Sample records for additional regulatory mechanism

  1. Selection of color additives: a regulatory view.


    Kumar, Anuj; Dureja, Harish; Madan, Anil K


    Color additives have a unique place in the categories of the excipients. However, most of the color additives are complex heterogeneous organic compounds. In pharmaceuticals, colors are used in various oral (solid, liquid) and topical dosage form. Different regulatory authorities have their own specific set of regulation for registration, approval, and control of color additives. However, at this time of globalization, selection of appropriate color is not an easy task when a company wants to sale its product in many countries. In this article, the authors have explored various important factors which should be considered in the selection of color additives.

  2. Regulatory Mechanisms of Hsp90

    PubMed Central

    Prodromou, Chrisostomos


    The ability of Hsp90 to activate a disparate clientele implicates this chaperone in diverse biological processes. To accommodate such varied roles, Hsp90 requires a variety of regulatory mechanisms that are coordinated in order to modulate its activity appropriately. Amongst these, the master-regulator heat shock factor 1 (HSF1) is critically important in upregulating Hsp90 during stress, but is also responsible, through interaction with specific transcription factors (such as STAT1 and Strap/p300) for the integration of a variety of biological signals that ultimately modulate Hsp90 expression. Additionally, transcription factors, such as STAT1, STAT3 (including STAT1-STAT3 oligomers), NF-IL6, and NF-kB, are known to influence Hsp90 expression directly. Co-chaperones offer another mechanism for Hsp90 regulation, and these can modulate the chaperone cycle appropriately for specific clientele. Co-chaperones include those that deliver specific clients to Hsp90, and others that regulate the chaperone cycle for specific Hsp90-client complexes by modulating Hsp90s ATPase activity. Finally, post-translational modification (PTM) of Hsp90 and its co-chaperones helps too further regulate the variety of different Hsp90 complexes found in cells. PMID:28289734

  3. IA channels: diverse regulatory mechanisms.


    Carrasquillo, Yarimar; Nerbonne, Jeanne M


    In many peripheral and central neurons, A-type K(+) currents, IA, have been identified and shown to be key determinants in shaping action potential waveforms and repetitive firing properties, as well as in the regulation of synaptic transmission and synaptic plasticity. The functional properties and physiological roles of native neuronal IA, however, have been shown to be quite diverse in different types of neurons. Accumulating evidence suggests that this functional diversity is generated by multiple mechanisms, including the expression and subcellular distributions of IA channels encoded by different voltage-gated K(+) (Kv) channel pore-forming (α) subunits, interactions of Kv α subunits with cytosolic and/or transmembrane accessory subunits and regulatory proteins and post-translational modifications of channel subunits. Several recent reports further suggest that local protein translation in the dendrites of neurons and interactions between IA channels with other types of voltage-gated ion channels further expands the functional diversity of native neuronal IA channels. Here, we review the diverse molecular mechanisms that have been shown or proposed to underlie the functional diversity of native neuronal IA channels.

  4. Mechanisms of T regulatory cell function.


    Askenasy, Nadir; Kaminitz, Ayelet; Yarkoni, Shai


    Regulatory T cells (Treg) play a pivotal role in tolerance to self-antigens and tissue grafts, and suppression of autoimmune reactions. These cells modulate the intensity and quality of immune reactions through attenuation of the cytolytic activities of reactive immune cells. Treg cells operate primarily at the site of inflammation where they modulate the immune reaction through three major mechanisms: a) direct killing of cytotoxic cells through cell-to-cell contact, b) inhibition of cytokine production by cytotoxic cells, in particular interleukin-2, c) direct secretion of immunomodulatory cytokines, in particular TGF-beta and interleukin-10. In addition to differential contributions of these mechanisms under variable inflammatory conditions, mechanistic complexity and diversity evolves from the diverse tasks performed by various Treg cell subsets in different stages of the immune reaction. Here we attempt to integrate the current experimental evidence to delineate the major suppressive pathways of Treg cells.

  5. Comparative studies of gene regulatory mechanisms.


    Pai, Athma A; Gilad, Yoav


    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution.

  6. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.


    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  7. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario


    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  8. Additive functions in boolean models of gene regulatory network modules.


    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario


    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  9. Regulatory mechanisms link phenotypic plasticity to evolvability.


    van Gestel, Jordi; Weissing, Franz J


    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations.

  10. Iron and ageing: an introduction to iron regulatory mechanisms.


    Levenson, Cathy W; Tassabehji, Nadine M


    While there have been significant advances made in our understanding of the cellular and molecular mechanisms that regulate iron absorption, transport, storage, and utilization, the effect of ageing on these mechanisms and the role of iron in the ageing process is not fully understood. Thus, this review will provide an overview of the iron regulatory mechanisms that may be a factor in the ageing process. Additional reviews in this volume represent an attempt to explore the very latest information on the regulation of iron with a particular emphasis on age-related pathology including mitochondrial function, Parkinson's disease, Alzheimer's disease, stroke, and cardiovascular disease.

  11. Major regulatory mechanisms involved in sperm motility.


    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário


    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies.

  12. Major regulatory mechanisms involved in sperm motility

    PubMed Central

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário


    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies. PMID:26680031

  13. Multiphoton imaging of renal regulatory mechanisms.


    Peti-Peterdi, János; Toma, Ildikó; Sipos, Arnold; Vargas, Sarah L


    Most physiological functions of the kidneys, including the clearance of metabolic waste products, maintenance of body fluid, electrolyte homeostasis, and blood pressure, are achieved by complex interactions between multiple renal cell types and previously inaccessible structures in many organ parts that have been difficult to study. Multiphoton fluorescence microscopy offers a state-of-the-art imaging technique for deep optical sectioning of living tissues and organs with minimal deleterious effects. Dynamic regulatory processes and multiple functions in the intact kidney can be quantitatively visualized in real time, noninvasively, and with submicron resolution. This article reviews innovative multiphoton imaging technologies and their applications that provided the most complex, immediate, and dynamic portrayal of renal function-clearly depicting as well as analyzing the components and mechanisms involved in renal (patho)physiology.

  14. Regulatory network reconstruction using an integral additive model with flexible kernel functions

    PubMed Central

    Novikov, Eugene; Barillot, Emmanuel


    Background Reconstruction of regulatory networks is one of the most challenging tasks of systems biology. A limited amount of experimental data and little prior knowledge make the problem difficult to solve. Although models that are currently used for inferring regulatory networks are sometimes able to make useful predictions about the structures and mechanisms of molecular interactions, there is still a strong demand to develop increasingly universal and accurate approaches for network reconstruction. Results The additive regulation model is represented by a set of differential equations and is frequently used for network inference from time series data. Here we generalize this model by converting differential equations into integral equations with adjustable kernel functions. These kernel functions can be selected based on prior knowledge or defined through iterative improvement in data analysis. This makes the integral model very flexible and thus capable of covering a broad range of biological systems more adequately and specifically than previous models. Conclusion We reconstructed network structures from artificial and real experimental data using differential and integral inference models. The artificial data were simulated using mathematical models implemented in JDesigner. The real data were publicly available yeast cell cycle microarray time series. The integral model outperformed the differential one for all cases. In the integral model, we tested the zero-degree polynomial and single exponential kernels. Further improvements could be expected if the kernel were selected more specifically depending on the system. PMID:18218091

  15. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine


    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  16. Gene regulatory networks elucidating Huanglongbing disease mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional...

  17. Mechanisms of Regulatory B cell Function in Autoimmune and Inflammatory Diseases beyond IL-10

    PubMed Central

    Ray, Avijit; Dittel, Bonnie N.


    In the past two decades it has become clear that in addition to antigen presentation and antibody production B cells play prominent roles in immune regulation. While B cell-derived IL-10 has garnered much attention, B cells also effectively regulate inflammation by a variety of IL-10-independent mechanisms. B cell regulation has been studied in both autoimmune and inflammatory diseases. While collectively called regulatory B cells (Breg), no definitive phenotype has emerged for B cells with regulatory potential. This has made their study challenging and thus unique B cell regulatory mechanisms have emerged in a disease-dependent manner. Thus to harness the therapeutic potential of Breg, further studies are needed to understand how they emerge and are induced to evoke their regulatory activities. PMID:28124981

  18. The regulatory compliance plan for the Minimum Additive Waste Stabilization (MAWS) Program

    SciTech Connect

    Akgunduz, N.K.; Gimpel, R.F.; Finger, S.M.


    The Fernald Environmental Management Project (FEMP) has initiated the Minimum Additive Waste Stabilization (MAWS) Program to demonstrate and evaluate integrated treatment of the FEMP site`s Operable Unit 1 contaminated soils and sludges. The demonstration will require on-site operation of an integrated treatment system consisting of soil washing, water treatment by ion exchange, and vitrification of all contaminated solid wastes at a rate of 300 kg per day. Compliance with all relevant environmental regulations is a major priority of this program. Relevant regulatory requirements come under the jurisdiction of the US Environmental Protection Agency (US EPA), the Ohio Environmental Protection Agency (Ohio EPA), and the Department of Energy (DOE). The plethora of potentially applicable regulations were reviewed and an efficient regulatory compliance strategy developed. This strategy was documented in the MAWS Regulatory Compliance Plan which was presented to the regulatory agencies as a reasonable working plan. The FEMP has found the development of a comprehensive, organized regulatory plan to be critical to the successful implementation of integrated demonstration projects such as the MAWS Program. This paper discusses the approaches used in the MAWS Regulatory Compliance Plan and highlights which could prove useful for others that want to approach the DOE and/or EPA with technology demonstrations.

  19. Naturally occurring regulatory T cells: markers, mechanisms, and manipulation.


    Schmetterer, Klaus G; Neunkirchner, Alina; Pickl, Winfried F


    Naturally occurring CD4(+)CD25(high) forkhead box protein 3 (FOXP3)(+) regulatory T cells (nTregs) are key mediators of immunity, which orchestrate and maintain tolerance to self and foreign antigens. In the recent 1.5 decades, a multitude of studies have aimed to define the phenotype and function of nTregs and to assess their therapeutic potential for modulating immune mediated disorders such as autoimmunity, allergy, and episodes of transplant rejection. In this review, we summarize the current knowledge on the biology of nTregs. We address the exact definition of nTregs by specific markers and combinations thereof, which is a prerequisite for the state-of-the-art isolation of defined nTreg populations. Furthermore, we discuss the mechanism by which nTregs mediate immunosuppression and how this knowledge might translate into novel therapeutic modalities. With first clinical studies of nTreg-based therapies being finished, questions concerning the reliable sources of nTregs are becoming more and more eminent. Consequently, approaches allowing conversion of CD4(+) T cells into nTregs by coculture with antigen-presenting cells, cytokines, and/or pharmacological agents are discussed. In addition, genetic engineering approaches for the generation of antigen-specific nTregs are described.

  20. Regulatory mechanisms underlying the differential growth of dendrites and axons.


    Wang, Xin; Sterne, Gabriella R; Ye, Bing


    A typical neuron is comprised of an information input compartment, or the dendrites, and an output compartment, known as the axon. These two compartments are the structural basis for functional neural circuits. However, little is known about how dendritic and axonal growth are differentially regulated. Recent studies have uncovered two distinct types of regulatory mechanisms that differentiate dendritic and axonal growth: dedicated mechanisms and bimodal mechanisms. Dedicated mechanisms regulate either dendritespecific or axon-specific growth; in contrast, bimodal mechanisms direct dendritic and axonal development in opposite manners. Here, we review the dedicated and bimodal regulators identified by recent Drosophila and mammalian studies. The knowledge of these underlying molecular mechanisms not only expands our understanding about how neural circuits are wired, but also provides insights that will aid in the rational design of therapies for neurological diseases.

  1. Secretory pattern and regulatory mechanism of growth hormone in cattle

    PubMed Central


    Abstract The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  2. Secretory pattern and regulatory mechanism of growth hormone in cattle.


    Kasuya, Etsuko


    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings.

  3. Gene regulatory network inference using out of equilibrium statistical mechanics

    PubMed Central

    Benecke, Arndt


    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem. PMID:19404429

  4. Sociocognitive self-regulatory mechanisms governing transgressive behavior.


    Bandura, A; Caprara, G V; Barbaranelli, C; Pastorelli, C; Regalia, C


    This longitudinal research examined a structural model of the self-regulatory mechanisms governing transgressive conduct. Perceived academic and self-regulatory efficacy concurrently and longitudinally deterred transgressiveness both directly and by fostering prosocialness and adherence to moral self-sanctions for harmful conduct. The impact of perceived social self-efficacy was mediated through prosocialness. Moral disengagement and prosocialness affected transgressiveness through the mediating influence of irascible affectivity and hostile rumination. Ruminative affectivity, in turn, both concurrently and longitudinally affected transgressiveness. Moral disengagement also contributed independently to variance in transgressiveness over time. This pattern of relations was obtained after controlling for prior transgressiveness. The structural model was replicated across gender and provided a better fit to the data than did several alternative models.

  5. Oblique view of east side mechanical additions and south side ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique view of east side mechanical additions and south side of 1955 addition, facing northwest. - Albrook Air Force Station, Dispensary, East side of Canfield Avenue, Balboa, Former Panama Canal Zone, CZ

  6. Regulatory mechanisms of EGFR signalling during Drosophila eye development.


    Malartre, Marianne


    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  7. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.


    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang


    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms.

  8. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang


    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  9. Toxin-mediated gene regulatory mechanism in Staphylococcus aureus

    PubMed Central

    Joo, Hwang-Soo; Otto, Michael


    The dangerous human pathogen Staphylococcus aureus relies heavily on toxins to cause disease, but toxin production can put a strong burden on the bacteria’s energy balance. Thus, controlling the synthesis of proteins solely needed in times of toxin production represents a way for the bacteria to avoid wasting energy. One hypothetical manner to accomplish this sort of regulation is by gene regulatory functions of the toxins themselves. There have been several reports about gene regulation by toxins in S. aureus, but these were never verified on the molecular level. In our study published in MBio [Joo et al., 7(5). pii: e01579-16], we show that phenol-soluble modulins (PSMs), important peptide toxins of S. aureus, release a repressor from the promoter of the operon encoding the toxin export system, thereby enabling toxin secretion. This study describes the first molecular regulatory mechanism exerted by an S. aureus toxin, setting a paradigmatic example of how S. aureus toxins may influence cell functions to adjust them to times of toxin production.

  10. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.


    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  11. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.


    Rødkaer, Steven V; Faergeman, Nils J


    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  12. Restricted autoantigen recognition associated with deletional and adaptive regulatory mechanisms.


    Gebe, John A; Yue, Betty B; Unrath, Kelly A; Falk, Ben A; Nepom, Gerald T


    Autoimmune diabetes (T1D) is characterized by CD4(+) T cell reactivity to a variety of islet-associated Ags. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. To study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TCR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57BL/6-derived "diabetes-resistant" background. Both TCR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65(555-567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self Ag associated with T1D. Although both TCR use the identical Valpha and Vbeta genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TCR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their Ag responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10-secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TCR recognition profile.

  13. Plants with genetically modified events combined by conventional breeding: an assessment of the need for additional regulatory data.


    Pilacinski, W; Crawford, A; Downey, R; Harvey, B; Huber, S; Hunst, P; Lahman, L K; MacIntosh, S; Pohl, M; Rickard, C; Tagliani, L; Weber, N


    Crop varieties with multiple GM events combined by conventional breeding have become important in global agriculture. The regulatory requirements in different countries for such products vary considerably, placing an additional burden on regulatory agencies in countries where the submission of additional data is required and delaying the introduction of innovative products to meet agricultural needs. The process of conventional plant breeding has predictably provided safe food and feed products both historically and in the modern era of plant breeding. Thus, previously approved GM events that have been combined by conventional plant breeding and contain GM traits that are not likely to interact in a manner affecting safety should be considered to be as safe as their conventional counterparts. Such combined GM event crop varieties should require little, if any, additional regulatory data to meet regulatory requirements.

  14. Regulatory mechanisms of growth hormone secretion are sexually dimorphic.

    PubMed Central

    Jaffe, C A; Ocampo-Lim, B; Guo, W; Krueger, K; Sugahara, I; DeMott-Friberg, R; Bermann, M; Barkan, A L


    Sexually dimorphic growth hormone (GH) secretory pattern is important in the determination of gender-specific patterns of growth and metabolism in rats. Whether GH secretion in humans is also sexually dimorphic and the neuroendocrine mechanisms governing this potential difference are not fully established. We have compared pulsatile GH secretion profiles in young men and women in the baseline state and during a continuous intravenous infusion of recombinant human insulin-like growth factor I (rhIGF-I). During the baseline study, men had large nocturnal GH pulses and relatively small pulses during the rest of the day. In contrast, women had more continuous GH secretion and more frequent GH pulses that were of more uniform size. The infusion of rhIGF-I (10 microg/kg/h) potently suppressed both spontaneous and growth hormone-releasing hormone (GHRH)-induced GH secretion in men. In women, however, rhIGF-I had less effect on pulsatile GH secretion and did not suppress the GH response to GHRH. These data demonstrate the existence of sexual dimorphism in the regulatory mechanisms involved in GH secretion in humans. The persistence of GH responses to GHRH in women suggests that negative feedback by IGF-I might be expressed, in part, through suppression of hypothalamic GHRH. PMID:9649569

  15. Mechanical Properties of Iron Alumininides Intermetallic Alloy with Molybdenum Addition

    SciTech Connect

    Zuhailawati, H.; Fauzi, M. N. A.


    In this work, FeAl-based alloys with and without molybdenum addition were fabricated by sintering of mechanically alloyed powders in order to investigate the effect of molybdenum on iron aluminide mechanical properties. Bulk samples were prepared by mechanical alloying for 4 hours, pressing at 360 MPa and sintering at 1000 deg. C for 2 hours. The specimens were tested in compression at room temperature using Instron machine. The phase identification and microstructure of the consolidated material was examined by x-ray diffraction and scanning electron microscope correspondingly. Results show that 2.5 wt%Mo addition significantly increased the ultimate stress and ultimate strain in compressive mode due to solid solution hardening. However, the addition of Mo more than 2.5 wt% was accompanied by a reduction in both properties caused by the presence of Mo-rich precipitate particles.

  16. Metal Additive Manufacturing: A Review of Mechanical Properties

    NASA Astrophysics Data System (ADS)

    Lewandowski, John J.; Seifi, Mohsen


    This article reviews published data on the mechanical properties of additively manufactured metallic materials. The additive manufacturing techniques utilized to generate samples covered in this review include powder bed fusion (e.g., EBM, SLM, DMLS) and directed energy deposition (e.g., LENS, EBF3). Although only a limited number of metallic alloy systems are currently available for additive manufacturing (e.g., Ti-6Al-4V, TiAl, stainless steel, Inconel 625/718, and Al-Si-10Mg), the bulk of the published mechanical properties information has been generated on Ti-6Al-4V. However, summary tables for published mechanical properties and/or key figures are included for each of the alloys listed above, grouped by the additive technique used to generate the data. Published values for mechanical properties obtained from hardness, tension/compression, fracture toughness, fatigue crack growth, and high cycle fatigue are included for as-built, heat-treated, and/or HIP conditions, when available. The effects of test orientation/build direction on properties, when available, are also provided, along with discussion of the potential source(s) (e.g., texture, microstructure changes, defects) of anisotropy in properties. Recommendations for additional work are also provided.

  17. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing

    PubMed Central

    Luecke, William E; Slotwinski, John A


    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands. PMID:26601037

  18. Mechanical Properties of Austenitic Stainless Steel Made by Additive Manufacturing.


    Luecke, William E; Slotwinski, John A


    Using uniaxial tensile and hardness testing, we evaluated the variability and anisotropy of the mechanical properties of an austenitic stainless steel, UNS S17400, manufactured by an additive process, selective laser melting. Like wrought materials, the mechanical properties depend on the orientation introduced by the processing. The recommended stress-relief heat treatment increases the tensile strength, reduces the yield strength, and decreases the extent of the discontinuous yielding. The mechanical properties, assessed by hardness, are very uniform across the build plate, but the stress-relief heat treatment introduced a small non-uniformity that had no correlation to position on the build plate. Analysis of the mechanical property behavior resulted in four conclusions. (1) The within-build and build-to-build tensile properties of the UNS S17400 stainless steel are less repeatable than mature engineering structural alloys, but similar to other structural alloys made by additive manufacturing. (2) The anisotropy of the mechanical properties of the UNS S17400 material of this study is larger than that of mature structural alloys, but is similar to other structural alloys made by additive manufacturing. (3) The tensile mechanical properties of the UNS S17400 material fabricated by selective laser melting are very different from those of wrought, heat-treated 17-4PH stainless steel. (4) The large discontinuous yielding strain in all tests resulted from the formation and propagation of Lüders bands.

  19. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin


    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  20. [Requirements for drug approval and additional benefits assessment: Regulatory aspects and experiences].


    Broich, K; Löbker, W; Schulte, A; Beinlich, P; Müller, T


    The early assessment of benefits of newly approved drugs with novel active substances or new applications, which came into force on 1 January 2011 still represents a challenge to all parties involved. This article highlights the definitions, regulatory requirements and interaction between drug marketing approval and early assessment of benefits in Germany. The constellation of an extensively harmonized European and even international drug authorization process with a predominantly national regulation of drug reimbursement situation inevitably causes friction, which could be markedly reduced through early joint advisory discussions during the planning phase for pivotal clinical trials. During the year 2015 the Federal Institute for Drugs and Medical Devices (BfArM) carried out 300 scientific advice procedures of which 34 were concerned with applications in the field of indications for the central nervous system (CNS). In comparison 98 advisory meetings were held by the Federal Joint Committee (G-BA) of which the BfArM provided advice in 12 instances and in 2 cases on CNS indications. Study design, endpoints and appropriate comparative therapies are the key issues in exchanges and discussions between the BfArM, the G‑BA and applicants. Under these aspects the BfArM and G‑BA promote an early and consistent involvement in early advice procedures regarding the prerequisites for drug approval and assessment of additional benefits.

  1. Regulatory and pathogenic mechanisms in human autoimmune myasthenia gravis.


    Le Panse, Rozen; Cizeron-Clairac, Géraldine; Cuvelier, Mélinée; Truffault, Frédérique; Bismuth, Jacky; Nancy, Patrice; De Rosbo, Nicole Kerlero; Berrih-Aknin, Sonia


    The thymus is frequently hyperplastic in young female myasthenia gravis (MG) patients presenting with anti-acetylcholine receptor (AChR) antibodies. This thymic pathology is characterized by the presence of ectopic germinal centers (GCs) containing B cells involved at least partially in the production of pathogenic anti-AChR antibodies. Our recent studies have furthered our understanding of the mechanisms leading to GC formation in the hyperplastic thymus. First, we showed that CXCL13 and CCL21, chemokines involved in GC formation, are overexpressed in MG thymus. Second, we demonstrated an increase in pro-inflammatory activity in the thymus from MG patients and its partial normalization by glucocorticoids, as evidenced by gene expression profile. Third, we found that pro-inflammatory cytokines are able to upregulate the expression of AChR subunits in thymic epithelial and myoid cells. Fourth, we showed that the function of T regulatory (Treg) cells, whose role is to downregulate the immune response, is severely impaired in the thymus of MG patients; such a defect could explain the chronic immune activation observed consistently in MG thymic hyperplasia. Altogether, these new data suggest that CXCL13 and CCL21, which are produced in excess in MG thymus, attract peripheral B cells and activated T cells, which are maintained chronically activated in the inflammatory thymic environment because of the defect in suppressive activity of Treg cells. Presence of AChR in the thymus and upregulation of its expression by the pro-inflammatory environment contribute to the triggering and maintenance of the anti-AChR autoimmune response.

  2. Translational regulatory mechanisms in persistent forms of synaptic plasticity.


    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu


    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength.

  3. Distinct Regulatory Mechanisms Act to Establish and Maintain Pax3 Expression in the Developing Neural Tube

    PubMed Central

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James


    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation. PMID:24098141

  4. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia


    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  5. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf


    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  6. Ser/Thr phosphorylation as a regulatory mechanism in bacteria.


    Dworkin, Jonathan


    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggest that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases.

  7. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma


    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  8. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability.


    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma


    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli.


    PubMed Central



    We have optimized a recombinant chromatin assembly system that properly incorporates core histones and histone H1 into a chromatin template containing a natural promoter sequence. This article provides a step-by-step procedure for expression and purification of the proteins required for assembling well-defined chromatin templates. We describe how the degree of chromatin assembly in the absence and presence of histone H1 is measured using topological analysis and the use of micrococcal nuclease digestion performed to confirm H1 incorporation and determine the quality of in vitro chromatin templates. Further we describe the use sucrose gradient ultracentrifugation to verify that no unincorporated H1 remains as a second means for deciding on the proper H1 to core histone ratio during assembly. Additionally, we discuss the use of both yeast and Drosophila NAP-1 (yNAP-1 and dNAP-1, respectively) in the assembly of H1-containing chromatin. Finally, we provide detailed description of functional assays for investigating the mechanism of transcriptional regulation in a chromatin context (transcription, histone acetyltransferase activity, and protein association with promoter-bound complexes using immobilized chromatin templates). PMID:17309835

  10. Mechanical characterisation of additively manufactured material having lattice microstructure

    NASA Astrophysics Data System (ADS)

    Cuan-Urquizo, E.; Yang, S.; Bhaskar, A.


    Many natural and engineered structures possess cellular and porous architecture. This paper is focused on the mechanical characterisation of additively manufactured lattice structures. The lattice consists of a stack of polylactic acid (PLA) filaments in a woodpile arrangement fabricated using a fused deposition modelling 3D printer. Some of the most promising applications of this 3D lattice material of this type include scaffolds for tissue engineering and the core for sandwich panels. While there is a significant body of work concerning the manufacture of such lattice materials, attempts to understand their mechanical properties are very limited. This paper brings together manufacturing with the need to understand the structure-property relationship for this class of materials. In order to understand the elastic response of the PLA-based lattice structures obtained from the fused deposition modelling process, single filaments manufactured using the same process were experimentally characterised first. The single PLA filaments were manufactured under different temperatures. These filaments were then characterised by using tensile testing. The stress-strain curves are presented. The variability of the measured results is discussed. The measured properties are then taken as input to a finite element model of the lattice material. This model uses simple one-dimensional elements in conjunction with a novel method achieving computational economy which precludes the use of fine meshes. Using this novel model, the apparent elastic modulus of lattice along the filaments has been obtained and is presented in this paper.

  11. Additional mechanisms conferring genetic susceptibility to Alzheimer’s disease

    PubMed Central

    Calero, Miguel; Gómez-Ramos, Alberto; Calero, Olga; Soriano, Eduardo; Avila, Jesús; Medina, Miguel


    Familial Alzheimer’s disease (AD), mostly associated with early onset, is caused by mutations in three genes (APP, PSEN1, and PSEN2) involved in the production of the amyloid β peptide. In contrast, the molecular mechanisms that trigger the most common late onset sporadic AD remain largely unknown. With the implementation of an increasing number of case-control studies and the upcoming of large-scale genome-wide association studies there is a mounting list of genetic risk factors associated with common genetic variants that have been associated with sporadic AD. Besides apolipoprotein E, that presents a strong association with the disease (OR∼4), the rest of these genes have moderate or low degrees of association, with OR ranging from 0.88 to 1.23. Taking together, these genes may account only for a fraction of the attributable AD risk and therefore, rare variants and epistastic gene interactions should be taken into account in order to get the full picture of the genetic risks associated with AD. Here, we review recent whole-exome studies looking for rare variants, somatic brain mutations with a strong association to the disease, and several studies dealing with epistasis as additional mechanisms conferring genetic susceptibility to AD. Altogether, recent evidence underlines the importance of defining molecular and genetic pathways, and networks rather than the contribution of specific genes. PMID:25914626

  12. Molecular mechanism underlying the regulatory specificity of a Drosophila homeodomain protein that specifies myoblast identity

    PubMed Central

    Busser, Brian W.; Shokri, Leila; Jaeger, Savina A.; Gisselbrecht, Stephen S.; Singhania, Aditi; Berger, Michael F.; Zhou, Bo; Bulyk, Martha L.; Michelson, Alan M.


    A subfamily of Drosophila homeodomain (HD) transcription factors (TFs) controls the identities of individual muscle founder cells (FCs). However, the molecular mechanisms by which these TFs generate unique FC genetic programs remain unknown. To investigate this problem, we first applied genome-wide mRNA expression profiling to identify genes that are activated or repressed by the muscle HD TFs Slouch (Slou) and Muscle segment homeobox (Msh). Next, we used protein-binding microarrays to define the sequences that are bound by Slou, Msh and other HD TFs that have mesodermal expression. These studies revealed that a large class of HDs, including Slou and Msh, predominantly recognize TAAT core sequences but that each HD also binds to unique sites that deviate from this canonical motif. To understand better the regulatory specificity of an individual FC identity HD, we evaluated the functions of atypical binding sites that are preferentially bound by Slou relative to other HDs within muscle enhancers that are either activated or repressed by this TF. These studies showed that Slou regulates the activities of particular myoblast enhancers through Slou-preferred sequences, whereas swapping these sequences for sites that are capable of binding to multiple HD family members does not support the normal regulatory functions of Slou. Moreover, atypical Slou-binding sites are overrepresented in putative enhancers associated with additional Slou-responsive FC genes. Collectively, these studies provide new insights into the roles of individual HD TFs in determining cellular identity, and suggest that the diversity of HD binding preferences can confer regulatory specificity. PMID:22296846

  13. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin


    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  14. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.


    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  15. Regulatory Mechanisms Underlying the Expression of Prolactin Receptor in Chicken Granulosa Cells

    PubMed Central

    Hu, Shenqiang; Duggavathi, Raj; Zadworny, David


    Prolactin (PRL) has both pro- and anti-gonadal roles in the regulation of avian ovarian functions through its interaction with the receptor (PRLR). However, neither the pattern of expression of PRLR nor its regulatory mechanisms during follicle development have been clearly defined. The objective of the present study was to investigate mechanisms of PRLR expression in chicken granulosa cells. Levels of PRLR transcript were highest in the stroma and walls of follicles < 2 mm in diameter and progressively declined with the maturation of follicles. In preovulatory follicles, PRLR was expressed at higher levels in granulosa than theca layers. FSH exerted the greatest stimulatory effect on PRLR and StAR expression in cultured granulosa cells of the 6–8 mm follicles but this effect declined as follicles matured to F1. In contrast, LH did not alter the expression of PRLR in granulosa cells of all follicular classes but increased levels of StAR in F2 and F1 granulosa cells. Both non-glycosylated- (NG-) and glycosylated- (G-) PRL upregulated basal PRLR expression in granulosa cells of the 6–8 mm, F3 or F1 follicles but had little effect in F2 follicles. Furthermore, FSH-stimulated PRLR expression was reduced by the addition of either isoform of PRL especially in F2 granulosa cells. These results indicate that PRLR is differentially distributed and regulated by FSH or PRL variants independently or in combination in the follicular hierarchy. By using activators and inhibitors, we further demonstrated that multiple signaling pathways, including PKA, PKC, PI3K, mTOR and AMPK, are not only directly involved in, but they can also converge to modulate ERK2 activity to regulate FSH-mediated PRLR and StAR expression in undifferentiated granulosa cells. These data provide new insights into the regulatory mechanisms controlling the expression of PRLR in granulosa cells. PMID:28107515

  16. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  17. A new regulatory mechanism for bacterial lipoic acid synthesis.


    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  18. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.


    McCraty, Rollin; Shaffer, Fred


    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  19. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred


    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  20. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms

    PubMed Central

    Guo, Michael H.; Nandakumar, Satish K.; Ulirsch, Jacob C.; Zekavat, Seyedeh M.; Buenrostro, Jason D.; Natarajan, Pradeep; Salem, Rany M.; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B.; Metspalu, Andres; Lander, Eric S.; Kathiresan, Sekar; Hirschhorn, Joel N.; Esko, Tõnu; Sankaran, Vijay G.


    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA. The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance. PMID:28031487

  1. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.


    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  2. Additives

    NASA Technical Reports Server (NTRS)

    Smalheer, C. V.


    The chemistry of lubricant additives is discussed to show what the additives are chemically and what functions they perform in the lubrication of various kinds of equipment. Current theories regarding the mode of action of lubricant additives are presented. The additive groups discussed include the following: (1) detergents and dispersants, (2) corrosion inhibitors, (3) antioxidants, (4) viscosity index improvers, (5) pour point depressants, and (6) antifouling agents.

  3. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.


    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C


    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  4. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique


    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  5. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela


    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  6. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.


    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J


    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings.

  7. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.


    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna


    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  8. Regulatory mechanisms for specification and patterning of plant vascular tissues.


    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku


    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  9. A model for the volume regulatory mechanism of the Airway Surface Layer

    NASA Astrophysics Data System (ADS)

    Lang, Michael; Rubinstein, Michael; Davis, C. William; Tarran, Robert; Boucher, Richard


    The airway surface layer (ASL) of a lung consists of two parts: a mucus layer with thickness of about 30 μm in contact with air and a periciliary layer (PCL) of about 7 μm below. Mucus collects dust and bacteria and is swept to throat by beating cilia, while riding on top of PCL. It is important that the thickness of PCL is matched with the length of cilia in order to optimize clearance of mucus. Decrease of PCL thickness would finally lead to an occlusion of the respiratory system. Experiments show that the height of PCL stays constant after removing mucus. When modifying height or composition of this open PCL by removing fluid or adding isotonic solution leads to the same final height of PCL. Thus, there must be a regulatory mechanism, that controls height, i.e. ASL volume. Additional experiments show that mechanical stimulus of the cells like shear leads to an increase of ASL volume, thus, the cell is able to actively adjust this volume. Based on these observations a class of models is introduced that describes the experiments and a specific minimum model for the given problem is proposed.

  10. Calcium-regulatory mechanisms. Functional classification using skinned fibers

    PubMed Central


    The primary purpose of this study was to determine whether various agents (adenosine 3-thiotriphosphate [ATP gamma S], trifluoperazine [TFP], troponin I, the catalytic subunit of the cyclic adenosine 3',5'- monophosphate dependent protein kinase [C-subunit], and calmodulin [CaM]) could be used to classify skinned fiber types, and then to determine whether the proposed mechanisms for Ca2+ regulation were consistent with the results. Agents (ATP gamma S, TFP, C-subunit, CaM) expected to alter a light chain kinase-phosphatase system strongly affect the Ca2+-activated tension in skinned gizzard smooth muscle fibers, whereas these agents have no effect on skinned mammalian striated and scallop adductor fibers. Troponin I, which is known to bind strongly to troponin C and CaM, inhibits Ca2+ activation of skinned mammalian striated and gizzard fibers but not scallop adductor muscle. The results in different types of skinned fibers are consistent with proposed mechanisms for Ca2+ regulation. PMID:6267161

  11. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.


    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  12. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle

    PubMed Central

    Fusi, L.; Brunello, E.; Yan, Z.; Irving, M.


    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway. PMID:27796302

  13. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability.


    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo


    Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions.

  14. [The neuroendocrine regulatory mechanisms of mammalian seasonal reproduction].


    Lai, Ping; Wang, Ping-Qing; Zhang, Bao-Yun; Chu, Ming-Xing; Liu, Chong-Xu; Tan, Ying; Fan, Qi


    The seasonal reproduction of mammal means the reproduction experiences an annual period from quiescence to renaissance. Studies have shown that kisspeptin and RFRP play an important role in the reproductive seasonality. The non-breeding season is characterized by an increase in the negative feedback effect of estrogen on GnRH, and this effect is transmitted by kisspeptin neurons, which may be an important factor affecting the reproduction activities. The expression of RFRP depends on melatonin secretion, and shows an apparent inhibition on reproduction in non-breeding season. In addition, thyroid hormones influence termination of the breeding season. Dopaminergic neuron A14/A15 also contributes to the seasonal changes in estrogen negative feedback. These neural systems may synergistically modulate the seasonal changes of reproductive function with the photoperiod. This review makes a systematic expatiation on the relationship between seasonal reproduction and these neural systems.

  15. Mechanical strength of additive manufactured carbon fiber reinforced polyetheretherketone

    NASA Astrophysics Data System (ADS)

    Chumaevskii, A. V.; Tarasov, S. Yu.; Filippov, A. V.; Kolubaev, E. A.; Rubtsov, V. E.; Eliseev, A. A.


    Mechanical properties of both pure and chopped carbon fiber reinforced polyetheretherketone samples have been carried out. It was shown that the reinforcement resulted in increasing the elasticity modulus, compression and tensile ultimate strength by a factor of 3.5, 2.9 and 2.8, respectively. The fracture surfaces have been examined using both optical and scanning electron microscopy.

  16. The relationships between deformation mechanisms and mechanical properties of additively manufactured porous biomaterials.


    Kadkhodapour, J; Montazerian, H; Darabi, A Ch; Zargarian, A; Schmauder, S


    Modulating deformation mechanism through manipulating morphological parameters of scaffold internal pore architecture provides potential to tailor the overall mechanical properties under physiological loadings. Whereas cells sense local strains, cell differentiation is also impressed by the elastic deformations. In this paper, structure-property relations were developed for Ti6-Al-4V scaffolds designed based on triply periodic minimal surfaces. 10mm cubic scaffolds composed of 5×5×5 unit cells formed of F-RD (bending dominated) and I-WP (stretching dominated) architectures were additively manufactured at different volume fractions and subjected to compressive tests. The first stages of deformation for stretching dominated structure, was accompanied by bilateral layer-by-layer failure of unit cells owing to the buckling of micro-struts, while for bending dominated structure, namely F-RD, global shearing bands appeared since the shearing failure of struts in the internal architecture. Promoted mechanical properties were found for stretching dominated structure since the global orientation of struts were parallel to loading direction while inclination of struts diminished specific properties for bending dominated structure. Moreover, elastic-plastic deformation was computationally studied by applying Johnson-Cook damage model to the voxel-based models in FE analysis. Scaling analysis was performed for mechanical properties with respect to the relative density thereby failure mechanism was correlated to the constants of power law describing mechanical properties.

  17. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling.


    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua


    The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method.

  18. Sparse Additive Ordinary Differential Equations for Dynamic Gene Regulatory Network Modeling

    PubMed Central

    Wu, Hulin; Lu, Tao; Xue, Hongqi; Liang, Hua


    Summary The gene regulation network (GRN) is a high-dimensional complex system, which can be represented by various mathematical or statistical models. The ordinary differential equation (ODE) model is one of the popular dynamic GRN models. High-dimensional linear ODE models have been proposed to identify GRNs, but with a limitation of the linear regulation effect assumption. In this article, we propose a sparse additive ODE (SA-ODE) model, coupled with ODE estimation methods and adaptive group LASSO techniques, to model dynamic GRNs that could flexibly deal with nonlinear regulation effects. The asymptotic properties of the proposed method are established and simulation studies are performed to validate the proposed approach. An application example for identifying the nonlinear dynamic GRN of T-cell activation is used to illustrate the usefulness of the proposed method. PMID:25061254

  19. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.


    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi


    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  20. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi


    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  1. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.


    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  2. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants.


    Cordoba, Elizabeth; Salmi, Mari; León, Patricia


    The methyl-D-erythritol 4-phosphate pathway is responsible for the biosynthesis of a substantial number of natural compounds of biological and biotechnological importance. In recent years, this pathway has become an obvious target to develop new herbicides and antimicrobial drugs. In addition, the production of a variety of compounds of medical and agricultural interest may be possible through the genetic manipulation of this pathway. To this end, a complete understanding of the molecular mechanisms that regulate this pathway is of tremendous importance. Recent data have accumulated that show some of the multiple mechanisms that regulate the methyl-D-erythritol 4-phosphate pathway in plants. In this review we will describe some of these and discuss their implications. It has been demonstrated that 1-deoxy-D-xylulose-5-phosphate synthase (DXS), the first enzyme of this route, plays a major role in the overall regulation of the pathway. A small gene family codes for this enzyme in most of the plants which have been analysed so far, and the members of these gene families belong to different phylogenetic groups. Each of these genes exhibits a distinct expression pattern, suggesting unique functions. One of the most interesting regulatory mechanisms recently described for this pathway is the post-transcriptional regulation of the level of DXS and DXR proteins. In the case of DXS, this regulation appears conserved among plants, supporting its importance. The evidence accumulated suggests that this regulation might link the activity of this pathway with the plant's physiological conditions and the metabolic demand for the final products of this route.

  3. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B


    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  4. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.


    Loli, Denise; Bicudo, José Eduardo P W


    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  5. Catecholamine Stress Hormones Regulate Cellular Iron Homeostasis by a Posttranscriptional Mechanism Mediated by Iron Regulatory Protein

    PubMed Central

    Tapryal, Nisha; Vivek G, Vishnu; Mukhopadhyay, Chinmay K.


    Adequate availability of iron is important for cellular energy metabolism. Catecholamines such as epinephrine and norepinephrine promote energy expenditure to adapt to conditions that arose due to stress. To restore the energy balance, epinephrine/norepinephrine-exposed cells may face higher iron demand. So far, no direct role of epinephrine/norepinephrine in cellular iron homeostasis has been reported. Here we show that epinephrine/norepinephrine regulates iron homeostasis components such as transferrin receptor-1 and ferritin-H in hepatic and skeletal muscle cells by promoting the binding of iron regulatory proteins to iron-responsive elements present in the UTRs of transferrin receptor-1 and ferritin-H transcripts. Increased transferrin receptor-1, decreased ferritin-H, and increased iron-responsive element-iron regulatory protein interaction are also observed in liver and muscle tissues of epinephrine/norepinephrine-injected mice. We demonstrate the role of epinephrine/norepinephrine-induced generation of reactive oxygen species in converting cytosolic aconitase (ACO1) into iron regulatory protein-1 to bind iron-responsive elements present in UTRs of transferrin receptor-1 and ferritin-H. Our study further reveals that mitochondrial iron content and mitochondrial aconitase (ACO2) activity are elevated by epinephrine/norepinephrine that are blocked by the antioxidant N-acetyl cysteine and iron regulatory protein-1 siRNA, suggesting involvement of reactive oxygen species and iron regulatory protein-1 in this mechanism. This study reveals epinephrine and norepinephrine as novel regulators of cellular iron homeostasis. PMID:25572399

  6. Mechanisms underlying the additive and redundant Qrr phenotypes in Vibrio harveyi and Vibrio cholerae.


    Hunter, Geoffrey A M; Keener, James P


    Vibrio harveyi and Vibrio cholerae regulate their virulence factors according to the local cell-population density in a regulatory system called quorum sensing. Their quorum sensing systems contain a small RNA (sRNA) circuit to regulate expression of a master transcriptional regulator via multiple quorum regulated RNA (Qrr) and a protein chaperon Hfq. Experiments and genetic analysis show that their respective quorum sensing networks are topologically equivalent and have homologous components, yet they respond differently to the same experimental conditions. In particular, V. harveyi Qrr are additive because all of its Qrr are required to maintain wild-type-like repression of its master transcriptional regulator. Conversely, V. cholerae Qrr are redundant because any of its Qrr is sufficient to repress its master transcriptional regulator. Given the striking similarities between their quorum sensing systems, experimentalists have been unable to identify conclusively the mechanisms behind these phenotypic differences. Nevertheless, the current hypothesis in the literature is that dosage compensation is the mechanism underlying redundancy. In this work, we identify the mechanisms underlying Qrr redundancy using a detailed mathematical model of the V. harveyi and V. cholerae sRNA circuits. We show that there are exactly two different cases underlying Qrr redundancy and that dosage compensation is unnecessary and insufficient to explain Qrr redundancy. Although V. harveyi Qrr are additive when the perturbations in Qrr are large, we predict that V. harveyi and V. cholerae Qrr are redundant when the perturbations in Qrr are small. We argue that the additive and redundant Qrr phenotypes can emerge from parametric differences in the sRNA circuit. In particular, we find that the affinity of Qrr and its expression relative to the master transcriptional regulator determine the level of redundancy in V. harveyi and V. cholerae. Furthermore, the additive and redundant Qrr

  7. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.


    Tamoi, Masahiro; Shigeoka, Shigeru


    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  8. Gene regulatory mechanisms orchestrated by p63 in epithelial development and related disorders.


    Kouwenhoven, Evelyn N; van Bokhoven, Hans; Zhou, Huiqing


    The transcription factor p63 belongs to the p53 family and is a key regulator in epithelial commitment and development. Mutations in p63 give rise to several epithelial related disorders with defects in skin, limb and orofacial structures. Since the discovery of p63, efforts have been made to identify its target genes using individual gene approaches and to understand p63 function in normal epithelial development and related diseases. Recent genome-wide approaches have identified tens of thousands of potential p63-regulated target genes and regulatory elements, and reshaped the concept of gene regulation orchestrated by p63. These data also provide insights into p63-related disease mechanisms. In this review, we discuss the regulatory role of p63 in normal and diseased epithelial development in light of these novel findings. We also propose future perspectives for dissecting the molecular mechanism of p63-mediated epithelial development and related disorders as well as for potential therapeutic strategies.

  9. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.


    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  10. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.


    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine


    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  11. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel


    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  12. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.


    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua


    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells.


    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  14. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.


    Bazargani, Farhan


    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  15. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.


    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J


    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation.

  16. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central



    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  17. Assessment of diurnal systemic dose of agrochemicals in regulatory toxicity testing--an integrated approach without additional animal use.


    Saghir, Shakil A; Bartels, Michael J; Rick, David L; McCoy, Alene T; Rasoulpour, Reza J; Ellis-Hutchings, Robert G; Sue Marty, M; Terry, Claire; Bailey, Jason P; Billington, Richard; Bus, James S


    Integrated toxicokinetics (TK) data provide information on the rate, extent and duration of systemic exposure across doses, species, strains, gender, and life stages within a toxicology program. While routine for pharmaceuticals, TK assessments of non-pharmaceuticals are still relatively rare, and have never before been included in a full range of guideline studies for a new agrochemical. In order to better understand the relationship between diurnal systemic dose (AUC(24h)) and toxicity of agrochemicals, TK analyses in the study animals is now included in all short- (excluding acute), medium- and long-term guideline mammalian toxicity studies including reproduction/developmental tests. This paper describes a detailed procedure for the implementation of TK in short-, medium- and long-term regulatory toxicity studies, without the use of satellite animals, conducted on three agrochemicals (X11422208, 2,4-D and X574175). In these studies, kinetically-derived maximum doses (KMD) from short-term studies instead of, or along with, maximum tolerated doses (MTD) were used for the selection of the high dose in subsequent longer-term studies. In addition to leveraging TK data to guide dose level selection, the integrated program was also used to select the most appropriate method of oral administration (i.e., gavage versus dietary) of test materials for rat and rabbit developmental toxicity studies. The integrated TK data obtained across toxicity studies (without the use of additional/satellite animals) provided data critical to understanding differences in response across doses, species, strains, sexes, and life stages. Such data should also be useful in mode of action studies and to improve human risk assessments.

  18. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN

    PubMed Central



    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN-overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN-VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV-NELIN-siRNA-VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN-VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α-actin and total Ras homolog gene family member A (RhoA) protein expression. The intra-nuclear translocation of SMα-actin-serum response factor (SMα-actin-SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y-27632, SRF and SMα-actin expression decreased. However, cells in the LV-NELIN-siRNA-VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα-actin protein and total RhoA protein was decreased. The occurrence of SRF extra-nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα-actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN-induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling diseases, including varicosity and

  19. Effect of fluorapatite additive on the mechanical properties of tricalcium phosphate-zirconia composites

    NASA Astrophysics Data System (ADS)

    Sallemi, I.; Ben Ayed, F.; Bouaziz, J.


    The effect of fluorapatite addition on the mechanical properties of tricalcium phosphate - 50 wt% zirconia composites was investigated during the sintering process. The Brazilian test was used to measure the mechanical resistance of bioceramics. The mechanical properties of composites increase with the sintering temperature and with fluorapatite additive. At 1400°C, the fluorapatite additive ameliorates the densification and the mechanical resistance of tricalcium phosphate - 50 wt% zirconia composites. The 31P magic angle spinning nuclear magnetic resonance analysis of tricalcium phosphate - zirconia composites sintered with fluorapatite additives reveals the presence of tetrahedral P sites.

  20. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola


    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  1. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas


    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  2. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs.


    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E


    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs.

  3. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

    PubMed Central

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.


    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

  4. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    PubMed Central

    Resende, Tatiana P.; Andrade, Raquel P.; Palmeirim, Isabel


    All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations. PMID:24895605

  5. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central


    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  6. Regulatory T cells: Mechanisms of suppression and impairment in autoimmune liver disease.


    Liberal, Rodrigo; Grant, Charlotte R; Longhi, Maria Serena; Mieli-Vergani, Giorgina; Vergani, Diego


    There are three classic liver diseases with probable autoimmune etiology: primary biliary cirrhosis, primary sclerosing cholangitis, and autoimmune hepatitis. The occurrence of these autoimmune conditions is determined by the breakdown of immune-regulatory mechanisms that in health are responsible for maintaining immunological tolerance against self-antigens. Among the multiple T cell subsets with suppressive function, the regulatory T cells (Tregs), defined by the expression of CD4, the IL-2 receptor α chain (CD25), and the transcription factor FOXP3, have emerged as having a central role in maintaining immune-tolerance to autoantigens. Tregs are equipped with an array of mechanisms of suppression, including the modulation of antigen presenting cell maturation and function, the killing of target cells, the disruption of metabolic pathways, and the production of anti-inflammatory cytokines. In all the three autoimmune liver diseases mentioned above, there is evidence pointing for either a reduced frequency and/or function of Tregs. Here, we review the definition, phenotypic characteristics, and mechanisms of suppression employed by Tregs and then we discuss the evidence available pointing to their impairment in patients with autoimmune liver disease.

  7. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana


    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  8. Security Clearances: Additional Mechanisms May Aid Federal Tax-Debt Detection

    DTIC Science & Technology


    SECURITY CLEARANCES Additional Mechanisms May Aid Federal Tax -Debt Detection Statement of Seto J. Bagdoyan, Director...Additional Mechanisms May Aid Federal Tax -Debt Detection 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER...Mechanisms May Aid Federal Tax -Debt Detection Why GAO Did This Study According to ODNI, several million civilian and military federal employees

  9. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun


    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  10. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young


    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  11. Large-scale profiling and identification of potential regulatory mechanisms for allelic gene expression in colorectal cancer cells.


    Lee, Robin Dong-Woo; Song, Min-Young; Lee, Jong-Keuk


    Allelic variation in gene expression is common in humans and this variation is associated with phenotypic variation. In this study, we employed high-density single nucleotide polymorphism (SNP) chips containing 13,900 exonic SNPs to identify genes with allelic gene expression in cells from colorectal cancer cell lines. We found 2 monoallelically expressed genes (ERAP2 and MYLK4), 32 genes with an allelic imbalance in their expression, and 13 genes showing allele substitution by RNA editing. Among a total of 34 allelically expressed genes in colorectal cancer cells, 15 genes (44.1%) were associated with cis-acting eQTL, indicating that large portions of allelically expressed genes are regulated by cis-acting mechanisms of gene expression. In addition, potential regulatory variants present in the proximal promoter regions of genes showing either monoallelic expression or allelic imbalance were not tightly linked with coding SNPs, which were detected with allelic gene expression. These results suggest that multiple rare variants could be involved in the cis-acting regulatory mechanism of allelic gene expression. In the comparison with allelic gene expression data from Centre d'Etude du Polymorphisme Humain (CEPH) family B cells, 12 genes showed B-cell specific allelic imbalance and 1 noncoding SNP showed colorectal cancer cell-specific allelic imbalance. In addition, different patterns of allele substitution were observed between B cells and colorectal cancer cells. Overall, our study not only indicates that allelic gene expression is common in colorectal cancer cells, but our study also provides a better understanding of allele-specific gene expression in colorectal cancer cells.

  12. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    PubMed Central

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat


    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: PMID:27996937

  13. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.


    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  14. [Influence of geomagnetic storms on the balance of autonomic regulatory mechanisms].


    Chichinadze, G; Tvildiani, L; Kvachadze, I; Tarkhan-Mouravi, I


    The investigation aimed to evaluate autonomic regulatory mechanisms in practically healthy persons during the geomagnetically quiet periods and during geomagnetic storms. The examinations were conducted among the volunteer young men (n=64) 18-22 years of age. The autonomic function was studied on the basis of the heart rate variability. The geomagnetically quiet periods were considered when the value of the K-index was no more then 2 and a geomagnetic storm was considered when the value of the index was 5 and more. It is ascertained that in the both cases the basic statistical indices of the heart rate were identical. The analysis of R-R intervals spectral power gave the possibility to sort the persons examined into the three different groups. The data obtained allowed to suggest that geomagnetic storms influence human organisms through the vagus centers by means of their excitation. This phenomenon may be considered as a self-regulatory physiologic mechanism of the adaptive character. The analysis of the spectral power of R-R intervals may be considered as a sensitive method for the detection of the magnitolabile persons.

  15. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?


    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S


    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  16. Putting Theory to the Test: Which Regulatory Mechanisms Can Drive Realistic Growth of a Root?

    PubMed Central

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T. S.


    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a ‘Uniform Longitudinal Strain Rule’ (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  17. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.


    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  18. Use of lactobacilli and their pheromone-based regulatory mechanism in gene expression and drug delivery.


    Diep, D B; Mathiesen, G; Eijsink, V G H; Nes, I F


    Lactobacilli are common microorganisms in diverse vegetables and meat products and several of these are also indigenous inhabitants in the gastro-intestinal (GI) tract of humans and animals where they are believed to have health promoting effects on the host. One of the highly appreciated probiotic effects is their ability to inhibit the growth of pathogens by producing antimicrobial peptides, so-called bacteriocins. Production of some bacteriocins has been shown to be strictly regulated through a quorum-sensing based mechanism mediated by a secreted peptide-pheromone (also called induction peptide; IP), a membrane-located sensor (histidine protein kinase; HPK) and a cytoplasmic response regulator (RR). The interaction between an IP and its sensor, which is highly specific, leads to activation of the cognate RR which in turn binds to regulated promoters and activates gene expression. The HPKs and RRs are built up by conserved modules, and the signalling between them within a network is efficient and directional, and can easily be activated by exogenously added synthetic IPs. Consequently, components from such regulatory networks have successfully been exploited in construction of a number of inducible gene expression systems. In this review, we discuss some well-characterised quorum sensing networks involved in bacteriocin production in lactobacilli, with special focus on the use of the regulatory components in gene expression and on lactobacilli as potential delivery vehicle for therapeutic and vaccine purposes.

  19. Regulatory mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis).


    Stager, Maria; Swanson, David L; Cheviron, Zachary A


    Small temperate birds reversibly modify their aerobic performance to maintain thermoregulatory homeostasis under seasonally changing environmental conditions and these physiological adjustments may be attributable to changes in the expression of genes in the underlying regulatory networks. Here, we report the results of an experimental procedure designed to gain insight into the fundamental mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis). We combined genomic transcriptional profiles with measures of metabolic enzyme activities and whole-animal thermogenic performance from juncos exposed to four 6-week acclimation treatments that varied in temperature (cold, 3°C; warm, 24°C) and photoperiod (short day, 8 h light:16 h dark; long day, 16 h light:8 h dark). Cold-acclimated birds increased thermogenic capacity compared with warm-acclimated birds, and this enhanced performance was associated with upregulation of genes involved in muscle hypertrophy, angiogenesis, and lipid transport and oxidation, as well as with catabolic enzyme activities. These physiological changes occurred over ecologically relevant timescales, suggesting that birds make regulatory adjustments to interacting, hierarchical pathways in order to seasonally enhance thermogenic capacity.

  20. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  1. Regulatory mechanisms of nitric oxide and reactive oxygen species generation and their role in plant immunity.


    Yoshioka, Hirofumi; Mase, Keisuke; Yoshioka, Miki; Kobayashi, Michie; Asai, Shuta


    Rapid production of nitric oxide (NO) and reactive oxygen species (ROS) has been implicated in diverse physiological processes, such as programmed cell death, development, cell elongation and hormonal signaling, in plants. Much attention has been paid to the regulation of plant innate immunity by these signal molecules. Recent studies provide evidence that an NADPH oxidase, respiratory burst oxidase homolog, is responsible for pathogen-responsive ROS burst. However, we still do not know about NO-producing enzymes, except for nitrate reductase, although many studies suggest the existence of NO synthase-like activity responsible for NO burst in plants. Here, we introduce regulatory mechanisms of NO and ROS bursts by mitogen-activated protein kinase cascades, calcium-dependent protein kinase or riboflavin and its derivatives, flavin mononucleotide and flavin adenine dinucleotide, and we discuss the roles of the bursts in defense responses against plant pathogens.

  2. Acute-Phase Serum Amyloid A in Osteoarthritis: Regulatory Mechanism and Proinflammatory Properties

    PubMed Central

    de Seny, Dominique; Cobraiville, Gaël; Charlier, Edith; Neuville, Sophie; Esser, Nathalie; Malaise, Denis; Malaise, Olivier; Calvo, Florence Quesada; Relic, Biserka; Malaise, Michel G.


    Objective To determine if serum amyloid A (A-SAA) could be detected in human osteoarthritic (OA) joints and further clarify if high A-SAA level in joints result from a local production or from a diffusion process from abnormally elevated plasma concentration. Regulatory mechanism of A-SAA expression and its pro-inflammatory properties were also investigated. Methods A-SAA levels in serum and synovial fluid of OA (n = 29) and rheumatoid arthritis (RA) (n = 27) patients were measured and compared to matched-healthy volunteers (HV) (n = 35). In vitro cell cultures were performed on primary joint cells provided from osteoarthritis patients. Regulatory mechanisms were studied using Western-blotting, ELISA and lentiviral transfections. Results A-SAA was statistically increased in OA plasma patients compared to HV. Moreover, A-SAA level in OA plasma and synovial fluid increased with the Kellgren & Lauwrence grade. For all OA and RA patients, A-SAA plasma level was higher and highly correlated with its corresponding level in the synovial fluid, therefore supporting that A-SAA was mainly due to the passive diffusion process from blood into the joint cavity. However, A-SAA expression was also observed in vitro under corticosteroid treatment and/or under IL-1beta stimuli. A-SAA expression was down-regulated by PPAR-γ agonists (genistein and rosiglitazone) and up-regulated by TGF-β1 through Alk1 (Smad1/5) pathway. RhSAA induced proinflammatory cytokines (IL-6, IL-8, GRO-α and MCP-1) and metalloproteinases (MMP-1, MMP-3 and MMP-13) expression in FLS and chondrocytes, which expression was downregulated by TAK242, a specific TLR4 inhibitor. Conclusion Systemic or local A-SAA expression inside OA joint cavity may play a key role in inflammatory process seen in osteoarthritis, which could be counteracted by TLR4 inhibition. PMID:23776697

  3. Restricted Autoantigen Recognition Associated With Deletional and Adaptive Regulatory Mechanisms1

    PubMed Central

    Gebe, John A.; Yue, Betty B.; Unrath, Kelly A; Falk, Ben A.; Nepom, Gerald T.


    Autoimmune diabetes (T1D) is characterized by CD4+ T cell reactivity to a variety of islet-associated antigens. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. In order to study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TcR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57Bl/6-derived “diabetes-resistant” background. Both TcR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65 (555–567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self antigen associated with T1D. Although both TcR use the identical Vα and Vβ genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TcR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their antigen responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10 secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TcR recognition profile. PMID:19535636

  4. Systemic blood loss affects NF-kappa B regulatory mechanisms in the lungs.


    Moine, P; Shenkar, R; Kaneko, D; Le Tulzo, Y; Abraham, E


    The nuclear regulatory factor (NF)-kappa B is activated in the lungs of patients with acute respiratory distress syndrome (ARDS). In experimental models of acute lung injury, activation of NF-kappa B contributes to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in the lungs. Because of the important role that NF-kappa B activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kappa B counterregulatory mechanisms in lung mononuclear cells, using a murine model in which inflammatory lung injury develops after blood loss. Sustained activation of NF-kappa B was present in lung mononuclear cells over the 4-h period after blood loss. The activation of NF-kappa B after hemorrhage was accompanied by alterations in levels of the NF-kappa B regulatory proteins I kappa B alpha and Bcl-3. Cytoplasmic and nuclear I kappa B alpha were increased and nuclear Bcl-3 was decreased during the first hour after blood loss, but, by 4 h posthemorrhage, cytoplasmic and nuclear I kappa B alpha levels were decreased and nuclear levels of Bcl-3 were increased. Inhibition of xanthine oxidase activity in otherwise unmanipulated unhemorrhaged mice resulted in increased levels of I kappa B alpha and decreased amounts of Bcl-3 in nuclear extracts from lung mononuclear cells. No changes in the levels of nuclear I kappa B alpha or Bcl-3 occurred after hemorrhage when xanthine oxidase activity was inhibited. These results demonstrate that blood loss, at least partly through xanthine oxidase-dependent mechanisms, produces alterations in the levels of both I kappa B alpha and Bcl-3 in lung mononuclear cell populations. The effects of hemorrhage on proteins that regulate activation of NF-kappa B may contribute to the frequent development of inflammatory lung injury in this setting.

  5. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.


    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  6. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes.


    Liu, Shu-Ting; Huang, Shih-Ming; Ho, Ching-Liang; Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin


    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression.

  7. Adjunct Strategies for Tuberculosis Vaccines: Modulating Key Immune Cell Regulatory Mechanisms to Potentiate Vaccination

    PubMed Central

    Jayashankar, Lakshmi; Hafner, Richard


    Tuberculosis (TB) remains a global health threat of alarming proportions, resulting in 1.5 million deaths worldwide. The only available licensed vaccine, Bacillus Calmette–Guérin, does not confer lifelong protection against active TB. To date, development of an effective vaccine against TB has proven to be elusive, and devising newer approaches for improved vaccination outcomes is an essential goal. Insights gained over the last several years have revealed multiple mechanisms of immune manipulation by Mycobacterium tuberculosis (Mtb) in infected macrophages and dendritic cells that support disease progression and block development of protective immunity. This review provides an assessment of the known immunoregulatory mechanisms altered by Mtb, and how new interventions may reverse these effects. Examples include blocking of inhibitory immune cell coreceptor checkpoints (e.g., programed death-1). Conversely, immune mechanisms that strengthen immune cell effector functions may be enhanced by interventions, including stimulatory immune cell coreceptors (e.g., OX40). Modification of the activity of key cell “immunometabolism” signaling pathway molecules, including mechanistic target of rapamycin, glycogen synthase kinase-3β, wnt/β-catenin, adenosine monophosophate-activated protein kinase, and sirtuins, related epigenetic changes, and preventing induction of immune regulatory cells (e.g., regulatory T cells, myeloid-derived suppressor cells) are powerful new approaches to improve vaccine responses. Interventions to favorably modulate these components have been studied primarily in oncology to induce efficient antitumor immune responses, often by potentiation of cancer vaccines. These agents include antibodies and a rapidly increasing number of small molecule drug classes that have contributed to the dramatic immune-based advances in treatment of cancer and other diseases. Because immune responses to malignancies and to Mtb share many similar mechanisms

  8. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.


    Li, Junlin; Zhao, Guifang; Gao, Xiaocai


    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders.

  9. NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome.


    Moine, P; McIntyre, R; Schwartz, M D; Kaneko, D; Shenkar, R; Le Tulzo, Y; Moore, E E; Abraham, E


    Activation of the nuclear regulatory factor NF-kappaB occurs in the lungs of patients with the acute respiratory distress syndrome (ARDS) and may contribute to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in this setting. Because of the important role that NF-kappaB activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kapppaB counterregulatory mechanisms, involving IkappaB proteins, in alveolar macrophages obtained from 7 control patients without lung injury and 11 patients with established ARDS. Cytoplasmic levels of the NF-kappaB subunits p50, p65, and c-Rel were significantly decreased in alveolar macrophages from patients with ARDS, consistent with enhanced migration of liberated NF-kappaB dimers from the cytoplasm to the nucleus. Cytoplasmic and nuclear levels of IkappaBalpha were not significantly altered in alveolar macrophages from patients with established ARDS, compared with controls. In contrast, nuclear levels of Bcl-3 were significantly decreased in patients with ARDS compared with controls (P = 0.02). No IkappaBgamma, IkappaBbeta, or p105 proteins were detected in the cytoplasm of alveolar macrophages from control patients or patients with ARDS. The presence of activated NF-kappaB in alveolar macrophages from patients with established ARDS implies the presence of an ongoing stimulus for NF-kappaB activation. In this setting, appropriate counterregulatory mechanisms to normalize nuclear levels of NF-kappaB and to suppress NF-kappaB-mediated transcription, such as increased cytoplasmic and nuclear IkappaBalpha levels or decreased Bcl-3 levels, appeared to be induced. Nevertheless, even though counterregulatory mechanisms to NF-kappaB activation are activated in lung macrophages of patients with ARDS, NF-kappaB remains activated. These results suggest that fundamental abnormalities in transcriptional mechanisms involving NF-kappaB and important in the

  10. Apoptosis as a mechanism of T-regulatory cell homeostasis and suppression.


    Yolcu, Esma S; Ash, Shifra; Kaminitz, Ayelet; Sagiv, Yuval; Askenasy, Nadir; Yarkoni, Shai


    Activation-induced cell death is a general mechanism of immune homeostasis through negative regulation of clonal expansion of activated immune cells. This mechanism is involved in the maintenance of self- and transplant tolerance through polarization of the immune responses. The Fas/Fas-ligand interaction is a major common executioner of apoptosis in lymphocytes, with a dual role in regulatory T cell (Treg) function: Treg cell homeostasis and Treg cell-mediated suppression. Sensitivity to apoptosis and the patterns of Treg-cell death are of outmost importance in immune homeostasis that affects the equilibrium between cytolytic and suppressor forces in activation and termination of immune activity. Naive innate (naturally occurring) Treg cells present variable sensitivities to apoptosis, related to their turnover rates in tissue under steady state conditions. Following activation, Treg cells are less sensitive to apoptosis than cytotoxic effector subsets. Their susceptibility to apoptosis is influenced by cytokines within the inflammatory environment (primarily interleukin-2), the mode of antigenic stimulation and the proliferation rates. Here, we attempt to resolve some controversies surrounding the sensitivity of Treg cells to apoptosis under various experimental conditions, to delineate the function of cell death in regulation of immunity.

  11. Effect of additives on mechanical properties of macroporous silicon carbide ceramics

    NASA Astrophysics Data System (ADS)

    Eom, Jung-Hye; Kim, Young-Wook


    Macroporous SiC ceramics were fabricated by carbothermal reduction of polysiloxane-derived SiOC containing hollow microspheres, followed by sintering and subsequent annealing. The effects of the additive composition and the annealing temperature on the porosity, microstructure, and mechanical strength of the resulting porous ceramics were investigated. Varying the additive composition was found to result in different porosities, microstructures, and mechanical properties. When the samples were sintered at 1750 °C and then annealed at 1900 °C for 4 h, the SiC prepared with 3% Al2O3 and 2% Y2O3 showed the highest strength (a flexural strength of 55 MPa and a compressive strength of 289 MPa, at a porosity of 45 %). The present results suggest that judicious selection of the sintering additive composition is very important for improving the mechanical properties of macroporous SiC ceramics.

  12. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.


    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P


    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  13. How does tissue regeneration influence the mechanical behavior of additively manufactured porous biomaterials?


    Hedayati, R; Janbaz, S; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A


    Although the initial mechanical properties of additively manufactured porous biomaterials are intensively studied during the last few years, almost no information is available regarding the evolution of the mechanical properties of implant-bone complex as the tissue regeneration progresses. In this paper, we studied the effects of tissue regeneration on the static and fatigue behavior of selective laser melted porous titanium structures with three different porosities (i.e. 77, 81, and 85%). The porous structures were filled with four different polymeric materials with mechanical properties in the range of those observed for de novo bone (0.7GPamechanical properties and fatigue behavior (S-N curves) of as-manufactured and filled porous structures were then determined. The static mechanical properties and fatigue life (including endurance limit) of the porous structures were found to increase by factors 2-7, even when they were filled with polymeric materials with relatively low mechanical properties. The relative increase in the mechanical properties was much higher for the porous structures with lower porosities. Moreover, the increase in the fatigue life was more notable as compared to the increase in the static mechanical properties. Such large values of increase in the mechanical properties with the progress of bone tissue regeneration have implications in terms of mechanical stimulus for bone tissue regeneration.

  14. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  15. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose.


    Knott, Brandon C; Crowley, Michael F; Himmel, Michael E; Zimmer, Jochen; Beckham, Gregg T


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  16. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    SciTech Connect

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle

  17. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose


    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; ...


    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  18. Improving Student Understanding of Addition of Angular Momentum in Quantum Mechanics

    ERIC Educational Resources Information Center

    Zhu, Guangtian; Singh, Chandralekha


    We describe the difficulties advanced undergraduate and graduate students have with concepts related to addition of angular momentum in quantum mechanics. We also describe the development and implementation of a research-based learning tool, Quantum Interactive Learning Tutorial (QuILT), to reduce these difficulties. The preliminary evaluation…

  19. Improvement of mechanical properties by additive assisted laser sintering of PEEK

    SciTech Connect

    Kroh, M. Bonten, C.; Eyerer, P.


    The additive assisted laser sintering was recently developed at IKT: A carbon black (CB) additive is used to adjust the polymer's laser absorption behavior with the aim to improve the interconnection of sintered powder layers. In this paper a parameter study, Polyetheretherketone (PEEK) samples were prepared with different contents of carbon black and were laser sintered with varying thermal treatment. The samples were mechanically tested and investigated by optical light and transmission electron microscopy. An influence on the morphology at the border areas of particles and intersections of laser sintered layers was found. Depending on the viscosity of the raw material and CB content, different shapes of lamellae were observed. These (trans-) crystalline or polymorph structures, respectively, influence the thermal and mechanical behavior of the virgin PEEK. Moreover, the thermal treatment during the sintering process caused an improvement of mechanical properties like tensile strength and elongation at break.

  20. Effects of mineral additions on durability and physico-mechanical properties of mortar

    NASA Astrophysics Data System (ADS)

    Logbi, A.; Kriker, A.; Snisna, Z.


    This paper consists of an experimental study of the effect of some mineral admixtures on the properties of mortar. Blast furnace Slag of El-Hadjar, natural pozzolan of Beni saf and limestone of Ghardaia, all from Algeria, are crushed in high fineness and incorporated in the cement with different contents (15 % 20 % and 10%) respectively, in order to perform the physico-mechanical characteristics and durability of the mortar. The replacement of cement by 15% of natural pozzolan, or 20% of the Blast furnace Slag improves the mechanical performances of mortar in early and long ages than the mortar without additions, but 10% of limestone fillers have a positive effect only at early age. For durability the three additions have developed a beneficial effect on mechanical resistance under the free aquifers water, while their effects are different on capillary absorption.

  1. PAH growth initiated by propargyl addition: mechanism development and computational kinetics.


    Raj, Abhijeet; Al Rashidi, Mariam J; Chung, Suk Ho; Sarathy, S Mani


    Polycyclic aromatic hydrocarbon (PAH) growth is known to be the principal pathway to soot formation during fuel combustion, as such, a physical understanding of the PAH growth mechanism is needed to effectively assess, predict, and control soot formation in flames. Although the hydrogen abstraction C2H2 addition (HACA) mechanism is believed to be the main contributor to PAH growth, it has been shown to under-predict some of the experimental data on PAHs and soot concentrations in flames. This article presents a submechanism of PAH growth that is initiated by propargyl (C3H3) addition onto naphthalene (A2) and the naphthyl radical. C3H3 has been chosen since it is known to be a precursor of benzene in combustion and has appreciable concentrations in flames. This mechanism has been developed up to the formation of pyrene (A4), and the temperature-dependent kinetics of each elementary reaction has been determined using density functional theory (DFT) computations at the B3LYP/6-311++G(d,p) level of theory and transition state theory (TST). H-abstraction, H-addition, H-migration, β-scission, and intramolecular addition reactions have been taken into account. The energy barriers of the two main pathways (H-abstraction and H-addition) were found to be relatively small if not negative, whereas the energy barriers of the other pathways were in the range of (6-89 kcal·mol(-1)). The rates reported in this study may be extrapolated to larger PAH molecules that have a zigzag site similar to that in naphthalene, and the mechanism presented herein may be used as a complement to the HACA mechanism to improve prediction of PAH and soot formation.

  2. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.


    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun


    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  3. Morphogenetic and Regulatory Mechanisms During Developmental Chondrogenesis: New Paradigms for Cartilage Tissue Engineering

    PubMed Central

    Quintana, Lluís; zur Nieden, Nicole I.


    Cartilage is the first skeletal tissue to be formed during embryogenesis leading to the creation of all mature cartilages and bones, with the exception of the flat bones in the skull. Therefore, errors occurring during the process of chondrogenesis, the formation of cartilage, often lead to severe skeletal malformations such as dysplasias. There are hundreds of skeletal dysplasias, and the molecular genetic etiology of some remains more elusive than of others. Many efforts have aimed at understanding the morphogenetic event of chondrogenesis in normal individuals, of which the main morphogenetic and regulatory mechanisms will be reviewed here. For instance, many signaling molecules that guide chondrogenesis—for example, transforming growth factor-β, bone morphogenetic proteins, fibroblast growth factors, and Wnts, as well as transcriptional regulators such as the Sox family—have already been identified. Moreover, extracellular matrix components also play an important role in this developmental event, as evidenced by the promotion of the chondrogenic potential of chondroprogenitor cells caused by collagen II and proteoglycans like versican. The growing evidence of the elements that control chondrogenesis and the increasing number of different sources of progenitor cells will, hopefully, help to create tissue engineering platforms that could overcome many developmental or degenerative diseases associated with cartilage defects. PMID:19063663

  4. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang


    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  5. The regulatory mechanism of Tremella mesenterica on steroidogenesis in MA-10 mouse Leydig tumor cells.


    Chen, Yen-Wen; Lo, Hui-Chen; Yang, Jyuer-Ger; Chien, Chi-Hsien; Lee, Shi-Hsiung; Tseng, Chi-Yu; Huang, Bu-Miin


    Tremella mesenterica (TM), a yellow jelly mushroom, has been traditionally used as tonic food to improve body condition in Chinese society for a long time. We have previously demonstrated that TM reduced in vitro hCG-treated steroidogenesis in MA-10 mouse Leydig tumor cells without any toxicity effect. In the present study, the mechanism how TM suppressed hCG-treated steroidogenesis in MA-10 cells was investigated. MA-10 cells were treated with vehicle, human chorionic gonadotropin (hCG, 50 ng/ml), or different reagents with or without TM to clarify the effects. TM significantly suppressed progesterone production with the presences of forskolin (10 and 100 microM) or dbcAMP (0.5 and 1mM), respectively, in MA-10 cells (p<0.05), which indicated that TM suppressed steroidogenesis after PKA activation along the signal pathway. Beyond our expectation, TM induced the expression of steroidogenic acute regulatory (StAR) protein with or without hCG treatments. However, TM profoundly decreased P450 side chain cleavage (P450scc) and 3beta-hydroxysteroid dehydrogenase (3beta-HSD) enzyme activities without any influences on the expression of both enzymes. These inhibitions on steroidogenic enzyme activities might counteract the stimulation of StAR protein expression. In conclusion, results suggest that TM suppressed hCG-treated steroidogenesis in MA-10 cells by inhibiting PKA signal pathway and steroidogenic enzyme activities.

  6. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.


    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin


    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  7. Effects of silicon additions on the mechanical properties and microstructure of high speed steels

    SciTech Connect

    Pan, F.; Ding, P.; Zhou, S.; Kang, M.; Edmonds, D.V.


    The effects of silicon additions up to 3.5 wt% on the mechanical properties and microstructure of high speed steels 6W3Mo2Cr4V, W3Mo2Cr4V and W9Mo3Cr4V have been investigated. In order to understand these effects further, a Fe-16Mo-0.9C alloy is also used. The results show silicon additions can increase the temper hardness of steels Fe-16Mo-0.9C, 6W3Mo2Cr4V and W3Mo2Cr4V, bu yield an opposite influence on the temper hardness in W9Mo3Cr4V steels. A critical tempering temperature exists for the bending strength of high speed steels containing silicon. If tempering is carried out at temperatures lower than the critical temperature, the bending strength of the high speed steels can be improved by the addition of silicon, otherwise their bending strength is decreased. Transmission electron microscopy reveals that silicon additions can obviously refine secondary hardening carbides and inhibit the formation of M{sub 3}C cementite at peak temperature. However, they are also found to accelerate both the depletion of martensite and the formation of coarse M{sub 6}C precipitates during tempering. The mechanism whereby silicon additions affect the secondary hardness of high speed steels is discussed in detail, and the types of high speed steel in which silicon additions can be used are suggested.

  8. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo


    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  9. Mechanical characterization of filler sandcretes with rice husk ash additions. Study applied to Senegal

    SciTech Connect

    Cisse, I.K.; Laquerbe, M.


    To capitalize on the local materials of Senegal (agricultural and industrial wastes, residual fines from crushing process, sands from dunes, etc.), rise husk ash and residues of industrial and agricultural wastes have been used as additions in sandcretes. The mechanical resistance of sandcrete blocks obtained when unground ash (and notably the ground ash) is added reveals that there is an increase in performance over the classic mortar blocks. In addition, the use of unground rice husk ash enables production of a lightweight sandcrete with insulating properties, at a reduced cost. The ash pozzolanic reactivity explains the high strengths obtained.

  10. Influence of polymeric additives on the cohesion and mechanical properties of calcium phosphate cements.


    An, Jie; Wolke, Joop G C; Jansen, John A; Leeuwenburgh, Sander C G


    To expand the clinical applicability of calcium phosphate cements (CPCs) to load-bearing anatomical sites, the mechanical and setting properties of CPCs need to be improved. Specifically, organic additives need to be developed that can overcome the disintegration and brittleness of CPCs. Hence, we compared two conventional polymeric additives (i.e. carboxylmethylcellulose (CMC) and hyaluronan (HA)) with a novel organic additive that was designed to bind to calcium phosphate, i.e. hyaluronan-bisphosphonate (HABP). The unmodified cement used in this study consisted of a powder phase of α-tricalcium phosphate (α-TCP) and liquid phase of 4% NaH2PO4·2H2O, while the modified cements were fabricated by adding 0.75 or 1.5 wt% of the polymeric additive to the cement. The cohesion of α-TCP was improved considerably by the addition of CMC and HABP. None of the additives improved the compression and bending strength of the cements, but the addition of 0.75% HABP resulted into a significantly increased cement toughness as compared to the other experimental groups. The stimulatory effects of HABP on the cohesion and toughness of the cements is hypothesized to derive from the strong affinity between the polymer-grafted bisphosphonate ligands and the calcium ions in the cement matrix.

  11. Effective Mechanical Properties of Lattice Material Fabricated by Material Extrusion Additive Manufacturing

    SciTech Connect

    Park, Sang-In; Choi, Seung-kyum; Rosen, David W; Duty, Chad E


    In this paper, a two-step homogenization method is proposed and implemented for evaluating effective mechanical properties of lattice structured material fabricated by the material extrusion additive manufacturing process. In order to consider the characteristics of the additive manufacturing process in estimation procedures, the levels of scale for homogenization are divided into three stages the levels of layer deposition, structural element, and lattice structure. The method consists of two transformations among stages. In the first step, the transformation between layer deposition and structural element levels is proposed to find the geometrical and material effective properties of structural elements in the lattice structure. In the second step, the method to estimate effective mechanical properties of lattice material is presented, which uses a unit cell and is based on the discretized homogenization method for periodic structure. The method is implemented for cubic lattice structure and compared to experimental results for validation purposes.

  12. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana


    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  13. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei


    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  14. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central



    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  15. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer


    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  16. Increased Mechanical Properties Through the Addition of Zr to GRCop-84

    NASA Technical Reports Server (NTRS)

    Ellis, David L.; Lerch, Bradley A.


    GRCop-84 (Cu-8 at.% Cr-4 at.% Nb) has shown exceptional mechanical properties above 932 F (773 K). However, its properties below 932 F (773 K) are inferior to precipitation strengthened alloys such as Cu-Cr, Cu-Zr and Cu-Cr-Zr when they are in the fully aged, hard-drawn condition. It has been noted that the addition of small amounts of Zr, typically 0.1 wt.% to 0.5 wt.%, can greatly enhance the mechanical properties of copper-based alloys. Limited testing was conducted upon GRCop-84 with an addition of 0.4 wt.% Zr to determine its tensile, creep and low cycle fatigue (LCF) properties. Very large increases in strength (up to 68%) and ductility (up to 123%) were observed at both room temperature and 932 F (773 K). Creep properties at 932 F (773 K) demonstrated more than an order of magnitude decrease in the creep rate relative to unmodified GRCop-84 with a corresponding order of magnitude increase in creep life. Limited LCF testing showed that the modified alloy had a comparable LCF life at room temperature, but it was capable of sustaining a much higher load. While more testing and composition optimization are required, the addition of Zr to GRCop-84 has shown clear benefits to mechanical properties.

  17. High-risk medical devices, children and the FDA: regulatory challenges facing pediatric mechanical circulatory support devices.


    Almond, Christopher S D; Chen, Eric A; Berman, Michael R; Less, Joanne R; Baldwin, J Timothy; Linde-Feucht, Sarah R; Hoke, Tracey R; Pearson, Gail D; Jenkins, Kathy; Duncan, Brian W; Zuckerman, Bram D


    Pediatric mechanical circulatory support is a critical unmet need in the United States. Infant- and child-sized ventricular assist devices are currently being developed largely through federal contracts and grants through the National Heart, Lung, and Blood Institute (NHLBI). Human testing and marketing of high-risk devices for children raises epidemiologic and regulatory issues that will need to be addressed. Leaders from the US Food and Drug Administration (FDA), NHLBI, academic pediatric community, and industry convened in January 2006 for the first FDA Workshop on the Regulatory Process for Pediatric Mechanical Circulatory Support Devices. The purpose was to provide the pediatric community with an overview of the federal regulatory process for high-risk medical devices and to review the challenges specific to the development and regulation of pediatric mechanical circulatory support devices. Pediatric mechanical circulatory support present significant epidemiologic, logistic, and financial challenges to industry, federal regulators, and the pediatric community. Early interactions with the FDA, shared appreciation of challenges, and careful planning will be critical to avoid unnecessary delays in making potentially life-saving devices available for children. Collaborative efforts to address these challenges are warranted.

  18. Mechanisms and modeling of the effects of additives on the nitrogen oxides emission

    NASA Technical Reports Server (NTRS)

    Kundu, Krishna P.; Nguyen, Hung Lee; Kang, M. Paul


    A theoretical study on the emission of the oxides of nitrogen in the combustion of hydrocarbons is presented. The current understanding of the mechanisms and the rate parameters for gas phase reactions were used to calculate the NO(x) emission. The possible effects of different chemical species on thermal NO(x), on a long time scale were discussed. The mixing of these additives at various stages of combustion were considered and NO(x) concentrations were calculated; effects of temperatures were also considered. The chemicals such as hydrocarbons, H2, CH3OH, NH3, and other nitrogen species were chosen as additives in this discussion. Results of these calculations can be used to evaluate the effects of these additives on the NO(x) emission in the industrial combustion system.

  19. Influence of oxide-based sintering additives on densification and mechanical behavior of tricalcium phosphate (TCP).


    Bhatt, Himesh A; Kalita, Samar J


    In this research, we studied and analyzed the effects of four different oxide-based sintering additives on densification, mechanical behavior, biodegradation and biocompatibility of tricalcium phosphate (TCP) bioceramics. Selective sintering additives were introduced into pure TCP ceramics, in small quantities, through homogeneous mixing, using a mortar and pestle. The consequent powders of different compositions were pressed into cylindrical compacts, uniaxially and sintered at elevated temperatures, 1150 degrees C and 1250 degrees C, separately in a muffle furnace. X-ray powder diffraction technique was used to analyze the phase-purity of TCP after sintering. Hardness of these sintered specimens was evaluated using a Vickers hardness tester. Sintered cylindrical samples were tested under uniaxial compressive loading, as a function of composition to determine their failure strength. Biodegradation studies conducted using simulated body fluid under dynamic environment, revealed that these additives could control the rate of resorption and hardness degradation of TCP ceramics.

  20. Mechanical properties of potato starch modified by moisture content and addition of lubricant

    NASA Astrophysics Data System (ADS)

    Stasiak, Mateusz; Molenda, Marek; Horabik, Józef; Mueller, Peter; Opaliński, Ireneusz


    Laboratory testing was conducted to deliver a set of characteristics of structure and mechanical properties of pure starch and starch with an addition of a lubricant - magnesium stearate. Considerable influence of moisture content of potato starch was found in the case of density, parameters of internal friction, coefficients of wall friction and flowability. Elasticity was found to be strongly influenced by water content of the material. Addition of magnesium stearate affected density and parameters of flowability, internal friction and elasticity. Bulk density increased from 604 to 774 kg m-3 with decrease in moisture content of potato starch from 17 to for 6%. Addition of magnesium stearate resulted in approximately 10% decrease in bulk density. Angle of internal friction obtained for 10 kPa of consolidation stress decreased from 33 to 24º with increase in moisture content, and to approximately 22º with addition of the lubricant. With an increase of moisture content from 6 to 18% and with addition of the lubricant, the modulus of elasticity during loading decreased from approximately 1.0 to 0.1 MPa. Modulus of elasticity during unloading was found in the range from 19 to 42 MPa and increased with increase of moisture content and amount of lubricant.

  1. Vaporization Mechanisms of Water-Insoluble Cs in Ash During Thermal Treatment with Calcium Chloride Addition.


    Jiao, Facun; Iwata, Norie; Kinoshita, Norikazu; Kawaguchi, Masato; Asada, Motoyuki; Honda, Maki; Sueki, Keisuke; Ninomiya, Yoshihiko


    The vaporization mechanisms of water-insoluble Cs in raw ash and Cs-doped ash during thermal treatment with CaCl2 addition was systematically examined in a lab-scale electrical heating furnace over a temperature range of 500-1500 °C. The results indicate that the water-insoluble Cs in the ash was associated with aluminosilicate as pollucite. Addition of 10% CaCl2 caused the maximum vaporization ratio of Cs in the raw ash to reach approximately 80% at temperatures higher than 1200 °C, whereas approximately 95% of Cs was vaporized at temperatures higher than 1300 °C when 30% CaCl2 was added. The formation of an intermediate compound, CsCaCl3, through the chemical reaction of Cs with CaCl2 was responsible for Cs vaporization by means of the subsequent decomposition of this intermediate upon the increase in temperature. The indirect chlorination of Cs by the gaseous chlorine released from the decomposition of CaCl2 was insignificant. A high CaCl2 content in the resulting annealed products with 30% CaCl2 addition delayed the decomposition of CsCaCl3 and thus lowered the Cs vaporization ratio compared to that with 10% CaCl2 addition at 900-1250 °C. Thermal treatment with CaCl2 addition is a proposed method to remove Cs from Cs-contaminated incineration ash.

  2. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor

    PubMed Central

    Ares, Miguel A.; Fernández-Vázquez, José L.; Pacheco, Sabino; Martínez-Santos, Verónica I.; Jarillo-Quijada, Ma. Dolores; Torres, Javier; Alcántar-Curiel, María D.; González-y-Merchand, Jorge A.; De la Cruz, Miguel A.


    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae. PMID:28278272

  3. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor.


    Ares, Miguel A; Fernández-Vázquez, José L; Pacheco, Sabino; Martínez-Santos, Verónica I; Jarillo-Quijada, Ma Dolores; Torres, Javier; Alcántar-Curiel, María D; González-Y-Merchand, Jorge A; De la Cruz, Miguel A


    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae.

  4. Effects of Te addition on microstructure and mechanical properties of AZ91 magnesium alloy

    NASA Astrophysics Data System (ADS)

    Cui, Shujing; Wu, Xiangwei; Liu, Rongxue; Teng, Xinying; Leng, Jinfeng; Geng, Haoran


    To improve the mechanical properties of AZ91 alloy, the effects of Te addition on the as-cast microstructure and mechanical properties of AZ91 magnesium alloy were investigated by means of optical microscope (OM), scanning electronic microscope (SEM), energy dispersive spectroscopy (EDS), x-ray diffraction (XRD) and tensile testing machine. The results show that the microstructure of Te-containing AZ91 alloys is refined with the improvement of mechanical properties of AZ91 alloys. When the addition of Te is 0.9 wt%, the grain becomes finer, with primary β-Mg17Al12 phases distributed, and new granule-like Al2Te3 phases emerge at the grain boundary with dispersive distribution. As a result, tensile strength and yield strength of as-cast AZ91 alloy are improved from 150 MPa and 80 MPa to 180 MPa and 107 MPa. The optimal tensile properties were obtained. This was attributed to the smaller grain size strengthening and new emerged hard Al2Te3 phase strengthening. The present findings provide a new way for strengthening of AZ91 alloys.

  5. Gelation Behaviors and Mechanism of Silk Fibroin According to the Addition of Nitrate Salts

    PubMed Central

    Im, Dong Su; Kim, Min Hee; Yoon, Young Il; Park, Won Ho


    Silk fibroin (SF) is a typical fibrous protein that is secreted by silkworms and spiders. It has been used in a variety of areas, and especially for tissue-engineering scaffolds, due to its sound processability, mechanical properties, biodegradability, and biocompatibility. With respect to gelation, the SF gelation time is long in aqueous solutions, so a novel approach is needed to shorten this time. The solubility of regenerated SF is sound in formic acid (FA), which is a carboxylic acid of the simplest structure. In this study, SF was dissolved in formic acid, and the addition of salts then induced a rapid gelation that accompanied a solution-color change. Based on the gelation behaviors of the SF solution according to different SF and salt concentrations, the gelation mechanism was investigated. PMID:27735861

  6. Gelation Behaviors and Mechanism of Silk Fibroin According to the Addition of Nitrate Salts.


    Im, Dong Su; Kim, Min Hee; Yoon, Young Il; Park, Won Ho


    Silk fibroin (SF) is a typical fibrous protein that is secreted by silkworms and spiders. It has been used in a variety of areas, and especially for tissue-engineering scaffolds, due to its sound processability, mechanical properties, biodegradability, and biocompatibility. With respect to gelation, the SF gelation time is long in aqueous solutions, so a novel approach is needed to shorten this time. The solubility of regenerated SF is sound in formic acid (FA), which is a carboxylic acid of the simplest structure. In this study, SF was dissolved in formic acid, and the addition of salts then induced a rapid gelation that accompanied a solution-color change. Based on the gelation behaviors of the SF solution according to different SF and salt concentrations, the gelation mechanism was investigated.

  7. Analytical relationships for prediction of the mechanical properties of additively manufactured porous biomaterials

    PubMed Central

    Hedayati, Reza


    Abstract Recent developments in additive manufacturing techniques have motivated an increasing number of researchers to study regular porous biomaterials that are based on repeating unit cells. The physical and mechanical properties of such porous biomaterials have therefore received increasing attention during recent years. One of the areas that have revived is analytical study of the mechanical behavior of regular porous biomaterials with the aim of deriving analytical relationships that could predict the relative density and mechanical properties of porous biomaterials, given the design and dimensions of their repeating unit cells. In this article, we review the analytical relationships that have been presented in the literature for predicting the relative density, elastic modulus, Poisson's ratio, yield stress, and buckling limit of regular porous structures based on various types of unit cells. The reviewed analytical relationships are used to compare the mechanical properties of porous biomaterials based on different types of unit cells. The major areas where the analytical relationships have improved during the recent years are discussed and suggestions are made for future research directions. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 3164–3174, 2016. PMID:27502358

  8. Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.


    Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath


    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  9. Failure mechanisms of additively manufactured porous biomaterials: Effects of porosity and type of unit cell.


    Kadkhodapour, J; Montazerian, H; Darabi, A Ch; Anaraki, A P; Ahmadi, S M; Zadpoor, A A; Schmauder, S


    Since the advent of additive manufacturing techniques, regular porous biomaterials have emerged as promising candidates for tissue engineering scaffolds owing to their controllable pore architecture and feasibility in producing scaffolds from a variety of biomaterials. The architecture of scaffolds could be designed to achieve similar mechanical properties as in the host bone tissue, thereby avoiding issues such as stress shielding in bone replacement procedure. In this paper, the deformation and failure mechanisms of porous titanium (Ti6Al4V) biomaterials manufactured by selective laser melting from two different types of repeating unit cells, namely cubic and diamond lattice structures, with four different porosities are studied. The mechanical behavior of the above-mentioned porous biomaterials was studied using finite element models. The computational results were compared with the experimental findings from a previous study of ours. The Johnson-Cook plasticity and damage model was implemented in the finite element models to simulate the failure of the additively manufactured scaffolds under compression. The computationally predicted stress-strain curves were compared with the experimental ones. The computational models incorporating the Johnson-Cook damage model could predict the plateau stress and maximum stress at the first peak with less than 18% error. Moreover, the computationally predicted deformation modes were in good agreement with the results of scaling law analysis. A layer-by-layer failure mechanism was found for the stretch-dominated structures, i.e. structures made from the cubic unit cell, while the failure of the bending-dominated structures, i.e. structures made from the diamond unit cells, was accompanied by the shearing bands of 45°.

  10. Investigation of mechanical properties of masterbatches and composites with small additions of CNTs

    NASA Astrophysics Data System (ADS)

    Burmistrov, I. N.; Yudintseva, T. I.; Ilinykh, I. A.; Khaydarov, B. B.; Mazov, I. N.; Anshin, S. M.; Kuznetsov, D. V.


    The present paper investigated physical and mechanical properties of the nanotube masterbatches and the polymer composites with low contents of carbon nanotubes (CNTs), which were obtained by diluting masterbatches. Ethylene-octene copolymer was used as the binder for the masterbatches, which provides the elasticity of the material at a content 20 wt% of CNT. Masterbatches were obtained with a 2-roller mixer, and their additive to polypropylene was carried out on a single screw injection molding machine. Strength properties of ethylene-octene copolymer increased when additing CNTs in an amount of 5-20 wt%. When the concentration of CNT in masterbatches is reduced to 0.01-0.1 wt% its strength characteristics increased up to 4-18%. The most effective strengthening of polypropylene was observed with the content of CNTs 0.1 wt%.

  11. Effect of Ca and Zn additions on the mechanical properties of Mg produced by powder metallurgy

    NASA Astrophysics Data System (ADS)

    Guleryuz, L. F.; Ipek, R.; Arıtman, I.; Karaoglu, S.


    Magnesium and its alloys are among important research topics in view of their excellent biocompatibility.In this study mechanical and microstructure properties of hot sintered Mg-Zn-Ca alloys were studied.The effects of the addition of different amounts Ca and Zn were added to the base material has been processed by powder metallurgy method.resulting microstructures densities and compression test behaviors of the Mg-based alloys were studied.Visual inspection using SEM (Scanning Electron Microscope) analyses indicates that the microstructure of the composite is also greatly effected by these parameters. In addition, EDS (Energy Dispersive X-Ray Spectroscopy) analyses were performed for reliable determination of the chemical composition.

  12. Fluid mechanics of additive manufacturing of metal objects by accretion of droplets - a survey

    NASA Astrophysics Data System (ADS)

    Tesař, Václav


    Paper presents a survey of principles of additive manufacturing of metal objects by accretion of molten metal droplets, focusing on fluid-mechanical problems that deserve being investigated. The main problem is slowness of manufacturing due to necessarily small size of added droplets. Increase of droplet repetition rate calls for basic research of the phenomena that take place inside and around the droplets: ballistics of their flight, internal flowfield with heat and mass transfer, oscillation of surfaces, and the ways to elimination of satellite droplets.

  13. Effects of Additive on the Mechanical Properties of Bamboo/pbs Composites

    NASA Astrophysics Data System (ADS)

    Lee, Yeon-Hee; Yoon, Han-Ki; Takagi, Hitoshi; Ohkita, Kazuya

    Compared with general composites which are produced from fossil fuel, biodegradable resins have received considerable attention as an environment-friendly material. Bamboo fiber has relatively high strength compared with other natural fibers. Therefore, the focus of this study is to produce bamboo fiber reinforced Poly butylene succinate (PBS) composites by injection molding and to study the effects of additive on mechanical properties of this bamboo/PBS composite. The injection-molding is a highly productive fabrication technique. Bamboo/PBS composites were examined by flexural test and Vickers hardness. Also we examined fracture surface and microstructure of the bamboo/PBS composites by microscope.

  14. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].


    Khalepo, O V; Molotkov, O V; Eshkina, S L


    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  15. Mechanism of wear and tribofilm formation with ionic liquids and ashless antiwear additives

    NASA Astrophysics Data System (ADS)

    Sharma, Vibhu

    Increasingly stringent government regulation on emissions (EPA Emissions Standard Reference Guide and latest CAFE standards requiring an average fuel economy of 54.5 mpg (combined cars and trucks) by 2025) impose significant challenges to the automotive and lubricant industries calling for the development and implementation of lower viscosity ILSAC GF-5&6 and API-CJ4&5 oils which further limit the amount of SAPS and deposits in engines. Development of additives that result in lower ash content, volatility and anti-wear property plays a crucial role in being able to reach these standards. The current industrial additive technology i.e. zinc dialkyldithiophosphate (ZDDP) forms harmful deposits on catalytic convertor due to the volatility of Zn, S and P which, impairs its functionality and consequently results in higher emission from vehicles. In this research work, ionic liquids (IL's) that are non-volatile have been studied as new generation environment friendly antiwear additives along with other ashless anti-wear additives including boron based additives to overcome the current challenges of improving the fuel efficiency and reducing the amount of hazardous emissions. The goal of this thesis work is to study the tribological performance of selected IL's and develop a comprehensive understating of IL's chemistry and its consequences to their friction and wear outcomes. As first approach, various P, S and F based ionic liquids are studied for their tribological properties by analyzing the friction and wear results generated using standard tribological experiments. Following this, advanced surface characterization techniques such as X-ray absorption near edge structure (XANES) spectroscopy, SEM, Nano-indentation, SPM techniques are used to investigate the chemical-mechanical properties of the antiwear films. Results indicate that the tribological properties of ionic liquids depend on their solubility in base oil (BO) as well as their chemical interaction with the

  16. Novel Sinorhizobium meliloti quorum sensing positive and negative regulatory feedback mechanisms respond to phosphate availability.


    McIntosh, Matthew; Meyer, Stefan; Becker, Anke


    The Sin quorum sensing system of Sinorhizobium meliloti depends upon at least three genes, sinR, sinI and expR, and N-acyl homoserine lactones (AHLs) as signals to regulate multiple processes in its free-living state in the rhizosphere and in the development towards symbiosis with its plant host. In this study, we have characterized novel mechanisms of transcription control through which the system regulates itself. At low AHL levels a positive feedback loop activates expression of sinI (AHL synthase), resulting in amplification of AHL levels. At high AHL levels, expression of sinI is reduced by a negative feedback loop. These feedback mechanisms are mediated by the LuxR-type regulators ExpR and SinR. Expression of sinR and expR is regulated by ExpR in the presence of AHLs. A novel ExpR binding site in the promoter of sinR is responsible for the reduction of expression of this gene. In addition, expression of sinR, upon which sinI expression is dependent, is induced by phoB during growth under phosphate-limiting conditions. This indicates that this response ensures quorum sensing in phosphate-restricted growth.

  17. Novel Regulatory Mechanisms for Generation of the Soluble Leptin Receptor: Implications for Leptin Action

    PubMed Central

    Schaab, Michael; Kausch, Henriette; Klammt, Juergen; Nowicki, Marcin; Anderegg, Ulf; Gebhardt, Rolf; Rose-John, Stefan; Scheller, Juergen; Thiery, Joachim; Kratzsch, Juergen


    Background The adipokine leptin realizes signal transduction via four different membrane-anchored leptin receptor (Ob-R) isoforms in humans. However, the amount of functionally active Ob-R is affected by constitutive shedding of the extracellular domain via a so far unknown mechanism. The product of the cleavage process the so-called soluble leptin receptor (sOb-R) is the main binding protein for leptin in human blood and modulates its bioavailability. sOb-R levels are differentially regulated in metabolic disorders like type 1 diabetes mellitus or obesity and can, therefore, enhance or reduce leptin sensitivity. Methodology/Principal Findings To describe mechanisms of Ob-R cleavage and to investigate the functional significance of differential sOb-R levels we established a model of HEK293 cells transiently transfected with different human Ob-R isoforms. Using siRNA knockdown experiments we identified ADAM10 (A Disintegrin And Metalloproteinase 10) as a major protease for constitutive and activated Ob-R cleavage. Additionally, the induction of lipotoxicity and apoptosis led to enhanced shedding shown by increased levels of the soluble leptin receptor (sOb-R) in cell supernatants. Conversely, high leptin concentrations and ER stress reduced sOb-R levels. Decreased amounts of sOb-R due to ER stress were accompanied by impaired leptin signaling and reduced leptin binding. Conclusions Lipotoxicity and apoptosis increased Ob-R cleavage via ADAM10-dependent mechanisms. In contrast high leptin levels and ER stress led to reduced sOb-R levels. While increased sOb-R concentrations seem to directly block leptin action, reduced amounts of sOb-R may reflect decreased membrane expression of Ob-R. These findings could explain changes of leptin sensitivity which are associated with variations of serum sOb-R levels in metabolic diseases. PMID:22545089

  18. Modeling and additive manufacturing of bio-inspired composites with tunable fracture mechanical properties.


    Dimas, Leon S; Buehler, Markus J


    Flaws, imperfections and cracks are ubiquitous in material systems and are commonly the catalysts of catastrophic material failure. As stresses and strains tend to concentrate around cracks and imperfections, structures tend to fail far before large regions of material have ever been subjected to significant loading. Therefore, a major challenge in material design is to engineer systems that perform on par with pristine structures despite the presence of imperfections. In this work we integrate knowledge of biological systems with computational modeling and state of the art additive manufacturing to synthesize advanced composites with tunable fracture mechanical properties. Supported by extensive mesoscale computer simulations, we demonstrate the design and manufacturing of composites that exhibit deformation mechanisms characteristic of pristine systems, featuring flaw-tolerant properties. We analyze the results by directly comparing strain fields for the synthesized composites, obtained through digital image correlation (DIC), and the computationally tested composites. Moreover, we plot Ashby diagrams for the range of simulated and experimental composites. Our findings show good agreement between simulation and experiment, confirming that the proposed mechanisms have a significant potential for vastly improving the fracture response of composite materials. We elucidate the role of stiffness ratio variations of composite constituents as an important feature in determining the composite properties. Moreover, our work validates the predictive ability of our models, presenting them as useful tools for guiding further material design. This work enables the tailored design and manufacturing of composites assembled from inferior building blocks, that obtain optimal combinations of stiffness and toughness.

  19. The effects of tantalum addition on the microtexture and mechanical behaviour of tungsten for ITER applications

    NASA Astrophysics Data System (ADS)

    Tejado, E.; Carvalho, P. A.; Munoz, A.; Dias, M.; Correia, J. B.; Mardolcar, U. V.; Pastor, J. Y.


    Tungsten (W) and its alloys are very promising materials for producing plasma-facing components (PFCs) in the fusion power reactors of the near future, even as a structural part in them. However, whereas the properties of pure tungsten are suitable for a PFC, its structural applications are still limited due to its low toughness, ductile to brittle transition temperature and recrystallization behaviour. Therefore, many efforts have been made to improve its performance by alloying tungsten with other elements. Hence, in this investigation, the thermo-mechanical performance of two new tungsten-tantalum materials has been evaluated. Materials with W-5wt.%Ta and W-15wt.%Ta were processed by mechanical alloying (MA) and later consolidation by hot isostatic pressing (HIP), with distinct settings for each composition. Thus, it was possible to determine the relationship between the microstructure and the addition of Ta with the macroscopic mechanical properties. These were measured by means of hardness, flexural strength and fracture toughness, in the temperature range of 300-1473 K. The microstructure and the fracture surfaces features of the tested materials were analysed by Field Emission Scanning Electron Microscopy (FESEM).

  20. The effect of additional etching and curing mechanism of composite resin on the dentin bond strength

    PubMed Central

    Lee, In-Su; Son, Sung-Ae; Hur, Bock; Kwon, Yong-Hoon


    PURPOSE The aim of this study was to evaluate the effects of additional acid etching and curing mechanism (light-curing or self-curing) of a composite resin on the dentin bond strength and compatibility of one-step self-etching adhesives. MATERIALS AND METHODS Sixteen human permanent molars were randomly divided into eight groups according to the adhesives used (All-Bond Universal: ABU, Clearfil S3 Bond: CS3), additional acid etching (additional acid etching performed: EO, no additional acid etching performed: EX), and composite resins (Filtek Z-250: Z250, Clearfil FII New Bond: CFNB). Group 1: ABU-EO-Z250, Group 2: ABU-EO-CFNB, Group 3: ABU-EX-Z250, Group 4: ABU-EX-CFNB, Group 5: CS3-EO-Z250, Group 6: CS3-EO-CFNB, Group 7: CS3-EX-Z250, Group 8: CS3-EX-CFNB. After bonding procedures, composite resins were built up on dentin surfaces. After 24-hour water storage, the teeth were sectioned to make 10 specimens for each group. The microtensile bond strength test was performed using a microtensile testing machine. The failure mode of the fractured specimens was examined by means of an optical microscope at ×20 magnification. The data was analyzed using a one-way ANOVA and Scheffe's post-hoc test (α=.05). RESULTS Additional etching groups showed significantly higher values than the no additional etching group when using All-Bond Universal. The light-cured composite resin groups showed significantly higher values than the self-cured composite resin groups in the Clearfil S3 Bond. CONCLUSION The additional acid etching is beneficial for the dentin bond strength when using low acidic one-step self-etch adhesives, and low acidic one-step self-etch adhesives are compatible with self-cured composite resin. The acidity of the one-step self-etch adhesives is an influencing factor in terms of the dentin bonding strength and incompatibility with a self-cured composite resin. PMID:24353889

  1. Analysis of the Transcription Regulatory Mechanism of Otx During the Development of the Sensory Vesicle in Ciona intestinalis.


    Oonuma, Kouhei; Hirose, Dan; Takatori, Naohito; Saiga, Hidetoshi


    Establishment of the anterior-posterior axis is an important event in the development of bilateral animals. A homeodomain transcription factor, Otx, is important for the formation of the anterior part of the embryo, and its mRNA is expressed in a continuous manner in a wide range of animals. This pattern of expression is thought to be important for the formation of anterior neural structures, but the mechanism that regulates Otx expression remains largely unknown. Towards understanding how the transcription of Otx is maintained in the cells of anterior neural structure, the sensory vesicle, during embryogenesis, we examined transcription regulatory mechanisms of Otx, using embryos of the ascidian, Ciona intestinalis, from the gastrula to tailbud stages, which have not been studied previously. We identified two genomic regions capable of mimicking the Otx expression pattern from the gastrula to tailbud stages. Putative transcription factor binding sites required for this activity were identified. Notably, distinct sets of transcription factor binding sites were required at different developmental stages for the expression of Otx, suggesting that the continuity of Otx is supported by distinct transcriptional mechanisms in the gastrula and neurula stages. Along with previous studies using Halocynthia roretzi, the present results provide insight into the evolution of transcriptional regulatory mechanism of Otx.


    SciTech Connect

    Walter, Matthew; Yin, Shengjun; Stevens, Gary; Sommerville, Daniel; Palm, Nathan; Heinecke, Carol


    In past years, the authors have undertaken various studies of nozzles in both boiling water reactors (BWRs) and pressurized water reactors (PWRs) located in the reactor pressure vessel (RPV) adjacent to the core beltline region. Those studies described stress and fracture mechanics analyses performed to assess various RPV nozzle geometries, which were selected based on their proximity to the core beltline region, i.e., those nozzle configurations that are located close enough to the core region such that they may receive sufficient fluence prior to end-of-life (EOL) to require evaluation of embrittlement as part of the RPV analyses associated with pressure-temperature (P-T) limits. In this paper, additional stress and fracture analyses are summarized that were performed for additional PWR nozzles with the following objectives: To expand the population of PWR nozzle configurations evaluated, which was limited in the previous work to just two nozzles (one inlet and one outlet nozzle). To model and understand differences in stress results obtained for an internal pressure load case using a two-dimensional (2-D) axi-symmetric finite element model (FEM) vs. a three-dimensional (3-D) FEM for these PWR nozzles. In particular, the ovalization (stress concentration) effect of two intersecting cylinders, which is typical of RPV nozzle configurations, was investigated. To investigate the applicability of previously recommended linear elastic fracture mechanics (LEFM) hand solutions for calculating the Mode I stress intensity factor for a postulated nozzle corner crack for pressure loading for these PWR nozzles. These analyses were performed to further expand earlier work completed to support potential revision and refinement of Title 10 to the U.S. Code of Federal Regulations (CFR), Part 50, Appendix G, Fracture Toughness Requirements, and are intended to supplement similar evaluation of nozzles presented at the 2008, 2009, and 2011 Pressure Vessels and Piping (PVP

  3. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R


    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  4. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.


    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R


    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix.

  5. Understanding reaction mechanisms in organic chemistry from catastrophe theory: ozone addition on benzene.


    Ndassa, Ibrahim Mbouombouo; Silvi, Bernard; Volatron, François


    The potential energy profiles of the endo and exo additions of ozone on benzene have been theoretically investigated within the framework provided by the electron localization function (ELF). This has been done by carrying out hybrid Hartree-Fock DFT B3LYP calculation followed by a bonding evolution theory (BET) analysis. For both approaches, the reaction is exothermic by ~98 kJ mol(-1). However, the activation energy is calculated to 10 kJ mol(-1) lower in the endo channel than in the exo one; therefore the formation of the endo C(6)H(6)O(3) adduct is kinetically favored. Six structural stability domains are identified along both reaction pathways as well as the bifurcation catastrophes responsible for the changes in the topology of the system. This provides a chemical description of the reaction mechanism in terms of heterolytic synchronous bond formation.

  6. Additional approach to PDT: type III mechanism and the role of native free radicals

    NASA Astrophysics Data System (ADS)

    Gal, Dezso; Kriska, Tamas; Shutova, Tatiana G.; Nemeth, Andras


    It has been suggested by us earlier that interactions of excited triplet sensitizer (3PS) and native free radicals compete with Type I (sensitizer radical mediated) and Type II (singlet oxygen mediated) mechanisms during PDT. Evidence such as fall in the overall radical concentration in vivo ( in mice tumors) during PDT and in the life time of 3PS caused by free radicals supported this assumption In addition, following results have been obtained recently. 1.) Excited Photofrin II and m-THPC affected luminol dependent chemiluminescence (CL) generated by respiratory burst of macrophages like free radical inhibitors. 2.) Quantification of spin trapping for chemical and in vitro systems by kinetic ESR spectrometry yielded detailed knowledge of triplet-doublet interactions 3.)Measurements in open systems (tank reactor) yielded data for the interactions between 3PS and peroxy type radicals 4.)Simulation of experimental data based on mechanisms suggested gave fair agreement. Based on experimental results new PS-s called Antioxidant Carrier Sensiters (ACS-s) have been devised, synthesized and tested one of them showing enhanced activity for PDT.

  7. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen

    SciTech Connect

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cornwell, Paris A.; Wang, Yanli; Dehoff, Ryan R.; Babu, Sudarsanam Suresh; Sochalski-Kolbus, Lindsay M.


    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlation between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.

  8. Mechanical Characterization of an Additively Manufactured Inconel 718 Theta-Shaped Specimen

    NASA Astrophysics Data System (ADS)

    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; Cooper, Ryan C.; Cornwell, Paris A.; Wang, Yanli; Sochalski-Kolbus, Lindsay M.; Dehoff, Ryan R.; Babu, Sudarsanam S.


    Two sets of "theta"-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlation between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. The spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.

  9. Mechanically tunable aspheric lenses via additive manufacture of hanging elastomeric droplets for microscopic applications

    NASA Astrophysics Data System (ADS)

    Fuh, Yiin-Kuen; Chen, Pin-Wen; Lai, Zheng-Hong


    Mechanically deformable lenses with dynamically tunable focal lengths have been developed in this work. The fabricated five types of aspheric polydimethylsiloxane (PDMS) lenses presented here have an initial focal length of 7.0, 7.8, 9.0, 10.0 and 10.2 mm. Incorporating two modes of operation in biconvex and concave-convex configurations, the focal lengths can be tuned dynamically as 5.2-10.2, 5.5-9.9, 6.6-11.9, 6.1-13.5 and 6.6-13.5 mm respectively. Additive manufacturing was utilized to fabricate these five types of aspheric lenses (APLs) via sequential layering of PDMS materials. Complex structures with three-dimensional features and shorter focal lengths can be successfully produced by repeatedly depositing, inverting and curing controlled PDMS volume onto previously cured PDMS droplets. From our experiments, we empirically found a direct dependence of the focal length of the lenses with the amount (volume) of deposited PDMS droplets. This new mouldless, low-cost, and flexible lens fabrication method is able to transform an ordinary commercial smartphone camera into a low-cost portable microscope. A few microscopic features can be readily visualized, such as wrinkles of ladybird pupa and printed circuit board. The fabrication technique by successively applying hanging droplet and facile mechanical focal-length-tuning set-up can be easily adopted in the development of high-performance optical lenses.

  10. Mechanical characterization of an additively manufactured Inconel 718 theta-shaped specimen


    Cakmak, Ercan; Watkins, Thomas R.; Bunn, Jeffrey R.; ...


    Two sets of “theta”-shaped specimens were additively manufactured with Inconel 718 powders using an electron beam melting technique with two distinct scan strategies. Light optical microscopy, mechanical testing coupled with a digital image correlation (DIC) technique, finite element modeling, and neutron diffraction with in situ loading characterizations were conducted. The cross-members of the specimens were the focus. Light optical micrographs revealed that different microstructures were formed with different scan strategies. Ex situ mechanical testing revealed each build to be stable under load until ductility was observed on the cross-members before failure. The elastic moduli were determined by forming a correlationmore » between the elastic tensile stresses determined from FEM, and the elastic strains obtained from DIC. The lattice strains were mapped with neutron diffraction during in situ elastic loading; and a good correlation between the average axial lattice strains on the cross-member and those determined from the DIC analysis was found. Lastly, the spatially resolved stresses in the elastic deformation regime are derived from the lattice strains and increased with applied load, showing a consistent distribution along the cross-member.« less

  11. Effect of addition of semi refined carrageenan on mechanical characteristics of gum arabic edible film

    NASA Astrophysics Data System (ADS)

    Setyorini, D.; Nurcahyani, P. R.


    Currently the seaweed is processed flour and Semi Refined Carraagenan (SRC). However, total production is small, but both of these products have a high value and are used in a wide variety of products such as cosmetics, processed foods, medicines, and edible film. The aim of this study were (1) to determine the effect of SRC on mechanical characteristics of edible film, (2) to determine the best edible film which added by SRC with different concentration. The edible film added by SRC flour which divided into three concentrations of SRC. There are 1.5%; 3%; and 4.5% of SRC, then added 3% glycerol and 0.6% arabic gum. The mechanical properties of the film measured by a universal testing machine Orientec Co. Ltd., while the water vapor permeability measured by the gravimetric method dessicant modified. The experimental design used was completely randomized design with a further test of Duncan. The result show SRC concentration differences affect the elongation breaking point and tensile strength. But not significant effect on the thickness, yield strength and the modulus of elasticity. The best edible film is edible film with the addition of SRC 4.5%.

  12. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.


    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo


    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  13. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo


    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  14. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.


    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo


    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  15. Effects of nitrogen addition on microstructure and mechanical behavior of biomedical Co-Cr-Mo alloys.


    Yamanaka, Kenta; Mori, Manami; Chiba, Akihiko


    In the present study, the microstructures and tensile deformation behaviors of biomedical Co-29Cr-6Mo (wt%) alloys containing different concentrations of nitrogen (0-0.24wt%) were systematically investigated. As the nitrogen concentration increased, the volume fraction of athermal ε martensite decreased, because nanoprecipitates hindered the formation of stacking faults (SFs) by acting as obstacles to Shockley partial dislocation formation, and athermal ε martensite usually forms through the regular overlapping of SFs. The formation of the athermal ε martensite was completely suppressed when the nitrogen concentration exceeded 0.10wt%, resulting in a simultaneous improvement in the strength and ductility of the alloys. It was found that the glide of the Shockley partial dislocations and the strain-induced γ (fcc)→ε (hcp) martensitic transformation (SIMT) operated as the primary deformation mechanisms. However, adding nitrogen reduced the work hardening by suppressing the formation of the SFs and preventing the SIMT from taking place. This resulted in an intrinsic decrease in the tensile ductility of the alloys. It is also shown that all the alloys exhibited premature fractures owing to the SIMT. The formation of annealing twins in the γ grains is found to be enhanced by nitrogen addition and to promote the SIMT, resulting in a reduction in the elongation-to-failure due to nitrogen addition. These results should aid in the design of alloys that contain nitrogen.

  16. Mechanical properties of tungsten alloys with Y 2O 3 and titanium additions

    NASA Astrophysics Data System (ADS)

    Aguirre, M. V.; Martín, A.; Pastor, J. Y.; LLorca, J.; Monge, M. A.; Pareja, R.


    In this research the mechanical behaviour of pure tungsten (W) and its alloys (2 wt.% Ti-0.47 wt.% Y 2O 3 and 4 wt.% Ti-0.5 wt.% Y 2O 3) is compared. These tungsten alloys, have been obtained by powder metallurgy. The yield strength, fracture toughness and elastic modulus have been studied in the temperature interval of 25 °C to 1000 °C. The results have shown that the addition of Ti substantially improves the bending strength and toughness of W, but it also dramatically increases the DBTT. On the other hand, the addition of 0.5% Y 2O 3, is enough to improve noticeably the oxidation behaviour at the higher temperatures. The grain size, fractography and microstructure are studied in these materials. Titanium is a good grain growth inhibitor and effective precursor of liquid phase in HIP. The simultaneous presence of Y 2O 3 and Ti permits to obtain materials with low pores presence.

  17. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?


    Askenasy, Nadir


    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction.

  18. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.


    Agrawal, Devanshu; Karsai, Istvan


    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  19. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.


    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A


    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  20. Comparative analysis of mutant plants impaired in the main regulatory mechanisms of photosynthetic light reactions - From biophysical measurements to molecular mechanisms.


    Tikkanen, Mikko; Rantala, Sanna; Grieco, Michele; Aro, Eva-Mari


    Chlorophyll (chl) fluorescence emission by photosystem II (PSII) and light absorption by P700 reaction center chl a of photosystem I (PSI) provide easy means to probe the function of the photosynthetic machinery. The exact relationship between the measured optical variables and the molecular processes have, however, remained elusive. Today, the availability of mutants with distinct molecular characterization of photosynthesis regulatory processes should make it possible to gain further insights into this relationship, yet a systematic comparative analysis of such regulatory mutants has been missing. Here we have systematically compared the behavior of Dual-PAM fluorescence and P700 variables from well-characterized photosynthesis regulation mutants. The analysis revealed a very convincing relationship between the given molecular deficiency in the photosynthetic apparatus and the original fluorescence and P700 signals obtained by using varying intensities of actinic light and by applying a saturating pulse. Importantly, the specific information on the underlying molecular mechanism, present in these authentic signals of a given photosynthesis mutant, was largely nullified when using the commonly accepted parameters that are based on further treatment of the original signals. Understanding the unique relationship between the investigated molecular process of photosynthesis and the measured variable is an absolute prerequisite for comprehensive interpretation of fluorescence and P700 measurements. The data presented here elucidates the relationships between the main regulatory mechanisms controlling the photosynthetic light reactions and the variables obtained by fluorescence and P700 measurements. It is discussed how the full potential of optical photosynthesis measurements can be utilized in investigation of a given molecular mechanism.

  1. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central


    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  2. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.


    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  3. Molecular mechanism for differential recognition of membrane phosphatidylserine by the immune regulatory receptor Tim4.


    Tietjen, Gregory T; Gong, Zhiliang; Chen, Chiu-Hao; Vargas, Ernesto; Crooks, James E; Cao, Kathleen D; Heffern, Charles T R; Henderson, J Michael; Meron, Mati; Lin, Binhua; Roux, Benot; Schlossman, Mark L; Steck, Theodore L; Lee, Ka Yee C; Adams, Erin J


    Recognition of phosphatidylserine (PS) lipids exposed on the extracellular leaflet of plasma membranes is implicated in both apoptotic cell removal and immune regulation. The PS receptor T cell immunoglobulin and mucin-domain-containing molecule 4 (Tim4) regulates T-cell immunity via phagocytosis of both apoptotic (high PS exposure) and nonapoptotic (intermediate PS exposure) activated T cells. The latter population must be removed at lower efficiency to sensitively control immune tolerance and memory cell population size, but the molecular basis for how Tim4 achieves this sensitivity is unknown. Using a combination of interfacial X-ray scattering, molecular dynamics simulations, and membrane binding assays, we demonstrate how Tim4 recognizes PS in the context of a lipid bilayer. Our data reveal that in addition to the known Ca(2+)-coordinated, single-PS binding pocket, Tim4 has four weaker sites of potential ionic interactions with PS lipids. This organization makes Tim4 sensitive to PS surface concentration in a manner capable of supporting differential recognition on the basis of PS exposure level. The structurally homologous, but functionally distinct, Tim1 and Tim3 are significantly less sensitive to PS surface density, likely reflecting the differences in immunological function between the Tim proteins. These results establish the potential for lipid membrane parameters, such as PS surface density, to play a critical role in facilitating selective recognition of PS-exposing cells. Furthermore, our multidisciplinary approach overcomes the difficulties associated with characterizing dynamic protein/membrane systems to reveal the molecular mechanisms underlying Tim4's recognition properties, and thereby provides an approach capable of providing atomic-level detail to uncover the nuances of protein/membrane interactions.

  4. Additional funding mechanisms for Public Hospitals in Greece: the case of Chania Mental Health Hospital

    PubMed Central


    Objectives To investigate whether the long term lease of public hospital owned land could be an additional financing mechanism for Greek public (mental) health hospitals. Methods We performed a financial analysis of the official 2008 data of a case - study hospital (Mental Health Hospital of Chania). We used a capital budgeting approach to investigate whether value is created for the public hospital by engaging its assets in a project for the development of a private renal dialysis Unit. Results The development of the private unit in hospital owned land is a good investment decision, as it generates high project Net Present Value and Internal Rate of Return. When the project commences generating operating cash flows, nearly €400.000 will be paid annually to the Mental Health Hospital of Chania as rent, thereby gradually decreasing the annual deficit of the hospital. Conclusions Revenue generated from the long term lease of public hospital land is crucial to gradually eliminate hospital deficit. The Ministry of Health should encourage similar forms of Public Private Partnerships in order to ensure the sustainability of public (mental) hospitals. PMID:21067580

  5. Microstructure and Mechanical Properties of Wire and Arc Additive Manufactured Ti-6Al-4V

    NASA Astrophysics Data System (ADS)

    Wang, Fude; Williams, Stewart; Colegrove, Paul; Antonysamy, Alphons A.


    Wire and arc additive manufacturing (WAAM) is a novel manufacturing technique in which large metal components can be fabricated layer by layer. In this study, the macrostructure, microstructure, and mechanical properties of a Ti-6Al-4V alloy after WAAM deposition have been investigated. The macrostructure of the arc-deposited Ti-6Al-4V was characterized by epitaxial growth of large columnar prior-β grains up through the deposited layers, while the microstructure consisted of fine Widmanstätten α in the upper deposited layers and a banded coarsened Widmanstätten lamella α in the lower layers. This structure developed due to the repeated rapid heating and cooling thermal cycling that occurs during the WAAM process. The average yield and ultimate tensile strengths of the as-deposited material were found to be slightly lower than those for a forged Ti-6Al-4V bar (MIL-T 9047); however, the ductility was similar and, importantly, the mean fatigue life was significantly higher. A small number of WAAM specimens exhibited early fatigue failure, which can be attributed to the rare occurrence of gas pores formed during deposition.

  6. Additive manufacturing of Inconel 718 using electron beam melting: Processing, post-processing, & mechanical properties

    NASA Astrophysics Data System (ADS)

    Sames, William James, V.

    Additive Manufacturing (AM) process parameters were studied for production of the high temperature alloy Inconel 718 using Electron Beam Melting (EBM) to better understand the relationship between processing, microstructure, and mechanical properties. Processing parameters were analyzed for impact on process time, process temperature, and the amount of applied energy. The applied electron beam energy was shown to be integral to the formation of swelling defects. Standard features in the microstructure were identified, including previously unidentified solidification features such as shrinkage porosity and non-equilibrium phases. The as-solidified structure does not persist in the bulk of EBM parts due to a high process hold temperature (˜1000°C), which causes in situ homogenization. The most significant variability in as-fabricated microstructure is the formation of intragranular delta-phase needles, which can form in samples produced with lower process temperatures (< 960°C). A novel approach was developed and demonstrated for controlling the temperature of cool down, thus providing a technique for in situ heat treatment of material. This technique was used to produce material with hardness of 478+/-7 HV with no post-processing, which exceeds the hardness of peak-aged Inconel 718. Traditional post-processing methods of hot isostatic pressing (HIP) and solution treatment and aging (STA) were found to result in variability in grain growth and phase solution. Recrystallization and grain structure are identified as possible mechanisms to promote grain growth. These results led to the conclusion that the first step in thermal post-processing of EBM Inconel 718 should be an optimized solution treatment to reset phase variation in the as-fabricated microstructure without incurring significant grain growth. Such an optimized solution treatment was developed (1120°C, 2hr) for application prior to aging or HIP. The majority of as-fabricated tensile properties met ASTM

  7. Biochemistry on a leash: Confinement as a regulatory mechanism for bimolecular reaction rates

    NASA Astrophysics Data System (ADS)

    Reeves, Daniel; Cheveralls, Keith; Kondev, Jane


    We describe two mechanisms by which confinement regulates diffusion-limited bimolecular reaction rates. The first mechanism, illustrated by the actin capping protein formin, uses a flexible polymer to tether ligand binding sites, which serve as intermediaries, to the reactive site. The second mechanism uses a potential (e.g. hard wall potential), to constrain the motion of a ligand receptor within a confining volume. We analyze both mechanisms theoretically, using a combination of analytic and numerical techniques, to obtain the steady state binding kinetics. We explore how the reaction rates are regulated by parameters of the model such as the length of the polymer tether, and use our findings to explain the key features of the formin system. Finally, we suggest other systems, both synthetic and biological, in which these mechanisms for regulating bimolecular reactions might be at play.

  8. Sodium Benzoate, a Food Additive and a Metabolite of Cinnamon, Enriches Regulatory T Cells via STAT6-Mediated Upregulation of TGF-β.


    Kundu, Madhuchhanda; Mondal, Susanta; Roy, Avik; Martinson, Jeffrey L; Pahan, Kalipada


    Upregulation and/or maintenance of regulatory T cells (Tregs) during autoimmune insults may have therapeutic efficacy in autoimmune diseases. Earlier we have reported that sodium benzoate (NaB), a metabolite of cinnamon and a Food and Drug Administration-approved drug against urea cycle disorders, upregulates Tregs and protects mice from experimental allergic encephalomyelitis, an animal model of multiple sclerosis. However, mechanisms by which NaB increases Tregs are poorly understood. Because TGF-β is an important inducer of Tregs, we examined the effect of NaB on the status of TGF-β. In this study, we demonstrated that NaB induced the expression of TGF-β mRNA and protein in normal as well as proteolipid protein-primed splenocytes. The presence of a consensus STAT6 binding site in the promoter of the TGF-β gene, activation of STAT6 in splenocytes by NaB, recruitment of STAT6 to the TGF-β promoter by NaB, and abrogation of NaB-induced expression of TGF-β in splenocytes by small interfering RNA knockdown of STAT6 suggest that NaB induces the expression of TGF-β via activation of STAT6. Furthermore, we demonstrated that blocking of TGF-β by neutralizing Abs abrogated NaB-mediated protection of Tregs and experimental allergic encephalomyelitis. These studies identify a new function of NaB in upregulating TGF-β via activation of STAT6, which may be beneficial in MS patients.

  9. Mechanics of additively manufactured porous biomaterials based on the rhombicuboctahedron unit cell.


    Hedayati, R; Sadighi, M; Mohammadi-Aghdam, M; Zadpoor, A A


    Thanks to recent developments in additive manufacturing techniques, it is now possible to fabricate porous biomaterials with arbitrarily complex micro-architectures. Micro-architectures of such biomaterials determine their physical and biological properties, meaning that one could potentially improve the performance of such biomaterials through rational design of micro-architecture. The relationship between the micro-architecture of porous biomaterials and their physical and biological properties has therefore received increasing attention recently. In this paper, we studied the mechanical properties of porous biomaterials made from a relatively unexplored unit cell, namely rhombicuboctahedron. We derived analytical relationships that relate the micro-architecture of such porous biomaterials, i.e. the dimensions of the rhombicuboctahedron unit cell, to their elastic modulus, Poisson's ratio, and yield stress. Finite element models were also developed to validate the analytical solutions. Analytical and numerical results were compared with experimental data from one of our recent studies. It was found that analytical solutions and numerical results show a very good agreement particularly for smaller values of apparent density. The elastic moduli predicted by analytical and numerical models were in very good agreement with experimental observations too. While in excellent agreement with each other, analytical and numerical models somewhat over-predicted the yield stress of the porous structures as compared to experimental data. As the ratio of the vertical struts to the inclined struts, α, approaches zero and infinity, the rhombicuboctahedron unit cell respectively approaches the octahedron (or truncated cube) and cube unit cells. For those limits, the analytical solutions presented here were found to approach the analytic solutions obtained for the octahedron, truncated cube, and cube unit cells, meaning that the presented solutions are generalizations of the

  10. Structural, Thermal, Physical, Mechanical, and Barrier Properties of Chitosan Films with the Addition of Xanthan Gum.


    de Morais Lima, Maria; Carneiro, Lucia Cesar; Bianchini, Daniela; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa; Prentice, Carlos; Moreira, Angelita da Silveira


    Films based on chitosan and xanthan gum were prepared using casting technique aiming to investigate the potential of these polymers as packaging materials. Six formulations of films were studied varying the proportion of chitosan and xanthan gum: 100:0 (chitosan:xanthan gum, w/w, C100XG0 film); 90:10 (chitosan:xanthan gum, w/w, C90XG10 film); 80:20 (chitosan:xanthan gum, w/w, C80XG20 film); 70:30 (chitosan:xanthan gum, w/w, C70XG30 film); 60:40 (chitosan:xanthan gum, w/w, C60XG40 film); and 50:50 (chitosan:xanthan gum, w/w, C50XG50 film). The total quantity of solids (chitosan and xanthan gum) in the filmogenic solution was 1.5 g per 100 mL of aqueous solution for all treatments, according to the proportion of each polymer. The films were evaluated by their functional groups, structural, thermal, morphological, physical, mechanical, and barrier properties. All films have presented endothermic peaks in the range of 122 to 175 °C and broad exothermic peaks above 200 °C, which were assigned to the melting temperature and thermal decomposition, respectively. These results demonstrated that films with xanthan gum have the highest Tm and Δm H. The films containing higher content of xanthan gum show also the highest tensile strength and the lowest elongation. Xanthan gum addition did not affect the water vapor permeability, solubility, and moisture of films. This set of data suggests the formation of chitosan-xanthan complexes in the films.

  11. Physical mechanism and statistics of occurrence of an additional layer in the equatorial ionosphere

    NASA Astrophysics Data System (ADS)

    Balan, N.; Batista, I. S.; Abdu, M. A.; MacDougall, J.; Bailey, G. J.


    A physical mechanism and the location and latitudinal extent of an additional layer, called the F3 layer, that exists in the equatorial ionosphere are presented. A statistical analysis of the occurrence of the layer recorded at the equatorial station Fortaleza (4°S, 38°W dip 9°S) in Brazil is also presented. The F3 layer forms during the morning-noon period in that equatorial region where the combined effect of the upward E×B drift and neutral wind provides a vertically upward plasma drift velocity at altitudes near and above the F2 peak. This velocity causes the F2 peak to drift upward and form the F3 layer while the normal F2 layer develops at lower altitudes through the usual photochemical and dynamical effects of the equatorial region. The peak electron density of the F3 layer can exceed that of the F2 layer. The F3 layer is predicted to be distinct on the summer side of the geomagnetic equator during periods of low solar activity and to become less distinct as the solar activity increases. Ionograms recorded at Fortaleza in 1995 show the existence of an F3 layer on 49% of the days, with the occurrence being most frequent (75%) and distinct in summer, as expected. During summer the layer occurs earlier and lasts longer compared to the other seasons; on the average, the layer occurs at around 0930 LT and lasts for about 3 hours. The altitude of the layer is also high in summer, with the mean peak virtual height being about 570 km. However, the critical frequency of the layer (foF3) exceeds that of the F2 layer (foF2) by the largest amounts in winter and equinox; foF3 exceeds foF2 by a yearly average of about 1.3 MHz.

  12. A novel regulatory mechanism of the mitochondrial Ca2+ uniporter revealed by the p38 mitogen-activated protein kinase inhibitor SB202190.


    Montero, Mayte; Lobaton, Carmen D; Moreno, Alfredo; Alvarez, Javier


    It is widely acknowledged that mitochondrial Ca2+ uptake modulates the cytosolic [Ca2+] ([Ca2+]c) acting as a transient Ca2+ buffer. In addition, mitochondrial [Ca2+] ([Ca2+]M) regulates the rate of respiration and may trigger opening of the permeability transition pore and start apoptosis. However, no mechanism for the physiological regulation of mitochondrial Ca2+ uptake has been described. We show here that SB202190, an inhibitor of p38 mitogen-activated protein (MAP) kinase, strongly stimulates ruthenium red-sensitive mitochondrial Ca2+ uptake, both in intact and in permeabilized HeLa cells. The [Ca2+]M peak induced by agonists was increased about fourfold in the presence of the inhibitor, with a concomitant reduction in the [Ca2+]c peak. The stimulation occurred fast and was rapidly reversible. In addition, experiments in permeabilized cells perfused with controlled [Ca2+] showed that SB202190 stimulated mitochondrial Ca2+ uptake by more than 10-fold, but only in the physiological [Ca2+]c range (1-4 mM). Other structurally related p38 MAP kinase inhibitors (SB203580, PD169316, or SB220025) produced little or no effect. Our data suggest that in HeLa cells, a protein kinase sensitive to SB202190 tonically inhibits the mitochondrial Ca2+ uniporter. This novel regulatory mechanism may be of paramount importance to modulate mitochondrial Ca2+ uptake under different physiopathological conditions.

  13. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.


    Suzuki, Takashi; Swift, Larry L


    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity.

  14. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.


    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  15. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.


    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin


    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  16. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila


    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  17. Effect of hypoeutectic boron additions on the grain size and mechanical properties of Ti-6Al-4V manufactured with powder bed electron beam additive manufacturing

    SciTech Connect

    Mahbooba, Zaynab; West, Harvey; Harrysson, Ola; Wojcieszynski, Andrzej; Dehoff, Ryan R.; Nandwana, Peeyush; Horn, Timothy


    In additive manufacturing, microstructural control is feasible via processing parameter alteration. However, the window for parameter variation for certain materials, such as Ti-6Al-4V, is limited, and alternative methods must be employed to customize microstructures. Grain refinement and homogenization in cast titanium alloys has been demonstrated through the addition of hypoeutectic concentrations of boron. This work explores the influence of 0.00 wt.%, 0.25 wt.%, 0.50 wt.%, and 1.0 wt.% boron additions on the microstructure and bulk mechanical properties of Ti-6Al-4V samples fabricated in an Arcam A2 electron beam melting (EBM) system with commercial processing parameters for Ti-6Al-4V. Analyses of EBM fabricated Ti-6Al-4V + B indicate that the addition of 0.25–1.0 wt.% boron progressively refines the grain structure, and it improves hardness and elastic modulus. Furthermore, despite a reduction in size, the β grain structure remained columnar as a result of directional heat transfer during EBM fabrication.

  18. Effect of hypoeutectic boron additions on the grain size and mechanical properties of Ti-6Al-4V manufactured with powder bed electron beam additive manufacturing


    Mahbooba, Zaynab; West, Harvey; Harrysson, Ola; ...


    In additive manufacturing, microstructural control is feasible via processing parameter alteration. However, the window for parameter variation for certain materials, such as Ti-6Al-4V, is limited, and alternative methods must be employed to customize microstructures. Grain refinement and homogenization in cast titanium alloys has been demonstrated through the addition of hypoeutectic concentrations of boron. This work explores the influence of 0.00 wt.%, 0.25 wt.%, 0.50 wt.%, and 1.0 wt.% boron additions on the microstructure and bulk mechanical properties of Ti-6Al-4V samples fabricated in an Arcam A2 electron beam melting (EBM) system with commercial processing parameters for Ti-6Al-4V. Analyses of EBM fabricatedmore » Ti-6Al-4V + B indicate that the addition of 0.25–1.0 wt.% boron progressively refines the grain structure, and it improves hardness and elastic modulus. Furthermore, despite a reduction in size, the β grain structure remained columnar as a result of directional heat transfer during EBM fabrication.« less

  19. Effect of Hypoeutectic Boron Additions on the Grain Size and Mechanical Properties of Ti-6Al-4V Manufactured with Powder Bed Electron Beam Additive Manufacturing

    NASA Astrophysics Data System (ADS)

    Mahbooba, Zaynab; West, Harvey; Harrysson, Ola; Wojcieszynski, Andrzej; Dehoff, Ryan; Nandwana, Peeyush; Horn, Timothy


    In additive manufacturing, microstructural control is feasible via processing parameter alteration. However, the window for parameter variation for certain materials, such as Ti-6Al-4V, is limited, and alternative methods must be employed to customize microstructures. Grain refinement and homogenization in cast titanium alloys has been demonstrated through the addition of hypoeutectic concentrations of boron. This work explores the influence of 0.00 wt.%, 0.25 wt.%, 0.50 wt.%, and 1.0 wt.% boron additions on the microstructure and bulk mechanical properties of Ti-6Al-4V samples fabricated in an Arcam A2 electron beam melting (EBM) system with commercial processing parameters for Ti-6Al-4V. Analyses of EBM fabricated Ti-6Al-4V + B indicate that the addition of 0.25-1.0 wt.% boron progressively refines the grain structure, and it improves hardness and elastic modulus. Despite a reduction in size, the β grain structure remained columnar as a result of directional heat transfer during EBM fabrication.

  20. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.


    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang


    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  1. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.


    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  2. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John


    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  3. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).


    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare


    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  4. Mechanisms of autoimmunity in the non-obese diabetic mouse: effector/regulatory cell equilibrium during peak inflammation.


    Askenasy, Nadir


    Immune imbalance in autoimmune disorders such as type 1 diabetes may originate from aberrant activities of effector cells or dysfunction of suppressor cells. All possible defective mechanisms have been proposed for diabetes-prone species: (i) quantitative dominance of diabetogenic cells and decreased numbers of regulatory T cells, (ii) excessive aggression of effectors and defective function of suppressors, (iii) perturbed interaction between effector and suppressor cells, and (iv) variations in sensitivity to negative regulation. The experimental evidence available to date presents conflicting information on these mechanisms, with identification of perturbed equilibrium on the one hand and negation of critical role of each mechanism in propagation of diabetic autoimmunity on the other hand. In our analysis, there is no evidence that inherent abnormalities in numbers and function of effector and suppressor T cells are responsible for the immune imbalance responsible for propagation of type 1 diabetes as a chronic inflammatory process. Possibly, the experimental tools for investigation of these features of immune activity are still underdeveloped and lack sufficient resolution, in the presence of the extensive biological viability and functional versatility of effector and suppressor elements.

  5. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan


    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  6. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay


    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  7. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].


    Wu, Qingping; Zhong, Xian; Zhang, Jumei


    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni.

  8. Histone Deacetylases 6 and 9 and Sirtuin-1 Control Foxp3+ Regulatory T Cell Function Through Shared and Isotype-Specific Mechanisms

    PubMed Central

    Beier, Ulf H.; Wang, Liqing; Han, Rongxiang; Akimova, Tatiana; Liu, Yujie; Hancock, Wayne W.


    Therapeutic targeting of histone/protein deacetylase 6 (HDAC6), HDAC9, or the sirtuin-1 (Sirt1) augments the suppressive functions of regulatory T cells (Tregs) that contain the transcription factor Foxp3. However, it is unclear whether distinct mechanisms are involved or whether combined inhibition of these targets would be more beneficial. We compared the suppressive functions of Tregs from wild-type C57BL/6 mice with those from mice with either global (HDAC6−/−, HDAC9−/−, and HDAC6−/−HDAC9−/−), or conditional (fl-Sirt1/CD4-Cre or fl-Sirt1/Foxp3-Cre) HDAC deletion, as well as treatment with isoform-selective HDAC inhibitors. We found that the heat shock response was important for the improvement of Treg suppressive function mediated by HDAC6 inhibition, but not Sirt1 inhibition. Furthermore, although HDAC6, HDAC9, and Sirt1 all deacetylated Foxp3, each protein had diverse effects on transcription factors controlling Foxp3 gene expression. For example, loss of HDAC9 was associated with stabilization of the acetylation of signal transducer and activator of transcription 5 (STAT5) and of its transcriptional activity. Hence, targeting different HDACs increased Treg function by multiple and additive mechanisms, which indicates the therapeutic potential for combinations of HDAC inhibitors in the management of autoimmunity and organ transplantation. PMID:22715468

  9. Insights into the mechanism of FTY720 and compatibility with regulatory T cells for the inhibition of graft-versus-host disease (GVHD).


    Taylor, Patricia A; Ehrhardt, Michael J; Lees, Christopher J; Tolar, Jakub; Weigel, Brenda J; Panoskaltsis-Mortari, Angela; Serody, Jonathan S; Brinkmann, Volker; Blazar, Bruce R


    The immunomodulator FTY720 (FTY) has been shown to be beneficial in experimental models of organ transplantation and autoimmunity. We show that FTY significantly inhibited but did not prevent graft-versus-host disease (GVHD) in lethally irradiated or nonirradiated allogeneic recipients. Although most studies implicate prevention of lymphocyte egress from lymphoid organs as the primary mechanism of action, our data indicate that FTY effects on the host are more likely to be responsible for GVHD inhibition. FTY reduced splenic CD11c+ cells by 50%, and similarly reduced CD4+ and CD8+ T-cell responder frequencies in the spleen early after transplantation. Imaging of GFP+ effectors indicated that FTY modified donor effector T-cell migration to secondary lymphoid organs, but did not uniformly trap T cells in lymph nodes or prevent early effector migration to GVHD parenchymal target organs. Administration of FTY only prior to transplantation inhibited GVHD, indicating that the primary function of FTY may be targeted to host cells. FTY was additive with regulatory T cells for GVHD inhibition. FTY slightly impaired but did not abrogate a graft-versus-leukemia (GVL) effect against C1498, a myeloid leukemia. Our data further define the mechanisms of action and provide insight as to the potential clinical uses of FTY in allogeneic bone marrow transplant recipients.

  10. Mechanical properties of PLA/PCL blends crosslinked by electron beam and TAIC additive

    NASA Astrophysics Data System (ADS)

    Malinowski, Rafał


    Investigation of the effect of electron radiation on selected mechanical properties of polylactide/polycaprolactone blends containing triallyl isocyanurate was the objective of the present paper. It was found that triallyl isocyanurate is an effective agent that hinders phase separation and links macromolecules of both the same and the different polymers. As a consequence of this, strength and modulus of elasticity of studied blends rise, while elongation at break as well as impact strength decrease. Moreover, some mechanical properties of crosslinked polylactide/polycaprolactone blends may also result from the partial degradation of polylactide phase after irradiation.

  11. Global regulatory mechanism underlying the activation of an exon network required for neurogenesis

    PubMed Central

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O’Hanlon, Dave; Yuan-Lin, Zhen; Chen, Ginny I.; Easton, Laura; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J.


    SUMMARY The vertebrate and neural-specific SR-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells, while weakening 3′ splice site recognition and contributing to exon skipping in non-neural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3′ splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  12. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.


    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D


    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  13. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).


    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O


    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  14. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.


    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W


    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  15. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.


    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  16. Flat magnetic exchange springs as mechanism for additional magnetoresistance in magnetic nanoisland arrays

    NASA Astrophysics Data System (ADS)

    Boltaev, A. P.; Pudonin, F. A.; Sherstnev, I. A.; Egorov, D. A.; Kozmin, A. M.


    Process of magnetization and magnetoresistance have been studied in nanoisland bilayer systems of FeNi-Co. Hysteresis loops show characteristic features (steps) most clearly observed in certain orientations of the sample in a magnetic field. To explain these features the concept of flat magnetic exchange spring has been introduced for nanoisland bilayers. It has been proposed that additional magnetoresistance can be the result of spin-dependent scattering of electrons in the area of flat magnetic exchange spring. Magnetoresistance studies of bilayer systems has shown that additional magnetoresistance occurs at the same magnetic fields as steps on hysteresis loops.

  17. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.


    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  18. Ca2+ regulatory mechanisms of exercise protection against coronary artery disease in metabolic syndrome and diabetes

    PubMed Central


    Chronic exercise attenuates coronary artery disease (CAD) in humans largely independent of reductions in risk factors; thus major protective mechanisms of exercise are directly within the coronary vasculature. Further, tight control of diabetes, e.g., blood glucose, can be detrimental. Accordingly, knowledge of mechanisms by which exercise attenuates diabetic CAD could catalyze development of molecular therapies. Exercise attenuates CAD (atherosclerosis) and restenosis in miniature swine models, which enable precise control of exercise parameters (intensity, duration, and frequency) and characterization of the metabolic syndrome (MetS) and diabetic milieu. Intracellular Ca2+ is a pivotal second messenger for coronary smooth muscle (CSM) excitation-contraction and excitation-transcription coupling that modulates CSM proliferation, migration, and calcification. CSM of diabetic dyslipidemic Yucatan swine have impaired Ca2+ extrusion via the plasmalemma Ca2+ ATPase (PMCA), downregulation of L-type voltage-gated Ca2+ channels (VGCC), increased Ca2+ sequestration by the sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA), increased nuclear Ca2+ localization, and greater activation of K channels by Ca2+ release from the SR. Endurance exercise training prevents Ca2+ transport changes with virtually no effect on the diabetic milieu (glucose, lipids). In MetS Ossabaw swine transient receptor potential canonical (TRPC) channels are upregulated and exercise training reverses expression and TRPC-mediated Ca2+ influx with almost no change in the MetS milieu. Overall, exercise effects on Ca2+ signaling modulate CSM phenotype. Future studies should 1) selectively target key Ca2+ transporters to determine definitively their causal role in atherosclerosis and 2) combine mechanistic studies with clinical outcomes, e.g., reduction of myocardial infarction. PMID:21596923

  19. Antiwear performance and mechanism of an oil-miscible ionic liquid as a lubricant additive.


    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter J; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald J


    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential antiwear lubricant additive. Unlike most other ILs that have very low solubility in nonpolar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 °C, showed no corrosive attack to cast iron in an ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8°). Most importantly, this phosphonium-based IL has demonstrated effective antiscuffing and antiwear characteristics when blended with lubricating oils. For example, a 5 wt % addition into a synthetic base oil eliminated the scuffing failure experienced in neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by 3 orders of magnitude. A synergistic effect on wear protection was observed with the current antiwear additive when added into a fully formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL's antiscuffing and antiwear functionality.

  20. Increasing the maximum achievable strain of a covalent polymer gel through the addition of mechanically invisible cross-links.


    Kean, Zachary S; Hawk, Jennifer L; Lin, Shaoting; Zhao, Xuanhe; Sijbesma, Rint P; Craig, Stephen L


    Hydrogels and organogels made from polymer networks are widely used in biomedical applications and soft, active devices for which the ability to sustain large deformations is required. The strain at which polymer networks fracture is typically improved through the addition of elements that dissipate energy, but these materials require extra work to achieve a given, desired level of deformation. Here, the addition of mechanically "invisible" supramolecular crosslinks causes substantial increases in the ultimate gel properties without incurring the added energetic costs of dissipation.

  1. Evidence of unbalanced regulatory mechanism of heart rate and systolic pressure after acute myocardial infarction.


    Nollo, Giandomenico; Faes, Luca; Porta, Alberto; Pellegrini, Barbara; Ravelli, Flavia; Del Greco, Maurizio; Disertori, Marcello; Antolini, Renzo


    The interactions between systolic arterial pressure (SAP) and R-R interval (RR) fluctuations after acute myocardial infarction (AMI) were investigated by measures of synchronization separating the feedback from the feedforward control and capturing both linear and nonlinear contributions. The causal synchronization, evaluating the ability of RR to predict SAP (chi(s/t)) or vice versa (chi(t/s)), and the global synchronization (chi) were estimated at rest and after head-up tilt in 35 post-AMI patients, 20 young and 12 old. Significance and nonlinearity of the coupling were assessed by surrogate data analysis. Tilting increased the number of young subjects in which RR-SAP link was significant (from 17 to 19) and linear (from 11 to 18). In AMI, both significance and linearity of the coupling were low at rest (26 significant and 24 nonlinear) and further reduced after tilt (17 significant and 16 nonlinear). Old subjects showed a partial recovery of linearity after tilt (rest: 1 linear of 7 significant; tilt: 5 linear of 8 significant). In young subjects, the causal synchronization indexes were balanced and increased from rest (chi(t/s) = 0.072 +/- 0.037 and chi(s/t) = 0.054 +/- 0.028) to tilt (chi(t/s) = 0.125 +/- 0.071 and chi(s/t) = 0.108 +/- 0.053). On the contrary, in old subjects and AMI patients, the feedforward was prevalent to the feedback coupling at rest (old: chi(t/s) = 0.041 +/- 0.023 and chi(s/t) = 0.069 +/- 0.042; AMI: chi(t/s) = 0.050 +/- 0.030 and chi(s/t) = 0.089 +/- 0.053). Tilting blunted the unbalance in old subjects (chi(t/s) = 0.065 +/- 0.052 and chi(s/t) = 0.069 +/- 0.044) but not in AMI patients (chi(t/s) = 0.040 +/- 0.019 and chi(s/t) = 0.060 +/- 0.040). Thus, after AMI, nonlinear mechanisms are elicited in RR-SAP interactions. Furthermore, the neural regulation of the cardiovascular system resulted in imbalance as a consequence of impaired feedback and enhanced feedforward control mechanisms.

  2. Process for improving mechanical properties of epoxy resins by addition of cobalt ions

    NASA Technical Reports Server (NTRS)

    Stoakley, D. M.; St.clair, A. K. (Inventor)


    A resin product useful as an adhesive, composite or casting resin is described as well as the process used in its preparation to improve its flexural strength mechanical property characteristics. Improved flexural strength is attained with little or no change in density, thermal stability or moisture resistance by chemically incorporating 1.2% to 10.6% by weight Co(3) ions in an epoxidized resin system.

  3. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.


    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro


    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  4. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications.


    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc


    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH.

  5. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef


    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  6. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.


    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B


    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats.

  7. The regulatory mechanism of fungal elicitor-induced secondary metabolite biosynthesis in medical plants.


    Zhai, Xin; Jia, Min; Chen, Ling; Zheng, Cheng-Jian; Rahman, Khalid; Han, Ting; Qin, Lu-Ping


    A wide range of external stress stimuli trigger plant cells to undergo complex network of reactions that ultimately lead to the synthesis and accumulation of secondary metabolites. Accumulation of such metabolites often occurs in plants subjected to stresses including various elicitors or signal molecules. Throughout evolution, endophytic fungi, an important constituent in the environment of medicinal plants, have known to form long-term stable and mutually beneficial symbiosis with medicinal plants. The endophytic fungal elicitor can rapidly and specifically induce the expression of specific genes in medicinal plants which can result in the activation of a series of specific secondary metabolic pathways resulting in the significant accumulation of active ingredients. Here we summarize the progress made on the mechanisms of fungal elicitor including elicitor signal recognition, signal transduction, gene expression and activation of the key enzymes and its application. This review provides guidance on studies which may be conducted to promote the efficient synthesis and accumulation of active ingredients by the endogenous fungal elicitor in medicinal plant cells, and provides new ideas and methods of studying the regulation of secondary metabolism in medicinal plants.

  8. The route of passive chloride movement across amphibian skin: localization and regulatory mechanisms.


    Nagel, Wolfram; Somieski, Petra; Katz, Uri


    Transepithelial Cl(-) conductance (G(Cl)) in amphibian skin can be activated in several species by serosa positive potentials. Mitochondria-rich cells (MRC) or tight junctions (TJ) between the epithelial cells are possible sites for this pathway. The properties and the techniques used to investigate this pathway are reviewed in the present paper. In situ techniques are preferable, since specific properties of the MRC are apparently not maintained in isolated cells. Volume measurements and electronprobe microanalysis of intracellular ions suggest the localization of voltage-activated G(Cl) to MRC. G(Cl) correlates poorly with the density of MRC. The vibrating voltage probe allows quantitative correlation of the local Cl(-) current through morphologically identified structures and the transepithelial Cl(-) current. Our analysis shows that 80% of the voltage-activated Cl(-) current is accounted for by current through MRC or their immediate vicinity. The activation patterns of this current and the inhibition by the alpha(1)-adrenergic agonist, epinephrine, conform to those of the transepithelial current. However, less than 20% of the MRC are active at a certain moment and the activity is spontaneously variable with time. The molecular nature of this pathway, physiological control mechanisms and their relation to the temporal activity of MRC remain to be studied.

  9. Early decrease in dietary protein:energy ratio by fat addition and ontogenetic changes in muscle growth mechanisms of rainbow trout: short- and long-term effects.


    Alami-Durante, Hélène; Cluzeaud, Marianne; Duval, Carine; Maunas, Patrick; Girod-David, Virginia; Médale, Françoise


    As the understanding of the nutritional regulation of muscle growth mechanisms in fish is fragmentary, the present study aimed to (1) characterise ontogenetic changes in muscle growth-related genes in parallel to changes in muscle cellularity; (2) determine whether an early decrease in dietary protein:energy ratio by fat addition affects the muscle growth mechanisms of rainbow trout (Oncorhynchus mykiss) alevins; and (3) determine whether this early feeding of a high-fat (HF) diet to alevins had a long-term effect on muscle growth processes in juveniles fed a commercial diet. Developmental regulation of hyperplasia and hypertrophy was evidenced at the molecular (expression of myogenic regulatory factors, proliferating cell nuclear antigen and myosin heavy chains (MHC)) and cellular (number and diameter of white muscle fibres) levels. An early decrease in dietary protein:energy ratio by fat addition stimulated the body growth of alevins but led to a fatty phenotype, with accumulation of lipids in the anterior part, and less caudal muscle when compared at similar body weights, due to a decrease in both the white muscle hyperplasia and maximum hypertrophy of white muscle fibres. These HF diet-induced cellular changes were preceded by a very rapid down-regulation of the expression of fast-MHC. The present study also demonstrated that early dietary composition had a long-term effect on the subsequent muscle growth processes of juveniles fed a commercial diet for 3 months. When compared at similar body weights, initially HF diet-fed juveniles indeed had a lower mean diameter of white muscle fibres, a smaller number of large white muscle fibres, and lower expression levels of MyoD1 and myogenin. These findings demonstrated the strong effect of early feed composition on the muscle growth mechanisms of trout alevins and juveniles.

  10. Additional Enhancement of Electric Field in Surface-Enhanced Raman Scattering due to Fresnel Mechanism

    NASA Astrophysics Data System (ADS)

    Jayawardhana, Sasani; Rosa, Lorenzo; Juodkazis, Saulius; Stoddart, Paul R.


    Surface-enhanced Raman scattering (SERS) is attracting increasing interest for chemical sensing, surface science research and as an intriguing challenge in nanoscale plasmonic engineering. Several studies have shown that SERS intensities are increased when metal island film substrates are excited through a transparent base material, rather than directly through air. However, to our knowledge, the origin of this additional enhancement has never been satisfactorily explained. In this paper, finite difference time domain modeling is presented to show that the electric field intensity at the dielectric interface between metal particles is higher for ``far-side'' excitation than ``near-side''. This is reasonably consistent with the observed enhancement for silver islands on SiO2. The modeling results are supported by a simple analytical model based on Fresnel reflection at the interface, which suggests that the additional SERS signal is caused by near-field enhancement of the electric field due to the phase shift at the dielectric interface.

  11. On the mechanism of solubilization of drugs in the presence of poorly soluble additives.


    Boldyrev, V V; Shakhtshneider, T P; Chizhik, S A


    A model is proposed which describes the solubilization of a poorly soluble drug in the presence of an insoluble excipient which forms an easily soluble compound with the drug. For sulfathiazole-calcium carbonate system as an example, it is demonstrated using sulfathiazole single crystals and powdered samples that the presence of insoluble additive causes an increase in dissolution rate and solubility of the drug.

  12. Small GTPases and phosphoinositides in the regulatory mechanisms of macropinosome formation and maturation

    PubMed Central

    Egami, Youhei; Taguchi, Tomohiko; Maekawa, Masashi; Arai, Hiroyuki; Araki, Nobukazu


    Macropinosome formation requires the sequential activation of numerous signaling pathways that coordinate the actin-driven formation of plasma membrane protrusions (ruffles) and circular ruffles (macropinocytic cups), followed by the closure of these macropinocytic cups into macropinosomes. In the process of macropinosome formation, localized productions of phosphoinositides such as PI(4,5)P2 and PI(3,4,5)P3 spatiotemporally orchestrate actin polymerization and rearrangement through recruiting and activating a variety of actin-associated proteins. In addition, the sequential activation of small GTPases, which are known to be master regulators of the actin cytoskeleton, plays a pivotal role in parallel with phosphoinositides. To complete macropinosome formation, phosphoinositide breakdown and Rho GTPase deactivation must occur in appropriate timings. After the nascent macropinosomes are formed, phosphoinositides and several Rab GTPases control macropinosome maturation by regulating vesicle trafficking and membrane fusion. In this review, we summarize recent advances in our understanding of the critical functions of phosphoinositide metabolism and small GTPases in association with their downstream effectors in macropinocytosis. PMID:25324782

  13. Phosphoproteomic analysis of interacting tumor and endothelial cells identifies regulatory mechanisms of transendothelial migration.


    Locard-Paulet, Marie; Lim, Lindsay; Veluscek, Giulia; McMahon, Kelly; Sinclair, John; van Weverwijk, Antoinette; Worboys, Jonathan D; Yuan, Yinyin; Isacke, Clare M; Jørgensen, Claus


    The exit of metastasizing tumor cells from the vasculature, extravasation, is regulated by their dynamic interactions with the endothelial cells that line the internal surface of vessels. To elucidate signals controlling tumor cell adhesion to the endothelium and subsequent transendothelial migration, we performed phosphoproteomic analysis to map cell-specific changes in protein phosphorylation that were triggered by contact between metastatic MDA-MB-231 breast cancer cells and endothelial cells. From the 2669 unique phosphorylation sites identified, 77 and 43 were differentially phosphorylated in the tumor cells and endothelial cells, respectively. The receptor tyrosine kinase ephrin type A receptor 2 (EPHA2) exhibited decreased Tyr(772) phosphorylation in the cancer cells upon endothelial contact. Knockdown of EPHA2 increased adhesion of the breast cancer cells to human umbilical vein endothelial cells (HUVECs) and their transendothelial migration in coculture cell assays, as well as early-stage lung colonization in vivo. EPHA2-mediated inhibition of transendothelial migration of breast cancer cells depended on interaction with the ligand ephrinA1 on HUVECs and phosphorylation of EPHA2-Tyr(772). When EPHA2 phosphorylation dynamics were compared between cell lines of different metastatic ability, EPHA2-Tyr(772) was rapidly dephosphorylated after ephrinA1 stimulation specifically in cells targeting the lung. Knockdown of the phosphatase LMW-PTP reduced adhesion and transendothelial migration of the breast cancer cells. Overall, cell-specific phosphoproteomic analysis provides a bidirectional map of contact-initiated signaling between tumor and endothelial cells that can be further investigated to identify mechanisms controlling the transendothelial cell migration of cancer cells.

  14. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P


    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  15. Effect of nano-additives on microstructure, mechanical properties and wear behaviour of Fe⿿Cr⿿B hardfacing alloy

    NASA Astrophysics Data System (ADS)

    Gou, Junfeng; Lu, Pengpeng; Wang, You; Liu, Saiyue; Zou, Zhiwei


    Fe⿿Cr⿿B hardfacing alloys with different nano-additives content were investigated. The effects of nano-additives on the microstructures of hardfacing alloy were studied by using optical microscope, scanning electron microscope, X-ray diffractometer. The hardness and the fracture toughness of hardfacing alloys were measured, respectively. The sliding wear tests were carried out using a ball-on-disc tribometer. The experimental results showed that primary carbide of hardfacing alloys was refined and its distribution became uniform with content of nano-additives increased. The hardfacing alloys are composed of Cr7C3, Fe7C3, α-Fe and Fe2B according to the results of X-ray diffraction. The hardness of hardfacing alloys increased linearly with the increase of nano-additives. The hardness of the hardfacing alloy with 1.5 wt.% nano-additives increased 54.8% than that of the hardfacing alloy without nano-additives and reached to 1011HV. The KIC of the hardfacing alloy with 0.65 wt.% nano-additives was 15.4 MPam1/2, which reached a maximum. The value increased 57.1% than that of the hardfacing alloy without nano-additives. The wear rates of the hardfacing layer with 0.65 wt.% and 1.0 wt.% nano-additives decreased about 88% than that of the hardfacing layer without nano-additives. The main wear mechanism was adhesion wear.

  16. Just-in-Time Control of Spo0A Synthesis in Bacillus subtilis by Multiple Regulatory Mechanisms ▿ §

    PubMed Central

    Chastanet, Arnaud; Losick, Richard


    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σA-recognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O1, O2, O3, and O4 in reverse order of their proximity to the coding sequence. Here we report that O1 is responsible for repressing Pv during the transition to stationary phase, that O2 is responsible for repressing Ps during growth, that O3 is responsible for activating Ps at the start of sporulation, and that O4 is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from Pv is impeded due to RNA secondary structure whereas mRNAs originating from Ps are fully competent for protein synthesis. We propose that the opposing actions of O2 and O3 and the enhanced translatability of mRNAs originating from Ps create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation. PMID:21949067

  17. Regulatory mechanism of gallic acid against advanced glycation end products induced cardiac remodeling in experimental rats.


    Umadevi, Subramanian; Gopi, Venkatachalam; Elangovan, Vellaichamy


    Advanced glycation end products (AGEs) play a major role in the development of cardiovascular disorders in diabetic patients. Recent studies evidenced the beneficial role of phytochemicals in reducing the risk of cardiovascular diseases. Hence the present study was framed to investigate the protective role of Gallic acid (GA) on AGEs induced cardiac fibrosis. Rats were infused with in vitro prepared AGEs (50mg/kg BW-intravenous injection) for 30 days. Further, GA (25mg/kgBW) was administered to rats along with AGEs. On infusion of AGEs, induction of fibrotic markers, collagen deposition, oxidative marker NADPH oxidase (NOX-p47 phox subunit), AGE receptor (RAGE) and cytokines expression was evaluated in the heart tissues using RT-PCR, Western blot and immunostaining methods. AGEs infusion significantly (P<0.01) increased the HW/BW ratio and fibrosis (4-fold) with increased expression of matrix genes MMP-2 and -9 (P<0.01, respectively) in the heart tissues. Whereas, administration of GA along with AGEs infusion prevented the fibrosis induced by AGEs. Further, GA treatment effectively prevented the AGEs mediated up-regulation of pro-fibrotic genes and ECM proteins such as TNF-α, TGF-β, MMP-2 and -9 expression. In addition, the increased expression of NOX (P<0.01), RAGE (P<0.01), NF-κB (P<0.01) and ERK 1/2 on AGEs infusion were normalized by GA treatment. Thus the present study shows the protective effect of GA on the fibrotic response and cardiac remodeling process induced by advanced glycation end products from external sources.

  18. Cellular Interrogation: Exploiting Cell-to-Cell Variability to Discriminate Regulatory Mechanisms in Oscillatory Signalling

    PubMed Central

    Gibson, Daniel; Chang, Frederick; Gnad, Florian; Gunawardena, Jeremy


    The molecular complexity within a cell may be seen as an evolutionary response to the external complexity of the cell’s environment. This suggests that the external environment may be harnessed to interrogate the cell’s internal molecular architecture. Cells, however, are not only nonlinear and non-stationary, but also exhibit heterogeneous responses within a clonal, isogenic population. In effect, each cell undertakes its own experiment. Here, we develop a method of cellular interrogation using programmable microfluidic devices which exploits the additional information present in cell-to-cell variation, without requiring model parameters to be fitted to data. We focussed on Ca2+ signalling in response to hormone stimulation, which exhibits oscillatory spiking in many cell types and chose eight models of Ca2+ signalling networks which exhibit similar behaviour in simulation. We developed a nonlinear frequency analysis for non-stationary responses, which could classify models into groups under parameter variation, but found that this question alone was unable to distinguish critical feedback loops. We further developed a nonlinear amplitude analysis and found that the combination of both questions ruled out six of the models as inconsistent with the experimentally-observed dynamics and heterogeneity. The two models that survived the double interrogation were mathematically different but schematically identical and yielded the same unexpected predictions that we confirmed experimentally. Further analysis showed that subtle mathematical details can markedly influence non-stationary responses under parameter variation, emphasising the difficulty of finding a “correct” model. By developing questions for the pathway being studied, and designing more versatile microfluidics, cellular interrogation holds promise as a systematic strategy that can complement direct intervention by genetics or pharmacology. PMID:27367445

  19. Late Chondritic Additions and Planet and Planetesimal Growth: Evaluation of Physical and Chemical Mechanisms

    NASA Technical Reports Server (NTRS)

    Righter, Kevin


    Studies of terrestrial peridotite and martian and achondritic meteorites have led to the conclusion that addition of chondritic material to growing planets or planetesimals, after core formation, occurred on Earth, Mars, asteroid 4 Vesta, and the parent body of the angritic meteorites [1-4]. One study even proposed that this was a common process in the final stages of growth [5]. These conclusions are based almost entirely on the highly siderophile elements (HSE; Re, Au, Pt, Pd, Rh, Ru, Ir, Os). The HSE are a group of eight elements that have been used to argue for late accretion of chondritic material to the Earth after core formation was complete (e.g., [6]). This idea was originally proposed because the D(metal/silicate) values for the HSE are so high, yet their concentration in the mantle is too high to be consistent with such high Ds. The HSE also are present in chondritic relative abundances and hence require similar Ds if this is the result of core-mantle equilibration. Since the work of [6] there has been a realization that core formation at high PT conditions can explain the abundances of many siderophile elements in the mantle (e.g., [7]), but such detailed high PT partitioning data are lacking for many of the HSE to evaluate whether such ideas are viable for all four bodies. Consideration of other chemical parameters reveals larger problems that are difficult to overcome, but must be addressed in any scenario which calls on the addition of chondritic material to a reduced mantle. Yet these problems are rarely discussed or emphasized, making the late chondritic (or late veneer) addition hypothesis suspect.

  20. Investigation of gamma ray shielding efficiency and mechanical performances of concrete shields containing bismuth oxide as an environmentally friendly additive

    NASA Astrophysics Data System (ADS)

    Yao, Ya; Zhang, Xiaowen; Li, Mi; Yang, Rong; Jiang, Tianjiao; Lv, Junwen


    Concrete has a proven ability to attenuate gamma rays and neutrons without compromising structural property; therefore, it is widely used as the primary shielding material in many nuclear facilities. Recently, there is a tendency toward using various additives to enhance the shielding properties of these concrete mixtures. However, most of these additives being used either pose hygiene hazards or require special handling processes. It would be ideal if environmentally friendly additives were available for use. The bismuth oxide (Bi2O3) additive shows promise in various shielding applications due to its proven radiation attenuation ability and environmentally friendly nature. To the best of our knowledge, however, Bi2O3 has never been used in concrete mixtures. Therefore, for this research, we fabricated the Bi2O3-based concrete mixtures by adding Bi2O3 powder in the ordinary concrete mixture. Concrete mixtures with lead oxide (PbO) additives were used for comparison. Radiation shielding parameters like the linear attenuation coefficients (LAC) of all these concrete mixtures showing the effects of the Bi2O3 additions are presented. The mechanical performances of concrete mixtures incorporated with Bi2O3 additive were also investigated. It suggested that the concrete mixture containing 25% Bi2O3 powder (B5 in this study) provided the best shielding capacity and mechanical performance among other mixes. It has a significant potential for application as a structural concrete where radiological protection capability is required.

  1. MicroRNA Regulatory Mechanisms on Citrus sinensis leaves to Magnesium-Deficiency

    PubMed Central

    Ma, Cui-Lan; Qi, Yi-Ping; Liang, Wei-Wei; Yang, Lin-Tong; Lu, Yi-Bin; Guo, Peng; Ye, Xin; Chen, Li-Song


    Magnesium (Mg)-deficiency, which affects crop productivity and quality, widespreadly exists in many agricultural crops, including citrus. However, very limited data are available on Mg-deficiency-responsive microRNAs (miRNAs) in higher plants. Using Illumina sequencing, we isolated 75 (73 known and 2 novel) up- and 71 (64 known and 7 novel) down-regulated miRNAs from Mg-deficient Citrus sinensis leaves. In addition to the remarkable metabolic flexibility as indicated by the great alteration of miRNA expression, the adaptive responses of leaf miRNAs to Mg-deficiency might also involve the following several aspects: (a) up-regulating stress-related genes by down-regulating miR164, miR7812, miR5742, miR3946, and miR5158; (b) enhancing cell transport due to decreased expression of miR3946 and miR5158 and increased expression of miR395, miR1077, miR1160, and miR8019; (c) activating lipid metabolism-related genes by repressing miR158, miR5256, and miR3946; (d) inducing cell wall-related gene expansin 8A by repressing miR779; and (e) down-regulating the expression of genes involved in the maintenance of S, K and Cu by up-regulating miR395 and miR6426. To conclude, we isolated some new known miRNAs (i.e., miR7812, miR8019, miR6218, miR1533, miR6426, miR5256, miR5742, miR5561, miR5158, and miR5818) responsive to nutrient deficiencies and found some candidate miRNAs that might contribute to Mg-deficiency tolerance. Therefore, our results not only provide novel information about the responses of plant to Mg-deficiency, but also are useful for obtaining the key miRNAs for plant Mg-deficiency tolerance. PMID:26973661

  2. Miniaturization of cellulose fibers and effect of addition on the mechanical and barrier properties of hydroxypropyl methylcellulose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose fibers were miniaturized by microfluidics technology and incorporated in hydroxypropyl methylcellulose (HPMC) films to study the effect of the addition of such fibers on the mechanical and barrier properties of HPMC films suitable for food packaging applications. The particle size of the f...

  3. Additional Enhancement of Electric Field in Surface-Enhanced Raman Scattering due to Fresnel Mechanism

    PubMed Central

    Jayawardhana, Sasani; Rosa, Lorenzo; Juodkazis, Saulius; Stoddart, Paul R.


    Surface-enhanced Raman scattering (SERS) is attracting increasing interest for chemical sensing, surface science research and as an intriguing challenge in nanoscale plasmonic engineering. Several studies have shown that SERS intensities are increased when metal island film substrates are excited through a transparent base material, rather than directly through air. However, to our knowledge, the origin of this additional enhancement has never been satisfactorily explained. In this paper, finite difference time domain modeling is presented to show that the electric field intensity at the dielectric interface between metal particles is higher for “far-side” excitation than “near-side”. This is reasonably consistent with the observed enhancement for silver islands on SiO2. The modeling results are supported by a simple analytical model based on Fresnel reflection at the interface, which suggests that the additional SERS signal is caused by near-field enhancement of the electric field due to the phase shift at the dielectric interface. PMID:23903714

  4. Mechanical behaviour of pressed and sintered titanium alloys obtained from master alloy addition powders.


    Bolzoni, L; Esteban, P G; Ruiz-Navas, E M; Gordo, E


    The fabrication of the workhorse Ti-6Al-4V alloy and of the Ti-3Al-2.5V alloy was studied considering the master alloy addition variant of the blending elemental approach conventionally used for titanium powder metallurgy. The powders were characterised by means thermal analysis and X-ray diffraction and shaped by means of uniaxial pressing. The microstructural evolution with the sintering temperature (900-1400 °C) was evaluated by SEM and EDS was used to study the composition. XRD patterns as well as the density by Archimedes method were also obtained. The results indicate that master alloy addition is a suitable way to fabricate well developed titanium alloy but also to produce alloy with the desired composition, not available commercially. Density of 4.3 g/cm³ can be obtained where a temperature higher than 1200 °C is needed for the complete diffusion of the alloying elements. Flexural properties comparable to those specified for wrought Ti-6Al-4V medical devices are, generally, obtained.

  5. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.


    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W


    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses.

  6. Mechanism of wiggling enhancement due to HBr gas addition during amorphous carbon etching

    NASA Astrophysics Data System (ADS)

    Kofuji, Naoyuki; Ishimura, Hiroaki; Kobayashi, Hitoshi; Une, Satoshi


    The effect of gas chemistry during etching of an amorphous carbon layer (ACL) on wiggling has been investigated, focusing especially on the changes in residual stress. Although the HBr gas addition reduces critical dimension loss, it enhances the surface stress and therefore increases wiggling. Attenuated total reflectance Fourier transform infrared spectroscopy revealed that the increase in surface stress was caused by hydrogenation of the ACL surface with hydrogen radicals. Three-dimensional (3D) nonlinear finite element method analysis confirmed that the increase in surface stress is large enough to cause the wiggling. These results also suggest that etching with hydrogen compound gases using an ACL mask has high potential to cause the wiggling.

  7. Effect of Zr addition on the mechanical characteristics and wear resistance of Al grain refined by Ti after extrusion

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Al-Qawabah, S. M. A.


    Aluminum and its alloys are normally grain refined by Ti or Ti+B to transfer their columnar structure during solidification into equiaxed one which improves their mechanical behavior and surface quality. In this paper, the effect of addition of Zr on the metallurgical, and mechanical aspects, hardness, ductility and wear resistance of commercially pure aluminum grain refined by Ti after extrusion is investigated. Zr was added at a level of 0.1% which corresponds to the peretectic limit at the Al-Zr phase diagram. The experimental work was carried out on the specimens after direct extrusion. It was found that addition of Ti resulted in decrease of Al grain size, whereas addition of Zr alone or in the presence of Ti, resulted in reduction of Al grain size. This led to increase of Al hardness. The effect of the addition of Ti or Zr alone resulted almost in the same enhancement of Al mechanical characteristics. As for the strain hardening index,n, increase was obtained when Zr was added alone or in the presence of Ti. Hence pronounced improvement of its formability. Regarding the effect of Zr addition on the wear resistance of aluminum; it was found that at small loads and speeds addition of Ti or Zr or both together resulted in deterioration of its wear resistance whereas at higher loads and speeds resulted in pronounced improvement of its wear resistance. Finally, the available Archard model and the other available models which consider only the mass loss failed to describe the wear mechanism of Al and its micro-alloys because they do not consider the mushrooming effect at the worn end.

  8. Unravelling the impact of hydrocarbon structure on the fumarate addition mechanism--a gas-phase ab initio study.


    Bharadwaj, Vivek S; Vyas, Shubham; Villano, Stephanie M; Maupin, C Mark; Dean, Anthony M


    The fumarate addition reaction mechanism is central to the anaerobic biodegradation pathway of various hydrocarbons, both aromatic (e.g., toluene, ethyl benzene) and aliphatic (e.g., n-hexane, dodecane). Succinate synthase enzymes, which belong to the glycyl radical enzyme family, are the main facilitators of these biochemical reactions. The overall catalytic mechanism that converts hydrocarbons to a succinate molecule involves three steps: (1) initial H-abstraction from the hydrocarbon by the radical enzyme, (2) addition of the resulting hydrocarbon radical to fumarate, and (3) hydrogen abstraction by the addition product to regenerate the radical enzyme. Since the biodegradation of hydrocarbon fuels via the fumarate addition mechanism is linked to bio-corrosion, an improved understanding of this reaction is imperative to our efforts of predicting the susceptibility of proposed alternative fuels to biodegradation. An improved understanding of the fuel biodegradation process also has the potential to benefit bioremediation. In this study, we consider model aromatic (toluene) and aliphatic (butane) compounds to evaluate the impact of hydrocarbon structure on the energetics and kinetics of the fumarate addition mechanism by means of high level ab initio gas-phase calculations. We predict that the rate of toluene degradation is ∼100 times faster than butane at 298 K, and that the first abstraction step is kinetically significant for both hydrocarbons, which is consistent with deuterium isotope effect studies on toluene degradation. The detailed computations also show that the predicted stereo-chemical preference of the succinate products for both toluene and butane are due to the differences in the radical addition rate constants for the various isomers. The computational and kinetic modeling work presented here demonstrates the importance of considering pre-reaction and product complexes in order to accurately treat gas phase systems that involve intra and inter

  9. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed


    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  10. Regulatory Mechanisms of the Ihh/PTHrP Signaling Pathway in Fibrochondrocytes in Entheses of Pig Achilles Tendon

    PubMed Central

    Han, Xuesong; Zhuang, Yanfeng; Zhang, Zhihong


    This study is aimed at exploring the effect of stress stimulation on the proliferation and differentiation of fibrochondrocytes in entheses mediated via the Indian hedgehog (Ihh)/parathyroid hormone-related protein (PTHrP) signaling pathway. Differential stress stimulation on fibrochondrocytes in entheses was imposed. Gene expression and protein levels of signaling molecules including collagen type I (Col I), Col II, Col X, Ihh, and PTHrP in the cytoplasm of fibrochondrocytes were detected. Ihh signal blocking group was set up using Ihh signaling pathway-specific blocking agent cyclopamine. PTHrP enhancement group was set up using PTHrP reagent. Ihh/PTHrP double intervention group, as well as control group, was included to study the regulatory mechanisms of the Ihh/PTHrP signaling pathway in fibrochondrocytes. Under low cyclic stress tensile (CTS), PTHrP, Col I, and Col II gene expression and protein synthesis increased. Under high CTS, Ihh and Col X gene expression and protein synthesis increased. Blocking Ihh signaling with cyclopamine resulted in reduced PTHrP gene expression and protein synthesis and increased Col X gene expression and protein synthesis. Ihh and PTHrP coregulate fibrochondrocyte proliferation and differentiation in entheses through negative feedback regulation. Fibrochondrocyte is affected by the CTS. This phenomenon is regulated by stress stimulation through the Ihh/PTHrP signaling pathway. PMID:27994624

  11. Enhancing water repellence and mechanical properties of gelatin films by tannin addition.


    Peña, Cristina; de la Caba, Koro; Eceiza, Arantxa; Ruseckaite, Roxana; Mondragon, Iñaki


    In order to reduce pollution caused by traditional non-biodegradable plastic films, renewable raw materials from plants and wastes of meat industries have been employed in this work. A hydrolysable chestnut-tree tannin was used for gelatin modification. Films of gelatin and gelatin-tannin were obtained by casting at room conditions. Transition temperatures of both gelatin and gelatin-tannin systems were determined by differential scanning calorimetry (DSC). Glass transition temperatures of modified gelatin occurred at higher temperatures than for neat gelatin. Enthalpy and temperature of helix-coil transition decreased when tannin content increased due to variations in the helical structure of gelatin as a consequence of tannin presence in agreement with X-ray analysis. Mechanical and thermal behaviour varied as a function of the content of tannin, showing optimum values for films modified with 10 wt% tannin. The transparency of films was maintained after modification with tannin. Solubility and swelling tests of the films revealed that the presence of tannin reduced the water affinity of gelatin.

  12. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties.


    Gupta, Bhavana; Kumar, N; Panda, Kalpataru; Dash, S; Tyagi, A K


    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication.

  13. Energy efficient reduced graphene oxide additives: Mechanism of effective lubrication and antiwear properties

    PubMed Central

    Gupta, Bhavana; Kumar, N.; Panda, Kalpataru; Dash, S.; Tyagi, A. K.


    Optimized concentration of reduced graphene oxide (rGO) in the lube is one of the important factors for effective lubrication of solid body contacts. At sufficiently lower concentration, the lubrication is ineffective and friction/wear is dominated by base oil. In contrast, at sufficiently higher concentration, the rGO sheets aggregates in the oil and weak interlayer sliding characteristic of graphene sheets is no more active for providing lubrication. However, at optimized concentration, friction coefficient and wear is remarkably reduced to 70% and 50%, respectively, as compared to neat oil. Traditionally, such lubrication is described by graphene/graphite particle deposited in contact surfaces that provides lower shear strength of boundary tribofilm. In the present investigation, graphene/graphite tribofilm was absent and existing traditional lubrication mechanism for the reduction of friction and wear is ruled out. It is demonstrated that effective lubrication is possible, if rGO is chemically linked with PEG molecules through hydrogen bonding and PEG intercalated graphene sheets provide sufficiently lower shear strength of freely suspended composite tribofilm under the contact pressure. The work revealed that physical deposition and adsorption of the graphene sheets in the metallic contacts is not necessary for the lubrication. PMID:26725334

  14. Mechanisms by Which B Cells and Regulatory T Cells Influence Development of Murine Organ-Specific Autoimmune Diseases

    PubMed Central

    Ellis, Jason S.; Braley-Mullen, Helen


    Experiments with B cell-deficient (B−/−) mice indicate that a number of autoimmune diseases require B cells in addition to T cells for their development. Using B−/− Non-obese diabetic (NOD) and NOD.H-2h4 mice, we demonstrated that development of spontaneous autoimmune thyroiditis (SAT), Sjogren’s syndrome and diabetes do not develop in B−/− mice, whereas all three diseases develop in B cell-positive wild-type (WT) mice. B cells are required early in life, since reconstitution of adult mice with B cells or autoantibodies did not restore their ability to develop disease. B cells function as important antigen presenting cells (APC) to initiate activation of autoreactive CD4+ effector T cells. If B cells are absent or greatly reduced in number, other APC will present the antigen, such that Treg are preferentially activated and effector T cells are not activated. In these situations, B−/− or B cell-depleted mice develop the autoimmune disease when T regulatory cells (Treg) are transiently depleted. This review focuses on how B cells influence Treg activation and function, and briefly considers factors that influence the effectiveness of B cell depletion for treatment of autoimmune diseases. PMID:28134752

  15. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    NASA Astrophysics Data System (ADS)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.


    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  16. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.


    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline


    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  17. Simulating molecular mechanisms of the MDM2-mediated regulatory interactions: a conformational selection model of the MDM2 lid dynamics.


    Verkhivker, Gennady M


    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between "closed" and "semi-closed" lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of "semi-closed" conformations. The dominant "semi-closed" lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation would require

  18. The effect of W and N addition on the mechanical properties of 10Cr steels

    NASA Astrophysics Data System (ADS)

    Kim, Sung Ho; Song, B. J.; Ryu, Woo Seog


    The effect of W and N on the creep properties and microstructural degradation in 10Cr steels was studied. Creep testing was performed to determine the creep rupture strength and minimum creep rate. Transmission electron microscopy was used to observe the microstructural degradation during the creep deformation. W and N which were added to the 10Cr steel increased the creep rupture strength and decreased the minimum creep rate. As W and N were added, the thermal stability of the subgrain and carbide was improved, thus the growth of the subgrain and carbide during creep deformation was restricted. In W added steel, the Laves phase played an important role in increasing creep rupture strength. But the impact toughness was rapidly degraded by the addition of W after aging at 600°C for 5000 hours. So one must evaluate more accurately the effect of the Laves phase on long term creep and impact properties. In N added steel, V(C, N) was precipitated in the lath boundary and within the lath. The size of the precipitates was 20-50 nm. The increase of creep rupture strength in N added steel may be due to the precipitate of the V(C, N). Future tests are required to clarify the effect of N on creep and impact properties.

  19. Mechanisms of nitrite addition for simultaneous sludge fermentation/nitrite removal (SFNR).


    Wu, Chengcheng; Peng, Yongzhen; Wang, Shuying; Li, Baikun; Zhang, Liang; Cao, Shenbin; Du, Rui


    Simultaneous sludge fermentation and nitrite removal (SFNR) was investigated as a novel sludge/wastewater treatment process with high nitrogen concentrations. The results showed that introducing nitrite improved the primary sludge (PS) fermentation system by improving the chemical oxygen demand (COD) yields and the volatile suspend solid (VSS) reduction. At a nitrite dosage of 0.2 g g SS(-1), the COD production was 1.02 g g VSS(-1) and the VSS reduction was 63.4% within 7-day fermentation, while the COD production was only 0.17 g g VSS(-1) and the VSS reduction was only 4.9% in the blank test. Nitrite contained in wastewater was removed through denitrification process in the SFNR system. The solubility of carbohydrate and protein was substantially enhanced, and their contents reached the peak once nitrite was consumed. In addition, the nutrient release and methane generation were inhibited in the SFNR system, which alleviated the environmental pollution. Unlike traditional fermentation systems, neither alkaline condition nor high free nitrite acid (FNA) concentration affected the PS fermentation in the SFNR system. Molecular weight distribution (MWD) and Live/Dead cell analysis indicated that the sludge disruption by nitrite and the consumption of soluble organic substances in sludge might play important roles in SFNR.

  20. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.


    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong


    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  1. Antipsychotic drugs disrupt normal development in Caenorhabditis elegans via additional mechanisms besides dopamine and serotonin receptors

    PubMed Central

    Donohoe, Dallas R.; Aamodt, Eric J.; Osborn, Elizabeth; Dwyer, Donard S.


    Antipsychotic drugs may produce adverse effects during development in humans and rodents. However, the extent of these effects has not been systematically characterized nor have molecular mechanisms been identified. Consequently, we sought to evaluate the effects of an extensive panel of antipsychotic drugs in a model organism, C. elegans, whose development is well characterized, and which offers the possibility of identifying novel molecular targets. For these studies, animals were grown from hatching in the presence of vehicle (control) or antipsychotic drugs over a range of concentrations (20–160 μM) and growth was analyzed by measuring head-to-tail length at various intervals. First-generation antipsychotics (e.g., fluphenazine) generally slowed growth and maturation more than second-generation drugs such as quetiapine, and olanzapine. This is consistent with in vitro effects on human neuronal cell lines. Clozapine, a second-generation drug, produced similar growth deficits as haloperidol. Converging lines of evidence, including the failure to rescue growth with high concentrations of agonists, suggested that the drug-induced delay in development was not mediated by the major neurotransmitter receptors recognized by the antipsychotic drugs. Moreover, in serotonin-deficient tph-1 mutants, the drugs dramatically slowed development and led to larval arrest (including dauer formation), and neuronal abnormalities. Evaluation of alternative targets of the antipsychotics revealed a potential role for calmodulin and underscored the significance of Ca2+-calmodulin signaling in development. These findings suggest that antipsychotic drugs may interfere with normal developmental processes, and provide a tool for investigating the key signaling pathways involved. PMID:16962336

  2. Effect of boron addition on injection molded 316L stainless steel: mechanical, corrosion properties and in vitro bioactivity.


    Bayraktaroglu, Esra; Gulsoy, H Ozkan; Gulsoy, Nagihan; Er, Ozay; Kilic, Hasan


    The research was investigated the effect of boron additions on sintering characteristics, mechanical, corrosion properties and biocompatibility of injection molded austenitic grade 316L stainless steel. Addition of boron is promoted to get high density of sintered 316L stainless steels. The amount of boron plays a role in determining the sintered microstructure and all properties. In this study, 316L stainless steel powders have been used with the elemental NiB powders. A feedstock containing 62.5 wt% powders loading was molded at different injection molded temperature. The binders were completely removed from molded components by solvent and thermal debinding at different temperature. The debinded samples were sintered at different temperature for 60 min. Mechanical property, microstructural characterization and electrochemical property of the sintered samples were performed using tensile testing, hardness, optical, scanning electron microscopy and electrochemical corrosion experiments. Sintered samples were immersed in a simulated body fluid (SBF) with elemental concentrations that were comparable to those of human blood plasma for a total period of 15 days. Both materials were implanted in fibroblast culture for biocompatibility evaluations were carried out. Results of study showed that sintered 316L and 316L with NiB addition samples exhibited high mechanical and corrosion properties in a physiological environment. Especially, 316L with NiB addition can be used in some bioapplications.

  3. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.


    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás


    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN;, to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases.

  4. Effects of Sn addition on the microstructure, mechanical properties and corrosion behavior of Ti–Nb–Sn alloys

    SciTech Connect

    Moraes, Paulo E.L.; Contieri, Rodrigo J.; Lopes, Eder S.N.; Robin, Alain; Caram, Rubens


    Ti and Ti alloys are widely used in restorative surgery because of their good biocompatibility, enhanced mechanical behavior and high corrosion resistance in physiological media. The corrosion resistance of Ti-based materials is due to the spontaneous formation of the TiO{sub 2} oxide film on their surface, which exhibits elevated stability in biological fluids. Ti–Nb alloys, depending on the composition and the processing routes to which the alloys are subjected, have high mechanical strength combined with low elastic modulus. The addition of Sn to Ti–Nb alloys allows the phase transformations to be controlled, particularly the precipitation of ω phase. The aim of this study is to discuss the microstructure, mechanical properties and corrosion behavior of cast Ti–Nb alloys to which Sn has been added. Samples were centrifugally cast in a copper mold, and the microstructure was characterized using optical microscopy, scanning electron microscopy and X-ray diffractometry. Mechanical behavior evaluation was performed using Berkovich nanoindentation, Vickers hardness and compression tests. The corrosion behavior was evaluated in Ringer's solution at room temperature using electrochemical techniques. The results obtained suggested that the physical, mechanical and chemical behaviors of the Ti–Nb–Sn alloys are directly dependent on the Sn content. - Graphical abstract: Effects of Sn addition to the Ti–30Nb alloy on the elastic modulus. - Highlights: • Sn addition causes reduction of the ω phase precipitation. • Minimum Vickers hardness and elastic modulus occurred for 6 wt.% Sn content. • Addition of 6 wt.% Sn resulted in maximum ductility and minimum compression strength. • All Ti–30Nb–XSn (X = 0, 2, 4, 6, 8 and 10%) alloys are passive in Ringer's solution. • Highest corrosion resistance was observed for 6 wt.% Sn content.

  5. Mechanical and Electrical Properties of a Polyimide Film Significantly Enhanced by the Addition of Single-Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Meador, Michael A.


    Single-wall carbon nanotubes have been shown to possess a combination of outstanding mechanical, electrical, and thermal properties. The use of carbon nanotubes as an additive to improve the mechanical properties of polymers and/or enhance their thermal and electrical conductivity has been a topic of intense interest. Nanotube-modified polymeric materials could find a variety of applications in NASA missions including large-area antennas, solar arrays, and solar sails; radiation shielding materials for vehicles, habitats, and extravehicular activity suits; and multifunctional materials for vehicle structures and habitats. Use of these revolutionary materials could reduce vehicle weight significantly and improve vehicle performance and capabilities.

  6. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.


    Chastanet, Arnaud; Losick, Richard


    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.

  7. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei


    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  8. The effect of boron addition on microstructure and mechanical properties of biomedical Ti35Nb6Ta alloy

    SciTech Connect

    Málek, Jaroslav; Hnilica, František; Veselý, Jaroslav; Smola, Bohumil; Březina, Vítězslav


    The beta-titanium alloys are promising materials for bioapplications but their processing via melting is difficult. Coarse grains have been observed in as-cast specimens. Subsequent thermo-mechanical processing seems to be necessary in order to obtain fine-grained microstructure with better mechanical properties. The grain size can be decreased significantly by addition of small boron amount. In this work Ti–35Nb–6Ta alloy with various B additions (0, 0.05, 0.1, 0.3 and 0.5 wt.%) has been studied. Even the smallest amount of B leads to significant grain refinement in Ti–35Nb–6Ta alloy (from 1300 to about 350 μm). Slight grain refinement has been observed also after hot forging and solution treatment. TiB particles emerged in specimens due to B addition. These particles contribute to changes in mechanical properties not only in hot forged and solution treated specimens (hardness increase from 140 to 180 HV10), but also in cold swaged specimens (hardness from 230 to 250 HV10, tensile strength from 800 to 920 MPa). The hardness values can be increased up to 370 HV10 during aging at 400 °C (specimen with 0.5 wt.% B). It has been observed that specimens with low boron addition 0.05 wt.% possess no cytotoxicity. On the other hand in specimens with 0.1 wt.% B or more slight adverse effect on cytotoxicity has been observed. - Highlights: • The influence of boron on microstructure and mechanical properties has been studied. • Beta-transus temperature has been determined. • Cytotoxicity depending on boron content has been evaluated. • Possibility of final heat treatment has been determined.

  9. Bifurcational Mechanism of Multistability Formation and Frequency Entrainment in a van der Pol Oscillator with an Additional Oscillatory Circuit

    NASA Astrophysics Data System (ADS)

    Astakhov, Sergey; Astakhov, Oleg; Astakhov, Vladimir; Kurths, Jürgen


    In this paper, the bifurcational mechanism of frequency entrainment in a van der Pol oscillator coupled with an additional oscillatory circuit is studied. It is shown that bistability observed in the system is based on two bifurcations: a supercritical Andronov-Hopf bifurcation and a sub-critical Neimark-Sacker bifurcation. The attracting basin boundaries are determined by stable and unstable invariant manifolds of a saddle two-dimensional torus.

  10. Identification of an additional ferric-siderophore uptake gene clustered with receptor, biosynthesis, and fur-like regulatory genes in fluorescent Pseudomonas sp. strain M114.

    PubMed Central

    O'Sullivan, D J; Morris, J; O'Gara, F


    Five cosmid clones with insert sizes averaging 22.6 kilobases (kb) were isolated after complementation of 22 Tn5-induced Sid- mutants of Pseudomonas sp. strain M114. One of these plasmids (pMS639) was also shown to encode ferric-siderophore receptor and dissociation functions. The receptor gene was located on this plasmid since introduction of the plasmid into three wild-type fluorescent pseudomonads enabled them to utilize the ferric-siderophore from strain M114. The presence of an extra iron-regulated protein in the outer membrane profile of one of these strains was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A ferric-siderophore dissociation gene was attributed to pMS639 since it complemented the ferric-siderophore uptake mutation in strain M114FR2. This mutant was not defective in the outer membrane receptor for ferric-siderophore but apparently accumulated ferric-siderophore internally. Since ferric-citrate alleviated the iron stress of the mutant, there was no defect in iron metabolism subsequent to release of iron from the ferric-siderophore complex. Consequently, this mutant was defective in ferric-siderophore dissociation. A fur-like regulatory gene also present on pMS639 was subcloned to a 7.0-kb BglII insert of pCUP5 and was located approximately 7.3 kb from the receptor region. These results established that the 27.2-kb insert of pMS639 encoded at least two siderophore biosynthesis genes, ferric-siderophore receptor and dissociation genes, and a fur-like regulatory gene from the biocontrol fluorescent Pseudomonas sp. strain M114. Images PMID:2143887

  11. Additive manufacturing and mechanical characterization of graded porosity scaffolds designed based on triply periodic minimal surface architectures.


    Afshar, M; Anaraki, A Pourkamali; Montazerian, H; Kadkhodapour, J


    Since the advent of additive manufacturing techniques, triply periodic minimal surfaces have emerged as a novel tool for designing porous scaffolds. Whereas scaffolds are expected to provide multifunctional performance, spatially changing pore patterns have been a promising approach to integrate mechanical characteristics of different architectures into a unique scaffold. Smooth morphological variations are also frequently seen in nature particularly in bone and cartilage structures and can be inspiring for designing of artificial tissues. In this study, we carried out experimental and numerical procedures to uncover the mechanical properties and deformation mechanisms of linearly graded porosity scaffolds for two different mathematically defined pore structures. Among TPMS-based scaffolds, P and D surfaces were subjected to gradient modeling to explore the mechanical responses for stretching and bending dominated deformations, respectively. Moreover, the results were compared to their corresponding uniform porosity structures. Mechanical properties were found to be by far greater for the stretching dominated structure (P-Surface). For bending dominated architecture (D-Surface), although there was no global fracture for uniform structures, graded structure showed a brittle fracture at 0.08 strain. A layer by layer deformation mechanism for stretching dominated structure was observed. For bending dominated scaffolds, deformation was accompanied by development of 45° shearing bands. Finite element simulations were also performed and the results showed a good agreement with the experimental observations.

  12. The Escherichia coli L-arabinose operon: binding sites of the regulatory proteins and a mechanism of positive and negative regulation.


    Ogden, S; Haggerty, D; Stoner, C M; Kolodrubetz, D; Schleif, R


    The locations of DNA binding by the proteins involved with positive and negative regulation of transcription initiation of the L-arabinose operon in Escherichia coli have been determined by the DNase I protection method. Two cyclic AMP receptor protein sites were found, at positions -78 to -107 and -121 to -146, an araC protein--arabinose binding site was found at position -40 to -78, and an araC protein-fucose binding site was found at position -106 to -144. These locations, combined with in vivo data on induction of the two divergently oriented arabinose promoters, suggest the following regulatory mechanism: induction of the araBAD operon occurs when cyclic AMP receptor protein, araC protein, and RNA polymerase are all present and able to bind to DNA. Negative regulation is accomplished by the repressing form of araC protein binding to a site in the regulatory region such that it stimultaneously blocks access of cyclic AMP receptor protein to two sites on the DNA, one site of which serves each of the two promoters. Thus, from a single operator site, the negative regulator represses the two outwardly oriented ara promoters. This regulatory mechanism explains the known positive and negative regulatory properties of the ara promoters.

  13. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.


    Peón, Alberto N; Terrazas, Luis I


    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  14. Influence of additional coupling agent on the mechanical properties of polyester-agave cantala roxb based composites

    NASA Astrophysics Data System (ADS)

    Ubaidillah, Raharjo, Wijang W.; Wibowo, A.; Harjana, Mazlan, S. A.


    The mechanical and morphological properties of the unsaturated polyester resins (UPRs)-agave cantala roxb based composite are investigated in this paper. The cantala fiber woven in 3D angle interlock was utilized as the composite reinforcement. Surface grafting of the cantala fiber through chemical treatment was performed by introducing silane coupling agent to improving the compatibility with the polymer matrix. The fabrication of the composite specimens was conducted using vacuum bagging technique. The effect of additional coupling agent to the morphological appearance of surface fracture was observed using scanning electron microscopy. Meanwhile, the influence of additional silane to the mechanical properties was examined using tensile, bending and impact test. The photograph of surface fracture on the treated specimens showed the residual matrix left on the fibers in which the phenomenon was not found in the untreated specimens. Based on mechanical tests, the treated specimens were successfully increased their mechanical properties by 55%, 9.67%, and 92.4% for tensile strength, flexural strength, and impact strength, respectively, at 1.5% silane coupling agent.

  15. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.


    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna


    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased.

  16. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.


    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne


    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  17. Regulatory T Cells from Colon Cancer Patients Inhibit Effector T-cell Migration through an Adenosine-Dependent Mechanism.


    Sundström, Patrik; Stenstad, Hanna; Langenes, Veronica; Ahlmanner, Filip; Theander, Lisa; Ndah, Tapuka Gordon; Fredin, Kamilla; Börjesson, Lars; Gustavsson, Bengt; Bastid, Jérémy; Quiding-Järbrink, Marianne


    T cell-mediated immunity is a major component of antitumor immunity. In order to be efficient, effector T cells must leave the circulation and enter into the tumor tissue. Regulatory T cells (Treg) from gastric cancer patients, but not from healthy volunteers, potently inhibit migration of conventional T cells through activated endothelium. In this study, we compared T cells from colon cancer patients and healthy donors to determine the mechanisms used by Tregs from cancer patients to inhibit conventional T-cell migration. Our results showed that circulating Tregs from cancer patients expressed high levels of CD39, an ectoenzyme mediating hydrolysis of ATP to AMP, as a rate-determining first step in the generation of immunosuppressive adenosine. Tumor-associated Tregs expressed even more CD39, and we therefore examined the importance of adenosine in Treg-mediated inhibition of T-cell transendothelial migration in vitro. Exogenous adenosine significantly reduced migration of conventional T cells from healthy volunteers, and blocking either adenosine receptors or CD39 enzymatic activity during transmigration restored the ability of conventional T cells from cancer patients to migrate. Adenosine did not directly affect T cells or endothelial cells, but reduced the ability of monocytes to activate the endothelium. Taken together, our results indicate that Treg-derived adenosine acts on monocytes and contributes to reduced transendothelial migration of effector T cells into tumors. This effect of Tregs is specific for cancer patients, and our results indicate that Tregs may affect not only T-cell effector functions but also their migration into tumors.

  18. Ionic mechanisms of regulatory volume increase (RVI) in the human hepatoma cell-line HepG2.


    Wehner, Frank; Lawonn, Peter; Tinel, Hanna


    We studied the effects of hypertonic stress on ion transport and cell volume regulation (regulatory volume increase; RVI) in the human tumor cell-line HepG2. Ion conductances were monitored in intracellular current-clamp measurements with rapid ion-substitutions and in whole-cell patch-clamp recordings; intracellular pH buffering capacity and activation of Na(+)/H(+) antiport were determined fluorometrically; the rates of Na(+)-K(+)-2Cl(-) symport and Na(+)/K(+)-ATPase were quantified on the basis of time-dependent and furosemide- or ouabain-sensitive (86)Rb(+) uptake, respectively; changes in cell volume were recorded by means of confocal laser-scanning microscopy. It was found that hypertonic conditions led to the activation of a cation conductance that was inhibited by Gd(3+), flufenamate as well as amiloride, but not by benzamil or ethyl-isopropyl-amiloride (EIPA). Most likely, this cation conductance was non-selective for Na(+) over K(+). Hypertonic stress did not change K(+) conductance, whereas possible changes in Cl(-) conductance remain ambiguous. The contribution of Na(+)/H(+)antiport to the RVI process appeared to be minor. Under hypertonic conditions an approximately 3.5-fold stimulation of Na(+)-K(+)-2Cl(-)symport was observed but this transporter did not significantly contribute to the overall RVI process. Hypertonic stress did not increase the activity of Na(+)/K(+)-ATPase, which even under isotonic conditions appeared to be working at its limit. It is concluded that the main mechanism in the RVI of HepG2 cells is the activation of a novel non-selective cation conductance. In contrast, there is little if any contribution of K(+) conductance, Na(+)/H(+) antiport, Na(+)-K(+)-2Cl(-) symport, and Na(+)/K(+)-ATPase to this process.

  19. Morphological and molecular characterization of a spontaneously tuberizing potato mutant: an insight into the regulatory mechanisms of tuber induction

    PubMed Central

    Fischer, Lukas; Lipavska, Helena; Hausman, Jean-Francois; Opatrny, Zdenek


    Background Tuberization in potato (Solanum tuberosum L.) represents a morphogenetic transition of stolon growth to tuber formation, which is under complex environmental and endogenous regulation. In the present work, we studied the regulatory mechanisms and the role of different morphogenetic factors in a newly isolated potato mutant, which exhibited spontaneous tuberization (ST). The ST mutant was characterized in detail at morphological, physiological and biochemical levels. Results Tuberization of the ST mutant grown in the soil was photoperiod-insensitive; predominantly sessile tubers formed directly from axillary buds even under continuous light. Single-node cuttings of the ST mutant cultured in vitro frequently formed tubers or basal tuber-like swellings instead of normal shoots under conditions routinely used for shoot propagation. The tuberization response of ST cuttings under light was dependent on sucrose, the concentration of which had to exceed certain threshold that inversely correlated with irradiance. Gibberellic acid prevented tuberization of ST cuttings, but failed to restore normal shoot phenotype and caused severe malformations. Carbohydrate analysis showed increased levels of both soluble sugars and starch in ST plants, with altered carbohydrate partitioning and metabolism. Comparative proteomic analysis revealed only a few differences between ST- and wild-type plants, primary amongst which seemed to be the absence of an isoform of manganese-stabilizing protein, a key subunit of photosystem II. Conclusion ST mutant exhibits complex developmental and phenotypic modifications, with features that are typical for plants strongly induced to tuberize. These changes are likely to be related to altered regulation of photosynthesis and carbohydrate metabolism rather than impaired transduction of inhibitory gibberellin or photoperiod-based signals. The effect of gibberellins on tuberization of ST mutant suggests that gibberellins inhibit tuberization

  20. The effect of TiO2/aluminosilicate nanocomposite additives on the mechanical and thermal properties of polyacrylic coatings

    NASA Astrophysics Data System (ADS)

    Nosrati, Rahimeh; Olad, Ali


    The commercial grade polyacrylic latex was modified in order to prepare a mechanical and thermal improved coating. TiO2/Ag-exchanged-aluminosilicate nanocomposites with montmorillonite, zeolite-A and clinoptilolite aluminosilicates were prepared and used as additive in the matrix of polyacrylic latex to achieve a coating with proper mechanical and thermal properties. X-ray diffraction patterns and FESEM were used to characterize the composition, structure, and morphology of the nanocomposite additives. Polyacrylic coatings modified by TiO2/Ag-exchanged-aluminosilicate nanocomposite additives showed higher adhesion strength and hardness compared to unmodified commercial grade polyacrylic coatings. Differential Scanning Calorimetry (DSC) analysis showed lower glass transition temperature for modified polyacrylic coatings than that of unmodified polyacrylic coatings. The tensile tests were also carried out for unmodified and modified polyacrylic coatings. According to the results, the modified polyacrylic based coating with TiO2/Ag-exchanged-clinoptilolite nanocomposite additive was the best coating considering most of useful properties.

  1. Influence of strontium addition on the mechanical properties of gravity cast Mg-3Al-3Sn alloy

    SciTech Connect

    Germen, Gülşah Şevik, Hüseyin; Kurnaz, S. Can


    In this study, the effect of strontium (0.01, 0.1, 0.5, 1 wt%) addition on the microstructure and mechanical properties of the gravity cast Mg-3Al-3Sn alloy were investigated. X-ray diffractometry revealed that the main phases are α−Mg, β−Mg{sub 17}Al{sub 12} and Mg{sub 2}Sn in the Mg-3Al-3Sn alloy. With addition The tensile testing results showed that the yield and ultimate tensile strength and elongation of Mg-3Al-3Sn alloy increased by adding Sr up to 0.1 wt.% and then is gradually decreased with the addition of more alloying element.

  2. Effects of Minute Addition of Ni on Microstructure and Mechanical Properties of Sn-Zn Eutectic Alloy

    NASA Astrophysics Data System (ADS)

    Pandey, P.; Tiwary, C. S.; Chattopadhyay, K.


    The current work explores the effects of a small addition of Ni on the microstructure and mechanical properties of Sn-Zn eutectic solder alloy (Sn-14.9 at.%Zn). In two sets of experiments, Ni is either added to the eutectic alloy or Zn in the eutectic alloy is replaced by an increasing amount of Ni. The study indicates that small additions of Ni in eutectic Sn-Zn solder (˜0.017 at.%) refines the eutectic microstructure together with the appearance of the small amount of primary Zn plates. Increasing the Ni content to 0.142 at.% and beyond, then an intermetallic phase ϒ-Ni5Zn21 with dendritic morphology appears in the microstructure along with dendrites of primary Sn. The scale of eutectic microstructure shows a decreasing trend till 0.902 at.%Ni with eutectic spacing of 1.98 ± 0.32 μm for this alloy. Further addition of Ni coarsens the microstructure. The replacement of Zn with Ni in the eutectic composition follows a similar trend with a lesser refinement of the microstructure. In both the scenarios, the addition of a small amount of Ni increases the eutectic temperatures till a critical concentration is reached beyond which one can observe a decrease in the eutectic point. The trend is similar for the solid solubility of Zn in Sn while the trend is opposite for the measured eutectic composition, which decreases at the initial stages of Ni addition. Through a detailed measurement of mechanical properties, the study establishes significant improvement of the strength of Sn-Zn solder with small additions of Ni in the alloy with a maximum hardness of 26 ± 1 HV and 0.2% proof stress of 72 ± 3 MPa at room temperature for the eutectic alloy with 0.902 at.%Ni.

  3. Apparent anti-Woodward-Hoffmann addition to a nickel bis(dithiolene) complex: the reaction mechanism involves reduced, dimetallic intermediates.


    Dang, Li; Shibl, Mohamed F; Yang, Xinzheng; Harrison, Daniel J; Alak, Aiman; Lough, Alan J; Fekl, Ulrich; Brothers, Edward N; Hall, Michael B


    Nickel dithiolene complexes have been proposed as electrocatalysts for alkene purification. Recent studies of the ligand-based reactions of Ni(tfd)2 (tfd = S2C2(CF3)2) and its anion [Ni(tfd)2](-) with alkenes (ethylene and 1-hexene) showed that in the absence of the anion, the reaction proceeds most rapidly to form the intraligand adduct, which decomposes by releasing a substituted dihydrodithiin. However, the presence of the anion increases the rate of formation of the stable cis-interligand adduct, and decreases the rate of dihydrodithiin formation and decomposition. In spite of both computational and experimental studies, the mechanism, especially the role of the anion, remained somewhat elusive. We are now providing a combined experimental and computational study that addresses the mechanism and explains the role of the anion. A kinetic study (global analysis) for the reaction of 1-hexene is reported, which supports the following mechanism: (1) reversible intraligand addition, (2) oxidation of the intraligand addition product prior to decomposition, and (3) interligand adduct formation catalyzed by Ni(tfd)2(-). Density functional theory (DFT) calculations were performed on the Ni(tfd)2/Ni(tfd)2(-)/ethylene system to shed light on the selectivity of adduct formation in the absence of anion and on the mechanism in which Ni(tfd)2(-) shifts the reaction from intraligand addition to interligand addition. Computational results show that in the neutral system the free energy of activation for intraligand addition is lower than that for interligand addition, in agreement with the experimental results. The computations predict that the anion enhances the rate of the cis-interligand adduct formation by forming a dimetallic complex with the neutral complex. The [(Ni(tfd)2)2](-) dimetallic complex then coordinates ethylene and isomerizes to form a Ni,S-bound ethylene complex, which then rapidly isomerizes to the stable interligand adduct but not to the intraligand adduct

  4. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.


    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J


    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  5. Effect of additive particles on mechanical, thermal, and cell functioning properties of poly(methyl methacrylate) cement

    PubMed Central

    Khandaker, Morshed; Vaughan, Melville B; Morris, Tracy L; White, Jeremiah J; Meng, Zhaotong


    The most common bone cement material used clinically today for orthopedic surgery is poly(methyl methacrylate) (PMMA). Conventional PMMA bone cement has several mechanical, thermal, and biological disadvantages. To overcome these problems, researchers have investigated combinations of PMMA bone cement and several bioactive particles (micrometers to nanometers in size), such as magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica. A study comparing the effect of these individual additives on the mechanical, thermal, and cell functional properties of PMMA would be important to enable selection of suitable additives and design improved PMMA cement for orthopedic applications. Therefore, the goal of this study was to determine the effect of inclusion of magnesium oxide, hydroxyapatite, chitosan, barium sulfate, and silica additives in PMMA on the mechanical, thermal, and cell functional performance of PMMA. American Society for Testing and Materials standard three-point bend flexural and fracture tests were conducted to determine the flexural strength, flexural modulus, and fracture toughness of the different PMMA samples. A custom-made temperature measurement system was used to determine maximum curing temperature and the time needed for each PMMA sample to reach its maximum curing temperature. Osteoblast adhesion and proliferation experiments were performed to determine cell viability using the different PMMA cements. We found that flexural strength and fracture toughness were significantly greater for PMMA specimens that incorporated silica than for the other specimens. All additives prolonged the time taken to reach maximum curing temperature and significantly improved cell adhesion of the PMMA samples. The results of this study could be useful for improving the union of implant-PMMA or bone-PMMA interfaces by incorporating nanoparticles into PMMA cement for orthopedic and orthodontic applications. PMID:24920906

  6. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug


    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  7. Role of hydrogen abstraction acetylene addition mechanisms in the formation of chlorinated naphthalenes. 2. Kinetic modeling and the detailed mechanism of ring closure.


    McIntosh, Grant J; Russell, Douglas K


    The dominant formation mechanisms of chlorinated phenylacetylenes, naphthalenes, and phenylvinylacetylenes in relatively low pressure and temperature (∼40 Torr and 1000 K) pyrolysis systems are explored. Mechanism elucidation is achieved through a combination of theoretical and experimental techniques, the former employing a novel simplification of kinetic modeling which utilizes rate constants in a probabilistic framework. Contemporary formation schemes of the compounds of interest generally require successive additions of acetylene to phenyl radicals. As such, infrared laser powered homogeneous pyrolyses of dichloro- or trichloroethylene were perturbed with 1,2,4- or 1,2,3-trichlorobenzene. The resulting changes in product identities were compared with the major products expected from conventional pathways, aided by the results of our previous computational work. This analysis suggests that a Bittner-Howard growth mechanism, with a novel amendment to the conventional scheme made just prior to ring closure, describes the major products well. Expected products from a number of other potentially operative channels are shown to be incongruent with experiment, further supporting the role of Bittner-Howard channels as the unique pathway to naphthalene growth. A simple quantitative analysis which performs very well is achieved by considering the reaction scheme as a probability tree, with relative rate constants being cast as branching probabilities. This analysis describes all chlorinated phenylacetylene, naphthalene, and phenylvinylacetylene congeners. The scheme is then tested in a more general system, i.e., not enforcing a hydrogen abstraction/acetylene addition mechanism, by pyrolyzing mixtures of di- and trichloroethylene without the addition of an aromatic precursor. The model indicates that these mechanisms are still likely to be operative.

  8. Effect of nitrogen addition on the microstructure and mechanical properties of diamond films grown using high-methane concentrations

    NASA Astrophysics Data System (ADS)

    Catledge, Shane A.; Vohra, Yogesh K.


    We report on the microstructure and mechanical properties of diamond films grown using varying nitrogen additions to a plasma with a high-CH4 fraction of 15% (in hydrogen) and an operating pressure of 125 Torr. Films were grown at N2/CH4 ratios ranging from 0 to 0.30 by fixing the CH4 flow rate and changing only the N2 flow rate. With increasing nitrogen addition, we observe an increase in intensity and a decrease in the full width at half maximum (FWHM) of the Raman band at 1550 cm-1, while the crystalline diamond peak at 1332 cm-1 decreases in intensity and increases in the FWHM. X-ray diffraction confirms that the film crystallinity and diamond grain size decrease rapidly with increasing nitrogen additions up to a N2/CH4 ratio of 0.10, but then do not change significantly above this ratio. A similar trend is observed for film surface roughness. In addition, we find from indentation testing that all films exhibit high hardness values ranging from 70 to 90 GPa and that the toughness of the films improves with increasing nitrogen addition. Optical emission spectroscopy reveals that an increase in CN species relative to C2 in the plasma is responsible for the formation of tetrahedral amorphous carbon (indicated by the Raman band at 1550 cm-1).

  9. Design rules for rational control of polymer glass formation behavior and mechanical properties with small molecular additives

    NASA Astrophysics Data System (ADS)

    Mangalara, Jayachandra Hari; Simmons, David

    Small molecule additives have long been employed to tune polymers' glass formation, mechanical and transport properties. For example, plasticizers are commonly employed to suppress polymer Tg and soften the glassy state, while antiplasticizers, which stiffen the glassy state of a polymer while suppressing its Tg, are employed to enhance protein and tissue preservation in sugar glasses. Recent literature indicates that additives can have a wide range of possible effects, but all of these have not been clearly understood and well appreciated. Here we employ molecular dynamics simulations to establish design rules for the selection of small molecule additives with size, molecular stiffness, and interaction energy chosen to achieve targeted effects on polymer properties. We furthermore find that a given additive's effect on a polymer's Tg can be predicted from its Debye-Waller factor via a function previously found to describe nanoconfinement effects on the glass transition. These results emphasize the potential for a new generation of targeted molecular additives to contribute to more targeted rational design of polymers. We acknowledge the Keck Foundation and the Ohio Supercomputing Center for financial and computational support of this effort, respectively.

  10. Effects of alumina (Al2O3) addition on mechanical property of fabricated melt-derived bioactive glass

    NASA Astrophysics Data System (ADS)

    Mohamad, Hasmaliza; Yan, Phooi; Ibrahim, Nurul Farhana; Noor, Siti Noor Fazliah Mohd


    Bioactive glass (BG) is advance materials that have the ability to form hydroxyapatite layer (HA) that accelerate bonding between bone tissues indicating a good biological response. However, BG fabricated with basic composition from SiO2-CaO-Na2O-P2O5 system exhibit lower mechanical strength. The present work aims to study the effects on alumina (Al2O3) addition in SiO2-CaO-Na2O-P2O5 system towards its mechanical performance. Bioactive glass (BG) was fabricated through melt-derived route. Various amount of alumina at (1 wt%, 2 wt%, 3 wt% and 4 wt%) was added in the system. BG with 2 wt% of alumina addition show highest compressive strength and significant improvement observed after sintered at 750°C and 950°C. XRD revealed the existence of crystalline peaks after the glass was sintered that might assist on the mechanical improvement. SEM shows reduction on porosity and enhancement on grain size for sintered bioactive glass.

  11. Effects of Ga addition on the mechanical properties of 35Ag-30Pd-20Au-15Cu alloy.


    Yamanaka, Masahiko; Goto, Shin-ichi; Churnjitapirom, Pornkiat; Ogura, Hideo


    Ten 35Ag-30Pd-20Au-15Cu alloys containing 0.00, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 2.00, 4.00, or 6.00% Ga were experimentally prepared to investigate the effect of Ga on their mechanical properties in addition to their use for denture frameworks, connectors and clasps. The effect of Ga addition on the mechanical properties was marked with a significant increase in the tensile strength, 0.2% off-set proof stress (proof stress) and Vickers hardness observed at low Ga contents (0.25-2.00%). On the other hand, the elongation significantly decreased with the addition of Ga at all contents used in this study. The tensile strength, proof stress and Vickers hardness of the 35Ag-30Pd-20Au-15Cu alloys containing 0.25-2.00% Ga were in the range of 809-957 MPa, 669-857 MPa and 260-301 MPa, respectively. These values are similar to those of Co-Cr alloys, suggesting that 0.25-2.00% Ga alloys can be used for denture frameworks, clasps and connectors.

  12. The effect of additives and mechanical agitation in surface modification of acrylic fibres by cutinase and esterase.


    Matamá, Teresa; Vaz, Filipe; Gübitz, Georg M; Cavaco-Paulo, Artur


    The surface of an acrylic fibre containing about 7% of vinyl acetate was modified using Fusarium solani pisi cutinase and a commercial esterase, Texazym PES. The effect of acrylic solvents and stabilising polyols on cutinase operational stability was studied. The half-life time of cutinase increased by 3.5-fold with the addition of 15% N,N-dimethylacetamide (DMA) and by 3-fold with 1M glycerol. The impact of additives and mechanical agitation in the protein adsorption and in the hydrolysis of vinyl acetate from acrylic fabric was investigated. The hydroxyl groups produced on the surface of the fibre were able to react specifically with Remazol Brilliant Blue R (cotton reactive dye) and to increase the colour of the acrylic-treated fabric. The best staining level was obtained with a high level of mechanical agitation and with the addition of 1% DMA. Under these conditions, the raise in the acrylic fabric colour depth was 30% for cutinase and 25% for Texazym. The crystallinity degree, determined by X-ray diffraction, was not significantly changed between control samples and samples treated with cutinase. The results showed that the outcome of the application of these enzymes depends closely on the reaction media conditions.

  13. The Effect of Chilling and Ce Addition on the Microstructure and Mechanical Properties of Al-23Si Alloy

    NASA Astrophysics Data System (ADS)

    Vijeesh, V.; Narayan Prabhu, K.


    The present work involves the study of the effect of varying concentration of Ce addition on microstructure and mechanical properties of Al-23%Si alloys. Melt-treated alloys were solidified in copper, brass, stainless steel molds to assess the effect of cooling rate. The effect on microstructure was assessed by measuring the fineness of primary silicon and eutectic silicon particle characteristics. The Ce melt treatment transformed the coarse and irregular primary silicon into refined polyhedral silicon crystals, and the effect was more significant at higher cooling rates. Although the melt treatment had refined the eutectic silicon at lower cooling rates, it did not show any considerable effect on the eutectic silicon at higher cooling rates. The mechanical properties of the alloy increased significantly with increase in cooling rates and cerium concentration. Analysis of the results and literature reveals that the refined primary silicon was formed as a result of an invariant reaction between Ce compounds and primary silicon at higher temperatures.

  14. Porous calcium polyphosphate bone substitutes: additive manufacturing versus conventional gravity sinter processing-effect on structure and mechanical properties.


    Hu, Youxin; Shanjani, Yaser; Toyserkani, Ehsan; Grynpas, Marc; Wang, Rizhi; Pilliar, Robert


    Porous calcium polyphosphate (CPP) structures proposed as bone-substitute implants and made by sintering CPP powders to form bending test samples of approximately 35 vol % porosity were machined from preformed blocks made either by additive manufacturing (AM) or conventional gravity sintering (CS) methods and the structure and mechanical characteristics of samples so made were compared. AM-made samples displayed higher bending strengths (≈1.2-1.4 times greater than CS-made samples), whereas elastic constant (i.e., effective elastic modulus of the porous structures) that is determined by material elastic modulus and structural geometry of the samples was ≈1.9-2.3 times greater for AM-made samples. X-ray diffraction analysis showed that samples made by either method displayed the same crystal structure forming β-CPP after sinter annealing. The material elastic modulus, E, determined using nanoindentation tests also showed the same value for both sample types (i.e., E ≈ 64 GPa). Examination of the porous structures indicated that significantly larger sinter necks resulted in the AM-made samples which presumably resulted in the higher mechanical properties. The development of mechanical properties was attributed to the different sinter anneal procedures required to make 35 vol % porous samples by the two methods. A primary objective of the present study, in addition to reporting on bending strength and sample stiffness (elastic constant) characteristics, was to determine why the two processes resulted in the observed mechanical property differences for samples of equivalent volume percentage of porosity. An understanding of the fundamental reason(s) for the observed effect is considered important for developing improved processes for preparation of porous CPP implants as bone substitutes for use in high load-bearing skeletal sites.

  15. Mechanical Properties and Fracture Behaviors of GTA-Additive Manufactured 2219-Al After an Especial Heat Treatment

    NASA Astrophysics Data System (ADS)

    Bai, J. Y.; Fan, C. L.; Lin, S. B.; Yang, C. L.; Dong, B. L.


    2219-Al parts were produced by gas tungsten arc-additive manufacturing and sequentially processed by an especial heat treatment. In order to investigate the effects of heat treatment on its mechanical properties, multiple tests were conducted. Hardness tests were carried out on part scale and layer scale along with tensile tests which were performed on welding and building directions. Results show that compared to conventional casting + T6 2219-Al, the current deposit + T6 2219-Al exhibits satisfying properties with regard to strength but unsatisfying results in plasticity. Additionally, anisotropy is significant. Fractures were observed and the cracks' propagating paths in both directional specimens are described. The effects of heat treatment on the cracks' initiation and propagation were also investigated. Ultimately, a revised formula was developed to calculate the strength of the deposit + T6 2219-Al. The aforementioned formula, which takes into consideration the belt-like porosities-distributing feature, can scientifically describe the anisotropic properties in the material.

  16. The Molecular Mechanism of the Supra-Additive Response of Prostate Cancer to Androgen Ablation and Radiotherapy

    DTIC Science & Technology


    Biol. Phys., 43: 607-616, 1999. wild-type p53 gene and induction of apoptosis in cervical cancer . 29. Lang, F. F., Yung, W. K. A., Raju, U., Libunao... cervical cancer . Cancer Res 1996;56:3047- 25. Li JH, Lax SA, Kim J, et al. The effects of ionizing radiation 3054. and adenoviral p53 therapy in...Mechanism of the Supra-Additive Response of Prostate Cancer to Androgen Ablation and Radiotherapy PRINCIPAL INVESTIGATOR: Alan Pollack, M.D., Ph.D

  17. Effect of additive composition on mechanical properties of pressureless sintered silicon carbide ceramics sintered with alumina, aluminum nitride and yttria

    NASA Astrophysics Data System (ADS)

    Eom, Jung-Hye; Seo, Yu-Kwang; Kim, Young-Wook; Lee, Seoung-Jae


    Silicon carbide (SiC) ceramics were pressureless sintered with 3 vol% Al2O3-Y2O3-AlN additives with the AlN/(Al2O3+AlN) molar ratios of 0-0.75 at 1850-2000 °C for 1 hr and the effects of additive composition (i.e., changes in the AlN/(Al2O3+AlN) molar ratio while maintaining constant Y2O3 content) on the mechanical properties of the pressureless-sintered SiC ceramics were investigated. Self-reinforced microstructures consisting of relatively large platelet SiC grains and relatively small equiaxed grains have been obtained in all specimens when sintered at 1900 °C for 1 h in an argon atmosphere. The achievement of self-reinforced microstructures under such mild conditions (holding for 1 hr at 1900 °C) is caused by the beneficial effects of additive composition and the acceleration of the β→α phase transformation of SiC by seeding, i.e., the addition of 1 vol% α-SiC into β-SiC. The typical flexural strength and fracture toughness of the pressureless-sintered SiC ceramics with an AlN/(Al2O3+AlN) mole ratio of 0.5 were 433 MPa and 6.6 MPa·m1/2 at room temperature, respectively.

  18. Contrasting evolutionary dynamics of the developmental regulator PAX9, among bats, with evidence for a novel post-transcriptional regulatory mechanism.


    Phillips, Caleb D; Butler, Boyd; Fondon, John W; Mantilla-Meluk, Hugo; Baker, Robert J


    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi's regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  19. A mechanistic study of manganese(iii) acetate-mediated phosphonyl group additions to [60]- and [70]-fullerenes: the oxidative-ion-transfer mechanism vs. free radical addition.


    Tumanskii, Boris L; Sabirov, Denis S; Lyakhovetsky, Yury I


    The phosphonylation of C60 with HP(O)(OAlk)2 and Mn(OAc)3·2H2O has been considered to occur via a free radical (FR) path involving intermediate radicals ˙P(O)(OAlk)2. The present study provides evidence in support of another mechanism for the reactions, oxidative-ion-transfer (OIT). The mechanism involves the change of an acetate group in Mn(OAc)3 for the phosphonate group and oxidation of C60 by the Mn(OAc)2P(O)(OAlk)2 formed to a pair: (C60˙(+), Mn(OAc)2P(O)(OAlk)2˙(-)) followed by the transfer of the phosphonate anion to give the monophposphonylfullerenyl radical. It undergoes reversible dimerization. The polyaddition occurs analogously. Moreover, the compounds Mn(OAc)2P(O)(OAlk)2 (Alk = Et and i-Pr) obtained make novel reagents for phosphonylation of fullerenes working by the OIT mechanism. The reactions of C60 in benzene with equimolar amounts of Mn(OAc)2P(O)(OPr-i)2 or Hg[P(O)(OPr-i)2]2 which is known as working by the FR mechanism since it produces radical ˙P(O)(OPr-i)2 under UV-irradiation, furnished the same radical ˙C60P(O)(OPr-i)2. However, at a 20-fold molar excess of the reagent toward C60, a single derivative C60[P(O)(OPr-i)2]4 and a mixture of derivatives bearing between two and eight phosphonyls were obtained in the former and latter cases, respectively. With C70, the change of the mechanism produced a change in the regioselectivity: 5 and 3 isomers of ˙C70P(O)(OPr-i)2 were obtained, respectively. DFT-calculations provided the hyperfine coupling (hfc) constants of the isomers and explained the regioselectivity change.

  20. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.


    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne


    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model.

  1. Effect of copper addition on mechanical properties, corrosion resistance and antibacterial property of 316L stainless steel.


    Xi, Tong; Shahzad, M Babar; Xu, Dake; Sun, Ziqing; Zhao, Jinlong; Yang, Chunguang; Qi, Min; Yang, Ke


    The effects of addition of different Cu content (0, 2.5 and 3.5wt%) on mechanical properties, corrosion resistance and antibacterial performance of 316L austenitic stainless steel (SS) after solution and aging treatment were investigated by mechanical test, transmission electron microscope (TEM), X-ray diffraction (XRD), electrochemical corrosion, X-ray photoelectron spectroscopy (XPS) and antibacterial test. The results showed that the Cu addition and heat treatment had no obvious influence on the microstructure with complete austenite features. The yield strength (YS) after solution treatment was almost similar, whereas the aging treatment obviously increased the YS due to formation of tiny Cu-rich precipitates. The pitting and protective potential of the solution treated Cu-bearing 316L SS in 0.9wt% NaCl solution increased with increasing Cu content, while gradually declined after aging, owing to the high density Cu-rich precipitation. The antibacterial test proved that higher Cu content and aging were two compulsory processes to exert good antibacterial performance. The XPS results further indicated that aging enhanced the Cu enrichment in passive film, which could effectively stimulate the Cu ions release from the surface of passive film.

  2. Quantum mechanics/molecular mechanics modeling of covalent addition between EGFR-cysteine 797 and N-(4-anilinoquinazolin-6-yl) acrylamide.


    Capoferri, Luigi; Lodola, Alessio; Rivara, Silvia; Mor, Marco


    Irreversible epidermal growth factor receptor (EGFR) inhibitors can circumvent resistance to first-generation ATP-competitive inhibitors in the treatment of nonsmall-cell lung cancer. They covalently bind a noncatalytic cysteine (Cys797) at the surface of EGFR active site by an acrylamide warhead. Herein, we used a hybrid quantum mechanics/molecular mechanics (QM/MM) potential in combination with umbrella sampling in the path-collective variable space to investigate the mechanism of alkylation of Cys797 by the prototypical covalent inhibitor N-(4-anilinoquinazolin-6-yl) acrylamide. Calculations show that Cys797 reacts with the acrylamide group of the inhibitor through a direct addition mechanism, with Asp800 acting as a general base/general acid in distinct steps of the reaction. The obtained reaction free energy is negative (ΔA = -12 kcal/mol) consistent with the spontaneous and irreversible alkylation of Cys797 by N-(4-anilinoquinazolin-6-yl) acrylamide. Our calculations identify desolvation of Cys797 thiolate anion as a key step of the alkylation process, indicating that changes in the intrinsic reactivity of the acrylamide would have only a minor impact on the inhibitor potency.

  3. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.


    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki


    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels.

  4. Hydro-gel environment and solution additives modify calcite growth mechanism to an accretion process of amorphous nanospheres

    NASA Astrophysics Data System (ADS)

    Gal, A.; Kahil, K.; Habraken, W.; Gur, D.; Fratzl, P.; Addadi, L.; Weiner, S.


    Various biominerals form via the transformation of a transient amorphous precursor phase into a mature crystalline phase. The mature biominerals usually exhibit morphology reminiscent of aggregated nanoparticles. Although these observations suggest an accretion-based growth process consisting on nanoparticles, the key factors that control the accretion process are unknown. We investigated the transformation of solid amorphous calcium carbonate (ACC) into calcite. When plant cystoliths, a biogenic stable ACC phase, are transformed into calcite in vitro by immersion in water, calcite crystals grow in two distinct steps (Gal et al., Angewandte Chemie, 2013). First, rhombohedral crystals grow that show flat facets as expected from ion-by-ion growth. These crystals then grow by the aggregation and crystallization of the original ACC nanospheres leading to a surface morphology dominated by aggregated spheres. The transformation process occurs within an organic hydro-gel that originates from inside the cystoliths. We tested the importance of the gel phase to the transformation process by transforming synthetic ACC into calcite inside various gels. In all the investigated systems: in gelatin, agarose, and pectin gels, calcite crystals grew that showed the nanosphere aggregation morphology. In additional experiments we demonstrated that also other additives, such as phosphate ions and biogenic macromolecules, that slow down ACC dissolution and calcite precipitation from ions can induce the accretion process dominance (see figure attached). These experiments show that although in solution the dominant process is dissolution to ions of the ACC and crystal growth by ion-by-ion mechanism, the presence of an additive that slows the ion-mediated processes makes the ACC nanospheres stable long enough to interact with the crystal surface. As a result, the metastable ACC nanospheres undergo secondary nucleation on the crystal surface without dissolving. These experiments highlight


    PubMed Central

    Davidson, Eric H.


    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  6. Evolutionary bioscience as regulatory systems biology.


    Davidson, Eric H


    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network.

  7. Microstructural Modification of Sn-0.7Cu Solder Alloys by Fe/Bi-Addition for Achieving High Mechanical Performance

    NASA Astrophysics Data System (ADS)

    Ali, Bakhtiar; Sabri, Mohd Faizul Mohd; Said, Suhana Mohd; Mahdavifard, Mohammad Hossein; Sukiman, Nazatul Liana; Jauhari, Iswadi


    In this work, we studied the Fe/Bi-bearing tin-copper (Sn-0.7Cu) solders for their microstructural and mechanical properties. The microstructure was studied using field emission scanning electron microscopy (FESEM) with a backscattered electron (BSE) detector, x-ray diffraction (XRD) analysis, and energy-dispersive x-ray spectroscopy (EDX). The microstructure study showed that Fe forms very few FeSn2 intermetallic compounds (IMCs) and does not significantly alter the microstructure of Sn-0.7Cu, whereas Bi controls the size of inter-dendritic regions containing Cu6Sn5 and Ag3Sn IMCs of the alloy, as well as significantly refines its primary β-Sn dendrites. Moreover, Bi atoms dissolve in β-Sn matrix, which in turn strengthen the solder by the Bi solid solution strengthening mechanism. Such microstructural modification leads to significant improvements in various mechanical properties of the alloy, including shear strength, impact toughness, and hardness values. Shear tests were performed with a 0.25 mm/min shear speed. The results showed that shear strength improves from 16.57 MPa to 38.36 MPa with the addition of Fe/Bi to Sn-0.7Cu, raising by about 130%. The energy absorbed during impact tests was measured for samples with the help of a Charpy impact testing machine with a 5.4 m/s impact speed. The results revealed that the addition of Fe/Bi to Sn-0.7Cu improves its impact absorbed energy by over 35%, increasing it from 7.5 J to 10.3 J. Vickers hardness tests were carried out for the test samples with a 245.2 mN applied load and 10 s dwell time. The results showed that the hardness number improves from 9.89 to 24.13 with Fe/Bi to Sn-0.7Cu, increasing by about 140%.

  8. Modeling probability and additive summation for detection across multiple mechanisms under the assumptions of signal detection theory.


    Kingdom, Frederick A A; Baldwin, Alex S; Schmidtmann, Gunnar


    Many studies have investigated how multiple stimuli combine to reach threshold. There are broadly speaking two ways this can occur: additive summation (AS) where inputs from the different stimuli add together in a single mechanism, or probability summation (PS) where different stimuli are detected independently by separate mechanisms. PS is traditionally modeled under high threshold theory (HTT); however, tests have shown that HTT is incorrect and that signal detection theory (SDT) is the better framework for modeling summation. Modeling the equivalent of PS under SDT is, however, relatively complicated, leading many investigators to use Monte Carlo simulations for the predictions. We derive formulas that employ numerical integration to predict the proportion correct for detecting multiple stimuli assuming PS under SDT, for the situations in which stimuli are either equal or unequal in strength. Both formulas are general purpose, calculating performance for forced-choice tasks with M alternatives, n stimuli, in Q monitored mechanisms, each subject to a non-linear transducer with exponent τ. We show how the probability (and additive) summation formulas can be used to simulate psychometric functions, which when fitted with Weibull functions make signature predictions for how thresholds and psychometric function slopes vary as a function of τ, n, and Q. We also show how one can fit the formulas directly to real psychometric functions using data from a binocular summation experiment, and show how one can obtain estimates of τ and test whether binocular summation conforms more to PS or AS. The methods described here can be readily applied using software functions newly added to the Palamedes toolbox.

  9. Meta-analysis of high-latitude nitrogen-addition and warming studies implies ecological mechanisms overlooked by land models

    NASA Astrophysics Data System (ADS)

    Bouskill, N. J.; Riley, W. J.; Tang, J. Y.


    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the climate. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the aboveground and belowground responses to warming and nitrogen addition in high-latitude ecosystems, and identified absent or poorly parameterized mechanisms in CLM4.5. While the two model versions predicted similar soil carbon stock trajectories following both warming and nitrogen addition, other predicted variables (e.g., belowground respiration) differed from observations in both magnitude and direction, indicating that CLM4.5 has inadequate underlying mechanisms for representing high-latitude ecosystems. On the basis of observational synthesis, we attribute the model-observation differences to missing representations of microbial dynamics, aboveground and belowground coupling, and nutrient cycling, and we use the observational meta-analysis to discuss potential approaches to improving the current models. However, we also urge caution concerning the selection of data sets and experiments for meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average = 72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which precludes a rigorous evaluation of the model responses to likely nitrogen perturbations. Overall, we demonstrate that elucidating ecological mechanisms via meta-analysis can identify deficiencies in ecosystem models and empirical experiments.

  10. Meta-analysis of high-latitude nitrogen-addition and warming studies implies ecological mechanisms overlooked by land models


    Bouskill, N. J.; Riley, W. J.; Tang, J. Y.


    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the climate. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the aboveground and belowground responses to warming and nitrogen addition in high-latitude ecosystems, and identified absent or poorly parameterized mechanisms in CLM4.5. While the two model versions predicted similar soil carbon stock trajectories following both warming and nitrogen addition, other predicted variables (e.g., belowgroundmore » respiration) differed from observations in both magnitude and direction, indicating that CLM4.5 has inadequate underlying mechanisms for representing high-latitude ecosystems. On the basis of observational synthesis, we attribute the model–observation differences to missing representations of microbial dynamics, aboveground and belowground coupling, and nutrient cycling, and we use the observational meta-analysis to discuss potential approaches to improving the current models. However, we also urge caution concerning the selection of data sets and experiments for meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average = 72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which precludes a rigorous evaluation of the model responses to likely nitrogen perturbations. Overall, we demonstrate that elucidating ecological mechanisms via meta-analysis can identify deficiencies in ecosystem models and empirical experiments.« less

  11. Review of Mechanical Properties of Ti-6Al-4V Made by Laser-Based Additive Manufacturing Using Powder Feedstock

    NASA Astrophysics Data System (ADS)

    Beese, Allison M.; Carroll, Beth E.


    Laser-based additive manufacturing (AM) of metals using powder feedstock can be accomplished via two broadly defined technologies: directed energy deposition (DED) and powder bed fusion (PBF). In these processes, metallic powder is delivered to a location and locally melted with a laser heat source. Upon deposition, the material undergoes a rapid cooling and solidification, and as subsequent layers are added to the component, the material within the component is subjected to rapid thermal cycles. In order to adopt AM for the building of structural components, a thorough understanding of the relationships among the complex thermal cycles seen in AM, the unique heterogeneous and anisotropic microstructure, and the mechanical properties must be developed. Researchers have fabricated components by both DED and PBF from the widely used titanium alloy Ti-6Al-4V and studied the resultant microstructure and mechanical properties. This review article discusses the progress to date on investigating the as-deposited and heat-treated microstructures and mechanical properties of Ti-6Al-4V structures made by powder-based laser AM using DED and PBF.

  12. Effect of Rare Earth Cerium Addition on Microstructures and Mechanical Properties of Low Carbon High Manganese Steels

    NASA Astrophysics Data System (ADS)

    Jiang, M. Z.; Yu, Y. C.; Li, H.; Ren, X.; Wang, S. B.


    Low carbon high manganese steels with different Ce contents were melted in medium frequency vacuum induction furnace. The microstructures and mechanical properties of steels were studied by OM, SEM, EDS and mechanical property testing. The results showed that the microstructures of experimental steels were refined remarkably, inclusions distributed more finely and uniformly, the tensile strength and impact toughness of tested steels both improved greatly after the addition of Ce. Thermodynamic calculation results demonstrated that Ce contained inclusions were Ce2O3 and Ce3S4, which agreed well with the results observed by SEM and EDS. By analysis of two-dimensional lattice disregistry, it was shown that the lattice misfit parameter between δ-Fe and Ce2O3, Ce3S4 are less than 6 %, which indicated that Ce2O3 and Ce3S4 could effectively act as the heterogeneous nuclei of initial δ-Fe. Therefore, the microstructures were refined significantly and the mechanical properties were improved correspondingly in Ce-added low carbon high manganese steels.

  13. Investigation into the effect of some additives on the mechanical strength, quality and thermal conductivity of clay bricks

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Qandil, A.; Qattous, M. A. A.


    It was repeatedly reported that the clay bricks industry in Jordan is facing both weak mechanical strength and poor quality which caused marketing problems where it is expected to serve the increasing demand of housing in the country especially after the political crises in the neighboring countries Iraq and Syria. It is therefore anticipated that improvement of the mechanical strength and quality of the produced clay evaluation of the brick industry in Jordan is worth investigating. In this paper, theoretical and experimental investigation obtained from field visits to the factories producing clay bricks were carried out. Furthermore, the effect of using some additives from locally available materials namely: Battn El-Ghoul Clay, Suweileh sand and Olive extracts on the mechanical strength, thermal conductivity and surface quality of the produced bricks is investigated and discussed. The experimental results indicated that thermal conductivity, color and durability were all enhanced and the ultimate compressive strength was reduced but remained higher than the acceptable value for brickwork.

  14. Complementary transcriptomic and proteomic analyses reveal regulatory mechanisms of milk protein production in dairy cows consuming different forages

    PubMed Central

    Dai, Wenting; Chen, Qiong; Wang, Quanjuan; White, Robin R.; Liu, Jianxin; Liu, Hongyun


    Forage plays a critical role in the milk production of dairy cows; however, the mechanisms regulating bovine milk synthesis in dairy cows fed high forage rations with different basal forage types are not well-understood. In the study, rice straw (RS, low-quality) and alfalfa hay (AH, high-quality) diets were fed to lactating cows to explore how forage quality affected the molecular mechanisms regulating milk production using RNA-seq transcriptomic method with iTRAQ proteomic technique. A total of 554 transcripts (423 increased and 131 decreased) and 517 proteins (231 up-regulated and 286 down-regulated) were differentially expressed in the mammary glands of the two groups. The correlation analysis demonstrated seven proteins (six up-regulated and one down-regulated) had consistent mRNA expression. Functional analysis of the differentially expressed transcripts/proteins suggested that enhanced capacity for energy and fatty acid metabolism, increased protein degradation, reduced protein synthesis, decreased amino acid metabolism and depressed cell growth were related to RS consumption. The results indicated cows consuming RS diets may have had depressed milk protein synthesis because these animals had decreased capacity for protein synthesis, enhanced proteolysis, inefficient energy generation and reduced cell growth. Additional work evaluating RS- and AH-based rations may help better isolate molecular adaptations to low nutrient availability during lactation. PMID:28290485

  15. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition

    PubMed Central

    Chou, Jyh-Horng


    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition. PMID:27504072

  16. Microstructure and Mechanical Properties of Microwave Sintered ZrO2 Bioceramics with TiO2 Addition.


    Kuo, Hsien-Nan; Chou, Jyh-Horng; Liu, Tung-Kuan


    The microwave sintered zirconia ceramics with 0, 1, 3, and 5 wt% TiO2 addition at a low sintering temperature of 1300°C and a short holding time of 1 hour were investigated. Effect of contents of TiO2 addition on microstructure and mechanical properties of microwave sintered zirconia bioceramics was reported. In the sintered samples, the main phase is monoclinic zirconia (m-ZrO2) phase and minor phase is tetragonal zirconia (t-ZrO2) phase. The grain sizes increased with increasing the TiO2 contents under the sintering temperature of 1300°C. Although the TiO2 phase was not detected in the XRD pattern, Ti and O elements were detected in the EDS analysis. The presence of TiO2 effectively improved grain growth of the ZrO2 ceramics. The Vickers hardness was in the range of 125 to 300 Hv and increased with the increase of TiO2 contents. Sintering temperature dependence on the Vickers hardness was also investigated from 1150°C to 1300°C, showing the increase of Vickers hardness with the increase of the sintering temperature as well as TiO2 addition.

  17. Effects of Be and Fe additions on the microstructure and mechanical properties of A357.0 alloys

    NASA Astrophysics Data System (ADS)

    Tan, Yen-Hung; Lee, Sheng-Long; Lin, Yu-Lom


    A357 hypoeutectic alloy is a heat-treatable Al-Si-Mg system with a nominal composition of Al-7 pct Si and about 0.6 pct Mg have widespreaded applications, especially in the aerospace and automotive industries. The purpose of this study was to determine the influences of Be and Fe content on the microstructure and mechanical properties of A357.0 alloys. Distinct morphologies were discerned between Be-containing and Be-free alloys. The Be-free alloys contain larger amount of iron-bearing phases with Mg than in Be-containing alloys. The addition of Be can change the plateletlike structure of iron-bearing phases to a comparatively harmless round nodular form. Also, the amounts of iron-rich phases are significantly lower and the silicon particles are smaller and more spherical in the Be-containing alloys. Small amounts of Be in A357.0 caused significant increases in the precipitation kinetics of Mg2Si. It was found that the addition of Be lowers the ternary and binary eutectic melting point. The amount of Mg available to form the major strengthening phase Mg2Si is increased promoting the tensile strength of A357.0 casting. The tensile properties were improved with decreasing Fe content and the addition of Be. The effect is more apparent in the higher Fe alloys than that in the lower Fe alloys.

  18. Effects of a Phytogenic Feed Additive Versus an Antibiotic Feed Additive on Oxidative Stress in Broiler Chicks and a Possible Mechanism Determined by Electron Spin Resonance.


    Settle, T; Leonard, S S; Falkenstein, E; Fix, N; Van Dyke, K; Klandorf, H

    Phytogenic feed additives are plant-derived products used in poultry feeding to improve overall performance of broilers. In this study, 588 one day-old Cobb 500 chicks were fed one of four diets and housed on either dirty or clean litter for 3wks. Treatments included: Group I: commercial diet with no additive and housed on clean litter; Group II: commercial diet with no additive and housed on dirty litter; Group III: commercial diet with a 0.05% inclusion of the anitobiotic, BMD (bacitracin methylene disalicylate); Group IV: commercial diet with a 0.05% inclusion of a phytogenic feed additive (PFA). The study was designed around a random block assignment of treatments allocated to groups of twenty-one birds per pen. Blood samples were obtained from chicks at 18 days of age for measurement of leukocyte oxidative activity by a bioluminescence technique. Results of the study showed that chicks in the treatment groups fed the PFA had significantly lower oxidative stress (p<0.02) when compared to the BMD treatment group. Once this was determined, electron spin resonance (ESR) spin trapping was used to detect and measure hydroxyl or superoxide radicals in. Fenton chemistry was utilized for production of hydroxyl radicals and a xanthine/xanthine oxidase reaction for the production of superoxide radicals in the diet and in RAW 264.7 mouse peritoneal monocytes exposed to the diet. Results from the reactions showed that the antibiotic scavenges hydroxyl and superoxide radicals more efficiently than the phytogenic. The results were comparable to those measured in the RAW 264.7 cells.

  19. Effects of a Phytogenic Feed Additive Versus an Antibiotic Feed Additive on Oxidative Stress in Broiler Chicks and a Possible Mechanism Determined by Electron Spin Resonance

    PubMed Central

    Settle, T.; Leonard, S.S.; Falkenstein, E.; Fix, N.; Van Dyke, K.; Klandorf, H.


    Phytogenic feed additives are plant-derived products used in poultry feeding to improve overall performance of broilers. In this study, 588 one day-old Cobb 500 chicks were fed one of four diets and housed on either dirty or clean litter for 3wks. Treatments included: Group I: commercial diet with no additive and housed on clean litter; Group II: commercial diet with no additive and housed on dirty litter; Group III: commercial diet with a 0.05% inclusion of the anitobiotic, BMD (bacitracin methylene disalicylate); Group IV: commercial diet with a 0.05% inclusion of a phytogenic feed additive (PFA). The study was designed around a random block assignment of treatments allocated to groups of twenty-one birds per pen. Blood samples were obtained from chicks at 18 days of age for measurement of leukocyte oxidative activity by a bioluminescence technique. Results of the study showed that chicks in the treatment groups fed the PFA had significantly lower oxidative stress (p<0.02) when compared to the BMD treatment group. Once this was determined, electron spin resonance (ESR) spin trapping was used to detect and measure hydroxyl or superoxide radicals in. Fenton chemistry was utilized for production of hydroxyl radicals and a xanthine/xanthine oxidase reaction for the production of superoxide radicals in the diet and in RAW 264.7 mouse peritoneal monocytes exposed to the diet. Results from the reactions showed that the antibiotic scavenges hydroxyl and superoxide radicals more efficiently than the phytogenic. The results were comparable to those measured in the RAW 264.7 cells. PMID:26180524

  20. Additively manufactured metallic porous biomaterials based on minimal surfaces: A unique combination of topological, mechanical, and mass transport properties.


    Bobbert, F S L; Lietaert, K; Eftekhari, A A; Pouran, B; Ahmadi, S M; Weinans, H; Zadpoor, A A


    Porous biomaterials that simultaneously mimic the topological, mechanical, and mass transport properties of bone are in great demand but are rarely found in the literature. In this study, we rationally designed and additively manufactured (AM) porous metallic biomaterials based on four different types of triply periodic minimal surfaces (TPMS) that mimic the properties of bone to an unprecedented level of multi-physics detail. Sixteen different types of porous biomaterials were rationally designed and fabricated using selective laser melting (SLM) from a titanium alloy (Ti-6Al-4V). The topology, quasi-static mechanical properties, fatigue resistance, and permeability of the developed biomaterials were then characterized. In terms of topology, the biomaterials resembled the morphological properties of trabecular bone including mean surface curvatures close to zero. The biomaterials showed a favorable but rare combination of relatively low elastic properties in the range of those observed for trabecular bone and high yield strengths exceeding those reported for cortical bone. This combination allows for simultaneously avoiding stress shielding, while providing ample mechanical support for bone tissue regeneration and osseointegration. Furthermore, as opposed to other AM porous biomaterials developed to date for which the fatigue endurance limit has been found to be ≈20% of their yield (or plateau) stress, some of the biomaterials developed in the current study show extremely high fatigue resistance with endurance limits up to 60% of their yield stress. It was also found that the permeability values measured for the developed biomaterials were in the range of values reported for trabecular bone. In summary, the developed porous metallic biomaterials based on TPMS mimic the topological, mechanical, and physical properties of trabecular bone to a great degree. These properties make them potential candidates to be applied as parts of orthopedic implants and/or as bone

  1. A quantum chemical study of the mechanisms of olefin addition to group 9 transition metal dioxo compounds.


    Ahmed, Issahaku; Tia, Richard; Adei, Evans


    triplet PES than on the singlet PES for the formation of similar analogues. There are fewer competitive reaction pathways on the triplet surface than on the singlet PES. Also, cycloadditions that seem impossible on the singlet PES seem possible on the doublet and or triplet PESs, this is the case typically for the Rh and Co complexes, illustrating the importance of multiple spin states in organometallic reactions.Graphical AbstractTable of Contents Synopsis: A study of the mechanism of ethylene addition to MO2(CH2)(CH3)(M=Co,Rh,Ir) shows the reactions of the Co complex have lower activation barriers for the preferred [3+2] and [2+2] addition pathways and fewer side reactions than those of Rh and Ir. Reactions are more feasible and selective on the triplet PES than on the singlet PES. These illustrate the importance of multiple spin states in organometallic reactions and shows catalyst activity and selectivity decreases down the group.

  2. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.


    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana


    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  3. Regulatory use of computational toxicology tools and databases at the United States Food and Drug Administration's Office of Food Additive Safety.


    Arvidson, Kirk B; Chanderbhan, Ronald; Muldoon-Jacobs, Kristi; Mayer, Julie; Ogungbesan, Adejoke


    Over 10 years ago, the Office of Food Additive Safety (OFAS) in the FDA's Center for Food Safety and Applied Nutrition implemented the formal use of structure-activity relationship analysis and quantitative structure-activity relationship (QSAR) analysis in the premarket review of food-contact substances. More recently, OFAS has implemented the use of multiple QSAR software packages and has begun investigating the use of metabolism data and metabolism predictive models in our QSAR evaluations of food-contact substances. In this article, we provide an overview of the programs used in OFAS as well as a perspective on how to apply multiple QSAR tools in the review process of a new food-contact substance.

  4. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system

    PubMed Central

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves


    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle. PMID:28212376

  5. The influence of impurities on the crystal structure and mechanical properties of additive manufactured U–14at.% Nb


    Wu, Amanda S.; Brown, Donald W.; Clausen, Bjørn; ...


    Uranium-niobium alloys can exist with significantly different microstructures and mechanical properties, heavily influenced by thermomechanical processing history and impurities. In this study, the influence of Ti and other impurities is studied on uranium-14 at.% niobium additively manufactured using laser powder bed fusion. In two different metallic impurity levels were investigated and a Nb equivalent (Nbeq) composition is defined to represent the impurities. Furthermore, in-situ neutron diffraction during compression loading shows that increased Nbeq promotes the formation of γ°-tetragonal phase at the expense of α''-monoclinic phase, resulting in 2 × higher yield strength than water quenched α'' and a strain inducedmore » transformation to α'' with superelastic strains to 4.5%.« less

  6. The Effect of the Kind of Sands and Additions on the Mechanical Behaviour of S.C.C

    NASA Astrophysics Data System (ADS)

    Zeghichi, L.; Benghazi, Z.; Baali, L.

    The sand is an inert element essential in the composition of concrete; its use ensures granular continuity between the cement and gravel for better cohesion of concrete. This paper presents the results of a study that investigated the influence of sand quality on the properties of fresh and hardened self-compacting concrete (SCC). The dune sands are very fine materials characterized by a high intergranular porosity, high surface area and low fineness modulus; on the other hand crushed (manufactured) sand has a high rate into thin and irregular shapes which are influencing the workability of concrete. The amount of dune sand varies from (0% 50%, to 100%) by weight of fine aggregates. The effect of additions is also treated (blast furnace slag and lime stone) The results show that the rheological properties favour the use of dune sands; however the mechanical properties support the use of crushed sand.

  7. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio


    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  8. Influence of processing parameters and alloying additions on the mechanically determined no-recrystallization temperature in niobium microalloyed steels

    NASA Astrophysics Data System (ADS)

    Homsher-Ritosa, Caryn Nicole

    TNR_Tor was determined by finding the intersection point of two linear regressions fit to the data. The TNR_Tor values were compared with measured TNR values from double-hit compression tests and with predicted values using empirical equations from the literature. Light optical micrographs and electron backscatter diffraction scans were examined for samples quenched from just above and just below the experimentally determined values of TNR_Tor for the high Nb, low Ti, and commercially produced 10V45 alloys to help verify the prior austenite grain morphology. For all processing conditions, the low Nb alloy was the least effective in increasing TNR_Tor and the high additions of Ti were the most effective at increasing TNR_Tor. The additions of V were not significantly effective in altering TNR_Tor and it is believed the Nb overpowered any influence the V additions may have had on TNR_Tor. An increase in strain or an increase strain rate decreased TNR_Tor. The T NR values measured from multistep hot torsion testing were lower than the TNR values measured from double-hit compression tests. The use of the mean flow stress versus inverse temperature curve to determine TNR_Tor does not correlate to the microstructural meaning of T NR (i.e. no recrystallization). The transition from completely recrystallized grains to less than complete recrystallization is not properly modeled by the intersection of two linear regions and is more gradual than the mechanical test implies. From the microstructural analysis of a10V45 steel, there is evidence of recrystallization at temperatures 200 °C below the measured TNR_Tor. The slope change on the mean flow stress versus inverse temperature curves is believed to be, in part, accumulated strain as well as refinement of continuously recrystallized grains causing a Hall-Petch type strength increase.

  9. Zoledronic acid inhibits aromatase activity and phosphorylation: potential mechanism for additive zoledronic acid and letrozole drug interaction.


    Schech, Amanda J; Nemieboka, Brandon E; Brodie, Angela H


    Zoledronic acid (ZA), a bisphosphonate originally indicated for use in osteoporosis, has been reported to exert a direct effect on breast cancer cells, although the mechanism of this effect is currently unknown. Data from the ABCSG-12 and ZO-FAST clinical trials suggest that treatment with the combination of ZA and aromatase inhibitors (AI) result in increased disease free survival in breast cancer patients over AI alone. To determine whether the mechanism of this combination involved inhibition of aromatase, AC-1 cells (MCF-7 human breast cancer cells transfected with an aromatase construct) were treated simultaneously with combinations of ZA and AI letrozole. This combination significantly increased inhibition of aromatase activity of AC-1 cells when compared to letrozole alone. Treatment of 1 nM letrozole in combination with 1 μM or 10 μM ZA resulted in an additive drug interaction on inhibition of cell viability, as measured by MTT assay. Treatment with ZA was found to inhibit phosphorylation of aromatase on serine residues. Zoledronic acid was also shown to be more effective in inhibiting cell viability in aromatase transfected AC-1 cells when compared to inhibition of cell viability observed in non-transfected MCF-7. Estradiol was able to partially rescue the effect of 1 μM and 10 μM ZA on cell viability following treatment for 72 h, as shown by a shift to the right in the estradiol dose-response curve. In conclusion, these results indicate that the combination of ZA and letrozole results in an additive inhibition of cell viability. Furthermore, ZA alone can inhibit aromatase activity through inhibition of serine phosphorylation events important for aromatase enzymatic activity and contributes to inhibition of cell viability.

  10. Theoretical investigation on mechanism of asymmetric Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex.


    Su, Zhishan; Lee, Hai Whang; Kim, Chan Kyung


    The mechanism of Michael addition of malononitrile to chalcones catalyzed by Cinchona alkaloid aluminium(III) complex has been investigated by DFT and ONIOM methods. Calculations indicate that the reaction proceeds through a dual activation mechanism, in which Al(III) acts as a Lewis acid to activate the electrophile α,β-unsaturated carbonyl substrate while the tertiary amine in the Cinchona alkaloid works as a Lewis base to promote the activation of the malononitrile and deprotonation. A stepwise pathway involving C-C bond formation followed by proton transfer from the catalyst to the carbonyl substrate is adopted, and latter step is predicted to be the rate-determining-step in the reaction with an energy barrier of 12.4 kcal mol(-1). In the absence of the Al(III)-complex, a Cinchona alkaloid activates the carbonyl substrate by a hydrogen bonding of the hydroxyl group, involving a higher energy barrier of 30.4 kcal mol(-1). The steric repulsion between the phenyl group attached to the carbonyl group in the chalcone and isopropoxyl groups of the Al(III)-complex may play an important role in the control of stereoselectivity. The π-π stacking effect between the quinuclidine ring of the quinine and the phenyl group of the chalcones may also help the stabilization of the preferred molecular complex. These results are in agreement with experimental observations.

  11. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    SciTech Connect

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.


    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  12. Effect of addition of Ag nano powder on mechanical properties of epoxy/polyaminoamide adduct coatings filled with conducting polymer

    NASA Astrophysics Data System (ADS)

    Samad, Ubair Abdus; Khan, Rawaiz; Alam, Mohammad Asif; Al-Othman, Othman Y.; Al-Zahrani, Saeed M.


    In this study the effect of Ag Nano powder on mechanical properties of epoxy coatings filled with optimized ratio of conducting polymers (Polyaniline and Polyppyrole) was evaluated. Bisphenol A diglycidyl ether epoxy resin (DGEBA) along with polyaminoamide adduct (ARADUR 3282-1 BD) is used as curing agent under optimized stoichiometry values. Curing is performed at room temperature with different percentages of Nano filler. Glass and steel panels were used as coating substrate. Bird applicator was used to coat the samples in order to obtain thin film with wet film thickness (WFT) of about 70-90 µm. The samples were kept in dust free environment for about 7 days at room temperature for complete curing. The coated steel panels were used to evaluate the mechanical properties of coating such as hardness, scratch and impact tests whereas coated glass panels were used for measuring pendulum hardness of the coatings. To check the dispersion and morphology of Nano filler in epoxy matrix scanning electron microscopy (SEM) was used in addition Nano indentation was also performed to observe the effect of Nano filler on modulus of elasticity and hardness at Nano scale.

  13. Meta-analysis of high-latitude nitrogen-addition and warming studies imply ecological mechanisms overlooked by land models

    NASA Astrophysics Data System (ADS)

    Bouskill, N. J.; Riley, W. J.; Tang, J.


    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the atmosphere. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the above and belowground high-latitude ecosystem responses to warming and nitrogen addition, and identified mechanisms absent, or poorly parameterized in CLM4.5. While the two model versions predicted similar trajectories for soil carbon stocks following both types of perturbation, other variables (e.g., belowground respiration) differed from the observations in both magnitude and direction, indicating the underlying mechanisms are inadequate for representing high-latitude ecosystems. The observational synthesis attribute these differences to missing representations of microbial dynamics, characterization of above and belowground functional processes, and nutrient competition. We use the observational meta-analyses to discuss potential approaches to improving the current models (e.g., the inclusion of dynamic vegetation or different microbial functional guilds), however, we also raise a cautionary note on the selection of data sets and experiments to be included in a meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average =72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which preclude a rigorous evaluation of the model responses to nitrogen perturbation. Overall, we demonstrate here that elucidating ecological mechanisms via meta-analysis can identify deficiencies in both ecosystem models and empirical experiments.

  14. Meta-analysis of high-latitude nitrogen-addition and warming studies imply ecological mechanisms overlooked by land models


    Bouskill, N. J.; Riley, W. J.; Tang, J.


    Accurate representation of ecosystem processes in land models is crucial for reducing predictive uncertainty in energy and greenhouse gas feedbacks with the atmosphere. Here we describe an observational and modeling meta-analysis approach to benchmark land models, and apply the method to the land model CLM4.5 with two versions of belowground biogeochemistry. We focused our analysis on the above and belowground high-latitude ecosystem responses to warming and nitrogen addition, and identified mechanisms absent, or poorly parameterized in CLM4.5. While the two model versions predicted similar trajectories for soil carbon stocks following both types of perturbation, other variables (e.g., belowground respiration) differedmore » from the observations in both magnitude and direction, indicating the underlying mechanisms are inadequate for representing high-latitude ecosystems. The observational synthesis attribute these differences to missing representations of microbial dynamics, characterization of above and belowground functional processes, and nutrient competition. We use the observational meta-analyses to discuss potential approaches to improving the current models (e.g., the inclusion of dynamic vegetation or different microbial functional guilds), however, we also raise a cautionary note on the selection of data sets and experiments to be included in a meta-analysis. For example, the concentrations of nitrogen applied in the synthesized field experiments (average =72 kg ha-1 yr-1) are many times higher than projected soil nitrogen concentrations (from nitrogen deposition and release during mineralization), which preclude a rigorous evaluation of the model responses to nitrogen perturbation. Overall, we demonstrate here that elucidating ecological mechanisms via meta-analysis can identify deficiencies in both ecosystem models and empirical experiments.« less

  15. PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1

    PubMed Central

    Langelier, Marie-France; Riccio, Amanda A.; Pascal, John M.


    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains—Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5′ phosphate (5′P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. PMID:24928857

  16. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.


    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M


    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  17. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.


    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M


    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci.

  18. Influence of Si addition on the microstructure and mechanical properties of Ti-35Nb alloy for applications in orthopedic implants.


    Tavares, A M G; Ramos, W S; de Blas, J C G; Lopes, E S N; Caram, R; Batista, W W; Souza, S A


    In the development of new materials for orthopedic implants, special attention has been given to Ti alloys that show biocompatible alloy elements and that are capable of reducing the elastic modulus. Accordingly, Ti-Nb-Si alloys show great potential for application. Thus, this is a study on the microstructures and properties of Ti-35Nb-xSi alloys (x=0, 0.15, 0.35 and 0.55) (wt%) which were thermally treated and cooled under the following conditions: furnace cooling (FC), air cooling (AC), and water quenching (WQ). The results showed that Si addition is effective to reduce the density of omega precipitates making beta more stable, and to produce grain refinement. Silicides, referred as (Ti,Nb)3Si, were formed for alloys containing 0.55% Si, and its formation presumably occurred during the heating at 1000°C. In all cooling conditions, the hardness values increased with the increasing of Si content, as a result from the strong Si solid solution strengthening effect, while the elastic modulus underwent a continuous reduction due to the reduction of omega precipitates in beta matrix. Lower elastic moduli were observed in water-quenched alloys, which concentration of 0.15% Si was more effective in their reduction, with value around 65 GPa. Regarding Ti-35Nb-xSi alloys (x=0, 0.15 and 0.35), the "double yield point" phenomenon, which is typical of alloys with shape memory effect, was observed. The increase in Si concentration also produced an increase from 382 MPa to 540 MPa in the alloys' mechanical strength. Ti-35Nb-0.55Si alloy, however, showed brittle mechanical behavior which was related to the presence of silicides at the grain boundary.

  19. Remediation of hexavalent chromium contamination in chromite ore processing residue by sodium dithionite and sodium phosphate addition and its mechanism.


    Li, Yunyi; Cundy, Andrew B; Feng, Jingxuan; Fu, Hang; Wang, Xiaojing; Liu, Yangsheng


    Large amounts of chromite ore processing residue (COPR) wastes have been deposited in many countries worldwide, generating significant contamination issues from the highly mobile and toxic hexavalent chromium species (Cr(VI)). In this study, sodium dithionite (Na2S2O4) was used to reduce Cr(VI) to Cr(III) in COPR containing high available Fe, and then sodium phosphate (Na3PO4) was utilized to further immobilize Cr(III), via a two-step procedure (TSP). Remediation and immobilization processes and mechanisms were systematically investigated using batch experiments, sequential extraction studies, X-ray diffraction (XRD) and X-ray Photoelectron Spectroscopy (XPS). Results showed that Na2S2O4 effectively reduced Cr(VI) to Cr(III), catalyzed by Fe(III). The subsequent addition of Na3PO4 further immobilized Cr(III) by the formation of crystalline CrPO4·6H2O. However, addition of Na3PO4 simultaneously with Na2S2O4 (via a one-step procedure, OSP) impeded Cr(VI) reduction due to the competitive reaction of Na3PO4 and Na2S2O4 with Fe(III). Thus, the remediation efficiency of the TSP was much higher than the corresponding OSP. Using an optimal dosage in the two-step procedure (Na2S2O4 at a dosage of 12× the stoichiometric requirement for 15 days, and then Na3PO4 in a molar ratio (i.e. Na3PO4: initial Cr(VI)) of 4:1 for another 15 days), the total dissolved Cr in the leachate determined via Toxicity Characteristic Leaching Procedure (TCLP Cr) testing of our samples was reduced to 3.8 mg/L (from an initial TCLP Cr of 112.2 mg/L, i.e. at >96% efficiency).

  20. Influence of Addition of Nb on Phase Transformation, Microstructure and Mechanical Properties of Equiatomic NiTi SMA

    NASA Astrophysics Data System (ADS)

    Jiang, Shuyong; Liang, Yulong; Zhang, Yanqiu; Zhao, Yanan; Zhao, Chengzhi


    Three novel NiTiNb shape memory alloys, which possess a nominal chemical composition of Ni50- x/2-Ti50- x/2-Nb x (at.%) where x stands for 2, 4 and 6, respectively, were designed in order to investigate the influence of the addition of Nb on phase transformation, microstructure and mechanical properties of equiatomic NiTi shape memory alloy. All the three NiTiNb shape memory alloys contain B2 austenite phase, B19' martensite phase and β-Nb precipitate phase. Martensite type II twin can be observed in the case of Ni49Ti49Nb2 alloy. In the case of Ni48Ti48Nb4 alloy, there exists a boundary between Ti2Ni precipitate phase and β-Nb precipitate phase. As for Ni47Ti47Nb6 alloy, it can be observed that there exists an orientation relationship of [01bar{1}]_{{β{{ - Nb}}}} //[01bar{1}]_{{B2}} between β-Nb precipitate phase and B2 austenite matrix. The increase in Nb content contributes to enhancing the yield stress of NiTiNb shape memory alloy, but it leads to the decrease in compression fracture stress. The addition of Nb to equiatomic NiTi shape memory alloy does not have a significant influence on the transformation hysteresis of the alloy, which is attributed to the fact that NiTiNb shape memory alloy is not subjected to plastic deformation and hence β-Nb precipitate phase is unable to relax the elastic strain in the martensite interface.

  1. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases

    PubMed Central

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W.


    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7’s catalytic domain, and S1565, in TRPM7’s exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7’s functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity. PMID:28220887

  2. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.


    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  3. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases.


    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W


    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7's catalytic domain, and S1565, in TRPM7's exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7's functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity.

  4. Antigen- and receptor-driven regulatory mechanisms. I. Induction of suppressor T cells with anti-idiotypic antibodies

    PubMed Central


    Delayed-type hypersensitivity (DTH) to the azobenzenearsonate (ABA) hapten can be readily induced in A/J mice injecting ABA-coupled syngeneic spleen cells subcutaneously. To further characterize this T- cell-dependent immunological phenomenon, the effect of passively administered anti-cross-reactive idiotype common to anti-ABA antibodies of A/J mice (CRI) antibodies on the development of ABA-specific DTH was investigated. Animals given daily injections (of minute amounts) of anti-CRI antibodies subsequent to immunization with ABA-coupled cells show significant reduction of ABA specific responses. This inhibition is antigen specific and requires the intact immunoglobulin molecule, as F(ab')2 treatments were ineffective in suppressing the reaction. Investigations of the mechanism of the anti-CRI-induced suppression of ABA DTH revealed that the observed suppression is a result of the activation of suppressor cells. Spleen cells taken from animals which received anti-CRI antibodies were able to adoptively transfer suppression to naive recipients. This suppression was shown to be mediated by T cells, as anti-Thy1.2 plus complement completely abrogated the transfer of suppression. In addition, animals pretreated with low doses of cyclophosphamide were not suppressed by the administration of anti-CRI antibodies. The genetic restriction of anti- CRI-induced suppression was demonstrated. Antibodies to the major cross- reactive idiotype, (CRI) associated with anti-ABA antibodies in A/J mice were unable to suppress the development of DTH to ABA in BALB/c mice (H-2d, Igh-1a). Such antibodies were, however, fully active in suppressing ABA DTH in the allotype-congenic C.AL-20 strain which has an allotype (Igh-1d) similar to that of A/J (Igh-1e) on a BALB/c background, and which produces humoral antibodies with the CRI. PMID:91656

  5. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria


    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  6. Failure mechanism of layered lithium-rich oxide/graphite cell and its solution by using electrolyte additive

    NASA Astrophysics Data System (ADS)

    Zhu, Yunmin; Luo, Xueyi; Xu, Mengqing; Zhang, Liping; Yu, Le; Fan, Weizhen; Li, Weishan


    We report a failure mechanism of layered lithium-rich oxide/graphite cell and a solution to this failure. Charge/discharge tests demonstrate that Li1.2Mn0.54Ni0.13Co0.13O2/graphite full cell fails when it is performed with cycling and this issue can be solved effectively by using an electrolyte additive, tris (trimethylsilyl) phosphite (TMSPi). Further cycling tests on Li/Li1.2Mn0.54Ni0.13Co0.13O2 and Li/graphite half-cells and physical characterizations on the cycled cathode indicate that this failure involves the increased HF concentration and the subsequent corrosion for aluminum current collector of cathode due to the electrolyte decomposition during cycling. TMSPi contributes to the formation of a protective interphase on cathode due to its preferential oxidation compared with the base electrolyte, which suppresses the electrolyte decomposition and the HF formation, preventing aluminum current collector from corrosion.

  7. Microstructure-mechanical property relationships for Al-Cu-Li-Zr alloys with minor additions of cadmium, indium or tin

    NASA Technical Reports Server (NTRS)

    Blackburn, L. B.; Starke, E. A., Jr.


    Minor amounts of cadmium, indium or tin were added to a baseline alloy with the nominal composition of Al-2.4Cu-2.4Li-0.15Zr. These elements were added in an attempt to increase the age-hardening response of the material such that high strengths could be achieved through heat-treatment alone, without the need for intermediate mechanical working. The alloy variant containing indium achieved a higher peak hardness in comparison to the other alloy variations, including the baseline material, when aged at temperatures ranging from 160 C to 190 C. Tensile tests on specimens peak-aged at 160 indicated the yield strength of the indium-bearing alloy increased by approximately 15 percent compared to that of the peak-aged baseline alloy. In addition, the yield strength obtained in the indium-bearing alloy was comparable to that reported for similar baseline material subjected to a 6 percent stretch prior to peak-aging at 190 C. The higher strength levels obtaied for the indium-bearing alloy are attributed to increased number densities and homogeneity of both the T1 and theta-prime phases, as determined by TEM studies.

  8. Investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al alloy with Ag and Mn additions

    SciTech Connect

    Silva, R.A.G.; Paganotti, A.; Gama, S.; Adorno, A.T.; Carvalho, T.M.; Santos, C.M.A.


    The investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al, Cu-11%Al-3%Ag, Cu-11%Al-10%Mn and Cu-11%Al-10%Mn-3%Ag alloys was made using microhardness measurements, differential scanning calorimetry, X-ray diffractometry, scanning electron microscopy, energy dispersion X-ray spectroscopy and magnetic moment change with applied field measurement. The results indicated that the Mn addition changes the phase stability range, the microhardness values and makes undetectable the eutectoid reaction in annealed Cu-11%Al and Cu-11%Al-3%Ag alloys while the presence of Ag does not modify the phase transformation sequence neither microhardness values of the annealed Cu-11%Al and Cu-11%Al-10%Mn alloys, but it increases the magnetic moment of this latter at about 2.7 times and decreases the rates of eutectoid and peritectoid reactions of the former. - Highlights: Black-Right-Pointing-Pointer The microstructure of Cu-Al alloy is modified in the Ag presence. Black-Right-Pointing-Pointer ({alpha} + {gamma}) phase is stabilized down to room temperature when Ag is added to Cu-Al alloy. Black-Right-Pointing-Pointer Ag-rich phase modifies the magnetic characteristics of Cu-Al-Mn alloy.

  9. The Effect of SiC Particle Addition During FSW on Microstructure and Mechanical Properties of AZ31 Magnesium Alloy

    NASA Astrophysics Data System (ADS)

    Abbasi, M.; Abdollahzadeh, A.; Bagheri, B.; Omidvar, H.


    Welding and joining of magnesium alloys exert a profound effect on magnesium application expansion, especially in ground and air transportations where large-size, complex components are required. Due to specific physical properties of magnesium, its welding requires great control. In general, the solid-state nature of friction stir welding (FSW) process has been found to produce a low concentration of defects. In the current research, specimens from AZ31 magnesium alloy were welded together using the friction stir process with previously inserted SiC powder particles in the nugget zone. In other words, during the FSW process, the pre-placed SiC particles were stirred throughout the nugget zone of the weld. The results indicated that proper values of rotation and translation speeds led to good appearance of weld zone and suitable distribution of SiC particles producing increased weld strength. The comparison of the microstructures and mechanical properties of FS-welded AZ31 with those of FS-welded one using pre-placed SiC particles showed that the addition of SiC particles decreased the grain size and increased the strength and the formability index.

  10. Unraveling the fundamental mechanisms of solvent-additive-induced optimization of power conversion efficiencies in organic photovoltaic devices

    SciTech Connect

    Herath, Nuradhika; Das, Sanjib; Zhu, Jiahua; Kumar, Rajeev; Chen, Jihua; Xiao, Kai; Gu, Gong; Browning, James F.; Sumpter, Bobby G.; Ivanov, Ilia N.; Lauter, Valeria


    The realization of controllable morphologies of bulk heterojunction (BHJ) in organic photovoltics (OPVs) is one of the key factors in obtaining high-efficiency devices. Here via simultaneous monitoring of the three-dimensional nanostructural modifications in BHJ correlated with the optical analysis and theoretical modeling of charge transport, we provide new insights into the fundamental mechanisms essential for the optimization of (power conversion efficiency) PCEs with additive processing. Our results demonstrate how a trace amount of diiodooctane (DIO) remarkably changes the vertical phase morphology of the active layers resulting in formation of a well-mixed donor-acceptor compact film, augments charge transfer and PCEs. In contrast, excess amount of DIO promotes a massive reordering and results loosely packed mixed phase vertical phase morphology with large clusters leading to deterioration in PCEs. Theoretical modeling of charge transport reveals that DIO increases the mobility of electrons and holes (the charge carriers) by affecting the energetic disorder and electric field dependence of the mobility. Our results show the significant of phase separation and carrier transport pathways to achieve optimal device performances.

  11. Unraveling the fundamental mechanisms of solvent-additive-induced optimization of power conversion efficiencies in organic photovoltaic devices


    Herath, Nuradhika; Das, Sanjib; Zhu, Jiahua; ...


    The realization of controllable morphologies of bulk heterojunction (BHJ) in organic photovoltics (OPVs) is one of the key factors in obtaining high-efficiency devices. Here via simultaneous monitoring of the three-dimensional nanostructural modifications in BHJ correlated with the optical analysis and theoretical modeling of charge transport, we provide new insights into the fundamental mechanisms essential for the optimization of (power conversion efficiency) PCEs with additive processing. Our results demonstrate how a trace amount of diiodooctane (DIO) remarkably changes the vertical phase morphology of the active layers resulting in formation of a well-mixed donor-acceptor compact film, augments charge transfer and PCEs. Inmore » contrast, excess amount of DIO promotes a massive reordering and results loosely packed mixed phase vertical phase morphology with large clusters leading to deterioration in PCEs. Theoretical modeling of charge transport reveals that DIO increases the mobility of electrons and holes (the charge carriers) by affecting the energetic disorder and electric field dependence of the mobility. Our results show the significant of phase separation and carrier transport pathways to achieve optimal device performances.« less

  12. Hemolysate-mediated platelet aggregation: an additional risk mechanism contributing to thrombosis of continuous flow ventricular assist devices.


    Tran, Phat L; Pietropaolo, Maria-Grazia; Valerio, Lorenzo; Brengle, William; Wong, Raymond K; Kazui, Toshinobu; Khalpey, Zain I; Redaelli, Alberto; Sheriff, Jawaad; Bluestein, Danny; Slepian, Marvin J


    Despite the clinical success and growth in the utilization of continuous flow ventricular assist devices (cfVADs) for the treatment of advanced heart failure, hemolysis and thrombosis remain major limitations. Inadequate and/or ineffective anticoagulation regimens, combined with high pump speed and non-physiological flow patterns, can result in hemolysis which often is accompanied by pump thrombosis. An unexpected increase in cfVADs thrombosis was reported by multiple major VAD implanting centers in 2014, highlighting the association of hemolysis and a rise in lactate dehydrogenase (LDH) presaging thrombotic events. It is well established that thrombotic complications arise from the abnormal shear stresses generated by cfVADs. What remains unknown is the link between cfVAD-associated hemolysis and pump thrombosis. Can hemolysis of red blood cells (RBCs) contribute to platelet aggregation, thereby, facilitating prothrombotic complications in cfVADs? Herein, we examine the effect of RBC-hemolysate and selected major constituents, i.e., lactate dehydrogenase (LDH) and plasma free hemoglobin (pHb) on platelet aggregation, utilizing electrical resistance aggregometry. Our hypothesis is that elements of RBCs, released as a result of shear-mediated hemolysis, will contribute to platelet aggregation. We show that RBC hemolysate and pHb, but not LDH, are direct contributors to platelet aggregation, posing an additional risk mechanism for cfVAD thrombosis.

  13. Enhancement mechanism of the additional absorbent on the absorption of the absorbing composite using a type-based mixing rule

    NASA Astrophysics Data System (ADS)

    Xu, Yonggang; Yuan, Liming; Zhang, Deyuan


    A silicone rubber composite filled with carbonyl iron particles and four different carbonous materials (carbon black, graphite, carbon fiber or multi-walled carbon nanotubes) was prepared using a two-roller mixture. The complex permittivity and permeability were measured using a vector network analyzer at the frequency of 2-18 GHz. Then a type-based mixing rule based on the dielectric absorbent and magnetic absorbent was proposed to reveal the enhancing mechanism on the permittivity and permeability. The enforcement effect lies in the decreased percolation threshold and the changing pending parameter as the carbonous materials were added. The reflection loss (RL) result showed the added carbonous materials enhanced the absorption in the lower frequency range, the RL decrement value being about 2 dB at 4-5 GHz with a thickness of 1 mm. All the added carbonous materials reinforced the shielding effectiveness (SE) of the composites. The maximum increment value of the SE was about 3.23 dB at 0.5 mm and 4.65 dB at 1 mm, respectively. The added carbonous materials could be effective additives for enforcing the absorption and shielding property of the absorbers.

  14. More than one way to control hair growth: regulatory mechanisms in enterobacteria that affect fimbriae assembled by the chaperone/usher pathway.


    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah


    Many gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms.

  15. Impact of guided exploration and enactive exploration on self-regulatory mechanisms and information acquisition through electronic search.


    Debowski, S; Wood, R E; Bandura, A


    Following instruction in basic skills for electronic search, participants who practiced in a guided exploration mode developed stronger self-efficacy and greater satisfaction than those who practiced in a self-guided exploratory mode. Intrinsic motivation was not affected by exploration mode. On 2 post-training tasks, guided exploration participants produced more effective search strategies. expended less effort, made fewer errors, rejected fewer lines of search, and achieved higher performance. Relative lack of support for self-regulatory factors as mediators of exploration mode impacts was attributed to the uninformative feedback from electronic search, which causes most people to remain at a novice level and to require external guidance for development of self-efficacy and skills. Self-guided learning will be more effective on structured tasks with more informative feedback and for individuals with greater expertise on dynamic tasks.

  16. Mechanical properties and phase composition of potential biodegradable Mg-Zn-Mn-base alloys with addition of rare earth elements

    SciTech Connect

    Stulikova, Ivana; Smola, Bohumil


    Mechanical properties and creep resistance of the MgY4Zn1Mn1 alloy in the as cast as well as in the T5 condition were compared to those of the MgCe4Zn1Mn1 alloy in the same conditions. Yield tensile stress and ultimate tensile strength of the MgY4Zn1Mn1 alloy are slightly better in the temperature range 20 deg. C-400 deg. C than these of the MgCe4Zn1Mn1 alloy. Better thermal stability of ultimate tensile strength was observed in the T5 treated MgCe4Zn1Mn1 alloy than in this material in the as cast condition. An outstanding creep resistance at 225 deg. C-350 deg. C found in the MgY4Zn1Mn1 alloy is due to the existence of the 18R long period stacking structure persisting in this alloy even a long heat treatment of 500 deg. C/32 h. No similar stacking effects happen when Ce substitutes Y in approximately the same concentration. The creep resistance deteriorates considerably in the MgCe4Zn1Mn1 alloy. Rectangular particles of the equilibrium Mg{sub 12}Ce phase dominate in the microstructure of as cast as well as of high temperature heat-treated MgCe4Zn1Mn1 alloy. A population of small oval particles containing Mg and Zn develops additionally during annealing of this alloy. These particles pin effectively dislocations and can be responsible for the better thermal stability of the T5 treated material.

  17. Allergic contact dermatitis: epidemiology, molecular mechanisms, in vitro methods and regulatory aspects. Current knowledge assembled at an international workshop at BfR, Germany.


    Peiser, M; Tralau, T; Heidler, J; Api, A M; Arts, J H E; Basketter, D A; English, J; Diepgen, T L; Fuhlbrigge, R C; Gaspari, A A; Johansen, J D; Karlberg, A T; Kimber, I; Lepoittevin, J P; Liebsch, M; Maibach, H I; Martin, S F; Merk, H F; Platzek, T; Rustemeyer, T; Schnuch, A; Vandebriel, R J; White, I R; Luch, A


    Contact allergies are complex diseases, and one of the important challenges for public health and immunology. The German 'Federal Institute for Risk Assessment' hosted an 'International Workshop on Contact Dermatitis'. The scope of the workshop was to discuss new discoveries and developments in the field of contact dermatitis. This included the epidemiology and molecular biology of contact allergy, as well as the development of new in vitro methods. Furthermore, it considered regulatory aspects aiming to reduce exposure to contact sensitisers. An estimated 15-20% of the general population suffers from contact allergy. Workplace exposure, age, sex, use of consumer products and genetic predispositions were identified as the most important risk factors. Research highlights included: advances in understanding of immune responses to contact sensitisers, the importance of autoxidation or enzyme-mediated oxidation for the activation of chemicals, the mechanisms through which hapten-protein conjugates are formed and the development of novel in vitro strategies for the identification of skin-sensitising chemicals. Dendritic cell cultures and structure-activity relationships are being developed to identify potential contact allergens. However, the local lymph node assay (LLNA) presently remains the validated method of choice for hazard identification and characterisation. At the workshop the use of the LLNA for regulatory purposes and for quantitative risk assessment was also discussed.

  18. Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms*

    PubMed Central

    Du, Zhihua; Fenn, Sebastian; Tjhen, Richard; James, Thomas L.


    Poly(C)-binding proteins (PCBPs) are important regulatory proteins that contain three KH (hnRNP K homology) domains. Binding poly(C) D/RNA sequences via KH domains is essential for multiple PCBP functions. To reveal the basis for PCBP-D/RNA interactions and function, we determined the structure of a construct containing the first two domains (KH1-KH2) of human PCBP2 by NMR. KH1 and KH2 form an intramolecular pseudodimer. The large hydrophobic dimerization surface of each KH domain is on the side opposite the D/RNA binding interface. Chemical shift mapping indicates both domains bind poly(C) DNA motifs without disrupting the KH1-KH2 interaction. Spectral comparison of KH1-KH2, KH3, and full-length PCBP2 constructs suggests that the KH1-KH2 pseudodimer forms, but KH3 does not interact with other parts of the protein. From NMR studies and modeling, we propose possible modes of cooperative binding tandem poly(C) motifs by the KH domains. D/RNA binding may induce pseudodimer dissociation or stabilize dissociated KH1 and KH2, making protein interaction surfaces available to PCBP-binding partners. This conformational change may represent a regulatory mechanism linking D/RNA binding to PCBP functions. PMID:18701464

  19. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.


    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  20. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen


    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  1. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.


    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  2. Control of liver size by RNAi-mediated multiplex knockdown and its application for discovery of regulatory mechanisms

    PubMed Central

    Yin, Hao; Bogorad, Roman L.; Barnes, Carmen; Walsha, Stephen; Zhuang, Iris; Nonaka, Hidenori; Ruda, Vera; Kuchimanchi, Satya; Nechev, Lubomir; Akinc, Akin; Xue, Wen; Zerial, Marino; Langer, Robert; Anderson, Daniel G.; Koteliansky, Victor


    Background and aims The Hippo pathway controls organ size through a negative regulation of the transcription co-activator Yap1. The overexpression of hyperactive mutant Yap1 or deletion of key components in the Hippo pathway leads to increased organ size in different species. Analysis of interactions of this pathway with other cellular signals corroborating organ size control is limited in part due to the difficulties associated with development of rodent models. Methods Here, we develop a new model of reversible induction of the liver size in mice using siRNA-nanoparticles targeting two kinases of Hippo pathway, namely, mammalian Ste20 family kinases 1 and 2 (Mst1 and Mst2), and an upstream regulator, neurofibromatosis type II (NF2). Results The triple siRNAs nanoparticle-induced hepatomegaly in mice phenocopies one observed with Mst1-/- Mst2-/- liver-specific depletion, as shown by extensive proliferation of hepatocytes and activation of Yap1. The simultaneous co-treatment with a fourth siRNA nanoparticle against Yap1 fully blocked the liver growth. Hippo pathway-induced liver enlargement is associated with p53 activation, evidenced by its accumulation in the nuclei and upregulation of its target genes. Moreover, injections of the triple siRNAs nanoparticle in p53LSL/LSL mice shows that livers lacking p53 expression grow faster and exceed the size of livers in p53 wild type animals, indicating a role of p53 in controlling Yap1-induced liver growth. Conclusion Our data show that siRNA-nanoparticulate manipulation of gene expression can provide the reversible control of organ size in adult animals, which presents a new avenue for the investigation of complex regulatory networks in liver. PMID:26658687

  3. Effect of Zr, Nb and Ti addition on injection molded 316L stainless steel for bio-applications: Mechanical, electrochemical and biocompatibility properties.


    Gulsoy, H Ozkan; Pazarlioglu, Serdar; Gulsoy, Nagihan; Gundede, Busra; Mutlu, Ozal


    The research investigated the effect of Zr, Nb and Ti additions on mechanical, electrochemical properties and biocompatibility of injection molded 316L stainless steel. Addition of elemental powder is promoted to get high performance of sintered 316L stainless steels. The amount of additive powder plays a role in determining the sintered microstructure and all properties. In this study, 316L stainless steel powders used with the elemental Zr, Nb and Ti powders. A feedstock containing 62.5 wt% powders loading was molded at different injection molded temperature. The binders were completely removed from molded components by solvent and thermal debinding at different temperatures. The debinded samples were sintered at 1350°C for 60 min. Mechanical, electrochemical property and biocompatibility of the sintered samples were performed mechanical, electrochemical, SBF immersion tests and cell culture experiments. Results of study showed that sintered 316L and 316L with additives samples exhibited high corrosion properties and biocompatibility in a physiological environment.

  4. Regulatory T cell memory

    PubMed Central

    Rosenblum, Michael D.; Way, Sing Sing; Abbas, Abul K.


    Memory for antigen is a defining feature of adaptive immunity. Antigen-specific lymphocyte populations show an increase in number and function after antigen encounter and more rapidly re-expand upon subsequent antigen exposure. Studies of immune memory have primarily focused on effector B cells and T cells with microbial specificity, using prime challenge models of infection. However, recent work has also identified persistently expanded populations of antigen-specific regulatory T cells that protect against aberrant immune responses. In this Review, we consider the parallels between memory effector T cells and memory regulatory T cells, along with the functional implications of regulatory memory in autoimmunity, antimicrobial host defence and maternal fetal tolerance. In addition, we discuss emerging evidence for regulatory T cell memory in humans and key unanswered questions in this rapidly evolving field. PMID:26688349

  5. Robustness and evolvability in natural chemical resistance: identification of novel systems properties, biochemical mechanisms and regulatory interactions.


    Venancio, Thiago M; Balaji, S; Geetha, S; Aravind, L


    A vast amount of data on the natural resistance of Saccharomyces cerevisiae to a diverse array of chemicals has been generated over the past decade (chemical genetics). We endeavored to use this data to better characterize the "systems" level properties of this phenomenon. By collating data from over 30 different genome-scale studies on growth of gene deletion mutants in presence of diverse chemicals, we assembled the largest currently available gene-chemical network. We also derived a second gene-gene network that links genes with significantly overlapping chemical-genetic profiles. We analyzed properties of these networks and investigated their significance by overlaying various sources of information, such as presence of TATA boxes in their promoters (which typically correlate with transcriptional noise), association with TFIID or SAGA, and propensity to function as phenotypic capacitors. We further combined these networks with ubiquitin and protein kinase-substrate networks to understand chemical tolerance in the context of major post-translational regulatory processes. Hubs in the gene-chemical network (multidrug resistance genes) are notably enriched for phenotypic capacitors (buffers against phenotypic variation), suggesting the generality of these players in buffering mechanistically unrelated deleterious forces impinging on the cell. More strikingly, analysis of the gene-gene network derived from the gene-chemical network uncovered another set of genes that appear to function in providing chemical tolerance in a cooperative manner. These appear to be enriched in lineage-specific and rapidly diverging members that also show a corresponding tendency for SAGA-dependent regulation, evolutionary divergence and noisy expression patterns. This set represents a previously underappreciated component of the chemical response that enables cells to explore alternative survival strategies. Thus, systems robustness and evolvability are simultaneously active as general

  6. Co-Expression Analysis of Blood Cell Genome Expression to Preliminary Investigation of Regulatory Mechanisms in Uremia

    PubMed Central

    Cheng, Liu; Yonggui, Wu


    Background Uremia involves a series of clinical manifestations and is a common syndrome that occurs in nearly all end-stage kidney diseases. However, the exact genetic and/or molecular mechanisms that underlie uremia remain poorly understood. Material/Methods In this case-control study, we analyzed whole-genome microarray of 75 uremia patients and 20 healthy controls to investigate changes in gene expression and cellular mechanisms relevant to uremia. Gene co-expression network analysis was performed to construct co-expression networks using differentially expressed genes (DEGs) in uremia. We then determined hub models of co-expressed gene networks by MCODE, and we used miRNA enrichment analysis to detect key miRNAs in each hub module. Results We found nine co-expressed hub modules implicated in uremia. These modules were enriched in specific biological functions, including “proteolysis”, “membrane-enclosed lumen”, and “apoptosis”. Finally, miRNA enrichment analysis to detect key miRNAs in each hub module found 15 miRNAs that were specifically targeted to uremia-related hub modules. Of these, miRNA-21-3p and miRNA-210-3p have been identified in other studies as being important for uremia. Conclusions In summary, our study connected biological functions, genes, and miRNAs that underpin the network modules that can be used to elucidate the molecular mechanisms involved in uremia. PMID:28050009

  7. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.


    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  8. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing


    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  9. Complementary vascular and matrix regulatory pathways underlie the beneficial mechanism of action of sorafenib in liver fibrosis

    PubMed Central

    Thabut, Dominique; Routray, Chittaranjan; Lomberk, Gwen; Shergill, Uday; Glaser, Kevin; Huebert, Robert; Patel, Leena; Masyuk, Tetyana; Blechacz, Boris; Vercnocke, Andrew; Ritman, Erik; Ehman, Richard; Urrutia, Raul; Shah, Vijay


    Background Paracrine signaling between hepatic stellate cells (HSC) and liver endothelial cells (LEC) modulates fibrogenesis, angiogenesis, and portal hypertension. However, mechanisms regulating these processes are not fully defined. Sorafenib is a receptor tyrosine kinase inhibitor that blocks growth factor signaling in tumor cells but also displays important and not yet fully characterized effects on liver nonparenchymal cells including HSC and LEC. The aim of this study was to test the hypothesis that sorafenib influences paracrine signaling between HSC and LEC and thereby regulates matrix and vascular changes associated with chronic liver injury. Results Complementary magnetic resonance elastography, micro-CT, and histochemical analyses indicate that sorafenib attenuates the changes in both matrix and vascular compartments that occur in response to bile-duct ligation induced liver injury in rats. Cell biology studies demonstrate that sorafenib markedly reduces cell to cell apposition and junctional complexes, thus reducing the proximity typically observed between these sinusoidal barrier cells. At the molecular level, sorafenib down-regulates angiopoietin-1 and fibronectin, both released by HSC in a manner dependent on the transcription factor KLF6, suggesting that this pathway underlies both matrix and vascular changes associated with chronic liver disease. Conclusion Collectively, our results demonstrate that sorafenib inhibits both matrix restructuring and vascular remodeling that accompany chronic liver diseases and characterize cell and molecular mechanisms underlying this effect. These data may help to refine future therapies for advanced gastrointestinal and liver diseases characterized by abundant fibrosis and neovascularization. PMID:21567441

  10. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.


    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  11. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun


    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  12. Molecular dynamics simulations for the examination of mechanical properties of hydroxyapatite/ poly α-n-butyl cyanoacrylate under additive manufacturing.


    Wang, Yanen; Wei, Qinghua; Pan, Feilong; Yang, Mingming; Wei, Shengmin


    Molecular dynamics (MD) simulations emerged to be a helpful tool in the field of material science. In rapid prototyping artificial bone scaffolds process, the binder spraying volume and mechanism are very important for bone scaffolds mechanical properties. In this study, we applied MD simulations to investigating the binding energy of α-n-butyl cyanoacrylate (NBCA) on Hydroxyapatite (HA) crystallographic planes (001, 100 and 110), and to calculating and analyzing the mechanical properties and radial distribution function of the HA(110)/NBCA mixed system. The simulation results suggested that HA (110) has the highest binding energy with NBCA owing to the high planar atom density, and the mechanical properties of HA(110)/NBCA mixed system is stronger than pure HA system. Therefore, the multi-grade strength bone scaffold could be fabricated through spraying various volume NBCA binders during 3D printing process. By calculating the radial distribution function of HA(110)/NBCA, the essence of the interface interaction were successfully elucidated. The forming situation parameters can be referred to calculation results. There exists a strong interaction between HA crystallographic plane (110) and NBCA, it is mainly derived from the hydrogen bonds between O atoms which connect with C atoms of NBCA and H atoms in HA crystal. Furthermore, a strong adsorption effect can be demonstrated between HA and NBCA.

  13. Casein films: effects of formulation, environmental conditions, and addition of citric pectin on the structure and mechanical properties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thin casein films for food packaging applications reportedly possess good strength and low oxygen permeability, but low water-resistance and elasticity. Modifying and customizing the mechanical properties of the films to target specific behaviors depending on environmental conditions would enable a...

  14. Selective laser melting additive manufactured Inconel 718 superalloy parts: High-temperature oxidation property and its mechanisms

    NASA Astrophysics Data System (ADS)

    Jia, Qingbo; Gu, Dongdong


    This work presented a comprehensive study of high-temperature oxidation behaviors and mechanisms of Selective laser melting (SLM) processed Inconel 718 superalloy parts using different methods including isothermal oxidation testing, X-ray diffraction, scanning electron microscopy and energy dispersive X-ray spectroscopy. The experimental results revealed that the oxidation process of the tested parts processed at a lower volumetric laser energy density experienced the severe spallation. On reasonably increasing the applied volumetric laser energy density, the oxidation kinetics of the as-produced parts obeyed a parabolic law, exhibiting the significantly improved oxidation resistance performance. The constitutional phases within the oxidation film were identified and the corresponding formation mechanisms were elucidated in detail according to the thermodynamic principles. The cross-sectional morphologies of oxidized Inconel 718 parts indicated that the oxidation microstructure mainly consisted of an external oxidation layer and an internal oxidation zone. The oxidation process was controlled by the outward diffusion of oxide forming elements and inward penetration of oxygen, by which the interaction mechanisms between the microstructures and internal oxidation zones were clarified. On the basis of the experimental results and theoretical analyses, the physical oxidation mechanisms were accordingly established to illustrate the oxidation behaviors of SLM-processed Inconel 718 parts at elevated operative temperatures.

  15. Depletion of Foxp3+ regulatory T cells increases severity of mechanical allodynia and significantly alters systemic cytokine levels following peripheral nerve injury.


    Lees, Justin G; Duffy, Samuel S; Perera, Chamini J; Moalem-Taylor, Gila


    Neuropathic pain is a debilitating condition caused by damage to the somatosensory nervous system, such as peripheral nerve injury. The immune system, and in particular the adaptive T cell response, plays a key role in mediating such pain. Regulatory T (Treg) cells are a small subpopulation of inhibitory T cells that prevent autoimmunity, limit immunopathology and maintain immune homeostasis. Here, we investigated the effects of conditional depletion of Treg cells on mechanical allodynia and serum cytokines in mice with chronic constriction injury (CCI) of the sciatic nerve, an animal model of neuropathic pain. We demonstrate that CCI induced the infiltration of small numbers of Treg cells within effected neuronal tissue. Utilising the transgenic DEREG (DEpletion of REGulatory T cells) mice, we confirmed effective depletion of Foxp3+ Treg cells by diphtheria toxin injections. Following CCI we observed a transient, though significant, increase in pain hypersensitivity for Treg-depleted DEREG mice compared to non-Treg-depleted mice. Analysis of systemic cytokine levels demonstrated significant changes in serum cytokine expression profiles. In particular, we observed significant increases in systemic concentration of RANTES, IL-2 and IL-5, and significant decreases in IL-12 and IFN-γ in nerve-injured Treg-depleted DEREG mice. Further analysis indicated a substantial increase in the serum concentration of IL-12p40 as a direct result of Treg cell depletion. These results suggest that depletion of Foxp3+ Treg cells promote nerve injury-induced pain hypersensitivity, partially by inducing altered systemic concentrations of cytokines, which may act to regulate neuropathic pain.

  16. Anti-Wear Performance and Mechanism of an Oil-Miscible Ionic Liquid as a Lubricant Additive

    SciTech Connect

    Qu, Jun; Bansal, Dinesh G; Yu, Bo; Howe, Jane Y; Luo, Huimin; Dai, Sheng; Li, Huaqing; Blau, Peter Julian; Bunting, Bruce G; Mordukhovich, Gregory; Smolenski, Donald


    An ionic liquid (IL) trihexyltetradecylphosphonium bis(2-ethylhexyl) phosphate has been investigated as a potential anti-wear lubricant additive. Unlike most other ILs that have very low solubility in non-polar fluids, this IL is fully miscible with various hydrocarbon oils. In addition, it is thermally stable up to 347 oC, showed no corrosive attack to cast iron in ambient environment, and has excellent wettability on solid surfaces (e.g., contact angle on cast iron <8o). Most importantly, this phosphonium-based IL has demonstrated effective anti-scuffing and anti-wear characteristics when blended with lubricating oils. For example, a 5 wt.% addition into a synthetic base oil eliminated the scuffing failure experienced by the neat oil and, as a result, reduced the friction coefficient by 60% and the wear rate by three orders of magnitude. A synergistic effect on wear protection was observed with the current anti-wear additive when added into a fully-formulated engine oil. Nanostructure examination and composition analysis revealed a tribo-boundary film and subsurface plastic deformation zone for the metallic surface lubricated by the IL-containing lubricants. This protective boundary film is believed to be responsible for the IL s anti-scuffing and anti-wear functionality.

  17. Densification of Reaction Bonded Silicon Nitride with the Addition of Fine Si Powder Effects on the Sinterability and Mechanical Properties

    SciTech Connect

    Lee, Sea-Hoon; Cho, Chun-Rae; Park, Young-Jo; Ko, Jae-Woong; Kim, Hai-Doo; Lin, Hua-Tay; Becher, Paul F


    The densification behavior and strength of sintered reaction bonded silicon nitrides (SRBSN) that contain Lu2O3-SiO2 additives were improved by the addition of fine Si powder. Dense specimens (relative density: 99.5%) were obtained by gas-pressure sintering (GPS) at 1850oC through the addition of fine Si. In contrast, the densification of conventional specimens did not complete at 1950oC. The fine Si decreased the onset temperature of shrinkage and increased the shrinkage rate because the additive helped the compaction of green bodies and induced the formation of fine Si3N4 particles after nitridation and sintering at and above 1600oC. The amount of residual SiO2 within the specimens was not strongly affected by adding fine Si powder because most of the SiO2 layer that had formed on the fine Si particles decomposed during nitridation. The maximum strength and fracture toughness of the specimens were 991 MPa and 8.0 MPa m1/2, respectively.

  18. Regulatory mechanisms of cAMP levels as a multiple target for antiplatelet activity and less bleeding risk.


    Fuentes, Eduardo; Palomo, Iván


    Platelet activation is a critical component of atherothrombosis. The multiple pathways of platelet activation limit the effect of specific receptor/pathway inhibitors, resulting in limited clinical efficacy. Recent research has confirmed that combination therapy results in enhanced antithrombotic efficacy without increasing bleeding risk. In this way, the best-known inhibitor and turn off signaling in platelet activation is cAMP. In this article we discuss the mechanisms of regulation of intraplatelet cAMP levels, a) platelet-dependent pathway: Gi/Gs protein-coupled receptors, phosphodiesterase inhibition and activation of PPARs and b) platelet-independent pathway: inhibition of adenosine uptake by erythrocytes. With respect to the association between intraplatelet cAMP levels and bleeding risk it is possible to establish that compounds/drugs with pleitropic effect for increased intraplatelet cAMP level could have an antithrombotic activity with less risk of bleeding.

  19. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.


    Xie, L; Smith, J A; Gross, S S


    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP.

  20. Effect of Ti/Al ratio and Cr, Nb, and Hf additions on material factors and mechanical properties in TiAl

    NASA Astrophysics Data System (ADS)

    Kawabata, T.; Tamura, T.; Izumi, O.


    The effect of the Ti/Al ratio and Cr, Nb, and Hf additions on material factors, such as the grain size, second phase, la tice parameters and the axial ratio, and on mechanical properties in TiAl-base alloys has been studied. The grain size was decreased by the deviation from the stoichiometric composition o the Ti-rich side and the addition of the third elements. The Cr element was contained a little more in Ti3Al phase than in TiAl phase in two-phase Ti-rich alloys. The lattice parameters, a and c, and the axial ratio, c/a, of the binary alloys varied linearly with decreasing Al content even in the dual-phase region. The Cr addition decreased the a and c and also c/a. The Nb addition increased weakly the a and c and c/a. On the contrary, the Hf addition increased the a and c but decreased the c/a ratio. In the Cr added alloys, the decrease of volume of a unit cell, due to the substitution of Cr atoms for Ti and Al atoms, was larger than that expected from the difference of atom sizes. The Nb addition should decrease the volume of a unit cell, but it increased the volume. The Hf addition caused a larger increase of volume of a unit cell than that expected from the difference of atom sizes. We suggested that the Cr addition increases and the Nb and Hf additions decrease the bond strength in TiAl. The deviation from stoichiometry and the addition of third elements caused an increase of work-hardening rate. The alloys with Ti-rich composition have superior mechanical properties compared to those of alloys vith Al-rich composition. The Cr addition resulted in high solution hardening, and the Ti-47A1 3Cr (in atomic percent) alloys had the highest fracture strain of 2.7 pct in all alloys tested. The Nb addition resulted in poor ductility in both Ti- and Al-rich alloys. The Hf additions to the Ti-rich composition caused better mechanical properties than those of Al-rich alloys. Thi; trend was also similar to the Nb-added alloys. In the Hf-added alloys, the Ti-49Al-2Hf

  1. The Effects of Hydroxyapatite Addition on the Properties of the Mechanically Alloyed and Sintered Mg-RE-Zr Alloy

    NASA Astrophysics Data System (ADS)

    Kowalski, K.; Nowak, M.; Jakubowicz, J.; Jurczyk, M.


    This paper discusses the influence of the chemical composition on the microstructure, mechanical and corrosion properties of mechanically alloyed and sintered (Mg-4Y-5.5Dy-0.5Zr)- x wt.% HA composites. Mechanical alloying for 25 h of the Mg-4Y-5.5Dy-0.5Zr composition, followed by sintering under argon at 550 °C for 2 h, led to the formation of a bulk alloy with an ultrafine grained microstructure. With the increase of the hydroxyapatite content in the (Mg-4Y-5.5Dy-0.5Zr)- x wt.% HA composite, a reduction of the grain sizes of the bulk material was noticeable. In the case of the bulk (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite, the grain sizes of approx. 60 nm have been recorded by atomic force microscopy. The final microstructure of the synthesized composites strongly influenced the mechanical and corrosion properties. The Mg-4Y-5.5Dy-0.5Zr alloy was characterized by higher average values of Young's modulus (36.6 GPa). In the case of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA scaffolds with the porosity of 48%, the Young's modulus was equal to 7.1 GPa. The (Mg-4Y-5.5Dy-0.5Zr)-10 wt.% HA composite was more corrosion resistant ( I c = 5.849 × 10-5 A cm-2, E c = -1.565 V versus SCE) than Mg-4Y-5.5Dy-0.5Zr alloy ( I c = 4.838 × 10-4 A cm-2, E c = -1.555 V versus SCE). The influence of hydrofluoric acid treatment on the corrosion behavior of the (Mg-4Y-5.5Dy-0.5Zr)-5 wt.% HA composite was also investigated. The electrochemical test showed that the corrosion resistance of fluoride-treated specimens was higher, compared with the untreated samples in the Ringer's solution. In conclusion, fluoride-treated (Mg-4Y-5.5Dy-0.5Zr)-HA composites are biodegradable materials with adjustable mechanical and corrosive properties.

  2. Effects of silicon additions on oxidation and mechanical behavior of the nickel-base superalloy B-1900

    NASA Technical Reports Server (NTRS)

    Miner, R. V., Jr.; Lowell, C. E.


    Test specimens with nominal additions of Si were tested in oxidation, thermal fatigue, sulfidation, tension, and stress rupture, and were also extensively studied metallographically. Alloy B-1900 modified with 0.6- or 1.2-wt% Si exhibited oxidation resistance equivalent to that of aluminide-coated B-1900 during cyclic, high-gas-velocity oxidation tests. Resistances to thermal fatigue and sulfidation were improved by the Si additions, but were not superior to aluminide-coated B-1900. Stress-rupture tests at 1000 C of specimens given the standard heat treatment to simulate an aluminide coating cycle showed Si to be detrimental. However, application of another heat treatment increased the rupture life of the alloy with 0.6-wt% Si to that of the unmodified B-1900 given the standard heat treatment.

  3. Resistance of Escherichia coli to nourseothricin (streptothricin): reduced penetrability of the cell wall as an additional, possibly unspecific mechanism.


    Seltmann, G


    The resistance of E. coli strains to the antibiotic nourseothricin is known to be caused by an acetyltransferase acetylating the beta-lysine chain of the antibiotic. In addition, most of the resistant strains exhibit reduced penetrability of the outer membrane, presumably caused by a reduced amount of available negative charges. This was shown using crystal violet, Congo red, or the hydrophobic antibiotic novobiocin as indicators.

  4. Improvement of mechanical and biological properties of TiNi alloys by addition of Cu and Co to orthodontic archwires.


    Phukaoluan, Aphinan; Khantachawana, Anak; Kaewtatip, Pongpan; Dechkunakorn, Surachai; Kajornchaiyakul, Julathep


    The purpose of this study was to investigate improved performances of TiNi in order to promote tooth movement. Special attention was paid to the effect on the clinical properties of TiNi of adding Cu and Co to this alloy. Ti49.4Ni50.6, Ti49Ni46Cu5 and Ti50Ni47Co3 (at %) alloys were prepared. Specimens were cold-rolled at 30% reduction and heat-treated at 400°C for 60min. Then, the test results were compared with two types of commercial archwires. The findings showed that superelasticity properties were confirmed in the manufactured commercial alloys at mouth temperature. The difference of stress plateau in TiNi, TiNiCo and commercial wires B at 25°C changed significantly at various testing temperatures due to the combination of martensite and austenite phases. At certain temperatures the alloys exhibited zero recovery stress at 2% strain and consequently produced zero activation force for moving teeth. The corrosion test showed that the addition of Cu and Co to TiNi alloys generates an increase in corrosion potential (Ecorr) and corrosion current densities (Icorr). Finally, we observed that addition of Cu and Co improved cell viability. We conclude that addition of an appropriate amount of a third alloying element can help enhance the performances of TiNi orthodontic archwires.

  5. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.


    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa


    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers.

  6. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.


    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin


    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  7. Genetic and regulatory mechanism of susceptibility to high-hyperdiploid acute lymphoblastic leukaemia at 10p21.2

    PubMed Central

    Studd, James B.; Vijayakrishnan, Jayaram; Yang, Minjun; Migliorini, Gabriele; Paulsson, Kajsa; Houlston, Richard S.


    Despite high-hyperdiploid acute lymphoblastic leukaemia (HD-ALL) being the most common subgroup of paediatric ALL, its aetiology remains unknown. Genome-wide association studies have demonstrated association at 10q21.2. Here, we sought to determine how this region influences HD-ALL risk. We impute genotypes across the locus, finding the single nucleotide polymorphism rs7090445 highly associated with HD-ALL (P=1.54 × 10−38), and residing in a predicted enhancer element. We show this region physically interacts with the transcription start site of ARID5B, that alleles of rs7090445 have differential enhancer activity and influence RUNX3 binding. RUNX3 knock-down reduces ARID5B expression and rs7090445 enhancer activity. Individuals carrying the rs7090445-C risk allele also have reduced ARID5B expression. Finally, the rs7090445-C risk allele is preferentially retained in HD-ALL blasts consistent with inherited genetic variation contributing to arrest of normal lymphocyte development, facilitating leukaemic clonal expansion. These data provide evidence for a biological mechanism underlying hereditary risk of HD-ALL at 10q21.2. PMID:28256501

  8. Structural basis of the regulatory mechanism of the plant CIPK family of protein kinases controlling ion homeostasis and abiotic stress

    PubMed Central

    Chaves-Sanjuan, Antonio; Sanchez-Barrena, Maria Jose; Gonzalez-Rubio, Juana Maria; Moreno, Maria; Ragel, Paula; Jimenez, Marta; Pardo, Jose M.; Martinez-Ripoll, Martin; Quintero, Francisco J.; Albert, Armando


    Plant cells have developed specific protective molecular machinery against environmental stresses. The family of CBL-interacting protein kinases (CIPK) and their interacting activators, the calcium sensors calcineurin B-like (CBLs), work together to decode calcium signals elicited by stress situations. The molecular basis of biological activation of CIPKs relies on the calcium-dependent interaction of a self-inhibitory NAF motif with a particular CBL, the phosphorylation of the activation loop by upstream kinases, and the subsequent phosphorylation of the CBL by the CIPK. We present the crystal structures of the NAF-truncated and pseudophosphorylated kinase domains of CIPK23 and CIPK24/SOS2. In addition, we provide biochemical data showing that although CIPK23 is intrinsically inactive and requires an external stimulation, CIPK24/SOS2 displays basal activity. This data correlates well with the observed conformation of the respective activation loops: Although the loop of CIPK23 is folded into a well-ordered structure that blocks the active site access to substrates, the loop of CIPK24/SOS2 protrudes out of the active site and allows catalysis. These structures together with biochemical and biophysical data show that CIPK kinase activity necessarily requires the coordinated releases of the activation loop from the active site and of the NAF motif from the nucleotide-binding site. Taken all together, we postulate the basis for a conserved calcium-dependent NAF-mediated regulation of CIPKs and a variable regulation by upstream kinases. PMID:25288725

  9. Structural basis of the regulatory mechanism of the plant CIPK family of protein kinases controlling ion homeostasis and abiotic stress.


    Chaves-Sanjuan, Antonio; Sanchez-Barrena, Maria Jose; Gonzalez-Rubio, Juana Maria; Moreno, Maria; Ragel, Paula; Jimenez, Marta; Pardo, Jose M; Martinez-Ripoll, Martin; Quintero, Francisco J; Albert, Armando


    Plant cells have developed specific protective molecular machinery against environmental stresses. The family of CBL-interacting protein kinases (CIPK) and their interacting activators, the calcium sensors calcineurin B-like (CBLs), work together to decode calcium signals elicited by stress situations. The molecular basis of biological activation of CIPKs relies on the calcium-dependent interaction of a self-inhibitory NAF motif with a particular CBL, the phosphorylation of the activation loop by upstream kinases, and the subsequent phosphorylation of the CBL by the CIPK. We present the crystal structures of the NAF-truncated and pseudophosphorylated kinase domains of CIPK23 and CIPK24/SOS2. In addition, we provide biochemical data showing that although CIPK23 is intrinsically inactive and requires an external stimulation, CIPK24/SOS2 displays basal activity. This data correlates well with the observed conformation of the respective activation loops: Although the loop of CIPK23 is folded into a well-ordered structure that blocks the active site access to substrates, the loop of CIPK24/SOS2 protrudes out of the active site and allows catalysis. These structures together with biochemical and biophysical data show that CIPK kinase activity necessarily requires the coordinated releases of the activation loop from the active site and of the NAF motif from the nucleotide-binding site. Taken all together, we postulate the basis for a conserved calcium-dependent NAF-mediated regulation of CIPKs and a variable regulation by upstream kinases.

  10. Stereoselectivities of Histidine-Catalyzed Asymmetric Aldol Additions and Contrasts with Proline Catalysis: A Quantum Mechanical Analysis

    PubMed Central

    Lam, Yu-hong; Houk, K. N.; Scheffler, Ulf; Mahrwald, Rainer


    Quantum mechanical calculations reveal the origin of diastereo- and enantioselectivities of aldol reactions between aldehydes catalyzed by histidine, and differences between related reactions catalyzed by proline. A stereochemical model that explains both the sense and the high levels of the experimentally observed stereoselectivity is proposed. The computations suggest that both the imidazolium and the carboxylic acid functionalities of histidine are viable hydrogen-bond donors that can stabilize the cyclic aldolization transition state. The stereoselectivity is proposed to arise from minimization of gauche interactions around the forming C–C bond. PMID:22458689

  11. Thermal clamping of temperature-regulating flowers reveals the precision and limits of the biochemical regulatory mechanism.


    Seymour, Roger S; Lindshau, Gemma; Ito, Kikukatsu


    The flowers of several families of seed plants warm themselves when they bloom. In some species, thermogenesis is regulated, increasing the rate of respiration at lower ambient temperature (T (a)) to maintain a somewhat stable floral temperature (T (f)). The precision of this regulation is usually measured by plotting T (f) over T (a). However, such measurements are influenced by environmental conditions, including wind speed, humidity, radiation, etc. This study eliminates environmental effects by experimentally 'clamping' T (f) at constant, selected levels and then measuring stabilized respiration rate. Regulating flowers show decreasing respiration with rising T (f) (Q (10) < 1). Q (10) therefore becomes a measure of the biochemical 'precision' of temperature regulation: lower Q (10) values indicate greater sensitivity of respiration to T (f) and a narrower range of regulated temperatures. At the lower end of the regulated range, respiration is maximal, and further decreases in floral temperature cause heat production to diminish. Below a certain tissue temperature ('switching temperature'), heat loss always exceeds heat production, so thermoregulation becomes impossible. This study compared three species of thermoregulatory flowers with distinct values of precision and switching temperature. Precision was highest in Nelumbo nucifera (Q (10) = 0.16) moderate in Symplocarpus renifolius (Q (10) = 0.48) and low in Dracunculus vulgaris (Q (10) = 0.74). Switching temperatures were approximately 30, 15 and 20 degrees C, respectively. There were no relationships between precision, switching temperature or maximum respiration rate. High precision reveals a powerful inhibitory mechanism that overwhelms the tendency of temperature to increase respiration. Variability in the shape and position of the respiration-temperature curves must be accounted for in any explanation of the control of respiration in thermoregulatory flowers.

  12. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.


    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  13. Defects in the regulatory clearance mechanisms favor the breakdown of self-tolerance during spontaneous autoimmune orchitis.


    Pelletier, R-Marc; Yoon, Suk Ran; Akpovi, Casimir D; Silvas, Emil; Vitale, María Leiza


    We identified aberrations leading to spontaneous autoimmune orchitis (AIO) in mink, a seasonal breeder and natural model for autoimmunity. This study provides evidence favoring the view that a malfunction of the clearance mechanisms for apoptotic cell debris arising from imbalances in phagocyte receptors or cytokines acting on Sertoli cells constitutes a major factor leading to breakdown of self-tolerance during spontaneous AIO. Serum anti-sperm antibody titers measured by ELISA reflected spermatogenic activity without causing immune inflammatory responses. Orchitic mink showed excess antibody production accompanied by spermatogenic arrest, testicular leukocyte infiltration, and infertility. AIO serum labeled the postacrosomal region, the mid and end piece of mink sperm, whereas normal mink serum did not. Normal serum labeled plasma membranes, whereas AIO serum reacted with germ cell nuclei. Western blot analyses revealed that AIO serum reacted specifically to a 23- and 50-kDa protein. The number of apostain-labeled apoptotic cells was significantly higher in orchitic compared with normal tubules. However, apoptosis levels measured by ELISA in seminiferous tubular fractions (STf) were not significantly different in normal and orchitic tubules. The levels of CD36, TNF-alpha, TNF-alpha RI, IL-6, and Fas but not Fas-ligand (L), and ATP-binding cassette transporter ABCA1 were changed in AIO STf. TNF-alpha and IL-6 serum levels were increased during AIO. Fas localized to germ cells, Sertoli cells, and the lamina propria of the tubules and Fas-L, to germ cells. Fas colocalized with Fas-L in residual bodies in normal testis and in giant cells and infiltrating leukocytes in orchitic tubules.

  14. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.


    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A


    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  15. A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.


    Yasuda, Hideyo; Oh, Chun-do; Chen, Di; de Crombrugghe, Benoit; Kim, Jin-Hoi


    Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1.

  16. Regulatory mechanisms of interleukin-8 production induced by tumour necrosis factor-α in human hepatocellular carcinoma cells

    PubMed Central

    Wang, Yaohui; Wang, Weimin; Wang, Lingyan; Wang, Xiangdong; Xia, Jinglin


    Abstract Interleukin (IL)-8 plays the critical role in the initiation of micro-environmental inflammation responsible for tumour growth and patient prognosis. This study aimed at investigating the molecular mechanisms of IL-8 production from human hepatocellular carcinoma (HCC) cells. The levels of IL-8 and phosphorylation of p38 mitogen-activated protein kinase (MAPK), ERK1/2 and Akt in MHCC-97H cells were measured by ELISA, Western blot and immunofluorescence. NF-κB p65 protein nuclear translocation was determined by non-radioactive NF-κB p50/p65 transcription factor activity kit and cell bio-behaviours were detected by the real-time cell-monitoring system. Tumour necrosis factor-α (TNF-α) significantly induced phosphorylation of p38 MAPK, ERK, Akt and production of IL-8 from HCC cells, which were prevented by SB203580 (p38 MAPK inhibitor), PD98059 (ERK inhibitor), LY294002 and Wortmannin (PI3K inhibitor) and SB328437 (CCR3 inhibitor). TNF-α could significantly increase the translocation of NF-κB p65 protein into the nucleus in a dose-dependent manner, while SB203580 partially inhibited. In inflammatory micro-environment, HCC auto-produced IL-8 through p38 MAPK, ERK and PI3K/Akt signalling pathways, where the p38 MAPK is a central factor to activate the NF-κB pathway and regulate the expression of IL-8 production. There was a potential cross-talking between receptors. PMID:21545687

  17. Differential response of regulatory and conventional CD4⁺ lymphocytes to CD3 engagement: clues to a possible mechanism of anti-CD3 action?


    Li, Li; Nishio, Junko; van Maurik, André; Mathis, Diane; Benoist, Christophe


    Several clinical trials have shown anti-CD3 treatment to be a promising therapy for autoimmune diabetes, but its mechanism of action remains unclear. Foxp3(+) regulatory T cells (Tregs) are likely to be involved, but through unknown mechanistic pathways. We profiled the transcriptional consequences in CD4(+) Tregs and conventional T cells (Tconvs) in the first hours and days after anti-CD3 treatment of NOD mice. Anti-CD3 treatment led to a transient transcriptional response, terminating faster than most Ag-induced responses. Most transcripts were similarly induced in Tregs and Tconvs, but several were differential, in particular, those encoding the IL-7R and transcription factors Id2/3 and Gfi1, upregulated in Tregs but repressed in Tconvs. Because IL-7R was a plausible candidate for driving the homeostatic response of Tregs to anti-CD3, we tested its relevance by supplementation of anti-CD3 treatment with IL-7/anti-IL-7 complexes. Although ineffective alone, IL-7 significantly improved the rate of remission induced by anti-CD3. Four anti-human CD3 mAbs exhibited the same differential effect on IL-7R expression in human as in mouse cells, suggesting that the mechanism also underlies therapeutic effect in human cells, and perhaps a rationale for testing a combination of anti-CD3 and IL-7 for the treatment of recent-onset human type 1 diabetes. Thus, systems-level analysis of the response to anti-CD3 in the early phase of the treatment demonstrates different responses in Tregs and Tconvs, and provides new leads to a mechanistic understanding of its mechanism of action in reverting recent-onset diabetes.

  18. UVB Induces a Genome-Wide Acting Negative Regulatory Mechanism That Operates at the Level of Transcription Initiation in Human Cells

    PubMed Central

    Gyenis, Ákos; Umlauf, David; Újfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò


    Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2–4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5–6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation. PMID:25058334

  19. Response of Mg Addition on the Dendritic Structures and Mechanical Properties of Hypoeutectic Al-10Si (Wt Pct) Alloys

    NASA Astrophysics Data System (ADS)

    Karaköse, Ercan; Yildiz, Mehmet; Keskin, Mustafa


    Rapidly solidified hypoeutectic Al-10Si- xMg ( x = 0, 5, 10 wt pct) alloys were produced by the melt-spinning method. The phase composition was identified by X-ray diffractometry, and the microstructures of the alloys were characterized by scanning electron microscopy. The melting characteristics were studied by differential scanning calorimetry and differential thermal analysis under an Ar atmosphere. The mechanical properties of the melt-spun and conventionally solidified alloys were tested by tensile-strength and Vickers microhardness tests. The results illustrate that the cooling rate and solidification time of 89 μm thick melt-spun ribbon were estimated to be 2.97 × 107 K s-1 and 9.31 × 10-6 s, respectively. Nanoscale Si spot particles were observed growing on the surface of the dendritic α-Al matrix and the average sizes of these spots ranged from 10 to 50 nm. The improvement in the tensile properties and microhardness was related to structural refinement and the supersaturated α-Al solid solution; the nanoscale-dispersed Si spot particles made a significant improvement to the mechanical properties of the melt-spun ribbon. Detailed electrical resistivity tests of the ribbons were carried out at temperatures of 300 K to 800 K (27 °C to 527 °C).

  20. Gene expression suggests double-segmental and single-segmental patterning mechanisms during posterior segment addition in the beetle Tribolium castaneum.


    Janssen, Ralf


    In the model arthropod Drosophila, all segments are patterned simultaneously in the blastoderm. In most other arthropods, however, posterior segments are added sequentially from a posterior segment addition zone. Posterior addition of single segments likely represents the ancestral mode of arthropod segmentation, although in Drosophila, segments are patterned in pairs by the pair-rule genes. It has been shown that in the new model insect, the beetle Tribolium, a segmentation clock operates that apparently patterns all segments in pairs as well. Here, I report on the expression of the segment polarity gene H15/midline in Tribolium. In the anterior embryo, segmental stripes of H15 appear in pairs, but in the posterior of the embryo stripes appear in a single-segmental periodicity. This implies that either two completely different segmentation-mechanisms may act in the germ band of Tribolium, that the segmentation clock changes its periodicity during development, or that the speed in which posterior segments are patterned changes. In any case, the data suggest the presence of another (or modified), yet undiscovered, mechanism of posterior segment addition in one of the best-understood arthropod models. The finding of a hitherto unrecognized segmentation mechanism in Tribolium may have major implications for the understanding of the origin of segmentation mechanisms, including the origin of pair rule patterning. It also calls for (re)-investigation of posterior segment addition in Tribolium and other previously studied arthropod models.

  1. The influence of α-Al2O3 addition on microstructure, mechanical and formaldehyde adsorption properties of fly ash-based geopolymer products.


    Huang, Yi; Han, Minfang


    Fly ash-based geopolymer with α-Al(2)O(3) addition were synthesized and used to remove formaldehyde from indoor air. The microstructure, mechanical and formaldehyde adsorption properties of the geopolymer products obtained were investigated. The results showed that α-Al(2)O(3) addition with appropriate amount (such as 5 wt%) increased the geopolymerization extent, resulting in the increase of surface area and compressive strength. In addition, the improvement of structural ordering level for geopolymer sample with 5 wt% α-Al(2)O(3) addition was found through FTIR analysis. By contrast, excessive addition (such as 10 wt%) had the opposite effect. The test of formaldehyde adsorption capacity confirmed that fly ash-based geopolymer product exhibited much better property of adsorbing indoor formaldehyde physically and chemically than fly ash itself. The surface area was an important but not unique factor influencing the adsorption capacity of geopolymers.

  2. Honeybee Colony Thermoregulation – Regulatory Mechanisms and Contribution of Individuals in Dependence on Age, Location and Thermal Stress

    PubMed Central

    Stabentheiner, Anton; Kovac, Helmut; Brodschneider, Robert


    Honeybee larvae and pupae are extremely stenothermic, i.e. they strongly depend on accurate regulation of brood nest temperature for proper development (33–36°C). Here we study the mechanisms of social thermoregulation of honeybee colonies under changing environmental temperatures concerning the contribution of individuals to colony temperature homeostasis. Beside migration activity within the nest, the main active process is “endothermy on demand” of adults. An increase of cold stress (cooling of the colony) increases the intensity of heat production with thoracic flight muscles and the number of endothermic individuals, especially in the brood nest. As endothermy means hard work for bees, this eases much burden of nestmates which can stay ectothermic. Concerning the active reaction to cold stress by endothermy, age polyethism is reduced to only two physiologically predetermined task divisions, 0 to ∼2 days and older. Endothermic heat production is the job of bees older than about two days. They are all similarly engaged in active heat production both in intensity and frequency. Their active heat production has an important reinforcement effect on passive heat production of the many ectothermic bees and of the brood. Ectothermy is most frequent in young bees (<∼2 days) both outside and inside of brood nest cells. We suggest young bees visit warm brood nest cells not only to clean them but also to speed up flight muscle development for proper endothermy and foraging later in their life. Young bees inside brood nest cells mostly receive heat from the surrounding cell wall during cold stress, whereas older bees predominantly transfer heat from the thorax to the cell wall. Endothermic bees regulate brood comb temperature more accurately than local air temperature. They apply the heat as close to the brood as possible: workers heating cells from within have a higher probability of endothermy than those on the comb surface. The findings show that thermal

  3. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.


    Gazestani, Vahid H; Salavati, Reza


    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  4. Effects of h-BN addition on microstructures and mechanical properties of β-CaSiO3 bioceramics.


    Pan, Ying; Yao, Dongxu; Zuo, Kaihui; Xia, Yongfeng; Yin, Jinwei; Liang, Hanqin; Zeng, Yuping


    The main purpose of this study consists in investigating the effects of h-BN addition on the sinterability of β-CaSiO3 (β-CS) bioceramics. β-CS bioceramics with different contents of h-BN were prepared at the sintering temperature ranging from 800°C to 1100°C. The results showed that h-BN can be successfully used as sintering additive by being oxidized to form low melting point B2O3 related glassy phase and enhanced the flexural strength by the formation of rod-like β-CS grains. β-CS bioceramics with 1wt% h-BN sintered at 1000°C revealed flexural strength and fracture toughness of 182.2MPa and 2.4MPam(1/2) respectively, which were much higher than that of pure β-CS bioceramics (30.2MPa, 0.53MPam(1/2)) fabricated in the same processing condition.

  5. The improved mechanical properties of β-CaSiO3 bioceramics with Si3N4 addition.


    Pan, Ying; Zuo, Kaihui; Yao, Dongxu; Yin, Jinwei; Xin, Yunchuan; Xia, Yongfeng; Liang, Hanqin; Zeng, Yuping


    The motivation of this study is to investigate the effect of Si3N4 addition on the sinterability of β-CaSiO3 ceramics. β-CaSiO3 ceramics with different content of Si3N4 were prepared at the sintering temperature ranging from 1000°C to 1150°C. The results showed that Si3N4 can be successfully used as sintering additive by being oxidized to form SiO2. The β-CaSiO3 ceramics with 3wt% Si3N4 sintered at 1100°C revealed flexural strength, hardness and fracture toughness of 157.2MPa, 4.4GPa and 2.3MPam(1/2) respectively, which was much higher than that of pure β-CaSiO3 ceramics (41.1MPa, 1.0GPa, 1.1MPam(1/2)). XRD analysis and SEM observation indicated that the main phase maintained to be β-phase after sintering.

  6. Characterization of mechanics and cytocompatibility of fibrin-genipin annulus fibrosus sealant with the addition of cell adhesion molecules.


    Guterl, Clare C; Torre, Olivia M; Purmessur, Devina; Dave, Khyati; Likhitpanichkul, Morakot; Hecht, Andrew C; Nicoll, Steven B; Iatridis, James C


    There is an unmet clinical need for a biomaterial sealant capable of repairing small annulus fibrosus (AF) defects. Causes of these defects include painful intervertebral disc herniations, microdiscectomy procedures, morbidity associated with needle puncture injury from discography, and future nucleus replacement procedures. This study describes the enhancements of a fibrin gel through genipin crosslinking (FibGen) and the addition of the cell adhesion molecules (CAMs), fibronectin and collagen. The gel's performance as a potential AF sealant is assessed using a series of in vitro tests. FibGen gels with CAMs had equivalent adhesive strength, gene expression, cytomorphology, and cell proliferation as fibrin alone. However, FibGen gels had enhanced material behaviors that were tunable to higher shear stiffness values and approximated human annulus tissue as compared with fibrin alone, were more dimensionally stable, and had a slower in vitro degradation rate. Cytomorphology of human AF cells cultured on FibGen gels exhibited increased elongation compared with fibrin alone, and the addition of CAMs to FibGen did not significantly affect elongation. This FibGen gel offers the promise of being used as a sealant material to repair small AF defects or to be used in combination with other biomaterials as an adhesive for larger defects.

  7. Characterization of Mechanics and Cytocompatibility of Fibrin-Genipin Annulus Fibrosus Sealant with the Addition of Cell Adhesion Molecules

    PubMed Central

    Guterl, Clare C.; Torre, Olivia M.; Purmessur, Devina; Dave, Khyati; Likhitpanichkul, Morakot; Hecht, Andrew C.; Nicoll, Steven B.


    There is an unmet clinical need for a biomaterial sealant capable of repairing small annulus fibrosus (AF) defects. Causes of these defects include painful intervertebral disc herniations, microdiscectomy procedures, morbidity associated with needle puncture injury from discography, and future nucleus replacement procedures. This study describes the enhancements of a fibrin gel through genipin crosslinking (FibGen) and the addition of the cell adhesion molecules (CAMs), fibronectin and collagen. The gel's performance as a potential AF sealant is assessed using a series of in vitro tests. FibGen gels with CAMs had equivalent adhesive strength, gene expression, cytomorphology, and cell proliferation as fibrin alone. However, FibGen gels had enhanced material behaviors that were tunable to higher shear stiffness values and approximated human annulus tissue as compared with fibrin alone, were more dimensionally stable, and had a slower in vitro degradation rate. Cytomorphology of human AF cells cultured on FibGen gels exhibited increased elongation compared with fibrin alone, and the addition of CAMs to FibGen did not significantly affect elongation. This FibGen gel offers the promise of being used as a sealant material to repair small AF defects or to be used in combination with other biomaterials as an adhesive for larger defects. PMID:24684314

  8. Influence of Tin Additions on the Phase-Transformation Characteristics of Mechanical Alloyed Cu-Al-Ni Shape-Memory Alloy

    NASA Astrophysics Data System (ADS)

    Saud, Safaa N.; Hamzah, E.; Abubakar, T.; Bakhsheshi-Rad, H. R.; Mohammed, M. N.


    The influence of the addition of Sn to Cu-Al-Ni alloy as a fourth element with different percentages of 0.5, 1.0, and 1.5 wt pct on the microstructure, phase-transformation temperatures, mechanical properties, and corrosion behaviors was investigated. The modified and unmodified alloys were fabricated by mechanical alloying followed by microwave sintering. The sintered and homogenized alloys of Cu-Al-Ni- xSn shape-memory alloys had a refined particle structure with an average particle size of 40 to 50 µm associated with an improvement in the mechanical properties and corrosion resistance. With the addition of Sn, the porosity density tends to decrease, which can also lead to improvements in the properties of the modified alloys. The minimum porosity percentage was observed in the Cu-Al-Ni-1.0 wt pct Sn alloy, which resulted in enhancing the ductility, strain recovery, and corrosion resistance. Further increasing the Sn addition to 1.5 wt pct, the strength of the alloy increased because the highest volume fraction of precipitates was formed. Regarding the corrosion behavior, addition of Sn up to 1 wt pct increased the corrosion resistance of the base SMA from 2.97 to 19.20 kΩ cm2 because of formation of a protective film that contains hydrated tin oxyhydroxide, aluminum dihydroxychloride, and copper chloride on the alloy. However, further addition of Sn reduced the corrosion resistance.

  9. Investigation on the effect of titanium (Ti) addition to the Mg- AZ31 alloy in the as cast and after extrusion conditions on its metallurgical and mechanical characteristics

    NASA Astrophysics Data System (ADS)

    Zaid, Adnan I. O.; Raghad; Hememat, S.


    Magnesium-aluminum alloys are versatile materials which are used in manufacturing a number of engineering and industrial parts in the automobile and aircraft industries due to their strength - to -weight -ratios. Against these preferable characteristics, magnesium is difficult to deform at room temperature; therefore it is alloyed with other elements mainly aluminum and zinc to add some required properties particularly to achieve high strength -to- weight ratio. Grain refinement is an important technology to improve the mechanical propertiesand the microstructure uniformity of the alloys. Most of the published work on grain refinement was directed toward grain refining aluminum and zinc alloys; however, the effect of the addition of rare earth material on the grain size or the mechanical behavior of Mg alloys is rare. In this paper the effect of Ti addition on the grain size, mechanical behavior, ductility, extrusion force and energy, of Mg-AZ31 alloy both in the as cast condition and after direct extrusion is investigated.

  10. Modeling the mechanical and aging properties of silicone rubber and foam - stockpile-historical & additively manufactured materials

    SciTech Connect

    Maiti, A.; Weisgraber, T. H.; Gee, R. H.


    M97* and M9763 belong to the M97xx series of cellular silicone materials that have been deployed as stress cushions in some of the LLNL systems. Their purpose of these support foams is to distribute the stress between adjacent components, maintain relative positioning of various components, and mitigate the effects of component size variation due to manufacturing and temperature changes. In service these materials are subjected to a continuous compressive strain over long periods of time. In order to ensure their effectiveness, it is important to understand how their mechanical properties change over time. The properties we are primarily concerned about are: compression set, load retention, and stress-strain response (modulus).

  11. Radical-chain oxidative addition mechanism for the reaction of an [Re(CO)5]- anion with α-bromostilbene.


    Sazonov, Petr K; Ptushkin, Dmitry S; Khrustalev, Victor N; Kolotyrkina, Natal'ya G; Beletskaya, Irina P


    E-α-Bromostilbene spontaneously reacts with Na[Re(CO)(5)] at 22 °C in THF to give Na[ReBr(CO)(4){Z-C(Ph)=CHPh}] and Na[Re(2)(CO)(9){Z-C(Ph)=CHPh}] as the main products. Z-α-Bromostilbene is less reactive, but gives the same products. The reaction is stimulated by visible light or a source of solvated electrons (NaK(2.8)) and can be inhibited by a quinomethide radical trap. With an excess of Na[Re(CO)(5)] one can observe the initial formation of Na[ReBr(CO)(4){Z-C(Ph)=CHPh}] and its complete transformation into Na[Re(2)(CO)(9){Z-C(Ph)=CHPh}]. Treatment of Na[ReBr(CO)(4){Z-C(Ph)=CHPh}] with CO almost quantitatively converts it to [Re(CO)(5){Z-C(Ph)=CHPh}], the structure of which is established by a single-crystal X-ray diffraction study. A radical-chain mechanism is proposed for the reaction comprising the following steps: (a) coupling of a Vin˙ radical with Na[Re(CO)(5)], (b) CO-dissociation from the formed 19-electron radical-anion and (c) bromine atom abstraction by [Re(CO)(4){Z-C(Ph)=CHPh}]˙(-) from α-bromostilbene. The mechanism is confirmed by the formation of the same Na[ReBr(CO)(4){Z-C(Ph)=CHPh}] product in the presence of NaI. When the radical-chain process is inhibited, a slow halogenophilic reaction is observed, mainly giving the Z and E-isomers of the acylrhenate Na[Re(2)(CO)(9){C(O)C(Ph)=CHPh}].

  12. Regulatory effect and mechanisms of carbon monoxide-releasing molecule II on hepatic energy metabolism in septic mice

    PubMed Central

    Liang, Feng; Cao, Jie; Qin, Wei-Ting; Wang, Xu; Qiu, Xue-Feng; Sun, Bing-Wei


    AIM: To investigate the possible mechanisms of exogenous carbon monoxide-releasing molecule II (CORM-2) intervention on hepatic energy metabolism in experimental sepsis. METHODS: Forty-eight C57BL/6 mice were randomly divided into four groups (n = 12): sham group; cecal ligation and puncture (CLP) group; CLP + CORM-2 group and CLP + iCORM-2 (inactive CORM-2) group. Survival rates were determined after 72 h. Twenty-four similarly treated mice (n = 6 in each group) were assayed for post-operative continuous blood glucose in the first 36 h. Thirty-six similarly treated mice (n = 9 in each group) underwent micro-positron emission tomography (PET) scanning after tail vein injection of 18F-fluorodeoxyglucose (FDG) 24 h after operation. Plasma and liver specimens were collected for assay of liver pathology, alanine transaminase (ALT) and aspartate transaminase (AST) activities. Hepatic glucokinase activity, lactic acid levels and mitochondrial swelling were also determined. RESULTS: Improved survival was observed in CORM-2 treated mice. Both the CLP and CLP + CORM-2 groups had sustained low blood glucose levels within the first post-operative 36 h. 18F-FDG micro-PET images showed abnormally high levels of hepatic glucose metabolism (standardized uptake value) in the CLP group (2.76 ± 0.39 vs 0.84 ± 0.14, P < 0.01), which declined to normal levels after CORM-2 intervention (1.29 ± 0.32 vs 2.76 ± 0.39, P < 0.05). glucokinase activity was markedly increased in the CLP group (6.38 ± 0.56 U/g vs 4.60 ± 0.21 U/g, P < 0.01), but was normal after CORM-2 intervention (4.74 ± 0.14 U/g vs 6.38 ± 0.56 U/g, P < 0.05). CORM-2 suppressed plasma lactic acid levels (4.02 ± 0.02 mmol/L vs 7.72 ± 2.37 mmol/L, P < 0.05) and protected hepatic mitochondria in CLP mice. CORM-2 intervention also reduced elevated plasma AST (199.67 ± 11.08 U/L vs 379.67 ± 16.34 U/L, P < 0.05) and ALT (63.67 ± 12.23 U/L vs 112.67 ± 9.74 U/L, P < 0.05) activities in CLP mice. CONCLUSION: The release

  13. On the mechanism of bifunctional squaramide-catalyzed organocatalytic Michael addition: a protonated catalyst as an oxyanion hole.


    Kótai, Bianka; Kardos, György; Hamza, Andrea; Farkas, Viktor; Pápai, Imre; Soós, Tibor


    A joint experimental-theoretical study of a bifunctional squaramide-amine-catalyzed Michael addition reaction between 1,3-dioxo nucleophiles and nitrostyrene has been undertaken to gain insight into the nature of bifunctional organocatalytic activation. For this highly stereoselective reaction, three previously proposed mechanistic scenarios for the critical CC bond-formation step were examined. Accordingly, the formation of the major stereoisomeric products is most plausible by one of the bifunctional pathways that involve electrophile activation by the protonated amine group of the catalyst. However, some of the minor product isomers are also accessible through alternative reaction routes. Structural analysis of transition states points to the structural invariance of certain fragments of the transition state, such as the protonated catalyst and the anionic fragment of approaching reactants. Our topological analysis provides deeper insight and a more general understanding of bifunctional noncovalent organocatalysis.

  14. Magnetic properties and coercivity mechanism of isotropic HDDR NdFeB bonded magnets with Co and Dy addition

    NASA Astrophysics Data System (ADS)

    Chen, W.; Gao, R. W.; Zhu, M. G.; Pan, W.; Li, W.; Li, X. M.; Han, G. B.; Feng, W. C.; Wang, B.


    Isotropic NdDyFeCoB bonded magnets with high coercivity of 1.59 MA/m and low temperature coefficient of remanence of -0.056%/ K (in the temperature range 298-428 K) were prepared successfully by controlling the HDDR process and adjusting the compositions. The influence of Co and Dy additions on the magnetic properties and the magnetization reversal process in magnet was investigated. The high coercivity in (Nd 0.8Dy 0.2) 13(Fe 0.875Co 0.125) 81B 6 HDDR magnet can be attributed to its unique microstructure and the enhancement of anisotropy field of 2:14:1 phase by substitution of Nd by Dy.

  15. CoCr F75 scaffolds produced by additive manufacturing: Influence of chemical etching on powder removal and mechanical performance.


    Van Hooreweder, Brecht; Lietaert, Karel; Neirinck, Bram; Lippiatt, Nicholas; Wevers, Martine


    Additive manufacturing techniques such as Selective Laser Melting (SLM) allow carefully controlled production of complex porous structures such as scaffolds. These advanced structures can offer many interesting advantages over conventionally produced products in terms of biological response and patient specific design. The surface finish of AM parts is often poor because of the layer wise nature of the process and adhering particles. Loosening of these particles after implantation should be avoided, as this could put the patient's health at risk. In this study the use of hydrochloric acid and hydrogen peroxide mixtures for surface treatment of cobalt-chromium F75 scaffolds produced by SLM is investigated. A 27% HCl and 8% H2O2 etchant proved effective in removing adhering particles while retaining the quasi-static and fatigue performance of the scaffolds.

  16. Effect of C and Ce addition on the microstructure and magnetic property of the mechanically alloyed FeSiBAlNi high entropy alloys

    NASA Astrophysics Data System (ADS)

    Xu, Jing; Axinte, Eugen; Zhao, Zhengfeng; Wang, Yan


    The effects of elemental addition, C and Ce, on the microstructure, thermal property and magnetic property of mechanically alloyed FeSiBAlNi (based-W5) high entropy alloys (HEAs) have been investigated in depth in the present work. The amorphous HEAs have been successfully fabricated by mechanical alloying. The results reveal that Ce addition obviously shortens the formation time of fully amorphous phase, therefore leading to the enhanced glass forming ability (GFA) of the based-W5. The final products of as-milled FeSiBAlNiC alloy consist of the main amorphous phase and a small amount of Si nanocrystals. In addition, C and Ce addition are both beneficial to enhance the thermal stability. The coercivity force (Hc) of the tested samples lies in the range of 50-378 Oe, suggesting the semi-hard magnetic property. The saturation magnetization (Ms) becomes decreased with increasing the milling time. C addition effectively increases Ms exhibiting the good magnetic property, however, Ce addition presents the negative effect. It should be noted that the amorphous phase tends to be formed when the radius ratio (Rr) is larger than 1, and the GFA is enhanced with increasing Rr and valence electron concentration.

  17. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.


    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B


    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves.

  18. Mechanism of araC autoregulation and the domains of two overlapping promoters, Pc and PBAD, in the L-arabinose regulatory region of Escherichia coli.


    Lee, N L; Gielow, W O; Wallace, R G


    The DNA-protein contact sites in the ara regulatory region, which contains the promoters for araBAD and araC, have been determined for araC protein, the cyclic AMP-binding protein, and RNA polymerase, by using the methylation protection and DNase I protection methods. The functional significance of binding was assessed by correlating the state of occupancy of these sites with promoter activity in transcription initiation. Our results suggest that the basis for araC autoregulation is that araC protein, in either its activator (P2) or repressor (P1) form, acts as a repressor for araC, by binding to the RNA polymerase attachment site at the araC promoter. We also found that the araC and araBAD promoters share a common site of positive control by the cyclic AMP-binding protein, located 90 bases from the araBAD and 60 bases from the araC transcriptional start points. A model for the mechanism of regulation of araBAD and araC expression by the catabolite gene-activator protein, P1, and Pe is proposed. An earlier model proposed by Ogden et al. [Ogden S., Haggerty, D., Stoner, C. M., Kolodrubetz, D. & Schleif, R. (1980) Proc. Natl. Acad. Sci, USA 77, 3346-3350] is discussed in the light of the data presented in this paper.

  19. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.


    Kolinsky, Monica A; Gross, Steven S


    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe.

  20. The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells.

    PubMed Central

    Goldschmidt-Clermont, P J; Furman, M I; Wachsstock, D; Safer, D; Nachmias, V T; Pollard, T D


    We present evidence for a new mechanism by which two major actin monomer binding proteins, thymosin beta 4 and profilin, may control the rate and the extent of actin polymerization in cells. Both proteins bind actin monomers transiently with a stoichiometry of 1:1. When bound to actin, thymosin beta 4 strongly inhibits the exchange of the nucleotide bound to actin by blocking its dissociation, while profilin catalytically promotes nucleotide exchange. Because both proteins exchange rapidly between actin molecules, low concentrations of profilin can overcome the inhibitory effects of high concentrations of thymosin beta 4 on the nucleotide exchange. These reactions may allow variations in profilin concentration (which may be regulated by membrane polyphosphoinositide metabolism) to control the ratio of ATP-actin to ADP-actin. Because ATP-actin subunits polymerize more readily than ADP-actin subunits, this ratio may play a key regulatory role in the assembly of cellular actin structures, particularly under circumstances of rapid filament turnover. Images PMID:1330091

  1. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.


    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  2. High-throughput exploration of thermoelectric and mechanical properties of amorphous NbO2 with transition metal additions

    NASA Astrophysics Data System (ADS)

    Music, Denis; Geyer, Richard W.; Hans, Marcus


    To increase the thermoelectric efficiency and reduce the thermal fatigue upon cyclic heat loading, alloying of amorphous NbO2 with all 3d and 5d transition metals has systematically been investigated using density functional theory. It was found that Ta fulfills the key design criteria, namely, enhancement of the Seebeck coefficient and positive Cauchy pressure (ductility gauge). These quantum mechanical predictions were validated by assessing the thermoelectric and elastic properties on combinatorial thin films, which is a high-throughput approach. The maximum power factor is 2813 μW m-1 K-2 for the Ta/Nb ratio of 0.25, which is a hundredfold increment compared to pure NbO2 and exceeds many oxide thermoelectrics. Based on the elasticity measurements, the consistency between theory and experiment for the Cauchy pressure was attained within 2%. On the basis of the electronic structure analysis, these configurations can be perceived as metallic, which is consistent with low electrical resistivity and ductile behavior. Furthermore, a pronounced quantum confinement effect occurs, which is identified as the physical origin for the Seebeck coefficient enhancement.

  3. Downregulation of Lnc-Spry1 mediates TGF-β-induced epithelial-mesenchymal transition by transcriptional and posttranscriptional regulatory mechanisms.


    Rodríguez-Mateo, Cristina; Torres, Belén; Gutiérrez, Gabriel; Pintor-Toro, José A


    Long non-coding RNAs (lncRNAs) are a class of regulatory genes that participate in a wide range of biological processes, including proliferation, differentiation and development, as well as in a broad spectrum of diseases. Although the role of lncRNAs in TGF-β-induced epithelial-to-mesenchymal transition (EMT) has been well established, little is known about the role of lncRNAs as immediate-early regulators of EMT. Here lnc-Spry1 is identified as an immediate-early regulator of EMT that is downregulated by TGF-β. It is also found that knockdown of lnc-Spry1 promotes a mesenchymal-like phenotype and results in increased cell migration and invasion. In addition, it is shown that lnc-Spry1 depletion preferentially affects the expression of TGF-β-regulated gene targets. Moreover, lnc-Spry1 associates with U2AF65 splicing factor, suggesting a role in alternative splicing. Depletion of lnc-Spry1 induces, as TGF-β, isoform switching of fibroblast growth factor receptors, resulting in FGF-2-sensitive cells. Taken together, these results show that lnc-Spry1 could act as an early mediator of TGF-β signaling and reveal different roles for a lncRNA in modulating transcriptional and posttranscriptional gene expressionCell Death and Differentiation advance online publication, 10 February 2017; doi:10.1038/cdd.2017.9.

  4. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.


    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke


    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  5. Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands

    PubMed Central

    Zubović, Lorena; Baralle, Marco; Baralle, Francisco E.


    Mutually exclusive splicing is a form of alternative pre-mRNA processing that consists in the use of only one of a set of two or more exons. We have investigated the mechanisms involved in this process for exon 18 of the Nav 1.6 sodium channel transcript and its significance regarding gene-expression regulation. The 18N exon (neonatal form) has a stop codon in phase and although the mRNA can be detected by amplification methods, the truncated protein has not been observed. The switch from 18N to 18A (adult form) occurs only in a restricted set of neural tissues producing the functional channel while other tissues display the mRNA with the 18N exon also in adulthood. We demonstrate that the mRNA species carrying the stop codon is subjected to Nonsense-Mediated Decay, providing a control mechanism of channel expression. We also map a string of cis-elements within the mutually exclusive exons and in the flanking introns responsible for their strict tissue and temporal specificity. These elements bind a series of positive (RbFox-1, SRSF1, SRSF2) and negative (hnRNPA1, PTB, hnRNPA2/B1, hnRNPD-like JKTBP) splicing regulatory proteins. These splicing factors, with the exception of RbFox-1, are ubiquitous but their levels vary during development and differentiation, ensuing unique sets of tissue and temporal levels of splicing factors. The combinatorial nature of these elements is highlighted by the dominance of the elements that bind the ubiquitous factors over the tissue specific RbFox-1. PMID:22434879

  6. Effect of addition of plants-derived polyamide 11 elastomer on the mechanical and tribological properties of hemp fiber reinforced polyamide 1010 composites

    NASA Astrophysics Data System (ADS)

    Mukaida, Jun; Nishitani, Yosuke; Kitano, Takeshi


    For the purpose of developing the new engineering materials such as structural materials and tribomaterials based on all plants-derived materials, the effect of the addition of plant-derived polyamide 11 Elastomer (PA11E) on the mechanical and tribological properties of hemp fiber(HF) reinforced polyamide 1010 (HF/PA1010) composites was investigated. PA1010 and PA11E (except the polyether groups used as soft segment) were made from plant-derived castor oil. Hemp fiber was surface-treated by two types of treatment: alkali treatment by NaOH solution and surface treatment by ureido silane coupling agent. HF/PA1010/PA11E ternary composites were extruded by a twin screw extruder and injection-molded. Their mechanical properties such as tensile, bending, Izod impact and tribological properties by ring-on-plate type sliding wear testing were evaluated. The effect of the addition of PA11E on the mechanical and tribological properties of HF/PA1010 composite differed for each property. Izod impact strength and specific wear rate improved with the addition of PA11E although tensile strength, modulus, and friction coefficient decreased with PA11E. It follows from these results that it may be possible to develop the new engineering materials with sufficient balance between mechanical and tribological properties.

  7. Effects of the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on mechanical properties of luting and lining glass ionomer cement

    NASA Astrophysics Data System (ADS)

    Heravi, Farzin; Bagheri, Hossein; Rangrazi, Abdolrasoul; Mojtaba Zebarjad, Seyed


    Recently, the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into glass ionomer cements (GICs) has attracted interest due to its remineralization of teeth and its antibacterial effects. However, it should be investigated to ensure that the incorporation of CPP-ACP does not have significant adverse effects on its mechanical properties. The purpose of this study was to evaluate the effects of the addition of CPP-ACP on the mechanical properties of luting and lining GIC. The first step was to synthesize the CPP-ACP. Then the CPP-ACP at concentrations of 1%, 1.56% and 2% of CPP-ACP was added into a luting and lining GIC. GIC without CPP-ACP was used as a control group. The results revealed that the incorporation of CPP-ACP up to 1.56%(w/w) increased the flexural strength (29%), diametral tensile strength (36%) and microhardness (18%), followed by a reduction in these mechanical properties at 2%(w/w) CPP-ACP. The wear rate was significantly decreased (23%) in 1.56%(w/w) concentration of CPP-ACP and it was increased in 2%(w/w). Accordingly, the addition of 1.56%(w/w) CPP-ACP into luting and lining GIC had no adverse effect on the mechanical properties of luting and lining GIC and could be used in clinical practice.

  8. Effects of heat treatments and Sn, Ga and In additives on mechanical properties of 35Ag-30Pd-20Au-15Cu alloy.


    Churnjitapirom, Pornkiat; Goto, Shin-ichi; Ogura, Hideo


    The mechanical properties of six 35Ag-30Pd-20Au-15Cu alloys containing different contents (2% and 4%) of Sn, Ga, or In and a 35Ag-30Pd-20Au-15Cu alloy without additives were evaluated. These alloys were subjected to four different heat treatments before a mechanical test. The distribution of the elements and their contents were analyzed. The mechanical properties of 35Ag-30Pd-20Au-15Cu alloy changed in wide-ranging ways with different heat treatments and with different additive contents. The effects of heat treatment on tensile strength and hardness significantly varied with different additives and their contents. These different changes could be attributed to the formation of different phases in these alloys. Based on the high strength and wide-ranging changes in the mechanical properties when subjected to softening and hardening heat treatments, the 2% Sn-added, 2% In-added, and 4% Ga-added alloys can be recommended for different dental restorations such as crown & bridges, inlays, and denture frameworks.

  9. Effect of Cr addition on the structural, magnetic and mechanical properties of magnetron sputtered Ni-Mn-In ferromagnetic shape memory alloy thin films

    NASA Astrophysics Data System (ADS)

    Akkera, Harish Sharma; Kaur, Davinder


    The effect of Cr substitution for In on the structural, martensitic phase transformation and mechanical properties of Ni-Mn-In ferromagnetic shape memory alloy (FSMA) thin films was systematically investigated. X-ray diffraction results revealed that the Ni-Mn-In-Cr thin films possessed purely austenitic cubic L21 structure at lower content of Cr, whereas higher Cr content, the Ni-Mn-In-Cr thin films exhibited martensitic structure at room temperature. The temperature-dependent magnetization ( M- T) and resistance ( R- T) results confirmed that the monotonous increase in martensitic transformation temperatures ( T M) with the addition of Cr content. Further, the room temperature nanoindentation studies revealed the mechanical properties such as hardness ( H), elastic modulus ( E), plasticity index ( H/ E) and resistance to plastic deformation ( H 3/ E 2) of all the samples. The addition of Cr content significantly enhanced the hardness (28.2 ± 2.4 GPa) and resistance to plastic deformation H 3/ E 2 (0.261) of Ni50.4Mn34.96In13.56Cr1.08 film as compared with pure Ni-Mn-In film. As a result, the appropriate addition of Cr significantly improved the mechanical properties with a decrease in grain size, which could be further attributed to the grain boundary strengthening mechanism. These findings indicate that the Cr-doped Ni-Mn-In FSMA thin films are potential candidates for microelectromechanical systems applications.

  10. β-carotene radical cation addition to green tea polyphenols. Mechanism of antioxidant antagonism in peroxidizing liposomes.


    Song, Lin-Lin; Liang, Ran; Li, Dan-Dan; Xing, Ya-Dong; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H


    Green tea polyphenols, (-)-epicatechin (EC), (-)-epigallocatechin (EGC), (-)-epicatechin gallate (ECG), and (-)-epigallocatechin gallate (EGCG), all showed antioxidative effect in liposomes for lipid oxidation initiated in the lipid phase (antioxidant efficiency EC > EGCG > ECG > EGC) or in the aqueous phase (EC ≫ EGC > EGCG > ECG) as monitored by the formation of conjugated dienes. For initiation in the lipid phase, β-carotene, itself active as an antioxidant, showed antagonism with the polyphenols (EC > ECG > EGCG > EGC). The Trolox equivalent antioxidant capacity (TEAC EGC > EGCG > ECG > EC) correlates with the lowest phenol O-H bond dissociation enthalpy (BDE) as calculated by density functional theory (DFT). Surface-enhanced Raman spectroscopy (SERS) was used to assess the reducing power of the phenolic hydroxyls in corroboration with DFT calculations. For homogeneous (1:9 v/v methanol/chloroform) solution, the β-carotene radical cation reacted readily with each of the polyphenol monoanions (but not with the neutral polyphenols) with a rate approaching the diffusion limit for EC as studied by laser flash photolysis at 25 °C monitoring the radical cation at 950 nm. The rate constant did not correlate with polyphenol HOMO/LUMO energy gap (DFT calculations), and β-carotene was not regenerated by an electron transfer reaction (monitored at 500 nm). It is suggested that the β-carotene radical cation is rather reacting with the tea polyphenols through addition, as further evidenced by steady-state absorption spectroscopy and liquid chromatography-mass spectroscopy (LC-MS), in effect preventing regeneration of β-carotene as an active lipid phase antioxidant and leading to the observed antagonism.

  11. The angiosperm gibberellin-GID1-DELLA growth regulatory mechanism: how an "inhibitor of an inhibitor" enables flexible response to fluctuating environments.


    Harberd, Nicholas P; Belfield, Eric; Yasumura, Yuki


    The phytohormone gibberellin (GA) has long been known to regulate the growth, development, and life cycle progression of flowering plants. However, the molecular GA-GID1-DELLA mechanism that enables plants to respond to GA has only recently been discovered. In addition, studies published in the last few years have highlighted previously unsuspected roles for the GA-GID1-DELLA mechanism in regulating growth response to environmental variables. Here, we review these advances within a general plant biology context and speculate on the answers to some remaining questions. We also discuss the hypothesis that the GA-GID1-DELLA mechanism enables flowering plants to maintain transient growth arrest, giving them the flexibility to survive periods of adversity.

  12. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc


    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  13. 76 FR 6123 - Reducing Regulatory Burden

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... regulatory program more effective and less burdensome in achieving its regulatory objectives. DATES: Written... regulatory objectives, taking into account, among other things, and to the extent practicable, the costs of... by objective scientific evidence. Additionally, the Executive Order directs agencies to consider...

  14. 78 FR 44355 - Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... flexibility agenda. In addition, this document includes an agenda of regulatory actions the Commission expects... requirements of the Regulatory Flexibility Act and Executive Order 12866. DATES: The Commission welcomes... Secretary by July 31, 2013. ADDRESSES: Comments on the regulatory flexibility agenda should be...

  15. Preparation and characterization of new dental porcelains, using K-feldspar and quartz raw materials. Effect of B2O3 additions on sintering and mechanical properties.


    Harabi, Abdelhamid; Guerfa, Fatiha; Harabi, Esma; Benhassine, Mohamed-Tayeb; Foughali, Lazhar; Zaiou, Soumia


    The aim of this work was to determine the effect of temperature and boric oxide (B2O3) addition on sintering and mechanical properties of a newly developed dental porcelain (DP) prepared from local Algerian raw materials. Based on a preliminary work, the new selected composition was 75wt.% feldspar, 20wt.% quartz and 5wt.% kaolin. It was prepared by sintering the mixture at different temperatures (1100-1250°C). The optimum sintering conditions gave a relatively higher density (2.47g/cm(3)) and excellent mechanical properties. The three point flexural strength (3PFS) and Martens micro-hardness of dental porcelains were 149MPa and 2600MPa, respectively. This obtained 3PFS value is more than four times greater than that of hydroxyapatite (HA) value (about 37MPa) sintered under the same conditions. However, the sintering temperature was lowered by about 25 and 50°C for 3 and 5wt.% B2O3 additions, respectively. But, it did not improve furthermore the samples density and their mechanical properties. It has also been found that B2O3 additions provoke a glass matrix composition variation which delays the leucite formation during sintering.

  16. Influence of the season on vitamin D levels and regulatory T cells in patients with polymorphic light eruption† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c5pp00398a Click here for additional data file. Click here for additional data file.

    PubMed Central

    Schweintzger, N. A.; Gruber-Wackernagel, A.; Shirsath, N.; Quehenberger, F.; Obermayer-Pietsch, B.


    The exact mechanisms of photohardening in polymorphic light eruption (PLE) are still unknown, but medical photohardening was shown to increase regulatory T cell (Treg) numbers in the blood of PLE patients, similar to natural hardening. Furthermore, oral vitamin D supplementation increased peripheral Tregs in healthy individuals. We herein report on a post hoc analysis of 26 screened PLE patients of a clinical trial ( No. NCT01595893), in which the influence of the progressing season was investigated on baseline CD4+CD25+FoxP3+CD127– Treg numbers by flow cytometry and Treg suppressive function by co-culture assays with T effector cells as a secondary endpoint, together with 25-hydroxy vitamin D (25(OH)D) serum levels at the study's screening visit, taking place in the period from January to June. The mean 25(OH)D serum level of all patients was 33.2 ng ml–1. Ten of those patients (38.5%) were identified with low 25(OH)D levels (<30 ng ml–1). Significantly higher baseline 25(OH)D serum levels (plus 34.4%; P = 0.0182) as well as higher relative Treg percentages in CD4+ population (plus 62.8%; P = 0.0157) and in total lymphocyte population (plus 59.6%; P = 0.0372) and higher absolute Treg numbers (plus 100.2%; P = 0.0042) were observed in the late spring/early summer period (April to June) compared to the winter period (January to February). No significant relationship was observed when Treg numbers and function were correlated with 25(OH)D levels. These data indicate that in PLE patients Treg numbers and their suppressive function are independent of vitamin D serum levels and suggest that UV light and/or other seasonal factors may affect these cells via the non-vitamin D related pathway(s). PMID:26911519

  17. Enhanced properties of MgO-Al2O3 composite materials with Al powder addition under 1300 °C creep test and its mechanism analysis

    NASA Astrophysics Data System (ADS)

    Jiang, Peng; Ma, Jiajia; Li, Yong; Yue, Dandan; Tong, Shanghao; Xue, Wendong


    The Al-MgO-Al2O3 composite samples were prepared with alumina (fused corundum and sintered alumina), high purity sintered magnesia and aluminum powder. Creep test was carried out at 1300 °C and studied. The results show that the creep rate of sample without aluminum addition decreases gradually. The creep properties of the MgO-Al2O3 composite material are improved by aluminum powder addition, with the sample demonstrating an increase creep rate. The physical properties of the samples are enhanced by aluminum powder addition as well. The mechanism of the improvement on the sample is analyzed by different characterization methods and kinetics calculations. Our results indicates that the AlN and MgAl2O4 spinel phases which are formed during the creep test are acting as the reinforcing phases and therefore enhance the creep performance of the samples.

  18. Exploring Regulatory Mechanisms of Atrial Myocyte Hypertrophy of Mitral Regurgitation through Gene Expression Profiling Analysis: Role of NFAT in Cardiac Hypertrophy

    PubMed Central

    Chang, Tzu-Hao; Chen, Mien-Cheng; Chang, Jen-Ping; Huang, Hsien-Da; Ho, Wan-Chun; Lin, Yu-Sheng; Pan, Kuo-Li; Huang, Yao-Kuang; Liu, Wen-Hao; Wu, Chia-Chen


    Background Left atrial enlargement in mitral regurgitation (MR) predicts a poor prognosis. The regulatory mechanisms of atrial myocyte hypertrophy of MR patients remain unknown. Methods and Results This study comprised 14 patients with MR, 7 patients with aortic valve disease (AVD), and 6 purchased samples from normal subjects (NC). We used microarrays, enrichment analysis and quantitative RT-PCR to study the gene expression profiles in the left atria. Microarray results showed that 112 genes were differentially up-regulated and 132 genes were differentially down-regulated in the left atria between MR patients and NC. Enrichment analysis of differentially expressed genes demonstrated that “NFAT in cardiac hypertrophy” pathway was not only one of the significant associated canonical pathways, but also the only one predicted with a non-zero score of 1.34 (i.e. activated) through Ingenuity Pathway Analysis molecule activity predictor. Ingenuity Pathway Analysis Global Molecular Network analysis exhibited that the highest score network also showed high association with cardiac related pathways and functions. Therefore, 5 NFAT associated genes (PPP3R1, PPP3CB, CAMK1, MEF2C, PLCE1) were studies for validation. The mRNA expressions of PPP3CB and MEF2C were significantly up-regulated, and CAMK1 and PPP3R1 were significantly down-regulated in MR patients compared to NC. Moreover, MR patients had significantly increased mRNA levels of PPP3CB, MEF2C and PLCE1 compared to AVD patients. The atrial myocyte size of MR patients significantly exceeded that of the AVD patients and NC. Conclusions Differentially expressed genes in the “NFAT in cardiac hypertrophy” pathway may play a critical role in the atrial myocyte hypertrophy of MR patients. PMID:27907007

  19. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail:; Kaur, Simarna


    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhi