms with extracts of both unstimulated and lipopolysaccharide-stimulated macrophages and requires a large fragment of the ARE containing clustered AUUUA pentamers. The other complex (complex 2) is only detected after cell activation, binds to a minimal UUAUUUAUU nonamer, and is composed of a 55-kDa protein. Here, we report the identification of the RNA-binding protein TIAR as a protein involved in complex 1. The RNA sequence bound by TIAR and the cytoplasmic localization of this protein in macrophages argue for an involvement of TIAR in TNF mRNA posttranscriptional regulation.

  19. Rapid kinetics of iron responsive element (IRE) RNA/iron regulatory protein 1 and IRE-RNA/eIF4F complexes respond differently to metal ions

    PubMed Central

    Khan, Mateen A.; Ma, Jia; Walden, William E.; Merrick, William C.; Theil, Elizabeth C.; Goss, Dixie J.

    2014-01-01

    Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn2+ decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn2+ increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn2+ eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. PMID:24728987

  20. Sterol regulatory element binding protein-mediated effect of fluvastatin on cytosolic 3-hydroxy-3-methylglutaryl-coenzyme A synthase transcription.

    PubMed

    Mascaró, C; Ortiz, J A; Ramos, M M; Haro, D; Hegardt, F G

    2000-02-15

    The effects of acute treatment with fluvastatin, a hypocholesteremic drug, on the mRNA levels of several regulatory enzymes of cholesterogenesis and of the LDL receptor were determined in rat liver. Fluvastatin increased the hepatic mRNA levels for HMG-CoA reductase up to 12-fold in 5 weeks of treatment at a daily dose of 6. 3 mg/kg. The effect was less marked in cytosolic HMG-CoA synthase, farnesyl-PP synthase, squalene synthetase, and LDL receptor. SREBP-2 mRNA levels were also increased, but SREBP-1 were not. De novo synthesis of cholesterol in several cultured cells was reduced by increasing concentrations of fluvastatin, and the IC(50) values of fluvastatin in HepG2, CV-1, and CHO cells were respectively 0.01, 0. 05, and 0.1 microM. When CHO cells stably transfected with a chimeric gene composed of the promoter of cytosolic HMG-CoA synthase and the CAT gene as a reporter were incubated with fluvastatin, the CAT gene was overexpressed, an effect which was similar to the cotransfection with the processed form of SREBP-1a. Both ALLN and fluvastatin increased the transcriptional activity of cytosolic HMG-CoA synthase. Mutation in either SRE or NF-Y boxes abolished the increase in transcriptional rate caused by fluvastatin in the promoter of cytosolic HMG-CoA synthase. These results indicate that the increase in transcriptional activity in the HMG-CoA synthase gene attributable to fluvastatin is a consequence of the activation of the proteolytic cleavage of SREBPs by reduced levels of intracellular cholesterol.

  1. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    SciTech Connect

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.

  2. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    PubMed Central

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  3. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    PubMed

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  4. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    SciTech Connect

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  5. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  6. Regulatory elements required for development of caenorhabditis elegans hermaphrodites are conserved in the tra-2 homologue of C. remanei, a male/female sister species.

    PubMed Central

    Haag, E S; Kimble, J

    2000-01-01

    The Caenorhabditis elegans hermaphrodite is essentially a female that produces sperm. In C. elegans, tra-2 promotes female fates and must be repressed to achieve hermaphrodite spermatogenesis. In an effort to learn how mating systems evolve, we have cloned tra-2 from C. remanei, the closest gonochoristic relative of C. elegans. We found its structure to be similar to that of Ce-tra-2 but its sequence to be divergent. RNA interference demonstrates that Cr-tra-2 promotes female fates. Two sites of tra-2 regulation are required for the onset of hermaphrodite spermatogenesis in C. elegans. One, the MX region of TRA-2, is as well conserved in C. remanei as it is in C. briggsae (another male/hermaphrodite species), suggesting that this control is not unique to hermaphrodites. Another, the DRE/TGE element of the tra-2 3' UTR, was not detected by sequence analysis. However, gel-shift assays demonstrate that a factor in C. remanei can bind specifically to the Cr-tra-2 3' UTR, suggesting that this translational control is also conserved. We propose that both controls are general and do not constitute a novel "switch" that enables sexual mosaicism in hermaphrodites. However, subtle quantitative or qualitative differences in their employment may underlie differences in mating system seen in Caenorhabditis. PMID:10790387

  7. Elucidation of the Regulon and cis-Acting Regulatory Element of HrpB, the AraC-Type Regulator of a Plant Pathogen-Like Type III Secretion System in Burkholderia pseudomallei▿†

    PubMed Central

    Lipscomb, Lyla; Schell, Mark A.

    2011-01-01

    The human pathogen Burkholderia pseudomallei possesses multiple type III secretion system (T3SS) gene clusters. One of these, the B. pseudomallei T3SS2 (T3SS2bp) gene cluster, which apparently plays no role in animal virulence, is also found in six additional Burkholderia spp. and is very similar to T3SSs found in phytopathogenic Xanthomonas spp. and Ralstonia solanacearum. The T3SS2bp gene cluster also encodes an AraC-type regulatory protein (HrpBbp) that is an ortholog of HrpB, the master regulator of the R. solanacearum T3SS (T3SSrso) and its secreted effectors. Transcriptome analysis showed that HrpBbp activates the expression of T3SS2bp genes, as well as their orthologs in R. solanacearum. In addition to activating T3SS2bp, HrpBbp also upregulates the expression of ∼30 additional B. pseudomallei genes, including some that may confer production of adhesive pili, a polyketide toxin, several putative T3SS2bp-secreted effectors, and components of a regulatory cascade. T3SS2bp promoter regions were found to contain a conserved DNA motif (p2bp box) identical in sequence and position to the hrpII box required for HrpB-dependent T3SSrso transcription activation. The p2bp box is also present in the promoter regions of the essentially identical T3SS found in the very closely related species Burkholderia thailandensis (T3SS2bt). Analysis of p2bp box mutants showed that it is essential for HrpBbp-mediated transcription activation in both species. Although it has been suggested that T3SS2bp and T3SS2bt may function in phytopathogenicity, we were unable to demonstrate a phytopathogenic phenotype for B. thailandensis in three different plant hosts. PMID:21335458

  8. Functional analysis of a metal response element in the regulatory region of flounder cytochrome P450 1A and implications for environmental monitoring of pollutants.

    PubMed

    Lewis, Nick A; Williams, Tim D; Chipman, James K

    2006-08-01

    Cytochrome P450 1A (CYP 1A) is a member of a multigene family of xenobiotic metabolizing enzymes. CYP 1A is highly inducible by numerous environmental contaminants including polycyclic aromatic hydrocarbons (PAHs) and is widely used in biomonitoring studies. Therefore, understanding the regulation of this gene is important for accurate interpretation of biomarker data. We describe here the functional role of a metal response element (MRE) in the European flounder CYP 1A promoter region. To help elucidate the potential role of this MRE, reporter gene constructs, with or without site-directed mutagenesis, were used in conjunction with a dual-luciferase assay. The electrophoretic mobility shift assay (EMSA) was also used to investigate potential protein binding at this MRE site. Treatment with the prototypical PAH 3-methylcholanthrene (3MC) (1.0 microM) produced a dose-dependent response at the CYP 1A promoter, whereas treatment with cadmium (0-1.0 microM) produced little transcriptional activity at either the wild-type or mutated promoter. Cotreatment with cadmium (1.0 microM) and 3MC (1.0 microM) reduced induction at this promoter to 1.83-fold compared to 3MC treatment alone (4.0-fold induction). Mutation of the MRE site resulted in abolishment of this cadmium-related loss of 3MC-dependent activity. Furthermore, a retarded band was observed in the EMSA when the MRE was used as a probe and incubated with liver nuclear protein from flounder treated with cadmium. The results not only add to knowledge of the diversity in vertebrate CYP 1A regulation but also raise the complexity of interpretation of CYP 1A induction in monitoring studies that involve mixtures of PAHs and metals.

  9. Uranium hydrogeochemical survey of well waters from an area around Pie Town, Catron County, West-Central New Mexico, including concentrations of twenty-three additional elements

    SciTech Connect

    Morgan, T.L.; George, W.E.; Hensley, W.K.; Thomas, G.J.; Langhorst, A.L.

    1980-10-01

    As part of the Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the National Uranium Resource Evaluation (NURE) sponsored by the US Department of Energy (DOE), the Los Alamos Scientific Laboratory (LASL) conducted a detailed hydrogeochemical survey of well waters in a 4250-km/sup 2/ area near Pie Town in west-central New Mexico. A total of 300 well samples was collected and analyzed for uranium and 23 other elements. The results of these analyses and carbonate and bicarbonate ion concentrations are presented in the Appendixes of this report. Uranium concentrations range from below the detection limit of 0.02 parts per billion (ppB) to 293.18 ppB and average 8.71 ppB. Samples containing high levels of uranium were collected from the Largo Creek valley west of Quemado, from a small area about 6 km east of Quemado, from a small area surrounding Pie Town, and from scattered locations in the area surrounding Adams Diggings north of Pie Town. Most of the samples containing high uranium concentrations were collected from wells associated with the volcanic sedimentary facies of the Datil formation. This formation is a likely source of mobile uranium that may be precipitating in the underlying Baca formation, a known uranium host unit. Bicarbonate ion concentration, while proportional to uranium concentration in some cases, is not a strong controlling factor in the uranium concentrations in samples from this area.

  10. Maps of context-dependent putative regulatory regions and genomic signal interactions.

    PubMed

    Diamanti, Klev; Umer, Husen M; Kruczyk, Marcin; Dąbrowski, Michał J; Cavalli, Marco; Wadelius, Claes; Komorowski, Jan

    2016-11-02

    Gene transcription is regulated mainly by transcription factors (TFs). ENCODE and Roadmap Epigenomics provide global binding profiles of TFs, which can be used to identify regulatory regions. To this end we implemented a method to systematically construct cell-type and species-specific maps of regulatory regions and TF-TF interactions. We illustrated the approach by developing maps for five human cell-lines and two other species. We detected ∼144k putative regulatory regions among the human cell-lines, with the majority of them being ∼300 bp. We found ∼20k putative regulatory elements in the ENCODE heterochromatic domains suggesting a large regulatory potential in the regions presumed transcriptionally silent. Among the most significant TF interactions identified in the heterochromatic regions were CTCF and the cohesin complex, which is in agreement with previous reports. Finally, we investigated the enrichment of the obtained putative regulatory regions in the 3D chromatin domains. More than 90% of the regions were discovered in the 3D contacting domains. We found a significant enrichment of GWAS SNPs in the putative regulatory regions. These significant enrichments provide evidence that the regulatory regions play a crucial role in the genomic structural stability. Additionally, we generated maps of putative regulatory regions for prostate and colorectal cancer human cell-lines.

  11. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  12. A duplication/paracentric inversion associated with familial X-linked deafness (DFN3) suggests the presence of a regulatory element more than 400 kb upstream of the POU3F4 gene.

    PubMed

    de Kok, Y J; Merkx, G F; van der Maarel, S M; Huber, I; Malcolm, S; Ropers, H H; Cremers, F P

    1995-11-01

    X-linked deafness with stapes fixation (DFN3) is caused by mutations in the POU3F4 gene at Xq21.1. By employing pulsed field gel electrophoresis (PFGE) we identified a chromosomal aberration in the DNA of a DFN3 patient who did not show alterations in the open reading frame (ORF) of POU3F4. Southern blot analysis indicated that a DNA segment of 150 kb, located 170 kb proximal to the POU3F4 gene, was duplicated. Fluorescence in situ hybridization (FISH) analysis, PFGE, and detailed Southern analysis revealed that this duplication is part of a more complex rearrangement including a paracentric inversion involving the Xq21.1 region, and presumably the Xq21.3 region. Since at least two DFN3-associated minideletions are situated proximal to the duplicated segment, the inversion most likely disconnects the POU3F4 gene from a regulatory element which is located at a distance of at least 400 kb upstream of the POU3F4 gene.

  13. 78 FR 4506 - Self-Regulatory Organizations; Chicago Stock Exchange, Inc.; Notice of Filing and Immediate...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-22

    ... Respect to Regulatory Fees Related to the Continuing Education Regulatory Element, Certain Examinations and Central Registration Depository, Which Are Collected By the Financial Industry Regulatory...''), effective January 2, 2013, relating to certain fees for services provided by the Financial...

  14. The impact of nanosilver addition on element ions release form light-cured dental composite and compomer into 0.9% NaCl.

    PubMed

    Sokołowski, Krzysztof; Szynkowska, Małgorzata I; Pawlaczyk, Aleksandra; Łukomska-Szymańska, Monika; Sokołowski, Jerzy

    2014-01-01

    The aim of this paper was to identify and to assess in semi-quantified way the release of different ions from composite and compomer restorative materials subjected to 0.9% NaCl solution, which simulates the environment of the human body. In the present study, the number of ions (Al, Ag, Ba, Sr, Ti) released from dental fillings over time (one week, one month and 3 months), in different temperatures (23°C, 37°C) and depending on the materials applied (unmodified/modified with nanosilver) was investigated. The results suggest that nanosilver addition influences directly on the process of metal ion releasing into 0.9% NaCl solution. The increase in the number of counts of metal ions was observed in the solutions in which samples modified with nanosilver were kept. Higher amount of metal ion release was observed for composite samples rather than for compomer materials. The study revealed that in general the number of released metal ions increases with the time of storage (for metal ions: Ti, Ba, Sr) and at higher temperature (Ag, Ti, Ba). Reverse tendency observed for silver ion release versus incubation time may be caused by the process of silver adsorption, which takes place on the surface of analyzed material and test-tube walls, where samples were incubated.

  15. Additive roles of PthAs in bacterial growth and pathogenicity associated with nucleotide polymorphisms in effector-binding elements of citrus canker susceptibility genes.

    PubMed

    Abe, Valeria Yukari; Benedetti, Celso Eduardo

    2016-10-01

    Citrus canker, caused by Xanthomonas citri, affects most commercial citrus varieties. All X. citri strains possess at least one transcription activator-like effector of the PthA family that activates host disease susceptibility (S) genes. The X. citri strain 306 encodes four PthA effectors; nevertheless, only PthA4 is known to elicit cankers on citrus. As none of the PthAs act as avirulence factors on citrus, we hypothesized that PthAs 1-3 might also contribute to pathogenicity on certain hosts. Here, we show that, although PthA4 is indispensable for canker formation in six Brazilian citrus varieties, PthAs 1 and 3 contribute to canker development in 'Pera' sweet orange, but not in 'Tahiti' lemon. Deletions in two or more pthA genes reduce bacterial growth in planta more pronouncedly than single deletions, suggesting an additive role of PthAs in pathogenicity and bacterial fitness. The contribution of PthAs 1 and 3 in canker formation in 'Pera' plants does not correlate with the activation of the canker S gene, LOB1 (LATERAL ORGAN BOUNDARIES 1), but with the induction of other PthA targets, including LOB2 and citrus dioxygenase (DIOX). LOB1, LOB2 and DIOX show differential PthA-dependent expression between 'Pera' and 'Tahiti' plants that appears to be associated with nucleotide polymorphisms found at or near PthA-binding sites. We also present evidence that LOB1 activation alone is not sufficient to elicit cankers on citrus, and that DIOX acts as a canker S gene in 'Pera', but not 'Tahiti', plants. Our results suggest that the activation of multiple S genes, such as LOB1 and DIOX, is necessary for full canker development.

  16. 76 FR 6123 - Reducing Regulatory Burden

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-03

    ... regulatory program more effective and less burdensome in achieving its regulatory objectives. DATES: Written... regulatory objectives, taking into account, among other things, and to the extent practicable, the costs of... by objective scientific evidence. Additionally, the Executive Order directs agencies to consider...

  17. 78 FR 44355 - Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ... flexibility agenda. In addition, this document includes an agenda of regulatory actions the Commission expects... requirements of the Regulatory Flexibility Act and Executive Order 12866. DATES: The Commission welcomes... Secretary by July 31, 2013. ADDRESSES: Comments on the regulatory flexibility agenda should be...

  18. Oxysterol sulfation by cytosolic sulfotransferase suppresses liver X receptor/sterol regulatory element binding protein-1c signaling pathway and reduces serum and hepatic lipids in mouse models of nonalcoholic fatty liver disease.

    PubMed

    Bai, Qianming; Zhang, Xin; Xu, Leyuan; Kakiyama, Genta; Heuman, Douglas; Sanyal, Arun; Pandak, William M; Yin, Lianhua; Xie, Wen; Ren, Shunlin

    2012-06-01

    Cytosolic sulfotransferase (SULT2B1b) catalyzes oxysterol sulfation. 5-Cholesten-3β-25-diol-3-sulfate (25HC3S), one product of this reaction, decreases intracellular lipids in vitro by suppressing liver X receptor/sterol regulatory element binding protein (SREBP)-1c signaling, with regulatory properties opposite to those of its precursor 25-hydroxycholesterol. Upregulation of SULT2B1b may be an effective strategy to treat hyperlipidemia and hepatic steatosis. The objective of the study was to explore the effect and mechanism of oxysterol sulfation by SULT2B1b on lipid metabolism in vivo. C57BL/6 and LDLR(-/-) mice were fed with high-cholesterol diet or high-fat diet for 10 weeks and infected with adenovirus encoding SULT2B1b. SULT2B1b expressions in different tissues were determined by immunohistochemistry and Western blot. Sulfated oxysterols in liver were analyzed by high-pressure liquid chromatography. Serum and hepatic lipid levels were determined by kit reagents and hematoxylin and eosin staining. Gene expressions were determined by real-time reverse transcriptase polymerase chain reaction and Western Blot. Following infection, SULT2B1b was successfully overexpressed in the liver, aorta, and lung tissues, but not in the heart or kidney. SULT2B1b overexpression, combined with administration of 25-hydroxycholesterol, significantly increased the formation of 25HC3S in liver tissue and significantly decreased serum and hepatic lipid levels, including triglycerides, total cholesterol, free cholesterol, and free fatty acids, as compared with controls in both C57BL/6 and LDLR(-/-) mice. Gene expression analysis showed that increases in SULT2B1b expression were accompanied by reduction in key regulators and enzymes involved in lipid metabolism, including liver X receptor α, SREBP-1, SREBP-2, acetyl-CoA carboxylase-1, and fatty acid synthase. These findings support the hypothesis that 25HC3S is an important endogenous regulator of lipid biosynthesis.

  19. The impact of transposable elements on mammalian development.

    PubMed

    Garcia-Perez, Jose L; Widmann, Thomas J; Adams, Ian R

    2016-11-15

    Despite often being classified as selfish or junk DNA, transposable elements (TEs) are a group of abundant genetic sequences that have a significant impact on mammalian development and genome regulation. In recent years, our understanding of how pre-existing TEs affect genome architecture, gene regulatory networks and protein function during mammalian embryogenesis has dramatically expanded. In addition, the mobilization of active TEs in selected cell types has been shown to generate genetic variation during development and in fully differentiated tissues. Importantly, the ongoing domestication and evolution of TEs appears to provide a rich source of regulatory elements, functional modules and genetic variation that fuels the evolution of mammalian developmental processes. Here, we review the functional impact that TEs exert on mammalian developmental processes and discuss how the somatic activity of TEs can influence gene regulatory networks.

  20. Identification of a negative regulatory cis-element in the enhancer core region of the prostate-specific antigen promoter: implications for intersection of androgen receptor and nuclear factor-kappaB signalling in prostate cancer cells.

    PubMed Central

    Cinar, Bekir; Yeung, Fan; Konaka, Hiroyuki; Mayo, Marty W; Freeman, Michael R; Zhau, Haiyen E; Chung, Leland W K

    2004-01-01

    The NF-kappaB (nuclear factor-kappaB) transcription factors mediate activation of a large number of gene promoters containing diverse kappaB-site sequences. Here, PSA (prostate-specific antigen) was used as an AR (androgen receptor)-responsive gene to examine the underlying mechanism by which the NF-kappaB p65 transcription factor down-regulates the transcriptional activity of AR in cells. We observed that activation of NF-kappaB by TNFalpha (tumour necrosis factor alpha) inhibited both basal and androgen-stimulated PSA expression, and that this down-regulation occurred at the promoter level, as confirmed by the super-repressor IkappaBalpha (S32A/S36A), a dominant negative inhibitor of NF-kappaB. Using a linker-scanning mutagenesis approach, we identified a cis -element, designated XBE (X-factor-binding element), in the AREc (androgen response element enhancer core) of the PSA promoter, which negatively regulated several AR-responsive promoters, including that of PSA. When three copies of XBE in tandem were juxtaposed to GRE4 (glucocorticoid response element 4), a 4-6-fold reduction of inducible GRE4 activity was detected in three different cell lines, LNCaP, ARCaP-AR and PC3-AR. Bioinformatics and molecular biochemical studies indicated that XBE is a kappaB-like element that binds specifically to the NF-kappaB p65 subunit; consistent with these observations, only NF-kappaB p65, but not the NF-kappaB p50 subunit, was capable of inhibiting AR-mediated PSA promoter transactivation in LNCaP cells. In addition, our data also showed that AR binds to XBE, as well as to the kappaB consensus site, and that the transfection of AR inhibits the kappaB-responsive promoter in transient co-transfection assays. Collectively, these data indicate that cross-modulation between AR and NF-kappaB p65 transcription factors may occur by a novel mechanism involving binding to a common cis -DNA element. PMID:14715080

  1. Dysregulation of sterol regulatory element binding protein-1c in livers of morbidly obese women is associated with altered suppressor of cytokine signaling-3 and signal transducer and activator of transcription-1 signaling.

    PubMed

    Elam, Marshall B; Yellaturu, Chandrahasa; Howell, George E; Deng, Xiong; Cowan, George S; Kumar, Poonam; Park, Edwards A; Hiler, M Lloyd; Wilcox, Henry G; Hughes, Thomas A; Cook, George A; Raghow, Rajendra

    2010-04-01

    We compared hepatic expression of genes that regulate lipid biosynthesis and metabolic signaling in liver biopsy specimens from women who were undergoing gastric bypass surgery (GBP) for morbid obesity with that in women undergoing ventral hernia repair who had experienced massive weight loss (MWL) after prior GBP. Comprehensive metabolic profiles of morbidly obese (MO) (22 subjects) and MWL (9 subjects) were also compared. Analyses of gene expression in liver biopsies from MO and MWL were accomplished by Affymetrix microarray, real-time polymerase chain reaction, and Western blotting techniques. After GBP, MWL subjects had lost on average 102 lb as compared with MO subjects. This was accompanied by effective reversal of the dyslipidemia and insulin resistance that were present in MO. As compared with MWL, livers of MO subjects exhibited increased expression of sterol regulatory element binding protein (SREBP)-1c and its downstream lipogenic targets, fatty acid synthase and acetyl-coenzyme A-carboxylase-1. Livers of MO subjects also exhibited enhanced expression of suppressor of cytokine signaling-3 protein and attenuated Janus kinase signal transducer and activator of transcription (JAK/STAT) signaling. Consistent with these findings, we found that the human SREBP-1c promoter was positively regulated by insulin and negatively regulated by STAT3. These data support the hypothesis that suppressor of cytokine signaling-3-mediated attenuation of the STAT signaling pathway and resulting enhanced expression of SREBP-1c, a key regulator of de novo lipid biosynthesis, are mechanistically related to the development of hepatic insulin resistance and dyslipidemia in MO women.

  2. SREBP2 Activation Induces Hepatic Long-chain Acyl-CoA Synthetase 1 (ACSL1) Expression in Vivo and in Vitro through a Sterol Regulatory Element (SRE) Motif of the ACSL1 C-promoter.

    PubMed

    Singh, Amar Bahadur; Kan, Chin Fung Kelvin; Dong, Bin; Liu, Jingwen

    2016-03-04

    Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism. To identify novel transcriptional modulators of ACSL1, we examined ACSL1 expression in liver tissues of hamsters fed a normal diet, a high fat diet, or a high cholesterol and high fat diet (HCHFD). Feeding hamsters HCHFD markedly reduced hepatic Acsl1 mRNA and protein levels as well as acyl-CoA synthetase activity. Decreases in Acsl1 expression strongly correlated with reductions in hepatic Srebp2 mRNA level and mature Srebp2 protein abundance. Conversely, administration of rosuvastatin (RSV) to hamsters increased hepatic Acsl1 expression. These new findings were reproduced in mice treated with RSV or fed the HCHFD. Furthermore, the RSV induction of acyl-CoA activity in mouse liver resulted in increases in plasma and hepatic cholesterol ester concentrations and reductions in free cholesterol amounts. Investigations on different ACSL1 transcript variants in HepG2 cells revealed that the mRNA expression of C-ACSL1 was specifically regulated by the sterol regulatory element (SRE)-binding protein (SREBP) pathway, and RSV treatment increased the C-ACSL1 abundance from a minor mRNA species to an abundant transcript. We analyzed 5'-flanking sequence of exon 1C of the human ACSL1 gene and identified one putative SRE site. By performing a promoter activity assay and DNA binding assays, we firmly demonstrated the key role of this SRE motif in SREBP2-mediated activation of C-ACSL1 gene transcription. Finally, we demonstrated that knockdown of endogenous SREBP2 in HepG2 cells lowered ACSL1 mRNA and protein levels. Altogether, this work discovered an unprecedented link between ACSL1 and SREBP2 via the specific regulation of the C-ACSL1 transcript.

  3. Berberine-improved visceral white adipose tissue insulin resistance associated with altered sterol regulatory element-binding proteins, liver x receptors, and peroxisome proliferator-activated receptors transcriptional programs in diabetic hamsters.

    PubMed

    Li, Guo-Sheng; Liu, Xu-Han; Zhu, Hua; Huang, Lan; Liu, Ya-Li; Ma, Chun-Mei; Qin, Chuan

    2011-01-01

    The diabetic "lipotoxicity" hypothesis presents that fat-induced visceral white adipose tissue insulin resistance plays a central role in the pathogenesis of type 2 diabetes. Berberine, a hypolipidemic agent, has been reported to have antidiabetic activities. The molecular mechanisms for this property are, however, not well clarified. Therefore in this study type 2 diabetic hamsters were induced by high-fat diet with low-dose streptozotocin. Then, we investigated the gene expression alterations and explored the molecular mechanisms underlying the therapeutic effect of berberine on fat-induced visceral white adipose tissue insulin resistance in diabetic hamsters by microarray analysis followed by real-time reverse transcription-polymerase chain reaction (RT-PCR) confirmation. Type 2 diabetic hamsters exhibited hyperglycemia and relative hyperinsulinemia, glucose intolerance, insulin resistance, intra-adipocyte lipid accumulation, significant increase in body weight and visceral white adipose tissue weight, abnormal serum adipokines levels, and deleterious dyslipidemia. Furthermore, they had increased sterol regulatory element-binding proteins (SREBPs) expression and decreased liver X receptors (LXRs) and peroxisome proliferator-activated receptors (PPARs) expression in visceral white adipose tissue. After 9-week berberine treatment, fat-induced insulin resistance and diabetic phenotype in type 2 diabetic hamsters were significantly improved. Compared with diabetic hamsters, expression of LXRs and PPARs significantly increased and SREBPs significantly decreased in visceral white adipose tissue from berberine-treated diabetic hamsters. These results suggest that altered visceral white adipose tissue LXRs, PPARs, and SREBPs transcriptional programs are involved in the therapeutic mechanisms of berberine on fat-induced visceral white adipose tissue insulin resistance in type 2 diabetic hamsters.

  4. SREBP2 Activation Induces Hepatic Long-chain Acyl-CoA Synthetase 1 (ACSL1) Expression in Vivo and in Vitro through a Sterol Regulatory Element (SRE) Motif of the ACSL1 C-promoter*

    PubMed Central

    Singh, Amar Bahadur; Kan, Chin Fung Kelvin; Dong, Bin; Liu, Jingwen

    2016-01-01

    Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism. To identify novel transcriptional modulators of ACSL1, we examined ACSL1 expression in liver tissues of hamsters fed a normal diet, a high fat diet, or a high cholesterol and high fat diet (HCHFD). Feeding hamsters HCHFD markedly reduced hepatic Acsl1 mRNA and protein levels as well as acyl-CoA synthetase activity. Decreases in Acsl1 expression strongly correlated with reductions in hepatic Srebp2 mRNA level and mature Srebp2 protein abundance. Conversely, administration of rosuvastatin (RSV) to hamsters increased hepatic Acsl1 expression. These new findings were reproduced in mice treated with RSV or fed the HCHFD. Furthermore, the RSV induction of acyl-CoA activity in mouse liver resulted in increases in plasma and hepatic cholesterol ester concentrations and reductions in free cholesterol amounts. Investigations on different ACSL1 transcript variants in HepG2 cells revealed that the mRNA expression of C-ACSL1 was specifically regulated by the sterol regulatory element (SRE)-binding protein (SREBP) pathway, and RSV treatment increased the C-ACSL1 abundance from a minor mRNA species to an abundant transcript. We analyzed 5′-flanking sequence of exon 1C of the human ACSL1 gene and identified one putative SRE site. By performing a promoter activity assay and DNA binding assays, we firmly demonstrated the key role of this SRE motif in SREBP2-mediated activation of C-ACSL1 gene transcription. Finally, we demonstrated that knockdown of endogenous SREBP2 in HepG2 cells lowered ACSL1 mRNA and protein levels. Altogether, this work discovered an unprecedented link between ACSL1 and SREBP2 via the specific regulation of the C-ACSL1 transcript. PMID:26728456

  5. Regulatory Forum.

    PubMed

    Peden, W Michael

    2016-12-01

    Revision of the International Council for Harmonization (ICH) S1 guidance for rat carcinogenicity studies to be more selective of compounds requiring a 2-year rat carcinogenicity study has been proposed following extensive evaluation of rat carcinogenicity and chronic toxicity studies by industry and drug regulatory authorities. To inform the ICH S1 expert working group in their potential revision of ICH S1, a prospective evaluation study was initiated in 2013, in which sponsors would assess the pharmacologic and toxicologic findings present in the chronic toxicity studies and predict a positive or negative carcinogenicity outcome using a weight of evidence argument (a carcinogenicity assessment document [CAD]). The Scientific and Regulatory Policy Committee was asked by the Society of Toxicology Pathology (STP) executive committee to track these changes with ICH S1 and inform the STP membership of status changes. This commentary is intended to provide a brief summary of recent changes to the CAD guidance and highlight the importance of STP membership participation in the process of CAD submissions.

  6. Regulatory facility guide for Ohio

    SciTech Connect

    Anderson, S.S.; Bock, R.E.; Francis, M.W.; Gove, R.M.; Johnson, P.E.; Kovac, F.M.; Mynatt, J.O.; Rymer, A.C.

    1994-02-28

    The Regulatory Facility Guide (RFG) has been developed for the DOE and contractor facilities located in the state of Ohio. It provides detailed compilations of international, federal, and state transportation-related regulations applicable to shipments originating at destined to Ohio facilities. This RFG was developed as an additional resource tool for use both by traffic managers who must ensure that